WO2001046234A1 - Nouveau polypeptide, proteine 9 de la famille des deshydrogenases d'acide 2-hydroxy nad-dependante, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine 9 de la famille des deshydrogenases d'acide 2-hydroxy nad-dependante, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001046234A1
WO2001046234A1 PCT/CN2000/000566 CN0000566W WO0146234A1 WO 2001046234 A1 WO2001046234 A1 WO 2001046234A1 CN 0000566 W CN0000566 W CN 0000566W WO 0146234 A1 WO0146234 A1 WO 0146234A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
dependent
nad
family protein
Prior art date
Application number
PCT/CN2000/000566
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Fudan University
Shanghai Bio Door Gene Technology Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fudan University, Shanghai Bio Door Gene Technology Ltd. filed Critical Fudan University
Priority to AU19839/01A priority Critical patent/AU1983901A/en
Publication of WO2001046234A1 publication Critical patent/WO2001046234A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide ⁇ AD-dependent 2-hydroxyacid dehydrogenase family protein 9, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides.
  • D-glycerate dehydrogenase NADH-dependent hydroxypyruvate reductase
  • NADH-dependent hydroxypyruvate reductase an enzyme that catalyzes the reduction of hydroxypyruvate to glycerate-specific plant leaf peroxisomes. This reaction is part of the glycolate pathway of photorespiration.
  • Erythronate-4 phosphate dehydrogenase (gene pdxB), a bacterial enzyme involved in the biosynthesis of pyridoxine (vitamin B6).
  • D-hicDH D-2 -Hydroxyisohexanal
  • FDH Formate dehydrogenase
  • Vancomycin resistance protein from Enterococcus faecium is a D-specific ⁇ - that participates in the formation of peptidoglycans that are not terminated by D-alanine and prevents vancomycin binding Keto acid dehydrogenase.
  • NAD + dependent dehydrogenases An important factor catalyzed by all NAD + dependent dehydrogenases is the enhancement of the C4N electrophilicity of the coenzyme nicotinamide moiety. This can be achieved by With negative charge
  • the NAD + carbamoyl group interacts with the carbamoyl group because it twists the plane of the pyridine and interferes with the polarization of the NAD + carbamoyl group.
  • NAD + -dependent dehydrogenases the carbamoyl group of the coenzyme is very far from the plane. universal.
  • the family members all have the same enzyme activity and are structurally related.
  • the other two templates are located in the catalytic domain and contain some conserved charged residues, some of which may play a role in the catalytic mechanism.
  • coli D-lactate dehydrogenase (did gene), which is a membrane-bound FDA flavinase.
  • the former sequence consists of a conserved catalytic domain of histidine / carboxylation / arginine, close to the active site of apoenzyme of the family member, and is located near the complete form of the nicotinamide ring.
  • the aspartate-histidine in the latter sequence forms a conserved catalytic pair.
  • NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 protein plays an important role in important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more involved in these Processes the NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 protein, specifically identifying the amino acid sequence of this protein. Isolation of the new MD-dependent 2-hydroxyacid dehydrogenase family protein 9 protein encoding gene also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is important.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a NAD-dependent 2-hydroxyacid dehydrogenase family protein 9.
  • Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a NAD-dependent 2-hydroxyacid dehydrogenase family protein 9.
  • Another object of the present invention is to provide a method for producing NAD-dependent 2-hydroxyacid dehydrogenase family protein 9.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, NAD-dependent 2-hydroxyacid dehydrogenase family protein 9.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, NAD-dependent 2-hydroxyacid dehydrogenase family protein 9.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of NAD-dependent 2-hydroxyacid dehydrogenase family protein 9.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 426-665 in SEQ ID NO: 1; and (b) a sequence having positions 1-1 in SEQ ID NO: 1 562-bit sequence.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 protein activity, which comprises utilizing a polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to an in vitro detection of a protein other than NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 protein.
  • a method that often expresses a related disease or disease susceptibility including detecting a mutation in the polypeptide or a coding polynucleotide sequence thereof in a biological sample, or detecting the amount or biological activity of the polypeptide of the present invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the polypeptides and / or polynucleotides of the present invention prepared for the treatment of cancer, developmental or immune diseases or other diseases caused by abnormal expression of NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 Use of drugs.
  • Figure 1 is the amino acid sequence homology of the characteristic sequence of the MD-dependent 2-hydroxyacid dehydrogenase family protein 73 of the NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 at 7-79 in the present invention Comparison chart.
  • the upper sequence is the NAD-dependent 2-hydroxyacid dehydrogenase family protein 9, and the lower sequence is the characteristic sequence domain of the NAD-dependent 2-hydroxyacid dehydrogenase family.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated NAD-dependent 2-hydroxyacid dehydrogenase family protein 9.
  • 9KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with D-dependent 2-hydroxyacid dehydrogenase family protein 9, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to a NAD-dependent 2-hydroxyacid dehydrogenase family protein 9.
  • Antagonist refers to a NAD-dependent 2-hydroxyacid dehydrogenase family protein 9, which binds or regulates NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 A biologically or immunologically active molecule.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to NAD-dependent 2-hydroxyacid dehydrogenase family protein 9.
  • Regular refers to changes in the function of NAD-dependent 2-hydroxyacid dehydrogenase family protein 9, including increased or decreased protein activity, changes in binding characteristics, and the NAD-dependent 2-hydroxyacid dehydrogenase family Changes in any other biological, functional or immune properties of protein 9.
  • substantially pure means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated.
  • Those skilled in the art can purify NAD-dependent 2-hydroxyacid dehydrogenase family proteins 9 using standard protein purification techniques.
  • the substantially pure NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 peptides can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T
  • the complementarity between two single-stranded molecules can be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. Inhibition of such hybridization can be detected by performing hybridization (Southern or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not imply that conditions with reduced stringency allow Non-specific binding is possible because conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad Son Wis.). 0 The MEGALIGN program can compare two or more sequences according to different methods, such as the Cluster method. (Hi gg ins, DG and PM Sha rp (1988)
  • the C l uster method arranges each group of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by:
  • the number of residues that match between the sequence and the sequence ⁇ The number of residues in the moving sequence ⁇ -the number of spacer residues in the sequence-the number of spacer residues X in the sequence S can also be determined by the C lus ter method or by using well-known in the art Methods such as Jo tun He in determine the percent identity between nucleic acid sequences (He in J., (1990) Methods in enzymol ogy 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • the "antisense strand” refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? It specifically binds to the NAD-dependent epitope of 2-hydroxyacid dehydrogenase family protein 9.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not its natural environment The ingredients, they are still separated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 refers to MD-dependent 2-hydroxyacid dehydrogenase family protein 9 which is substantially free of other proteins, lipids naturally associated with it. Class, sugar or other substance.
  • Those skilled in the art can purify NAD-dependent 2-hydroxyacid dehydrogenase family proteins 9 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, NAD-dependent 2-hydroxyacid dehydrogenase family protein 9, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
  • polypeptide of the invention may be glycosylated, or it may be non-glycosylated.
  • the polypeptides of the invention may also include or exclude the initial methionine residue.
  • the invention also includes fragments, derivatives and analogs of NAD-dependent 2-hydroxyacid dehydrogenase family protein 9.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the MD-dependent 2-hydroxyacid dehydrogenase family protein 9 of the present invention .
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by the genetic code; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. Multi-core The full-length nucleotide sequence is 1562 bases, and its open reading frame 426-665 encodes 79 amino acids.
  • This polypeptide has the characteristic sequence of the MD-dependent 2-hydroxyacid dehydrogenase family, and it can be deduced that the NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 has the NAD-dependent 2-hydroxyacid dehydrogenase family Structure and function represented by feature sequence.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) only between the two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores Glycylic acid or more.
  • Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding NAD-dependent 2-hydroxyacid dehydrogenase family protein 9.
  • the polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • polynucleotide sequence encoding the NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • mRNA extraction There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 The level of transcripts; (4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA )Wait.
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA )Wait.
  • a method for amplifying DNA / RNA using PCR technology is preferably used to obtain the gene of the present invention. Especially difficult to get from the library
  • the RACE method RACE-rapid cDNA end rapid amplification method
  • the primers used for PCR can be appropriately selected according to the polynucleotide sequence information of the present invention disclosed herein, and conventional methods can be used synthesis.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using the NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 coding sequence, and recombinant Technology A method of producing a polypeptide of the invention.
  • a polynucleotide sequence encoding a NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct recombinant expression vectors.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant technology (Sambroook, et al. Molecular Cloning , a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989) the DNA sequence may be 0 operably linked to expression An appropriate promoter in the vector to direct mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression. There are usually about 10 to 300 base pairs that act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reduction, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reduction, neomycin resistance, and green for eukaryotic cell culture.
  • Fluorescent protein (GFP) or tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute the polynucleotide or the recombinant vector.
  • Genetically engineered host cells refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • polynucleotide sequence of the present invention can be used to express or produce recombinant MD-dependent 2-hydroxyacid dehydrogenase family protein 9 (Scence, 1984; 224: 1431). Generally speaking, there are the following steps:
  • a polynucleotide encoding human NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 of the present invention is used
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. When the host cell has grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and The cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can be used to treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immunological diseases.
  • the abnormal expression of the NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 of the present invention will produce various diseases, especially metabolic disorders related to energy and material metabolism, and disorders of growth and development. These diseases including but not limited to:
  • Organic acidemia isovalerate, propionate, methylmalonic aciduria, combined carboxylase deficiency, glutarate type I
  • Amino acid metabolism defects phenylketonuria, albinism, sulfur amino acid metabolism defects, tryptophanemia, branch amino acid metabolism defects, glycineemia, hypersarcosinemia, proline and hydroxyproline Metabolism deficiency disease, Glutamate metabolism deficiency disease, Metabolism deficiency disease of urea cycle, Histidine metabolism deficiency disease, Lysine metabolism deficiency disease
  • Mucopolysaccharidosis and other marginal diseases Mucopolysaccharidosis type I-VII, Mucopolysaccharidosis marginal diseases such as rheumatoid mucopolysaccharidosis, mucolipid storage disease
  • Purine and Pyrimidine Metabolism Defects Abnormal purine metabolism such as Ray-niney syndrome, xanthineuria, pyrimidine metabolic abnormalities such as orotic aciduria, adenine deaminase deficiency
  • Abnormal lipid metabolism hyperlipoproteinemia, familial hyper- ⁇ -lipoproteinemia, familial non- ⁇ -lipoproteinemia, familial hypo-p-lipoproteinemia, familial lecithin-cholesterol acetyltransferase
  • Glucose metabolism defects Congenital sugar digestion and absorption defects such as congenital lactose intolerance, hereditary fructose intolerance, monosaccharide metabolism defects such as galactosemia, fructose metabolism defects, glycogen metabolism diseases such as glycogen storage Backlog
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, familial cerebral nucleus dysplasia, skin, fat, and muscular dysplasia such as congenital skin relaxation, premature senile, congenital horn Poor metabolism, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
  • Embryonic disorders congenital abortion, cleft palate, limb absentness, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney, ectopic kidney, double ureter, cryptorchidism, congenital inguinal hernia, double uterus, vagina Atresia, hypospadias, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, open ductus arteriosus, neural tube defects, congenital hydrocephalus, iris defect, congenital cataract, congenital glaucoma or cataract, congenital Deaf
  • Abnormal expression of the NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 of the present invention will also generate certain tumors, certain hereditary, hematological diseases, and immune system diseases.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially metabolic disorders related to energy and material metabolism, disorders of growth and development, innate sexual malformations, certain tumors, certain hereditary, hematological and immune system diseases, etc.
  • the invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) NAD-dependent 2-hydroxyacid dehydrogenase family protein 9.
  • Agonists increase NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 can be combined with labeled NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 in the presence of drugs. to cultivate. The ability of the drug to increase or block this interaction is then determined.
  • NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 antagonists include antibodies, compounds, receptor deletions, and the like that have been screened.
  • NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 antagonists can bind to NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 and eliminate its function, or inhibit the production of the polypeptide, or The active site binding of the polypeptide prevents the polypeptide from performing a biological function.
  • NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 can be added to the bioanalytical assay. The effect of their receptor interactions to determine whether a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • the dependent 2-hydroxyacid dehydrogenase family protein 9-binding polypeptide molecule can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the present invention also provides antibodies against NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response. Including but not limited to Freund's adjuvant and the like.
  • Techniques for preparing NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 monoclonal antibodies include, but are not limited to, hybridoma technology (Kohler and Milstein n. Nature, 1975, 256: 495-497), three Tumor technology, human B-cell hybridoma technology, EBV-hybridoma technology, etc.
  • a chimeric antibody that binds a human constant region to a non-human variable region can be produced using existing techniques (Morrie et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against NAD-dependent 2-hydroxyacid dehydrogenase family protein 9.
  • Antibodies against NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 can be used in immunohistochemical techniques to detect NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 in biopsy specimens.
  • Monoclonal antibodies that bind to MD-dependent 2-hydroxyacid dehydrogenase family protein 9 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • NAD_dependent 2-hydroxyacid dehydrogenase family protein 9 High-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill NAD-dependent 2-hydroxyacid removal.
  • Catalase 9 protein positive cells are examples of proteins that kill NAD-dependent 2-hydroxyacid removal.
  • the antibodies of the present invention can be used to treat or prevent diseases related to NAD-dependent 2-hydroxyacid dehydrogenase family protein 9.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of NAD-dependent 2-hydroxyacid dehydrogenase family protein 9.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 levels.
  • tests are well known in the art and include FI SH assays and radioimmunoassays.
  • NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 levels detected in the test can be used as Explain the importance of NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 in various diseases and use it to diagnose diseases in which NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 functions.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of NAD-dependent 2-hydroxyacid dehydrogenase family protein 9.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 to inhibit endogenous NAD-dependent 2-hydroxyacid dehydrogenase family Protein 9 activity.
  • a variant NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 may be a shortened, NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 that lacks a signaling domain.
  • the downstream substrate binds but lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of NAD-dependent 2-hydroxyacid dehydrogenase family protein 9.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 to in the cell.
  • a recombinant viral vector carrying a polynucleotide encoding MD-dependent 2-hydroxyacid dehydrogenase family protein 9 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • Polynucleotides encoding NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 can be used to interact with NAD-dependent Diagnosis of 2-hydroxyacid Dehydrogenase Family Protein 9-related Diseases
  • a polynucleotide encoding a NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 can be used to detect the expression of NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 or NAD-dependent 2 in a disease state -Aberrant Expression of Hydroxy Acid Dehydrogenase Family Protein 9.
  • a DNA sequence encoding NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 can be used to hybridize biopsy specimens to determine the expression status of NAD-dependent 2-hydroxyacid dehydrogenase family protein 9.
  • Hybridization techniques include Sou thern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 specific primers for RM-polymerase chain reaction (RT-PCR) in vitro amplification can also detect NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 Transcription products.
  • NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 gene can also be used to diagnose NAD-dependent 2-hydroxyacid dehydrogenase family protein 9-related diseases.
  • NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 mutant forms include point mutations, translocations, deletions, recombination compared to normal wild-type NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 DNA sequences And any other exceptions. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, the mutation may affect the expression of the protein, so the Nort Hern blotting and Western blotting can be used to indirectly determine whether there is a mutation in the gene.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • a PCR primer (preferably 15-35 bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization (FI SH) of cDNA clones with metaphase chromosomes can be refined in one step Perform chromosomal mapping accurately.
  • FI SH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government regulatory agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts the government regulatory agency that manufactures, uses, or sells them to permit their administration on the human body.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using the Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragments into the multicloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ . The bacteria formed a cDNA library.
  • Dye terminate cycle reaction sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
  • the 0055f05 clone contained a full-length cDNA of 1562bp (as shown in Seq IDN0: 1), and a 240bp open reading frame (0RF) from 426bp to 665bp, encoding a new protein (such as Seq ID NO: 2).
  • This clone pBS-0055f 05 and encoded the protein as NAD-dependent 2-hydroxyacid dehydrogenase family protein 9.
  • the sequence of the NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 of the present invention and the protein sequence encoded by the protein were subjected to a profile scan program (Basic local alignment search tool) in GCG [Altschul, SF et al. J Mol. Biol. 1990; 215: 403-10], domain analysis was performed in databases such as Prote.
  • the NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 of the present invention is homologous with the characteristic sequence of the domain NAD-dependent 2-hydroxyacid dehydrogenase family at 7-79. The results of the homology are shown in FIG. 1, The homology rate is 0.14, and the score is 8.69; the threshold is 8.51.
  • Example 3 Cloning of a gene encoding NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
  • Primer2 5'- ATATCAGTATTTATTATCTTTTCA -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification conditions 50ramol / L KC1, 10mmol / L Tris- HC1, pH8.5, 1.5mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primer, 1U in 50 ⁇ 1 reaction volume Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min 0 ⁇ -act in was set as positive at RT-PCR Controls and template blanks are negative controls.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen). DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of l-1562bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 gene expression
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA was synthesized by electrophoresis on a 1.2% agarose gel containing 20raM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-ImM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane.
  • the DNA probe used was the NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 coding region sequence (426bp to 665bp) amplified by PCR as shown in FIG.
  • a 32P-labeled probe (about 2 x 10 6 cpra / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4)-5 X SSC-5 X Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filters were placed in 1 X SSC-0.1% SDS at 55. C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant NAD-dependent 2-hydroxyacid dehydrogenase family protein 9
  • Primer3 5'- CCCCATATGATGGGGGTGGTAATCTCTTTGTTTTTT -3 '(Seq ID No: 5)
  • Primer4 5'- CATGGATCCTTAGAATATGAATATCAACTTTGAA -3' (Seq ID No: 6)
  • These two primers contain Ndel and BamHI restriction sites, respectively.
  • the coding sequences of the 5 'and 3' ends of the target gene are followed respectively, and the Ndel and BamHI restriction sites correspond to the expression vector plasmid pET- Selective endonuclease site on 28b (+) (Novagen, Cat. No. 69865.3).
  • the PCR reaction was performed using the pBS-0055f05 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: 10 pg of pBS-0055f05 plasmid was contained in a total volume of 50 ⁇ 1, and primers Primer-3 and Primer-4 were lOpmol and Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligated product was transformed into E. coli DH5cc using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), the positive clones were screened by colony PCR method and sequenced. Correct positive clone (PET-0055f05) The recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
  • a peptide synthesizer (product of PE) was used to synthesize the following NAD-dependent 2-hydroxyacid dehydrogenase family protein 9 specific peptides:
  • NH-Met-Gly-Val-Val-Ile-Ser-Leu-Phe-Tyr-Leu-Val-Gly-Phe-Pro-Asp-COOH SEQ ID NO: 7
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin for methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polymorphic complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Total Ig G was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepha rOS e4B column, and the anti-peptide antibody was separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method demonstrated that the purified antibody could specifically bind to NAD-dependent 2-hydroxyacid dehydrogenase family protein 9.
  • Example 7 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • oligonucleotide fragments from the polynucleotides of the present invention for use as hybridization probes. Uses: if the probe can be used to hybridize to the genomic or cDNA library of normal tissue or pathological tissue from different sources to identify whether it contains the polynucleotide sequence of the present invention and detect a homologous polynucleotide sequence, it can further be used The probe detects whether the polynucleotide sequence of the present invention or a homologous polynucleotide sequence thereof is abnormally expressed in cells of normal tissue or pathological tissue.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • GC content is 30% -70%, if it exceeds, non-specific hybridization will increase
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt) 5'- CAGGTTTGGAATCTTAATATCCAACCCCCAACTCCAAGCCC -3 '(SEQ ID NO: 8)
  • Probe 1 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe for subsequent experiments.
  • the film is washed with high-strength conditions and strength conditions, respectively.
  • the sample membrane was placed in a plastic bag, and 3-10 mg of pre-hybridization solution (10xDenhardf s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After the bag was sealed, the bag was shaken at 68 ° C for 2 hours.
  • pre-hybridization solution 10xDenhardf s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)
  • Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; finding and screening for tissue specificity New genes, especially those related to diseases such as tumors; Diagnosis of diseases, such as hereditary diseases. The specific method steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500 ng / ul after purification.
  • the Cartesian 7500 spotter (purchased from Cartesian, USA) was spotted on the glass medium, and the distance between the dots It was 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips.
  • the specific method steps have been reported in the literature.
  • the sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from normal liver and liver cancer in one step, and mRNA was purified with Oligotex mRNAMidi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP (5- Amino- propargy 1-2 '-deoxyuri dine 5 '-triphate coupled to Cy3 fluorescent dye, purchased from Amershara Phamacia Biotech company) labeled mRNA of normal liver tissue, using a fluorescent reagent Cy5dUTP (5-Amino-propargy 1-2--deoxyuri dine 5--triphate coupled to Cy5 fluorescent dye, (Purchased from Amersham Phamacia Biotech) was used to label liver cancer tissue mRNA, and the probe was prepared after purification.
  • Cy3dUTP 5- Amino- propargy 1-2 '-deoxyuri dine 5 '-triphate coupled to Cy3 fluorescent dye, purchased from Amershara Phamacia Biotech company
  • Cy5dUTP 5-Amin
  • the probes from the above two tissues and the chips were respectively hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and the washing solution (1 ⁇ SSC, 0.2% SDS) After washing, scan with a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned images are analyzed by Imagene software (Biodiscovery, USA), and the Cy3 / Cy5 ratio of each point is calculated. The points whose ratio is less than 0.5 and greater than 2 are considered to be genes with differential expression.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine 9 de la famille des déshydrogénases d'acide 2-hydroxy NAD-dépendante, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine 9 de la famille des déshydrogénases d'acide 2-hydroxy NAD-dépendante.
PCT/CN2000/000566 1999-12-21 2000-12-11 Nouveau polypeptide, proteine 9 de la famille des deshydrogenases d'acide 2-hydroxy nad-dependante, et polynucleotide codant pour ce polypeptide WO2001046234A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU19839/01A AU1983901A (en) 1999-12-21 2000-12-11 A novel polypeptide - nad-dependent 2-hydroxy acid dehydrogenase family protein 9 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN99124289.0 1999-12-21
CN 99124289 CN1300737A (zh) 1999-12-21 1999-12-21 一种新的多肽－nad－依赖的2－羟酸脱氢家族蛋白9和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001046234A1 true WO2001046234A1 (fr) 2001-06-28

Family

ID=5283373

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000566 WO2001046234A1 (fr) 1999-12-21 2000-12-11 Nouveau polypeptide, proteine 9 de la famille des deshydrogenases d'acide 2-hydroxy nad-dependante, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1300737A (fr)
AU (1) AU1983901A (fr)
WO (1) WO2001046234A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105907732A (zh) * 2016-01-27 2016-08-31 上海交通大学 一种d-乳酸脱氢酶、含有该酶的工程菌株及其构建和应用

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5883240A (en) * 1995-08-24 1999-03-16 Baker Medical Research Institute Genetic sequences encoding glucocorticoid dehydrogenases and uses therefor
US5965372A (en) * 1995-08-24 1999-10-12 Baker Medical Research Institute Genetic sequences encoding glucocorticoid dehydrogenases and uses thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5883240A (en) * 1995-08-24 1999-03-16 Baker Medical Research Institute Genetic sequences encoding glucocorticoid dehydrogenases and uses therefor
US5965372A (en) * 1995-08-24 1999-10-12 Baker Medical Research Institute Genetic sequences encoding glucocorticoid dehydrogenases and uses thereof

Also Published As

Publication number Publication date
AU1983901A (en) 2001-07-03
CN1300737A (zh) 2001-06-27

Similar Documents

Publication Publication Date Title
WO2001090169A1 (fr) Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide
WO2001046234A1 (fr) Nouveau polypeptide, proteine 9 de la famille des deshydrogenases d'acide 2-hydroxy nad-dependante, et polynucleotide codant pour ce polypeptide
WO2001048168A1 (fr) Nouveau polypeptide, gamma1-pyroline-5-hydroxy reductase 14, et polynucleotide codant pour ce polypeptide
WO2001085922A1 (fr) Nouveau polypeptide, proteine humaine de la famille des 2-hydroxyacide deshydrogenases nad-dependantes 16, et polynucleotide codant pour ce polypeptide
WO2001094406A1 (fr) Nouveau polypeptide, dihydropyridine-acide dicarboxylique deshydrogenase 21, et polynucleotide codant ce polypeptide
WO2001055404A1 (fr) Nouveau polypeptide, alcool deshydrogenase humaine 39, et polynucleotide codant pour ce polypeptide
WO2001073044A1 (fr) Nouveau polypeptide, 2-hydroxy acide deshydrogenase humaine 8, et polynucleotide codant pour ce polypeptide
WO2001072981A1 (fr) Nouveau polypeptide, proteine humaine 11 de la famille des 2-hydroxyacide deshydrogenases nad-dependante, et polynucleotide codant pour ce polypeptide
WO2001046432A1 (fr) Nouveau polypeptide, 2-hydroxy deshydrogenase 9, et polynucleotide codant pour ce polypeptide
WO2001072982A1 (fr) Nouveau polypeptide, proteine humaine 13 de la famille des 2-hydroxyacide deshydrogenases nad-dependante, et polynucleotide codant pour ce polypeptide
WO2002012510A1 (fr) Nouveau polypeptide, proteine 11 de la famille de la 2-hydroxy deshydrogenase nad-dependante, et polynucleotide codant ce polypeptide
WO2001055190A1 (fr) Nouveau polypeptide, 2-hydroxy deshydrogenase 30 a d-isomeres specifiques, et polynucleotide codant pour ce polypeptide
WO2001098488A1 (fr) Nouveau polypeptide, sous-unite 24 de flavoproteine humaine, et polynucleotide codant ce polypeptide
WO2001053492A1 (fr) Nouveau polypeptide, s-adenosylmethionine synthetase 31, et polynucleotide codant pour ce polypeptide
WO2001046433A1 (fr) Nouveau polypeptide, aldehyde/cetone reductase 9, et polynucleotide codant pour ce polypeptide
WO2002032950A1 (fr) Nouveau polypeptide, proteine 26.29 de la famille de la 2-hydroxy deshydrogenase nad-dependante, et polynucleotide codant ce polypeptide
WO2001047980A1 (fr) Nouveau polypeptide, dihydrodipicolinate synthase 9, et polynucleotide codant pour ce polypeptide
WO2001048165A1 (fr) Nouveau polypeptide, aldehyde/cetone reductase 9, et polynucleotide codant pour ce polypeptide
WO2001047995A1 (fr) Nouveau polypeptide, dioxygenase humaine 13, et polynucleotide codant pour ce polypeptide
WO2001046424A1 (fr) Nouveau polypeptide, deshydrogenase nadh 12, et polynucleotide codant pour ce polypeptide
WO2001046429A1 (fr) Nouveau polypeptide, deshydrogenase a chaine respiratoire 10 nadh, et polynucleotide codant pour ce polypeptide
WO2001094592A1 (fr) Nouveau polypeptide, aldehyde/cetone reductase humaine 10.1, et polynucleotide codant ce polypeptide
WO2001046246A1 (fr) Nouveau polypeptide, deshydrogenase/reductase a chaine courte 12, et polynucleotide codant pour ce polypeptide
WO2001049863A1 (fr) Nouveau polypeptide, ribulose bisphosphate carboxylase humaine 11, et polynucleotide codant pour ce polypeptide
WO2001048008A1 (fr) Nouveau polypeptide, ribulose-bisphophate carboxylase (rubisco) 13, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP