WO2001047976A1 - Nouveau polypeptide, amylase 8, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, amylase 8, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001047976A1
WO2001047976A1 PCT/CN2000/000683 CN0000683W WO0147976A1 WO 2001047976 A1 WO2001047976 A1 WO 2001047976A1 CN 0000683 W CN0000683 W CN 0000683W WO 0147976 A1 WO0147976 A1 WO 0147976A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
amylase
sequence
seq
Prior art date
Application number
PCT/CN2000/000683
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU21445/01A priority Critical patent/AU2144501A/en
Publication of WO2001047976A1 publication Critical patent/WO2001047976A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405—Glucanases
    • C12N9/2408—Glucanases acting on alpha -1,4-glucosidic bonds
    • C12N9/2411—Amylases
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, amylase 8, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides.
  • ⁇ -amylase is a monomeric protein with a molecular weight of 57, 000 or 58, 000. It catalyzes the hydrolysis of 1,4- ⁇ -glycosides in starch-based polysaccharide substrates and can connect the maltose units of the non-reducing ends of starch long chains. Continuous removal. Beta-amylase is now found in some bacteria and plants.
  • the first conserved region is at the N-terminus of ⁇ -amylase, which contains an aspartic acid residue related to the contact reaction mechanism.
  • the second conserved sequence is located relatively centrally, centered on a glutamate that is involved in the contact response mechanism. If the aspartic acid and glutamic acid residues are substituted at the same time, it will lead to the complete loss of ⁇ -amylase catalytic activity, but it does not prevent its ability to bind to the substrate analog. We use these two regions as the signal pattern.
  • Starch granules are stored in the matrix of the plastids, either in the chloroplasts or in the amyloplasts. Plants obtain energy by gradually breaking down starch, and animals can obtain energy and carbon sources by ingesting starch in plants. This time, two active sites in the conserved sequence of ⁇ -amylase were discovered, which destroyed the active site, and the catalytic activity of the enzyme was reduced, which is helpful for understanding the degradation pathway of starch polysaccharides.
  • amylase 8 protein plays an important role in important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more amylase 8 proteins involved in these processes, especially to identify this. Amino acid sequence of several proteins. The isolation of the new amylase 8 protein encoding gene also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is important.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding an amylase 8.
  • Another object of the present invention is to provide a method for producing amylase 8.
  • Another object of the present invention is to provide an antibody against amylase 8 which is a polypeptide of the present invention.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, amylase 8.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to amylase 8 abnormalities.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 126-356 in SEQ ID NO: 1; and (b) a sequence having 1-921 in SEQ ID NO: 1 Sequence of bits.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of amylase 8 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of amylase 8 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting the The amount or biological activity of the polypeptide of the invention.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the invention also relates to the polypeptides and / or polynucleotides of the invention in the preparation for the treatment of cancer, developmental diseases Or the use of drugs for immune diseases or other diseases caused by abnormal expression of amylase 8.
  • Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.
  • Fig. 1 is a comparison diagram of amino acid sequence homology of amylase 8 of the present invention at 47-54 in total of 47 amino acids and domain amylase active site sequence fragments.
  • the upper sequence is amylase 8 and the lower sequence is the amylase active site sequence domain.
  • ⁇ "and”: “and”. “Indicate that the probability of the same amino acid appearing between two sequences decreases in sequence.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated amylase 8. 8kDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to natural, recombinant or synthetic proteins and fragments thereof in suitable The ability to induce a specific immune response in an animal or cell and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with amylase 8, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate or any other molecule that can bind amylase 8.
  • Antagonist refers to a molecule that, when combined with amylase 8, can block or regulate the biological or immunological activity of amylase 8.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind amylase 8.
  • Regular refers to a change in the function of amylase 8, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of amylase 8.
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify amylase 8 using standard protein purification techniques.
  • a substantially pure amylase 8 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of the amylase 8 peptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T
  • the complementarity between two single-stranded molecules can be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higgs, DG and PM Sharp (1988) Gene 73: 237-244). 0 The C lus ter method checks the distance between all pairs. The groups of sequences are arranged into clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: Number of residues that match between sequences
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in enzymology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
  • the "antisense strand” refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to HFP or a chemical modification of its nucleic acid. Such a chemical modification may be a substitution of a hydrogen atom with a fluorenyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of amylase 8.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated amylase 8 means that amylase 8 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify amylase 8 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the amylase 8 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, amylase 8, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of amylase 8.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the amylase 8 of the invention.
  • the fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) is one in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide ( Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protein sequence).
  • such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes a nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a full length of 921 bases, and its open reading frame 126-356 encodes 76 amino acids.
  • This polypeptide has a characteristic sequence of an amylase active site sequence fragment, and it can be deduced that the amylase 8 has the structure and function represented by the amylase active site sequence fragment.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • the term "polynucleotide encoding a polypeptide" is meant to include polynucleotides that encode such polypeptides and polynucleotides that include additional coding and / or noncoding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) added during hybridization) Use a denaturant, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42 ° C, etc .; or (3) the identity between the two sequences is at least 95% Above, it is more preferable that the hybridization occurs at 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding amylase 8.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the amylase 8 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or CDM libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DM sequence to obtain the double-stranded DM of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate raRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRM, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of amylase 8 transcripts; (4) immunization Technology or measurement of biological activity to detect gene-expressed protein products. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the amylase 8 gene.
  • a method using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using an amylase 8 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology.
  • the polynucleotide sequence encoding the amylase 8 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding an amylase 8 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • Drosophila S2 or Sf9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase, and treated with the ( 12 method, the steps used It is well known in the art.
  • MgCl 2 is used.
  • transformation can also be performed by electroporation.
  • the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • polynucleotide sequence of the present invention can be used to express or produce recombinant amylase 8 (Scence, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can be used to treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immunological diseases.
  • P-amylase can catalyze the hydrolysis of 1,4-cc-glycosidic linkages in starch-based polysaccharide substrates, and can continuously remove the maltose unit of the non-reducing end of the starch long chain.
  • the two active sites in the conserved sequence of ⁇ -amylase destroy the active site and the catalytic activity of the enzyme will decrease.
  • ⁇ -amylase-specific conserved sequences are required to form its active mot if. It can be speculated that digestive enzymes in the human body, muscle tissue, and liver tissue contain ⁇ -amylase-specific raot if, which can degrade amylase or degrade muscle glycogen and liver glycogen.
  • abnormal expression of the specific ⁇ -amylase mot if will cause abnormal function of the polypeptide containing the mot if of the present invention, resulting in abnormal degradation of muscle glycogen and liver glycogen, or abnormal digestive function of the body
  • the metabolism of carbohydrates is impaired, and related diseases such as glucose metabolism defects, organic acidemia tumors, and gastrointestinal dysfunctions are generated.
  • amylase 8 of the present invention will cause various diseases, especially glucose metabolism deficiency.
  • Pit disease, mucopolysaccharidosis and other marginal diseases, organic acidemia, gastrointestinal dysfunction, these diseases include but are not limited to:
  • Glucose deficiency congenital lactose intolerance, hereditary fructose intolerance, glycogen metabolic diseases such as glycogen storage disease
  • Organic acidemia propionic acidemia, methylmalonic aciduria, isovalerate, combined carboxylase deficiency, glutarate type I
  • Gastrointestinal Dysfunction Irritable Bowel Syndrome, Chronic Diarrhea, Gastrointestinal Dyspepsia
  • Mucopolysaccharidosis and other marginal diseases Mucopolysaccharidosis I ⁇ ⁇ , Mucopolysaccharidosis marginal diseases such as rheumatoid mucopolysaccharidosis, and mucolipid storage disease
  • the abnormal expression of the amylase 8 of the present invention will also cause certain genetic diseases and immune system diseases.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially glucose metabolism deficiency disease, mucopolysaccharidosis and other borderline diseases, organic acidemia Gastrointestinal dysfunction, certain genetic diseases and immune system diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or inhibit (antagonist) amylase 8.
  • Agonists increase biological functions such as amylase 8 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing amylase 8 can be cultured together with labeled amylase 8 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of amylase 8 include antibodies, compounds, receptor deletions, and the like that have been screened.
  • An antagonist of amylase 8 can bind to amylase 8 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform a biological function.
  • amylase 8 can be added to a bioanalytical assay to determine whether a compound is an antagonist by measuring its effect on the interaction between amylase 8 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to amylase 8 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the amylase 8 molecule should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against an amylase 8 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by directly injecting immunized animals (such as rabbits, mice, and rats) with amylase 8 Etc.), a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies to amylase 8 include, but are not limited to, hybridoma technology (Kohl er and Miste i n. Nature, 1975, 256: 495-497), triple tumor technology, human B-cell hybridoma technology , EBV-Hybridoma Technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morris on etal, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against amylase 8.
  • Anti-amylase 8 antibody can be used in immunohistochemistry to detect amylase in biopsy specimens
  • Monoclonal antibodies that bind to amylase 8 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • amylase 8 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of the antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill amylase 8 positive cells.
  • the antibodies in the present invention can be used to treat or prevent diseases related to amylase 8. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of amylase 8.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of amylase 8 levels.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of amylase 8 detected in the test can be used to explain the importance of amylase 8 in various diseases and to diagnose diseases in which amylase 8 functions.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding amylase 8 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of amylase 8.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant amylase 8 to inhibit endogenous amylase 8 activity.
  • a variant amylase 8 may be a shortened amylase 8 lacking a signaling domain, and although it can bind to a downstream substrate, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of amylase 8.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding amylase 8 into a cell. Building a Carrying Code Lake Methods for recombinant viral vectors of a powderase 8 polynucleotide can be found in the literature (Sambrook, etal.). In addition, the polynucleotide encoding the amylase 8 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit amylase 8 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis. The technology for synthesizing oligonucleotides has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • Polynucleotides encoding amylase 8 are useful in the diagnosis of diseases related to amylase 8.
  • Polynucleotides encoding amylase 8 can be used to detect the expression of amylase 8 or abnormal expression of amylase 8 in a disease state.
  • the DM sequence encoding amylase 8 can be used to hybridize biopsy specimens to determine the expression of amylase 8.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • polynucleotides of the present invention can be used as probes to be fixed on a micro array (Mi croar ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues .
  • RNA-polymerase chain reaction (RT-PCR) in vitro amplification using amylase 8 specific primers can also detect amylase 8 transcripts.
  • Amylase 8 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type amylase 8 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for labeling chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome. In short, PCR primers (preferably 15-35bp) are prepared according to CDM, and the sequences can be mapped on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders authorize them to be administered to humans by government agencies that manufacture, use, or sell them.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Amylase 8 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of amylase 8 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RM using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Sma rt cDNA cloning kit (purchased from C 1 on tech ⁇ cDNA fragment was inserted into the multiple cloning site of pBS (+) vector (Clontech)) to transform DH5a, and bacteria were used to form a cDNA library.
  • Dye terminate cycle reaction Sequencing kit Perkin-Elmer
  • ABI 377 automated sequencer Perkin-Elmer
  • the determined cDNA sequences were compared with existing public DM sequence databases (Genebank ), The result showed that the cloned cDNA sequence of one of the clones 0510F07 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragment of the clone in both directions.
  • the sequence of the amylase 8 of the present invention and the protein sequence encoded by the amylase 8 of the present invention were profiled using the GCG profile scan program (Basic local alignment search tool) [Altschul, SF et al.
  • domain analysis was performed in a database such as Proste.
  • the amylase 8 of the present invention is homologous with the domain amylase active site sequence fragment at 8-54.
  • the result of the homology is shown in Fig. 1.
  • the homology is 0.28, the score is 13.12;
  • Example 3 Cloning of a gene encoding amylase 8 by RT-PCR CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5'— GGAGAGCTTTTTAAAAAGACATCT -3 '(SEQ ID NO: 3)
  • Primer 2 5'- AAGGTATAATTTATTGGGGAACCG -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer 2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification reaction conditions 50 mmol / L KC1, 10 mmol / L Tris-HCl, pH 8.5, 1.5 mmol / L MgCl 2 , 200 ⁇ 1 / ⁇ dNTP, lOpmol primer, 1U Taq DM polymerase in a 50 ⁇ 1 reaction volume (Clontech).
  • the reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • ⁇ -actin was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector using a TA cloning kit (Invitrogen).
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-921bp shown in SEQ ID NO: 1.
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • Primer3 5'- CCCCATATGATGCCAACTATATCCACCTACCAA -3 '(Seq ID No: 5)
  • Pr imer4 5'- CCCAAGCTTTCAAGGCTGCAGTGAGCCATGATT -3 '(Seq ID No: 6)
  • the two ends of the two primers contain Ndel and Hindl ll digestion sites, respectively, followed by the coding of the target gene 5, and 3' Sequences, Ndel and Hindl11 restriction sites correspond to selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen Corporation, Cat. No. 69865. 3).
  • PCR was performed using the PBS-0510F07 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0510F07 plasmid, primers Primer-3 and Primer-4 were 10 pmol, and Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and Hindl11 were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligated product was transformed into Escherichia coli DH5 cc using the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 30 ⁇ ⁇ / ⁇ 1), positive clones were selected by colony PCR method and sequenced. A positive clone (PET-0510F07) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • the host bacteria BL21 (pET-0510F07) was cultured at 37 ° C to the logarithmic growth phase, IPTG was added to the final concentration lmraol / L, and continued Incubate for 5 hours. The cells were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His s. Bind Quick Cartr idge (product of Novagen) was used to bind 6 histidines (6His-Tag). By chromatography, a purified protein amylase 8 was obtained.
  • a peptide synthesizer (product of PE company) was used to synthesize the following amylase 8-specific peptides:
  • the titer of antibody in rabbit serum was determined by ELISA using a titer plate coated with 15 ⁇ ⁇ / ⁇ 1 bovine serum albumin polypeptide complex.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepharos B column and the anti-peptide antibody was separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to amylase 8.
  • Example 7 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter and then hybridize.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding sites of the sample on the filter with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered-.
  • the preferred range of probe size is 18-50 nucleotides
  • GC content is 30% -70%, if it exceeds, non-specific hybridization increases
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
  • Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt)
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe for subsequent experiments.
  • the film is washed with high-strength conditions and strength conditions, respectively.
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (1 OxDenhardt-s; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
  • prehybridization solution 1 OxDenhardt-s; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)
  • probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
  • Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of fast, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as the target DM, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from normal liver and liver cancer in one step, and mRNA was purified with Oligotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP (5- Amino- propargy l-2 ' -deoxyur idine 5 '-tr iphate coupled to Cy3 f luorescent dye (purchased from Amersham Pharaacia Biotech) was used to label the mRNA of normal liver tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargy 1-2- -deoxyur i dine 5'- tr iphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamac ia Biotech) labeled liver cancer tissue mRNA, Probes were prepared after purification. For specific steps and methods, see
  • the probes from the two types of tissues and the chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1> ⁇ SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray.
  • the 3000 scanner purchased from General Scanning, USA was used for scanning.
  • the scanned image was analyzed by Imagene software (Biodiscovery, USA), and the Cy3 / Cy5 ratio of each point was calculated. The points whose ratio was less than 0.5 and greater than 2 were scanned. It is considered to be a gene whose expression is different.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une amylase 8, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour l'amylase 8.
PCT/CN2000/000683 1999-12-27 2000-12-25 Nouveau polypeptide, amylase 8, et polynucleotide codant pour ce polypeptide WO2001047976A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU21445/01A AU2144501A (en) 1999-12-27 2000-12-25 A novel polypeptide-amylase 8 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 99125359 CN1301817A (zh) 1999-12-27 1999-12-27 一种新的多肽——淀粉酶8和编码这种多肽的多核苷酸
CN99125359.0 1999-12-27

Publications (1)

Publication Number Publication Date
WO2001047976A1 true WO2001047976A1 (fr) 2001-07-05

Family

ID=5283886

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000683 WO2001047976A1 (fr) 1999-12-27 2000-12-25 Nouveau polypeptide, amylase 8, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1301817A (fr)
AU (1) AU2144501A (fr)
WO (1) WO2001047976A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0377090A1 (fr) * 1989-01-03 1990-07-11 Jkl Rohema Maschinenbau Gmbh Dispositif pour enfiler des objets munis d'une bouche de suspension
JPH09289893A (ja) * 1996-04-26 1997-11-11 Rikagaku Kenkyusho 耐熱性アミラーゼ遺伝子

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0377090A1 (fr) * 1989-01-03 1990-07-11 Jkl Rohema Maschinenbau Gmbh Dispositif pour enfiler des objets munis d'une bouche de suspension
JPH09289893A (ja) * 1996-04-26 1997-11-11 Rikagaku Kenkyusho 耐熱性アミラーゼ遺伝子

Also Published As

Publication number Publication date
CN1301817A (zh) 2001-07-04
AU2144501A (en) 2001-07-09

Similar Documents

Publication Publication Date Title
WO2001048168A1 (fr) Nouveau polypeptide, gamma1-pyroline-5-hydroxy reductase 14, et polynucleotide codant pour ce polypeptide
WO2001047976A1 (fr) Nouveau polypeptide, amylase 8, et polynucleotide codant pour ce polypeptide
WO2001049857A1 (fr) Nouveau polypeptide, serine transhydroxymethylase 15, et polynucleotide codant pour ce polypeptide
WO2001055404A1 (fr) Nouveau polypeptide, alcool deshydrogenase humaine 39, et polynucleotide codant pour ce polypeptide
WO2001048221A1 (fr) Nouveau polypeptide, colipase 12, et polynucleotide codant pour ce polypeptide
WO2001053492A1 (fr) Nouveau polypeptide, s-adenosylmethionine synthetase 31, et polynucleotide codant pour ce polypeptide
WO2001048220A1 (fr) Nouveau polypeptide, serine protease 15, et polynucleotide codant pour ce polypeptide
WO2001094593A1 (fr) Nouveau polypeptide, glycero-3-phosphate deshydrogenase humaine 11, et polynucleotide codant ce polypeptide
WO2001055402A1 (fr) Nouveau polypeptide, succinyl-coa synthetase 51 atp specifique, et polynucleotide codant pour ce polypeptide
WO2001046250A1 (fr) Nouveau polypeptide, triose phosphate isomerase 9, et polynucleotide codant pour ce polypeptide
WO2001046430A1 (fr) Nouveau polypeptide, peroxydase 12, et polynucleotide codant pour ce polypeptide
WO2001071003A1 (fr) Nouveau polypeptide, serine protease humaine 8, et polynucleotide codant pour ce polypeptide
WO2001085923A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 9.2, et polynucleotide codant pour ce polypeptide
WO2001087943A1 (fr) Protease a serine 13 atp-dependante, polypeptide humain, et polynucleotide le codant
WO2001047980A1 (fr) Nouveau polypeptide, dihydrodipicolinate synthase 9, et polynucleotide codant pour ce polypeptide
WO2001090376A1 (fr) Nouveau polypeptide, triose phosphate isomerase humaine 11, et polynucleotide codant ce polypeptide
WO2001094403A1 (fr) Nouveau polypeptide, sous-unite de proteine d'activation de la transcription humaine 14, et polynucleotide codant ce polypeptide
WO2001048206A1 (fr) Nouveau polypeptide, facteur d'inhibition de proteinase humain 12, et polynucleotide codant pour ce polypeptide
WO2001049732A1 (fr) Nouveau polypeptide, transglutaminase 10, et polynucleotide codant pour ce polypeptide
WO2001094592A1 (fr) Nouveau polypeptide, aldehyde/cetone reductase humaine 10.1, et polynucleotide codant ce polypeptide
WO2001048210A1 (fr) Nouveau polypeptide, tyrosinase 10, et polynucleotide codant pour ce polypeptide
WO2001040287A1 (fr) Nouveau polypeptide, sous-unite beta 10 de la pompe a sodium, et polynucleotide codant pour ce polypeptide
WO2001048218A1 (fr) Nouveau polypeptide, proteine muts 13, et polynucleotide codant pour ce polypeptide
WO2001087944A1 (fr) Proteine 10, polypeptide humain caracterise en ce qu'il contient la sequence de la gamma glutamyl transpeptidase, et polynucleotide codant ce polypeptide
WO2001055373A1 (fr) Nouveau polypeptide, capside proteine vp4, 13, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP