WO2001047991A1 - Nouveau polypeptide, glycosyl hydrolase 12, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, glycosyl hydrolase 12, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001047991A1
WO2001047991A1 PCT/CN2000/000635 CN0000635W WO0147991A1 WO 2001047991 A1 WO2001047991 A1 WO 2001047991A1 CN 0000635 W CN0000635 W CN 0000635W WO 0147991 A1 WO0147991 A1 WO 0147991A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
glycosyl hydrolase
sequence
seq
Prior art date
Application number
PCT/CN2000/000635
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU19898/01A priority Critical patent/AU1989801A/en
Publication of WO2001047991A1 publication Critical patent/WO2001047991A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01074—Glucan 1,4-beta-glucosidase (3.2.1.74)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405—Glucanases
    • C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, a glycosyl hydrolase 12, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides. Background technique
  • Enzymes such as endoglucanase, cellobiohydrolase, or xylanase are required for microbial degradation of cellulose and xylan. Fungi and bacteria are able to produce a cellulase and xylanase. Based on the sequence commonality and differences of these enzymes, they can be classified into different families, one of which is called the glycosyl hydrolase family 9 ( Or called cellulase family E).
  • the glycosyl hydrolase family 9 is found in many bacteria and fungi, which cause some infectious diseases and is also closely related to some respiratory and intestinal diseases.
  • a reovirus was found in the intestines and respiratory tracts of mammals.
  • the ⁇ protein on its surface contains glycosyl hydrolase activity and contains two amino acid residues, Asp and G lu, belonging to the glycosyl hydrolase family9.
  • This virus can attach to the surface of host cells (respiratory intestinal epithelial cells) and use glycosyl hydrolase to dissolve the mucus layer covering epithelial cells, causing respiratory intestinal infection.
  • glycosyl hydrolase activity is affected by many factors. In most organisms, high carbon source metabolism produces high concentrations of glucose, which inhibits the degradation of glycosyl hydrolase. In addition, some mRNA transcripts can also regulate sugars. Synthesis of aminohydrolase. Since the glycosyl hydrolase 12 protein plays an important role in important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more glycosyl hydrolase 12 proteins involved in these processes. In particular, the amino acid sequence of this protein is identified. The isolation of the new glycosyl hydrolase 12 protein encoding gene also provides a basis for research to determine the role of the protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases. very heavy need. Disclosure of invention
  • An object of the present invention is to provide an isolated novel polypeptide-glycosyl hydrolase 12 and fragments, analogs and derivatives thereof.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a glycosyl hydrolase 12. It is another object of the present invention to provide a genetically engineered host cell containing a polynucleotide encoding a glycosyl hydrolase 12.
  • Another object of the present invention is to provide a method for producing a glycosyl hydrolase 12.
  • Another object of the present invention is to provide an antibody against the polypeptide-glycosyl hydrolase 12 of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the glycosyl hydrolase 12 of the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of glycosyl hydrolase 12.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 237-572 in SEQ ID NO: 1; and (b) a sequence having positions 1-1 in SEQ ID NO: 1 119-bit sequence.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of glycosyl hydrolase 12 protein, which comprises utilizing the polypeptide of the invention.
  • the present invention also relates to a compound obtained by the method.
  • the present invention also relates to a method for in vitro detection of a disease or disease susceptibility associated with abnormal expression of a glycosyl hydrolase 12 protein, which comprises detecting the polypeptide or a polynucleoside encoded therein in a biological sample Mutations in the acid sequence, Alternatively, a large amount of the present invention or biological activity is detected in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of glycosyl hydrolase 12.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with glycosyl hydrolase 12, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to a glycosyl hydrolase 12.
  • Antagonist refers to a sugar that blocks or regulates sugar when combined with glycosyl hydrolase 12.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to glycosyl hydrolase 12.
  • “Regulation” refers to a change in the function of glycosylhydrolase 12, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of glycosylhydrolase 12.
  • substantially pure ' means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify glycosyl hydrolase 12 using standard protein purification techniques. Basically pure The glycosyl hydrolase 12 can generate a single main band on a non-reducing polyacrylamide gel. The purity of the glycosyl hydrolase 12 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of a nucleotide by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other specifically or selectively.
  • Percent identity refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (La sergene sof tware package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, D. G. and P. M. Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by:
  • the percent identity of a nucleic acid sequence can also be determined by the C 1 uster method or by methods known in the art such as J 01 un He in (He in J., (1990) Methods in emzumo logy 183: 625-645). 0
  • Similarity refers to the identity or preservation of amino acid residues at corresponding positions in the alignment of amino acid sequences. The extent of conservative substitution.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be a substitution of a hydrogen atom with a fluorenyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of glycosyl hydrolase 12.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated glycosyl hydrolase 12 means that glycosyl hydrolase 12 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify glycosyl hydrolase 12 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the glycosyl hydrolase 12 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, a glycosyl hydrolase 12, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be obtained from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammals) using recombinant techniques. Cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of glycosyl hydrolase 12.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the glycosylhydrolase 12 of the present invention.
  • a fragment, derivative, or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full nucleotide sequence of 1119 bases, and its open reading frame 237-572 encodes 111 amino acids.
  • This polypeptide has a characteristic sequence of a glycosyl hydrolase, and it can be deduced that the glycosyl hydrolase 12 has the structure and function represented by the glycosyl hydrolase.
  • the polynucleotide of the present invention may be in the form of DNA or RM.
  • DNA forms include d) NA, genomic DNA or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, Mutants and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add a denaturant during hybridization, such as 50% ( ⁇ / ⁇ ) formamide, 0.1Vj, bovine serum / 0.1% Ficol 1, 42, etc .; or (3) only the identity between the two sequences is at least Hybridization occurs at 95% or more, and more preferably 97% or more. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding glycosyl hydrolase 12.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the glycosyl hydrolase 12 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • Various methods have been developed for mRNA extraction, and kits are also commercially available (Q i agene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecluar Cloning, A Labora tory Manual, Coldspring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech Corporation. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the glycosyl hydrolase 12 gene.
  • ELISA enzyme-linked immunosorbent assay
  • a method of applying a PCR technique to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a glycosyl hydrolase 12 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology. .
  • a polynucleotide sequence encoding a glycosyl hydrolase 12 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • DNA sequence containing a glycosyl hydrolase 12 And expression vectors for appropriate transcriptional / translational regulatory elements can be used to construct a DNA sequence containing a glycosyl hydrolase 12 And expression vectors for appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, etal. Molecule Cloning, a Laboraty Manua, Coll Spring Harbor Laborat ory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers from 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a glycosyl hydrolase 12 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DM can be harvested after the exponential growth phase and treated with the ( 12 method, the steps used are well known in the art.
  • MgC 12 If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and lipids. Body packaging, etc.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant glycosyl hydrolase 12 (Science, 1984; 224: 1431). Generally there are the following steps: (1) using the polynucleotide (or variant) encoding human glycosyl hydrolase 12 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • Fig. 1 is a comparison diagram of amino acid sequence homology of 60 amino acids in 2-61 and characteristic domains of glycosyl hydrolase of the present invention.
  • the upper sequence is the glycosyl hydrolase 12, and the lower sequence is the characteristic domain of the glycosyl hydrolase.
  • ⁇ "and”: “and” ⁇ indicate that the probability of different amino acids appearing at the same position between two sequences decreases in sequence.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated glycosyl hydrolase 12. 12kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention
  • Example 1 Cloning of glycosyl hydrolase 12
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • a Smart cDNA cloning kit purchased from Clontech was used to insert the (; 1) ⁇ fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ to form a cDNA library.
  • Dye terminate cycle reaction sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0766F11 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results show that the full-length cDNA contained in the 0766F11 clone is 7 ⁇ ?
  • the sequence of the glycosyl hydrolase 12 of the present invention and the protein sequence encoded by the glycosyl hydrolase 12 of the present invention were analyzed using the profile scan program (Basiclocal Alignment search tool) in GCG [Altschul, SF et a 1. J. Mol. Biol. 1990; 215: 403-10], performing domain analysis in a database such as prosite.
  • the glycosyl hydrolase 12 of the present invention has homology with the characteristic domain of the glycosyl hydrolase from 2-61. The results of the homology are shown in Fig. 1. The homology is 0.19, the score is 10.20 ⁇ , and the threshold is.
  • Example 3 Cloning of a gene encoding glycosyl hydrolase 12 by RT-PCR
  • CDNA was synthesized using fetal brain cell total RNA as a template and oligo-dT as a primer for reverse transcription reaction.
  • PCR amplification was performed with the following primers:
  • Primer 1 -AGACCTGGGAGACTTGGAGGATCC -J (SEQ ID NO: 3)
  • Primer2 5-GCACGGCTGCGAGAAGACG GCT -3 (SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification reaction conditions 50 leg ol / L KC1, 10 mmol / L Tris-CI, (pH8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primers in a 50 ⁇ 1 reaction volume , 1U of Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2rain.
  • RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
  • Amplification products were purified using QIAGEN kits and TA The cloning kit was ligated to a pCR vector (Invitrogen). DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as 1-1119bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of glycosyl hydrolase 12 gene expression:
  • RNA extraction in one step involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • the 32P- labeled probe (approximately 2 X 10 6 cpm / ml) and RNA was transferred to a nitrocellulose membrane overnight at 42 ° C in a hybridization solution, the solution comprising 50% formamide -25mM KH 2 P0 4 (pH7.4) -5 SSC-5 x Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant glycosyl hydrolase 12
  • Primer 3 5'- CCCCATATGATGCTTTTCTTGGGAAGCACAGCC -3 '(Seq ID No: 5)
  • Primer4 5'- CCCGAATTCTTAGGTCTCAACACAGAAAAACAA -3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and EcoRI digestion sites, respectively, followed by the coding sequences of the 5 'and 3' ends of the target gene, respectively.
  • the Ndel and EcoRI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3).
  • the pBS-0766F11 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: 10 pg of pBS-0766F11 plasmid, primer Primer-3 and Primer-4 in a total volume of 50 ⁇ 1, and 1 J was lOpmol, Advantage polymerase Mix (Ciontech) 1 ⁇ 1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into E. coli DH5CC using the calcium chloride method.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is identified whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can also be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in pathological tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Nor thern blotting, and copying methods. They all use the same stepwise hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer so that the non-specific binding site of the sample on the filter is loaded And synthetic polymers.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt)
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • pre-hybridization solution 10xDenhardt's; 6xSSC, 0.1mg / ml CT DNA (calf thymus DNA).
  • the polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • the glycosyl hydrolase family 9 exists in many bacteria and fungi, and it can hydrolyze some polysaccharides, monosaccharides, and glycoproteins, which can cause certain infectious diseases, and is also closely related to some respiratory and intestinal diseases.
  • a reovirus has been found in the intestines and respiratory tracts of mammals.
  • the ⁇ protein on its surface contains glycosyl hydrolase activity and belongs to the glycosyl hydrolase family 9. This virus can attach to the surface of host cells (respiratory intestinal epithelial cells) and use glycosyl hydrolase to dissolve the mucus layer covering epithelial cells, causing respiratory intestinal infection.
  • the 9 active site of the glycosyl hydrolase family mot if, also exists in humans. It is speculated that it is closely related to the glucose metabolism function related to the body, related to glycoprotein function, and may be related to the function of monocyte phagocytic cells.
  • the abnormal expression of the specific glycosyl hydrolase family 9 protein mot if will cause the function of the polypeptide containing the mot if of the present invention to be abnormal, resulting in abnormal glucose metabolism in the body and glycoproteins.
  • Dysfunction and may make mononuclear phagocytes dysfunctional, such as glucose metabolism disorders, organic acidemia, inflammation, immune diseases, tumors, etc.
  • the abnormal expression of the glycosyl hydrolase 12 of the present invention will produce various diseases, especially glucometabolic disorder, organic acidemia, inflammation, immune diseases, and tumors. These diseases include, but are not limited to:
  • Glucose metabolism defects Congenital sugar digestion and absorption defects such as congenital lactose intolerance, hereditary fructose intolerance, monosaccharide metabolism defects such as galactosemia, fructose metabolism defects, glycogen metabolism diseases such as glycogen storage Mucopolysaccharidosis and other marginal diseases: Mucopolysaccharidosis I to VII, Mucopolysaccharidosis marginal diseases such as rheumatoid mucopolysaccharidosis, and mucolipid storage disease
  • Organic acidemia propionic acidemia, methylmalonic aciduria, isovalerate, combined carboxylase deficiency, glutarate type I
  • Inflammation allergic reaction, bronchial asthma, allergic pneumonia, adult respiratory distress syndrome, sarcoidosis, rheumatoid arthritis, rheumatoid arthritis, osteoarthritis, cholecystitis, glomerulonephritis, immune complex Types of glomerulonephritis, acute anterior uveitis, dermatomyositis, urticaria, atopic dermatitis, hemochromatosis, polymyositis, Addison's disease, chronic active hepatitis, emergency bowel syndrome, atrophy Gastritis, systemic lupus erythematosus, myasthenia gravis, cerebrospinal spinal multiple sclerosis, Guillain-Barre syndrome, intracranial granuloma, pancreatitis, myocarditis, and inflammation caused by infections and trauma
  • Immune diseases primary phagocytic deficiency, primary complement system deficiency, primary cell-humoral immunodeficiency disease
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon cancer, thymic tumor, nasal cavity and sinus tumor, nose Pharyngeal cancer, laryngeal cancer, tracheal tumors, fibroids, fibrosarcomas, lipomas, liposarcomas, leiomyomas.
  • Abnormal expression of the glycosyl hydrolase 12 of the present invention will also produce certain hereditary, hematological diseases and the like.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially glucose metabolism disorders, organic acidemia, inflammation, immune diseases, tumors, certain Some hereditary, bloody diseases, etc.
  • the polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides can also be used to treat certain respiratory enterovirus infections.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) glycosyl hydrolase 12.
  • Agonists enhance biological functions such as glycosyl hydrolase 12 to stimulate cell proliferation, and Antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing glycosyl hydrolase 12 can be cultured with labeled glycosyl hydrolase 12 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of glycosyl hydrolase 12 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of glycosyl hydrolase 12 can bind to glycosyl hydrolase 12 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • glycosyl hydrolase 12 When screening compounds that are antagonists, glycosyl hydrolase 12 can be added to a bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between glycosyl hydrolase 12 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to glycosyl hydrolase 12 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, 12 molecules of glycosyl hydrolase are generally labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against a glycosyl hydrolase 12 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting glycosyl hydrolase 12 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies to glycosyl hydrolase 12 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridization Tumor technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Mor r e son e t a l, PNAS, 1985, 81: 6851).
  • the existing technology for producing single-chain antibodies (U.S. Pat No. 4946778) can also be used to produce single-chain antibodies against glycosyl hydrolase 12.
  • Antibodies against glycosyl hydrolase 12 can be used in immunohistochemical techniques to detect glycosyl hydrolase 12 in biopsy specimens.
  • Monoclonal antibodies that bind to glycosyl hydrolase 12 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • glycosyl hydrolase 12 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill the glycosyl hydrolase. Sexual cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to glycosyl hydrolase 12. Administration of an appropriate dose of antibody can stimulate or block the production or activity of glycosyl hydrolase 12.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of glycosyl hydrolase 12 levels.
  • These tests are well known in the art and include FI SH assays and radioimmunoassays.
  • the level of glycosyl hydrolase 12 detected in the test can be used to explain the importance of glycosyl hydrolase 12 in various diseases and to diagnose diseases in which glycosyl hydrolase 12 functions.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding glycosyl hydrolase 12 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of glycosyl hydrolase 12.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated glycosyl hydrolase 12 to inhibit endogenous glycosyl hydrolase 12 activity.
  • a variant glycosyl hydrolase 12 may be a shortened glycosyl hydrolase 12 lacking a signaling domain, and although it can bind to a downstream substrate, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of glycosyl hydrolase 12.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a glycosyl hydrolase 12 into a cell.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a glycosyl hydrolase 12 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding glycosyl hydrolase 12 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit glycosylhydrolase 12 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DM sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds. Polynucleotides encoding glycosyl hydrolase 12 are useful in the diagnosis of diseases related to glycosyl hydrolase 12.
  • the polynucleotide encoding glycosyl hydrolase 12 can be used to detect the expression of glycosyl hydrolase 12 or the abnormal expression of glycosyl hydrolase 12 in a disease state.
  • the DM sequence encoding glycosyl hydrolase 12 can be used to hybridize biopsy specimens to determine the expression of glycosyl hydrolase 12.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Transcripts of glycosyl hydrolase 12 can also be detected by RNA-polymerase chain reaction (RT-PCR) in vitro amplification using glycosyl hydrolase 12 specific primers.
  • RT-PCR RNA-
  • glycosyl hydrolase 12 gene can also be used to diagnose glycosyl hydrolase 12-related diseases.
  • the glycosyl hydrolase 12 mutant forms include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type glycosyl hydrolase 12 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization (FI SH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FI SH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckus i ck, Mende li aii Inher it ance in Man (available online with Johns Hopk ins Un i ver sity We lch Med i ca l L i brary). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Glycosyl hydrolase 12 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of glycosylhydrolase 12 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une glycosyl hydrolase 12, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la glycosyl hydrolase 12.
PCT/CN2000/000635 1999-12-24 2000-12-18 Nouveau polypeptide, glycosyl hydrolase 12, et polynucleotide codant pour ce polypeptide WO2001047991A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU19898/01A AU1989801A (en) 1999-12-24 2000-12-18 A novel polypeptide-glycosyl hydrolase and the polynucleotide encoding the same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN99125774.X 1999-12-24
CN 99125774 CN1301836A (zh) 1999-12-24 1999-12-24 一种新的多肽——糖基水解酶12和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001047991A1 true WO2001047991A1 (fr) 2001-07-05

Family

ID=5284184

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000635 WO2001047991A1 (fr) 1999-12-24 2000-12-18 Nouveau polypeptide, glycosyl hydrolase 12, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1301836A (fr)
AU (1) AU1989801A (fr)
WO (1) WO2001047991A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998015617A2 (fr) * 1996-10-07 1998-04-16 Laboratoires Goemar S.A. Genes de carraghenases et leur utilisation pour la production d'enzymes de biodegradation des carraghenanes

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998015617A2 (fr) * 1996-10-07 1998-04-16 Laboratoires Goemar S.A. Genes de carraghenases et leur utilisation pour la production d'enzymes de biodegradation des carraghenanes

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
PROG. BIOCHEM. BIOPHYS. (IN CHINESE), vol. 26, no. 3, 1999, pages 233 - 237 *

Also Published As

Publication number Publication date
AU1989801A (en) 2001-07-09
CN1301836A (zh) 2001-07-04

Similar Documents

Publication Publication Date Title
WO2002026972A1 (fr) Nouveau polypeptide, proteine humaine 20.13 de liaison de l'acide polyadenylique, et polynucleotide codant ce polypeptide
WO2001090169A1 (fr) Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide
WO2001047968A1 (fr) Nouveau polypeptide, hexokinase 12, et polynucleotide codant pour ce polypeptide
WO2001083780A1 (fr) Nouveau polypeptide, methylthioadenosine phosphorylase humaine 37, et polynucleotide codant pour ce polypeptide
WO2001047991A1 (fr) Nouveau polypeptide, glycosyl hydrolase 12, et polynucleotide codant pour ce polypeptide
WO2001085903A2 (fr) Nouveau polypeptide, proteine humaine 9 contenant un fragment de sequence particulier de p5cr, et polynucleotide codant pour ce polypeptide
WO2001046240A1 (fr) Nouveau polypeptide, mariner transposase 19 humaine, et polynucleotide codant pour ce polypeptide
WO2001048159A1 (fr) Nouveau polypeptide, dihydroorotase 9, et polynucleotide codant pour ce polypeptide
WO2001049733A1 (fr) Nouveau polypeptide, glycosyl hydrolase 12, et polynucleotide codant pour ce polypeptide
WO2001055412A1 (fr) Nouveau polypeptide, phosphoenolpyruvate carboxylase 81, et polynucleotide codant pour ce polypeptide
WO2001072790A1 (fr) Nouveau polypeptide, proteine humaine p40 12 de facteur l1, et polynucleotide codant pour ce polypeptide
WO2001087953A1 (fr) Nouveau polypeptide, galactokinase humaine 11, et polynucleotide codant ce polypeptide
WO2001048173A1 (fr) Nouveau polypeptide, aminoacyl-arnt synthetase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001081385A1 (fr) Nouveau polypeptide, nucleotide reductase humaine 9, et polynucleotide codant pour ce polypeptide
WO2001081389A1 (fr) Nouveau polypeptide, proteine humaine 9 contenant un fragment de sequence particulier d'une proteine ribosomale l19, et polynucleotide codant pour ce polypeptide
WO2001081381A1 (fr) Nouveau polypeptide, proteine humaine 9 contenant un fragment de sequence particulier d'une recombinase specifique au site, et polynucleotide codant pour ce polypeptide
WO2001064726A1 (fr) Nouveau polypeptide, formamido-pyrimidine-adn-gylcosylase 37, et polynucleotide codant pour ce polypeptide
WO2002012323A1 (fr) Nouveau polypeptide, proteine secretrice 11 de la famille des hlyd, et polynucleotide codant ce polypeptide
WO2001047994A1 (fr) Nouveau polypeptide, proteine 10 utilisant pep, et polynucleotide codant pour ce polypeptide
WO2001081593A1 (fr) Nouveau polypeptide, proteine humaine 20 contenant un domaine a structure de boite de paires appariees, et polynucleotide codant pour ce polypeptide
WO2001049723A1 (fr) Nouveau polypeptide, atp synthetase 9, et polynucleotide codant pour ce polypeptide
WO2001074885A1 (fr) Nouveau polypeptide, spase i humaine 8, et polynucleotide codant pour ce polypeptide
WO2002000830A2 (fr) Nouveau polypeptide, sucre phosphotransferase phosphoenolpyruvate-dependante 12, et polynucleotide codant ce polypeptide
WO2001074996A2 (fr) Nouveau polypeptide, c. elegans 52 humain, et polynucléotide codant pour ce polypeptide
WO2001085776A1 (fr) Polypeptide humain dihydro-orotase 12 et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP