WO2001046433A1 - Nouveau polypeptide, aldehyde/cetone reductase 9, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, aldehyde/cetone reductase 9, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001046433A1 WO2001046433A1 PCT/CN2000/000607 CN0000607W WO0146433A1 WO 2001046433 A1 WO2001046433 A1 WO 2001046433A1 CN 0000607 W CN0000607 W CN 0000607W WO 0146433 A1 WO0146433 A1 WO 0146433A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- aldehyde
- ketoreductase
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
- C12Y101/01002—Alcohol dehydrogenase (NADP+) (1.1.1.2), i.e. aldehyde reductase
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56983—Viruses
- G01N33/56988—HIV or HTLV
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/90—Enzymes; Proenzymes
- G01N2333/902—Oxidoreductases (1.)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/22—Haematology
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/24—Immunology or allergic disorders
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, an aldehyde / ketone reductase 9, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides. Background technique
- the aldehyde / ketone reductase family includes many oxidoreductases whose structure and function depend on NADPH and other proteins. These enzymes can be involved in the catalytic reduction of a wide range of carboxyl compounds, such as sugars, gluconic acid, alcohol hormones, and some heterologous substances of aldehydes and ketones.
- the aldehyde / ketone reductase family consists of proteins with similar enzyme functions and structures. The conserved sequences of these proteins show their relevance during evolution. These similarities can be used to explain the non-specificity and unpredictability of enzyme substrates, and to prove why aldose reductase inhibitors are ineffective and have side effects in the treatment of diabetic complications.
- aldehyde / ketone reductase 9 protein plays an important role in important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more aldehyde / ketone reductase 9 involved in these processes Protein, especially the amino acid sequence of this protein.
- the isolation of the new aldehyde / ketone reductase 9 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This These proteins may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate their coding DNA. Disclosure of invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a method for producing aldehyde / ketone reductase 9.
- Another object of the present invention is to provide an antibody against the polypeptide aldehyde / ketone reductase 9 of the present invention.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide aldehyde / ketone reductase 9 of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases related to aldehyde / ketoreductase 9 abnormalities.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 202-453 in SEQ ID NO: 1; and (b) a sequence having positions 1-605 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; A method of preparing the polypeptide of the present invention by culturing the host cell and recovering the expressed product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of aldehyde / ketoreductase 9 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the present invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of an aldehyde / ketoreductase 9 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of aldehyde / ketoreductase 9.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- “Insertion” or “addition” refers to changes in the amino acid sequence or nucleotide sequence that result in The molecule is increased compared to one or more amino acids or nucleotides. “Replacement” refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
- An "agonist” refers to a molecule that, when combined with aldehyde / ketoreductase 9, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind an aldehyde / ketone reductase 9.
- Antagonist refers to a molecule that, when combined with aldehyde / ketoreductase 9, can block or regulate the biological or immunological activity of aldehyde / ketoreductase 9.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to aldehyde / ketoreductase 9.
- “Regulation” refers to a change in the function of aldehyde / ketoreductase 9, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of aldehyde / ketoreductase 9.
- Substantially pure means substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated.
- Those skilled in the art can purify aldehyde / ketoreductase 9 using standard protein purification techniques. Essentially pure aldehyde / ketone reductase 9 produces a single main band on a non-reducing polyacrylamide gel. The purity of the aldehyde / ketone reductase 9 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of a nucleotide by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. Available electronically measuring the percentage identity, as determined by MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad i son Wi s.) 0 MEGALIGN program, such as comparing two or more depending on the method of Method C l us ter Sequence (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). The C 1 ust er method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
- the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun He in (Hein J., (1990) Methods in emzumol ogy 183: 625-645).
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be the replacement of a hydrogen atom with an alkyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa, (') 2 and? ⁇ It can specifically bind to the epitope of aldehyde / ketoreductase 9.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
- a naturally occurring polynucleotide or polypeptide in a living animal is It is not isolated, but the same polynucleotide or polypeptide is separated from some or all of the substances with which it coexists in natural systems.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
- isolated aldehyde / ketoreductase 9 means that aldehyde / ketoreductase 9 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify aldehyde / ketoreductase 9 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the aldehyde / ketoreductase 9 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, aldehyde / ketone reductase 9, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of aldehyde / ketoreductase 9.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the aldehyde / ketoreductase 9 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: U) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted
- the amino acid may or may not be encoded by the genetic code; or ( ⁇ ) such that a group on one or more amino acid residues is substituted by another group to include a substituent; or ( ⁇ ⁇ )
- a type in which a mature polypeptide is fused to another compound such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol
- IV a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
- such fragments, derivatives and analogs are It is considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 605 bases, and its open reading frame 202-453 encodes 83 amino acids.
- This polypeptide has the characteristic sequence of aldehyde / ketoreductase family proteins, and it can be deduced that the aldehyde / ketoreductase 9 family has the structure and function represented by the aldehyde / ketoreductase family proteins.
- the polynucleotide of the present invention may be in a DNA form or an A form.
- DNA forms include cDNA, genomic DNA, or synthetic DM.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
- These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
- the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum Z0.1% Ficoll, 42 ° C, etc .; or (3) only the identity between the two sequences is at least 95%, more preferably 97 Hybridization occurs only at% or more.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding aldehyde / ketoreductase 9.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the aldehyde / ketoreductase 9 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DM-DM or DNA-RNA hybridization; (2) the presence or loss of marker gene function; (3) determination of aldehyde / ketoreductase 9 transcript levels; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleosides Acid, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- MA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the aldehyde / ketoreductase 9 gene.
- ELISA enzyme-linked immunosorbent assay
- a method of applying a PCR technique to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified MA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDM sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using an aldehyde / ketoreductase 9 coding sequence, and a recombinant technology for producing a polypeptide of the present invention. method.
- a polynucleotide sequence encoding an aldehyde / ketoreductase 9 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements. Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding an aldehyde / ketoreductase 9 and appropriate transcription / translation regulatory elements.
- DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis.
- promoters are: the lac or tr P promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding an aldehyde / ketone reductase 9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
- Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells insect cells
- fly S2 or Sf9 animal cells
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. It is well known in the art. The alternative is to use MgC l 2 .
- transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant aldehyde / ketoreductase 9 (Scence, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
- Fig. 1 is a comparison diagram of amino acid sequence homology of a total of 60 amino acids and domain aldehyde / ketone reductase family proteins of the aldehyde / ketone reductase 9 of the present invention at 18-77.
- the upper sequence is the aldehyde / ketone reductase 9 and the lower sequence is the domain aldehyde / ketone reductase family proteins.
- ⁇ "and”: "and” ⁇ indicate that the probability of different amino acids at the same position between two sequences decreasing in sequence
- FIG. 2 is a polyacrylamide gel electrophoresis diagram (SDS-PAGE) of the isolated aldehyde / ketone reductase 9. 9kDa to The molecular weight of the protein. The arrow indicates the isolated protein band.
- the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0240a09 was new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- the results show that the 0240a09 clone contains a full-length cDNA of 60 5 bp (as shown in Seq IDN0: 1), and has a 252 bp open reading frame (0RF) from 202 bp to 453 bp, encoding a new protein (such as Seq ID NO: 2).
- This clone pBS-0240a09 and named the encoded protein as aldehyde / ketone reductase 9.
- Example 2 Domain analysis of cDNA clones
- the sequence of the aldehyde / ketoreductase 9 of the present invention and the protein sequence encoded by the aldehyde / ketoreductase 9 of the present invention were analyzed using the profile scan program (Basiclocal Alignment search tool) in GCG [Altschul, SF et a 1. J. Mol. Biol. 1990; 215 : 403-10], performing domain analysis in databases such as prosite.
- the aldehyde / ketoreductase 9 of the present invention is homologous with the domain aldehyde / ketoreductase family proteins at 18-77, and the homology results are shown in FIG. 1 with a homology of 0.18 and a score of 10.43; the threshold is 9.77.
- Example 3 Cloning of a gene encoding aldehyde / ketone reductase 9 by RT-PCR
- CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer.
- PCR amplification was performed with the following primers:
- Primerl 5'- TACCTTCACCTTCGCTAAGAACCC -3 '(SEQ ID NO: 3)
- Primer 2 5'- GGCTGTCCTCCGGCAGAATGGGAT -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification reaction conditions 50 leg ol / L KC1, 10 mol ol / L Tris-CI, (pH8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ / L dNTP, lOpmol in a reaction volume of 50 ⁇ 1 Primer, 1U Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
- RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
- DM sequence analysis results showed that the DM sequence of the PCR product was exactly the same as that of 1-605bp shown in SEQ ID NO: 1.
- Example 4 Northern blot analysis of aldehyde / ketoreductase 9 gene expression:
- RNA extraction in one step [Anal. Biochem 19252, 162, 156-159].
- This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RM precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- the 32P- labeled probes (about 2 x l0 6 cpm / ml) and RNA was transferred to a nitrocellulose membrane overnight at 42 ° C in a hybridization solution, the solution comprising 50% formamide -25mM KH 2 P0 4 (pH7.4) -5 x SSC-5 x Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DM. After hybridization, the filter was placed in 1 x SSC-0.1% SDS in 55. C for 30 min. Then, Phosphor Imager was used for analysis and quantification ⁇ Example 5: In vitro expression, isolation and purification of recombinant aldehyde / ketoreductase 9
- Primer3 5'- CATCATATGATGGCTGTTGCGTATTGGAAATTAG -3 '(Seq ID No: 5)
- Primer 4 5'- CATGGATCCCTAGAAAAGGCTGCGTTTTCCACCT -3' (Seq ID No: 6)
- the two ends of these two primers contain Ndel and BamHI restriction sites , followeded by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
- the Ndel and BamHI restriction sites correspond to the selectivity on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Endonuclease site.
- PCR was performed using the pBS-0240a09 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS- 0 2 40a09 plasmid, , Advantage polymerase Mix
- a peptide synthesizer (product of PE company) was used to synthesize the following aldehyde / ketone reductase 9 specific peptides: Lai plant Met- Ala- Vab Ala- Tyr- Trp- Lys- Leu- Vab Leu- Ser- G ly-Arg-Phe- Lys- COOH (SEQ ID NO: 7).
- the peptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Needle-to-sample hybridization has the strongest specificity and is retained.
- oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
- Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt)
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe for subsequent experiments.
- the film is washed with high-strength conditions and strength conditions, respectively.
- Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; finding and screening for tissue specificity New genes, especially those related to diseases such as tumors; Diagnosis of diseases, such as hereditary diseases. The specific method steps have been reported in the literature.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as the target DM, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ m. The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
- Total mRNA was extracted from normal liver and liver cancer in one step, and the mRNA was purified with Oligotex mRNA Midi Kit (purchased from QiaGen).
- the fluorescent reagent Cy ⁇ UTP 5 -Amino- propargy 1- 2 '-deoxyur i dine 5--tr iphate coupled to Cy3 f luorescent dye (purchased from Amersham Phamac ia Biotech) was used to label the mRNA of normal liver tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargyl-2' -deoxyur i dine 5'-tr iphate coupled to Cy5 f luorescent dye (purchased from Amersham Phamacia Biotech) was used to label liver cancer tissue mRNA, and the probe was prepared after purification.
- Cy5dUTP 5-Amino-propargyl-2' -deoxyur i dine 5'-tr iphate coupled
- the probes from the two types of tissues were hybridized with the chip in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
- Scanner purchased from General Scanning Company, USA
- the scanned image was analyzed and processed with Imagene software (Biodiscovery Company, USA), and the Cy3 / Cy5 ratio of each point was calculated. The points with the ratio less than 0.5 and greater than 2 were considered.
- Genes with differential expression were used to analyze the a UniHyb TM Hybridization Solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
- Scanner purchased from General Scanning Company, USA
- the scanned image was analyzed and processed with Imagene software (Biodiscovery Company, USA), and the Cy3
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- the aldehyde / ketone reductase family includes many oxidoreductases whose structure and function depend on NADPH and other proteins.
- the aldehyde / ketoreductase family contains the specific aldehyde / ketoreductase family Motif. These enzymes can be involved in the catalytic reduction of a wide range of carboxyl compounds, such as sugars, gluconic acid, alcohol hormones, and some heterologous substances of aldehydes and ketones. They play an important role in material metabolism and conversion and energy metabolism.
- the aldehyde / ketoreductase-specific motif-containing polypeptide of the present invention has the above functions.
- aldehyde / ketone reductase 9 of the present invention will produce various diseases, especially metabolic disorders related to material and energy metabolism, disorders of growth and development, and disorders of lipid metabolism. These diseases include But not limited to:
- Organic acidemia isovalerate, propionate, methylmalonic aciduria, combined carboxylase deficiency, glutarate type I
- Diabetes-related diseases diabetic ketoacidosis, hypertonic non-ketogenic diabetic coma
- Amino acid metabolism defects phenylketonuria, tyrosine metabolism defects such as albinism, sulfur amino acid metabolism defects, tryptophan metabolism defects such as tryptophanemia, branch amino acid metabolism defects, glycine metabolism defects such as Glycineemia, Hypersarcosineemia, Proline and Hydroxyproline Metabolism Defects, Glutamate Metabolism Defects, Urea Cycle Metabolism Defects, Histidine Metabolism Defects, Lysine Metabolism Defects , And other amino acid metabolism defects.
- Mucopolysaccharidosis and other marginal diseases Mucopolysaccharidosis I to ⁇ , marginal diseases of mucopolysaccharidosis such as rheumatoid mucopolysaccharidosis and mucolipid storage disease.
- Purine and Pyrimidine Metabolism Defects Abnormal purine metabolism such as Ray-niney syndrome, xanthineuria, abnormal pyrimidine metabolism such as orotic aciduria, and adenosine deaminase deficiency.
- Abnormal lipid metabolism hyperlipoproteinemia, familial hyperalpha-lipoproteinemia, familial alipoproteinemia, familial hypobeta-lipoproteinemia, familial lecithin-cholesterol acetyltransferase deficiency .
- Glucose metabolism defects Congenital sugar digestion and absorption defects such as congenital lactose intolerance, hereditary fructose intolerance, monosaccharide metabolism defects such as galactosemia, fructose metabolism defects, glycogen metabolism diseases such as glycogen storage Backlog.
- Growth and development disorders mental retardation, cerebral palsy, brain development disorders, familial cerebral nucleus dysplasia syndrome, skin, fat and muscular dysplasias such as congenital skin relaxation, premature aging, congenital horn Poor metabolism, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
- Fatty deposition disease fatty liver, steatosis cardiomyopathy, steatosis nephropathy
- Cardiovascular diseases Coronary atherosclerotic heart disease such as occult heart disease, angina pectoris, myocardial infarction, dying coronary heart disease, hypertension
- Sterol derivatives such as bile acids, sex hormones (testosterone, estradiol, estriol, progesterone)
- Metabolic disorders (1) Bile acid metabolic disorders such as biliary cirrhosis, cholelithiasis ( 2) Sexual developmental disorders during growth and development: precocious puberty, delayed sexual development, sexual differentiation disorders, other defects in external genital development (3)
- Endocrine and metabolic syndromes Hyperadrenocortical diseases such as Cushing syndrome, hyperaldosteronism, adrenal glands Cortical dysfunction such as acute adrenal insufficiency, chronic adrenal insufficiency
- Tumors lipoma, lipoblastoma, liposarcoma, breast cancer
- the abnormal expression of the aldehyde / ketone reductase 9 of the present invention will also generate certain tumors, certain hereditary, hematological diseases, and immune system diseases.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially metabolic disorders related to material and energy metabolism, growth disorders, lipids. Metabolic disorders, some tumors, some hereditary, hematological and immune system diseases.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) aldehyde / ketone reductase 9.
- Agonists increase biological functions such as aldehyde / ketone reductase 9 stimulation of cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing aldehyde / ketoreductase 9 can be cultured with labeled aldehyde / ketoreductase 9 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of aldehyde / ketoreductase 9 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of aldehyde / ketoreductase 9 can bind to aldehyde / ketoreductase 9 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
- aldehyde / ketoreductase 9 can be added to the bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between aldehyde / ketoreductase 9 and its receptor. .
- Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to aldehyde / ketoreductase 9 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, 9 molecules of aldehyde / ketoreductase should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against the aldehyde / ketoreductase 9 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by direct injection of aldehyde / ketoreductase 9 into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait.
- Techniques for preparing monoclonal antibodies to aldehyde / ketoreductase 9 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human B-cell hybridoma Skill Surgery, EBV-hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions and non-human variable regions can be produced using existing techniques (Morris on etal, PNAS, 1985, 81: 685 1). Existing techniques for producing single-chain antibodies (US Pa t No. 4946778) can also be used to produce single chain antibodies against aldehyde / ketoreductase 9.
- Antibodies against aldehyde / ketoreductase 9 can be used in immunohistochemistry to detect aldehyde / ketoreductase 9 in biopsy specimens.
- Monoclonal antibodies that bind to aldehyde / ketoreductase 9 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
- This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- aldehyde / ketone reductase 9 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of the antibody with a thiol crosslinker such as SPDP, and toxin is bound to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill aldehyde / ketoreductase 9 positive cells .
- the antibodies of the present invention can be used to treat or prevent diseases related to aldehyde / ketone reductase 9.
- Administration of an appropriate dose of antibody can stimulate or block aldehyde / ketoreductase 9 production or activity.
- the invention also relates to a diagnostic test method for quantitative and localized detection of aldehyde / ketoreductase 9 levels.
- tests are well known in the art and include FI SH assays and radioimmunoassays.
- the levels of aldehyde / ketoreductase 9 detected in the test can be used to explain the importance of aldehyde / ketoreductase 9 in various diseases and to diagnose diseases in which aldehyde / ketoreductase 9 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- Polynucleotides encoding aldehyde / ketone reductase 9 can also be used for a variety of therapeutic purposes.
- Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by non-expression or abnormal / inactive expression of aldehyde / ketoreductase 9.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant aldehyde / ketone reductase 9 to inhibit endogenous aldehyde / ketone reductase 9 activity.
- a variant aldehyde / ketoreductase 9 may be a shortened aldehyde / ketoreductase 9 lacking a signaling domain, and although it can bind to a downstream substrate, it lacks signaling activity. Therefore recombinant gene therapy vectors can be used to treat aldehyde / ketone reductase 9 Diseases caused by abnormal expression or activity.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding an aldehyde / ketoreductase 9 into a cell.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding an aldehyde / ketone reductase 9 can be found in the existing literature (Sambrook, et al.).
- the recombinant polynucleotide encoding aldehyde / ketoreductase 9 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit aldehyde / ketoreductase 9 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RM molecule that can specifically decompose specific RNA. Its mechanism is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DM synthesis techniques, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RM polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
- Polynucleotides encoding aldehyde / ketoreductase 9 are useful in the diagnosis of diseases related to aldehyde / ketoreductase 9.
- Polynucleotides encoding aldehyde / ketoreductase 9 can be used to detect the expression of aldehyde / ketoreductase 9 or abnormal expression of aldehyde / ketoreductase 9 in disease states.
- the DNA sequence encoding aldehyde / ketone reductase 9 can be used to hybridize biopsy specimens to determine the expression of aldehyde / ketone reductase 9.
- Hybridization techniques include Sou thern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array (Microar ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes in tissues and genes diagnosis.
- RM-polymerase chain reaction (RT-PCR) in vitro amplification with aldehyde / ketoreductase 9 specific primers can also detect aldehyde / ketoreductase 9 transcription products.
- Detection of mutations in the aldehyde / ketoreductase 9 gene can also be used to diagnose aldehyde / ketoreductase 9-related diseases.
- Forms of aldehyde / ketoreductase 9 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type aldehyde / ketoreductase 9 DNA sequences.
- Can use existing techniques such as Southern blotting Methods, DNA sequence analysis, PCR and in situ hybridization to detect mutations.
- mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
- an important first step is to locate these DNA sequences on a chromosome.
- a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
- the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technologies, The cDNA of the disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution and one gene per 20 kb).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Aldehyde / ketone reductase 9 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of aldehyde / ketoreductase 9 to be administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Microbiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Pathology (AREA)
- Genetics & Genomics (AREA)
- General Physics & Mathematics (AREA)
- Physics & Mathematics (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- General Engineering & Computer Science (AREA)
- Hospice & Palliative Care (AREA)
- Epidemiology (AREA)
- Tropical Medicine & Parasitology (AREA)
- AIDS & HIV (AREA)
- Marine Sciences & Fisheries (AREA)
- Gastroenterology & Hepatology (AREA)
- Pharmacology & Pharmacy (AREA)
- Oncology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU19873/01A AU1987301A (en) | 1999-12-22 | 2000-12-18 | A novel polypeptide, aldehyde/ketone reductase 9 and the polynucleotide encodingthe polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN99125681.6 | 1999-12-22 | ||
CN 99125681 CN1300839A (zh) | 1999-12-22 | 1999-12-22 | 一种新的多肽-醛/酮还原酶9和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001046433A1 true WO2001046433A1 (fr) | 2001-06-28 |
Family
ID=5284094
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2000/000607 WO2001046433A1 (fr) | 1999-12-22 | 2000-12-18 | Nouveau polypeptide, aldehyde/cetone reductase 9, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1300839A (fr) |
AU (1) | AU1987301A (fr) |
WO (1) | WO2001046433A1 (fr) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8592637B2 (en) | 2009-08-31 | 2013-11-26 | Basf Se | Process for preparing mononitrated organic compounds |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5919685A (en) * | 1997-08-08 | 1999-07-06 | Incyte Pharmaceuticals, Inc. | Human aflatoxin B1 aldehyde reductase |
-
1999
- 1999-12-22 CN CN 99125681 patent/CN1300839A/zh active Pending
-
2000
- 2000-12-18 WO PCT/CN2000/000607 patent/WO2001046433A1/fr active Application Filing
- 2000-12-18 AU AU19873/01A patent/AU1987301A/en not_active Abandoned
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5919685A (en) * | 1997-08-08 | 1999-07-06 | Incyte Pharmaceuticals, Inc. | Human aflatoxin B1 aldehyde reductase |
US5981244A (en) * | 1997-08-08 | 1999-11-09 | Incyte Pharmaceuticals, Inc. | Human aflatoxin B1 aldehyde reductase |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8592637B2 (en) | 2009-08-31 | 2013-11-26 | Basf Se | Process for preparing mononitrated organic compounds |
Also Published As
Publication number | Publication date |
---|---|
CN1300839A (zh) | 2001-06-27 |
AU1987301A (en) | 2001-07-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001046433A1 (fr) | Nouveau polypeptide, aldehyde/cetone reductase 9, et polynucleotide codant pour ce polypeptide | |
WO2001055404A1 (fr) | Nouveau polypeptide, alcool deshydrogenase humaine 39, et polynucleotide codant pour ce polypeptide | |
WO2001048168A1 (fr) | Nouveau polypeptide, gamma1-pyroline-5-hydroxy reductase 14, et polynucleotide codant pour ce polypeptide | |
WO2001055380A1 (fr) | Nouveau polypeptide, 3-beta-hydroxysteroide deshydrogenase/5-ene-4-ene isomerase 57, et polynucleotide codant pour ce polypeptide | |
WO2001048221A1 (fr) | Nouveau polypeptide, colipase 12, et polynucleotide codant pour ce polypeptide | |
WO2001047986A1 (fr) | Nouveau polypeptide, thiolase proteine 11, et polynucleotide codant pour ce polypeptide | |
WO2001073071A1 (fr) | Nouveau polypeptide, aldehyde/cetone reductase humaine 10, et polynucleotide codant pour ce polypeptide | |
WO2001075118A1 (fr) | Nouveau polypeptide, aldehyde/cetone reductase humaine 18, et polynucleotide codant pour ce polypeptide | |
WO2001094592A1 (fr) | Nouveau polypeptide, aldehyde/cetone reductase humaine 10.1, et polynucleotide codant ce polypeptide | |
WO2001048165A1 (fr) | Nouveau polypeptide, aldehyde/cetone reductase 9, et polynucleotide codant pour ce polypeptide | |
WO2001053492A1 (fr) | Nouveau polypeptide, s-adenosylmethionine synthetase 31, et polynucleotide codant pour ce polypeptide | |
WO2001085922A1 (fr) | Nouveau polypeptide, proteine humaine de la famille des 2-hydroxyacide deshydrogenases nad-dependantes 16, et polynucleotide codant pour ce polypeptide | |
WO2001053499A1 (fr) | Nouveau polypeptide, proteine nucleolaire humaine 18 de proliferation cellulaire, et polynucleotide codant pour ce polypeptide | |
WO2001087973A1 (fr) | Nouveau polypeptide, aldehyde/cetone reductase humaine 9.9, et polynucleotide codant ce polypeptide | |
WO2001090367A1 (fr) | Nouveau polypeptide, aldehyde/cetone reductase humaine 9.2, et polynucleotide codant pour ce polypeptide | |
WO2001087948A1 (fr) | Nouveau polypeptide, aldehyde/cetone reductase humaine 12, et polynucleotide codant pour ce polypeptide | |
WO2001094371A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s4-10, et polynucleotide codant ce polypeptide | |
WO2001098488A1 (fr) | Nouveau polypeptide, sous-unite 24 de flavoproteine humaine, et polynucleotide codant ce polypeptide | |
WO2001040288A1 (fr) | Nouveau polypeptide, uteroglobine humaine 13, et polynucleotide codant pour ce polypeptide | |
WO2001046432A1 (fr) | Nouveau polypeptide, 2-hydroxy deshydrogenase 9, et polynucleotide codant pour ce polypeptide | |
WO2001055190A1 (fr) | Nouveau polypeptide, 2-hydroxy deshydrogenase 30 a d-isomeres specifiques, et polynucleotide codant pour ce polypeptide | |
WO2001047982A1 (fr) | Nouveau polypeptide, support mitochondrial 30, et polynucleotide codant pour ce polypeptide | |
WO2001046246A1 (fr) | Nouveau polypeptide, deshydrogenase/reductase a chaine courte 12, et polynucleotide codant pour ce polypeptide | |
WO2001047976A1 (fr) | Nouveau polypeptide, amylase 8, et polynucleotide codant pour ce polypeptide | |
WO2001040289A1 (fr) | Nouveau polypeptide, support mitochondrial 12, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |