WO2001055434A1 - Hemmung von kohlenhydrat-modifizierenden enzymen in wirts-organismen - Google Patents

Hemmung von kohlenhydrat-modifizierenden enzymen in wirts-organismen Download PDF

Info

Publication number
WO2001055434A1
WO2001055434A1 PCT/DE2000/003902 DE0003902W WO0155434A1 WO 2001055434 A1 WO2001055434 A1 WO 2001055434A1 DE 0003902 W DE0003902 W DE 0003902W WO 0155434 A1 WO0155434 A1 WO 0155434A1
Authority
WO
WIPO (PCT)
Prior art keywords
carbohydrate
protein
enzyme
peptide
host organism
Prior art date
Application number
PCT/DE2000/003902
Other languages
English (en)
French (fr)
Other versions
WO2001055434A8 (de
Inventor
Klaus Düring
Irina Wenderoth
Original Assignee
Mpb Cologne Gmbh Molecular Plant & Protein Biotechnology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Mpb Cologne Gmbh Molecular Plant & Protein Biotechnology filed Critical Mpb Cologne Gmbh Molecular Plant & Protein Biotechnology
Priority to AU2001225011A priority Critical patent/AU2001225011A1/en
Publication of WO2001055434A1 publication Critical patent/WO2001055434A1/de
Publication of WO2001055434A8 publication Critical patent/WO2001055434A8/de

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8257—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8257—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon
    • C12N15/8258—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon for the production of oral vaccines (antigens) or immunoglobulins

Definitions

  • the present invention relates to a method for the post-translational inhibition of a carbohydrate-modifying enzyme in host organisms, preferably in a transgenic plant, and a plant suitable for carrying out the method.
  • Carbohydrates play an important role in the metabolism of organisms, both as independent molecules, eg starch in plants, and in forms chemically bound to other classes of substances, eg in the glycosylation of proteins.
  • the glycosylation residues and their specific structure play an important role in the subcellular localization of the glycosylated proteins in question.
  • Advances in genetic engineering have made it possible to specifically change the composition of carbohydrates, eg modified starch in potatoes, or that of the glycosylation side chains of proteins, eg in transgenic plants, in a transgenic organism. On the one hand, this enables new applications for known products, for example by improving their properties, such as in potato starch by developing transgenic plants which produce homogeneous, one-component modified starch.
  • the invention is essentially based on the technical problem of providing a method for inhibiting carbohydrate-modifying enzymes in host organisms which does not have the disadvantages of the methods described in the prior art, i.e. above all, it ensures that the escapement is reliable and essentially complete.
  • the present invention relates to a method which does not involve the transcription of the cDNA coding for the enzyme in question by antisense or co-suppression, ie overexpression of the cDNA in question in the antisense or sense direction, but - much more controllably - post-translationally on the enzymatic activity of the enzyme itself.
  • a gene which codes for a peptide or protein which has at least one of the following properties: (a) it binds to the carbohydrate-modifying enzyme itself and inhibits its activity, (b) it binds, modifies or degrades a specific or selectively acting cofactor for the carbohydrate-modifying enzyme , (c) it binds, modifies or degrades a specific substrate for the carbohydrate-modifying enzyme, or (d) it catalyzes the synthesis of an organic or inorganic compound which directly or indirectly inhibits the carbohydrate-modifying enzyme.
  • the present invention has over the prior art antisense and co-suppression technology to eliminate endogenous enzyme functions in an organism, in particular the advantage that need not be done on the protein expression in the first cell of the organism in a complete suppression of the enzyme production, sonderj ⁇ f for suitable time the enzyme function inhibition can be activated.
  • there is a major advantage in inhibiting the function of GnTI as long as the antisense or co-suppression of GnTI gene expression is not complete, some molecules of the GnTI enzyme can still be formed.
  • the function-inhibiting reaction is carried out in a plant at a desired point in time, for example by activating an inducible promoter which controls the inhibitor-coding cDNA, a complete inhibition reaction can take place.
  • the time period required for the inhibition to be complete is dependent on the “on- Rate "of the inhibitor and can be determined experimentally.
  • a therapeutic protein can be activated in a controlled manner via a second induced promoter, for example in a bioreactor plant.
  • a second induced promoter for example in a bioreactor plant.
  • any physiological or growth disorders or agronomic or resistance impairments in plants
  • antibodies or fragments thereof are particularly suitable, since they are molecules which are very stable and consequently efficient in host organisms.
  • the present invention thus relates to a method for post-translational inhibition of a carbohydrate-modifying enzyme in a host organism, which is characterized in that a gene is expressed in the host organism which codes for a peptide or protein which has at least one of the following properties:
  • carbohydrate-modifying enzyme used here refers to any enzyme that is involved in the biosynthesis of free carbohydrates in the organism and that Structure of free oligomeric or polymeric carbohydrates catalyzed, is involved in the biosynthesis of free carbohydrates in the organism and modifies free mono-, oligomeric or polymeric carbohydrates, or is involved in the biosynthesis of free carbohydrates in the organism and free oligomeric or polymeric carbohydrates demoted.
  • any enzyme which is involved in the biosynthesis of carbohydrates bound to other substances, in particular proteins, in the organism and which catalyzes the formation of bound mono-, oligomeric or polymeric carbohydrates, in the biosynthesis of other substances, in particular proteins, bound carbohydrates is involved in the organism and modifies bound mono-, oligo- or polymeric carbohydrates or is involved in the biosynthesis of carbohydrates bound to other substances, in particular proteins, in the organism and degrades bound mono-, oligo- or polymeric carbohydrates.
  • nucleic acid constructs which contain the gene to be expressed
  • the gene is preferably inserted into a vector, the vector being in particular a plasmid, a cosmid, a virus, a bacteriophage or another vector customary in genetic engineering.
  • These vectors can have further functional units which bring about a stabilization of the vector in the host organism.
  • agrobacterial T-DNA when a plant is used as the host organism, "left border” and “right border” sequences of agrobacterial T-DNA can be contained, which enables stable integration into the genome of plants. There may also be a termination sequence which serves to correctly terminate the transcription and to add a poly-A sequence to the transcript. Such elements are described in the literature (Gielen et al., EMBO J. 8 (1989), 23-29) and interchangeable. When used in plants, these vectors can contain, for example, the terminator of the octopine synthase gene from agrobacteria.
  • cloning vectors which contain a replication signal for E. coli and a marker gene for the selection of transformed bacterial cells.
  • examples of such vectors are pBR322, pUC series, Ml3mp series, pACYC184 etc.
  • the desired gene can be introduced into the vector at a suitable restriction site.
  • the plasmid obtained is used for the transformation of E. coli cells.
  • Transformed E.coli cells are grown in a suitable medium, then harvested and lysed.
  • the plasmid is recovered. Restriction analyzes, gel electrophoresis and other biochemical-molecular biological methods are generally used as the analysis method for characterizing the plasmid DNA obtained. After each manipulation, the plasmid DNA can be cleaved and DNA fragments obtained can be linked to other DNA sequences.
  • a variety of techniques are available for introducing the above nucleic acid constructs or vectors into a plant cell. These techniques include the transformation of plant cells with T-DNA using Agrobacterium tumefaciens or Agrobacterium rhizogenes as a transformation agent, the fusion of protoplasts, the injection or electroporation of DNA, the introduction of DNA using the biolistic method and other possibilities.
  • plasmids When injecting and electroporation of DNA into plant cells, there are no special requirements for the plasmids used. Simple plasmids, such as pUC derivatives, can be used. If whole plants are to be regenerated from such transformed cells, there should be a selectable marker. Suitable selectable markers are known to the person skilled in the art and include, for example, the neomycin phosphotransferase gene, the phosphinotricin acetyltransferase gene or the hygromycin phosphotransferase gene. Depending on the method of introducing desired genes into the plant cell, additional DNA sequences may be required.
  • the Ti or Ri plasmid is used for the transformation of the plant cell, then at least the right boundary, but often the right and left boundary of the Ti and Ri plasmid T-DNA as the flank region, must be linked to the genes to be introduced.
  • agrobacteria If agrobacteria are used for the transformation, the DNA to be introduced must be cloned into special plasmids, either in an intermediate vector or in a binary vector (cf. Examples 1-3 below). Due to sequences that are homologous to sequences of the T-DNA, intermediate vectors can be integrated into the Ti or Ri plasmid of the agrobacteria by homologous recombination. This also contains the vir region necessary for the transfer of the T-DNA. Intermediate vectors cannot replicate in agrobacteria. The intermediate vector can be transferred to Agrobacterium tumefaciens using a helper plasmid. Binary vectors can replicate in E. coli as well as in agrobacteria.
  • the agrobacterium serving as the host cell should contain a plasmid carrying a vir region. The vir region is necessary for the transfer of the T-DNA into the plant cell. Additional T-DNA may be present.
  • the agrobacterium transformed in this way is used to transform plant cells.
  • plant explants can advantageously be cocultivated with Agrobacterium tumefaciens or Agrobacterium rhizogenes.
  • Agrobacterium tumefaciens or Agrobacterium rhizogenes From the Infected plant material, such as leaf pieces, stem segments, roots, protoplasts or suspension-cultivated plant cells can then be regenerated again in a suitable medium, which can contain antibiotics or biocides for the selection of transformed cells.
  • the plants thus obtained can then be examined for the presence of the introduced DNA.
  • the plants which can be used in the process according to the invention can in principle be plants of any plant species, i.e. both monocot and dicotyledonous plants. They are preferably useful plants, in particular plants such as wheat, barley, rice, corn, sugar beet, sugar cane, Brassicaceaen, legumes, tobacco or potato.
  • the parts of the plant which can be used for the expression of the desired inhibitor in principle relate to any part of the plant, in any case propagation material and crop products of the plants, for example fruits, seeds, tubers, rhizomes, seedlings, cuttings, etc.
  • Proteins suitable for inhibiting the activity of the carbohydrate-modifying enzyme include, for example, inhibiting or neutralizing antibodies which bind to the enzyme, or inhibiting or neutralizing peptides (see also Examples 1-3 below).
  • Methods for producing a gene coding for a specific antibody are known to the person skilled in the art. For this, the antibodies with the desired specificity must first be generated. Methods for obtaining such antibodies are known to the person skilled in the art and include, for example with respect to polyclonal antibodies, the use of the desired enzyme or a fragment thereof or a synthetic peptide derived from the amino acid sequence (or optionally the substrate or the cofactor) as an immunogen for the immunization of suitable animals and the production of serum.
  • the next step is to produce monoclonal antibodies.
  • Methods for producing monoclonal antibodies are also known to the person skilled in the art. For example, cell hybrids are produced and cloned from antibody-producing cells and myeloma cells. A clone is then selected which produces an antibody with the desired specificity. This antibody is then isolated. Examples of cells that produce antibodies are spleen cells, lymph node cells, B-lymphocytes, etc. Examples of animals that can be immunized for this purpose are mice, rats, horses, goats and rabbits. The myeloma cells can / be obtained from mice, rats, humans or other sources. Cell fusion can be carried out, for example, using the well-known method from Köhler and Milstein.
  • the cell hybrids obtained by cell fusion, ie hybridomas are screened using the appropriate enzyme, substrate or cofactor using the enzyme-antibody method or a similar method.
  • clones are obtained using the limit dilution method.
  • the clones obtained are injected intraperitoneally into BALB / c mice, after 10 to 14 days the ascites fluid is removed from the mouse and the monoclonal antibody is purified by known methods, for example ammonium sulfate fractionation, PEG fractionation, ion exchange chromatography, gel chromatography or affinity chromatography.
  • the nucleic acid of the desired antibody is isolated and sequenced.
  • the desired nucleic acid constructs coding for the desired antibody or a fragment thereof can be prepared for the method according to the invention according to standard methods.
  • the antibodies according to the invention relate not only to antibodies which inhibit the activity of the carbohydrate-modifying enzyme itself, but also to those which inhibit the carbohydrate-modifying enzyme by binding to a specific cofactor or to a specific substrate.
  • the peptide or protein which inhibits the carbohydrate-modifying enzyme is therefore an inhibiting or neutralizing antibody.
  • antibody used here also relates to fragments of the antibody, for example Fab, Fv or “single chain Fv” fragments, which have the same epitope specificity and activity as the complete antibody.
  • the antibody is a catalytic antibody, f of the above-mentioned compounds, for example enzymes, substrates or cofactors, modified or degrades, so that the conventionally catalyzed by this enzyme reaction is no longer, or only to a minor like Measure can expire.
  • catalytic antibodies are known to the person skilled in the art.
  • Suitable peptides or proteins for binding, modifying or breaking down a specific or selectively acting cofactor of the carbohydrate-modifying enzyme include, for example, antibodies or degrading enzymes.
  • NAD-dependent malate dehydrogenases such as the NAD-dependent malate dehydrogenase from chloroplasts of Arid bidopsis thaliana
  • NAD-binding enzymes for example the glucose-6-phosphate dehydrogenase from Leuconostoc mesenteroides, by means of binding referenced by NAD + in chloroplasts of transgenic Arabidopsis plants.
  • Cu + -dependent enzymes for example the chloroplast plastid superoxide dismutase from spinach
  • a Cu-binding protein such as a bovine amine oxidase from bovine
  • human hemoglobin for example in transgenic tobacco, can be used for the complexation of iron, as a result of which the activity of iron-dependent enzymes, for example catalases, is inhibited.
  • Peptides or proteins suitable for the binding, modification or degradation of a specific substrate of the carbohydrate-modifying enzyme are likewise known to the person skilled in the art or can be isolated by known selection methods. These include, for example, the antibodies or degrading enzymes discussed above. Furthermore, the removal of the substrate can also be achieved in that the substrate is consumed by the expression of an enzyme competing for the same substrate. Such enzymes or genes coding for them can easily be determined and used by the person skilled in the art on the basis of the known metabolic pathways for carbohydrate-modifying enzymes. Here, e.g.
  • the method according to the invention can also be carried out by expressing in the host organism a gene which codes for an enzyme which synthesizes an organic or inorganic compound which directly isolates the carbohydrate-modifying enzyme, e.g. by binding to the enzyme itself, or indirectly, e.g. through interaction with cofactors and / or substrates.
  • Suitable enzymes or genes coding for them are known to the person skilled in the art. For example referred to the finding that plant and animal diamine oxidases e.g. be inhibited by histamine. Thus these enzymes can be inhibited by the expression of an enzyme leading to the formation of histamine, e.g. by the expression of bacterial histidine decarboxylase from Lactobacillus (Gallagher et al., J. Mol. Biol. 230. (1993). 516-528), which uses histidine as a substrate.
  • the inhibitor of the carbohydrate-modifying enzyme e.g. to bring the antibody not only into the host organism, in particular cells thereof, but into the same subcellular compartment in which the inhibitory reaction is also to take place.
  • This offers e.g. if the inhibition reaction is to take place in the Golgi apparatus or the enzyme to be inhibited is a plastid or mitochondrial enzyme.
  • the inhibitory peptide or protein is therefore linked to a further peptide or protein which localizes the inhibitory peptide or protein within specific fischer cell compartments of the cells of the host organism, for example the transgenic plant, for example in the plastids or mitochondria.
  • Suitable peptides or proteins and DNA sequences coding for them, as well as methods for linking to inhibiting peptides or proteins, for example antibodies, such that both the peptides or proteins are still active and the transport into the desired cell compartment are known to the person skilled in the art and for example in Anderson and Smith, Biochem. J. 240 (1986) 709-715; Baszczynski et al. , Nucl. Acids Res. 16 (1988), 4732.
  • the peptide or protein linked to the peptide or protein used for the inhibition is a Golgi, plastid or mitochondrial localization signal.
  • the gene coding for the desired protein is linked to an inducible promoter, which e.g. the inhibition of the carbohydrate-modifying enzyme and thus e.g. allows glycosylation patterns in a transgenic plant to be changed at a desired time.
  • Suitable promoters are known to the person skilled in the art and these include, for example, the anaerobically inducible GapC4 promoter from maize (Bülow et al., Molecular Plant Microbe Interactions 12, (1999), 182-188), the ethylene-inducible PAL promoter or "hydroxyproline” rieh glycoprotein “promoter (Ecker and Davies, Proc. Natl. Acad. Sci. USA 84, (1987), 5202-5206) or the ethanol-inducible promoter from Aspergillus nidulans (Caddick et al., Nature 16, (1998), 177-180).
  • the carbohydrate-modifying enzyme is one which is involved in starch synthesis or protein glycosylation.
  • it is an invertase, an ADP-glucose pyrophosphorylase, an ⁇ - (1,6) -fucosyltransferase or a ⁇ -mannosidase.
  • carbohydrate-modifying enzyme is "Granule Bound Starch Synthase” (GBSS) or ⁇ -1, 2-N-acetyl- glucosaminyltransferase I (GnTI).
  • GBSS Gramule Bound Starch Synthase
  • GnTI 2-N-acetyl- glucosaminyltransferase I
  • Plants in particular useful plants and very particularly wheat, barley, corn, sugar beet, sugar cane, a Brassicaceae, a legume, tobacco and a potato plant are preferred as host organisms in the process according to the invention.
  • the present invention also relates to plant seeds, plant cells or plants, e.g. Plants which contain a gene described above for the expression of a peptide or protein for the post-translational inhibition of a carbohydrate-modifying enzyme.
  • Example 1 Inhibition of GBSS activity in transgenic potatoes by expression of a specific scFv antibody
  • the DNA for the transit peptide from the gene coding for the small subunit of the ribulose-biphosphate-carboxyJL ⁇ se was modified in this way by means of a PCR reaction that an Ncol restriction site was inserted at the 5 'end and the sequence GTCGAC, which contains a Sall site, was inserted at the 3' end.
  • the PCR reaction included the following primer sequences: 5 ': CCATGGCTTCTATGATATCCTCTTCAG; 3 ': GTCGACGCACTTT-ACTCTTCCAC-CATTGC; The cDNA for a "Granule Bound Starch Synthase" (GBSS) inhibiting scFv antibody was modified by means of a PCR reaction in such a way that at the 5 'end the sequence GTCGAC, which contains a Sall restriction site, and at the 3' end an Xbal- Restriction interface were inserted.
  • the PCR reaction included the following primer sequences: 5 ': GTCGACATGAAATACCTATTGCCTAC; 3 ': TCTAGATGCGGCCGCACCTAG-GACGG.
  • Both cDNA fragments were digested with Ncol and Sall or Sall and Xbal, so that overhanging ends were formed.
  • the cDNA fragments obtained were simultaneously inserted into the vector pRT100 (Töpfer et al., Nucleic Acids Research 15 (1987), 5890; Odell et al., Nature 313 (1985), 810), which contained an expression cassette with the CaMV 35S promoter and contains ination sequences.
  • the expression cassette coding for the recombinant scFv antibody was isolated and inserted into the binary vector pSR 8-30 (Düring et al., Plant Journal 3 (1993), 587-598; Porsch et al., Plant Molecular Biology 37: 581-585 (1998).
  • the expression vector pSR 8-30 / t-scFv (GBSS) was obtained.
  • the agrobacteria were washed off and plant growth substances were added to the potato leaves, so that shoots preferably regenerated. Furthermore, non-transformed cells in the potato leaves were killed by adding kanamycin to the plant medium. Growing shoots were cut off and rooted on medium without plant growth substances, but with kanamycin. The further cultivation of the potato plants was carried out in the usual way.
  • the detection of the expressed scFv antibody was carried out by antibodies that bind to scFv or protein L in a Western blot or ELISA.
  • the total protein of the potato material was isolated and used in the corresponding detection methods.
  • the biological effect of inhibiting GBSS activity in the transgenic potato tubers and the resulting change in the starch composition has been known to the person skilled in biochemical separation methods demonstrated (Kuipers et al., Plant Molecular Biology 26th (1994), 1759-1773).
  • Example 2 Inhibition of GnTI activity in transgenic potato plants by expression of a specific scFv antibody
  • the DNA for the Golgi localization signal was derived from the gene coding for the ⁇ -1,2-acetylglucosaminyltransferase I (GnTI) from rabbits (Burke et al., J. Biol. Chem 267, (1992), 24433-24440) by means of a PCR reaction (5 'primer sequence: CCATGGATGCTGAAGCAGTCTGCTGG; 3' primer sequence: GTCGA-CACGTGTCCAGAAGAAGAGGAGGAG) in such a way that an Ncol interface at the 5 'end and the sequence GTCGAC at the 3' end contains a Sall interface.
  • GnTI ⁇ -1,2-acetylglucosaminyltransferase I
  • the cDNA for a GnTI-inhibiting scFv antibody was determined by means of a PCR modification reaction (5 'primer sequence: GTCGACAT-GAAATACCTATTGCCTAC; 3' primer sequence: TCTAGATGCGGCCGCACCTAG-GACGG at the 5 'end by incorporating the sequence GTCGAC contains a Sall cleavage site and provided with an Xbal restriction cut at the 3 'end. Both cDNA fragments were digested with Ncol + Sall and Sall + Xbal, respectively, so that overhanging ends were formed.
  • the cDNA fragments obtained were inserted into the vector pRTllO inserted, which contains an expression cassette with CaMV 35S promoter and termination sequences (Töpfer et al., Nucleic Acids Reserch 15 (1987), 5890; Odell et al., Nature 313 (1985), 810-812).
  • the expression cassette coding for the recombinant scFv antibody was isolated and inserted into the binary vector pSR 8-30 (Düring et al., Plant Journal 3 (1993), 587-598; Porsch et al., Plant Molecular Biology 37 (1998) . 581-585).
  • the expression vector pSR 8-30 / g-scFv (GnTI) was obtained. Transgenic potato plants were produced as described in Example 1.
  • GnTI activity was demonstrated by enzyme activity test methods known to the person skilled in the art (Schaewen et al., Plant Physiology 102 (1993), 1109-1118) or standardized structural analysis methods of the glycosylation residues on plant-produced proteins (Lerouge et al., Plant Journal 10 (1996), 713-719).
  • the Golgi localization of the recombinant antibody was shown to inhibit GnTI function. It was also shown that the composition of the glycosylation residues was modified by vegetable proteins and that these no longer contained cc (1,3) -fucose and ⁇ (1,2) -xylose residues.
  • Example 3 Inhibition of GnTl activity in transgenic potato plants by expression of an inhibitory peptide
  • DNA for the Golgi localization signal was derived from the gene encoding rabbit ⁇ -1,2-acetylglucosaminyltransferase I (GnTI) (Burke et al., 1992, J. Biol. Chem. 267, 24433-24440) by means of a PCR reaction (5 'primer sequence: CCATGGATGCTGAAGCAGTCTGCTGG; 3' primer sequence: GTCGA-CACGTGTCCAGAAGAAGAGGAGGAG) in such a way that an Ncol interface at the 5 'end and the sequence GTCGAC at the 3' end contains a Sall interface.
  • GnTI rabbit ⁇ -1,2-acetylglucosaminyltransferase I
  • the cDNA for a GnTI-inhibiting peptide which is contained in the protein hPSTI (GnTI) selected from the "peptide phage display bank"("pSKAN Phagemid Display System", MoBiTec, Göttingen, Germany) (Rottgen and Collins, Gene 164, (1995), 243-250), became so by means of a linker ligation (at the 5 'end with the 5' phosphorylated oligonucleotide CCGTCGACAT and at the 3 'end with the 5' phosphorylated oligonucleotide GCTCTAGAGC) modified that it received a scal interface at the 5 'end and a -, ⁇ baI restriction interface at the 3' end.
  • GnTI protein hPSTI
  • Both modified cDNA fragments were digested with the restriction enzymes Ncol and Sall or Sall and Xbal, so that overhanging ends were formed.
  • the cDNA fragments obtained were inserted into the vector pRTHO, which contains an expression cassette with CaMV 35S promoter and termination sequences (Töpfer et al., Nucleic Acids Research 15 (1987), 5890; Odell et al., Nature 313 ( 1985), 810-812). This gave the new vector pRTHO / g-hPSTI (GnTI).
  • the expression cassette coding for the recombinant protein g-hPSTI was isolated and inserted into the binary vector pSR 8-30 (Duringing et al., Plant Journal 3 (1993), 587-598; Porsch et al. , Plant Molecular Biology 37 (1998), 581-585).
  • the expression vector pSR 8-30 / g-hPSTI (GnTI) was obtained.
  • Transgenic potato plants were produced as described in Example 1. The inhibition of GnTI activity was detected by enzyme activity test methods known to the person skilled in the art (Vischer and Hughes, Eur. J. Biochem. 177, (1981), 275-284) or standardized structural analysis methods of the glycosylation residues on plant-produced proteins (Lerouge et al., Plant Journal 10 (1996), 713-719).
  • the Golgi localization of the recombinant protein was shown to inhibit GnTI function. Furthermore, it was found that the composition of the glycosylation residues of vegetable proteins was modified and that they no longer contained ⁇ (1,3) -fucose and ⁇ (1,2) -xylose residues.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Nutrition Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Immunology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Die vorliegende Erfindung betrifft ein Verfahren zur posttranslationalen Hemmung eines Kohlenhydrat-modifizierenden Enzyms in einem Wirtsorganismus, vorzugsweise einer transgenen Pflanze, wobei in dem Wirtsorganismus ein Gen exprimiert wird, das für ein Peptid oder Protein codiert, das mindestens eine der folgenden Eigenschaften aufweist: (a) es bindet an das Kohlenhydrat-modifizierende Enzym selbst und hemmt dessen Aktivität, (b) es bindet, modifiziert oder baut einen spezifischen oder selektiv wirkenden Cofaktor für das Kohlenhydrat-modifizierende Enzym ab, (c) es bindet, modifiziert oder baut ein spezifisches Substrat für das Kohlenhydrat-modifizierende Enzym ab, oder (d) es katalysiert die Synthese einer organischen oder anorganischen Verbindung, die das Kohlenhydrat-modifizierende Enzym direkt oder indirekt hemmt. In einer bevorzugten Ausführungsform ist das Peptid oder Protein mit einem weiteren Peptid oder Protein verknüpft, das die Lokalisation des hemmenden Peptids oder Proteins innerhalb eines spezifischen Zellkompartiments der Zellen des Wirtsorganismus erlaubt.

Description

Hemmung von Kohlenhydrat-modifizierenden Enzymen in Wirtsorganismen
Die vorliegende Erfindung betrifft ein Verfahren zur post- translationalen Hemmung eines Kohlenhydrat-modifizierenden Enzyms in Wirtsorganismen, vorzugsweise in einer transgenen Pflanze, und eine zur Durchführung des Verfahrens geeignete Pflanze.
Kohlenhydrate spielen eine wesentliche Rolle im Metabolismus von Organismen, sowohl als eigenständige Moleküle, z.B. Stärke in Pflanzen, als auch in chemisch an andere Stoffklassen gebundenen Formen, z.B. bei der Glykosylierung von Proteinen. In tierischen Zellen spielen die Glykosylierungsreste sowie auch deren spezifische Struktur eine wichtige Rolle in der subzellulären Lokalisation der betreffenden glykosylierten Proteine. Durch die Fortschritte in der Gentechnologie ist es möglich geworden, in einem transgenen Organismus gezielt die Zusammensetzung von Kohlenhydraten, z.B. modifizierte Stärke in Kartoffeln, oder diejenige der Glykosylierungsseitenketten von Proteinen, z.B. in transgenen Pflanzen, zu verändern. Damit können einerseits neue Anwendungen für bekannte Produkte, z.B. durch Verbesserung von deren Eigenschaften, wie bei Kartoffelstärke durch Entwicklung von transgenen Pflanzen, die homogene, einkomponentige modifizierte Stärke erzeugen, ermöglicht werden. Andererseits können funktionelle Veränderungen z.B. an in Pflanzen produzierten humanen Proteinen erreicht werden, die für therapeutische Zwecke eingesetzt werden sollen, indem beispielsweise durch die Ausschaltung der Akti- vität der ß-1, 2-N-Acetylglucosaminyltransferase I (GnTI) die ansonsten in Pflanzen erfolgende Anknüpfung von α(l , 3 ) Fucose- und ß(l, 2)Xylose-Resten an das vorliegende proteingebundene Glykosylierungsgrundgerüst vom "high-mannose-type" unterbunden wird. Dadurch kann eine humane Immunverträglichkeit erreicht werden, die ansonsten bei der typischen pflanzlichen Glykosy- lierungsstruktur nicht gegeben ist. Diese Modifizierungsansätze werden bisher üblicherweise durch die weit verbreitete Antisense- oder Co-Suppressions-Techno- logie angestrebt. Die Nachteile dieser Methoden liegen beispielsweise in ihrer bekannten schwierigen quantitativen Re- produzierbarkeit und Steuerbarkeit. Zudem werden meist nur partielle Effekte erzielt, die zwar in Einzelfällen bei modifizierten direkten Produkten tolerierbar sein mögen, jedoch keinesfalls bei der Hemmung einer Enzymfunktion. So muß im Beispiel der GnTI-Hemmung eine vollständige Ausschaltung der Enzymfunktion über den gesamten Lebenszyklus einer Produktionspflanze für ein humanes Therapeutiku gewährleistet sein, da sonst noch Spuren oder sogar höhere Anteile der unerwünschten AusgangsStrukturen im Produkt enthalten sein können. Besonders wichtig ist dies bei sehr effizienten und in nur ge- ringen Mengen vorkommenden Enzymen und bei sehr stabilen Enzymen mit einer langen Halbwertszeit. Greift die Antisense- oder Co-Suppressions-Ausschaltung eines spezifischen Enzyms nur partiell, so werden nach wie vor zumindest kleine Mengen des betreffenden Enzyms gebildet, die dann die unerwünschte Modi- fizierung verursachen. Ein derartig verunreinigtes Produkt ist z.B. für therapeutische Anwendungen-.nicht geeignet.
Somit liegt der Erfindung im wesentlichen das technische Problem zugrunde, ein Verfahren zur Hemmung von Kohlenhydrat- modifizierenden Enzymen in Wirtsorganismen zur Verfügung zu stellen, das die Nachteile der im Stand der Technik beschriebenen Verfahren nicht aufweist, d.h. vor allem gewährleistet, daß die Hemmung zuverlässig und im wesentlichen vollständig ist .
Die Lösung dieses technischen Problems wird durch die Bereitstellung der in den Patentansprüchen gekennzeichneten Ausführungsformen erreicht.
Die vorliegende Erfindung betrifft ein Verfahren, das nicht an der Transkription der für das betreffende Enzym codierenden cDNA durch Antisense- oder Co-Suppression, d.h. Überexpression der betreffenden cDNA in Antisense- oder in Sense-Richtung, ansetzt, sondern - wesentlich besser steuerbar - posttransla- tional an der enzymatischen Aktivität des Enzyms selbst. Dies wird durch die Expression eines Gens in dem Wirtsorganismus erreicht, das für ein Peptid oder Protein codiert, das mindestens eine der folgenden Eigenschaften aufweist: (a) es bindet an das Kohlenhydrat-modifizierende Enzym selbst und hemmt dessen Aktivität, (b) es bindet, modifiziert oder baut einen spezifischen oder selektiv wirkenden Cofaktor für das Kohlen- hydrat-modifizierende Enzym ab, (c) es bindet, modifiziert oder baut ein spezifisches Substrat für das Kohlenhydrat-modifizierende Enzym ab, oder (d) es katalysiert die Synthese einer organischen oder anorganischen Verbindung, die das Kohlenhydrat-modifizierende Enzym direkt oder indirekt hemmt.
Die vorliegende Erfindung weist gegenüber der bekannten Antisense- und Co-Suppressions-Technologie zur Ausschaltung endogener Enzymfunktionen in einem Organismus insbesondere den Vorteil auf, daß nicht von der Proteinexpression in der ersten Zelle des Organismus an eine vollständige Unterdrückung der Enzymproduktion erfolgen muß, sonderjιfzum geeigneten Zeitpunkt die Enzymfunktions-Hemmung aktiviert werden kann. Beispielsweise ergibt sich für die Hemmung der Funktion von GnTI ein wesentlicher Vorteil: Solange die Antisense- oder Co-Suppression der GnTI-Genexpression nicht vollständig ist, können nach wie vor einige Moleküle des GnTI-Enzyms gebildet werden. Da dieses Enzym sehr effizient ist, reichen die verbleibenden Moleküle aus, um die unerwünschten Xylose- und Fucose-Reste an die getrimmte "high-mannose ' -Glykosylierungs- grundstruktur anzuknüpfen und damit die Wirksamkeit des Antisense- oder Co-Suppressionsansatzes zunichte zu machen. Führt man dagegen in einer Pflanze zu einem gewünschten Zeitpunkt die funktionshemmende Reaktion beispielsweise durch Aktivierung eines induzierbaren Promotors aus, der die Inhibitor- codierende cDNA steuert, so kann eine vollständige Hemmungsreaktion erfolgen. Der benötigte Zeitraum bis zur Vollständigkeit der Hemmung ist von der "On-Rate" des Inhibitors abhängig und kann experimentell ermittelt werden. Sobald die Hemmungs- reaktion vollständig ist, kann, z.B. in einer Bioreaktor- Pflanze, die Produktion eines therapeutischen Proteins über einen zweiten induzierten Promotor kontrolliert aktiviert werden. Durch die vollständige Hemmung der Enzymfunktion besteht kein Risiko einer falschen "Hintergrundreaktion" mehr. Ein weiterer erfindungsgemäßer Vorteil besteht darin, daß eventuell auftretende physiologische oder WachstumsStörungen (oder bei Pflanzen agronomische oder Resistenzbeeinträchtigun- gen) vermieden werden können, da erst zu einem späten Zeitpunkt kurz vor der Produktion des erwünschten Stoffes die Modifizierung des Kohlenhydrats abgeschaltet wird. Bei diesem erfindungsgemäßen Ansatz sind z.B. Antikörper oder Fragmente davon besonders geeignet, da es sich dabei um in Wirtsorganis- men sehr stabile und folglich effiziente Moleküle handelt.
Somit betrifft die vorliegende Erfindung ein Verfahren zur posttranslationalen Hemmung eines Kohlenhydrat-modifizierenden Enzyms in einem Wirtsorganismus, das sich dadurch auszeichnet, daß in dem Wirtsorganismus ein Gen exprimiert wird, das für ein Peptid oder Protein codiert, das. mindestens eine der folgenden Eigenschaften aufweist:
(a) es bindet an das Kohlenhydrat-modifizierende Enzym selbst und hemmt dessen Aktivität; (b) es bindet, modifiziert oder baut einen spezifischen oder selektiv wirkenden Cofaktor für das Kohlenhydrat- modifizierende Enzym ab;
(c) es bindet, modifiziert oder baut ein spezifisches Substrat für das Kohlenhydrat-modifizierende Enzym ab; oder
(d) es katalysiert die Synthese einer organischen oder anorganischen Verbindung, die das Kohlenhydrat-modifizierende Enzym direkt oder indirekt hemmt.
Der hier verwendete Ausdruck "Kohlenhydrat-modifizierendes Enzym" betrifft jegliches Enzym, das in der Biosynthese von freien Kohlenhydraten im Organismus involviert ist und den Aufbau von freien oligo- oder polymeren Kohlenhydraten katalysiert, in der Biosynthese von freien Kohlenhydraten im Organismus involviert ist und freie mono-, oligo- oder polymere Kohlenhydrate modifiziert, oder in der Biosynthese von freien Kohlenhydraten im Organismus involviert ist und freie oligo- oder polymere Kohlenhydrate degradiert. Auch ist jegliches Enzym gemeint, das in der Biosynthse von an andere Stoffe, insbesondere Proteine, gebundenen Kohlenhydraten im Organismus involviert ist und den Aufbau von gebundenen mono-, oligo- oder polymeren Kohlenhydraten katalysiert, in der Biosynthese von an andere Stoffe, insbesondere Proteine, gebundenen Kohlenhydraten im Organismus involviert ist und gebundene mono-, oligo- oder polymere Kohlenhydrate modifiziert oder in der Biosynthese von an andere Stoffe, insbesondere Proteine, ge- bundenen Kohlenhydraten im Organismus involviert ist und gebundene mono-, oligo- oder polymere Kohlenhydrate degradiert.
Verfahren zur Konstruktion der für das erfindungsgemäße Verfahren benötigten Nucleinsäurekonstrukte, d.h. Nucleinsäure- konstrukte, die das zu exprimierende Gen enthalten, sind dem Fachmann bekannt und beispielsweise , auch in gängigen Standardwerken beschrieben (z.B. Sambrook et al . , 1989, Molecular Cloning, A Laboratory Manual, 2. Aufl. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY) . Das Gen liegt vor- zugsweise in einen Vektor inseriert vor, wobei es sich bei dem Vektor insbesondere um ein Plasmid, ein Cosmid, ein Virus, einen Bacteriophagen oder einen anderen in der Gentechnik üblichen Vektor handelt. Diese Vektoren können weitere Funktionseinheiten besitzen, die eine Stabilisierung des Vektors im Wirtsorganismus bewirken. Ferner können bei Verwendung einer Pflanze als Wirtsorganismus "left border"- und "right border" -Sequenzen agrobakterieller T-DNA enthalten sein, wodurch eine stabile Integration in das Erbgut von Pflanzen ermöglicht wird. Ferner kann eine Terminationssequenz vorhan- den sein, die der korrekten Beendigung der Transkription sowie der Addition einer Poly-A-Sequenz an das Transkript dient. Derartige Elemente sind in der Literatur beschrieben (Gielen et al . , EMBO J. 8 (1989), 23-29) und beliebig austauschbar. Bei der Verwendung in Pflanzen können diese Vektoren beispielsweise den Terminator des Octopinsynthase-Gens aus Agrobakterien enthalten.
Zur Vorbereitung der Einführung gewünschter Gene in Wirtsorganismen, z.B. höhere Pflanzen, stehen eine große Anzahl von Klonierungsvektoren zur Verfügung, die ein Replikationssignal für E.coli und ein Markergen zur Selektion transformierter Bakterienzellen enthalten. Beispiele für derartige Vektoren sind pBR322, pUC-Serien, Ml3mp-Serien, pACYC184 usw.. Das gewünschte Gen kann an einer passenden Restriktionsschnittstelle in den Vektor eingeführt werden. Das erhaltene Plasmid wird für die Transformation von E.coli-Zellen verwendet. Transformierte E.coli-Zellen werden in einem geeigneten Medium angezogen, anschließend geerntet und lysiert. Das Plasmid wird wiedergewonnen. Als Analysemethode zur Charakterisierung der gewonnenen Plasmid-DNA werden im allgemeinen Restriktionsanalysen, Gelelektrophoresen und weitere biochemisch-moleku- larbiologische Methoden eingesetzt. Nach jeder Manipulation kann die Plasmid-DNA gespalten und , gewonnene DNA-Fragmente können mit anderen DNA-Sequenzen verknüpft werden.
Für die Einführung der vorstehenden Nucleinsäurekonstrukte bzw. Vektoren in eine Pflanzenzelle stehen eine Vielzahl von Techniken zur Verfügung. Diese Techniken umfassen die Transformation von Pflanzenzellen mit T-DNA unter Verwendung von Agrobacterium tumefaciens oder Agrobacterium rhizogenes als Transformationsmittel, die Fusion von Protoplasten, die Injek- tion oder Elektroporation von DNA, die Einbringung von DNA mittels der biolistischen Methode sowie weitere Möglichkeiten.
Bei der Injektion und Elektroporation von DNA in Pflanzenzellen werden an sich keine speziellen Anforderungen an die ver- wendeten Plasmide gestellt. Es können einfache Plasmide, wie pUC-Derivate, verwendet werden. Sollen aber aus derartig transformierten Zellen ganze Pflanzen regeneriert werden, sollte ein selektierbarer Marker vorhanden sein. Geeignete selektierbare Marker sind dem Fachmann bekannt und hierzu zählen beispielsweise das Neomycinphosphotransferase-Gen, das Phosphinotricinacetyltransferase-Gen oder das Hygromycinphos- photransferase-Gen. Je nach Einführungsmethode gewünschter Gene in die Pflanzenzelle können weitere DNA-Sequenzen erforderlich sein. Werden z.B. für die Transformation der Pflanzenzelle das Ti- oder Ri-Plasmid verwendet, so muß mindestens die rechte Begrenzung, häufig jedoch die rechte und linke Begrenzung der Ti- und Ri-Plasmid T-DNA als Flankenbereich mit den einzuführenden Genen verbunden werden.
Werden für die Transformation Agrobakterien verwendet, muß die einzuführende DNA in spezielle Plasmide kloniert werden, und zwar entweder in einen intermediären Vektor oder in einen binären Vektor (vgl .nachstehende Beispiele 1-3). Intermediäre Vektoren können aufgrund von Sequenzen, die homolog zu Sequenzen der T-DNA sind, durch homologe Rekombination in das Ti- oder Ri-Plasmid der Agrobakterien integriert werden. Dieses enthält außerdem die für den Transfer der T-DNA notwendige vir-Region. Intermediäre Vektoren können nicht in Agrobakterien replizieren. Mittels eines Helferplasmids kann der intermediäre Vektor auf Agrobacterium tumefaciens übertragen werden. Binäre Vektoren können sowohl in E.coli als auch in Agro- bakterien replizieren. Sie enthalten ein Selektionsmarker-Gen und einen Linker oder Polylinker, welche von der rechten und linken T-DNA Grenzregion eingerahmt werden. Sie können direkt in die Agrobakterien transformiert werden. Das als Wirtszelle dienende Agrobakterium sollte ein Plasmid, das eine vir-Region trägt, enthalten. Die vir-Region ist für den Transfer der T- DNA in die Pflanzenzelle notwendig. Zusätzliche T-DNA kann vorhanden sein. Das derartig transformierte Agrobakterium wird zur Transformation von Pflanzenzellen verwendet.
Für den Transfer der DNA in die Pflanzenzelle können Pflanzen- Explantate zweckmäßigerweise mit Agrobacterium tumefaciens oder Agrobacterium rhizogenes cokultiviert werden. Aus dem infizierten Pflanzenmaterial, z.B. Blattstücke, StengelSegmente, Wurzeln, Protoplasten oder Suspensions-kultivierte Pflanzenzellen können dann in einem geeigneten Medium, welches Antibiotika oder Biozide zur Selektion transformierter Zellen enthalten kann, wieder ganze Pflanzen regeneriert werden. Die so erhaltenen Pflanzen können dann auf Anwesenheit der eingeführten DNA untersucht werden. Alternative Systeme zur Transformation von monokotylen Pflanzen sind die Transformation mittels des biolistischen Ansatzes, die elektrisch oder che- misch induzierte DNA-Aufnahme in Protoplasten, die Elektroporation von partiell permeabilisierten Zellen, die Makroinjektion von DNA in Blütenstände, die Mikroinjektion von DNA in Mikrosporen und Pro-Embryonen, die DNA-Aufnahme durch keimende Pollen und die DNA-Aufnahme in Embryonen durch Quellung (zur Übersicht: Potrykus, Physiol. Plant (1990), 269 - 273). Während die Transformation dikotyler Pflanzen über Ti-Plasmid- Vektorsysteme mit Hilfe von Agrobacterium tumefaciens etabliert ist, weisen neuere Arbeiten darauf hin, daß auch monokotyle Pflanzen der Transformation mittels auf Agrobacte- rium basierender Vektoren zugänglich sind.
"• l
Bei den in dem erfindungsgemäßen Verfahren verwendbaren Pflanzen kann es sich prinzipiell um Pflanzen jeder beliebigen Pflanzenspezies handeln, d.h. sowohl monokotyle als auch diko- tyle Pflanzen. Bevorzugt handelt es sich um Nutzpflanzen, insbesondere um Pflanzen wie Weizen, Gerste, Reis, Mais, Zuk- kerrübe, Zuckerrohr, Brassicaceaen, Leguminosen, Tabak oder Kartoffel. Die für die Expression des gewünschten Inhibitors verwendbaren Pflanzenteile betreffen prinzipiell jedes belie- bige Pflanzenteil, jedenfalls Vermehrungsmaterial und Ernteprodukte der Pflanzen, beispielsweise Früchte, Samen, Knollen, Wurzelstöcke, Sämlinge, Stecklinge etc.
Für die Hemmung der Aktivität des Kohlenhydrat-modifizierenden Enzyms geeignete Proteine sind dem Fachmann bekannt und umfassen beispielsweise hemmende oder neutralisierende Antikörper, die an das Enzym binden, oder hemmende bzw. neutralisie- rende Peptide (vgl. auch die nachstehenden Beispiele 1-3). Verfahren zur Herstellung eines für einen bestimmten Antikörper codierenden Gens sind dem Fachmann bekannt. Dazu müssen zuerst die Antikörper mit der gewünschten Spezifität erzeugt werden. Verfahren zur Gewinnung solcher Antikörper sind dem Fachmann bekannt und umfassen beispielsweise bezüglich poly- klonaler Antikörper die Verwendung des gewünschten Enzyms oder eines Fragments davon oder eines von der Aminosäuresequenz abgeleiteten synthetischen Peptids (oder gegebenenfalls des Subtrats oder des Cofaktors) als Immunogen zur Immunisierung geeigneter Tiere und die Gewinnung von Serum. Im nächsten Schritt werden dann monoklonale Antikörper hergestellt. Verfahren zur Herstellung monoklonaler Antikörper sind dem Fachmann ebenfalls bekannt. Dazu werden beispielsweise Zell-Hybri- de aus Antikörper produzierenden Zellen und Myelomzellen hergestellt und kloniert. Anschließend wird ein Klon selektio- niert, der einen Antikörper mit der gewünschten Spezifität produziert. Dieser Antikörper wird dann isoliert. Beispiele von Zellen, die Antikörper produzieren, sind Milzzellen, Lymphknotenzellen, B-Lymphozyten etc.. Beispiele von Tieren, die zu diesem Zweck immunisiert w rben können, sind Mäuse, Ratten, Pferde, Ziegen und Kaninchen. Die Myelomzellen lassen / sich aus Mäusen, Ratten, Menschen oder anderen Quellen erhalten. Die Zellfusion kann man beispielsweise durch das all- gemein bekannte Verfahren von Köhler und Milstein durchführen. Die durch Zellfusion erhaltenen Zeil-Hybride, d.h. Hybridome, werden mittels des entsprechenden Enzyms, Substrats oder Cofaktors nach dem Enzym-Antikörper-Verfahren oder einem ähnlichen Verfahren abgesucht. Klone werden beispielsweise mit dem Grenz-Verdünnungsverfahren erhalten. Die erhaltenen Klone werden BALB/c-Mäusen intraperitoneal injiziert, nach 10 bis 14 Tagen wird die Ascites-Flüssigkeit der Maus entnommen und der monoklonale Antikörper durch bekannte Verfahren, beispielsweise Ammoniumsulfatfraktionierung, PEG-Fraktionierung, Ionen- austauschchromatographie, Gelchromatographie oder Affinitätschromatographie, gereinigt. Die Nucleinsäure des gewünschten Antikörpers wird isoliert und sequenziert. Hiervon ausgehend können die gewünschten Nucleinsäurekonstrukte, die für den gewünschten Antikörper oder ein Fragment davon codieren, für das erfindungsgemäße Verfahren entsprechend Standardverfahren hergestellt werden. Die erfindungsgemäßen Antikörper betreffen nicht nur Antikörper, die die Aktivität des Kohlenhydrat-modi- fizierenden Enzyms selbst hemmen, sondern auch solche, die das Kohlenhydrat-modifizierende Enzym dadurch hemmen, daß sie an einen spezifischen Cofaktor oder an ein spezifisches Substrat binden.
In einer bevorzugten Ausführungsform des erfindungsgemäßen Verfahrens ist somit das das Kohlenhydrat-modifizierende Enzym hemmende Peptid oder Protein ein hemmender oder neutralisierender Antikörper.
Der hier verwendete Ausdruck "Antikörper" betrifft auch Fragmente des Antikörpers, z.B. Fab-, Fv- oder "Single chain Fv"- Fragmente, welche die gleiche Epitopspezifität und Wirkung wie der vollständige Antikörper aufweisen. In einer bevorzugten Ausführungsform des erfindungsgemäßen Verfahrens ist der Antikörper ein katalytischer Antikörper, f der die vorstehend erwähnten Verbindungen, z.B. Enzyme, Substrate oder Cofaktoren, modifiziert oder abbaut, so daß die üblicherweise von diesem Enzym katalysierte Reaktion nicht mehr oder nur noch in gerin- gern Maß ablaufen kann. Solche katalytischen Antikörper sind dem Fachmann bekannt .
Verfahren zur Selektion geeigneter hemmender oder neutralisierender Peptide sind dem Fachmann ebenfalls bekannt. Hierzu zählt z.B. die "Phage Display"-Technik, welche die schnelle Isolierung des gewünschten Peptids aus molekularen Banken erlaubt (Ladner et al . , Directed evolution of novel binding proteins (1995); US . Patent 583 7500).
Für die Bindung, Modifizierung oder den Abbau eines spezifischen oder selektiv wirkenden Cofaktors des Kohlenhydrat- modifizierende Enzyms geeignete Peptide oder Proteine sind dem Fachmann ebenfalls bekannt und diese umfassen z.B. Antikörper oder degradierende Enzyme. In diesem Zusammenhang wird z.B. auf die Hemmung NAD-abhängiger Malat-Dehydrogenasen, wie der NAD-abhängigen Malat-Dehydrogenase aus Chloroplasten von Ara- bidopsis thaliana, durch NAD-bindende Enzyme, z.B. die Glucose-6-phosphatdehydrogenase aus Leuconostoc mesenteroides, mittels Bindung von NAD+ in Chloroplasten transgener Arabidop- sis-Pflanzen verwiesen. Cu+-abhängige Enzyme, z.B. die chloro- plastidäre Superoxid-Dismutase aus Spinat, können beispiels- weise durch die Expression eines Cu-bindenden Proteins, wie einer bovinen Aminoxidase aus dem Rind, in Chloroplasten transgener Pflanzen gehemmt werden. Schließlich kann die Expression von humanem Hämoglobin z.B. in transgenem Tabak für die Komplexierung von Eisen verwendet werden, wodurch die Aktivität eisenabhängiger Enzyme, z.B. von Katalasen, gehemmt wird.
Für die Bindung, Modifizierung oder den Abbau eines spezifischen Substrats des Kohlenhydrat-modifizierenden Enzyms geeignete Peptide oder Proteine sind dem Fachmann ebenfalls bekannt bzw. er kann diese nach bekannten Selektionsverfahren isolieren. Diese umfassen beispielsweise auch die vorstehend diskutierten Antikörper oder degradierenden Enzyme. Ferner kann die Entfernung des Substrats auch dadurch erreicht wer- den, daß das Substrat durch die Expression eines um das gleiche Substrat konkurrierenden Enzyms verbraucht wird. Derartige Enzyme bzw. für sie codierende Gene können vom Fachmann leicht aufgrund der bekannten Stoffwechselwege für Kohlenhydrat-modifizierende Enzyme bestimmt und angewandt werden. Hier sollte z.B. erwähnt werden, daß die Synthese aromatischer Aminosäuren (Phe, Tyr) aus dem gemeinsamen Vorläufer-Molekül L-Arogenat erfolgt, das entweder durch Arogenat-Dehydrogenase (=Aroge- nat :NAD-Oxidoreduktase) zu Phenylalanin oder durch Arogenat- Dehydratase (=Arogenathydrolase) zu Tyrosin umgesetzt wird. Die Überexpression der Arogenat-Dehydrogenase z.B. aus Acti- noplanes missouriensis (Hund et al . , Z .Naturforschung 44.
(1989) , 797-801) in transgenen Pflanzen führt zu einer bevor- zugten Produktion von Phenylalanin, wobei die Synthese von Tyrosin dann nahezu vollständig unterdrückt wird, während die Überexpression von Arogenat-Dehydratase z.B. aus Sorghum bico- lor (Siehl und Conn, Arch.Biochem.Biophys . 260 (1988), 822- 829) umgekehrt zur bevorzugten Produktion von Tyrosin führt und die Phenylalaninbildung unterdrückt wird.
Desweiteren kann das erfindungsgemäße Verfahren auch dadurch ausgeführt werden, daß in dem Wirtsorganismus ein Gen expri- miert wird, das für ein Enzym codiert, das eine organische oder anorganische Verbindung synthetisiert, die das Kohlenhydrat-modifizierende Enzym direkt, z.B. durch Bindung an das Enzym selbst, oder indirekt, z.B. durch Interaktion mit Cofak- toren und/oder Substraten, hemmt. Geeignete Enzyme bzw. für sie codierende Gene sind dem Fachmann bekannt. Es wird z.B. auf den Befund verwiesen, daß pflanzliche und tierische Di- aminoxidasen z.B. durch Histamin gehemmt werden. Somit können diese Enzyme durch die Expression eines zur Bildung von Histamin führenden Enzyms gehemmt werden, z.B. durch die Expression von bakterieller Histidin-Decarboxylase aus Lactobacillus (Gallagher et al . , J.Mol.Biol. 230 .(1993) . 516-528), die Hi- stidin als Substrat verwendet.
Ferner kann es für die Durchführung des erfindungsgemäßen Verfahrens günstig sein, den Inhibitor des Kohlehydrat-modifizierenden Enzyms, z.B. den Antikörper, nicht nur in den Wirtsorganismus, insbesondere Zellen davon, sondern in das gleiche subzelluläre Kompartiment zu bringen in dem auch die Hemmreaktion stattfinden soll. Dies bietet sich z.B. an, wenn die Hemmreaktion im Golgi-Apparat stattfinden soll oder das zu hemmende Enzym ein plastidär oder mitochondrial vorkommendes Enzym ist.
In einer bevorzugten Ausführungsform des erfindungsgemäßen Verfahrens ist daher das hemmende Peptid oder Protein mit einem weiteren Peptid oder Protein verknüpft, das die Lokalisation des hemmenden Peptids oder Proteins innerhalb spezi- fischer Zellkompartimente der Zellen des Wirtsorganismus, z.B. der transgenen Pflanze, beispielsweise in den Piastiden oder Mitochondrien, bewirkt. Geeignete Peptide bzw. Proteine und für diese codierende DNA-Sequenzen sowie Verfahren zur Ver- knüpfung mit hemmenden Peptiden bzw. Proteinen z.B. Antikörpern, derart, daß sowohl die Peptide bzw. die Proteine noch aktiv sind als auch der Transport in das gewünschte Zellkom- partiment erfolgt, sind dem Fachmann bekannt und beispielsweise in Anderson and Smith, Biochem. J. 240 (1986), 709-715; Baszczynski et al . , Nucl. Acids Res . 16 (1988), 4732 beschrieben. In besonders bevorzugter Ausführungsform des erfindungsgemäßen Verfahrens ist das mit dem zur Hemmung verwendete Peptid oder Protein verknüpfte Peptid oder Protein ein Golgi-, Piastiden- oder Mitochondrien-Lokalisierungs-signal .
Desweiteren ist in einer bevorzugten Ausführungsform des erfindungsgemäßen Verfahrens das für das gewünschte Protein codierende Gen mit einem induzierbaren Promotor verknüpft, was z.B. die Hemmung des Kohlenhydrat-modifizierenden Enzyms und damit z.B. die Veränderung von Glykosylierungsmustern in einer transgenen Pflanze zu einem gewünschten Zeitpunkt erlaubt.
-• l
Geeignete Promotoren sind dem Fachmann bekannt und hierzu zählen beispielsweise der anaerob induzierbare GapC4-Promotor aus Mais (Bülow et al . , Molecular Plant Microbe Interactions 12, (1999), 182-188), der Ethylen-induzierbare PAL-Pro otor oder "Hydroxyproline rieh glycoprotein" Promotor (Ecker and Davies, Proc . Natl. Acad. Sei. USA 84, (1987), 5202-5206) oder der Ethanol-induzierabre Promotor aus Aspergillus nidulans (Caddick et al., Nature 16, (1998), 177-180).
In einer weiteren bevorzugten Ausführungsform des erfindungsgemäßen Verfahrens ist das Kohlenhydrat-modifizierende Enzym ein solches, das an der Stärkesynthese oder der Proteinglyko- sylierung beteiligt ist. Beispielsweise ist es eine Invertase, eine ADP-Glucose-pyrophosphorylase, eine α- (1 , 6 ) -Fucosyltrans- ferase oder eine ß-Mannosidase.
Besonders bevorzugt als Kohlenhydrat-modifizierendes Enzym ist "Granule Bound Starch Synthase" (GBSS) oder ß-1, 2-N-Acetyl- glucosaminyltransferase I (GnTI) .
Als Wirtsorganismen in dem erfindungsgemäßen Verfahren sind Pflanzen, insbesondere Nutzpflanzen und ganz besonders Weizen, Gerste, Mais, Zuckerrübe, Zuckerrohr, eine Brassicaceae, eine Leguminose, Tabak und eine Kartoffelpflanze bevorzugt.
Ferner betrifft die vorliegende Erfindung auch Pflanzensamen, Pflanzenzellen oder Pflanzen, z.B. Pflanzen, die ein vorste- hend beschriebenes Gen zur Expression eines Peptids oder Proteins zur posttranslationalen Hemmung eines Kohlenhydrat-modifizierenden Enzyms enthalten.
Die folgenden Beispiele erläutern die Erfindung.
Beispiel 1: Hemmung der GBSS-Aktivität in transgenen Kartoffeln durch Expression eines spezifischen scFv-Antikörpers
Die DNA für das Transitpeptid aus dem für die kleine Untereinheit der Ribulose-Biphosphat-CarboxyJL^se (für plastidäre Lokalisation) codierenden Gen (Anderson und Smith, Biochemical Journal 240 (1986), 709-715) wurde mittels einer PCR-Reaktion derart modifiziert, daß am 5 ' -Ende eine Ncol-Restriktionsschnittstelle und am 3 ' -Ende die Sequenz GTCGAC, welche eine Sall-Schnittstelle enthält, eingefügt wurde. Die PCR-Reaktion umfaßte folgende Primer-Sequenzen: 5': CCATGGCTTCTATGATATCCTCTTCAG; 3': GTCGACGCACTTT-ACTCTTCCAC- CATTGC; Die cDNA für einen "Granule Bound Starch Synthase" (GBSS) inhibierenden scFv-Antikörper wurde mittels einer PCR-Reaktion derart modifiziert, daß am 5' Ende die Sequenz GTCGAC, welche eine Sall-Restriktionsschnittstelle enthält, und am 3' Ende eine Xbal-Restriktionsschnittstelle eingefügt wurden. Die PCR-Reaktion umfaßte folgende Primer-Sequenzen: 5 ' : GTCGACATGAAATACCTATTGCCTAC; 3 ' : TCTAGATGCGGCCGCACCTAG- GACGG. Beide cDNA-Fragmente wurden mit Ncol und Sall bzw. Sall und Xbal verdaut, so daß überhängende Enden entstanden. Die erhaltenen cDNA-Fragmente wurden gleichzeitig in den Vektor pRTlOO (Töpfer et al . , Nucleic Acids Research 15 (1987), 5890; Odell et al . , Nature 313 (1985), 810) inseriert, der eine Expressionskassette mit dem CaMV 35S-Promotor und Ter ina- tionssequenzen enthält. Nach Spaltung mit Hindlll wurde die für den rekombinanten scFv-Antikörper codierende Expressionskassette isoliert und in den binären Vektor pSR 8-30 inseriert (Düring et al . , Plant Journal 3 (1993), 587-598; Porsch et al., Plant Molecular Biology 37 (1998), 581-585). Es wurde der Expressionsvektor pSR 8-30/t-scFv (GBSS) erhalten.
Dieser wurde zur Transformation von E.coli SM10 verwendet. Transformanden wurden mit Agrobacterium GV 3101 gemischt und über Nacht bei 28°C inkubiert (Koncz und Schell, Molecular and General Genetics 204 (1986), 383-396; Koncz et al . , Proc.Natl.Acad.Sci.USA 84 (1987), 131-135). Es wurde auf Carbenicillin selektioniert, wobei das hierfür notwendige bla-Gen in den vorstehenden Expresssionsvektoren vorliegt. Selektionsklone von Agrobacterium tumefaciens wurden auf abge- schnittenen und mehrfach an der Mittelrippe eingeritzten Blättern der Kartoffelpflanze cv. Desiree aufgebracht und die Blätter wurden 2 Tage bei 20°C im Dunkeln inkubiert. Danach/ wurden die Agrobakterien abgewaschen und den Kartoffelblättern Pflanzenwuchsstoffe zugesetzt, so daß bevorzugt Sprosse rege- nerierten. Ferner wurden durch Zugabe von Kanamycin in das Pflanzenmedium nicht-transformierte Zellen in den Kartoffelblättern abgetötet. Heranwachsende Sprosse wurden abgeschnitten und auf Medium ohne Pflanzenwachstumsstoffe, aber mit Kanamycin, bewurzelt. Die weitere Kultivierung der Kartoffel- pflanzen erfolgte in üblicher Weise.
Der Nachweis des exprimierten scFv-Antikörpers wurde durch Antikörper, die an scFv oder Protein L binden, im Western Blot bzw. ELISA erbracht. Hierzu wurde das Gesamtprotein des Kar- toffelmaterials isoliert und in die entsprechenden Nachweisverfahren eingesetzt. Der biologische Effekt der Hemmung der GBSS-Aktivität in den transgenen Kartoffelknollen und der daraus resultierenden Veränderung der Stärkezusammensetzung wurde durch dem Fachmann bekannte biochemische Trennverfahren nachgewiesen (Kuipers et al . , Plant Molecular Biology 26. (1994) , 1759-1773) .
Es zeigte sich, daß die plastidäre Expression des rekombinan- ten Antikörpers die GBSS-Funktion hemmte. Ferner zeigte sich, daß dadurch die Zusammensetzung der Stärke verändert wurde.
Beispiel 2: Hemmung der GnTI-Aktivität in transgenen Kartoffelpflanzen durch Expression eines spezifischen scFv-Antikörpers
Die DNA für das Golgi-Lokalisierungssignal aus dem für die ß- 1, 2-N-Acetylglucosaminyltransferase I (GnTI) aus Kaninchen codierenden Gen (Burke et al . , J. Biol . Chem 267, (1992), 24433 - 24440) wurde mittels einer PCR-Reaktion (5'-Primer- Sequenz: CCATGGATGCTGAAGCAGTCTGCTGG; 3 ' -Primer-Sequenz : GTCGA- CACGTGTCCAGAAGAAGAGGAGGAG) derart modifiziert, daß am 5 '-Ende eine Ncol-Schnittstelle und am 3 ' -Ende die Sequenz GTCGAC, die eine Sall-Schnittstelle enthält, eingefügt wurden. Die cDNA für einen GnTI-inhibierenden scFv-Antikörper wurde mittels einer PCR-Modifizierungsreaktion (5 ' -Primer-Sequenz : GTCGACAT- GAAATACCTATTGCCTAC ; 3 ' -Primer-Sequenz : TCTAGATGCGGCCGCACCTAG- GACGG am 5 ' -Ende durch Einbau der Sequenz GTCGAC, die eine Sall-Schnittstelle enthält, und am 3 ' -Ende mit einer Xbal- Restriktionsschnittsteile versehen. Beide cDNA-Fragmente wurden mit Ncol + Sall bzw. Sall + Xbal verdaut, so daß überhängende Enden entstanden. Die erhaltenen cDNA-Fragmente wurden in den Vektor pRTllO inseriert, der eine Expressionskassette mit CaMV 35S Promotor- und Terminationssequenzen enthält (Töpfer et al., Nucleic Acids Reserch 15 (1987), 5890; Odell et al., Nature 313 (1985), 810-812). Nach Spaltung mit Hindlll wurde die für den rekombinanten scFv-Antikörper codierende Expressionskassette isoliert und in den binären Vektor pSR 8-30 inseriert (Düring et al . , Plant Journal 3 (1993), 587-598; Porsch et al . , Plant Molecular Biology 37 (1998), 581-585) . Es wurde der Expressionsvektor pSR 8-30/g-scFv(GnTI) erhalten. Die Erzeugung transgener Kartoffelpflanzen erfolgte wie in Beispiel 1 beschrieben.
Der Nachweis der Hemmung der GnTI-Aktivität erfolgte durch dem Fachmann bekannte Enzymaktivitätstest-Verfahren (Schaewen et al., Plant Physiology 102 (1993), 1109-1118) oder standardisierte Strukturanalyse-Methoden der Glykosylierungsreste an pflanzlich produzierten Proteinen (Lerouge et al . , Plant Jour- nal 10 (1996) , 713-719) .
Es zeigte sich, daß die Golgi-Lokalisierung des rekombinanten Antikörpers die GnTI-Funktion hemmt. Ferner zeigte sich, daß dadurch die Zusammensetzung der Glykosylierungsreste pflanzli- eher Proteine modifiziert wurde und diese keine cc(l, 3) -Fucose- und ß(l, 2) -Xylose-Reste mehr enthielten.
Beispiel 3: Hemmung der GnTl-Aktivität in transgenen Kartoffelpflanzen durch Expression eines hemmenden Peptids
Die DNA für das Golgi-Lokalisierungssignal aus dem für die ß- 1, 2-N-Acetylglucosaminyltransferase I (GnTI) aus Kaninchen codierenden Gen (Burke et al . , J.Biol.Chem. 267 (1992), 24433- 24440) wurde mittels einer PCR-Reaktion (5 ' -Primer-Sequenz : CCATGGATGCTGAAGCAGTCTGCTGG; 3 ' -Primer-Sequenz : GTCGA- CACGTGTCCAGAAGAAGAGGAGGAG) derart modifiziert, daß am 5 '-Ende eine Ncol-Schnittstelle und am 3 '-Ende die Sequenz GTCGAC, die eine Sall-Schnittstelle enthält, eingefügt wurden. Die cDNA für ein GnTI-hemmendes Peptid, welches in dem aus der "Peptide-Phage-Display-Bank" ( "pSKAN Phagemid Display System", MoBiTec, Göttingen, Deutschland) selektierten Protein hPSTI(GnTI) enthalten ist (Rottgen and Collins, Gene 164, (1995), 243-250), wurde mittels einer Linker-Ligation (am 5'- Ende mit dem 5' -phosphorylierten Oligonucleotid CCGTCGACAT und am 3 ' -Ende mit dem 5 ' -phosphorylierten Oligonucleotid GCTCTA- GAGC) derart modifiziert, daß sie am 5 ' -Ende eine Scal- Schnittstelle und am 3 ' -Ende eine -,χbaI-Restriktionsschnitt- stelle erhielt. Beide modifizierten cDNA-Fragmente wurden mit den Restriktionsenzymen Ncol und Sall bzw. Sall und Xbal verdaut, so daß überhängende Enden entstanden. Die erhaltenen cDNA-Fragmente wurden in den Vektor pRTHO inseriert, der eine Expressionskassette mit CaMV 35S Promotor- und Terminations- sequenzen enthält (Töpfer et al . , Nucleic Acids Research 15. (1987), 5890; Odell et al . , Nature 313 (1985), 810-812). Dadurch wurde der neue Vektor pRTHO/g-hPSTI (GnTI) erhalten. Nach Spaltung mit Hindlll wurde die für das rekombinante Protein g-hPSTI (GnTI) codierende Expressionskassette isoliert und in den binären Vektor pSR 8-30 inseriert (Düring et al., Plant Journal 3 (1993), 587-598; Porsch et al . , Plant Molecular Biology 37 (1998) , 581-585) . Es wurde der Expressionsvektor pSR 8-30/g-hPSTI (GnTI) erhalten. Die Erzeugung transgener Kartoffelpflanzen erfolgte wie in Beispiel 1 beschrieben. Der Nachweis der Hemmung der GnTI-Aktivität erfolgte durch dem Fachmann bekannte Enzymaktivitätstest-Verfahren (Vischer and Hughes, Eur. J. Biochem. 177, (1981), 275-284) oder standardisierte Strukturanalyse-Methoden der Glykosylierungsreste an pflanzlich produzierten Proteinen (Lerouge et al . , Plant Journal 10 (1996) , 713-719) .
Es zeigte sich, daß die Golgi-Lokalisierung des rekombinanten Proteins die GnTI-Funktion hemmt. Ferner zeigte sich, daß dadurch die Zusammensetzung der Glykosylierungsreste pflanzlicher Proteine modifiziert wurde und diese keine α(l, 3) -Fucose- und ß(l, 2) -Xylose-Reste mehr enthielten.

Claims

Patentansprüche
1. Verfahren zur posttranslationalen Hemmung eines Kohlenhydrat-modifizierenden Enzyms in einem Wirtsorganismus, wobei in dem Wirtsorganismus ein Gen exprimiert wird, das für ein Peptid oder Protein codiert, das mindestens eine der folgenden Eigenschaften aufweist: (a) es bindet an das Kohlenhydrat-modifizierende Enzym selbst und hemmt dessen Aktivität; (b) es bindet, modifiziert oder baut einen spezifischen oder selektiv wirkenden Cofaktor für das Kohlenhydrat- modifizierende Enzym ab; (c) es bindet, modifiziert oder baut ein spezifisches Substrat für das Kohlenhydrat-modifizierende Enzym ab; oder (d) es katalysiert die Synthese einer organischen oder anorganischen Verbindung, die das Kohlenhydrat-modifi- zierende Enzym direkt oder indirekt hemmt.
2 . Verfahren nach Anspruch 1, wobei in dem Wirtsorganismus für mehrere unterschiedliche Peptide oder Proteine kodierende Gene exprimiert werden.
3. Verfahren nach Anspruch 1 oder 2, wobei das Peptid oder Protein ein hemmender oder neutralisierender Antikörper ist.
4. Verfahren nach Anspruch 3, wobei der Antikörper ein katalytischer Antikörper ist.
5. Verfahren nach einem der Ansprüche 1-4, wobei das hemmende Peptid oder Protein mit einem weiteren Peptid oder Protein verknüpft ist, das die Lokalisation des hemmenden Peptids oder Proteins innerhalb eines spezifischen Zellkomparti ents der Zellen des Wirtsorganis- mus bewirkt.
6. Verfahren nach Anspruch 5, wobei das weitere Peptid oder Protein ein Golgi-, Piastiden- oder Mitochondrien- Lokalisierungssignal ist.
7. Verfahren nach einem der Ansprüche 1-6, wobei das oder die in dem Wirtsorganismus exprimierten Gene mit einem induzierbaren Promotor funktioneil verknüpft sind.
8. Verfahren nach einem der Ansprüche 1-7, wobei das Kohlenhydrat-modifizierende Enzym ein Enzym ist, das an der Stärkesynthese beteiligt ist.
9. Verfahren nach Anspruch 8, wobei das Enzym "Granule Bound Starch Synthese" ist.
10. Verfahren nach einem der Ansprüche 1-7, wobei das Kohlenhydrat-modifizierende Enzym ein Enzym ist, das an der Proteinglykosylierung beteiligt ist.
11. Verfahren nach Anspruch 10, wobei das Enzym ß-l,2-N- Acetylglucosaminyltransferase I (GnTI) ist.
12. Verfahren nach einem der Ansprüche 1 bis 11, wobei der Wirtsorganismus eine Nutzpflanze ist.
13. Verfahren nach Anspruch 12, wobei die Nutzpflanze Weizen, Gerste, Mais, Zuckerrübe, Zuckerrohr, eine Brassi- caceae, eine Leguminose, Tabak oder eine Kartoffelpflanze ist.
14. Pflanzensamen, Pflanzenzelle oder Pflanze, die das nach einem der Ansprüche 1-11 definierte Gen enthalten.
PCT/DE2000/003902 2000-01-27 2000-11-06 Hemmung von kohlenhydrat-modifizierenden enzymen in wirts-organismen WO2001055434A1 (de)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001225011A AU2001225011A1 (en) 2000-01-27 2000-11-06 Inhibition of carbohydrate-modified enzymes in host organisms

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE2000103573 DE10003573A1 (de) 2000-01-27 2000-01-27 Hemmung von Kohlenhydrat-modifizierenden Enzymen in Wirtsorganismen
DE10003573.6 2000-01-27

Publications (2)

Publication Number Publication Date
WO2001055434A1 true WO2001055434A1 (de) 2001-08-02
WO2001055434A8 WO2001055434A8 (de) 2002-05-30

Family

ID=7628934

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DE2000/003902 WO2001055434A1 (de) 2000-01-27 2000-11-06 Hemmung von kohlenhydrat-modifizierenden enzymen in wirts-organismen

Country Status (3)

Country Link
AU (1) AU2001225011A1 (de)
DE (1) DE10003573A1 (de)
WO (1) WO2001055434A1 (de)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1878747A1 (de) * 2006-07-11 2008-01-16 greenovation Biotech GmbH Glyco-hergestellte Antikörper
WO2011117249A1 (en) * 2010-03-22 2011-09-29 Philip Morris Products S.A. Modifying enzyme activity in plants

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996007321A1 (en) * 1994-09-06 1996-03-14 The Uab Research Foundation Methods for modulating protein function in cells using intracellular antibody homologues
WO1996015248A1 (de) * 1994-11-10 1996-05-23 Hoechst Schering Agrevo Gmbh Dna-moleküle codierend enzyme, die an der stärkesynthese beteiligt sind, vektoren, bakterien, transgene pflanzenzellen und pflanzen enthaltend diese moleküle
WO1999006575A1 (en) * 1997-07-31 1999-02-11 Plant Bioscience Limited Starch debranching enzymes
WO1999029879A1 (de) * 1997-12-09 1999-06-17 Antje Von Schaewen PFLANZLICHE GntI-SEQUENZEN UND VERWENDUNG DERSELBEN ZUR GEWINNUNG VON PFLANZEN MIT VERMINDERTER ODER FEHLENDER N-ACETYLGLUCOSAMINYLTRANSFERASE I (GnTI)-AKTIVITÄT
WO2000005391A1 (en) * 1998-07-21 2000-02-03 Dow Agrosciences Llc Antibody-mediated down-regulation of plant proteins
WO2000023593A2 (en) * 1998-10-16 2000-04-27 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Molecular pathogenicide mediated plant disease resistance

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996007321A1 (en) * 1994-09-06 1996-03-14 The Uab Research Foundation Methods for modulating protein function in cells using intracellular antibody homologues
WO1996015248A1 (de) * 1994-11-10 1996-05-23 Hoechst Schering Agrevo Gmbh Dna-moleküle codierend enzyme, die an der stärkesynthese beteiligt sind, vektoren, bakterien, transgene pflanzenzellen und pflanzen enthaltend diese moleküle
WO1999006575A1 (en) * 1997-07-31 1999-02-11 Plant Bioscience Limited Starch debranching enzymes
WO1999029879A1 (de) * 1997-12-09 1999-06-17 Antje Von Schaewen PFLANZLICHE GntI-SEQUENZEN UND VERWENDUNG DERSELBEN ZUR GEWINNUNG VON PFLANZEN MIT VERMINDERTER ODER FEHLENDER N-ACETYLGLUCOSAMINYLTRANSFERASE I (GnTI)-AKTIVITÄT
WO2000005391A1 (en) * 1998-07-21 2000-02-03 Dow Agrosciences Llc Antibody-mediated down-regulation of plant proteins
WO2000023593A2 (en) * 1998-10-16 2000-04-27 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Molecular pathogenicide mediated plant disease resistance

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CONRAD ET AL: "Compartment-specific accumulation of recombinant immunoglobulins in plant cells: an essential tool for antibody production and immunomodulation of physiological functions and pathogen activity", PLANT MOLECULAR BIOLOGY,NL,NIJHOFF PUBLISHERS, DORDRECHT, vol. 38, September 1998 (1998-09-01), pages 101 - 109, XP002135721, ISSN: 0167-4412 *
DE JAEGER GEERT ET AL: "The plantibody approach: Expression of antibody genes in plants to modulate plant metabolism or to obtain pathogen resistance.", PLANT MOLECULAR BIOLOGY, vol. 43, no. 4, July 2000 (2000-07-01), pages 419 - 428, XP000995953, ISSN: 0167-4412 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1878747A1 (de) * 2006-07-11 2008-01-16 greenovation Biotech GmbH Glyco-hergestellte Antikörper
WO2008006554A2 (en) 2006-07-11 2008-01-17 Greenovation Biotech Gmbh Glyco-engineered antibodies
EP2368913A2 (de) 2006-07-11 2011-09-28 Greenovation Biotech GmbH Glycomanipulierte Antikörper
US9051577B2 (en) 2006-07-11 2015-06-09 Greenovation Biotech Gmbh Glyco-engineered antibodies
US10253098B2 (en) 2006-07-11 2019-04-09 Greenovation Biotech Gmbh Glyco-engineered antibodies
WO2011117249A1 (en) * 2010-03-22 2011-09-29 Philip Morris Products S.A. Modifying enzyme activity in plants
CN103025866A (zh) * 2010-03-22 2013-04-03 菲利普莫里斯生产公司 修饰植物中酶的活性
JP2013526844A (ja) * 2010-03-22 2013-06-27 フィリップ・モーリス・プロダクツ・ソシエテ・アノニム 植物の酵素活性の改変

Also Published As

Publication number Publication date
DE10003573A1 (de) 2001-08-09
WO2001055434A8 (de) 2002-05-30
AU2001225011A1 (en) 2001-08-07

Similar Documents

Publication Publication Date Title
DE60037123T2 (de) Mittel und verfahren zur veränderung der genexpression mittels nicht-polyadenylierter rna
US5773699A (en) Nucleotide sequences of galactinol synthase from zucchini and soybean
Vincent et al. Overexpression of a soybean gene encoding cytosolic glutamine synthetase in shoots of transgenic Lotus corniculatus L. plants triggers changes in ammonium assimilation and plant development
EP1038014B1 (de) PFLANZLICHE (GntI)-SEQUENZEN UND VERWENDUNG DERSELBEN ZUR GEWINNUNG VON PFLANZEN MIT VERMINDERTER ODER FEHLENDER N-ACETYLGLUCOSAMINYLTRANSFERASE I (GnTI)-AKTIVITÄT
DE4447387A1 (de) Debranching-Enzyme aus Pflanzen und DNA-Sequenzen kodierend diese Enzyme
DE69333180T2 (de) Für oligosaccharidetransporter kodierende dna sequenzen
DE4104782A1 (de) Neue plasmide, enthaltend dna-sequenzen, die veraenderungen der karbohydratkonzentration und karbohydratzusammensetzung in pflanzen hervorrufen, sowie pflanzen und pflanzenzellen enthaltend dieses plasmide
JPH07500970A (ja) 植物寄生線虫に対する低下された感受性を有する植物の生産方法
DE4441408A1 (de) DNA-Sequenzen aus Solanum tuberosum kodierend Enzyme, die an der Stärkesynthese beteiligt sind, Plasmide, Bakterien, Pflanzenzellen und transgene Pflanzen enhaltend diese Sequenzen
DE19708774A1 (de) Nucleinsäuremoleküle codierend Enzyme die Fructosylpolymeraseaktivität besitzen
DE69634361T2 (de) Für eine cinnamoyl-coa-reduktase kodierende dna sequenzen, und ihre verwendung zur regulation des lignun-gehalts von pflanzen
WO1993006711A1 (en) Tomato acid invertase gene
DE69434173T2 (de) Herstellung von trehalose in pflanzen
EP0952222A1 (de) Transgene Pflanzen mit einem modifizierten Inulin produzierendem Profil
DE69729727T2 (de) Verfahren zur herstellung von pflanzen mit erhöhten wachstumseigenschften
DE19734218A1 (de) Verfahren zur Ertragssteigerung in Pflanzen
WO2001055434A1 (de) Hemmung von kohlenhydrat-modifizierenden enzymen in wirts-organismen
DE10006462B4 (de) Produktion nicht-kariogener Zucker in transgenen Pflanzen
JP2001512972A (ja) デンプン分枝酵素発現のセンスイントロン阻害
DE60008962T2 (de) Klonierung einer N-Methyltransferase, die an der Koffeinbiosynthese beteiligt ist
EP1523561A1 (de) Verfahren zur herstellung von transgenen pflanzen mit erhöhter virusresistenz durch "silencing" pflanzlicher dnaj-ähnlicher proteine
DE19836405C1 (de) Transgene Pflanzen und Pflanzenzellen mit verminderter Expression von Invertaseinhibitoren
EP1458230A1 (de) Produktion von rekombinanten antikörpern mittels fusion mit elastin-ähnlichen peptiden
DE19914792A1 (de) Metabolische Selektionsmarker für Pflanzen
US20060236430A1 (en) Methods and compositions for producing male sterile plants

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: C1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: C1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

122 Ep: pct application non-entry in european phase