WO2001075021A2 - Nouveau polypeptide, proteine humaine associee au transport de glucose 10, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, proteine humaine associee au transport de glucose 10, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001075021A2 WO2001075021A2 PCT/CN2001/000359 CN0100359W WO0175021A2 WO 2001075021 A2 WO2001075021 A2 WO 2001075021A2 CN 0100359 W CN0100359 W CN 0100359W WO 0175021 A2 WO0175021 A2 WO 0175021A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- glucose transport
- related protein
- human glucose
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human glucose transport-related protein 10, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
- glucose can quickly spread across liver cell membranes to various related tissues, such as muscles, to maintain a balanced glucose content in the body.
- transport-related proteins constitute an independent protein family, the glucose transporter family.
- Members of this protein family are expressed in a variety of cells and tissues including hepatocytes, pancreatic cells, ⁇ -cells, intestinal cells, and renal epithelial cells.
- the transport catalytic activity of this protein is mainly controlled by the level of thyroid hormones in the body.
- thyroid hormones regulation in the body it regulates various glucose metabolism in the liver, such as gluconeogenesis and glycolysis.
- the mutation or abnormal expression of this protein will directly affect the abnormality of related metabolic pathways in the body, and then cause various related disorders of glucose metabolism disorders.
- the proteins related to glucose transport constitute an independent protein family in the body. All members of the protein family are involved in regulating glucose and some nutrients in relevant tissues of the organism Transfer process. The main activity of these proteins is the regulation of thyroid hormone levels in their receptors. Mutations or abnormal expression of these proteins will directly lead to abnormal glucose metabolism in liver, muscle and other tissues, and then cause various related metabolic diseases.
- the protein is usually closely related to the occurrence of various diseases related to sugar metabolism disorders, malnutrition and motor system diseases in the body. It can also be used to diagnose and treat the various related diseases mentioned above.
- the human glucose transport related protein 10 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, there has been a need in the art to identify more involved in these Process for the identification of human glucose transporter-related protein 10 proteins, especially the amino acid sequence of this protein. Isolation of the new human glucose transport related protein 10 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of a diagnostic and / or therapeutic agent for the disease, so it is important to isolate its coded DM. Disclosure of invention
- An object of the present invention is to provide isolated novel polypeptides-human glucose transport-related protein 10 and fragments, analogs and derivatives thereof.
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human glucose transport-related protein 10.
- Another object of the present invention is to provide a method for producing a human glucose transport-related protein 10.
- Another object of the present invention is to provide a human glucose transporter related protein to the polypeptide of the present invention.
- Another object of the present invention is to provide a human glucose transport related protein directed to the polypeptide of the present invention.
- Another object of the present invention is to provide diagnosis and treatment related to abnormality of human glucose transport related protein 1 0 Of disease.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human glucose transport related protein 10 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human glucose transporter-associated protein 10 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of metabolic disorders, organic acidemia, various tumors, development disorders, inflammation, immune diseases, blood diseases, HIV infection or other Use of a medicament for diseases caused by abnormal expression of human glucose transport related protein 10.
- Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof Minute.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
- An "agonist” refers to a molecule that, when combined with a human glucose transport-related protein 10, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to human glucose transport-related protein 10.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human glucose transport-related protein 10 when combined with human glucose transport-related protein 10.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human glucose transport-related protein 10.
- Regular refers to a change in the function of human glucose transport-related protein 10, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune changes in human glucose transport-related protein 10. .
- substantially pure is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human glucose transport related proteins 10 using standard protein purification techniques. Basically pure human glucose transport-related protein 10 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human glucose transport related protein 10 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to polynucleotides that naturally bind through base-pairing under conditions of acceptable salt concentration and temperature.
- sequence "CT-G-A” can be combined with the complementary sequence "GA-C-T”.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method checks the distance between all pairs by Each group of sequences is arranged into clusters. Then the clusters are allocated in pairs or groups.
- the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The residues of the match between sequence A and sequence B The number of bases X 100 The number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by Clus ter method or by methods known in the art such as Jotun Hein Percent sex (He in J., (1990) Methods in emzumo logy 183: 625-645) 0 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- negatively charged amino acids can include aspartic acid and glutamic acid; positively charged amino acids can include lysine and arginine; similarly, uncharged head groups are similar Hydrophilic amino acids Including leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives encode major organisms that retain natural molecules Peptides with chemical properties.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? It can specifically bind to the epitope of human glucose transporter-related protein 10.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human glucose transport-related protein 10 means that human glucose transport-related protein 10 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify human glucose transport-related protein 10 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human glucose transport-related protein 10 can be analyzed by amino acid sequence analysis.
- the present invention provides a new polypeptide, a human glucose transport-related protein 10, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude initial methionine residues.
- the invention also includes fragments, derivatives, and analogs of human glucose transport-related protein 10.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human glucose transport-related protein 10 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution Amino An acid may or may not be encoded by a genetic codon; or ( ⁇ ) is one in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ) such as Species, wherein the mature polypeptide is fused with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as Leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences) As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 2850 bases, and its open reading frames 385-651 encode 88 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile with human glucose transport related proteins, and it can be inferred that the human glucose transport related protein 10 has a similar function to human glucose transport related proteins.
- the polynucleotide of the present invention may be in the form of DNA or RM.
- DM forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DM can be a coding chain or a non-coding chain.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant” refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but having a sequence different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the present invention also relates to a polynucleotide that hybridizes to a sequence described above 50% less, preferably 70% identity).
- the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturing agent during hybridization, such as 503 ⁇ 4 (v / v) formamide, 0.1% calf serum / 0.1% Ficol l, 42 ° C, etc .; or (3) only the same between the two sequences Crosses only occur when the sex is at least 953 ⁇ 4 and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human glucose transport-related protein 10.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human glucose transport-related protein 10 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DM is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice. The more commonly used method is the separation of cDM sequences.
- the standard method for isolating the cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- Various methods have been developed for raRNA extraction, and kits are also commercially available (Qiagene;).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RM hybridization; (2) the presence or loss of marker gene function; (3) determination of the level of transcripts of human glucose transport-related protein 10; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used alone or in combination.
- the probe used for hybridization is the same as any part of the polynucleotide of the present invention.
- the source has a length of at least 10 nucleotides, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DM sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the human glucose transport related protein 10 gene expression protein.
- ELISA enzyme-linked immunosorbent assay
- a method (Sa ik i, et al. Science 1985; 230: 1 350-1 354) using DNA technology to amplify DNA / RM is preferably used to obtain the gene of the present invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RM fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger e t al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDM sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDM sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human glucose transport related protein 10 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology. .
- a polynucleotide sequence encoding a human glucose transport-related protein 10 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding a human glucose transport-related protein 10 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the (3 ⁇ 4 (12 ) method. The steps used are well known in the art. Alternatively, MgCl 2 can be used. If necessary, transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and lipid Body packaging, etc.
- the present invention is the use of polynucleotide sequences may be used to express or produce recombinant human glucose transporter related protein 10 (Sc ience, 1984; 224 : 1431) 0 in general the following steps: (1) transforming or transducing a suitable host cell with the polynucleotide (or variant) encoding human human glucose transporter-related protein 10 of the present invention, or with a recombinant expression vector containing the polynucleotide;
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
- Fig. 1 is a comparison diagram of gene expression profiles of human glucose transport-related protein 10 and human glucose transport-related protein of the present invention.
- the upper graph is a graph of the expression profile of human glucose transport-related protein 10
- the lower graph is the graph of the expression profile of human glucose transport-related protein.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human glucose transport-related protein 10 isolated.
- OKDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Quik mRNA Isolat ion Ki t Qiegene
- Isolate poly A) mRNA from total RM. 2ug poly (A) mRNA is reverse transcribed to form cDNA.
- Use Smart cDNA Cloning Kit purchased from Clontech. The 0 fragment was inserted into the multicloning site of pBSK (+) vector (Clontech), and transformed into DH5 c. The bacteria formed a cDNA library.
- the sequences at the 5 'and 3' ends of all clones were determined using Dye terminate cycle reaction ionization kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer).
- the determined cDNA sequence was compared with an existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0468ell was a new DM.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- CDNA was synthesized using fetal brain cell total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
- Pr imerl 5'- ACGGCTGCGAGAAGACGAAGCTTA -3 '(SEQ ID NO: 3)
- Pr imer2 5'- AGAAGACGAAGCTTAGGGACGGCT -3 '(SEQ ID NO: 4)
- Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Pr imer 2 is the 3′-end reverse sequence in SEQ ID NO: 1.
- Amplification conditions 50ramol / L KCl, 10mmol / L Tris s-
- Total RM was extracted by one step method [Anal. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M Sodium acetate (pH 4.0) was used to homogenize the tissue, 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added, and the mixture was centrifuged. The aqueous phase layer was aspirated and isopropyl alcohol ( 0.8 volume) and centrifuge the mixture to obtain RNA pellet. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- RNA was synthesized by electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (H7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane.
- the DNA probe used was the PCR amplified human glucose transport related protein 10 coding region sequence (385bp to 651bp) shown in FIG. 1.
- a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 ( ⁇ 7.4)-5xSSC-5x Denhardt's solution and 200 yg / ml salmon sperm DNA. After hybridization, the filter was washed in 1 X SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant human glucose transport-related protein 10
- Primer3 5,-CATGCTAGCATGATACTCATATTGATTAACTTT -3, (Seq ID No: 5)
- Primer4 5,-CATGGATCCCTAAAGCTTGGAATGGCATTTCTG -3, (Seq ID No: 6)
- the 5 'ends of these two primers contain Nhel and BamHI restriction sites, respectively.
- the coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively.
- the Nhel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
- the pBS-0468ell plasmid containing the full-length target gene was used as a template for the PCR reaction.
- the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0468ell plasmid, primer ⁇ : 1 ⁇ 1116]: -3 and? 1 11161: -4 points in addition!] Is 10 11101, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles.
- Nhel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into the colibacillus DH5 ⁇ by the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 30 ⁇ ⁇ / ⁇ 1), positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0468ell) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
- the host bacteria BL21 (pET-0468ell) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 mmol / L, and continued. Incubate for 5 hours. The cells were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 histidine (6His-Tag). Purified the target protein human glucose transporter-related protein10.
- Polypeptide specific for human glucose transporter-related protein 10 was synthesized using a peptide synthesizer (product of PE):
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin peptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin peptide complex plus incomplete Freund's adjuvant was used to boost immunity once. 15The titer of antibody in rabbit serum was measured by ELISA using a 15 g / ml bovine serum albumin peptide complex-coated titration plate. Protein A-Sepharose was used to isolate total IgG from antibody-positive rabbit serum.
- Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membrane nitrocellulose membrane
- the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
- Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of fast, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500ng / ul after purification.
- the spots were spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ ⁇ .
- the spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip.
- the specific method steps are widely reported in the literature.
- the post-spot processing steps of this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRM was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen).
- J Cy3dUTP (5-Amino-propargy 1-2. -Amino- propargyl- 2'- deoxyuridine 5 '-tr iphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech, was used to label the mRNA of specific tissues (or stimulated cell lines) in the body, and probes were prepared after purification.
- the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.
- the glucose transporter family mainly mediates glucose transport in various cells and tissues such as hepatocytes, pancreatic cells, P-cells, intestinal cells, and renal epithelial cells.
- the transport catalytic activity of this protein is mainly controlled by the level of thyroid hormones in the body. As the target of thyroid hormones regulation in the body, it regulates various glucose metabolism in the liver, such as glycogenesis and glycolysis.
- the mutation or abnormal expression of this protein will directly affect the abnormality of related metabolic pathways in the body, and then cause various related disorders of sugar metabolism disorders.
- the expression profile of the polypeptide of the present invention is consistent with the expression profile of human glucose transporter, and both have similar biological functions. It is involved in mediating the transport of glucose in various tissue cells such as liver cells, pancreatic cells, ⁇ -cells, intestinal cells and renal epithelial cells, and regulates various glucose metabolism in the liver such as glycogen production and glycolysis. The progress of metabolic pathways. Its abnormal expression will directly affect the relevant metabolic pathways in the body, and then cause various related disorders of carbohydrate metabolism.
- the abnormal expression of the human glucose transport-related protein 10 of the present invention will produce various diseases, especially metabolic disorders, organic acidemia, various tumors, development disorders, inflammation, and immune diseases. These diseases including but not limited to: ⁇
- Metabolic disorders congenital lactose intolerance, hereditary fructose intolerance, galactosemia, fructose metabolism deficiency, glycogen storage disease, phenylketonuria, albinism, serotoninemia, glycineemia, Hypersarcosinemia, glutamate metabolism deficiency disease, mucopolysaccharidosis type I ⁇ ⁇ , mucolipid storage disease, Ray-niney syndrome
- Organic acidemia isovalerate, propionate, methylmalonic aciduria, tumors of various tissues combined with carboxylase deficiency: gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymph Tumor, thyroid tumor, neuroblastoma, astrocytoma, ependymoma, glioblastoma, uterine cancer, endometrial cancer, colon cancer
- congenital abortion congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness, mental retardation, brain development disorder, Skin, fat and muscle dysplasia, bone and joint dysplasia
- Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
- Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
- Abnormal expression of the human glucose transporter-related protein 10 of the present invention may also cause certain hereditary, hematological diseases, and the like.
- the polypeptides of the present invention and the antagonists, agonists and inhibitors of the polypeptides can be directly used in the treatment of diseases, for example, they can treat various diseases, especially metabolic disorders, organic acidemia, various tumors, developmental disorders, Inflammation, immune diseases, some hereditary, blood diseases, etc.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or inhibit (antagonist) human glucose transport-related protein 10.
- Agonists enhance biological functions such as human glucose transport-related protein 10 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human glucose transport related protein 10 can be cultured together with labeled human glucose transport related protein 10 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human glucose transport-related protein 10 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human glucose transport-related protein 10 can bind to human glucose transport-related protein 10 and eliminate its function, or inhibit the production of the polypeptide, or combine with the active site of the polypeptide so that the polypeptide cannot function biologically.
- human glucose transporter-related protein 10 can be added to the bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human glucose transporter-related protein 10 and its receptor .
- Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
- Polypeptide molecules capable of binding to human glucose transport related protein 10 can be obtained by screening a random multi-peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally 10 molecules of human glucose transport related proteins should be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies directed against human glucose transport-related protein 10 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human glucose transport related protein 10 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait.
- Techniques for preparing monoclonal antibodies to human glucose transporter-related protein 10 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, and human beta-cell hybridoma technology , EBV-hybridoma technology, etc.
- Chimeric antibodies can be produced using existing techniques (Morr i son etal, PNAS, 1985, 81: 6851), and existing techniques for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce anti-human glucose transport related Single-chain antibody to protein 10.
- Antibodies against human glucose transport-related protein 10 can be used in immunohistochemical techniques to detect human glucose transport-related protein 10 in biopsy specimens.
- Monoclonal antibodies that bind to human glucose transport related protein 10 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human glucose transport related protein 10 high affinity monoclonal antibody can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human glucose transport related protein 10 positive cells .
- the antibodies of the present invention can be used to treat or prevent diseases related to human glucose transport-related protein 10.
- Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human glucose transport related protein 10.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human glucose transport-related protein 10 levels.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the levels of human glucose transport related protein 10 detected in the test can be used to explain the importance of human glucose transport related protein 10 in various diseases and to diagnose diseases in which human glucose transport related protein 10 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- Polynucleotides encoding human glucose transport related protein 10 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human glucose transport-related protein 10.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human glucose transport related protein 10 to inhibit endogenous human glucose transport related protein 10 activity.
- a mutated human glucose transporter-related protein 10 may be a shortened human glucose transporter-related protein 10 lacking a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity.
- the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human glucose transporter-related protein 10.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transport human glucose encoding
- the polynucleotide of related protein 10 is transferred into the cell.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human glucose transport-related protein 10 can be found in existing literature (Sambrook, et al.).
- a recombinant polynucleotide encoding human glucose transporter-related protein 10 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense 'RM and DNA
- ribozymes that inhibit the human glucose transport related protein 10 raRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation.
- Antisense RM, DNA and ribozymes can be obtained by any existing RNA or DNA synthesis technology. For example, solid-phase phosphoramidite chemical synthesis technology has been widely used.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
- This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter.
- it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human glucose transport-related protein 10 can be used for the diagnosis of diseases related to human glucose transport-related protein 10.
- the polynucleotide encoding human glucose transport-related protein 10 can be used to detect the expression of human glucose transport-related protein 10 or the abnormal expression of human glucose transport-related protein 10 in a disease state.
- a DNA sequence encoding human glucose transport-related protein 10 can be used to hybridize biopsy specimens to determine the expression of human glucose transport-related protein 10.
- Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
- a part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a micro array or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues.
- Human glucose transport related protein 10 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human glucose transport related protein 10 transcription products.
- Detection of mutations in the human glucose transport related protein 10 gene can also be used to diagnose human glucose transport related protein 10 related diseases.
- Human glucose transport-related protein 10 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human glucose transport-related protein 10 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- the sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- chromosome Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for labeling chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian Inheritance in Man (available online with Johns Hopkins University Wetch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that are mapped to chromosomal regions.
- the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
- polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human glucose transport related protein 10 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human glucose transporter-related protein 10 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Gastroenterology & Hepatology (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Toxicology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Cell Biology (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
L'invention concerne un nouveau polypeptide, une protéine humaine associée au transport de glucose 10, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des troubles du métabolisme, de l'acidémie organique, de toutes sortes de tumeurs, des troubles du développement, des inflammations, des maladies immunitaires, de l'hémopathie et de l'infection par VIH. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine humaine associée au transport de glucose 10.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU48239/01A AU4823901A (en) | 2000-03-22 | 2001-03-19 | A novel polypeptide, glucose transport-associated human protein 10 and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00115046 CN1314398A (zh) | 2000-03-22 | 2000-03-22 | 一种新的多肽——人葡萄糖转运相关蛋白10和编码这种多肽的多核苷酸 |
CN00115046.4 | 2000-03-22 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2001075021A2 true WO2001075021A2 (fr) | 2001-10-11 |
WO2001075021A3 WO2001075021A3 (fr) | 2007-11-15 |
Family
ID=4584517
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000359 WO2001075021A2 (fr) | 2000-03-22 | 2001-03-19 | Nouveau polypeptide, proteine humaine associee au transport de glucose 10, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1314398A (fr) |
AU (1) | AU4823901A (fr) |
WO (1) | WO2001075021A2 (fr) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113557058A (zh) * | 2019-03-12 | 2021-10-26 | 通用电气公司 | 靶向葡萄糖转运子和/或肠促胰岛素途径的神经调节 |
-
2000
- 2000-03-22 CN CN 00115046 patent/CN1314398A/zh active Pending
-
2001
- 2001-03-19 WO PCT/CN2001/000359 patent/WO2001075021A2/fr active Application Filing
- 2001-03-19 AU AU48239/01A patent/AU4823901A/en not_active Abandoned
Non-Patent Citations (4)
Title |
---|
DATABASE EMBL [Online] 23 November 1999 XP003018864 Database accession no. (Z78022) * |
DATABASE GENBANK [Online] 01 April 1999 XP003018867 Database accession no. (AC006059) * |
DATABASE GENBANK [Online] 21 December 1999 SULSTON J.E. AND WILSON R.: 'Toward a complete human genome sequence', XP003018865 Database accession no. (AC004911) & GENOME RES. vol. 8, no. 11, 1998, pages 1097 - 1108 * |
DATABASE GENBANK [Online] 21 December 1999 SULSTON J.E. AND WILSON R.: 'Toward a complete human genome sequence', XP003018866 Database accession no. (AC006459) & GENOME RES. vol. 8, no. 11, 1998, pages 1097 - 1108 * |
Also Published As
Publication number | Publication date |
---|---|
CN1314398A (zh) | 2001-09-26 |
AU4823901A (en) | 2001-10-15 |
WO2001075021A3 (fr) | 2007-11-15 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001075021A2 (fr) | Nouveau polypeptide, proteine humaine associee au transport de glucose 10, et polynucleotide codant pour ce polypeptide | |
WO2001070964A1 (fr) | Nouveau polypeptide, proteine humaine de transport de glucose 18, et polynucleotide codant pour ce polypeptide | |
WO2001083743A1 (fr) | Polypeptide sous-unite 11 d'adducine alpha de globule rouge humain et polynucleotide codant pour ce polypeptide | |
WO2001066730A1 (fr) | Nouveau polypeptide, proteine humaine rs3 12, et polynucleotide codant pour ce polypeptide | |
WO2001068684A1 (fr) | Nouveau polypeptide, protocadherine humaine 14, et polynucleotide codant pour ce polypeptide | |
WO2001083538A1 (fr) | Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide | |
WO2001064721A1 (fr) | Nouveau polypeptide, adenosine triphosphatase 30, et polynucleotide codant pour ce polypeptide | |
WO2001068873A1 (fr) | Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide | |
WO2001075054A2 (fr) | Nouveau polypeptide, facteur humain de regulation 30 de la transcription de la microglobuline, et polynucleotide codant pour ce polypeptide | |
WO2001074887A1 (fr) | Nouveau polypeptide, proteine humaine 9 humsiah, et polynucleotide codant pour ce polypeptide | |
WO2001070983A1 (fr) | Nouveau polypeptide, proteine antigene prostatique specifique membranaire 9, et polynucleotide codant pour ce polypeptide | |
WO2001074996A2 (fr) | Nouveau polypeptide, c. elegans 52 humain, et polynucléotide codant pour ce polypeptide | |
WO2001081393A1 (fr) | Nouveau polypeptide, proteine kinase ysk1 humaine 20, et polynucleotide codant pour ce polypeptide | |
WO2001075012A2 (fr) | Nouveau polypeptide, peptide signal humain 10 d'une proteine precurseur de la lipoproteine, et polynucleotide codant pour ce polypeptide | |
WO2001081392A1 (fr) | Nouveau polypeptide, phosphoproteine nucleolaire humaine 13, et polynucleotide codant pour ce polypeptide | |
WO2001083728A1 (fr) | Nouveau polypeptide, proteine humaine de transport d'acides amines excitateurs 9, et polynucleotide codant pour ce polypeptide | |
WO2001078755A2 (fr) | Nouveau polypeptide, proteine humaine de mutation 9 de l'ataxie-telangiectasie, et polynucleotide codant pour ce polypeptide | |
WO2001075029A2 (fr) | Nouveau polypeptide, facteur humain 11 associe a nf-e2, et polynucleotide codant pour ce polypeptide | |
WO2001081536A2 (fr) | Nouveau polypeptide, proteine kinase ysk1 humaine 10, et polynucleotide codant pour ce polypeptide | |
WO2001070791A1 (fr) | Nouveau polypeptide, facteur humain lie a nf-e2, et polynucleotide codant pour ce polypeptide | |
WO2001083539A1 (fr) | Nouveau polypeptide, kinase mitotique ask1-26, et polynucleotide codant pour ce polypeptide | |
WO2001074877A1 (fr) | Nouveau polypeptide, proteine humaine de transport 12 d'acides amines excitateurs, et polynucleotide codant pour ce polypeptide | |
WO2001068693A1 (fr) | Nouveau polypeptide, proteine humaine de reception cannabinoide 7, et polynucleotide codant pour ce polypeptide | |
WO2001055401A1 (fr) | Nouveau polypeptide, helicase atp-dependante humaine 31, et polynucleotide codant pour ce polypeptide | |
WO2001090181A1 (fr) | Nouveau polypeptide, proteine tyrosine kinase humaine 13 de cellules b, et polynucleotide codant ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |