WO2001049739A1 - Nouveau polypeptide, la proteine po 14 de la myeline, et polynucleotide le codant - Google Patents
Nouveau polypeptide, la proteine po 14 de la myeline, et polynucleotide le codant Download PDFInfo
- Publication number
- WO2001049739A1 WO2001049739A1 PCT/CN2000/000668 CN0000668W WO0149739A1 WO 2001049739 A1 WO2001049739 A1 WO 2001049739A1 CN 0000668 W CN0000668 W CN 0000668W WO 0149739 A1 WO0149739 A1 WO 0149739A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- protein
- polypeptide
- myelin
- polynucleotide
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, myelin P0 protein 14, and a polynucleotide sequence encoding the polypeptide. The invention also relates to the preparation method and application of the polynucleotide and polypeptide.
- the myelin P0 protein motif forms the V-type immunoglobulin region: the transmembrane region: the cytoplasmic C-terminal region, including some positively charged residues and the role of some serine protein kinases Substrate.
- P0 protein is a major structural glycoprotein of myelin in the peripheral nervous system (PNS), accounting for more than 50% of the total myelin protein, and plays an important role in the formation and maintenance of myelin structure.
- PNS peripheral nervous system
- the P0 protein has a molecular weight of about 28KD and consists of 219 amino acid residues in three different functional regions: the N-terminus (residues 1-124), the transmembrane region (125-150), and the C-terminus (151-219).
- the amino acid region includes a negatively charged sugar chain.
- Asn-93 is likely to be located on the extracellular membrane. It is possible that this region forms myelin IPL (intraperiod line ⁇ ) through the interaction of hydrophobic and electrostatic forces.
- the basic C-terminal region of the cytoplasmic part together with basic proteins forms MDL (major dense) through electrostatic interaction with the membrane.
- the 125-150 region of the P0 protein is highly hydrophobic, indicating that this region is a transmembrane segment.
- the secondary structure of the P0 protein includes 7 helix regions, 11 P-fold regions, and 8 corner structures. Amino acid regions It is mainly P-fold, and the carboxyl terminus is mainly a helix. 7 ⁇ -sheet structures: A, B, C, D, E, F, G, similar to all immunoglobulins, and composed of 2 ⁇ -sheets
- the P-sheet is composed of antiparallel P chains.
- There is a special ⁇ -sheet C in the PO protein which indicates that the homology between the PO protein and the V region of the immunoglobulin is greater than that of the C region.
- the functional region of the MPZ (Myelin P0) gene is approximately 7KB long and consists of six exons. All exon-intron junction sequences follow the GT / AG rules.
- the 5 'end region of the gene has a TA enrichment unit (class (Like the TATA box), two CAAT boxes, and a single transcription initiation site detected by primer extension.
- the human MPZ gene is located on chromosomes Iq22-lq23.
- the P0 protein acts as a binding molecule in the formation of the myelin structure.
- This glycoprotein is the main binding component of the surrounding myelin and serves as a self-adhesive medium for Schwann cell protoplasmic membranes.
- the molecular mechanism of P0 mediator adhesion is universal and necessary. Because when secreted in different cell lines, P0 causes strong intercellular adhesions. PO protein can also promote the growth of axons.
- the PO protein belongs to the immunoglobulin superfamily. This family includes NCAM, MAG, L1, etc. Since the P0 protein includes a single immunoglobulin region, which is the simplest molecule in the superfamily, the P0 protein is assumed to be the original form of the immunoglobulin superfamily.
- the mutation of the MPZ gene is located on chromosome 1 and is related to the dominant chromosome pattern of Charcot-Marie-Tooth progressive neurofibromuscular atrophy. Symptoms of the disease are a reduction in the speed of nerve conduction and excessive growth and hypertrophy of Schwann cells.
- CMT1 (Charcot- Marie- Tooth Type 1) neuropathy manifests as a decrease in nerve conduction.
- CMTla (Charcot-Marie-Tooth Type la) is due to the duplication of the peripheral myelin protein 22 gene on chromosome II and occasional point mutation, which greatly reduces the nerve conduction speed.
- CMTlb (Charcot- Marie-Tooth Type lb) is the deletion of the Ser34 codon due to a 3 bp deletion in exon 2. This residue is located extracellularly.
- the polypeptide of the present invention is inferred and identified as a novel human myelin phospholipid P0 protein, which functions as an adhesion molecule in the formation of myelin structure and is related to the speed of nerve conduction and growth rate.
- this gene is also very helpful for studying the mechanism and interaction of members of the immunoglobulin superfamily.
- This gene can also be used to develop drugs for the treatment of progressive neurofibromuscular atrophy.
- myelin P0 protein 14 protein plays an important role in important body functions as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more myelin P0 protein 14 proteins involved in these processes. In particular, the amino acid sequence of this protein is identified.
- the isolation of the new myelin P0 protein 14 protein encoding gene also provides a basis for the study to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is very important.
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a myelin PG protein 1 4.
- Another object of the invention is to provide a genetically engineered host cell containing a polynucleotide encoding a myelin PO protein 14.
- Another object of the present invention is to provide a method for producing myelin PO protein 14.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention, myelin PO protein 14.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, myelin PO protein 14.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in myelin P0 protein 14. Summary of invention
- the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 92 3-1 297 in SEQ ID NO: 1; and (b) a sequence having 1 in SEQ ID NO: 1 -142 3-bit sequence.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- a vector in particular an expression vector, containing the polynucleotide of the invention
- a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
- a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of myelin PO protein 14 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to a compound obtained by the method Thing.
- the invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of myelin P0 protein 14 protein in vitro, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a biological sample The amount or biological activity of a polypeptide of the invention.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of myelin P 0 protein 14.
- Fig. 1 is a comparison diagram of the amino acid sequence homology of the myelin P0 protein 14 of the present invention with a total of 48 amino acids and domain myelin P0 family proteins at 60-1 07.
- the upper sequence is the myelin P0 protein 14 and the lower sequence is the myelin P0 family protein domain.
- ⁇ "and”: "" and ".” Indicate that the probability of the same amino acid decreasing between the two sequences decreases in sequence.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated myelin P0 protein 14.
- 14KDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, where substitutions Amino acids have similar structural or chemical properties to the original amino acids, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with myelin PO protein 14, can cause the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind myelin PO protein 14.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of myelin PO 0 protein 14 when bound to myelin PO 0 protein 14.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind myelin PO protein 14.
- Regular refers to a change in the function of myelin P0 protein 14, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of myelin P0 protein 14.
- substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- myelin PO protein 14 can purify myelin PO protein 14 using standard protein purification techniques. Basically pure myelin P0 protein 14 produces a single main band on a non-reducing polyacrylamide gel. The purity of myelin phosphate P0 protein 14 peptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T
- the complementarity between two single-stranded molecules can be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. Inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nort hern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not imply that conditions with reduced stringency allow Non-specific binding is possible because conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences based on different methods, such as the Cluster method (Hi gg ins, D. G. and P. M. Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of residues matching between sequence and sequence ⁇
- Bad sequence number of residues - the sequence of spacer residues - residues spacer sequence S x may be measured as Jotun He in the percentage of identity between nucleic acid sequences by methods known in the art method or by C lus ter (He in J., (1990) Me thods in enzymo logy 183: 625-645).
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- the "antisense strand” refers to a nucleic acid strand that is complementary to the “sense strand”.
- Derivative refers to HFP or a chemical modification of its nucleic acid. Such a chemical modification may be a substitution of a hydrogen atom with a fluorenyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (& 1) ') 2 and? , It can specifically bind to the epitope of myelin P0 protein 14.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is shared with some or all of the natural system. Separated matter is separated.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
- isolated myelin PO protein 14 means that myelin PO protein 14 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify myelin PO protein 14 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the myelin P0 protein 14 peptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, myelin P0 protein 14, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- Polypeptides of the invention may be naturally purified products, or products that are chemically synthesized, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of myelin PO protein 14.
- fragment refers to a polypeptide that substantially retains the same biological function or activity of the myelin PO protein 14 of the invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide ( Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protein sequence).
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. Multi-core The full-length nucleotide sequence is 1423 bases, and its open reading frame 923-1297 encodes 124 amino acids.
- This polypeptide has a characteristic sequence of a myelin P 0 family protein, and it can be deduced that the myelin P0 protein 14 has the structure and function represented by the myelin P0 family protein.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID D NO: 2 but different from the coding region sequence shown in SEQ ID D NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
- These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only between the two sequences Crosses occur at least 95% or more, and more preferably 97% or more.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 More than nucleotides.
- Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding myelin PO protein 14.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the myelin PG protein 14 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDM of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- mRNA extraction There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of transcripts of myelin PO protein 14; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of the myelin P0 protein 14 gene expression.
- ELISA enzyme-linked immunosorbent assay
- a method of applying a PCR technique to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-rapid cDNA end rapid amplification method
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- Polynucleotide sequences of the gene of the present invention obtained as described above, or various DNA fragments can be used It is determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. To obtain the full-length CDM sequence, sequencing needs to be repeated. Sometimes the CDM sequences of multiple clones need to be determined in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a myelin P0 protein coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.
- the polynucleotide sequence encoding the myelin P0 protein 14 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
- the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance for eukaryotic cell culture. And green fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance for eukaryotic cell culture.
- GFP green fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding a myelin P 0 protein 14 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells insect cells
- fly S 2 or Sf 9 animal cells
- animal cells such as CH0, COS or Bowes s melanoma cells Wait.
- Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
- transformation can also be performed by electroporation.
- the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- polynucleotide sequence of the present invention can be used to express or produce recombinant myelin PO protein 14 (Scence, 1 984; 224: 14 31). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.
- Myelin P0 protein is the main structural glycoprotein of the myelin of the peripheral nervous system (PNS) and plays an important role in the formation and stabilization of myelin. It is specifically expressed in peripheral myelin Schwann cells. It is the most abundant protein in myelin and belongs to the immunoglobulin superfamily.
- P0 protein in peripheral nerve myelin, the increase in P0 protein is closely related to the formation of myelin. In the early stage of embryonic development, P0 protein appeared earlier than other basic proteins, both in its intracellular and extracellular parts. It is of great significance to the formation and maintenance of myelin structure. P0 protein is not only a structural glycoprotein, but also exhibits more important biological activities. Its extracellular part is similar to the V-type structure of immunoglobulin, which makes P0 protein function as an adhesion molecule. It has also been found that in vivo, regardless of the original expression of the P0 protein, the P0 protein plays a role in stimulating and promoting neurite outgrowth during damaged nerve regeneration.
- the specific conserved sequence of the myelin P0 protein is required for its active mo t i f. It can be seen that the abnormal expression of the specific myelin P0 protein mot if will cause the function of the polypeptide containing the motif of the present invention to be abnormal, resulting in abnormal myelin formation and abnormal repair of damaged nerves. And may produce related diseases such as neurodevelopmental disorders, nervous system diseases, nerve repair abnormalities, and nervous system immune diseases.
- the abnormal expression of the myelin P 0 protein 14 of the present invention will produce various diseases, especially neurodevelopmental disorders, neurological diseases, neurorepair abnormalities, and neurological immune diseases. These diseases include, but are not limited to:
- Neurodevelopmental disorders neural tube insufficiency, brain developmental malformations, neuronal migration disorders, aqueduct malformations, cerebellar dysplasia, Down syndrome, spinal malformations, congenital hydrocephalus, congenital cerebellar dysplasia syndrome, Congenital abortion
- Neurological diseases Schwann cell tumor, neurofibromatosis, ependymal tumor, intracranial granulomatosis, Parkinson's disease, chorea, depression, amnesia, Huntington's disease, epilepsy, migraine, dementia, Spinal muscular atrophy, muscular hypertrophy, tonic muscle dystrophy, bradykinesia, dystonia, neurofibromatosis, nodular sclerosis, cerebral trigeminal neurohemangioma, ataxia capillary telangiectasia, Schizophrenia, paranoia, anxiety, obsessive-compulsive disorder, phobia, neurasthenia, acute myelitis, spinal cord compression, trigeminal neuralgia, facial paralysis, bulbar palsy, sciatica,
- Neurological Immunity Myasthenia Gravis, Guillain-Barre Syndrome, Multiple Sclerosis
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) myelin P 0 protein 14.
- Agonist enhances myelin P0 protein 14 stimulates cell proliferation and other biological functions Yes, while antagonists prevent and treat disorders related to hyperproliferation, such as various cancers.
- mammals 'field cells or membrane preparations expressing myelin PO protein 14 can be cultured with labeled myelin PO protein 14 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of myelin P0 protein 14 include antibodies, compounds, receptor deletions, and analogs that have been screened.
- An antagonist of myelin PO 0 protein 14 can bind to myelin PO 0 protein 14 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform a biological function.
- myelin PO protein 14 can be added to the bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between myelin PO protein 14 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to myelin PO protein 14 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, the myelin PO protein 14 molecule should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against the myelin PO 0 protein 14 epitope. These antibodies include (but are not limited to): Doklon antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.
- Polyclonal antibodies can be produced by injecting myelin P0 protein 14 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
- Techniques for preparing monoclonal antibodies to myelin P0 protein 14 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV-hybridization. Tumor technology, etc.
- Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0 Existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single chain antibodies against myelin PO protein 14.
- Antibodies against myelin P0 protein 14 can be used in immunohistochemical techniques to detect myelin P0 protein 14 in biopsy specimens.
- Monoclonal antibodies that bind to myelin P0 protein 14 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- High-affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill myelin P0 protein 14-positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases associated with myelin PO protein 14. Administration of an appropriate dose of antibody can stimulate or block the production or activity of myelin PO protein 14.
- the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of myelin P0 protein 14.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of myelin P0 protein 14 detected in the test can be used to explain the importance of myelin P0 protein 14 in various diseases and to diagnose diseases in which myelin P0 protein 14 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- Polynucleotides encoding myelin PO protein 14 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of myelin P0 protein 14. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated myelin P0 protein 14 to inhibit endogenous myelin P0 protein 14 activity. For example, a variant myelin P0 protein 14 may be a shortened myelin P0 protein 14 lacking a signaling domain, and although it can bind to downstream substrates, it lacks signaling activity.
- recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of myelin P0 protein 14.
- Expression vectors derived from viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a myelin P0 protein 14 into a cell.
- viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding a myelin phospholipid PO protein 14 can be found in the existing literature (Sambrook, et al.).
- the polynucleotide encoding the myelin PO protein 14 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit myelin PO0 protein 14 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA and DNA and ribozymes can be obtained using any existing RM or DNA synthesis technology, such as solid-phase phosphoramide The technology of synthesizing oligonucleotides by chemical synthesis has been widely used.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding myelin P0 protein 14 can be used for the diagnosis of diseases related to myelin P0 protein 14.
- the polynucleotide encoding myelin P0 protein 14 can be used to detect the expression of myelin P0 protein 14 or the abnormal expression of myelin P0 protein 14 in a disease state.
- the DNA sequence encoding myelin P0 protein 14 can be used to hybridize biopsy specimens to determine the expression of myelin P0 protein 14.
- Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are all mature and open technologies, and related kits are commercially available.
- a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microarray) or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis of genes in tissues and gene diagnosis.
- RNA-polymerase chain reaction (RT-PCR) in vitro amplification of myelin phospholipid P0 protein 14 specific primers can also detect myelin phospholipid P0 protein 14 transcription products.
- Myelin P0 protein 14 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type myelin P0 protein 14 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
- oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ Hybridization, pre-screening of chromosomes using labeled flow sorting, and pre-selection of hybridization, thereby constructing a chromosome-specific cDNA library.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Myelin P0 protein 14 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of myelin P0 protein 14 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
- the present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention.
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA was reverse transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from Clontech). The 0 ⁇ fragment was inserted into the multiple cloning site of the pBSK (+) vector (Clontech), and transformed into DH5a. The bacteria formed a cDNA library.
- Dye terminate cycle react ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0465H08 was new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- the sequence of the myelin P0 protein 14 of the present invention and the protein sequence encoded by the myelin P0 protein 14 of the present invention were profiled using the GCG profile scan program (Basic local alignment search tool) [Al tschul, SF et a 1. J. Mol. Biol. 1990; 215 : 403-10], performing domain analysis in databases such as prosite.
- the myelin P0 protein 14 of the present invention is homologous with the domain myelin P0 family protein at 60-107, and the homology result is shown in FIG. 1.
- the homology rate is 36%, and the score is 15.46; the threshold value is 15.38.
- Example 3 Cloning of a gene encoding myelin P0 protein 14 by RT-PCR
- CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
- Primerl 5'- TAAGAGAGAGATTTTTTTCCATCC -3 '(SEQ ID NO: 3)
- Primer2 5'- CAAGGAACCTTTATTTATTTTTTT -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
- Conditions for the amplification reaction 50 mmol / L KC1, 10 ramol / L Tris-HC1, pH 8.5, 1.5 mmol / L MgCl 2 , 200 ⁇ 1 / ⁇ dNTP, lOpraol primer, 1U Taq DNA polymerase in a 50 ⁇ 1 reaction volume (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55. C 30sec; 72. C 2rain.
- RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
- the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
- the DNA sequence analysis results showed that the DM sequence of the PCR product was exactly the same as 1-1423bp shown in SEQ ID NO: 1.
- Example 4 Northern blot analysis of myelin P0 protein 14 gene expression
- RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
- This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 ( pH7.4)-5 x SSC-5 x Denhardt's solution and 2G ( ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in ix SSC-0.1% SDS at 55 ° C for 30 minutes. Then, Phosphor Imager Analysis and quantification Example 5 In vitro expression, isolation and purification of recombinant myelin PO protein 14
- Primer3 5'- CCCCATATGATGTGTACAGCAAATTGTCAGTGTG -3 '(Seq ID No: 5)
- Primer4 5'- CATGGATCCTCAAGAGAGGGCAACCCATATTTTC -3' (Seq ID No: 6)
- the Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site. With full length The PBS-0465H08 plasmid of the target gene was used as a template for PCR reaction.
- the PCR reaction conditions were as follows: 10 pg of PBS-0465H08 plasmid was contained in a total volume of 50 ⁇ 1, and Primer-3 and Primer-4 primers were 1 Opmol and Advantage polymera Se Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E.
- coli DH5a by the calcium chloride method, and cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), and positive clones were selected by colony PCR method and sequenced. Positive sequence correct clone (PET-0465H08) was used to transform the recombinant plasmid into E. coli BL21 (DE3) p lySs (product of Novagen) by calcium chloride method.
- Polypeptide synthesizer (product of PE company) was used to synthesize the following myelin P0 protein 14-specific peptides: NH 2 -Me t-Cys-Thr-A 1 a-Asn-Cys-G 1 n-Cys-G 1 yH i s-Pro-G 1 y-Leu-Trp-Arg-COOH (SEQ ID NO: 7).
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to Identifying whether it contains the polynucleotide sequence of the present invention and detecting a homologous polynucleotide sequence, further The probe is used to detect whether the expression of the polynucleotide sequence of the present invention or a homologous polynucleotide sequence thereof in cells of normal tissues or pathological tissues is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Sou thern imprinting, Northern blotting, and copying methods, etc., all of which are used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the invention; the second type of probes are partially related to the invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- GC content is 30% -70%, if it exceeds, non-specific hybridization increases
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
- Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt)
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (4: Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- the sample membrane was placed in a plastic bag, and 3-lOmg prehybridization solution (10xDenhardf s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
- 3-lOmg prehybridization solution (10xDenhardf s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Animal Behavior & Ethology (AREA)
- General Chemical & Material Sciences (AREA)
- Public Health (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Gastroenterology & Hepatology (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Peptides Or Proteins (AREA)
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU21435/01A AU2143501A (en) | 1999-12-29 | 2000-10-25 | A new polypeptide-myelin p0 protein 14 and the polynucleotide encoding it |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN99127238A CN1301756A (zh) | 1999-12-29 | 1999-12-29 | 一种新的多肽——髓磷脂p0蛋白14和编码这种多肽的多核苷酸 |
CN99127238.2 | 1999-12-29 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001049739A1 true WO2001049739A1 (fr) | 2001-07-12 |
Family
ID=5284826
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2000/000668 WO2001049739A1 (fr) | 1999-12-29 | 2000-12-25 | Nouveau polypeptide, la proteine po 14 de la myeline, et polynucleotide le codant |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1301756A (zh) |
AU (1) | AU2143501A (zh) |
WO (1) | WO2001049739A1 (zh) |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1992021694A1 (en) * | 1991-06-06 | 1992-12-10 | Baylor College Of Medicine | Molecular diagnosis of autosomal dominant charcot-marie-tooth disease |
WO1995006727A2 (en) * | 1993-09-03 | 1995-03-09 | Immulogic Pharmaceutical Corporation | Uses of myelin oligodendrocyte glycoprotein and peptide portions thereof in protocols related to autoimmune disease |
WO1996028470A2 (en) * | 1995-03-09 | 1996-09-19 | Neurocrine Biosciences, Inc. | Peptide analogues of human myelin basic protein useful in treating multiple sclerosis |
WO1996034622A1 (en) * | 1995-05-02 | 1996-11-07 | Alexion Pharmaceuticals, Inc. | Modified myelin protein molecules |
EP0805162A1 (en) * | 1987-08-17 | 1997-11-05 | The Board Of Trustees Of The Leland Stanford Junior University | Peptide determinant associated with immunity |
-
1999
- 1999-12-29 CN CN99127238A patent/CN1301756A/zh active Pending
-
2000
- 2000-10-25 AU AU21435/01A patent/AU2143501A/en not_active Abandoned
- 2000-12-25 WO PCT/CN2000/000668 patent/WO2001049739A1/zh active Application Filing
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0805162A1 (en) * | 1987-08-17 | 1997-11-05 | The Board Of Trustees Of The Leland Stanford Junior University | Peptide determinant associated with immunity |
WO1992021694A1 (en) * | 1991-06-06 | 1992-12-10 | Baylor College Of Medicine | Molecular diagnosis of autosomal dominant charcot-marie-tooth disease |
WO1995006727A2 (en) * | 1993-09-03 | 1995-03-09 | Immulogic Pharmaceutical Corporation | Uses of myelin oligodendrocyte glycoprotein and peptide portions thereof in protocols related to autoimmune disease |
WO1996028470A2 (en) * | 1995-03-09 | 1996-09-19 | Neurocrine Biosciences, Inc. | Peptide analogues of human myelin basic protein useful in treating multiple sclerosis |
WO1996034622A1 (en) * | 1995-05-02 | 1996-11-07 | Alexion Pharmaceuticals, Inc. | Modified myelin protein molecules |
Also Published As
Publication number | Publication date |
---|---|
CN1301756A (zh) | 2001-07-04 |
AU2143501A (en) | 2001-07-16 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001038523A1 (fr) | Nouveau polypeptide, gene humain 14 lie a la surdite, et polynucleotide codant pour ce polypeptide | |
WO2002051867A1 (fr) | Nouveau facteur 8.8 polypeptidique liberant de la corticotrophine et polynucleotide codant ledit polypeptide | |
WO2002026972A1 (fr) | Nouveau polypeptide, proteine humaine 20.13 de liaison de l'acide polyadenylique, et polynucleotide codant ce polypeptide | |
WO2001090169A1 (fr) | Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide | |
WO2001046440A1 (fr) | Nouveau polypeptide, proteine humaine de lignee neuronale, et polynucleotide codant pour ce polypeptide | |
WO2001083780A1 (fr) | Nouveau polypeptide, methylthioadenosine phosphorylase humaine 37, et polynucleotide codant pour ce polypeptide | |
WO2001049739A1 (fr) | Nouveau polypeptide, la proteine po 14 de la myeline, et polynucleotide le codant | |
WO2002026809A1 (fr) | Nouveau polypeptide, proteine transmembranaire 35.31 possedant un domaine permettant la duplication de facteurs de croissance epidermique, et polynucleotide codant ce polypeptide | |
WO2001075103A1 (fr) | Nouveau polypeptide, proteine humaine 9 de toxine de scorpion a chaine courte, et polynucleotide codant pour ce polypeptide | |
WO2001049734A1 (fr) | Nouveau polypeptide, proteine plp 10, et polynucleotide codant pour ce polypeptide | |
WO2001064733A1 (fr) | Nouveau polypeptide, facteur humain 22 lie a la transcription inverse, et polynucleotide codant pour ce polypeptide | |
WO2002033077A1 (fr) | Nouveau polypeptide, une proteine de regulation 10.01 etant associee au developpement humain et polynucleotide la codant | |
WO2001064727A1 (fr) | Nouveau polypeptide, adenosinate cyclase soluble 25 de souris, et polynucleotide codant pour ce polypeptide | |
WO2001075101A1 (fr) | Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide | |
WO2001072796A1 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 11, et polynucleotide codant pour ce polypeptide | |
WO2001081594A1 (fr) | Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide | |
WO2001079432A2 (en) | A novel polypeptide, a human cell differentiation transcription factor 58 and the polynucleotide encoding the polypeptide | |
WO2001049724A1 (fr) | Nouveau polypeptide, proteine lissencephale humaine 43, et polynucleotide codant pour ce polypeptide | |
WO2001046437A1 (fr) | Nouveau polypeptide, region de liaison d'arn-eucaryote rnp-1-21, et polynucleotide codant pour ce polypeptide | |
WO2001048004A1 (fr) | Nouveau polypeptide, proteine de liaison de l'heparine 10, et polynucleotide codant pour ce polypeptide | |
WO2001055372A1 (fr) | Nouveau polypeptide, proteine humaine tnfr/ngfr 10, et polynucleotide codant pour ce polypeptide | |
WO2001047977A1 (fr) | Nouveau polypeptide, proteine p0 9, et polynucleotide codant pour ce polypeptide | |
WO2001055186A1 (fr) | Nouveau polypeptide, proteine humaine a doigt de zinc 14, et polynucleotide codant pour ce polypeptide | |
WO2001090170A1 (fr) | Nouveau polypeptide, proteine humaine 31 d'adhesion des cellules nerveuses, et polynucleotide codant ce polypeptide | |
WO2002040526A1 (fr) | Nouveau polypeptide, proteine 18.70 exprimee de maniere specifique dans le cerveau chez l'homme, et polynucleotide codant ledit polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |