WO2001012814A1 - Adn lie a la biosynthese ml-236b - Google Patents

Adn lie a la biosynthese ml-236b Download PDF

Info

Publication number
WO2001012814A1
WO2001012814A1 PCT/JP2000/005420 JP0005420W WO0112814A1 WO 2001012814 A1 WO2001012814 A1 WO 2001012814A1 JP 0005420 W JP0005420 W JP 0005420W WO 0112814 A1 WO0112814 A1 WO 0112814A1
Authority
WO
WIPO (PCT)
Prior art keywords
pcr
primer
sequence
nucleotide
seq
Prior art date
Application number
PCT/JP2000/005420
Other languages
English (en)
Japanese (ja)
Inventor
Yuki Abe
Masahiko Hosobuchi
Hiroji Yoshikawa
Original Assignee
Sankyo Company, Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sankyo Company, Limited filed Critical Sankyo Company, Limited
Priority to AU64758/00A priority Critical patent/AU6475800A/en
Publication of WO2001012814A1 publication Critical patent/WO2001012814A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria

Definitions

  • the present invention provides a DNA characterized by improving the ML-236B-producing ability of an HMG-CoA reductase inhibitor ML-236B-producing bacterium, a nucleic acid molecule that hybridizes with the DNA, A recombinant DNA vector incorporating the DNA, a host cell transformed with the recombinant DNA vector, a method for producing ML-236B, and a PCR designed based on the nucleotide sequence of the DNA.
  • a DNA characterized by improving the ML-236B-producing ability of an HMG-CoA reductase inhibitor ML-236B-producing bacterium, a nucleic acid molecule that hybridizes with the DNA, A recombinant DNA vector incorporating the DNA, a host cell transformed with the recombinant DNA vector, a method for producing ML-236B, and a PCR designed based on the nucleotide sequence of the DNA.
  • HMG—CoA reductase inhibitor pravastatin which is used clinically as a hyperlipidemia ameliorating agent, uses ML-236B produced by Penicillium citrinum for Streptomyces ′ (Streptomyces carbophilus) by microbial conversion (Endo, A., et al., J. Antibiot., 29, 1346 (1976): Matsuoka, S., et al., Eur. J. Biochem., 184, 707 (1989)).
  • pravastatin precursor ML-236B and the HMG-CoA inhibitor lovastatin which shares a partial structure with pravastatin, have been shown to be biosynthesized via polyketides (Moore, RN, et al.). al., J. Am. Chem. Soc., 107, 3694 (1955): described in Shiao, M. and Don, HS, Proc. Natl. Sci. Counc. ROC., 11, 223 (1987)).
  • Polyketide is a general term for compounds derived from 3-keto carbon chains resulting from the continuous condensation reaction of low molecular weight carboxylic acid residues such as acetic acid, propionic acid, and butyric acid.
  • PKS Polyketide synthase
  • the inventors cloned the gene or gene cluster of the enzyme responsible for ML-236B biosynthesis of Penicillium citrinum from the genomic DNA library of ML-236B-producing bacteria, and obtained It has been found that the productivity of TML-236B in the producing bacterium is improved by transforming the producing bacterium using the recombinant DNA vector thus obtained, and thus the present invention has been completed.
  • the present invention is a.
  • nucleotides represented by nucleotide numbers 1 to 324 of SEQ ID NO: 1 in the sequence listing A DNA comprising the sequence, wherein the DNA is introduced into a ML-236B-producing bacterium to improve the ML-236B-producing ability of the bacterium;
  • DNA characterized by the following:
  • a method for producing ML-236B comprising culturing the host cell according to (8) or (9), and then recovering ML-236B from the culture.
  • SEQ ID NO: 2 in the sequence listing a sequence consisting of at least 10 bases having 5'-terminal at the adenine at nucleotide number 2304 5 or at the 5'-side thereof. Having PCR primers Al,
  • a primer A2 having at least 70% homology with the nucleotide sequence of the primer A1 for PCR described in (13) and containing a sequence consisting of at least 10 bases (However, the PCR primer A2 has a N-terminal methionine residue coded by the nucleotide numbers 23045 to 23047 of SEQ ID NO: 2 in the sequence listing. Can be used for PCR to amplify cDNA encoding the peptide) '
  • a primer A3 for PCR having at least 80% homology with the nucleotide sequence of primer A1 for PCR described in (13) and containing a sequence consisting of at least 10 bases
  • the primer A3 for PCR is a polypeptide having a methionine residue encoded by a nucleotide number 23045 to 23047 of SEQ ID NO: 2 in the sequence listing as an N-terminal. Can be used for PCR to amplify cDNA),
  • a primer A4 for PCR having at least 90% homology with the nucleotide sequence of the primer A1 for PCR according to (13) and containing a sequence consisting of at least 10 bases
  • the primer A4 for PCR is a polypeptide having a methionine residue encoded by the nucleotide number 23045 to 23047 of SEQ ID NO: 2 in the sequence listing as an N-terminal. Can be used for PCR to amplify the encoding cDNA),
  • SEQ ID NO: 1 consisting of at least 10 bases with the 5'-terminal base of cytosine or 5'-side of the nucleotide number 1479 as the 5'-terminal A primer for PCR having a sequence B1,
  • a PCR primer B2 having at least 70% homology with the nucleotide sequence of the primer for PCR B1 according to (17), comprising a sequence consisting of at least 10 bases
  • the PCR primer B2 encodes a polypeptide having a C-terminal alanine residue encoded by the nucleotide numbers 32720 to 32272 of SEQ ID NO: 2 in the sequence listing. Can be used for PCR to amplify cDNA
  • a primer B3 for PCR containing a sequence consisting of at least 10 bases and having a homology of 80% or more with the nucleotide sequence of the primer B1 for PCR described in (17).
  • the primer B3 for PCR is a primer having a C-terminal alanine residue encoded by the nucleotide numbers 3227 to 32272 of SEQ ID NO: 2 in the sequence listing. Can be used for PCR to amplify cDNA encoding the peptide), (20) A PCR primer B4 having at least 90% homology with the nucleotide sequence of the PCR primer B1 according to (17) and containing a sequence consisting of at least 10 bases
  • the PCR primer B4 is a primer having a C-terminal alanine residue coded by nucleotide numbers 32720 to 32272 of SEQ ID NO: 2 in the sequence listing. Can be used for PCR to amplify cDNA encoding the peptide),
  • PCR primer C1 having
  • a primer for PCR C2 having a homology of 70% or more with the nucleotide sequence of primer C1 for PCR described in (21) and containing a sequence consisting of at least 10 bases
  • the primer C2 for PCR uses a polypeptide having a methionine residue encoded by the nucleotide number 11174 to 11750 of SEQ ID NO: 2 in the sequence listing as an N-terminal. Can be used for PCR to amplify the cDNA to be encoded),
  • a primer for PCR that has a homology of 80% or more with the nucleotide sequence of the primer C1 for PCR described in (21) and contains a sequence consisting of at least 10 bases C3
  • the primer for PCR is C3; a polymethod having an N-terminal methionine residue encoded by the nucleotide numbers 1 1 7 4 8 to 1 1 7 0 of SEQ ID NO: 2 in the sequence listing) It can be used for PCR to amplify cDNA that encodes a peptide
  • a primer for PCR that has a homology of 90% or more with the nucleotide sequence of the primer C1 for PCR described in (21) and contains a sequence consisting of at least 10 bases C4
  • PCR primer C4 has a N-terminal methionine residue encoded by the nucleotide numbers 11174 to 11750 of SEQ ID NO: 2 in the sequence listing. Can be used for PCR to amplify cDNA
  • SEQ ID NO: 1 comprises at least 10 bases, with the thymine of nucleotide number 14432 or the 5'-side base 5'-terminal to the 5'-terminal.
  • a primer for PCR having a sequence D1 is provided.
  • PCR primer D1 having a sequence consisting of at least 10 bases (provided that the primer D2 has a nucleotide number of 198 of SEQ ID NO: 2 in the sequence listing). 37 to 1983 can be used for PCR to amplify cDNA which encodes a polypeptide having a serine residue at the C-terminus),
  • a primer D3 for PCR that has at least 80% homology with the nucleotide sequence of the primer D1 for PCR described in (25) and contains a sequence consisting of at least 10 bases (provided that The primer D3 for PCR is a polypeptide having a C-terminal serine residue coded by nucleotide numbers 198 337 to 198 39 of SEQ ID NO: 2 in the sequence listing. Can be used for PCR to amplify cDNA),
  • SEQ ID NO: 1 in the sequence listing a sequence consisting of at least 10 bases having 5'-terminal at the adenine of nucleotide number 11976 or at the 5'-side thereof is referred to as Having a primer for PCR E1,
  • the PCR primer E2 (H) having at least 70% homology with the nucleotide sequence of the PCR primer E1 according to (29) and containing a sequence consisting of at least 10 bases.
  • the PCR primer E2 is a polypeptide having a methionine residue encoded by the nucleotide number 11796 to 11798 of SEQ ID NO: 1 in the sequence listing as an N-terminal. It can be used for PCR to amplify the encoding cDNA),
  • a primer E3 for PCR that has at least 80% homology with the nucleotide sequence of primer E1 for PCR described in (29) and contains a sequence consisting of at least 10 bases (provided that The PCR primer E3 comprises a polypeptide having a methionine residue encoded by the nucleotide number 11796 to 11798 of SEQ ID NO: 1 in the sequence listing as an N-terminal. Can be used for PCR to amplify cDNA
  • Primer E4 containing a sequence consisting of at least 10 bases, provided that the primer has a nucleotide sequence of SEQ ID NO: 1 in the sequence listing. Or can be used for PCR to amplify cDNA which encodes a polypeptide having a methionine residue encoded by 117898 as an N-terminus),
  • nucleotide consists of at least 10 bases having a 5'-terminal at the thymine or 5'-side of nucleotide 20723.
  • a PCR primer F2 having at least 70% homology with the nucleotide sequence of the primer F1 for PCR described in (33) and containing a sequence consisting of at least 10 bases (provided that A primer having a C-terminal cysteine residue encoded by the nucleotide numbers 1347 to 13478 of SEQ ID NO: 1 in the sequence listing. Can be used for PCR to amplify the coding cDNA)),
  • the polypeptide having the cysteine residue encoded by the nucleotide number 1347 to 13478 of SEQ ID NO: 1 in the sequence listing as the C-terminus is encoded.
  • a PCR primer G3 having at least 80% homology with the nucleotide sequence of the primer G1 for PCR described in (37) and containing a sequence consisting of at least 10 bases (provided that A primer G3 for PCR; a polynucleotide having a methionine residue encoded by nucleotide numbers 243211 to 24324 of SEQ ID NO: 1 in the sequence listing at the N-terminus. Can be used for PCR to amplify the cDNA encoding the peptide),
  • a primer G4 for PCR having at least 90% homology with the nucleotide sequence of the primer G1 for PCR described in (37) and containing a sequence consisting of at least 10 bases (provided that The primer G4 for PCR; encodes a polypeptide having a N-terminal methionine residue encoded by the nucleotide number 2432 21 to 243223 of SEQ ID NO: 1 in the sequence listing. c can be used for PCR to amplify DNA)),
  • SEQ ID NO: 2 in the sequence listing a sequence consisting of at least 10 bases having a thymine having a nucleotide number of 6312 or a 5′-terminal base 5′-terminal to the 5′-terminal Including PCR primer H1,
  • the primer H2 for PCR is a polypeptide having a C-terminal arginine residue encoded by nucleotide numbers 278787 to 27889 of SEQ ID NO: 1 in the sequence listing. Can be used for PCR to amplify the encoding cDNA)
  • the primer H3 for PCR having at least 80% homology with the nucleotide sequence of the primer H1 for PCR described in (41) and containing a sequence consisting of at least 10 bases
  • the primer H3 for PCR is a polypeptide having a C-terminal arginine residue encoded by nucleotide numbers 278787 to 27889 of SEQ ID NO: 1 in the sequence listing. Can be used for PCR to amplify cDNA encoding
  • a primer H4 for PCR having at least 90% homology with the nucleotide sequence of the primer H1 for PCR described in (41) and containing a sequence consisting of at least 10 bases
  • the primer H4 for PCR is the nucleotide number of SEQ ID NO: 1 in the sequence listing.
  • No. 278887 to 278889 can be used for PCR to amplify cDNA encoding a polypeptide having a C-terminal arginine residue encoded by arginine residue
  • (45) a sequence consisting of at least 10 bases, with the adenine at nucleotide number 354 5 or the 5'-side nucleotide at the 5'-end thereof as the 5'-terminal in SEQ ID NO: 2 of the sequence listing PCR primers I 1, including
  • a PCR primer I2 having at least 70% homology with the nucleotide sequence of the PCR primer I1 according to (45) and containing a sequence consisting of at least 10 bases (provided that The PCR primer I2 is a cDNA encoding a polypeptide having a methionine residue at the N-terminus, which is encoded by nucleotide numbers 3545 to 3547 of SEQ ID NO: 2 in the sequence listing. Can be used for PCR to amplify
  • a PCR primer I 3 having at least 80% homology with the nucleotide sequence of the PCR primer I 1 according to (45) and containing a sequence consisting of at least 10 bases (provided that The PCR primer I 3 A cDNA encoding a polypeptide having a N-terminal methionine residue encoded by the nucleotide number 3545 to 3547 of SEQ ID NO: 2 in the sequence listing Can be used for PCR to amplify
  • the PCR primer I4 (having at least 90% homology with the nucleotide sequence of the PCR primer I1 according to (45) and comprising a sequence consisting of at least 10 bases. However, the PCR primer I4 encodes a polypeptide having the N-terminal methionine residue encoded by the nucleotide numbers 3545 to 3547 of SEQ ID NO: 2 in the sequence listing. c can be used for PCR to amplify DNA)),
  • SEQ ID NO: 1 consists of at least 10 bases, with the thymine at nucleotide number 28472 or the 5'-side base 5'-terminal to the 5'-terminal, PCR primer J1, including the sequence
  • a primer J2 for PCR that has at least 70% homology with the nucleotide sequence of the primer J1 for PCR described in (49) and contains a sequence consisting of at least 10 bases (provided that The PCR primer J2 is a polypeptide having a C-terminal alanine residue encoded by the nucleotide number 5727 to 5729 of SEQ ID NO: 2 in the sequence listing.
  • SEQ ID NO: 2 including a sequence consisting of at least 10 bases, with adenine having a nucleotide number of 400 or a 5'-terminal base 5'-terminal to the 5'-terminal PCR primer K1,
  • a primer for PCR K2 which has at least 70% homology with the nucleotide sequence of the primer K1 for PCR described in (53) and contains a sequence consisting of at least 10 bases (provided that CDNA that encodes a polypeptide wherein the PCR primer K2 has a N-terminal methionine residue encoded by nucleotide numbers 400 to 402 of SEQ ID NO: 2 in the sequence listing Can be used for PCR to amplify
  • a PCR primer K4 having at least 90% homology with the nucleotide sequence of the PCR primer K1 described in (53) and containing a sequence consisting of at least 10 bases (provided that The primer for K4 is a cDN encoding a polypeptide having a methionine residue at the N-terminus, which is encoded by the nucleotide number 400 to 402 of SEQ ID NO: 2 in the sequence listing.
  • A can be used for PCR to amplify A)
  • Primer for PCR L 1 including
  • the PCR primer L2 encodes a polypeptide having a C-terminal alanine residue encoded by nucleotide numbers 1912 to 1914 of SEQ ID NO: 2 in the sequence listing. Can be used for PCR to amplify cDNA)
  • c DN A can be used for PCR to amplify A), and.
  • a primer L4 for PCR having at least 90% homology with the nucleotide sequence of the primer L1 for PCR described in (57) and containing a sequence consisting of at least 10 bases (provided that The PCR primer L4 encodes a polypeptide having a C-terminal alanine residue encoded by nucleotide numbers 1912 to 1914 of SEQ ID NO: 2 in the sequence listing.c DN which can be used for PCR to amplify A).
  • the present invention provides a DNA derived from the genome of the bacterium, which is characterized by improving the ability of the bacterium to produce ML-236B by being introduced into the ML-236B-producing bacterium.
  • ML—236B biosynthesis-related DNA it is referred to as “ML—236B biosynthesis-related DNA.”.
  • the ML-236B-producing bacterium refers to a microorganism having an ML-236B-producing ability innately.
  • ML-236B-producing bacteria include, for example, Penicillium
  • Penicillium including ML-236B-producing bacteria, such as Penicillium citrinum, Penicillium brevicompactum: Brown, AG, et al., J. Chem. Soc. Perkin-1., 1165 (1976)), Penicillium cyclopium: Doss, SL, et al., J. Natl. Prod., 49, 357 (1986)).
  • Penicillium citrinum Penicillium citrinum
  • Penicillium brevicompactum Brown, AG, et al., J. Chem. Soc. Perkin-1., 1165 (1976)
  • Penicillium cyclopium Doss, SL, et al., J. Natl. Prod., 49, 357 (1986)
  • u-nispium-SP M6603 described in Eupenicillium sp. M6603: Endo, A., et al., J.
  • Pacilomyces viridis FERM P-6236 Patent Publication No. 58-98092
  • Pacilomyces viridis FERM P-6236 Pascilomyces viridis FERM P-6236 sp. M2016: Endo, A., et al., J. Antibiot.-Tokyo, 39, 1609 (1986)
  • Trichoderma 'guchi ngibrachiatum M6735 Trichoderma longibrachiatum M6735: Endo, A., et al., J.
  • Trichoderma 'Piride IFO 5836 Trichoderma viride IF05836: Tokushou 62- No. 195, published in Japanese Patent Application Publication No.
  • IFO9022 (Eupenicillium reticulisporum IF09022: described in JP-B-6-19-159).
  • it is Penicillium 'Citrimum, and more preferably, it is Penicillium' Citrimum S ANK13380 strain.
  • L-236B biosynthesis-related DNA is a DNA sequence from a filamentous fungus that is presumed to have a similar function to the genomic DNA library of ML-236B-producing bacteria. It is obtained by performing screening using a probe designed based on the above.
  • the method for preparing the genomic DNA library is not particularly limited as long as it is a method for preparing a genomic DNA library of eukaryotes in general.
  • Mania Fish et al. C03 ⁇ 4 "j3 ⁇ 4 Maniati s, ⁇ ., et al., Molecular cinging, a laboratory manua 1, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989). Listed).
  • the genome DNA of the ML-236B-producing bacterium can be obtained by recovering the cells from the culture of the producing bacterium, physically disrupting the bacterium, and then extracting and purifying the nuclear DNA.
  • the culture of the ML-236B-producing bacteria can be performed under conditions suitable for each ML-236B-producing bacteria.
  • the preferred ML-236B-producing bacterium, Penicillium'citrine was cultured from the slant in which the cells were cultured in an MBG3-8 medium (composition: 7% (w / v) glycerol).
  • the slant is prepared by inoculating the cells and incubating at 22 to 28 ° (for 3 to 7 days while shaking.
  • the slant is prepared by dissolving PGA agar medium (composition: 200 g).
  • the cells of the ML-236B-producing bacteria cultured in a liquid medium are centrifuged, and the cells of the bacteria cultured in a solid medium are scraped off with a cell scraper or the like. Each can be collected.
  • Physical disruption of the cells can be performed by crushing the cells with a mortar and pestle while freezing the cells with liquid nitrogen or the like. Extraction of DNA in the nucleus of the disrupted cells can be carried out using a surfactant such as sodium dodecyl sulfate (sodimuddodecylssulphate: hereinafter referred to as "SDS").
  • SDS sodium dodecyl sulfate
  • the extracted genomic DNA is deproteinized by performing phenol-close-form extraction, and can be recovered as a precipitate by performing ethanol precipitation.
  • the obtained genomic DNA is digested with appropriate restriction enzymes and fragmented.
  • the restriction enzyme used for the restriction digestion is not particularly limited as long as it is a commonly available restriction enzyme, and examples thereof include Sau3AI.
  • Fragmented DN A Is subjected to gel electrophoresis, and DNA is recovered from a gel containing an appropriately sized genomic DNA.
  • the size of the DNA fragment is not particularly limited, but is preferably 20 kb or more.
  • the DNA vector for preparing a genomic DNA library is not particularly limited as long as it has a nucleotide sequence necessary for replication in a host cell transformed with the DNA vector.
  • a plasmid vector First, a phage vector, a cosmid vector, a BAC vector and the like are preferable, and a cosmid vector is preferable. Further, these DNA vectors may be expression vectors.
  • the DNA vector preferably has a base sequence that confers the selectivity of a phenotypic trait (phenotype; Phenotype) to a host cell transformed with the DNA vector.
  • the DNA vector is preferably one that can be used for both cloning and functional expression.
  • the DNA vector it is preferable to use a shuttle vector that can be transformed into a plurality of microorganism groups.
  • the shuttle vector has at least a nucleotide sequence necessary for replication in a host cell of one of the microorganism groups. Further, the shuttle vector preferably has a base sequence that imparts selectivity of a phenotypic trait to a host of a plurality of microorganism groups.
  • the combination of microorganisms transformed by the shuttle vector is not particularly limited as long as one of the microorganisms is applicable for cloning and the other has ML-236B-producing ability.
  • Examples include a combination of a bacterium and a filamentous fungus, a combination of a yeast and a filamentous fungus, and preferably a combination of a bacterium and a filamentous fungus.
  • the bacterium is not particularly limited as long as it is usually used for genetic engineering, and examples thereof include Escherichia coli and Bacillus subtilis. Escherichia coli is preferred, and E. coli X is more preferred. 1-8 1 1 6 ⁇ 11 shares.
  • the yeast is not particularly limited as long as it is usually used for genetic engineering, and examples thereof include Saccharomyces cerevisiae.
  • the filamentous fungi include the ML-236B-producing bacteria described above.
  • the microorganism group is selected from bacteria, filamentous fungi and yeast.
  • Such shuttle vectors include, for example, cosmid vectors having an appropriate phenotypic selectable marker gene and a cos (cos) site, and preferably the Escherichia coli hygromycin B phosphotransferase gene.
  • the plasmid (pSAK333) having the sequence (described in Japanese Patent Application Laid-Open No.
  • Heisei 3-2-264886 contains the cosmid (cos) portion of the cosmid vector pWE15 (manufactured by ST RATAG ENE).
  • P SAK cos 1 created by insertion, but is not limited thereto. The procedure for constructing pSAK cos1 is described in FIG.
  • a desired genomic DNA library is completed by introducing into a host cell a shuttle vector obtained by ligating the above-mentioned genomic DNA fragment of the ML-236B-producing bacterium.
  • Escherichia coli more preferably Escherichia coli XL1-B1ue MR strain, is preferably used as the host cell.
  • the introduction is carried out by invitro packaging.
  • the term “transformation” also refers to the introduction of foreign DNA by invitro packaging, and cells into which exogenous DNA has been introduced by invitro knocking are also included in the meaning of transformed cells.
  • an antibody or a nucleic acid probe is used, and preferably a nucleic acid probe is used.
  • the nucleic acid probe can be prepared based on the nucleotide sequence of a gene related to polyketide biosynthesis of a filamentous fungus. Such genes are not particularly limited as long as their involvement in polyketide biosynthesis has been confirmed and their nucleotide sequences are known. Examples thereof include Aspergillus flavus and Aspergillus flavus. 'Aflatoxin PKS gene of Norasitycus (Aspergillus parasiticus), Aspergillus' stridama tocystin PKS gene of Aspergillus nidulans, and the like.
  • the nucleic acid probe was prepared by synthesizing an oligonucleotide probe consisting of a partial base sequence of genomic DNA based on the above-mentioned known nucleotide sequence, and also preparing an oligonucleotide primer to form the genomic DNA into a ⁇ type.
  • Polymerase chain reaction hereinafter referred to as iPC Rj: Saiki, RK, et al., Science, 239, 487 (1988)
  • iPC Rj Saiki, RK, et al., Science, 239, 487 (1988)
  • cDNA reverse transcriptase
  • reverse transcriptase reverse transcriptase
  • PCR or RT-PCR primer used for PCR
  • PCR primers is preferably designed based on the nucleotide sequence of a polyketide biosynthesis-related gene whose nucleotide sequence is known, preferably Aspergillus flavus or Aspergillus flavus. ⁇ Noreginoles '' Paracitycus
  • a primer for PCR can be designed by reducing an amino acid sequence with high interspecies conservation to a base sequence on the amino acid sequence of any one of these PKSs.
  • a method for reducing an amino acid sequence to a base sequence a method of deriving a single sequence in consideration of the codon usage of the host or a mixed sequence using multiple codons (hereinafter referred to as “mixed sequence”). ⁇ It is called "primer.” In the latter case, the multiplicity can be reduced by including hypoxanthine in the base sequence.
  • the PCR for primer scratch in addition to the nucleotide sequence for ⁇ strand Aniri ring, 5 of the primer '- the ends c its good UNA nucleotide sequence it is possible to adding appropriate nucleotide sequence
  • the primer is not particularly limited as long as the primer can be used for PCR.
  • examples include a base sequence that is convenient for performing a subsequent cloning operation on the PCR product.
  • a restriction enzyme recognition sequence and a base sequence containing the restriction enzyme recognition sequence are exemplified.
  • the sum of the number of guanine bases and the number of cytosine bases is preferably 40 to 60% of the total number of bases.
  • both PCR primers do not easily anneal to each other.
  • the number of bases of the primer for PCR is not particularly limited as long as it can be applied to PCR, but the lower limit of the range is 10 to 14, the upper limit is 40 to 60, and the preferred range is 14 to 60. 40.
  • the primer for PCR is preferably DNA.
  • the nucleosides constituting the primer include deoxyadenosine, deoxycytidine, deoxythymidine, deoxyguanosine, adenosine, cytidine, peridine and guanosine, as well as deoxyinosine and inosine.
  • the 5'-position of the nucleoside located at the 5'-end of the PCR primer is a force that is a hydroxyl group or a state in which monocarboxylic acid is ester-bonded to the hydroxyl group.
  • PCR primers can be synthesized by a method usually used for nucleic acid synthesis, for example, a phosphoramidite method. For such a method, a DNA automatic synthesizer is suitable. Used for
  • Genome DNA of ML-236B-producing bacterium can be used as type II of PCR, and mRNA of ML-236B-producing bacterium can be used as type II of RT-PCR.
  • mRNA of ML-236B-producing bacterium can be used as type II of RT-PCR.
  • all RNAs can be used instead of mRNAs.
  • the PCR product or RT-PCR product can be cloned by incorporating the PCR product or the RT-PCR product into a DNA vector suitable for this.
  • the DNA vector used for the cloning is not particularly limited as long as it is a DNA vector usually used for closing a DNA fragment.
  • kits for easily cloning PCR products or RT-PCR products are commercially available. Such kits include, for example, Original TACI oning Kit (manufactured by Invitrogen: a DNA vector). PCR 2.1 is used.) Is preferably used.
  • the cloned pCR product can be obtained by culturing transformed host cells that have been confirmed to contain the desired PCR product, extracting and purifying plasmid from the cells, and inserting the inserted DNA fragment from the obtained plasmid. It can be done by collecting Culture of the transformed host cells can be performed under conditions suitable for each host cell. Culture of a transformant of Escherichia coli, which is a suitable host cell, is performed in LB medium (l% (w / v) tryptone, 0.5% (w / v) yeast extract, 0.5% (w / v). v) Sodium chloride) at 30 to 37 ° (:, for 18 hours to 2 days).
  • Plasmid is prepared from a culture of a transformed host cell by collecting cells of the host cell and removing genomic DNA and proteins. Preparation of a plasmid from a culture of a transformant of Escherichia coli, which is a suitable host cell, is performed by the Manoleatis method (Maniatis, T., et al., Molecular cloning, a laboratory raanua 1, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989)). In addition, kits for obtaining a higher purity plasmid are commercially available. As such a kit, for example, P1asmidMiniKit (manufactured by QIAGEN) is suitably used.
  • a kit for preparing a large amount of plasmid is commercially available.
  • Plasmid MaxiKit manufactured by QIAGEN
  • the purity of the DNA can be calculated from the ratio of the absorbance at the wavelengths of 280 and 260 nm.
  • Labels of nucleic acid probes are broadly classified into radioactive labels and non-radioactive labels.
  • Radionuclides used in radioactive-labeled usually not particularly limited as long as it can be used, for example, 3 2 P, 35 S, 1 4 C and the like can be mentioned, preferably 32 P It is.
  • the reagent used for non-radioactive labeling is not particularly limited as long as it is generally used for labeling nucleic acids. Examples thereof include digoxigenin and biotin, and digoxigenin is preferred.
  • the method of labeling a nucleic acid probe is not particularly limited as long as it is a commonly used method.
  • Examples thereof include a method of incorporating the product into a product using a PC using a labeled substrate, a nick translation method, and a random primer. Method, end labeling method, method of synthesizing oligo DNA using a labeled substrate, etc., and can be appropriately selected from these methods depending on the type of nucleic acid probe, etc. You.
  • the presence of the nucleotide sequence of the nucleic acid probe in the genome of the ML-236B producing bacterium can be confirmed by Southern blot hybridization using the genomic DNA of the producing bacterium.
  • the Southern blot hybridization method was performed according to the method of Mania noted et al. (Maniat 1s, T., et al, Molecular cloning, a laboratory manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989)). Described) ⁇ You can do it.
  • the target clone can be screened from the genomic DNA library.
  • the screening method is not particularly limited as long as it is a method usually used for gene cloning, but is preferably a suitable method such as colony 'Niffif', Rita, Isesion method (Maniatis, T. et al. , et al., Molecular cloning, a laboratory manual, 2nd ed., Cod Spring Harbor Laboratory, old Spring Har.bor, NY (1989)) can be used.
  • the culture of colonies used for colonization and hybridization can be performed under conditions suitable for each host cell, and the culture of a transformant of Escherichia coli, which is a suitable host cell, is performed using LB agar medium (1% ( (w / v) tryptone, 0.5% (w / v) distract extract, 0.5% (w / v) sodium chloride, 1.5% (w / v) agaguchi 1)
  • LB agar medium 1% ( (w / v) tryptone, 0.5% (w / v) distract extract, 0.5% (w / v) sodium chloride, 1.5% (w / v) agaguchi 1
  • the above can be carried out by keeping the temperature at 30 to 37 C for 18 hours to 2 days.
  • Preparation of a recombinant DNA vector from a positive clone obtained by colony'hybridization is performed by extracting and purifying plasmid from a culture of the positive clone.
  • the transformed Escherichia coli E. colip ML48 S ANK 711 199 strain obtained as a positive clone obtained in the present invention was produced by the Ministry of International Trade and Industry on July 7, 1999. It was deposited internationally with the Institute of Biotechnology, Industrial Technology Research Institute (Tsukuba East, Ibaraki Prefecture, Japan, Japan, Japan, Japan, Japan), and was assigned the accession number FE RM BP—680.
  • the recombinant DNA vector contained in the E. colip ML48 SANK711 9199 strain was named pML48.
  • the fact that the recombinant DNA vector possessed by the positive clone contains the desired ML-236B biosynthesis-related DNA can be determined by determining the inserted nucleotide sequence of the recombinant DNA vector, Southern blot hybridisation. Can be confirmed by the expression or function expression.
  • the nucleotide sequence of DNA can be determined by the chemical modification method of Maxam-Gilbert (described in Maxiam, AMM and Gilbert, W., Methods in Enzymology, 65, 499 (1980)) or the dideoxynucleotide chain termination method (Messing, J. and Vieira). , J., Gene, 19, 269 (1982)).
  • Maxam-Gilbert described in Maxiam, AMM and Gilbert, W., Methods in Enzymology, 65, 499 (1980)
  • the dideoxynucleotide chain termination method Messing, J. and Vieira.
  • J., Gene, 19, 269 (1982) a sample with higher purity is preferable.
  • the inserted base sequence of pML48 is shown in SEQ ID NO: 1 in the sequence listing.
  • the nucleotide sequence shown in SEQ ID NO: 2 in the sequence listing is completely complementary to the nucleotide sequence shown in SEQ ID NO: 2.
  • the nucleotide sequence of the genome DNA has a genetic polymorphism (polymorphism: pol'ymorphysm) within the same species.
  • polymorphism pol'ymorphysm
  • the present invention provides an ML-236B biosynthesis-related DNA which hybridizes to a DNA having a nucleotide sequence represented by nucleotide numbers 1 to 342 of SEQ ID NO: 1 or 2 in the sequence listing, and ML-236B biosynthesis-related DN that hybridizes under stringent conditions to DNA having the nucleotide sequence represented by nucleotide numbers 1 to 342 of SEQ ID NO: 1 or 2 in the sequence listing A is also included.
  • These DNAs are those in which one or more nucleotide substitutions, deletions, and deletions or additions have occurred in the nucleotide sequence represented by nucleotide numbers 1 to 342 of SEQ ID NO: 1 or 2 in the sequence listing.
  • hybridization means that two single-stranded nucleic acids form a double-stranded region in a region complementary to each other or in a region having high complementarity.
  • the composition of the hybridization solution is 6 XSSC
  • composition of 1 XSSC is 150 mM NaCl, 15 mM trisodium citrate.
  • the incubation temperature at the time of hybridization is 55 ° C. Review
  • the gene region in the genome DNA sequence can be estimated by using existing gene analysis programs (GeneFinding program (hereinafter referred to as "GRAIL")) and sequence homology search programs (BLASTN and BLASTN). LA STX).
  • GeneFinding program hereinafter referred to as "GRAIL”
  • BLASTN and BLASTN sequence homology search programs
  • LA STX LA STX
  • GRAIL divides the genomic sequence into seven parameters that evaluate the “likeness of the gene sequence,” and integrates the results using a neural net method to generate structural genes on the genome DNA. (Uberbacher, E. & Mural, RJ, Proc. Natl. Acad. Sci. USA., 88, 11261 (1991) fBi), and ApoCom G RA ILT oolkit (APOC OM) ) Is preferably used.
  • BLAST is a program using an algorithm for homology search of nucleic acid sequence and amino acid sequence (described in Altechul, SF, Madden, T., et al., Ucl. Acids Res., 25, 3389 (1997)). .
  • the position and direction of the structural gene on the test DNA sequence can be estimated.
  • the divided genomic DNA sequence is translated into an amino acid sequence according to six translation frames (three in each of a sense sequence and an antisense sequence), and the amino acid sequence is homologous to the peptide database.
  • the position and direction of the structural gene on the DNA sequence to be removed can also be estimated.
  • the coding region of a structural gene contained in a genomic DNA sequence may be interrupted by an intron sequence, and the analysis of a structural gene having such a gap is a gap.
  • BLAST for contained sequences is more effective, and Gapped—BLAST (BLAST2: mounted on WIS CON SIN GC G packagever. 10.0) is preferably used.
  • the total RNA of the ML-236B producing bacterium to be used for the Northern blot can be obtained from a culture of the bacterium.
  • a suitable ML-236B producing bacterium Penicillium citrinum
  • the strain is inoculated from a slant of the bacterium into a MGB3-8 medium, and the bacterium is cultured at a temperature of 22 to 28 ° (: For 1 to 4 days by keeping the temperature while shaking.
  • RNA from ML-236B-producing bacteria is not particularly limited as long as it is a method generally used for preparing total RNA.
  • guanidine 'thiosinate' hot phenol method guanidine-thiosine Monoguanidine ⁇ hydrochloric acid method.
  • kits for preparing higher-purity total RNAs include, for example, RNeasyPlantMiniKit (manufactured by QIAGEN).
  • mRNA can be obtained by adding total RNA to an oligo (dT) column and collecting the fraction adsorbed on the column.
  • Transfer of the RNA to the membrane, preparation of the probe, hybridization, and detection of the signal can be performed in the same manner as in the Southern blot 'hybridization described above.
  • RACE rapidammpliificantionanofcDNAEnds
  • RACE uses mRNA as a type III and converts cDNA containing the region from the base sequence to the 5'-end or 3'-end region where the base sequence has not been determined by RT-PCR.
  • the first strand of cDNA is formed by reverse transcriptase reaction using oligo-DNA (1) on the antisense side, which is designed based on a known portion of the base sequence, with mRNA as type III. After synthesizing, a homopolymeric (homopolymeric: consisting of a single base) nucleotide chain at the 3'-end of the first strand of the cDNA is obtained by terminal deoxynucleotidyl transferase. Is added.
  • the oligo DNA present on the sense side which has the first strand of cDNA as a type II and contains a nucleotide sequence complementary to the homopolymeric nucleotide sequence, and an oligo present on the antisense side.
  • This method amplifies the double-stranded cDNA in the 5'-terminal region by PCR using the oligo DNA (2) present on the 3 'side of the DNA (1) as the primer (Frohman, MA , Methods in Enzymol., 218, 340 (1993)).
  • Kits for 5 'RACE are commercially available. As such a kit, for example, 5' RACLS ystemior Rapid Am pliiicationofc DNA ends, Version 2.0 (manufactured by GIBCO) and the like are preferable. Used for
  • 3 ′ RACE is a method that utilizes the poly A region present at the 3′-end of mRNA. That is, after the cDNA is synthesized as a type I cDNA, the first strand of the cDNA is synthesized by a reverse transcriptase reaction using the oligo d (T) adapter as a primer, and then the first strand of the cDNA is expressed as a type II.
  • the oligo DNA (3) on the sense side designed based on the known portion of the nucleotide sequence and the P'CR with the oligo d (T) adapter on the antisense primer as the primer 3 ' This method amplifies double-stranded cDNA in the terminal region.
  • Kits for 3 'RACE are commercially available. Examples of such kits include: Ready—To—Go—Primed First—Strand Kit (Pharmacia) Is preferably used.
  • the analysis results of the above 1) and 2) can be suitably used for designing a primer based on a known portion of the base sequence in RACE.
  • the direction of the structural gene on the genomic DNA sequence, the position of the transcription start point, the position of the translation start codon, and the translation stop codon in the structural gene And its position can be estimated. Based on this information, each structural gene and its cDNA can be obtained.
  • mlcA, mlcB, mlcC, mlcD, mlcE and m1 c Named R are coding regions on the base sequence shown in SEQ ID NO: 2 in the sequence listing. It was presumed that mlc C and mlc D had a coding region on the nucleotide sequence shown in SEQ ID NO: 1 in the sequence listing.
  • Methods for obtaining cDNA include cloning by RT-PCR using a primer that can be designed based on the above-mentioned information, and cDNA cloning using a DNA probe obtained based on such information. Cloning and the like. In order to express the function of the cDNA obtained by these methods, it is necessary to obtain a full-length cDNA. In addition, in order to obtain cDNA capable of functional expression by RT-PCR, the RT-PCR product contains a translation initiation codon at its original position and is contained in a translation frame initiated by the translation initiation codon. It is essential to design a primer so that it does not contain a translation termination codon other than its original position.
  • PCR primers XI (X is selected from any of A, C, E, G, I and K. A1 is (13), C1 is (21), E1 is (29), G1 is described in (37), I1 is described in (45), K1 is described in (53).) Or PCR primer 1 ( ⁇ is ⁇ , D, F, H, J or L is selected from B, B1 is (17), D1 is (25), F1 is (33), HI is (41), J1 is (49), L1 is
  • the base sequence of the primer for PCR can selectively anneal to the type I strand and can function as a primer for PCR or RT-PCR, it can be completely integrated with a part of the type I strand. Need not be complementary to ⁇
  • PCR primers X2 to X4 (X is selected from any of A, C, E, G, I and K, ⁇ 2 is (14), A3 is (15), ⁇ 4 is ( 1 6), C 2 is (2 2), C 3 is (2 3), C 4 is (24), ⁇ 2 is (30), ⁇ 3 is (3 1), ⁇ 4 (3 2) , G2 is (38), G3 is (39), G4 is (40), I2 is (46), 13 is (47), 14 is (48), K 2 is described in (54), K3 is described in (55)., K4 is described in (56).) X of PCR primers XI (XI and X2 to X4 is the same alpha-base).
  • A1 represents A2 to A4, C1 represents C2 to C4, El represents E2 to E4, G1 represents G2 to G4, and I1 represents a group of bits.
  • I2 to I4, and K1 corresponds to K2 to K4, respectively.
  • PCR primers Y2 to Y4 (Y is selected from any of B, D, F, H, J or L, B2 is (18), B3 is (19), B4 is ( 20), D2 is (26), D3 is (27), D4 is (28), F2 is (34), F3 is (35), F4 is (36) ), H 2 is (4 2), H 3 is (4 3), H 4 is (4 4), J 2 is (50), J 3 is (5 1), J 4 is (5 2), L2 is described in (58), L3 is described in (59), L4 is described in (60).) Y1 of PCR primer Yl (Y1 and Y2 to Y4 is the same) Represents a group of alphabets; B1 is B2 to B4, D1 is D2 to D4, F1 is F2 to F4, HI is H2 to H4, J1 Correspond to J2 to J4, and L1 corresponds to L2 to L4, respectively.) Has a homology of 70% or more, preferably 80% or more. More
  • PCR primers X1 to X4 (X is selected from any one of A, C, E, G, I and K) and PCR primers ⁇ 1 to ⁇ 4 ( ⁇ ⁇ , D, F, H, J, or L) PCR or RT-PCR can be performed using any one of the primers as a primer.
  • the six structural genes (mlc A, mlc B, mlc C, mlc D, m1cE and m1c) were placed on the pML48 insert sequence of the recombinant DNA vector obtained in the present invention.
  • R was estimated.
  • the cDNA of these six structural genes was obtained by combining RT with a reverse transcription reaction and PCR using any one of the PCR primers X1 to X4 and any one of the PCR primers Y1 to Y4. I) It can be obtained by PCR.
  • each of the structural genes uses any one of the primers X1 to X4 for PCR and any one of the primers Y1 to Y4 for PCR as primers to generate the ML-236B-producing bacteria.
  • Genomic DNA can be obtained by PCR using type III.
  • cDNA that is full-length and can be expressed in a suitable host cell
  • a combination of any one of the primers A1 to A4 for PCR and any one of the primers B1 to B4 for PCR is suitably used.
  • any one of PCR primers C1 to C4 and any one of PCR primers D1 to D4 are preferably used. .
  • a combination of any one of the primers E1 to E4 for PCR and any one of the primers F1 to F4 for PCR is suitably used.
  • a combination of any one of the primers G1 to G4 for PCR and any one of the primers HI to H4 for PCR is suitably used.
  • a combination of any one of primers I1 to 14 for PCR and any one of primers J1 to J4 for PCR is preferably used.
  • a combination of any one of primers K1 to K4 for PCR and any one of primers L1 to L4 for PCR is suitably used.
  • primers XI to X4 for PCR have the following requirement (1).
  • PCR primers X1 to X4 are located in the original positions of the PCR products using any one of the PCR primers X1 to X4 and any one of the PCR primers Y1 to Y4 as primers.
  • the translation frame is designed so as to contain a translation initiation codon atg and to include no translation termination codon other than the original position in the translation frame started from the translation initiation codon (see SEQ ID NO: Nucleotide number 1 to 3 of the nucleotide sequence shown in SEQ ID NO: 2
  • the position of the translation initiation codon of each structural gene estimated in the present invention in the nucleotide sequence shown in 4203 is described in Table 4).
  • Primer XI for PCR has a 5′-terminal at the a or 5′-side base thereof in the translation initiation codon atg of cDNA.
  • the primers for PCR X2 to X4 are on the nucleotide sequence shown in SEQ ID NO: 1 to SEQ ID NO: 1 to 324203 or the nucleotide numbers 1 to 34 in SEQ ID NO: 2 in the sequence listing. Selectively anneals to a specific region on the nucleotide sequence shown in SEQ ID NO: 03 (The entire nucleotide sequence of SEQ ID NO: 2 in the sequence listing is completely complementary to the entire nucleotide sequence of SEQ ID NO: 1 in the sequence listing. is there. ) .
  • PCR primers X2 to X4 contain a nucleotide sequence 3 'to the translation initiation codon atg, translation starting from the initiation codon atg on the nucleotide sequence 3' to the translation initiation codon atg
  • the base sequence (taa, tag, or tga) that is a codon in the frame is not included.
  • the translation frame starting from the start codon atg is a sequence consisting of three bases generated when the base sequence 3'-side from the translation start codon atg is divided into three base units from the translation start codon atg. Say.
  • PCR primers X2 to X4 a base or base sequence (“base or base sequence”) corresponding to the translation initiation codon a, & 1 or & 18 (referred to as “base or base sequence m”) at that position.
  • base or base sequence m a base or base sequence corresponding to the translation initiation codon a, & 1 or & 18
  • base or base sequence m a base or base sequence corresponding to the translation initiation codon a, & 1 or & 18
  • the base or base sequence m is atg
  • the base or base sequence m ' is atg
  • a in the atg of the base or base sequence m' is the first and 3 X is counted in the 3'-direction.
  • the nucleotide sequence of the trinucleotide is taa. , Tag or tga.
  • the 3'-end of the PCR primers X2 to X4 is When a is the first nucleotide in the 3 X n + l (n is an integer of 1 or more) counting in the 3′-direction with a being the first, the PCR primers X2 to X4 are used as one of the primers.
  • the 3Xn + 1st The nucleotide sequence of a trinucleotide consisting of a nucleotide and a dinucleotide adjacent to the 3′-side is not taa, tag, or tga.
  • Terminal is 3 X n + 2 (n is 1 RT-PCR product that uses the PCR primers X2 to X4 as one primer and the RNA or mRNA of the ML-236B-producing bacterium as the ⁇ -type nucleotide.
  • n is 1 RT-PCR product that uses the PCR primers X2 to X4 as one primer and the RNA or mRNA of the ML-236B-producing bacterium as the ⁇ -type nucleotide.
  • a trinucleotide consisting of a 3Xn + 2nd nucleotide and two mononucleotides adjacent to its 3′- and 5′-sides
  • the base sequence may not be any of taa, tag and tga.
  • the 3'-end of the PCR primers X2 to X4 is 3Xn + 3 (n is an integer of 1 or more) in the 3'-direction, with a in the translation initiation codon atg as the first.
  • the nucleotide sequence of the trinucleotide consisting of the 3 ⁇ n + 1 to 3 ⁇ n + 3 nucleotides is not any of taa, tag and tga.
  • primers Y1 to Y4 for PCR have the following requirement (3).
  • the PCR primers Y1 to Y4 are prepared by PCR using any one of the PCR primers X1 to X4 and any one of the primers Y1 to Y4 as primers.
  • (Mlc A, mlc B, mlc C, mlc D, mlc E and m1cR) are designed to amplify cDNA encoding the N-terminal to C-terminal of the peptide encoded by it. .
  • the PCR primer Y1 is used for the base sequence near the translation termination region on the cDNA.
  • the primer is not particularly limited as long as it is a PCR primer having a complementary base sequence, but is preferably a base complementary to the 3′-terminal base of the translation termination codon or a base 5 ′ to one side thereof.
  • the positions of the nucleotide sequences represented by the nucleotide numbers 1 to 324 of SEQ ID NO: 1 in the sequence listing and those represented by the nucleotide sequences represented by the nucleotide numbers 1 to 324 of SEQ ID NO: 2 in the sequence listing are as follows. , Tables 8-10).
  • the primers for PCR Y 2 to Y 4 are the nucleotide numbers 1 to 3 4 0 on the nucleotide sequence shown in SEQ ID NO: 1 to SEQ ID NO: 3 or SEQ ID NO: 2 in the sequence listing. Selectively anneals to a specific region on the base sequence shown in 3. '
  • a nucleotide sequence should be appropriately added to their 5'-ends.
  • a base sequence is not particularly limited as long as the primer can be used for PCR, and examples thereof include a base sequence that is convenient for performing a subsequent cloning operation on the PCR product. Examples of the sequence include a restriction enzyme recognition sequence and a base sequence containing the restriction enzyme recognition sequence.
  • the design of the primers X1 to X4 for PCR and the primers Y1 to Y4 for PCR are performed in accordance with the above description on the design of the primer for PCR.
  • Functional expression of the recombinant DNA vector possessed by the positive clone should be performed by transforming cells with the recombinant DNA vector and measuring the ML-236B-producing ability of the transformed cells. Can be.
  • the cells that express the function the above-mentioned ML-236B-producing bacteria or ML-236B non-producing bacteria can be used.
  • a cell transformed with the DNA vector is particularly preferable.
  • non-producing mutants of the above-mentioned ML-236B-producing bacteria and the like can be mentioned.
  • the production of ML-236B is restored by transforming the mutant strain, it can be estimated that the recombinant DNA vector has a desired function.
  • a transformation method for expressing the function is appropriately selected depending on the host cell. Transformation of a suitable ML-236B producing bacterium, P. citrinum, is performed by preparing a protoplast from the spores of P. citrinum and adding a recombinant DNA vector to the protoplast. It can be performed by introduction (described in Nara, F., et al., Curr. Genet. 23, 28 (1993)).
  • Protoplasts are prepared as follows.
  • the bacteria are inoculated on a PGA agar plate from the slant in which Penicillium 'citrinum has been cultured, incubated at 22 to 28 ° (for 10 to 14 days), and spores are collected from the plate. and, spores 1 X 1 0 7 to 1 X 1 0 9 pieces of 5 0 to 1 0 0 ml of YPL - 2 0 medium (composition; 0.
  • Germinated spores are collected from the culture and treated with a cell wall degrading enzyme to obtain protoplasts.
  • the cell wall degrading enzyme is not particularly limited as long as it degrades the cell wall of Penicillium citrinum and does not exert a harmful effect on the bacterium. Examples thereof include zymoliase and chitinase. Is mentioned.
  • Culture of the transformed ML-236B-producing bacteria can be carried out under conditions suitable for each host cell, but the preferred ML-236B-producing bacteria, Benicillium citrinum
  • the cell wall is regenerated by culturing the transformed protoplasts under appropriate conditions before producing ML-236B.
  • the cell wall was regenerated by transforming VGS medium agar medium containing the transformed penicillium and citrinum protoplasts (composition: Voge 1 minimal medium, 2% (w / v) dalcose, 1 M glucitol, 2% (w / v) agar) VGS lower layer agar medium (composition: Voge 1 minimal medium, 2% (w / v) glucose, 1M glucitol, 2.7% (w / v) agar ) And VGS upper layer agar medium (composition: Voge 1 minimal medium, 2% (w / v) Darcos, 1M glucitol, 1.5% (w / v) agar), 22 to 2
  • the strain can be subcultured on a PGA medium while keeping the temperature at 22 to 28 ° C.
  • the strain can be subcultured on a PGA medium at a temperature of 22 to 28 ° C.
  • the slant prepared in the medium is inoculated with a platinum loop, kept at 22 to 28 ° ⁇ for 10 to 14 days, and stored at 0 to 4.C.
  • ML-236B Purification of ML-236B from cultures of ML-236B-producing bacteria is accomplished by combining techniques commonly used for the purification of natural products. Examples of the various techniques include, but are not limited to, centrifugation, solid-liquid separation by filtration, alkali or acid treatment, extraction with an organic solvent, phase transfer, adsorption and distribution, and various types of chromatography, crystallization, and the like. No. ML-236B takes the form of both the hydroxy and lactone forms, which are converted to each other, and the hydroxy form forms stable salts.
  • ML-236B hydroxy acid form hereinafter referred to as “free hydroxy acid”
  • ML-236B hydroxy acid salt hereinafter referred to as “free hydroxy acid”
  • hydroxylate a lactone form of ML-236B
  • lactone a lactone form of ML-236B
  • the culture is opened by heating or at room temperature to hydrolyze and hydrolyze to convert to a hydroxylate, the reaction solution is acidified and filtered, and the filtrate is not mixed with water.
  • the target compound By extracting with an organic solvent, the target compound can be obtained as free hydroxy acid.
  • the organic solvent that is immiscible with water is not particularly limited; for example, aliphatic hydrocarbons such as hexane and heptane, aromatic hydrocarbons such as benzene and toluene, methylene chloride, and the like.
  • Halogenated hydrocarbons such as black form, ethers such as getyl ether, ethenolees such as ethyl formate and ethyl acetate, Examples thereof include a mixed solvent of two or more thereof.
  • the target compound can be obtained as a hydroxy acid salt by dissolving the free hydroxy acid in an aqueous solution of an alkali metal salt such as sodium hydroxide.
  • the target compound can be obtained as a lactone by dehydrating the free hydroxy acid by heating in an organic solvent or by closing the ring by another method.
  • the free hydroxy acid, hydroxy acid salt and lactone thus obtained can be purified and isolated by column chromatography or the like.
  • column chromatography or the like.
  • Sephadex LH-20 manufactured by Pharmacia
  • HP-20 manufactured by Mitsubishi Chemical Corporation
  • silica gel examples thereof include silica gel, and a reversed-phase carrier, and a C18-based carrier is preferred.
  • the method for quantifying ML-236B is not particularly limited as long as it is a method usually used for the quantification of organic compounds.
  • reverse-phase HPLC reverse-phase high-performance chromatography
  • cultures of ML-236B-producing bacteria were hydrolyzed with alkali, and the soluble fraction was subjected to reversed-phase HPLC using a C18 column to measure ultraviolet absorption. This can be done by quantifying the absorption.
  • the C18 column is not particularly limited as long as it is a C18 column used for ordinary reversed-phase HPLC.
  • the mobile phase is not particularly limited as long as it is a solvent usually used for reverse phase HPLC.For example, 75% (v / v) methanol-0.1% (v / v) triethylamine-0.1 1% (v / v) acetic acid and the like.
  • adenine is described as “a”
  • guanine is described as “g”
  • thymine is described as “mo”
  • cytosine is described as “c”.
  • the nucleotide sequence shown in each SEQ ID NO in the sequence listing is described in accordance with “Guidelines for Preparation of Specifications and the like Containing Base Sequence or Amino Acid Sequence (published by the Patent Office, June 2010)”.
  • Figure 1 Construction diagram of pSAK cos1, a DNA vector that can be introduced into E. coli and filamentous fungi and can insert a long DNA.
  • Figure 2 Structural gene analysis of the pML48 insertion sequence.
  • Figure 3 Northern blot, hybridization of the pML48 insertion sequence.
  • Plasmid pSAK333 (described in Japanese Patent Application Laid-Open No. 3-226486) having a hygromycin B phosphotransferase gene derived from Escherichia coli was replaced with a restriction enzyme BamHr (Takara Shuzo Co., Ltd.). ) And blunt-ended with T4 DNA polymerase (Takara Shuzo Co., Ltd.).
  • a strain carrying a plasmid lacking the BamHI site was selected from the transformed Escherichia coli, and the plasmid carried by this strain was transformed into pSAK. It was named 360.
  • pSAK365 was digested with the restriction enzyme PvuII, and then subjected to an alkaline phosphatase treatment, followed by dephosphorylation of the 5 'end.
  • a [Sa1I—Sca.I] fragment (about 3 kb) containing a cosm (cos) site was obtained from the cosmid vector pWEl5 (manufactured by STRATAG ENE), and T4 DNA polymerase was obtained. After blunting the ends, the ligation was carried out at the PVuII site of pSAK365, and the JM109 strain was transformed.
  • pSAKcosl has one restriction site for each of BamHI, EcoRI and NotI derived from pWE15. Also, pSAK cosl has an ampicillin resistance gene and a hidalomycin resistance gene as selection markers.
  • the ANK 13380 strain was inoculated with a platinum loop and kept at 26 ° C for 14S. This slant was stored at 4 ° C.
  • the main culture was performed by liquid aeration culture.
  • the above slant 5 mm square cells A 500 ml Erlenmeyer flask containing ml of MBG3-8 medium was inoculated, and cultured under shaking at 26 ° C and 210 rpm for 5 days.
  • the culture obtained in 1) was centrifuged at room temperature under a condition of 10000 XG for 10 minutes to collect the cells.
  • Cells having a wet weight of 3 g were crushed in a mortar cooled with dry ice until they became powder.
  • 20 ml of 62.5 mM EDTA ⁇ 2Na (manufactured by Wako Pure Chemical Industries, Ltd.) — 5% (w / v) SDS—50 mM Tris (Wako Pure Chemical Industries, Ltd.)
  • the mixture was placed in a centrifuge tube filled with a monohydrochloric acid (manufactured by Wako Pure Chemical Industries, Ltd.) buffer (pH 8.0), mixed gently, and allowed to stand at 0 ° C. for 1 hour.
  • the restriction enzyme reaction was stopped by adding EDTA ( ⁇ 8.0).
  • the obtained partially digested DNA fragment was separated by agarose gel electrophoresis, and an agarose gel containing a DNA fragment having a size of 30 kb or more was recovered.
  • the collected gel was finely crushed and placed in an Ultrafree C3 centrifugal filtration unit (manufactured by Nippon Miripore Co., Ltd.). — After cooling at 80 ° C for 15 minutes and freezing the gel, it was kept at 37 ° C for 10 minutes to melt the gel. Centrifugation was performed at 5,000 XG for 5 minutes to obtain a DNA extract. The DNA extract was subjected to phenol / chloroform extraction and ethanol precipitation, and the resulting precipitate was dissolved in a small amount of TE.
  • the genomic DNA fragment (2 / g) described in 1) above and the pretreated pSAK cosl (lg) described in 2) above were mixed, and DNA ligationkit Ver. 2 (Takara Shuzo Co., Ltd.) was used.
  • a Reigesion reaction was performed at 16 ° C for 16 hours.
  • the reaction-terminated liquid was subjected to phenol / chloroform extraction and ethanol precipitation, and the resulting precipitate was dissolved in 5 ⁇ l of water.
  • the resulting mixture was subjected to in vitro packaging using the recombinant DNA vector to obtain transformed E. coli containing the recombinant DNA vector.
  • recovery liquid 2 (This is referred to as recovery liquid 2.)
  • a mixture of recovered solutions 1 and 2 with glycerin added to a final concentration of 18% is called Escherichia coli germ fluid, and the genomic DNA library of Penicillium 'Citulinum SANK 13380 strain is used. For storage, it was stored at 180 ° C.
  • Example 4 Amplification of PKS gene fragment by PCR using genomic DNA of Penicillium 'citrinum S ANK13380 as type III
  • n represents the base of inosine (hypoxanthine)
  • y represents t or c
  • s represents g or c
  • k represents g or t
  • r represents Represents g or a
  • w represents a or t, respectively.
  • the primers for PCR (100 pmo 1 each) described in 2) above, the genomic DNA (500 ⁇ g) of the Penicillium 'citrineum S ANK 13380 strain obtained in Example 2, 0.2 mM d ATP, 0.2 mM d CTP, 0.2 mM d GTP, 0.2 mM d TTP, 50 mM potassium chloride, 2 mM magnesium chloride and 1.25 50 ⁇ l of the reaction solution containing the unit of EX.Taq DNA polymerase (Takara Shuzo Co., Ltd.) was added at 94 ° C (1 minute, 58 ° C for 2 minutes, 70 ° C). For 3 minutes at, and subjected to a cycle reaction consisting of three consecutive steps. Thus, the DNA fragment was amplified. PCR was carried out using TaKaRa PCRT herma 1 Cycler MP TP3000 (manufactured by Takara Shuzo Co., Ltd.).
  • an agarose gel containing a DNA fragment having a size of about 1.0 to 2.0 kb was recovered.
  • the DNA was recovered from the gel and subjected to phenol / chloroform extraction and ethanol precipitation. The resulting precipitate was dissolved in a small amount of TE.
  • Preparation of a recombinant DNA vector from this culture was performed using the alkaline method (Maniatis, T., et a ⁇ ., Molecular cloning, a laboratory manual, 2nd ed., Co ⁇ d Spring Harbor Laboratory, Cold Spring Harbor, NY (1989)). That is, 1.5 ml of the culture solution was centrifuged at room temperature under a condition of 10000 XG for 2 minutes, and the cells were collected by precipitation.
  • the genomic DNA (10 ⁇ g) of the Penicillium ′ citrinum S ANK 13 380 strain obtained in Example 2 was ligated with the restriction enzymes EcoRI, Sail, and Hindi.
  • Digestion was performed using I I or Sac I (both manufactured by Takara Co., Ltd.) and subjected to agarose gel electrophoresis.
  • Agarose gel was prepared using Agarose L03 "TAKARA" (manufactured by Takara Shuzo Co., Ltd.). After the electrophoresis, the gel was immersed in 0.25N hydrochloric acid (manufactured by Wako Pure Chemical Industries, Ltd.) and gently shaken at room temperature for 1 minute. This gel was transferred into 0.4 N sodium hydroxide (manufactured by Wako Pure Chemical Industries, Ltd.) and gently shaken at room temperature for 30 minutes.
  • the PKS gene fragment DNA (1 mg) obtained in Example 4 was labeled with DIGDNA Labeling Kit (manufactured by Boehringer Mannheim), boiled for 10 minutes immediately before use, and quenched.
  • DIGDNA Labeling Kit manufactured by Boehringer Mannheim
  • a hybridization solution DIG Easy Hive: manufactured by Boehringer Mannheim
  • TITEC Multi Shaker 'Oven HB
  • the sample was processed with KitforNucleicAcids (manufactured by Boehringer Mannheim) and exposed to an X-ray film (Noremi Film: manufactured by Behringer Mannheim). Exposure was performed using Fuji Medical Film Processor F PM800A (FujiFi1m).
  • Example 6 Screening of genomic DNA library of Penicillium 'Citrinaum S ANK 133 80 strain using PKS gene fragment as probe
  • the cloning of the genomic DNA containing the PKS gene was performed by the Koguchi 21 hybridization method.
  • Escherichia coli bacterial fluid (described in Example 3) stored as a genomic DNA library of Penicillium 'Citulinum SA NK13380 strain was added to a plate of LB agar medium. 5,000 to 10,000 colonies were diluted and scattered so as to grow. The plate was kept at 26 ° C for 18 hours and then cooled at 4 ° C for 1 hour. Hybond TM — N + (Amersham) was placed on the plate and indirectly contacted for 1 minute. Carefully separate the membrane with the colonies from the plate and place 200 ml of 1.5 M sodium chloride—0.5N with the column contact side up.
  • the PKS gene fragment DNA (1 ⁇ g) obtained in Example 4 was labeled with DIG DNA Labeling Kit (manufactured by Behringer Mannheim), and after boiling for 10 minutes immediately before use The quenched one was used.
  • the membrane described in 1) is immersed in a hybridization solution (DIG Easy Hive: manufactured by Behringer Mannheim), and prehybridization is performed at 42 ° C for 2 hours while shaking at 20 rpm. After that, the above-mentioned labeled probe is added to the hybridization solution, and hybridization is performed at 42 ° C for 18 hours while shaking at 20 rpm using a multi-shaker Oven HB (manufactured by AITEC). Was performed.
  • the membrane subjected to hybridization was washed three times with 2 XSSC at room temperature for 20 minutes, and washed with 0.1 XSSC at 68 ° (: twice for 30 minutes. Each was done.
  • the sample was processed with KitforNucleiccAcids (manufactured by Boehringer Mannheim) and exposed to an X-ray film (Noremi film: manufactured by Behringer Mannheim). Exposure was performed using Fuji Medical Film Processor F PM800A (FujiFi1m).
  • a clone in which a positive signal was detected in the first screening was scraped around the colony, suspended in LB medium, diluted appropriately, and spread on a plate, followed by culture in the same manner. was screened to purify the positive clones.
  • Example 6 The cultivation of the E.co1ipML48SANK71199 strain obtained in Example 6 and the preparation of a recombinant DNA vector from the culture were performed according to the method described in Example 4.
  • the obtained recombinant DNA vector was designated as pML48.
  • the pML48 insertion sequence was subcloned by digesting with various restriction enzymes and incorporating it into pUC119 (manufactured by Takara Shuzo Co., Ltd.). Using the obtained subclone as a probe, Southern plot hybridization was carried out according to the method described in Example 5. That is, the various restriction enzyme digests of pML48 were subjected to electrophoresis, and the DNA was transferred to the membrane, and hybridization was performed.
  • nucleotide sequence of the inserted sequence of each of the above-mentioned subclones was determined using a DNA Sequencer-1 model 377 (manufactured by Perkin-Elma Japan KK), and the entire nucleotide sequence of pML48 was determined.
  • the inserted sequence of pML48 was a total of 342 003 bases.
  • the base sequence of the inserted sequence of PML48 is described in SEQ ID NOs: 1 and 2 in the sequence listing.
  • the nucleotide sequences shown in SEQ ID NOs: 1 and 2 in the sequence listing are completely complementary to each other.
  • mlc A, mlc B, mlc C, mlc D, mlc E and mlc R are In the nucleotide sequence described in SEQ ID No. 2 in the sequence listing, it is presumed that m1cC and m1cD each have a code region in the nucleotide sequence shown in SEQ ID NO. 1 in the sequence listing. It was done. Further, the relative position and size of each putative structural gene in the inserted sequence were estimated.
  • Penicillium citrineum S ANK 1 330 The strain of 5 mm square from the slant (described in Example 2) was cultured in 100 ml of 100 ml of MGB3-8 medium. The mixture was inoculated into a 1-volume Erlenmeyer flask and cultured with shaking at 26 ° C for 3 days.
  • RNA from the culture was carried out using RNeasyPlAntMiniKit (manufactured by Qiagen) utilizing the panidine-isothiocane method. That is, the culture was centrifuged at room temperature under the condition of 5,000 XG for 10 minutes to collect the cells, and the cells with a wet weight of 2 g were frozen with liquid nitrogen and then placed in a mortar. Crushed to a powder. This crushed product was suspended in 4 ml of a cell lysis buffer (included in this kit) containing guanidine / isothiothionate.
  • RNA sample was used for 65. After keeping the mixture at C for 10 minutes, it was rapidly cooled in ice water and subjected to agarose gel electrophoresis.
  • the electrophoresis gel was prepared by combining 10 ml of 10 XMOPS and 1 g of Agarose L03 “TAKA RA” (Takara Shuzo Co., Ltd.) with 72 ml of Pyro-Kyoroné Bonic's acid gel. It was prepared by mixing chill ester (manufactured by Sigma) with treated water, heating to dissolve the agarose, cooling, and adding 18 ml of formaldehyde. As a sample buffer, 1 XMO PS (10 X MO PS diluted 10-fold with water) was used. The RNA in the gel was transferred to Hybond TM —N + (Amersham) in 10 XSSC.
  • DNA fragments (a, b, c, d and e) obtained by digesting the pML48 insertion sequence with restriction enzymes 1 and 2 shown in Table 1 below were used as probes.
  • restriction enzyme recognition site Restriction of restriction enzyme recognition site Restriction of restriction enzyme recognition site — _ enzyme Nucleotide number * Enzyme 2 Nucleotide number * a. EcoRI 6319— 6324 EcoRI 15799 to 15804
  • Each nucleotide number is based on SEQ ID No. 1 in the sequence listing. Probe labeling, hybridization and signal detection were performed according to the Southern blot hybridization of Example 5. FIG. 3 shows the results of this example.
  • Each signal indicates the presence of a transcript homologous to the nucleotide sequence of each probe.
  • mlcB, mlcD, mlcE and m1cR were:
  • each signal does not indicate the relative size of the transcript.
  • Table 2 shows the nucleotide sequence of the oligosense DNA (1) on the antisense side designed based on the nucleotide sequence located on the 3'-side of each structural gene.
  • the nucleotide sequence of oligo-DNA (2) on the antisense side designed based on the nucleotide sequence located at (1) is described.
  • Table 2. Oligo DNA (1) gene used for 5'-terminal sequence analysis by 5 'R ACE SEQ ID NO in the Sequence Listing: Base sequence _
  • mlcE Sti system number 15 ggaaggcaaagaaagtgtac
  • mlcR C column number 1: agattcattgctgttggcatc oligo DNA (1) was used as the primer, and penicillium.
  • the chain was synthesized. That is, the 24 // 1 reaction mixture containing l ⁇ g of total RNA, 2.5 pmol of oligo DNA (1), and 1 ⁇ l of SUPERSCRIPT TM II reversetranscriptase (included in this kit) was After incubating at 16 ° C for 1 hour, the product was added to the GLAS SMAX spin cartridge contained in this kit to purify the cDNA first strand.
  • the tertiary chain C was added to the terminaldeleoxyrivibonuc1eottidy1transsieraisasei contained in this kit.
  • 3 ' Contains the first strand of cDNA with a poly C chain added at the end, 40 pmo 1 of oligo DNA (2) and 40 pmol of Bridged Anchor Primer (included in this kit) Incubate 50 ⁇ l of the reaction solution at 94 ° C for 2 minutes, then continue at 94 ° C for 30 seconds, 55 ° C for 30 seconds, and 72 ° C. The reaction was performed 35 times for 2 minutes in a cycle of 2 minutes, and then incubated at 72 ° C for 5 minutes and at 4 ° C for 18 hours.
  • the nucleotide sequence of the cDNA fragment containing the 5 'end was determined, and the positions of the transcription start point and the translation start codon were estimated.
  • Table 4 shows the sequence numbers of the sequence listings describing the base sequence of the 5'-terminal cDNA fragment corresponding to each structural gene obtained by 5 'RACE.
  • Table 5 shows the transcription start point of each structural gene, the sequence number where translation starts, the position of transcription start point, and the position of translation start point.
  • Table 4 SEQ ID No. in the sequence listing showing the nucleotide sequence of each 5'-terminal cDNA fragment
  • the nucleotide sequence of the 3′-side fragment of the obtained cDNA was determined, and the position of the translation termination codon was estimated.
  • Table 7 summarizes the sequence numbers of the sequence listings describing the base sequence of the 3′-terminal cDNA fragment corresponding to each structural gene obtained by 3 ′ RACE. Also, in Table 8, the translation termination codon of each structural gene and the position of the codon are described based on SEQ ID NO: 1 or 2 in the sequence listing. Table 7. Sequence number in the sequence listing showing the nucleotide sequence of each 3'-terminal c DNA fragment
  • Residue C-terminal The amino acid is transferred to the trinucleotide SEQ ID NO: 1 or 2.
  • the trinucleotide in the presence of the trinucleotide is present.
  • Penicillium 'citrinum Transformation of Penicillium 'citrinum was performed according to the method of Nara et al. (Described in Nara, F., et al., Curr. Genet. 23, 28 (1993)).
  • a PGA agar medium was inoculated with a platinum loop from a slant obtained by cultivating Penicillium citrinum S ANK 133 0 8 strain, and incubated at 26 ° C for 14 days. Spores of 1 3 3 8 0 shares the culture by repeller Nishiri um 'citrate Rinamu SANK were collected and IX 1 0 8 spores were inoculated into YPL- 2 0 medium 8 0 ml, the 2 6 ° C For one day.
  • the germinated spores were centrifuged at room temperature under the condition of 500.times.XG for 10 minutes, and the spores were collected as a precipitate. The spores were washed three times with sterile water, and then protoplasted. That is, 200 mg of Zymoryase 20 T (manufactured by Seikagaku Corporation) and 100 mg of chitinase (Sig was dissolved in 10 ml of 0.5M magnesium chloride, and centrifuged at room temperature under the condition of 500 XG for 10 minutes.
  • m 1 Enzyme solution and 0.5 g wet weight of germinated spores were placed in a 100-ml Erlenmeyer flask and gently shaken at 30 ° C for 60 minutes to form protoplasts. After confirmation by microscopic observation, the reaction solution was filtered through a 3G-2 glass filter (manufactured by HARIO). The filtrate was centrifuged at room temperature under a condition of 1000 XG for 10 minutes, and the protoplast was collected as a precipitate.
  • the protoplast obtained in 1) was washed twice with 30 ml of 0.5 M magnesium chloride solution, and 30 ml of 0.5 M magnesium chloride- 50 mM calcium chloride 10 mM 3-methylene chloride solution. Wash once with morpholinopropanesulfonic acid ( ⁇ ⁇ 6.3: hereafter referred to as “ ⁇ CM solution”), and add 100% of 4/1 (w / v) polyethylene glycol 800-10 mM 3-morpholinopropanesulfonic acid-0.025% (w / v) heparin (manufactured by Sigma)-50 mM Shiridani Magnesium
  • transformation solution (pH 6.3: hereinafter, referred to as “transformation solution”). About 5 X 1 0 7 single mixing 1 0 mu 1 of TE containing pro Topurasu transformation of 9 6 beta 1 including bets solution ⁇ Pi 1 2 0 / xg pML 4 8 DNA in ice for 3 0 minutes It was left still. To this was added 1.2 ml of 20% (w / v) polyethylene glycol-50 mM magnesium chloride-10 mM 3-morpholinopropanesulfonic acid (pH 6.3), and the mixture was moderately diluted. This was pipetted and allowed to stand at room temperature for 20 minutes. To this, 10 ml of an MCM solution was added, mixed gently, and centrifuged at room temperature under a condition of 1000 XG for 10 minutes. Transformation protoplasts were recovered from the precipitate.
  • the transformation protoplast obtained in 2) was suspended in 5 ml of a liquid VGS medium agar medium, and layered on a solidified 10 ml VGS lower agar medium plate. After culturing the plate at 26 ° C for 1 day, 10 ml of liquid VGS upper agar containing 5 mg of hygromycin B (Sigma) per plate was used. The medium was overlaid (final concentration of hygromycin B was 200 ⁇ g Z ml). The strain obtained by incubation at 26 ° C for 14 days was subcultured on PGA agar medium containing SOO / igZml of hygromycin B, and then inoculated on the slant prepared on PGA agar medium. And incubated at 26 ° C for 14 days.
  • Test Example 1 Comparison of ML-236B production ability of transformed strain and parent strain
  • Example 9 The transformed strain obtained in Example 9 and the parent strain Penicillium 'citrinum S ANK 13380 strain were cultured, and the amount of ML-236B in the culture was measured.
  • a 5 mm square cell from the slant (described in Example 9) in which the transformed strain was cultured (described in Example 9) or the slant (in Example 2) in which the penicillium 'citrine S ANK 13380 strain was cultured was added to 1O. After inoculating a 10 O m1 Erlenmeyer flask containing m1 MBG3-8 medium and culturing with shaking at 26 ° C for 2 days, 50% of 3.5 m1 ( (w / v) Dalyceline solution was added, and the cells were further cultured with shaking at 26 ° C for 10 days.
  • the HPLC column used was SSC-ODS-262 (diameter 6 mm, length 100 mm: manufactured by Sensyu Kagaku Co., Ltd.), and the mobile phase was 75% (v / v) methanol 0.1% (v / v) triethylamine—eluted with 0.1% (v / v) acetic acid at room temperature at a flow rate of 2 ml / min. Under these conditions, ML-236B was eluted 4.0 minutes after column loading. Detection was carried out by setting the absorption wavelength of the UV detector to 236 nm, and among the c- transformed strains, 5 strains with improved ML236B-producing ability were obtained. On average 12% higher.
  • the DNA obtained from the ML-236B-producing bacterium improves the ML-236B-producing ability of the producing bacterium by being introduced into the producing bacterium.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un ADN que l'on a cloné à partir d'une bibliothèque d'ADN du génome d'un micro-organisme produisant ML-236B et qui est caractérisé en ce qu'il peut améliorer la productivité en ML-236B du brin lorsqu'il y est transféré. Une fois transféré dans le brin produisant ML-236B, l'ADN susmentionné améliore la productivité en ML-236B dudit brin.
PCT/JP2000/005420 1999-08-11 2000-08-11 Adn lie a la biosynthese ml-236b WO2001012814A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU64758/00A AU6475800A (en) 1999-08-11 2000-08-11 Ml-236b biosynthesis-associated dna

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP11/227696 1999-08-11
JP22769699 1999-08-11

Publications (1)

Publication Number Publication Date
WO2001012814A1 true WO2001012814A1 (fr) 2001-02-22

Family

ID=16864926

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2000/005420 WO2001012814A1 (fr) 1999-08-11 2000-08-11 Adn lie a la biosynthese ml-236b

Country Status (2)

Country Link
AU (1) AU6475800A (fr)
WO (1) WO2001012814A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1149919A2 (fr) * 2000-04-18 2001-10-31 Sankyo Company Limited Genes en relation de la biosynthése de ML-236B

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995012661A1 (fr) * 1993-11-02 1995-05-11 Merck & Co., Inc. Adn codant une triol-polycetide-synthase

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995012661A1 (fr) * 1993-11-02 1995-05-11 Merck & Co., Inc. Adn codant une triol-polycetide-synthase

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
BECK J. ET AL.: "The multifunctional 6-methylsalicylic acid synthase gene of penicillium patulum", EUR. J. BIOCHEM., vol. 192, no. 2, 1990, pages 487 - 498, XP002934751 *
BROWN D.W. ET AL.: "Twenty-five coregulated transcripts define a sterigmatocytin gene cluster in aspergillus nidulans", PROC. NATL. ACAD. SCI. USA, vol. 93, 1996, pages 1418 - 1422, XP002934749 *
FUJII I. ET AL.: "Structures and functional analysis of fungal polyketide synthase genes", ACTINOMYCETOL., vol. 12, no. 1, 1998, pages 1 - 14, XP002934750 *
FUJII I.: "Polyketide kousei busshitsu seigousei idenshi no cloning", RESEARCH REPORT OF MOCHIDA KINEN ZAIDAN, vol. 5, 1989, pages 256 - 257, XP002934748 *
HENDRICKSON L. ET AL.: "Lovastatin biosynthesis in aspergillus terreus: Characterization of blocked mutants, enzyme activities and a multifunctional polyketide synthesis gene", CHEM. BIOL., vol. 6, no. 7, June 1999 (1999-06-01), pages 429 - 439, XP002934746 *
KENNEDY J. ET AL.: "Modulation of polyketide synthase activity by accessory proteins during lovastatin biosynthesis", SCIENCE, vol. 284, May 1999 (1999-05-01), pages 1368 - 1372, XP002934745 *
SERIZAWA N.: "Development of two-step fermentation-based production of pravastatin, a HMG-CoA reductase", J. SYNTH. ORGAN. CHEM., vol. 55, no. 4, 1997, pages 334 - 338, XP002934747 *
TSUJITA Y. ET AL.: "Discovery and development of hypolipidemic drug, pravastatin sodium", TISS. CULT. RES. COMMUN., vol. 12, no. 4, 1993, pages 279 - 289, XP002934752 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1149919A2 (fr) * 2000-04-18 2001-10-31 Sankyo Company Limited Genes en relation de la biosynthése de ML-236B
EP1149919A3 (fr) * 2000-04-18 2002-02-06 Sankyo Company Limited Genes en relation de la biosynthése de ML-236B
US7056710B2 (en) 2000-04-18 2006-06-06 Sankyo Company, Limited Methods for producing ML-236B, a pravastatin precursor, using a host cell transformed with mlcR, a transcription factor

Also Published As

Publication number Publication date
AU6475800A (en) 2001-03-13

Similar Documents

Publication Publication Date Title
KR101690802B1 (ko) 피리피로펜 ａ 생합성 유전자
JP5514185B2 (ja) Ｎｒｐｓ−ｐｋｓ遺伝子群ならびにその操作および有用性
WO2006126723A1 (fr) Microorganisme genetiquement modifie et procede pour la production d’un compose macrolide utilisant le microorganisme
US20090011476A1 (en) Gene cluster and method for the biosynthesis of terrequinone a
US20070111293A1 (en) Genes from a gene cluster
JP4668176B2 (ja) トリテルペン水酸化酵素
MX2012013099A (es) Cepas spnk.
WO2001012814A1 (fr) Adn lie a la biosynthese ml-236b
EP1381685B1 (fr) Genes et proteines destines a la biosynthese de polyketides
JP3972068B2 (ja) 遺伝子クラスター上の構造遺伝子
CN111378675A (zh) 长春花中艾里莫芬烷倍半萜的生物合成基因及应用
KR100808307B1 (ko) 신규한(알)-2-히드록시-3-페닐프로피온산(디-페닐유산)탈수소효소 및 이 것을 코드하는 유전자
EP1826267B1 (fr) Nouvelle halogénase
JP5954539B2 (ja) １−ベンジル−４−ヒドロキシ−３−ピペリジンカルボン酸アルキルエステルの製造方法
JP2001112487A (ja) Ｍｌ−２３６ｂ生合成関連ｄｎａ
JP2003116567A (ja) 遺伝子クラスター
JP2004173537A (ja) カナマイシン生合成遺伝子
CN117625567A (zh) 酮还原酶突变体、其组合物、生物材料及应用
CN116656641A (zh) 咖啡酸o-甲基转移酶突变体及其应用
EA013412B1 (ru) Новый ген sms 27
JP2003033188A (ja) エバーメクチン誘導体の製造法
JP2006136291A (ja) リポペプチド化合物生合成遺伝子
Temporini et al. The cfp genes (cfp-1 and cfp-2) of Neurospora crassa: a tale of a bunch of filaments, one enzyme, and two genes
JP2007000104A (ja) 渦鞭毛藻由来のポリケチド合成酵素遺伝子

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU BR CA CN CZ HU ID IL IN KR MX NO NZ PL RU TR US ZA

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase