WO2000040607A2 - Tiam2 (t-cell lymphoma invasion and metastasis 2) nucleotide exchange factor - Google Patents
Tiam2 (t-cell lymphoma invasion and metastasis 2) nucleotide exchange factor Download PDFInfo
- Publication number
- WO2000040607A2 WO2000040607A2 PCT/US2000/000459 US0000459W WO0040607A2 WO 2000040607 A2 WO2000040607 A2 WO 2000040607A2 US 0000459 W US0000459 W US 0000459W WO 0040607 A2 WO0040607 A2 WO 0040607A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- amino acids
- tiam2
- polynucleotide
- aal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
Definitions
- the present invention is in the field of molecular biology. More specifically, the present invention relates to a polynucleotide sequence and corresponding TIAM2 protein.
- the TIAM1 gene and characteristics of the encoded protein are discussed in Habets et al., Cell 77:537-549 (1994); Hart, M.J. et al.. J. Biol Chem. 269:62-65 (1994); Haslam et al., Nature 565:309-310 (1993); and Mayer, B.J. et al.. Cell 75:629-630 (1993).
- the invention relates to a polynucleotide comprising a polynucleotide of SEQ ID NO:8.
- the invention also relates to a polypeptide encoded by SEQ ID NO:8.
- the invention further relates to a polynucleotide having at least 80% sequence identity to SEQ ID NO:8.
- the invention still further relates to a polynucleotide having at least 85% sequence identity to SEQ ID NO:8.
- the invention also relates to a polynucleotide having at least 90% sequence identity to SEQ ID NO:8.
- the invention further relates to a polynucleotide having at least 95% sequence identity to SEQ ID NO: 8.
- the invention relates to a polynucleotide comprising a polynucleotide of SEQ ID NO:9.
- the invention also relates to a polypeptide encoded by SEQ ID NO:9.
- the invention further relates to a polynucleotide having at least 80% sequence identity to SEQ ID NO:9.
- the invention still further relates to a polynucleotide having at least 85% sequence identity to SEQ ID NO:9.
- the invention also relates to a polynucleotide having at least 90% sequence identity to SEQ ID NO:9.
- the invention further relates to a polynucleotide having at least 95% sequence identity to SEQ ID NO:9.
- the invention relates to a polynucleotide comprising a polynucleotide of SEQ ID NO:10.
- the invention also relates to a polypeptide encoded by SEQ ID NO- 10.
- the invention further relates to a polynucleotide having at least 80% sequence identity to SEQ ID NO: 10.
- the invention still further relates to a polynucleotide having at least 85% sequence identity to SEQ ID NO: 10.
- the invention also relates to a polynucleotide having at leasi 90% sequence identity to SEQ ID NO:l 0.
- the invention further relates to a polynucleotide having at least 95% sequence identity to SEQ ID NO: 10.
- the invention relates to a polypeptide having at least 80% sequence identity to the amino acid sequence of SEQ ID NO:l l, SEQ ID NO:12 or SEQ ID NO:13.
- the invention also relates to a polypeptide having at least 85% sequence identity to the amino acid sequence of SEQ ID NO: l l, SEQ ID NO:12 or SEQ ID NO:13.
- the invention further relates to a polypeptide having at least 90% sequence identity to the amino acid sequence of SEQ ID NO:l l , SEQ ID NO:12 or SEQ ID NO:13.
- the invention still further relates to a polypeptide having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: l l , SEQ ID NO:12 or SEQ ID NO: 13.
- the invention further relates to an antibody capable of specifically binding to a polypeptide encoded by SEQ ID NO:8.
- the invention further relates to an antibody capable of specifically binding to a polypeptide having the amino acid sequence of SEQ ID NO:l l .
- the invention also relates to a method of detecting expression of a
- TIAM2 expression product in a biological sample comprising obtaining polypeptides from the biological sample, contacting the polypeptides with an antibody capable of specifically binding to TIAM2. and detecting the presence or absence of antibody- polypeptide complexes.
- the invention also relates to a method of obtaining a TIAM2 polypeptide. comprising expressing a polynucleotide having at least 80% sequence identity to SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO: 10.
- the invention further relates to a vector comprising a polynucleotide having at least 80% sequence identity to SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10.
- the invention still further relates to a vector comprising a polynucleotide having at least 80% sequence identity to SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO: 10. and at least one regulatory region.
- the invention also relates to a host cell comprising a polynucleotide having at least 80% sequence identity to SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO: 10.
- the invention further relates to a method of detecting a deletion of a region of chromosome 6q25 in ovarian cancer, comprising comparing the polynucleotide sequence of region of chromosome 6q25 of an ovarian tissue sample suspected of being cancerous with the polynucleotide sequence of SEQ ID NO:8, SEQ ID NO: 9 or SEQ ID NO: 10 and determining the presence or absence of the sequence in the polynucleotides of the tissue sample.
- FIGURES Figure 1 Human brain-(A) and tissue-specific (B) blots containing
- TIAM-specific probes that recognize both the long (TIAM and the short (TIAM S ) forms of TIAM2.
- a probe derived from the 5 " end of the 4.4-Kb message hybridized to only the long form (C), while a S'-specific probe hybridized to both the long and the short forms (D). on the brain-specific Northerns.
- FIG. 2 shows expression of TIAM2 and mRNA in mouse brain.
- A Whole mount of a El 3.5 embryo brain. TIAM2 transcripts are expressed throughout the developing telencephalon (T).
- B Parasagittal section through an El 3.5 telencephalon demonstrating that TIAM2 mRNA is localized to cells near the pial (P) surface; labeling is not seen near the ventricular surface (V).
- C Coronal section through the adult mouse forebrain. TIAM2 transcripts are localized to the cerebral cortex (Ctx) and caudate putamen (CP), with intense labeling in the ependyma (small arrow) and in the indusium griseum (arrow).
- Ctx cerebral cortex
- CP caudate putamen
- Figure 3 shows a comparison of the carboxy-terminus amino acid sequence of TIAM1 protein (amino acids 576-1591 ) with the amino acid sequence of TIAM2 L .
- the EX domain, alternatively splice region. DHR domain, DH domain, and PH domain are underlined, and the initiator methionine for TIAM2 S (amino acid 452) is in boldface and designated with an arrow.
- Figure 4 shows the results of a GDP-GTP exchange assay. Partially purified His-TIAM2 S protein was assayed for the ability to stimulate GDP-GTP exchange activity with immunoprecipitated Rac (A) or Ras (B) proteins.
- Figure 5 shows the expression of TIAM2 mRNA in tumor tissue and normal tissues.
- TIAM2 (DP-75), for T-cell lymphoma invasion and metastasis 2, relates to a novel DNA and amino acid sequence that has some sequence homology with TIAMl .
- TIAMl is a member of a family GDP dissociation stimulators (GDSs) which are proteins that activate Rho-like and Rac-like GTPases. GDSs as well as Rho and Rac have oncogenic potential.
- TIAM2 with high homology to TIAMl, has been identified.
- TIAM2 is expressed as ⁇ 4.4- and ⁇ 3.3-kb messages that encode long (TIAM2 and short forms (TIAM2 S ) of the TIAM2 protein.
- TIAM2 L begins in a region with identity to the coiled-coil region of TIAMl and includes both the EX and the PDZ domains found within TIAMl .
- Both TIAM2 L and TIAM2 S contain regions of identity to the DH and carboxyl-terminal PH domains of TIAMl .
- An additional level of complexity is added by alternative splicing of the -4.4- kb message, which leads to the insertion of 24 amino acids between the EX and the DHR domains.
- His-tagged version of TIAM2 S was expressed in a baculovirus system, which is the preferred system for TIAM2 expression, and purified on a nickel column. His-TIAM2 S was compared to SOS and was shown to have GEF activity that prefers RAC over RAS.
- TIAM2 may play a role in neural development.
- the high level of TIAM2 expression throughout the El 3.5 telencephalon suggests that TIAM2 may play an important role in development of the forebrain.
- TIAM2 expression during mouse embryogenesis may reveal a correlation with specific morphogenetic events or with specific GTP-ase family members, regulators, or effectors. It is likely that some of the specificity established during neural development is due to cell-type-specific expression of GTPase signaling pathway components such as TIAMl . RAC3, and TIAM2.
- TIAM2 continues to be expressed at high levels in the adult forebrain.
- the areas of high expression in the adult are regions of synaptic plasticity (cortex. hippocampus) or neurogenesis (dentate gyrus, ependyma/subependyma) in the adult (Gould et al.. Trends Cogn. Sci. 5:186-192. 1999; Temple. Curr. Biol 9:R397-399. 1999; Lowenstein and Parent. Science 253: 1 126-1 127, 1999).
- TIAM2 may play a role in metastasis or tumor suppression. Radiation hybrid mapping of TIAM2 places it in a 4-cM region of chromosome 6q25 that is frequently deleted in ovarian cancer (Colitti et al., Oncogene 76:555-559, 1998). Since the majority of ovarian cancer is epithelial in nature, and since TIAMl (21q22.1 ; Chen and Antonarakis, Genomics 50:123-127, 1995) has been suggested to act as a tumor suppressor in epithelial cells, this might suggest a role for TIAM2 in ovarian cancer.
- TIAM2 suggests distinct roles for TIAM2 L and TIAM2 S . Both the EX and the PDZ domains found in TIAM2 L have been suggested to play roles in protein-protein interactions and intracellular localization of proteins. Since TIAM2 S lacks both the EX and the PDZ domains of TIAM2, . the two forms may be localized to different regions of the cell. Understanding the alternate forms of TIAM2 extends knowledge of the complexity of this emerging family of GEFs and may ultimately yield insight into the divergent roles of TIAMl as both a promoter of invasiveness and a tumor suppressor.
- TIAM2 may be useful to diagnose cancerous cells.
- Many techniques may be used to diagnose whether tissue samples possess TIAM2-containing tumor tissue. For example, reverse transcription and PCR amplification of the RNA of a tumor sample to identify the presence of TIAM2 mRNA sequences (see Sambrook. et al. , Molecular Cloning; A Laboratory Manual, Second Edition (1989). chapter 14 or Gaugler et al. J. Exp. Med 779:921-930 (1994)).
- immunohistochemical techniques or ELISA assays may be used to identify TIAM2-expressing tumors.
- the TIAM2 protein can be recombinantly expressed and monoclonal antibodies can be prepared according to methods that are known in the art. For example, the methods shown in EP 174.204, Kohler and Milstein, Nature 256:495-497 (1975), Fong el al. J. Immun. Meth. 70:83-90 (1984), GB 2,086,937, 2,113.715, EP 57,107. 62.409, EP 118.893, EP 124.301, and EP 131,878 are suited to the present invention.
- the anti-TIAM2 monoclonal antibodies can then be used in the standard assays recited above or those assays that are otherwise known in the art.
- Monoclonal antibodies may also be used therapeutical ly.
- Anti-TIAM2 monoclonal antibodies can be administered by means known in the art. Preferably, the antibodies are administered parenterally or subcutaneously, more preferably, they are administered intravenously.
- the monoclonal antibodies can be administered in combination with other agents designed to promote the activity of the antibodies or to treat the underlying condition involving the TIAM2 expressing cell.
- branched DNA testing may be performed to assay for TIAM2 DNA as shown in U.S. Patent Nos. 5,124.246, and 4.868.105 (hereby incorporated by reference in their entireties).
- TIAM2 nucleic acid probe molecules for the branched DNA testing are preferably from 10 to 50 bases in length, more preferably, between 15 and 40 bases in length, most preferably, between 20 and 30 bases in length
- Ribozymes may be designed to act on the TIAM2 sequence identified in SEQ ID NO: l .
- SEQ ID NO:6 SEQ ID NO:8.
- SEQ ID NO:9 SEQ ID NO:10 or fragments thereof.
- the ribozyme gene is cloned into an available vector and transfected into the cells of choice.
- Different vectors may be chosen based on the target cell to be infected.
- respiratory cells may be targeted by an adeno or adeno associated virus
- AAV vector AAV vector. Appropriate promoters may be inserted into these vectors to ensure regulatable expression. (Kashani-Cabet at p. 216).
- Antisense molecules can be developed based on the TIAM2 sequence shown in SEQ ID NO:l, SEQ ID NO:6, SEQ ID NO:8. SEQ ID NO:9, or SEQ ID NO:10. For example, see U. S. Patent Nos. 5,491 ,133 and 5,271.941 which are hereby incorporated by reference in their entireties.
- Antisense RNA sequences have been described as naturally occurring biological inhibitors of gene expression in both prokaryotes (Mizuno, T., Chou, M-Y, and Inouye, M. (1984), Proc. Natl. Acad. Sci. USA 81, (1966-1970)) and eukaryotes (Heywood, S. M. Nucleic Acids Res., If. 6771 -6772 (1986) and these sequences function by hybridizing to complementary mRNA sequences, resulting in hybridization arrest of translation (Paterson. B. M., Roberts. B. E.. and Kuff. E. L.. (1977) Proc Natl Acad. Sci. USA, 74. 4370-4374.
- Antisense oligodeoxynucleotides are short synthetic nucleotide sequences formulated to be complementary to a specific gene or RNA message. Through the binding of these oligomers to a target DNA or mRNA sequence, transcription or translation of the gene can be selectively blocked and the disease process generated by that gene can be halted.
- the cytoplasmic location of mRNA provides a target considered to be readily accessible to antisense oligodeoxynucleotides entering the cell; hence much of the work in the field has focused on RNA as a target.
- Antisense therapy is the administration of oligonucleotides which bind to a target polynucleotide located within the cells. These oligonucleotides are usually exogenous, but they can be endogenously expressed.
- the term “antisense” refers to the fact that such oligonucleotides are complementary to their intracellular targets, e g , TIAM2. See for example. Jack Cohen, Oligodeoxynucleotides, Antisense Inhibitors of Gene Expression. CRC Press, 1989: and Synthesis 7:1-5 (1988).
- the TIAM2 antisense oligonucleotides of the present invention include derivatives such as S-oligonucleotides (phosphorothioate derivatives or S-oligos, see, Jack Cohen, supra) which exhibit enhanced cancer cell growth inhibitory action.
- the TIAM2 antisense oligonucleotides of the present invention may be RNA or DNA which are complementary to and stably hybridize with the TIAM2 genome or the corresponding mRNA. Use of an oligonucleotide complementary to this region allows for the selective hybridization to TIAM2 mRNA and not to other mRNAs.
- the TIAM2 antisense oligonucleotides of the present invention are 15 to 40-mer fragments of the antisense DNA molecules which hybridize to TIAM2 mRNA.
- the preferred TIAM2 antisense oligonucleotide is a 20- to 30-mer oligonucleotide which is complementary to a region in TIAM2.
- pharmaceutical compositions comprising an effective amount of at least one of the TIAM2 antisense oligonucleotides of the invention in combination with a pharmaceutically acceptable carrier.
- a single TIAM2 antisense oligonucleotide is utilized.
- two TIAM2 antisense oligonucleotides are utilized which are complementary to adjacent regions of the TIAM2 genome.
- TIAM2 antisense oligonucleotides which are complementary to adjacent regions of the TIAM2 genome or corresponding mRNA may allow for more efficient inhibition of TIAM2 genomic transcription or mRNA translation, resulting in more effective inhibition of cancer cell growth.
- the TIAM2 antisense oligonucleotide is coadministered with an agent which enhances the uptake of the antisense molecule by the cells.
- the TIAM2 antisense oligonucleotide may be combined with a lipophilic cationic compound which may be in the form of liposomes.
- liposomes to introduce nucleotides into cells is taught, for example, in U.S. Pat. Nos. 4.897,355 and 4,394.448, the disclosures of which are incorporated by reference in their entireties. See also U.S. Pat. N ' os. 4.235.871. 4.231.877, 4.224,179, 4,753,788, 4,673,567, 4,247.41 1 , 4.814.270 for general methods of preparing liposomes comprising biological materials.
- the TIAM2 antisense oligonucleotide may be combined with a lipophilic carrier such as any one of a number of sterols including cholesterol, cholate and deoxycholic acid.
- a preferred sterol is cholesterol.
- the TIAM2 antisense oligonucleotide may be conjugated to a peptide that is ingested by cells. Examples of useful peptides include peptide hormones, antigens or antibodies, and peptide toxins. By choosing a peptide that is selectively taken up by the neoplastic cells, specific delivery of the antisense agent may be effected.
- the TIAM2 antisense oligonucleotide may be covalently bound via the 5' H group by formation of an activated aminoalkyl derivative.
- the peptide of choice may then be covalently attached to the activated TIAM2 antisense oligonucleotide via an amino and sulfhydryl reactive hetero bifunctional reagent. The latter is bound to a cysteine residue present in the peptide.
- the peptidyl antisense agent Upon exposure of cells to the TIAM2 antisense oligonucleotide bound to the peptide, the peptidyl antisense agent is endocytosed and the TIAM2 antisense oligonucleotide binds to the target TIAM2 mRNA to inhibit translation. See PCT Application Publication No. PCT/US89/02363.1.
- TIAM2 antisense oligonucleotides and the pharmaceutical compositions of the present invention may be administered by any means that achieve their intended purpose.
- administration of the antisense compounds or other compounds of the present invention may be by parenteral, subcutaneous, intravenous, intramuscular, intra-peritoneal. or transdermal routes.
- compositions within the scope of this invention include all compositions wherein the TIAM2 antisense oligonucleotide is contained in an amount which is effective to achieve inhibition of proliferation and/or stimulate differentiation of the subject cancer cells.
- the TIAM2 antisense oligonucleotide may be administered to mammals, e.g , humans, at a dose of 0.005 to 1 mg/kg/day, or an equivalent amount of the pharmaceutically acceptable salt thereof, per day of the body weight of the mammal being treated.
- the TIAM2 antisense oligonucleotides may be administered as part of a pharmaceutical preparation containing suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the TIAM2 antisense oligonucleotide into preparations which can be used pharmaceutically.
- suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the TIAM2 antisense oligonucleotide into preparations which can be used pharmaceutically.
- pharmaceutically acceptable refers to compounds and compositions which may be administered to mammals without undue toxicity.
- Exemplary pharmaceutically acceptable salts include mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates. and the like.
- Suitable formulations for parenteral administration include aqueous solutions of the TIAM2 antisense oligonucleotides in water-soluble form, for example. water-soluble salts.
- suspensions of the active compounds as appropriate oily injection suspensions may be administered.
- Suitable lipophilic solvents or vehicles include fatty oils, for example, sesame oil, or synthetic fatty acid esters, for example, ethyl oleate or triglycerides.
- Aqueous injection suspensions may contain substances which increase the viscosity of the suspension include, for example, sodium carboxymethyl cellulose, sorbitol, and/or dextran.
- the suspension may also contain stabilizers.
- the antisense oligonucleotides of the present invention may be prepared according to any of the methods that are well known to those of ordinary skill in the art.
- the antisense oligonucleotides are prepared by solid phase synthesis. See. Goodchild, J., Bioconjugate Chemistry, 7:165-167 (1990), for a review of the chemical synthesis of oligonucleotides.
- the antisense oligonucleotides can be obtained from a number of companies which specialize in the custom synthesis of oligonucleotides.
- TIAM2 polypeptides, polynucleotides, or antibodies can be administered orally, topically, or by parenteral means, including subcutaneous and intramuscular injection, implantation of sustained release depots, intravenous injection, intranasal administration, and the like.
- parenteral means including subcutaneous and intramuscular injection, implantation of sustained release depots, intravenous injection, intranasal administration, and the like.
- TIAM2 polypeptides, polynucleotides, or antibodies may be administered as a pharmaceutical composition comprising a pharmaceutically acceptable excipient.
- compositions may be aqueous solutions, emulsions, creams, ointments, suspensions, gels, liposomal suspensions, and the like.
- Suitable excipients include water, saline. Ringer's solution, dextrose solution, and solutions of ethanol, glucose, sucrose, dextran. mannose. mannitol. sorbitol. polyethylene glycol (PEG), phosphate, acetate, gelatin, collagen. Carbopol®, vegetable oils, and the like.
- PEG polyethylene glycol
- phosphate acetate
- gelatin collagen
- Carbopol® vegetable oils, and the like.
- One may additionally include suitable preservatives, stabilizers, antioxidants, antimicrobials, and buffering agents, for example. BHA, BHT, citric acid, ascorbic acid, tetracycline, and the like.
- Cream or ointment bases useful in formulation include lanolin, Silvadene® (Marion).
- Other devices include indwelling catheters and devices such as the Alzet® minipump.
- Ophthalmic preparations may be formulated using commercially available vehicles such as Sorbi-care® (Allergan), Neodecadron® (Merck, Sharp & Dohme), Lacrilube®, and the like, or may employ topical preparations such as that described in US 5,124.155. incorporated herein by reference.
- TIAM2 polypeptide, polynucleotide, or antibody in solid form, especially as a lyophilized powder.
- Lyophilized formulations typically contain stabilizing and bulking agents, for example human serum albumin, sucrose, mannitol. and the like. A thorough discussion of pharmaceutically acceptable excipients is available in Remington's Pharmaceutical Sciences (Mack Pub. Co.).
- TIAM2 polypeptide, polynucleotide, or antibody required to treat any particular disorder will of course vary depending upon the nature and severity of the disorder, the age and condition of the subject, and other factors readily determined by one of ordinary skill in the art.
- the appropriate dosage may be determined by one of ordinary skill in the art.
- nucleic acid molecules described above i.e., the ribozyme or antisense molecules
- vectors and techniques described below will be useful.
- the following expression systems describe vectors, promoters and regulatory elements that are useful for gene therapy applications for the delivery of the above polynucleotides.
- Vectors and expression systems useful for the present invention include viral and non-viral systems.
- examples of viral delivery systems include retroviruses, adenoviruses, adeno-associated viruses (AAV), Sindbis and herpes viruses.
- the viral vector is capable of integrating the above nucleic acid sequence into the host cell genome for long term expression.
- retrovirus is a murine leukemia virus.
- Non-viral vectors include naked DNA and DNA formulated with cationic lipids or liposomes.
- a non-viral system that can be used is the T7/T7 system.
- TIAM2 can be expressed by a baculovirus that has been transformed with a native or modified TIAM2 nucleic acid sequence.
- the TIAM2 nucleic acid sequence useful in the present invention encodes a protein having an amino acid sequence that is substantially identical to the amino acid sequence of native TIAM2.
- the TIAM2 nucleic acid or protein sequence will be homologous to the partial sequences listed below.
- the above sequence will be greater than 80% homologous to SEQ ID NO:6, SEQ ID NO:8. SEQ ID NO:9.
- SEQ ID NO: 10 or fragments thereof more preferably it will be greater than 85% homologous, more preferably greater than 90% homologous, even more preferably greater than 91 %, 92%, 93% . 94% or 95% homologous. Most preferably, it will be greater than 96%>, 97%, 98%o or 99% homologous.
- Substantial identity means the sequences are identical or differ by one or more alterations (deletion, additions, substitutions) that do not adversely affect the activity of the protein. It is preferable that the protein sequences are homologous in the same percentages noted above. Percent identity or homology can be calculated using methods and algorithms known in the art. A suitable but non-limiting method is the Smith- Waterman homology search algorithm as implemented in MPSRCH program (Oxford Biomolecular) using an affine gap search with the following search parameters: gap open penalty of 12, and gap extension penalty of 1.
- TIAM2 sequence can depend on a number of factors. As ionizable amino and carboxyl groups are present in the molecule, a particular protein may be obtained as a acidic or basic salt, or in neutral form. All such preparations which retain their activity when placed in suitable environmental conditions are included in the definition of proteins herein. Further, the primary amino acid sequence of the protein may be augmented by derivitization using sugar moieties (glycosylation) or by other supplementary molecules such as lipids, phosphate, acetyl groups and the like. Certain aspects of such augmentation are accomplished through post-translational processing systems of the producing host; other such modifications may be introduced in vitro.
- modifications are included in the definition of protein herein so long as the activity of the protein is not destroyed. It is expected that such modifications may quantitatively or qualitatively affect the activity, either by enhancing or diminishing the activity of the protein, in the various assays. Further, individual amino acid residues in the chain may be modified by oxidation, reduction, or derivatization, and the protein may be cleaved to obtain fragments which retain activity. Such alterations which do not destroy activity do not remove the protein sequence from the definition of TIAM2 herein.
- Modifications to the primary structure itself by deletion, addition, oi ⁇ alteration of the amino acids incorporated into the sequence during translation, can be made without destroying the activity of the protein.
- site specific mutagenesis can enable specific changes in the DNA structure to effect a change in the polypeptide structure. See Mark et al. U. S. Pat. No. 4.959,314, and Sambrook. et al . supra. Volume 2. chapter 15 which is hereby incorporated by reference in its entirety.
- the TIAM2 proteins include mutants, fragments, fusions, and the protein encoded by the sequence listed in SEQ ID NO: 1 , SEQ ID NO:6, SEQ ID NO:8. SEQ ID NO:9, SEQ ID NO: 10 or fragments thereof.
- the native TIAM2 proteins are those that occur in nature.
- the amino acid sequence of native polypeptides will comprise a sequence that varies slightly; typically, less than by 10-20 amino acids encoded by SEQ ID NO: l.
- polynucleotide' or “nucleic acid sequence " ' as used herein refers to a polymer of nucleotides of any length, preferably deoxyribonucleotides. and is used interchangeably herein with the terms “oligonucleotide” and “oligomer.”
- the term refers only to the primary structure of the molecule. Thus, this term includes double- and single-stranded DNA, as well as antisense polynucleotides. It also includes known types of modifications, for example, the presence of labels which are known in the art. methylation. end “ caps,” substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as.
- uncharged linkages e.g. , methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.
- charged linkages e.g , phosphorothioates, phosphorodithioates, etc.
- pendant moieties such as, for example, proteins (including nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.).
- intercalators e.g.. acridine, psoralen, etc.
- chelators e.g. , metals, radioactive species, boron, oxidative moieties, etc.
- alkylators e g , alpha anomeric nucleic acids, etc.
- a polynucleotide sequence encoding a native TIAM2 protein can be easily modified to encode other classes of TIAM2 proteins. It will be recognized in the art that some amino acid sequence of the TIAM2 polypeptide can be varied without significant effect on the structure or function of the protein. If such differences in sequence are contemplated, it should be remembered that there are critical areas on the protein which determine activity. In general, it is possible to replace residues that form the tertiary structure, provided that residues performing a similar function are used. In other instances, the type of residue may be completely unimportant if the alteration occurs at a non-critical region of the protein. The replacement of amino acids can also change the selectivity of binding to cell surface receptors.
- the polypeptides of the present invention may include one or more amino acid substitutions, deletions or additions, either from natural mutations or human manipulation.
- the invention further includes variations of the TIAM2 polypeptide which show substantial TIAM2 polypeptide activity or which include regions of TIAM2 protein such as the protein portions discussed below.
- Such mutants include deletions, insertions, inversions, repeats, and type substitutions.
- Amino acids in the polypeptides of the present invention that are essential for function can be identified by methods known in the art, such as site- directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244: 1081-1085 (1989)). The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for biological activity such as receptor binding or in vitro, or in vitro proliterative activity. Sites that are critical for ligand-receptor binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al., J. Mol Biol. 22-7:899-904 (1992) and de Vos et al.
- mutants can be constructed by making conservative amino acid substitutions.
- a subset of mutants, called muteins, is a group of polypeptides with the non-disulfide bond participating cysteines substituted with a neutral amino acid, generally, with serines. These mutants may be stable over a broader temperature range than native TIAM2 proteins.
- changes are preferably of a minor nature, such as conservative amino acid substitutions that do not significantly affect the folding or activity of the protein.
- the number of amino acid substitutions a skilled artisan would make depends on many factors, including those described above. Generally speaking, the number of substitutions for any given TIAM2 polypeptide will not be more than 50. 40. 30. 25. 20, 15. 10, 5 or 3.
- the coding sequence of mutants can be constructed by in vitro mutagenesis of the native TIAM2 polypeptide coding sequences.
- protein refers to a polymer of amino acids and does not refer to a specific length of the product: thus, peptides, oligopeptides. polypeptides, proteins, and polyproteins. as well as fragments of these, are included within this definition.
- This term also does not refer to. or exclude, post expression modifications of the protein, for example, glycosylations, acetylations, phosphorylations and the like. Included within the definition are, for example, proteins containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), proteins with substituted linkages, as well as other modifications known in the art, both naturally occurring and non-naturally occurring.
- a polypeptide or protein or amino acid sequence "derived from” or “coded by " or ''encoded by "” a designated nucleic acid sequence refers to a polypeptide having an amino acid sequence identical to that of a polypeptide encoded in the sequence, or a portion thereof wherein the portion consists of at least 3-5 consecutive amino acids, and more preferably at least 8-10 amino acids, and even more preferably at least 1 1-15 amino acids, or which is immunologically identifiable with a polypeptide encoded in the sequence. This terminology also includes a polypeptide expressed from a designated nucleic acid sequence.
- purified and isolated mean, when referring to a polypeptide or nucleotide sequence, that the indicated molecule is present in the substantial absence of other biological macromolecules of the same type.
- purified as used herein preferably means at least 75% by weight, more preferably at least 85%> by weight, more preferably still at least 95% by weight, and most preferably at least 98%> by weight, of biological macromolecules of the same type present (but water, buffers, and other small molecules, especially molecules having a molecular weight of less than 1000, can be present).
- fragments of polynucleotides that encode the TIAM2 polypeptides disclosed herein may encode antigenic regions of the proteins or biologically functional regions of the proteins as described herein. Such fragments also encode polypeptide components of the fusion proteins disclosed herein. Fragments are also suitable for use as probes for identifying polynucleotides capable of hybridizing with SEQ ID NO:8, 9. and/or 10. Fragments can range in length from about 10 basepairs to the full length polynucleotide, which is 3344 basepairs for SEQ ID NO:8, 4590 basepairs for SEQ ID NO:9, and 4514 basepairs for SEQ ID NO: 10. Preferred fragments are 15. 20.
- a particularly preferred fragment comprises nucleotides 1 -104 of SEQ ID NO:8.
- Polypeptide fragments are amino and/or carboxyl terminal amino acid deletions of mutant or native TIAM2 proteins.
- the number of amino acids that are truncated is not critical as long as the polypeptide fragment exhibits the desired sequence homology, immunological or biological activity.
- Preferred fragments are 10. 15. 20. 25, 30, 35. 40. 45, 50, 55. 60. 65, 70. 75. 80. 85, 90. 95. 100, 125. 150, 175, 200, 250. 300, 350, 400, 450, 500, 550, 600 or 625 amino acids of SEQ ID NO:7. 1 1. 12 or 13; 650, 675. 700, 750. 800, 825.
- Polypeptide fragments of immunological significance comprise, for example, at least one epitope shared by a native TIAM2 protein.
- TIAM2 proteins may be only 5-15 amino acids in length.
- Examples of amino acid sequence of fragments comprise amino acid number 1-8 (aal to aa8) of SEQ ID NO:7, 1 1. 12. or 13; aa2 to aa9 of SEQ ID NO:7, 1 1 , 12, or 13; aa3 to aalO of SEQ ID NO:7. 1 1 , 12.
- Fusions are fragment, mutant, or native TIAM2 proteins with additional amino acids at either or both of the termini.
- the additional amino acid sequence generally is not homologous to sequence found in native TIAM2 polypeptides.
- the additional amino acid residues can facilitate expression, detection, or activity of the polypeptide, for example.
- the additional amino acid sequence can also be used as linker to construct multimers of TIAM2 proteins. All fusion polypeptides exhibit the desired sequence homology. immunological or biological activity.
- Recombinant TIAM2 fusion proteins can be produced using the preferred cell system, baculovirus. After inserting the TIAM2 DNA sequence into the transfer vector, the vector and the wild type viral genome are transfected into an insect host cell where the vector and viral genome are allowed to recombine.
- the packaged recombinant virus is expressed and recombinant plaques are identified and purified.
- Materials and methods for baculovirus/insect cell expression systems are commercially available in kit form from, inter alia. Invitrogen, San Diego CA ("MaxBac” kit). These techniques are generally known to those skilled in the art and fully described in Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987).
- the above-described components comprising a promoter, leader (if desired), coding sequence of interest, and transcription termination sequence, are usually assembled into an intermediate construct (transfer vector).
- pAc373 the most commonly used transfer vector for introducing foreign genes into AcNPV.
- Many other vectors known to those of skill in the art. have also been designed. These include, for example, pVL985 (which alters the polyhedrin start codon from ATG to ATT. and which introduces a BamHI cloning site 32 base pairs downstream from the ATT; see Luckow and Summers, Virology 77:31 (1989).
- the plasmid usually also contains the polyhedron polyadenylation signal (Miller et al Ann. Rev. Microbiol, 42:177 (1988)) and a prokaryotic ampicillin- resistance (amp) gene and origin of replication for selection and propagation in E. coli.
- polyhedron polyadenylation signal iller et al Ann. Rev. Microbiol, 42:177 (1988)
- amp ampicillin- resistance
- Baculovirus transfer vectors usually contain a baculovirus promoter.
- a promoter will have a transcription initiation region which is usually placed proximal to the 5' end of the coding sequence. This transcription initiation region usually includes an RNA polymerase binding site and a transcription initiation site.
- a baculovirus transfer vector may also have a second domain called an enhancer, which, if present, is usually distal to the structural gene. Expression may be either regulated or constitutive.
- Structural genes abundantly transcribed at late times in a viral infection cycle, provide particularly useful promoter sequences. Examples include sequences derived from the gene encoding the viral polyhedron protein, Friesen et al, (1986) "The Regulation of Baculovirus Gene Expression, " in: The Molecular Biology of Baculoviruses (ed. Walter Doerfler); EPO Publ. Nos. 127 839 and 155 476; and the gene encoding the plO protein. Vlak et al , J. Gen. Virol 69:765 (1988).
- DNA encoding suitable signal sequences can be derived from genes for secreted insect or baculovirus proteins, such as the baculovirus polyhedrin gene
- IL-3 (Miyajima et al. Gene 58:272 ( 1987); and human glucocerebrosidase, Martin et al. DNA 7:99 (1988), can also be used to provide for secretion in insects.
- an insect cell host is co-transformed with the heterologous DNA of the transfer vector and the genomic DNA of wild type baculovirus, usually by co-transfection.
- Methods for introducing heterologous DNA into the desired site in the baculovirus virus are known in the art. (See Summers and Smith; Ju et al. (1987); Smith et al, Mol. Cell. Biol 5:2156 (1983); and Luckow and Summers (1989)).
- the insertion can be into a gene such as the polyhedrin gene, by homologous double crossover recombination; insertion can also be into a restriction enzyme site engineered into the desired baculovirus gene. Miller et al. Bioessays 4:9 ⁇ (1989).
- the newly formed baculovirus expression vector is subsequently packaged into an infectious recombinant baculovirus.
- Methods to identify recombinant viruses are described in "Current Protocols in Microbiology” Vol. 2 (Ausubel et al eds) at 16.8 (Supp. 10, 1990); Summers and Smith; Miller et al. (1989).
- Recombinant baculovirus expression vectors have been developed for infection into several insect cells. For example, recombinant baculoviruses have been developed for, inter alia: Aedes aegypti , Autographa californica, Bombyx mori. Drosophila melanogaster, Spodoptera frugiperda.
- the TIAM2 protein can be used in an assay for inhibitors and for preparing antibodies directed to TIAM2. TIAM2 protein may also be useful as a factor that promotes the growth of cancer cells in culture.
- the TIAM2 protein may be combined with the pharmaceutically acceptable carrier noted above for use with the
- TIAM2 antisense molecule TIAM2 antisense molecule.
- DP-75 377- nucleotide clone
- TIAM2 T-cell lymphoma invasion and metastasis 2
- Northern analysis with the DP-75 probe revealed a ⁇ -3.3-kb transcript in cerebral cortex, occipital pole, frontal lobe, and temporal lobe, and a ⁇ 4.4-kb transcript in testis and cerebellum ( Figures 1A and IB).
- the compiled cDNA for the ⁇ 4.4-kb message is 4586 nucleotides long, without polyadenylation, and is predicted to encode the 1077-amino-acid-long form of the TIAM2 protein (TIAM2 L ).
- the first ATG is at nucleotide 51 and is in good context for translation.
- An alignment of the predicted protein to TIAMl ( Figure 3) shows significant identity beginning with the first methionine of TIAM2 and a methionine at position 576 of TIAMl, a region that corresponds to the last 14 amino acids of the coiled coil domain of TIAMl (aa 548-590).
- EX domain extends from amino acid 599 to amino acid 691 of human TIAMl .
- a comparison of the TIAMl /TIAM2 1 EX domains shows 62%> overall identity, but with 85% identity in a 60-aa subdomain.
- alternative splicing of a 72-nucleotide miniexon leads to the presence or absence of a 24-amino acid sequence with no significant identity to TIAMl or SIF sequences.
- TIAMl sequence with weak identity to TIAMl (18%)). but which contains the conserved residues of PDZ or DHR domains (Michiels et al.. Nature 375:338-340, 1995).
- the remaining sequence contains identity to the DH catalytic region (70%) and the carboxyl-terminal PH domain (54%).
- the compiled sequence for the ⁇ 3.3-kb message is 3344 nucleotides long and is predicted to encode a short form (626 aa) of TIAM2 (TIAM2 S ).
- the ⁇ 3.3-kb message differs from the ⁇ 4.4-kb message in that the first 104 nucleotides are unique, suggesting that the ⁇ 3.3-kb message results from initiation at a promoter distinct from that of the ⁇ 4.4-kb message.
- the initiator methionine at position 162 coincides with a methionine at amino acid 428 of the 4.4-kb TIAM2 predicted protein and for the remainder of the protein shows complete identity with TIAM2 L .
- TIAMl Similar to what is seen with the TIAMl gene (Habets et al.. Cell 77:537-549, 1994), there are two upstream ATGs in the ⁇ 3.3-kb message that precede the long open reading frame (nucleotide 162), but only the start codon at nucleotide 162 is in good context for translation. A comparison with TIAMl shows that TIAM2 S . begins immediately upstream (24 aa) of the DH domain.
- a Radiation Hybrid Mapping experiment was performed as follows. TIAM2-specif ⁇ c oligos AGTCCTACCTCATCAAGCCG (SEQ ID NO: 14) and TTAGTGCTTCCGTCAGGTGG (SEQ ID NO: 15) were synthesized and used with the G3 panel (Research Genetics) as per the manufacturer ' s instructions. The resulting PCR products were analyzed by gel electrophoresis, and the resulting data were analyzed according to methods of Stewart and Cox. In “Genome Mapping: A Practical Approach " (P. Dear et al. Ed.) pp. 73-93. Oxford Lniv. Press, Oxford. 1997. A two- point maximum-likelihood analysis showed that the markers were linked to D6S1556 (6q25 ) with a lod score of 1000.
- Oligos designed from nucleotides 566-586 (AGTACAGAAGGTT- CTGGAGCG) and from nucleotides 1348-1367 (TACCAGGCGATCCTTACACG) of the human 3.3 kb TIAM2 cDNA were used to perform PCR on mouse brain cDNA (Clontech). Thirty cycles of PCR performed with an annealing temperature of 40° C led to the production of a product (MDP75) of the expected size (802 nt). Cloning and sequencing confirmed that MDP75 was 90% identical to human TIAM2 throughout the length of the clone.
- TIAM-2 transcripts are present throughout the telencephalon ( Figure 2A). Parasagittal sections through the telencephalon demonstrate that expression is localized to the pial surface where early born postmitotic neurons are located ( Figure 2B). TIAM2 is not expressed in the proliferating neural precursor cells that line the ventricles.
- TIAM2 continues to be expressed primarily in regions derived from the telencephalon ( Figures 2C-2G. Table 1). Areas of strong expression include the olfactory bulb, cerebral cortex, caudate putamen, and hippocampus. The hippocampus expression is highly specific in that cells of the dentate gyrus and regions derived from it. induseum griseum and fasciola cinerea; and pyramidal cells of one subregion of the CA fields (CA2) are labeled very strongly while CA1 and CA3 show very little expression. TIAM2 is also strongly expressed in the ependymal cells of the lateral surface of the lateral ventricles (Figure 2D). This region is a germinal zone where neurons are generated throughout adult life. The majority of neurons born in this region are believed to migrate to the olfactory bulb.
- His-TIAM2 An amino-terminal HIS tagged version of the 3.3-kb TIAM S protein (His-TIAM2) was expressed in a baculovirus system. A protein of the predicted molecular mass (75.661 Da) was partially purified on a nickel column, and its identity was confirmed by amino-terminal sequencing and mass spectrometry. To generate the His-tagged TIAM2 s expression construct, a linker-adapter was produced such that it added an EcoRI site to the 5' end of the first 29 bp of the TIAM2 S sequence (GAATTCATGGAAGGACCGCGGGA-GAATCAGGATCC).
- This kinased linker/adapter terminating in a BamHI site (bases 23-29 of the TIAM2 S sequence), was ligated to a cDNA clone DP-75#1 , which had been linearized by a BamHI fragment that encompassed the entire coding region of TIAM2 S .
- a subsequent Sail digest liberated an -2000-bp Ec ⁇ Rl-Sall fragment that encompassed the entire coding region of TIAM2 S .
- the fragment was isolated, purified, and ligated into ⁇ coRI-S ⁇ 7/I-digested pBlueBacHis2B vector (Invitrogen).
- pHIS-TIAM2 s was introduced into SF9 cells, and clones expressing high levels of pHIS- TIAM2 S were identified by Western blot. Following clonal expansion, pHIS- TIAM2 -expressing cells were concentrated, lysed, and applied to a nickel column (Invitrogen). pHIS-TIAM2 s protein was purified from the column as per the manufacturer's recommendations except that following the 50 mM imidazole wash, the protein was directly eluted in 500 mM imidazole.
- His-TIAM showed approximately fivefold stimulation of Rac exchange activity at 30 min relative to buffer alone, while SOS showed a modest stimulation (1.6 ⁇ ) at best ( Figure 4 A). Conversely, when His- TIAM2 S and SOS were incubated with RAS. SOS demonstrated a four- to fivefold stimulation of exchange activity while His-TIAM2 S had little or no effect (Figure 4B).
- TIAM2 was hybridized to RNA from both cancerous and normal tissue.
- the source of cancerous tissue include renal, thyroid, breast, colon, ureter, lung, nose, stomach, esophagus, liver, lymphoma. uterus, bladder, rectum, and brain.
- the blots were from BioChain Institute, Inc.. San Leandro, California.
- SEQ ID NOT mRNA levels were higher in the cancer than the normal samples.
- SEQ ID NOT mRNA levels were higher in the cancer than the normal samples.
- SEQ ID NOT (TIAM2) mRNA level were higher in the cancer than the normal sample.
- SEQ ID NOT (TIAM2) mRNA level were higher in the cancer than the normal sample.
- SEQ ID NO:6 was isolated from a frontal cortex library utilizing a phage vector Stratagene. La Jolla. California, USA). The library was probed with SEQ ID NOT. which was generated by a random primed label with a final radioactive count of approximately 1x10 6 cpm/ml. The probe was labeled according to manufacturer ' s instruction with a RediPrimeTM DNA labeling kit (Amersham, Arlington Heights. Illinois, USA).
- the phage library was propagated and plated onto twenty plates according to the manufacturer's instructions with a 3.0-5.0 x 10 " plaques/plate.
- the plaques were transferred to a nitrocellulose membranes.
- Each membrane was incubated with the SEQ ID NOT probe for 2 hours at 65°C in ExpressHybTM hybridization solution purchased from Clontech, Palo Alto. California, USA.
- the filters were washed according to the Clontech instruction. Film was exposed to the membranes to identify putative positive plaques containing the desired TIAM2 polynucleotide.
- a second round of plating and hybridization was performed to identify a single positive plaque.
- the positive plaques from the first round were propagated and plated onto agar medium according to the instructions provided by Stratagene.
- the plaques were transferred to filters. These filters were incubated with the SEQ ID NOT probe.
- the probe and hybridization conditions were the same as described above. Positive plaques were identified and propagated. According to manufacturer ' s instructions, a BlueScript plasmid was rescued from the phage vector.
- the EcoRI insert from the plasmid was sequenced. The polynucleotide sequence is shown in SEQ ID NO:6.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pharmacology & Pharmacy (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Gastroenterology & Hepatology (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biophysics (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Enzymes And Modification Thereof (AREA)
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP00902369A EP1144448A3 (en) | 1999-01-06 | 2000-01-06 | Tiam2 (t-cell lymphoma invasion and metastasis 2) nucleotide exchange factor |
| JP2000592315A JP4707235B2 (ja) | 1999-01-06 | 2000-01-06 | Tiam2(t細胞のリンパ腫の侵襲およびmetastasis2)ヌクレオチド交換因子 |
| AU24097/00A AU2409700A (en) | 1999-01-06 | 2000-01-06 | Dna encoding t-cell lymphoma invasion and metastasis 2 and process for its use |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US22727899A | 1999-01-06 | 1999-01-06 | |
| US09/227,278 | 1999-01-06 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2000040607A2 true WO2000040607A2 (en) | 2000-07-13 |
| WO2000040607A3 WO2000040607A3 (en) | 2001-11-01 |
Family
ID=22852486
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2000/000459 Ceased WO2000040607A2 (en) | 1999-01-06 | 2000-01-06 | Tiam2 (t-cell lymphoma invasion and metastasis 2) nucleotide exchange factor |
Country Status (4)
| Country | Link |
|---|---|
| EP (1) | EP1144448A3 (https=) |
| JP (3) | JP4707235B2 (https=) |
| AU (1) | AU2409700A (https=) |
| WO (1) | WO2000040607A2 (https=) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002026817A3 (en) * | 2000-09-25 | 2003-10-30 | Millennium Pharm Inc | 33521, a human guanine nucleotide exchange family member and uses thereof |
| EP1752040A1 (en) * | 2005-08-12 | 2007-02-14 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | Isolation of the t-complex distorters and applications thereof |
| CN102768281A (zh) * | 2011-05-03 | 2012-11-07 | 孙孝芳 | 用以评估肿瘤增生、侵犯或转移风险的生物标记及方法 |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP6675287B2 (ja) | 2016-08-23 | 2020-04-01 | 日機装株式会社 | 流体殺菌装置 |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2331441T3 (es) * | 1996-06-05 | 2010-01-04 | Novartis Vaccines And Diagnostics, Inc. | Dna que codifica dp-75 y un proceso para su uso. |
-
2000
- 2000-01-06 AU AU24097/00A patent/AU2409700A/en not_active Abandoned
- 2000-01-06 JP JP2000592315A patent/JP4707235B2/ja not_active Expired - Fee Related
- 2000-01-06 WO PCT/US2000/000459 patent/WO2000040607A2/en not_active Ceased
- 2000-01-06 EP EP00902369A patent/EP1144448A3/en not_active Withdrawn
-
2010
- 2010-05-21 JP JP2010117840A patent/JP2010233574A/ja not_active Withdrawn
-
2011
- 2011-02-01 JP JP2011020242A patent/JP2011083295A/ja not_active Withdrawn
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002026817A3 (en) * | 2000-09-25 | 2003-10-30 | Millennium Pharm Inc | 33521, a human guanine nucleotide exchange family member and uses thereof |
| EP1752040A1 (en) * | 2005-08-12 | 2007-02-14 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | Isolation of the t-complex distorters and applications thereof |
| WO2007020026A1 (en) * | 2005-08-12 | 2007-02-22 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Isolation of the t-complex distorters and applications thereof |
| CN102768281A (zh) * | 2011-05-03 | 2012-11-07 | 孙孝芳 | 用以评估肿瘤增生、侵犯或转移风险的生物标记及方法 |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2000040607A3 (en) | 2001-11-01 |
| JP4707235B2 (ja) | 2011-06-22 |
| JP2002538774A (ja) | 2002-11-19 |
| AU2409700A (en) | 2000-07-24 |
| EP1144448A2 (en) | 2001-10-17 |
| EP1144448A3 (en) | 2002-03-06 |
| JP2010233574A (ja) | 2010-10-21 |
| JP2011083295A (ja) | 2011-04-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP2007289186A (ja) | Dp75をコードするdnaおよびその使用のための工程 | |
| WO1996026215A1 (en) | Ingap protein involved in pancreatic islet neogenesis | |
| US20130102542A1 (en) | Cancer related isoforms of components of transcription factor complexes as biomarkers and drug targets | |
| US7329741B2 (en) | Polynucleotides that hybridize to DP-75 and their use | |
| USRE39062E1 (en) | INGAP protein involved in pancreatic islet neogenesis | |
| CN1747744B (zh) | 使用otx2基因再生和新生视网膜感光细胞 | |
| US5905146A (en) | DNA binding protein S1-3 | |
| JP2011083295A (ja) | Tiam2(t細胞のリンパ腫の侵襲および転移2)ヌクレオチド交換因子 | |
| JPH10201482A (ja) | カルシトニン遺伝子関連ペプチド受容体成分因子(houdc44) | |
| JP2002300891A (ja) | 新規化合物 | |
| KR19990007806A (ko) | 전환 성장 인자 α HII | |
| US7041497B2 (en) | Nuclear factor κB inducing factor | |
| JP2004041175A (ja) | ヒトlig−1相同体(hlig−1) | |
| JP4280878B2 (ja) | Masl1遺伝子 | |
| US20030113869A1 (en) | Human FGF gene and gene expression products | |
| US7309783B2 (en) | Mammalian early developmental regulator gene | |
| AU708499C (en) | Ingap protein involved in pancreatic islet neogenesis | |
| WO2003091390A2 (en) | Regulation of gene expression by neuromodulators and discovery of a novel ngf-induced protein termed pincher | |
| US20030049699A1 (en) | Polypeptide (MBP1) capable of interacting with oncogenic mutants of the P53 protein | |
| WO2001029179A2 (en) | Regulation of gene expression by neuromodulators | |
| JP2001145493A (ja) | 熱ショック蛋白質hsp47と相互作用する蛋白質 | |
| JPH11103866A (ja) | 新規化合物 | |
| JPH11507813A (ja) | ヒトアミン受容体 | |
| JP2003038174A (ja) | ヒトアミン受容体 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| ENP | Entry into the national phase |
Ref country code: JP Ref document number: 2000 592315 Kind code of ref document: A Format of ref document f/p: F |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2000902369 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 2000902369 Country of ref document: EP |
|
| AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |