WO2001055190A1 - Nouveau polypeptide, 2-hydroxy deshydrogenase 30 a d-isomeres specifiques, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, 2-hydroxy deshydrogenase 30 a d-isomeres specifiques, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001055190A1
WO2001055190A1 PCT/CN2001/000072 CN0100072W WO0155190A1 WO 2001055190 A1 WO2001055190 A1 WO 2001055190A1 CN 0100072 W CN0100072 W CN 0100072W WO 0155190 A1 WO0155190 A1 WO 0155190A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
specific
isomer
hydroxyacid dehydrogenase
Prior art date
Application number
PCT/CN2001/000072
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biodoor Gene Technology Ltd. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biodoor Gene Technology Ltd. Shanghai filed Critical Biodoor Gene Technology Ltd. Shanghai
Priority to AU2001231486A priority Critical patent/AU2001231486A1/en
Publication of WO2001055190A1 publication Critical patent/WO2001055190A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a D-isomer-specific 2-hydroxyacid dehydrogenase 30, and a polynucleotide sequence encoding the polypeptide. . The invention also relates to methods and applications for preparing such polynucleotides and polypeptides. Background technique
  • NAD-dependent 2-hydroxyacid dehydrogenases that show specificity for the D-isomers of their substrates. They catalyze some important metabolic steps, both in function and structure. Related and classified as a family.
  • the family members all have the same enzyme activity and are structurally related.
  • the other two templates are located in the catalytic domain and contain some conserved charged residues, some of which may play a role in the catalytic mechanism.
  • the former sequence consists of a conserved catalytic domain of histidine / carboxylation / arginine, close to the active site of the apoenzyme of the family member, and is located near the complete form of the nicotinamide ring.
  • the aspartate-histidine in the latter sequence forms a conserved catalytic pair.
  • D-isomer-specific 2-hydroxyacid dehydrogenase 30 protein plays an important role in important functions in the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art Identification of more D-isomer-specific 2-hydroxyacid dehydrogenase 30 proteins involved in these processes, especially the amino acid sequence of this protein. Isolation of the new D-isomer-specific 2-hydroxyacid dehydrogenase 30 protein encoding gene also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for the disease, so isolation of its coding DNA is very important. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a D-isomer-specific 2-hydroxyacid dehydrogenase 30.
  • Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a D-isomer-specific 2-hydroxyacid dehydrogenase 30.
  • Another object of the present invention is to provide a method for producing D-isomer-specific 2-hydroxyacid dehydrogenase 30.
  • Another object of the present invention is to provide an antibody against 2-hydroxy acid dehydrogenase 30 specific to the D-isomer of the polypeptide of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors of 2-hydroxyacid dehydrogenase 30 specific to the D-isomer of the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of D-isomer-specific 2-hydroxyacid dehydrogenase 30.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;
  • sequence of the polynucleotide is one selected from: (a) a sequence having positions 1535-2353 in SEQ ID NO: 1; and (b) a sequence having 1-2455 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; The method for preparing a polypeptide of the present invention by describing a host cell and recovering an expressed product is described.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit D-isomer-specific 2-hydroxyacid dehydrogenase 30 protein activity, which comprises utilizing a polypeptide of the present invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or disease susceptibility related to abnormal expression of a D-isomer-specific 2-hydroxyacid dehydrogenase 30 protein, which comprises detecting the polypeptide or a susceptibility in a biological sample.
  • a mutation in a coding polynucleotide sequence, or the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the invention also relates to the expression of the polypeptides and / or polynucleotides of the invention in the preparation for the treatment of cancer, developmental or immune disease or other 2-hydroxyacid dehydrogenase 30 due to D-isomer specificity. Use of medicines for diseases caused by abnormalities.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide is one that has one or more amino acid or nucleotide changes Amino acid sequence or polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence. . ⁇
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with D-isomer-specific 2-hydroxyacid dehydrogenase 30, causes the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to a 2-hydroxyacid dehydrogenase 30 specific to a D-isomer.
  • Antagonist refers to a D-isomer-specific 2-hydroxyacid dehydrogenase 30 that binds or regulates the specificity of the D-isomer when combined with it.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind D-isomer-specific 2-hydroxyacid dehydrogenase 30.
  • Regulation refers to a change in the function of D-isomer-specific 2-hydroxyacid dehydrogenase 30, including an increase or decrease in protein activity, changes in binding characteristics, and D-isomer specificity. Any other biological, functional, or immunological changes in the nature of 2-hydroxyacid dehydrogenase 30.
  • Substantially pure ' 1 means essentially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated. Those skilled in the art can purify the D-isomer specificity using standard protein purification techniques.
  • 2-hydroxyacid dehydrogenase 30 A substantially pure D-isomer-specific 2-hydroxyacid dehydrogenase 30 produces a single main band on a non-reducing polyacrylamide gel.
  • D -The purity of the isomer-specific 2-hydroxyacid dehydrogenase 30 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of a nucleotide by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partially homologous means A partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higgins, D. G. and P. M. Sharp (1988) Gene 73: 237-244). The Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by:
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by a method known in the art such as Jotun Hein ( Hein J., (1990) Methods in emzumology 183: 625-645) 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be a substitution of a hydrogen atom with a fluorenyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.
  • Antibody means a complete antibody molecule and its fragments, such as? ( ⁇ ') 2 and ⁇ , which can specifically bind to the D-isomer-specific 2-hydroxyacid dehydrogenase 30 antigenic determinants.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated D-isomer-specific 2-hydroxyacid dehydrogenase 30 means that the D-isomer-specific 2-hydroxyacid dehydrogenase 30 is substantially free of Other proteins, lipids, sugars or other substances with which they are naturally associated. Those skilled in the art can purify D-isomer-specific 2-hydroxyacid dehydrogenase 30 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the D-isomer-specific 2-hydroxyacid dehydrogenase 30 polypeptide can be analyzed by amino acid sequence analysis.
  • the present invention provides a novel D-isomer-specific 2-hydroxyacid dehydrogenase 30, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the invention can be naturally purified products, or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
  • polypeptides of the invention may be glycosylated, or they may be non-glycosylated.
  • the polypeptides of the invention may also include or exclude the initial methionine residue.
  • the invention also includes fragments, derivatives, and analogs of D-isomer-specific 2-hydroxyacid dehydrogenase 30.
  • fragment As used in the present invention, the terms “fragment”, “derivative” and “analog” refer to a 2-hydroxyacid dehydrogenase 30 that substantially maintains the D-isomer specificity of the present invention and the same biological function Or active polypeptide.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such that one or more of the amino acid residues is substituted by another group to include a substituent; or ( ⁇ )
  • One, in which the mature polypeptide is fused to another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) one in which the additional amino acid sequence is fused to the mature polypeptide
  • the resulting polypeptide sequence (such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art .
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2455 bases in length and its open reading frame of 1535-2353 encodes 272 amino acids.
  • This polypeptide has a characteristic sequence of a D-isomer-specific 2-hydroxyacid dehydrogenase family member, and it can be deduced that the D-isomer-specific 2-hydroxyacid dehydrogenase 30 has a D -Structure and function represented by isomer-specific 2-hydroxyacid dehydrogenase family members.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1 ° /. SDS, 6 (TC; or (2) adding denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding D-isomer-specific 2-hydroxyacid dehydrogenase 30.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence of the present invention encoding a D-isomer-specific 2-hydroxyacid dehydrogenase 30 can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • Various methods have been developed for raRNA extraction, and kits are also commercially available (Q i agene).
  • the construction of cDNA libraries is also a common method (Sarabrook, et al., Mo l ecu l ar Cl on i ng, A Labora tory Manua l, Co l d Spr i ng Harbor Labora tory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene function; (3) determination of D-isomer specific 2-hydroxy acids Level of transcript of dehydrogenase 30; (4) Detecting protein products of gene expression by immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably Is at least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of the D-isomer-specific 2-hydroxyacid dehydrogenase 30 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunoassay. Adsorption method (ELISA) and so on.
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunoassay.
  • ELISA Adsorption method
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DM / RM fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDM sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a D-isomer-specific 2-hydroxyacid dehydrogenase 30 coding sequence. , And a method for producing the polypeptide of the present invention by recombinant technology.
  • a polynucleotide sequence encoding a D-isomer-specific 2-hydroxyacid dehydrogenase 30 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: a ⁇ promoter-based expression vector (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing MA sequences encoding D-isomer-specific 2-hydroxyacid dehydrogenase 30 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be effectively linked to an appropriate promoter in an expression vector, To guide mRNA synthesis. Representative examples of these promoters are: l ac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a D-isomer-specific 2-hydroxyacid dehydrogenase 30 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute the polynucleoside-containing Genetically engineered host cell of an acid or recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DM may be in exponential growth phase were harvested after the treatment with (Method 12, using the procedure well known in the art. Alternatively, it is a MgCl 2. If If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging Wait.
  • polynucleotide sequence of the present invention can be used to express or produce recombinant D-isomer-specific 2-hydroxyacid dehydrogenase 30 (Sc ience, 1984; 224: 1431) . Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • Figure 1 is a comparison of the amino acid sequences of the functional domains of D-isomer-specific 2-hydroxyacid dehydrogenase 30 and D-isomer-specific 2-hydroxyacid dehydrogenase family members of the present invention Illustration.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated D-isomer-specific 2-hydroxyacid dehydrogenase 30.
  • 30KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA was reverse transcribed CDNA is formed. Smar t cDNA cloning kit (purchased from C 1 on t ech) will be used. The 0 fragment was inserted into the multicloning site of pBSK (+) vector (Clontech), and transformed into DH5 ⁇ . The bacteria formed a CDM library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined CDM sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0400e07 was new DNA.
  • a series of primers were synthesized to perform bidirectional determination of the inserted CDM fragments contained in this clone.
  • the sequence of the D-isomer-specific 2-hydroxyacid dehydrogenase 30 of the present invention and its encoded protein sequence ⁇ 'J were used with the prof i le scan program (Basic local search tool in GCG). ) [Al tschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], domain analysis was performed in a database such as prosit.
  • the D-isomer-specific 2-hydroxyacid dehydrogenase 30 of the present invention is homologous with a domain D-isomer-specific 2-hydroxyacid dehydrogenase family member, and the homology results Shown in Figure 1.
  • PCR amplification was performed with the following primers:
  • Pr imerl 5'- CTCTAAACAACAGGATGAAACCCA —3 '(SEQ ID NO: 3)
  • Primer2 5'- TAAAAGTTCAGCTTTAATGACAAA -3 '(SEQ ID NO: 4)
  • Pr imerl is a forward sequence starting at lbp at the 5 ′ end of SEQ ID NO: 1;
  • Pr itner2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification reaction conditions reaction volume containing 5 0 ⁇ 1 in 50mmol / L KC1, 10 face ol / L Tr i s- CI, ( ⁇ 8 ⁇ 5), 1. 5mmol / L MgCl 2, 200 ⁇ mol / L dNTP, l Opmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Iiwi trogen).
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-2455bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of D-isomer-specific 2-hydroxyacid dehydrogenase 30 gene expression:
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7, 4)-5 x SSC-5 x Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DM. After hybridization, the filter was washed in lx SSC-0.1% SDS at 55 ° C for 30 minutes. Then, Phosphor Imager Analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant D-isomer-specific 2-hydroxyacid dehydrogenase 30 according to SEQ ID NO: 1 and the coding region sequence shown in FIG. 1 To design a pair of specific amplification primers, the sequence is as follows:
  • Primer 3 5'- CATGCTAGCATGCTCAAATCATCATTTTCTGGG -3 '(Seq ID No:)
  • Primer4 5'- CATGGATCCTCAATACACTGTAGCCAGTGCACT -3' (Seq ID No: 6)
  • the 5 'ends of these two primers contain Nhel and BamHI restriction sites, respectively.
  • the coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Nhel and BamHI restriction sites correspond to the selective endonucleases on the expression vector plasmid pET 28b (+) (Novagen, Cat. No. 69865.3). Enzyme site.
  • the pBS-0400e07 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions are as follows: a total volume of 50 ⁇ l contains 10 pg of pBS- 0400e07 plasmid, primers Primer 3 and Primaer-4; ⁇ l ⁇ 10 pmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Nhel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into E. coli DH5a by the calcium chloride method. After being cultured on LB plates containing kanamycin (final concentration 30 ⁇ ⁇ / ⁇ 1) overnight, positive clones were selected by colony PCR method and sequenced. Select positive clones with the correct sequence (pET-0400e07) to transform the recombinant plasmid into the large intestine by calcium chloride method Bacillus BL21 (DE3) p lySs (product of Novagen).
  • polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For the method, see: Avrameas, e t a l. Immunochemi s try, 1969; 6: 43. Rabbits were immunized with 4rag of the hemocyanin polypeptide complex and complete Freund's adjuvant. After 15 days, the rabbit was immunized with hemocyanin polypeptide complex and incomplete Freund's adjuvant once.
  • the titer of antibody in rabbit serum was measured by ELISA using a 15 g / ml bovine serum albumin peptide complex-coated titration plate.
  • Protein A-Sepharose was used to isolate total IgG from antibody-positive rabbit sera.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method demonstrated that the purified antibody specifically binds to the D-isomer-specific 2-hydroxyacid dehydrogenase 30.
  • Example ⁇ Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Sou thern blotting, Nor thern blotting, and copying methods, etc., all of which fix the polynucleotide sample to be tested on the filter The membranes were hybridized using essentially the same procedure.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when the GC content is exceeded;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt): ⁇
  • Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment or its complementary fragment (41Nt) of SEQ ID NO: 1:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • pre-hybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA) .;
  • seal the bag and shake at 68 ° C in a water bath hour.
  • High-intensity washing film 1) Take out the hybridized sample membrane.
  • Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of fast, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, see the literature DeRi si, J, L., Lyer, V. & Brown, P. 0 (1997) Science 278, 680-686. And the literature Hel le, RA , Schema, M., Cha i, A., Sha lom, D., (1997) PNAS 94: 21
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and the samples were spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between the points is 280 ⁇ m. The spotted slides are hydrated, dried, and placed in purple Crosslink in Diplomatic Instrument. After elution, the DNA is fixed on a glass slide to prepare a chip. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are:
  • Total fflRNA was extracted from normal liver and liver cancer in one step, and mRNA was purified with Oligotex raRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP (5- Amino- propargyl-2'- deoxyuridine 5'-tr ip ate coupled to Cy3 f luorescent dye (purchased from Amershaffl Phamacia Biotech) was used to label the mRNA of normal liver tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-tr iphate coupled to Cy5 f luorescent dye (purchased from Amersham Phamacia Biotech) was used to label liver cancer tissue mRNA, and the probe was prepared after purification.
  • Cy3dUTP 5- Amino- propargyl-2'- deoxyuridine 5'-tr ip ate coupled to Cy3 f luorescent
  • the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodi scovery, USA) to calculate the Cy3 / Cy5 ratio of each point, which was less than 0.5 Dots greater than 2 are considered genes with differential expression.
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • NAD-dependent 2-hydroxyacid dehydrogenases that show specificity for the D-isomers of their substrates. They catalyze some important metabolic steps, both in function and structure.
  • D-lactate dehydrogenase, 3-phosphate glycerate dehydrogenase, D-glycerate dehydrogenase, Erythronate-4 phosphate dehydrogenase, etc. all act on the hydroxy acid D-isomer. They play an important role in the metabolism of substances and energy in the tricarboxylic acid cycle such as pyruvate and D-3-glycerate.
  • the polypeptide of the present invention is a polypeptide containing a specific sequence of a NAD binding domain and a catalytic domain, and abnormal expression of a characteristic sequence thereof will cause abnormal metabolism of matter and energy, and cause related diseases.
  • the abnormal expression of the 2-hydroxyacid dehydrogenase 30 specific to the D-isomer of the present invention will cause various diseases, especially metabolic disorders related to energy and material metabolism, and growth and development disorders.
  • Diseases, disorders of lipid metabolism, these diseases include but are not limited to:
  • Organic acidemia isovalerate, propionate, methylmalonic aciduria, combined carboxylase deficiency, glutarate type I
  • Amino Acid Metabolism Defects Phenylketonuria, Albinism, Sulfur Amino Acid Metabolism Defects, Tryptophanemia, Glycineemia, Hypersarcosemia, Glutamate Metabolism Defects, Urea Cycle Metabolism Defects
  • Glucose deficiency congenital lactose intolerance, hereditary fructose intolerance, galactosemia, fructose metabolism deficiency, glycogen storage disease
  • Abnormal lipid metabolism hyperlipoproteinemia, familial hyperalpha-lipoproteinemia, familial non-beta-lipoproteinemia, familial hypo-beta-lipoproteinemia, familial lecithin-cholesterol acetyltransferase Deficiency, fatty liver, steatosis cardiomyopathy, steatosis nephropathy, coronary atherosclerotic heart disease, 'hypertension, biliary cirrhosis, gallstones, precocious puberty, delayed sexual development, disorders of sexual differentiation, adrenal glands Hypercortical diseases such as Cushing syndrome, hyperaldosteronism, and adrenal insufficiency diseases such as acute adrenal insufficiency, chronic adrenal insufficiency, lipoma, lipoblastoma, liposarcoma, breast cancer, endometrium Tumor
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, familial cerebral nucleus dysplasia syndrome, skin, fat and muscular dysplasias such as congenital skin relaxation, premature aging, congenital horn No, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
  • Embryonic developmental disorders congenital abortion, cleft palate, limb absentness, limb differentiation disorders, hyaline membrane disease, Pulmonary insufficiency, polyphrenic kidney, ectopic kidney, double ureter, crypto, congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary artery stenosis, arterial duct ductus , Neural tube defects, congenital hydrocephalus, iris defect, congenital cataract, congenital glaucoma or cataract, congenital deafness
  • Abnormal expression of the 2-hydroxyacid dehydrogenase 30 specific to the D-isomer of the present invention will also produce certain tumors, certain hereditary, hematological diseases, and immune system diseases.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially metabolic disorders related to energy and material metabolism, disorders of growth and development, innate sexual malformations, certain tumors, certain hereditary, hematological and immune system diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) D-isomer specific 2-hydroxyacid dehydrogenase 30.
  • Agonists increase D-isomer-specific 2-hydroxyacid dehydrogenase 30 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing D-isomer-specific 2-hydroxyacid dehydrogenase 30 can be labeled with a labeled D-isomer-specific 2 in the presence of a drug.
  • -Hydroxide dehydrogenase 30 is cultured together. The ability of the drug to increase or block this interaction is then determined.
  • D-isomer-specific antagonists of 2-hydroxyacid dehydrogenase 30 include antibodies, compounds, receptor deletions, and the like that have been screened. D-isomer-specific 2-hydroxyacid dehydrogenase 30 antagonists can bind to D-isomer-specific 2-hydroxyacid dehydrogenase 30 and eliminate its function, or inhibit The production of the polypeptide or binding to the active site of the polypeptide prevents the polypeptide from performing its biological function.
  • D-isomer-specific 2-hydroxyacid dehydrogenase 30 can be added to the bioanalytical assay, and the D-isomer-specific 2 -The effect of the interaction between hydroxyacid dehydrogenase 30 and its receptor to determine whether a compound is an antagonist.
  • Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to D-isomer-specific 2-hydroxyacid dehydrogenase 30 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, the D-isomer-specific 2-hydroxyacid dehydrogenase 30 molecules should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the D-isomer-specific 2-hydroxyacid dehydrogenase 30 epitope. These antibodies Including (but not limited to) ⁇ Polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting D-isomer-specific 2-hydroxyacid dehydrogenase 30 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used Enhance immune response, including but not limited to Freund's adjuvant and the like.
  • Techniques for preparing D-isomer-specific 2-hydroxyacid dehydrogenase 30 monoclonal antibodies include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497 ), Three tumor technology, human B-cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced by known techniques (Morrison et al., PNAS, 1985, 81: 6851).
  • the existing technology for producing single-chain antibodies (US Pat. No. 4946778) can also be used to produce single-chain anti-D-isodifferentiation against D-isomer-specific 2-hydroxyacid dehydrogenase 30
  • Antibodies that are specific for 2-hydroxyacid dehydrogenase 30 can be used in immunohistochemistry to detect D-isomer-specific 2-hydroxyacid dehydrogenase 30 in biopsy specimens.
  • Monoclonal antibodies that bind to D-isomer-specific 2-hydroxyacid dehydrogenase 30 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • D-isomer-specific 2-hydroxyacid dehydrogenase 30 high affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a sulfhydryl crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill D-isomer specificity.
  • 2-hydroxyacid dehydrogenase 30 positive cells are examples of cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to D-isomer-specific 2-hydroxyacid dehydrogenase 30.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of D-isomer-specific 2-hydroxyacid dehydrogenase 30.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of D-isomer-specific 2-hydroxyacid dehydrogenase 30 levels.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the D-isomer-specific 2-hydroxyacid dehydrogenase 3 Q level detected in the test can be used to explain the D-isomer-specific 2-hydroxyacid dehydrogenase 30 in each The importance of this disease and the diagnosis of diseases in which D-isomer-specific 2-hydroxyacid dehydrogenase 30 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding D-isomer-specific 2-hydroxyacid dehydrogenase 30 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormalities in cell proliferation, development, or metabolism due to the non-expression or abnormal / inactive expression of D-isomer-specific 2-hydroxyacid dehydrogenase 30.
  • Recombinant gene therapy vectors can be designed to express mutated D-isomer-specific 2-hydroxyacid dehydrogenase 30 to inhibit endogenous D-isomer specificity Sexual 2-hydroxyacid dehydrogenase 30 activity.
  • a variant D-isomer-specific 2-hydroxyacid dehydrogenase 30 may be a shortened D-isomer-specific 2-hydroxyacid that lacks a signaling domain Dehydrogenase 30, although it can bind to downstream substrates, lacks signal transduction activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of D-isomer-specific 2-hydroxyacid dehydrogenase 30.
  • Viral-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to encode a D-isomer-specific 2-hydroxyacid dehydrogenase 30 multinucleus Nucleotide transfer into cells.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a D-isomer-specific 2-hydroxyacid dehydrogenase 30 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding D-isomer-specific 2-hydroxyacid dehydrogenase 30 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RN A and DNA
  • ribozymes that inhibit D-isomer-specific 2-hydroxyacid dehydrogenase 30 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RM or DM synthesis techniques, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence is integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond rather than the phosphodiester bond is used for the ribonucleoside linkage.
  • a polynucleotide encoding a D-isomer-specific 2-hydroxyacid dehydrogenase 30 can be used for the diagnosis of diseases related to the D-isomer-specific 2-hydroxyacid dehydrogenase 30.
  • the polynucleotide encoding D-isomer-specific 2-hydroxyacid dehydrogenase 30 can be used to detect whether the D-isomer-specific 2-hydroxyacid dehydrogenase 30 is Abnormal expression of D-isomer-specific 2-hydroxyacid dehydrogenase 30 in disease states.
  • the DNA sequence encoding D-isomer-specific 2-hydroxyacid dehydrogenase 30 can be used to hybridize biopsy specimens to determine D-isomer-specific 2-hydroxyacid dehydrogenase 30 Expression Situation.
  • Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DM chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • D-isomer-specific 2-hydroxyacid dehydrogenase 30-specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect the D-isomer-specific Transcript of 2-hydroxyacid dehydrogenase 30.
  • D-isomer-specific 2-hydroxyacid dehydrogenase 30 gene can also be used to diagnose D-isomer-specific 2-hydroxyacid dehydrogenase 30-related diseases.
  • D-isomer-specific 2-hydroxyacid dehydrogenase 30 mutant forms include points compared to normal wild-type D-isomer-specific 2-hydroxyacid dehydrogenase 30 DNA sequences Mutations, translocations, deletions, recombinations, and any other abnormalities. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DM sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct a chromosome-specific c-leg bank.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mende l ian Inher i tance in Man (available through contact with Johns Hopkins Univers i ty Welch Medica l Library available online). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • D-isomer-specific 2-hydroxyacid dehydrogenase 30 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of D-isomer-specific 2-hydroxyacid dehydrogenase 30 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une 2-hydroxy déshydrogénase 30 à D-isomères spécifiques, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la 2-hydroxy déshydrogénase 30 à D-isomères spécifiques.
PCT/CN2001/000072 2000-01-28 2001-01-21 Nouveau polypeptide, 2-hydroxy deshydrogenase 30 a d-isomeres specifiques, et polynucleotide codant pour ce polypeptide WO2001055190A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001231486A AU2001231486A1 (en) 2000-01-28 2001-01-21 A novel polypeptide, d-isomer specific 2-hydroxy acid dehydrogenase 30 and the polynucleotide encoding thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00111577.4 2000-01-28
CN 00111577 CN1319658A (zh) 2000-01-28 2000-01-28 一种新的多肽——d－同分异构体特异性的2－羟酸脱氢酶30和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001055190A1 true WO2001055190A1 (fr) 2001-08-02

Family

ID=4581486

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000072 WO2001055190A1 (fr) 2000-01-28 2001-01-21 Nouveau polypeptide, 2-hydroxy deshydrogenase 30 a d-isomeres specifiques, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1319658A (fr)
AU (1) AU2001231486A1 (fr)
WO (1) WO2001055190A1 (fr)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
BIOCHEM. BIOPHYS. RES. COMMUN., vol. 184, no. 1, 15 April 1992 (1992-04-15), pages 60 - 66 *

Also Published As

Publication number Publication date
CN1319658A (zh) 2001-10-31
AU2001231486A1 (en) 2001-08-07

Similar Documents

Publication Publication Date Title
WO2001055190A1 (fr) Nouveau polypeptide, 2-hydroxy deshydrogenase 30 a d-isomeres specifiques, et polynucleotide codant pour ce polypeptide
WO2001048168A1 (fr) Nouveau polypeptide, gamma1-pyroline-5-hydroxy reductase 14, et polynucleotide codant pour ce polypeptide
WO2001085922A1 (fr) Nouveau polypeptide, proteine humaine de la famille des 2-hydroxyacide deshydrogenases nad-dependantes 16, et polynucleotide codant pour ce polypeptide
WO2001055404A1 (fr) Nouveau polypeptide, alcool deshydrogenase humaine 39, et polynucleotide codant pour ce polypeptide
WO2001094406A1 (fr) Nouveau polypeptide, dihydropyridine-acide dicarboxylique deshydrogenase 21, et polynucleotide codant ce polypeptide
WO2001046234A1 (fr) Nouveau polypeptide, proteine 9 de la famille des deshydrogenases d'acide 2-hydroxy nad-dependante, et polynucleotide codant pour ce polypeptide
WO2001098488A1 (fr) Nouveau polypeptide, sous-unite 24 de flavoproteine humaine, et polynucleotide codant ce polypeptide
WO2001075011A2 (fr) Nouveau polypeptide, proteine humaine de constitution 10 de cytochromes, et polynucleotide codant pour ce polypeptide
WO2001046433A1 (fr) Nouveau polypeptide, aldehyde/cetone reductase 9, et polynucleotide codant pour ce polypeptide
WO2001073044A1 (fr) Nouveau polypeptide, 2-hydroxy acide deshydrogenase humaine 8, et polynucleotide codant pour ce polypeptide
WO2001046432A1 (fr) Nouveau polypeptide, 2-hydroxy deshydrogenase 9, et polynucleotide codant pour ce polypeptide
WO2001072981A1 (fr) Nouveau polypeptide, proteine humaine 11 de la famille des 2-hydroxyacide deshydrogenases nad-dependante, et polynucleotide codant pour ce polypeptide
WO2001046248A1 (fr) Nouveau polypeptide, proteine ribosomale s9 26, et polynucleotide codant pour ce polypeptide
WO2002020606A1 (fr) Nouveau polypeptide, la proteine humaine 38.39 liee aux defauts d'audition, et polynucleotide codant pour elle
WO2001053492A1 (fr) Nouveau polypeptide, s-adenosylmethionine synthetase 31, et polynucleotide codant pour ce polypeptide
WO2001090376A1 (fr) Nouveau polypeptide, triose phosphate isomerase humaine 11, et polynucleotide codant ce polypeptide
WO2001048165A1 (fr) Nouveau polypeptide, aldehyde/cetone reductase 9, et polynucleotide codant pour ce polypeptide
WO2001072982A1 (fr) Nouveau polypeptide, proteine humaine 13 de la famille des 2-hydroxyacide deshydrogenases nad-dependante, et polynucleotide codant pour ce polypeptide
WO2001048210A1 (fr) Nouveau polypeptide, tyrosinase 10, et polynucleotide codant pour ce polypeptide
WO2001087973A1 (fr) Nouveau polypeptide, aldehyde/cetone reductase humaine 9.9, et polynucleotide codant ce polypeptide
WO2001087948A1 (fr) Nouveau polypeptide, aldehyde/cetone reductase humaine 12, et polynucleotide codant pour ce polypeptide
WO2001094592A1 (fr) Nouveau polypeptide, aldehyde/cetone reductase humaine 10.1, et polynucleotide codant ce polypeptide
WO2002012510A1 (fr) Nouveau polypeptide, proteine 11 de la famille de la 2-hydroxy deshydrogenase nad-dependante, et polynucleotide codant ce polypeptide
WO2001047980A1 (fr) Nouveau polypeptide, dihydrodipicolinate synthase 9, et polynucleotide codant pour ce polypeptide
WO2001048218A1 (fr) Nouveau polypeptide, proteine muts 13, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP