WO2001049863A1 - Nouveau polypeptide, ribulose bisphosphate carboxylase humaine 11, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, ribulose bisphosphate carboxylase humaine 11, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001049863A1 WO2001049863A1 PCT/CN2000/000657 CN0000657W WO0149863A1 WO 2001049863 A1 WO2001049863 A1 WO 2001049863A1 CN 0000657 W CN0000657 W CN 0000657W WO 0149863 A1 WO0149863 A1 WO 0149863A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- human
- sequence
- diphosphate carboxylase
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human ribulose dicarboxylate carboxylase ⁇ , and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing the polynucleotide and polypeptide.
- Ribulose diphosphate carboxylase catalyzes the first step in the Calvin reduction cycle of pentose phosphate. We now find that this enzyme also functions as an oxygenase. During the solidification of carbon by photosynthesis, ribulose diphosphate carboxylase catalyzes the key carboxylation reaction; at the same time, in photorespiration, it can also catalyze the oxygenated competition by replacing 02 with 02 as a substrate sexual response (Miz i orko HM, Lor imer GH 1983 Annu. Rev. Biochem).
- ribulose diphosphate carboxylase in both catalytic reactions requires an activation process.
- carbon dioxide is involved
- a lysine residue on the large subunit unit reacts with a CO2 molecule as a catalyst
- an unstable carbamate compound lys ine-NH-C02
- the activated enzyme molecule binds to the substrate and is subsequently carboxylated by CO2 or oxidized by 02.
- the urethane compound itself is unstable and is stabilized by a magnesium ion.
- the ⁇ -amino terminal of the carbamate contains a conserved lysine residue.
- One of the ligands of the magnesium ion is an aspartic acid residue, which is close to the lysine active site.
- the position of the metal ion at the active site is near the bottom middle nder s son I., 1989 Nature 337: 229-234).
- the ribulose diphosphate carboxylase contains a large number of catalytic units. In plants, the large subunit is encoded by the chloroplast genome, while the small subunit is encoded by the nuclear genome. We studied the unique gene sequence in the long chain of ribulose diphosphate carboxylase and found that it contains both active site amino acid residues and metal ligands.
- the second D is a magnesium ion ligand
- Ribulose diphosphate carboxylase catalyzes the carboxylation reaction in the Calvin cycle C02 curing--a reaction that stores energy captured during photosynthesis, and also catalyzes the initial oxidation reaction in photorespiration--a A reaction that converts most of the stored energy into heat, this Photorespiration constitutes a serious depletion of chloroplast metabolism.
- the description of the active site of ribulose diphosphate carboxylase helps to make use of genetic engineering principles and techniques to make the enzyme more effective in catalyzing the carboxylation reaction than the oxygenation reaction on a reasonable basis, thereby improving the Yield.
- polypeptide of the present invention has been putatively identified as human ribulose diphosphate carboxylase 11.
- An object of the present invention is to provide an isolated novel polypeptide, human ribulose diphosphate carboxylase 11 and another object of the present invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human ribulose diphosphate carboxylase 11.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human ribulose diphosphate carboxylase 11.
- Another object of the present invention is to provide a method for producing human ribulose diphosphate carboxylase 11.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human ribulose diphosphate carboxylase 11.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, human ribulose diphosphate carboxylase 11.
- Another object of the present invention is to provide a method for diagnosing and treating a disease associated with abnormality of human ribulose diphosphate carboxylase 11. Summary of invention
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 494-784 in SEQ ID NO: 1; and (b) a sequence having 1-1660 in SEQ ID NO: 1 Sequence of bits.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- a vector in particular an expression vector, containing the polynucleotide of the invention
- a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
- a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human ribulose diphosphate carboxylase 11 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of human ribulose diphosphate carboxylase 11 protein in vitro, comprising detecting mutations in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample Or detecting the amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the preparation of a polypeptide and / or polynucleotide of the present invention for the treatment of cancer, developmental disease or immune disease or other medicines caused by abnormal expression of human ribulose diphosphate carboxylase 1 1. use.
- FIG. 1 is a comparison diagram of amino acid sequence homology of a total of 76 amino acids and domains of ribulose diphosphate carboxylase 11 at 1-76 of the present inventor.
- the upper sequence is human ribulose diphosphate carboxylase 11 and the lower sequence is ribulose diphosphate carboxylase domain.
- "Means in The probability that the same amino acid appears between the two sequences decreases in order.
- Figure 2 shows the polyacrylamide gel electrophoresis of isolated human ribulose diphosphate carboxylase 11 (SDS-PAGE l lkDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
- Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DM or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with human ribulose diphosphate carboxylase 11, can cause the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human ribulose diphosphate carboxylase 11.
- Antagonist refers to a biological or immunological activity that can block or regulate human ribulose diphosphate carboxylase 11 when combined with human ribulose diphosphate carboxylase 11 Molecule.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other bindable human ribulose diphosphate Molecule of carboxylase 11.
- Regular refers to a change in the function of human ribulose diphosphate carboxylase 11, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological activity of human ribulose dicarboxylase 11 Changes in nature, function, or immune properties.
- substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human ribulose diphosphate carboxylase using standard protein purification techniques
- Substantially pure human ribulose diphosphate carboxylase 11 produces a single main band on a non-reducing polyacrylamide gel.
- the purity of human ribulose diphosphate carboxylase 11 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T
- the complementarity between two single-stranded molecules can be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Cluster method (Hi gg ins, D. G. and P. M. Sharp (1988) Gene 73: 237-244). The Cl uster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence ⁇ and sequence A
- the number of residues in sequence ⁇ -the number of spacer residues in the sequence-the number of spacer residues X in the sequence ⁇ can also be determined by the Clus ter method or by a method known in the art such as Jotun He in. in J "(1990) Methods in enzymo logy 183: 625-645). "Similarity” refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DM or RM sequence.
- the "antisense strand” refers to a nucleic acid strand that is complementary to the “sense strand”.
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to an intact antibody molecules and fragments thereof, such as Fa, F (a b ') 2 and F V, which specifically binds to human ribulose bisphosphate carboxylase 11 antigenic determinants.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist in the natural system.
- Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
- isolated human diphosphate ribulose carboxylase 11 means that human diphosphate ribulose carboxylase 11 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human ribulose diphosphate carboxylase 11 using standard protein purification techniques. Essentially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human ribulose diphosphate carboxylase 11 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human ribulose diphosphate carboxylase 11, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a Into a polypeptide, preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human ribulose dicarboxylase carboxylase 11.
- fragment refers to a polypeptide that substantially retains the same biological function or activity of the human ribophosphate dicarboxylase 11 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
- Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
- a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify this polypeptide or protein sequence).
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes a nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1,660 bases in length, and its open reading frame (494-784) encodes 96 amino acids.
- This peptide has the characteristic sequence of ribulose diphosphate carboxylase, and it can be deduced that the human ribulose diphosphate carboxylase 11 has the structure and function represented by ribulose diphosphate carboxylase.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- the DM can be a coding chain or a non-coding chain.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant” refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- the term "polynucleotide encoding a polypeptide" is meant to include polynucleotides that encode such polypeptides and polynucleotides that include additional coding and / or noncoding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
- These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (with at least two sequences between
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60'C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fi co ll, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human ribulose diphosphate carboxylase 11.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding human ribulose diphosphate carboxylase 11 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- Q i agene There are many mature techniques for mRNA extraction, and kits are also commercially available (Q i agene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the transcript of human ribulose diphosphate carboxylase 11 Level; (4) detecting protein products of gene expression by immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein product expressed by the human ribulose diphosphate carboxylase 11 gene can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- a method using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-rapid cDNA end rapid amplification method
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human ribulose diphosphate carboxylase 11 coding sequence, and that the present invention is produced by recombinant technology Said method of polypeptide.
- a polynucleotide sequence encoding human ribulose diphosphate carboxylase 11 can be inserted into a vector In order to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human ribulose diphosphate carboxylase 11 and suitable transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human ribulose diphosphate carboxylase 11 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetic engineering containing the polynucleotide or the recombinant vector.
- Host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower true Nuclear cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf 9
- animal cells such as CH0, COS, or Bowes s melanoma cells, etc. .
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of DNA uptake can be harvested after exponential growth phase, with (: Treatment 1 2, steps well known in the art with alternative is MgC l 2
- transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and lipid Body packaging, etc.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human ribulose diphosphate carboxylase 1 1 (Sc ience, 1984; 224: 1 4 31). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can be used to treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immunological diseases.
- the ribulose diphosphate carboxylase catalyzes the first step in the Calvin reduction cycle of pentose phosphate.
- This enzyme also functions as an oxygenase in plants.
- the pentose phosphate cycle is a substance in the tricarboxylic acid cycle The key link of mass flow and energy flow. Disturbances in this cycle can disrupt the cycle of cellular material and energy, leading to various metabolic diseases. According to investigations, Alzheimer's disease has also been linked to disturbances in the tricarboxylic acid cycle.
- human ribulose diphosphate carboxylase 11 of the present invention will produce various diseases, especially Alzheimer's disease, disorders of energy and material metabolism, disorders of embryonic development, and disorders of growth and development.
- Diseases, various tumors, these diseases include but are not limited to:
- Disorders related to energy and substance metabolism disorders isovaleric acidemia, propionic acidemia, methylmalonic aciduria, combined carboxylase deficiency, glutaric acid type I, phenylketonuria, albinism, color Aminoemia, Glycineemia, Hypersarcosineemia, Defective Metabolism of Glutamate, Metabolism Defective Disease of Urea Cycle, Defective Disease of Histidine Metabolism, Defective Lysine Metabolism, Mucopolysaccharidosis I ⁇ ⁇ , Mucolipid storage disease, Ray-niney syndrome, xanthineuria, orotic aciduria, adenine hyperlipoproteinemia, congenital lactose intolerance, galactoseemia, fructose metabolism deficiency, glycogen Storage disease
- Embryonic disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney, double ureter, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, suburethral Fissure, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris defect, congenital cataract, congenital glaucoma or cataract, congenital deafness
- Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
- Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasal cavity and sinus cancer, nasopharyngeal cancer, Laryngeal cancer, tracheal tumor, fibroma, fibrosarcoma, lipoma, liposarcoma, leiomyoma
- human diphosphate ribulose carboxylase 11 of the present invention will also generate certain inflammations, certain genetic, hematological diseases, and immune system diseases.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases Treatment, for example, can treat various diseases, especially Alzheimer's disease, disorders of energy and material metabolism, embryonic developmental disorders, disorders of growth and development, various tumors, certain inflammations, certain hereditary, blood Sexually transmitted diseases and immune system diseases.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human ribulose diphosphate carboxylase 1 1.
- Agonists enhance biological functions such as human ribulose diphosphate carboxylase stimulating cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
- mammalian cells or human ribose diphosphate carboxylase can be expressed in the presence of drugs
- the membrane preparation of 1 1 was cultured with labeled human ribulose diphosphate carboxylase 1 1. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human ribulose diphosphate carboxylase 11 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human ribulose diphosphate carboxylase 11 can bind to human ribulose diphosphate carboxylase 11 1 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide Disabling the polypeptide from performing a biological function.
- human ribulose diphosphate carboxylase 11 When screening compounds as antagonists, human ribulose diphosphate carboxylase 11 can be added to a bioanalytical assay, and the interaction between human ribulose diphosphate carboxylase 11 and its receptor can be determined by measuring the compound Influence to determine if a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human ribulose diphosphate carboxylase 1 1 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, the molecule of human ribulose diphosphate carboxylase 11 should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies directed against the human ribulose diphosphate carboxylase 11 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human diphosphate ribose carboxylase ⁇ directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant, etc.
- Techniques for preparing monoclonal antibodies to human ribulose diphosphate carboxylase 11 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human Beta-cell hybridoma technology, EBV-hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies US Pat No. 4946778, It can also be used to produce single chain antibodies against human ribulose diphosphate carboxylase 11.
- Antibodies against human ribulose diphosphate carboxylase 11 can be used in immunohistochemical techniques to detect human ribulose diphosphate carboxylase 11 in biopsy specimens.
- Monoclonal antibodies that bind to human ribulose diphosphate carboxylase 11 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
- This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- Such as human ribulose diphosphate carboxylase 11 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human ribodiphosphate carboxylase 11 positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases related to human ribulose diphosphate carboxylase 11.
- Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human ribulose diphosphate carboxylase 11.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human ribulose diphosphate carboxylase 11 levels.
- tests are well known in the art and include FI SH assays and radioimmunoassays.
- the level of human ribulose diphosphate carboxylase 11 detected in the test can be used to explain the importance of human ribulose diphosphate carboxylase 11 in various diseases and to diagnose human ribulose diphosphate carboxylase Diseases at which enzyme 11 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- Polynucleotides encoding human ribulose diphosphate carboxylase 11 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by non-expression or abnormal / inactive expression of human ribulose diphosphate carboxylase 11.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human diphosphate ribulose carboxylase 11 to inhibit endogenous human diphosphate ribulose carboxylase 11 activity.
- a variant human diphosphate ribulose carboxylase 11 may be a shortened human diphosphate ribulose carboxylase 11 lacking a signaling domain. Although it can bind to downstream substrates, it lacks Signaling activity.
- the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human ribulose diphosphate carboxylase 11.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to encode human diphosphate
- the ribulose carboxylase 1 1 polynucleotide is transferred into the cell.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding human ribulose diphosphate carboxylase 11 can be found in the existing literature (Sambrook, et al.).
- a recombinant polynucleotide encoding human ribulose diphosphate carboxylase 11 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RM and DNA
- ribozymes that inhibit human ribulose diphosphate carboxylase 11 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RM molecule that can specifically decompose a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained using any existing RM or DNA synthesis technology. For example, solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides has been widely used.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human ribulose diphosphate carboxylase 11 can be used for the diagnosis of diseases related to human ribulose diphosphate carboxylase 11.
- Polynucleotides encoding human ribulose diphosphate carboxylase 11 can be used to detect the expression of human ribulose diphosphate carboxylase 11 or abnormal expression of human ribulose diphosphate carboxylase 11 in disease states .
- the DNA sequence encoding human ribulose diphosphate carboxylase 11 can be used to hybridize biopsy specimens to determine the expression of human ribulose diphosphate carboxylase 11.
- Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization.
- polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- Human ribose diphosphate carboxylase 11 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect the transcription products of human ribulose diphosphate carboxylase 11.
- Detection of mutations in the human ribulose diphosphate carboxylase 1 1 gene can also be used to diagnose human ribophosphate dicarboxylase 1 1 -related diseases.
- Human ribose diphosphate carboxylase 11 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human ribulose diphosphate carboxylase 11 DNA sequence. Available techniques such as Southern blotting, DNA sequence analysis, PCR, and Detect mutations.
- mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be combined with Use in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human ribulose diphosphate carboxylase 11 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and dose range of human ribulose diphosphate carboxylase 11 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik mRNA I solat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
- a Smart cDM cloning kit (purchased from Clontech) was used to orient the cDNA fragment into the multicloning site of the pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cDNA library.
- the sequences at the 5 'and 3' ends of all clones were determined using Dye terminate cyc le react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer).
- the determined cDNA sequence was compared with an existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0541al l was a new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- the 0541al l clone contains a full-length cDNA of 1660bp (as shown in Seq ID N0: 1), and has a 291bp open reading frame (0RF) from 4 ⁇ bp to 78 4 b P , encoding a new Protein (as shown in Seq ID NO: 2).
- This clone pBS-0541all and the encoded protein was named human ribulose diphosphate carboxylase 11
- Example 2 cDNA Analysis of the cloned domain
- the human diphosphate ribulose carboxylase 11 sequence of the present invention and its encoded protein sequence were subjected to a profile scan program (Basic local alignment search tool) in GCG [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], performing domain analysis in databases such as Prote.
- the human ribulose diphosphate carboxylase 11 of the present invention is homologous to the domain diphosphate ribulose carboxylase at 1-76, and the homology result is shown in FIG. 1.
- the homology rate is 35%, and the score is 16.15. Threshold value is 15.10.
- Example 3 Cloning of the gene encoding human ribulose diphosphate carboxylase 11 by RT-PCR.
- the total RNA of fetal brain cells was used as a template, and oligo-dT was used as a primer for reverse transcription to synthesize cDNA. After purification of the kit, PCR amplification was performed with the following primers
- Primerl 5-ATAGAGATATAGAAATATTCTTGT-3 '(SEQ ID NO: 3)
- Primer2 5'- GACCACGCCATTGCACTCCAGCCT- 3 '(SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification reaction conditions 50 ⁇ l reaction volume containing 50 ol / L KC1, 10 mmol / L Tris- HC1, pH 8.5, 1.5 mmol / L MgCl 2 , 200 ⁇ 1 / ⁇ dNTP, lOpmol primer, 1U Taq DM polymerization
- the enzyme (Clontech) was reacted on a PE9600 DM thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 C 30sec; 55 C 30sec; 72 C 2min.
- RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen product) using a TA cloning kit.
- DM sequence analysis results showed that the DNA sequence of the PCR product was identical to l-1660bp shown in SEQ ID NO: 1.
- Example 4 Northern blot analysis of human ribulose diphosphate carboxylase 11 gene expression Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0 This method includes acid guanidine thiocyanate phenol-chloroform Extraction.
- the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- RNA containing 20raM 3- (N- Morpholine) Propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde was run on a 1.2% agarose gel. It was then transferred to a nitrocellulose membrane.
- the DM probe used was the PCR amplified human ribulose diphosphate carboxylase 11 coding region sequence (494bp to 784bp) shown in FIG. 1.
- a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 ( ⁇ 7.4)-5 x SSC- 5 x Denhardt, s solution and 200 ⁇ ⁇ ⁇ 1 salmon sperm DNA. After hybridization, the filters were placed in 1 X SSC-0.1% SDS at 55. C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 5 In vitro expression, isolation and purification of recombinant human ribulose diphosphate carboxylase 11 According to the sequence of the coding region shown in SEQ ID NO: 1 and FIG. 1, a pair of specific amplification primers were designed, the sequence is as follows:
- Primer3 5'- CCCCATATGATGGGTTTTTCTGCTAAAGCTTTA- 3 '(Seq ID No: 5)
- Primer4 5'— CATGGATCCTTAAACAATTGGAATCAAGGTCCT— 3' (Seq ID No: 6)
- the Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
- PCR was performed using the pBS-0541all plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0541all plasmid, Primer-3 and Primer-4 were lpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94. C 20s, 60. C 30s, 68. C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into colibacillus DH5C by the calcium chloride method.
- a peptide synthesizer (product of PE company) was used to synthesize the following human diphosphate ribose carboxylase 11 specific peptides:
- a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
- Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose.
- the peptide was bound to a cyanogen bromide-activated Seph a r0 S e4B column, and the anti-peptide antibody was separated from the total IgG by affinity chromatography.
- the immunoprecipitation method proved that the purified antibody could specifically bind to human ribulose diphosphate carboxylase 11.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
- Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt)
- Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (lOxDenhardt-s; 6xSSC, 0.1 mg / ral CT DM (calf thymus DM)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
- prehybridization solution lOxDenhardt-s; 6xSSC, 0.1 mg / ral CT DM (calf thymus DM)
- Gene chip or gene micro matrix (DNA Mi croarray) is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high density arrangement of a large number of target gene fragments on glass. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature. See, for example, DeR i s i, J. L., Lyer, V. & Brown, P. 0.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between the points is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DM on the glass slide to prepare chips. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are: 1. Hydration in a humid environment for 4 hours;
- Total mRM was extracted from normal liver and liver cancer in one step, and mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
- the fluorescent reagent Cy3dUTP (5- Amino- propargyl-2'-deoxyur idine 5 ' -triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech) mRNA labeled with normal liver tissue
- Cy5dUTP (5-Araino-propargyl-2'-deoxyur idine 5'-triphate coupled to Cy5 fluorescent dye, purchased from fluorescent reagent, purchased from (Amersham Phamacia Biotech) was used to label liver cancer tissue mRNA, and the probe was prepared after purification.
- the probes from the two types of tissues and the chip were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (lx SSC, 0.2% SDS) at room temperature and scanned with ScanArray 3000. Instrument (purchased from General Scanning Company, USA) for scanning, and the scanned image was analyzed and processed with Imagene software (Biodiscovery Company, USA), and the Cy3 / Cy5 ratio of each point was calculated. The points with the ratio less than 0.5 and greater than 2 were considered as Differentially expressed genes.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU21428/01A AU2142801A (en) | 1999-12-29 | 2000-12-25 | Novel polypeptide---human ribulose bisphosphate carboxylase 11 and polynucleotide encoding it |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 99127210 CN1301853A (zh) | 1999-12-29 | 1999-12-29 | 一种新的多肽——人二磷酸核酮糖羧化酶11和编码这种多肽的多核苷酸 |
CN99127210.2 | 1999-12-29 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001049863A1 true WO2001049863A1 (fr) | 2001-07-12 |
Family
ID=5284798
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2000/000657 WO2001049863A1 (fr) | 1999-12-29 | 2000-12-25 | Nouveau polypeptide, ribulose bisphosphate carboxylase humaine 11, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1301853A (fr) |
AU (1) | AU2142801A (fr) |
WO (1) | WO2001049863A1 (fr) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4962028A (en) * | 1986-07-09 | 1990-10-09 | Dna Plant Technology Corporation | Plant promotors |
CN1225133A (zh) * | 1996-05-09 | 1999-08-04 | 日本制纸株式会社 | 标记基因可从其上选择性地去除的用于将基因导入植物的载体 |
-
1999
- 1999-12-29 CN CN 99127210 patent/CN1301853A/zh active Pending
-
2000
- 2000-12-25 AU AU21428/01A patent/AU2142801A/en not_active Abandoned
- 2000-12-25 WO PCT/CN2000/000657 patent/WO2001049863A1/fr active Application Filing
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4962028A (en) * | 1986-07-09 | 1990-10-09 | Dna Plant Technology Corporation | Plant promotors |
CN1225133A (zh) * | 1996-05-09 | 1999-08-04 | 日本制纸株式会社 | 标记基因可从其上选择性地去除的用于将基因导入植物的载体 |
Also Published As
Publication number | Publication date |
---|---|
AU2142801A (en) | 2001-07-16 |
CN1301853A (zh) | 2001-07-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001068694A1 (fr) | Nouveau polypeptide, proteine humaine d'hexokinase 10, et polynucleotide codant pour ce polypeptide | |
WO2001068689A1 (fr) | Nouveau polypeptide, 1alpha sous-unite 13 humaine du facteur adaptatif de l'hypoxie, et polynucleotide codant pour ce polypeptide | |
WO2001048168A1 (fr) | Nouveau polypeptide, gamma1-pyroline-5-hydroxy reductase 14, et polynucleotide codant pour ce polypeptide | |
WO2001072815A1 (fr) | Nouveau polypeptide, ferredoxine humaine 12, et polynucleotide codant pour ce polypeptide | |
WO2001049863A1 (fr) | Nouveau polypeptide, ribulose bisphosphate carboxylase humaine 11, et polynucleotide codant pour ce polypeptide | |
WO2001055404A1 (fr) | Nouveau polypeptide, alcool deshydrogenase humaine 39, et polynucleotide codant pour ce polypeptide | |
WO2001066707A1 (fr) | Nouveau polypeptide, serine protease humaine atp-dependante 11, et polynucleotide codant pour ce polypeptide | |
WO2001075085A1 (fr) | Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.3, et polynucleotide codant pour ce polypeptide | |
WO2001072986A1 (fr) | Nouveau polypeptide, serine hydrolase humaine atp-dependante 10, et polynucleotide codant pour ce polypeptide | |
WO2001098488A1 (fr) | Nouveau polypeptide, sous-unite 24 de flavoproteine humaine, et polynucleotide codant ce polypeptide | |
WO2001046431A1 (fr) | Nouveau polypeptide, catalase 10, et polynucleotide codant pour ce polypeptide | |
WO2001092541A1 (fr) | Nouveau polypeptide, catalase 12, et polynucleotide codant ce polypeptide | |
WO2001046430A1 (fr) | Nouveau polypeptide, peroxydase 12, et polynucleotide codant pour ce polypeptide | |
WO2001087943A1 (fr) | Protease a serine 13 atp-dependante, polypeptide humain, et polynucleotide le codant | |
WO2001072972A1 (fr) | Nouveau polypeptide, ribulose-biphosphate carboxylase humaine 8, et polynucleotide codant pour ce polypeptide | |
WO2001048008A1 (fr) | Nouveau polypeptide, ribulose-bisphophate carboxylase (rubisco) 13, et polynucleotide codant pour ce polypeptide | |
WO2001048001A1 (fr) | Nouveau polypeptide, quinone-proteine reductase 7, et polynucleotide codant pour ce polypeptide | |
WO2001073066A1 (fr) | Nouveau polypeptide, serine hydrolase atp-dependante humaine 10.1, et polynucleotide codant pour ce polypeptide | |
WO2001048012A1 (fr) | Nouveau polypeptide, sous-unite i-11 de nadh-deshydrogenase, et polynucleotide codant pour ce polypeptide | |
WO2001047984A1 (fr) | Nouveau polypeptide, proteine 10 de la famille des amidases, et polynucleotide codant pour ce polypeptide | |
WO2001075126A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s18-9, et polynucleotide codant pour ce polypeptide | |
WO2001090171A1 (fr) | Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide | |
WO2001083681A2 (fr) | Nouveau polypeptide, dihydroorotase humaine 21, et polynucleotide codant pour ce polypeptide | |
WO2001048177A1 (fr) | Nouveau polypeptide, fumarate lyase 13, et polynucleotide codant pour ce polypeptide | |
WO2001075062A2 (fr) | Nouveau polypeptide, hydrogenase humaine 10, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |