WO1999010503A1 - Autokatalytisch aktivierbare zymogene vorstufen von proteasen und deren verwendung - Google Patents
Autokatalytisch aktivierbare zymogene vorstufen von proteasen und deren verwendung Download PDFInfo
- Publication number
- WO1999010503A1 WO1999010503A1 PCT/EP1998/005094 EP9805094W WO9910503A1 WO 1999010503 A1 WO1999010503 A1 WO 1999010503A1 EP 9805094 W EP9805094 W EP 9805094W WO 9910503 A1 WO9910503 A1 WO 9910503A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- protease
- zymogenic
- trypsin
- precursor
- cleavage site
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
- C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
- C12N9/6424—Serine endopeptidases (3.4.21)
- C12N9/647—Blood coagulation factors not provided for in a preceding group or according to more than one of the proceeding groups
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
- C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
- C12N9/6424—Serine endopeptidases (3.4.21)
- C12N9/6427—Chymotrypsins (3.4.21.1; 3.4.21.2); Trypsin (3.4.21.4)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
- C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
- C12N9/6424—Serine endopeptidases (3.4.21)
- C12N9/6432—Coagulation factor Xa (3.4.21.6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
- C12Y304/21—Serine endopeptidases (3.4.21)
- C12Y304/21006—Coagulation factor Xa (3.4.21.6)
Definitions
- the invention relates to zymogenic precursors of proteases which can be activated autocatalytically due to a protease cleavage site newly introduced into the molecule, and to their processes for the production and use.
- peptide hormones such as Insulin (Jonasson, P. et al., Eur. J. Biochem. 236 (1996) 656-661; WO 96/20724), the insulin-like growth factors IGF-I and IGF-II (Nilsson, B. et al. , Methods Enzymol.
- N-terminal initiator methionine-free growth factors and cytokines (for overview of growth factors and cytokines, see: Wang, E.A., TIBTECH 11 (1993) 379-383; Meyer-Ingold, W., TIBTECH 11 (1993) 387-392) such as e.g. IL-1-ß, IL-2, GM-CSF (Miller, CG. Et al, Proc. Natl. Acad. Sei. USA 84 (1987) 2718-2722), G-CSF (EP-B 0 513 073) .
- specifically cleaving proteases are e.g.
- hemophilia B factor IX and factor VII
- clot dissolution e.g. after heart attack (tPA, "tissue type plasminogen activator” and streptokinase) and thrombin (US Patent 5,432,062) used to promote blood clotting in wound treatment.
- tPA heart attack
- thrombin US Patent 5,432,062
- proteases that selectively cleave N- or C-terminal from an amino acid, such as LysC endoprotease after lysine, or selectively from 2 specific amino acids, such as trypsin after lysine and arginine.
- restriction proteases Carter, P .: In: Ladisch, MR; Willson, RC; Painton, CC; Builder, SE, eds., Protein Purification: From Molecular Mechanisms to Large-Scale Processes. ACS Symposium Series No. 427, American Chemical Society, pp. 181-193 (1990)
- cleave preferably according to a recognition motif from> 2 amino acids.
- prohormone convertases furin PC1 / PC3, PC2, PC4, PC5 and PACE4 (Perona, JJ. And Craik, CS, Protein Science 4 (1995) 337-360)
- the blood coagulation proteases FVIIa, FIXa, FXa , Thrombin, protein C Kallekrein, plasmin, plasminogen activator and urokinase (Furie, B. and Furie, BC, Cell 53 (1988) 505-518; Davie, EW et al., Biochem.
- proteases such as the TEV protease (Parks, TD et al., Anal. Biochem. 216 (1994) 413-417), and / or proteases of microbial origin, such as the kexin (Kex2p) Protease from yeast (EP-A 0 467 839) and the IgA protease from Neisseria gonorrhoeae (Pohlner, J. et al., Nature 325 (1987) 458-462).
- TEV protease Parks, TD et al., Anal. Biochem. 216 (1994) 413-417
- proteases of microbial origin such as the kexin (Kex2p) Protease from yeast (EP-A 0 467 839) and the IgA protease from Neisseria gonorrhoeae (Pohlner, J. et al., Nature 325 (1987) 458-462).
- proteases For the recombinant production of peptide hormones and some therapeutically used proteins from fusion proteins, specifically cleaving proteases, such as trypsin, carboxypeptidase B, thrombin, factor Xa, collagenase and enterokinase, are required as starting materials.
- the methodology of the enzymatic cleavage of fusion proteins is state of the art and the proteases commercially available for cleaving fusion proteins have been described (Flaschel, E. and Friehs, K., Biotech. Adv. 11 (1993) 31-78; Sassenfeld, HM , Trends Biotechnol. 8 (1990) 88-93).
- the proteases listed there are isolated from animal raw materials, such as the pancreas, liver and blood.
- animal raw materials such as the pancreas, liver and blood.
- infectious agents such as, for example, human pathogenic viruses and prions.
- proteins / enzymes from animal and / or human raw materials (eg blood)
- proteases including trypsin, thrombin and factor X
- a second protease originating from an animal raw material source is usually used even when these proteases are produced recombinantly , is required for the enzymatic activation of the recombinant protease.
- enterokinase is used to activate trypsinogen (Hedstrom, L. et al., Science 255 (1992) 1249-1253), to activate factor X (Takeya, H. et al., J. Biol. Chem.
- thrombin used a protease from snake venom.
- specifically cleaving proteases play an important role in medicine.
- FIX, FVII, tPA tissue type plasminogen activator
- protein C protein C
- thrombin protein C
- protease variants derived therefrom are used in the treatment of coagulation disorders or are being tested. Trypsin is also a component of some medicinal products (ointments, dragees and aerosols to be inhaled (Red List, 1997; The United States Pharmacopeia, The National Formulary, USP23-NF18, 1995).
- Enzymatically active trypsin is formed in the periplasm of E. coli after cleavage of the signal sequence and native trypsin protein folding with the formation of 6 disulfide bridges.
- the formation of active trypsin is toxic to the cell.
- Active trypsin hydrolyzes the periplasmic E. coli proteins, causing the cells to lyse.
- the protein folding of trypsin appears, especially the correct native formation of the 6 disulfide bridges in the periplasm of E. coli to be difficult.
- the system was not suitable for isolating larger amounts of trypsin (> 10 mg; Wille, "WS et al., Biochem. 34 (1995) 2172-2180).
- trypsinogen precursor 50-100 mg
- an inactive trypsinogen precursor was secreted in yeast under the control of an adjustable ADH / GAPDH promoter and by fusion with the yeast ⁇ -factor leader sequence.
- the trypsinogen zymogen secreted into the medium was converted into trypsin in vitro by means of enterokinase.
- the yield was 10-15 mg / l (Hedstrom, L. et al., Science 255 (1992) 1249-1253).
- EP-A 0 597 681 describes DNA sequences which code for mature trypsin or trypsinogen with a preceding methion residue.
- WO 97/00316 describes a process for the production of trypsin or a derivative by a recombinant process in Aspergillus.
- a vector is used for the transformation, which codes for trypsinogen or a derivative thereof, which is N-terminally fused to a signal peptide.
- the object of the invention is to provide a simple process for the recombinant production of proteases and new, autocatalytically activatable proteases and their zymogens (inactive, zymogenic precursors).
- the invention relates to a process for the recombinant production of a protease, characterized by:
- Proteases in the sense of the invention are understood to mean both eukaryotic and microbial proteases. Examples of this are given in the introduction to the description of this invention. This process is particularly advantageous for the recombinant production of trypsin, thrombin and factor Xa.
- Another object of the invention is an autocatalytically cleavable (activatable) zymogenic precursor of a protease, the zymogenic precursor containing a naturally non-occurring autocatalytic cleavage site (which cannot be autocatalytically activated) which replaces a cleavage site of the natural form.
- any host cell in which proteins can be formed as "inclusion bodies” is to be understood as a host cell in the sense of the invention.
- these are prokaryotic host cells, preferably E. coli cells.
- prokaryotic host cells preferably E. coli cells.
- Such methods are described, for example, in F.A.O. Marston, Biochem. J. 240 (1986) 1-12; L. Stryer, Biochemistry, W.H. Freeman and Company, San Francisco, 1975, 24-30; T.E. Creighton, Progress Biophys. Molec. Biol. 33 (1978) 231-291; CH. Schein, Bio / Technology 8 (1990) 308-317; EP-B 0 114 506; A. Mitraki and J.
- inclusion bodies are to be understood as essentially insoluble, denatured and inactive protein, which is accumulated in the cytoplasm of the host cells and at least partially represents microscopically visible particles.
- Another object of the invention is accordingly a preparation of an autocatalytically cleavable zymogenic precursor of a protease, characterized in that the protein to be prepared is inactive and denatured in the form of inclusion bodies in a prokaryotic cell.
- Another object of the invention is an aqueous solution which consists of a denaturing agent in a concentration which is suitable for dissolving the inclusion bodies and the dissolved inclusion bodies.
- a zymogenic (inactive) precursor of a protease is to be understood as a protein which, even after the inclusion bodies have been naturalized, has no or only a very small amount proteolytic activity, in contrast to the active protease in the correct protein structure, shows (at least a factor of 5, preferably a factor of 10 less activity than the active form).
- the zymogenic form differs from the active form of the protease essentially in that it contains additional amino acids at which cleavage or must be cleaved in order to obtain the active form of the protease. These amino acids can be located at the C-terminal, N-terminal and / or within the protease.
- Proteases such as factor IX, factor X, thrombin or plasminogen activator consist of several domains.
- One of these domains is the protease domain, ie the domain that mediates the protease activity.
- a precursor of the protease is inactive in the sense of the invention if additional amino acids are present at the N-terminus of the protease domain, which can be split off autocatalytically.
- An autocatalytic cleavage in the sense of the invention is to be understood as a cleavage of the zymogenic precursor of the protease into the active form, which takes place without the addition of further enzymes. Since the zymogenic precursors of the proteases usually still show low residual proteolytic activities, this is sufficient for the start of the autocatalytic proteolysis. Preferably, the ratio of the proteolytic activity of the zymogenic precursor and the active protease is 1: 5 or less.
- Another object of the invention are autocatalytically cleavable zymogenic precursors of proteases, in which a cleavage site of the naturally occurring form is replaced by an autocatalytically cleavable cleavage site.
- the recombinant production of proteases is difficult to accomplish since these proteases, as an active protein, cleave the proteins of the host organism and are therefore lethal to the host organism. If the proteases are produced recombinantly in inactive, zymogenic form, it is necessary to convert the protein into the active form in an additional step after the recombinant production.
- Proteases which are usually obtained from natural sources such as animal raw materials, are in turn used to cleave the zymogenic form. Such a process is therefore complex and cost-intensive.
- the process according to the invention is distinguished by the fact that an additional step for cleaving the zymogenic form by adding another protease can be completely dispensed with.
- this also has the advantage that the recombinant protease thus produced cannot be found by further proteases (in particular by proteases of animal origin) or by proteins which are naturally found as contamination of the proteases when isolated from natural sources (for example mammalian cell proteins). is contaminated.
- the inactive, zymogenic form of the protease can be expressed, isolated and purified during recombinant production. Such methods are known to the person skilled in the art for both eukaryotic and prokaryotic cells.
- proteases that can be produced according to the invention are specifically cleaving proteases, such as, for example, serine proteases (e.g. the eukaryotic proteases, such as factor IX, factor X, factor VII, protein C, thrombin, trypsin, chymotrypsin or tissue plasminogen activator).
- serine proteases e.g. the eukaryotic proteases, such as factor IX, factor X, factor VII, protein C, thrombin, trypsin, chymotrypsin or tissue plasminogen activator.
- the recognition sequence (s) and positioning of the autocatalytic cleavage site or cleavage sites inserted into the protease depend on the type of the protease and also on how the zymogenic form is activated.
- the active form of factor X arises, for example, by cutting out a fragment from the inactive, zymogenic form. This means that according to the invention there must be an autocatalytic cleavage site at the N- and C-terminus of this fragment.
- the activation of trypsin proceeds in such a way that an activation peptide is split off at the N-terminus of the zymogenic form. In this case it is necessary to change the native activation peptide so that it can be cleaved autocatalytically.
- plasminogen activators such as tissue plasminogen activator
- the activation takes place only by cleaving a peptide bond within the Molecule.
- the naturally occurring cleavage site is replaced by the autocatalytic cleavage site.
- the activation takes place by cleaving off an N- and C-terminal fragment from a prepro form during the secretion.
- the C-terminal prosegment should be removed according to the invention and a suitable autocatalytic cleavage site should be inserted between the N-terminal prosegment and the protease domain.
- the recombinant zymogenic form of the protease differs from the naturally occurring zymogenic form.
- bacterial proteases in the zymogenic form contain signal sequences and prosequences which are suitable for enabling the inactive protease to be removed from the cell.
- the recombinant protease is formed in the form of insoluble inclusion bodies. It is therefore advantageous to optimize the amino acid sequence of the zymogenic form so that it leads as completely as possible to the formation of inclusion bodies, from which the protease can expediently be naturalized with a high yield.
- the inclusion bodies show no enzymatic activity due to the denatured form of the protein, it is not absolutely necessary that the zymogenic form shows no proteolytic activity at all. It is even preferred that the zymogenic form show low proteolytic activity in order to accelerate the autocatalytic cleavage after naturation.
- the cleavage site or cleavage sites are preferably inserted while maintaining the native primary structure (protease domain). According to the invention, it is thus possible, for example, to produce active trypsin with an unchanged amino acid sequence in a simple manner in procarytes. A protease is thus obtained in which the N-terminal start codon (methionine) no longer has to be split off.
- the active protease produced according to the invention is immobilized.
- immobilization can be carried out, for example, by binding to a polymeric, insoluble carrier or by self-crosslinking (see, for example, US Pat. No. 4,634,671 and EP-A 0 367 302).
- the zymogenic form can essentially (except for the autocatalytic cleavage site) correspond to the natural zymogenic form of the protease.
- the naturally occurring zymogenic form already an autocatalytic cleavage site.
- the second cleavage site of the zymogenic form is replaced by another autocatalytic cleavage site.
- the sequence of the fragment or fragments to be cleaved is further modified. Suitable autocatalytic cleavage sites for preferred enzymes are given in the table below:
- a preferred embodiment of the invention is an autocatalytically activatable zymogenic precursor of factor X.
- Factor X is a complex glycosylated protease consisting of several domains. Mechanistically it belongs to the family of serine proteases. FX is synthesized in the liver as an inactive proenzyme (zymogen), secreted into the blood and, if necessary, activated by specific proteolysis. The factor X is structured analogously to the factor VII, IX and protein C with regard to the protein domain arrangement. In addition, the amino acid sequences of these 4 proteases are very homologous (amino acid sequence identity: approx. 40%). They are grouped into a protease subfamily, the factor IX family.
- proteases of the factor IX family are also preferred according to the invention. These proteases exist according to Furie, B. and Furie, B.C. (Cell 53 (1988) 505-518)
- EGF1 and EGF2 an "aromatic amino acid stack" domain, - two EGF domains (EGF1 and EGF2),
- blood plasma proteases are modified post-translationally during secretion:
- the enzymatically active proteases consist of 2 chains, which are designated by their molecular weight as heavy and light chain. The two chains are held together in the factor IX protease family by an intermolecular disulfide bridge between the EGF2 domain and the protease domain.
- the zymogen-enzyme transformation (activation) leads to conformational changes within the protease domain.
- an essential salt bridge necessary for the protease activity can form between the ⁇ -NH 3 group of the N-terminal amino acid of the protease domain and an Asp residue within the FXa protease domain.
- the N-terminal region is very critical for this subgroup of serine proteases and must not be modified. Only then can the "active site" typical of serine proteases develop with the catalytic triad of Ser, Asp and His (Blow, DM: Acc. Chem. Res. 9 (1976) 145-152; Polgar, L .: In: Mechanisms of protease action.Boca Raton, Florida, CRC Press, chapter 3 (1989)).
- FX activation peptide processing begins in the cell during secretion (first cleavage between the EGF2 domain and the activation peptide). FX is then activated to FXa by a second FIXa or FVIIa-catalyzed cleavage on the membrane in complex with the cofactor FVIIIa or "tissue factor” (Mann, KG et al., Blood 76 (1990) 1-16).
- the catalytic domain of FXa consists of 254 amino acids, is not glycosylated and forms 4 disulfide bridges. It is built from structurally 2 "tonnenfb 'shaped" ß-pleated sheets, the so-called half-sites.
- trypsinogens are autocatalytically cleavable zymogenic precursors of trypsin proteases.
- the trypsin proteases are formed in the exocrine acinar cells of the pancreas as inactive proenzymes (zymogens), the so-called trypsinogens.
- zymogens the so-called trypsinogens.
- 4 different trypsinogens trypsinogens (trypsinogen I, II, III and IV) were isolated from the human pancreatic secretion, characterized enzymatically and the amino acid sequences determined.
- the 2 most expressed trypsinogen genes TRYI (trypsinogen I) and TRYII (trypsinogen II) are known. They were isolated by cloning the corresponding cDNAs (Emi, M.
- the human trypsinogen genes TRYI and TRYII code according to a secreted protein for a common signal peptide from 15 amino acid residues. This is followed by a prosegment characteristic of the trypsinogen genes, which in the case of human trypsinogens I and II consists of the N-terminal activation peptide AlaProPheAspAspAspAspLys (Guy, O. et al., Biochem. 17 (1978) 1669-1675).
- This pro segment is recognized by the glycoprotease enterokinase secreted from the small intestine mucosa cells into the small intestine and is split off in the presence of calcium, as a result of which the inactive trypsinogens are converted into the active form, the trypsme.
- the activation of the trypsinogens is partially autocatalytic. However, enterokinase cleavage is over 1000 times faster.
- the trypsins belong to the family of serine proteases.
- the activation of the trypsinogens by cleavage of the N-terminal activation peptide also leads to a conformational change within the protease domain with the participation of the free N-terminus (formation of an essential salt bridge between the ⁇ -NH 3 group of the N-terminal amino acid of trypsin and the Aspl94 -Rest within the protease domain), whereby the "active site" typical of serine proteases can form with the catalytic triad of Ser, Asp and His.
- trypsinogen I gene codes for 247 amino acids including a signal sequence of 15 amino acids and an activation peptide of 8 amino acids.
- the mature trypsin I isoenzyme thus consists of 224 amino acid residues. It contains 10 cysteine residues that form 5 disulfide bridges (Emi, M. et al., Gene 41 (1986) 305-310).
- the catalytic domain of trypsin is structurally made up of 2 "barrel-shaped" ß-sheets.
- the human trypsin isoenzyme I has a sequence homology of 89% to the human trypsin isoenzyme II, a sequence homology of about 75% to bovine trypsin and a sequence homology of about 43% to the catalytic domain of the human factor Xa.
- SEQ ID NO: 11 the native FX activation peptide.
- SEQ ID NO: 12 the nucleotide sequence of the cloned TRYI variant gene.
- TRYI-GPK-SS variant shows the nucleotide and derived amino acid sequence of the cloned TRYI trypsin variant gene with a shortened prosegment.
- the modified activation peptides of the autocatalytically activatable trypsin variants rTRYI-GPK and rTRYI-VGR are shown.
- the mutations additionally introduced in the TRYI-GPK-SS variant P132C, P133A and Y233C; amino acid sequence numbering according to the publication by Emi, M. et al. (Gene 41 (1986) 305-310) are highlighted. Examples
- the protein concentration of the proteases and protease variants was determined by determining the optical density (OD) at 280 nm using the molar extinction coefficient calculated on the basis of the amino acid sequence.
- the vector for the expression of the autocatalytically activatable proteases is based on the
- Expression vector pSAM-CORE for core streptavidin.
- the preparation and description of the plasmid pSAM-CORE is described in WO 93/09144 by Kopetzki, E. et al. described.
- the core streptavidin gene was replaced by the desired protease gene in the pSAM-CORE vector.
- the trypsinogen I cDNA from Bp position 61-750 coding for trypsinogen I from amino acid position 19-247 (cDNA sequence and amino acid sequence numbering according to the publication by Emi, M. et al. (Gene 41 (1986) 305-310) was carried out in a "polymerase chain reaction” (PCR) according to the method of Mullis, KB and Faloona, FA (Methods Enzymol. 155 (1987) 355-350) using the PCR primers Nl (SEQ ID NO: 1) and N2 ( SEQ ID NO: 2)
- Ncol Nl 5 '-AAAAAACCATGGATGATGATGACAAGATCGTTGGG-3' MetAspAspAspLysIleValGly ...
- Hindlll N2 5 '- AAAAAAAAGCTTCATTAGCTATTGGCAGCTATGGTGTTC - 3'
- the approx. 715 bp PCR product was digested with the restriction endonucleases Ncol and Hindlll and the approx. 700 bp Ncol / Hindlll trypsinogen I fragment after purification by agarose gel electrophoresis into the approx. 2.55 kBp long NcoI / Hindlll-pSAM-CORE Vector fragment ligated.
- the desired plasmid pTRYI was identified by restriction mapping and the TRYI cDNA sequence isolated by PCR was checked by DNA sequencing.
- the N-terminal native trypsinogen I prosegment AlaProPheAspAspAspAspLys was replaced by the activation peptide GlyProLys.
- the desired TRYI-GPK trypsin variant gene was produced using the PCR technique.
- the human trypsinogen I cDNA from Bp position 73-750, coding for Lys-Trypsin I from amino acid position 23-247 (cDNA sequence and amino acid sequence numbering according to the publication by Emi, M. et al. (Gene 41 (1986) 305-310) by means of PCR using the primers N3 (SEQ ID NO: 3) and N2 (SEQ ID NO: 2, Example 1)
- N3 5 '-AAAAAAACCATGGGTCCGAAAATCGTTGGtGGtTACAAtTGTGAGGAGAATTCTGTCC-5' MetGlyProLysIleValGlvGlvThrAsnCvsGluGluAsnSerVal
- telomere sequence coding for an ATG start codon and the activation peptide GlyProLys with a unique Ncol interface at the 5 'end was introduced by means of the 5' overhanging end of the PCR primer N3.
- the PCR primer N3 was used within the coding N-termi- nal region of the trypsin I structural gene, an additional Muni interface was introduced and the "Codonusage" (amino acid positions: 7, 8 and 10) partially adapted to the codons used in E. coli ("ATG environment with optimized Codonusage", characterized by lowercase of the Bases in the N3 primer) without changing the protein sequence.
- the approx. 700 bp PCR product was digested with the restriction endonucleases Ncol and Hindlll and the approx. 685 bp NcoI / Hindlll-TRYI-GPK fragment after purification by agarose gel electrophoresis into the approx. 2.55 kBp long NcoI / Hindlll-pSAM- Ligated CORE vector fragment.
- the desired plasmid pTRYI-GPK was identified by restriction mapping (additional Muni interface) and the TRPI-GPK gene amplified by PCR was checked by DNA sequencing.
- the N-terminal native trypsinogen I prosegment AlaProPheAspAspAspAspLys was replaced by the activation peptide ValGlyArg.
- the TRYI-VGR trypsin variant gene was produced analogously to the TRYI-GPK trypsin variant gene using the PCR technique.
- the human trypsinogen I cDNA from Bp position 76-750 coding for trypsin I from amino acid position 24-247 (cDNA sequence and amino acid sequence numbering according to the publication by Emi, M. et al. (Gene 41 (1986) 305- 310) by means of PCR using primers N4 (SEQ ID NO: 4) and N2 (SEQ ID NO: 2, example 1)
- N4 5 '- AAAAAAACCATGGTTGGTCGTATCGTTGGtGGtTACAAtTGTGAGGAGAATTCTGTCC - 3' MetValGlvArqlleValGlvGlvThrAsnCysGluGluAsnSerVal
- telomere sequence a DNA sequence coding for an ATG start codon and the activation peptide ValGlyArg with a unique Ncol site at the 5' end was introduced.
- an additional Muni interface was introduced with the PCR primer N4 within the coding N-terminal region of the trypsin I structural gene and the "Codonusage" (amino acid positions: 7, 8 and 10) was partially adapted to the codons used in E. coli (" ATG environment with optimized Codonusage ", characterized by lower case of the bases in the N4 primer), without changing the protein sequence. The approx.
- the human trypsin I isoenzyme was changed by introducing an additional disulfide bridge.
- the amino acid Pro at position 132 and the amino acid Tyr at position 233 were mutated to Cys (amino acid sequence numbering according to the publication by Emi, M. et al. (Gene 41 (1986) 305-310)).
- These 2 point mutations can form an additional 6th disulfide bridge between the cysteine residues introduced according to the invention at positions 132 and 233.
- the amino acid Pro was mutated to Ala at position 133 (P133A).
- trypsinogen I cDNA from Bp position 353-750 coding for trypsinogen I from amino acid position 116-247 (cDNA sequence and amino acid sequence numbering according to the publication by Emi, M. et al. (Gene 41 (1986) 305- 310), by means of PCR using the primers N5 (SEQ ID NO: 5) and N6 (SEQ ID NO: 6)
- Example 1 amplified as template DNA.
- the PCR primer N5 the P132C and the P133A mutation and with the primer N6 the Y233C mutation guided.
- the mutations are identified by lowercase the bases in the PCR primers.
- the approx. 420 bp PCR product was digested with the restriction endonucleases Bsgl and HindHI and the approx. 405 bp Bsgl / HindüI-TRYI fragment after purification by agarose gel electrophoresis into the approx. 2.85 kBp long Bsgl / Hindlll-pTRPI- GPK vector fragment ligated (example 2).
- the desired plasmid pTRYI-GPK-SS was identified by restriction mapping (missing Dralll interface) and the TRYI DNA sequence amplified by PCR was checked by DNA sequencing.
- FX-EGF2-APau-CD autocatalytically activatable FX-EGF2-AP-CD variant; plasmid: pFX-EGF2-APau-CD
- the cloning of the FX gene and the construction of the plasmid pFX-EGF2-AP-CD is described in detail in WO 97/03027, Example 3).
- the FX-EGF2-AP-CD expression unit on the plasmid pFX-EGF2-AP-CD codes for an N-truncated FX protease variant from the EGF2 domain, activation peptide and catalytic protease domain.
- the desired NLT to IDG amino acid sequence change was introduced using a fusion PCR.
- the FX DNA from Bp position 330-629, coding for the EGF2 domain and the activation peptide from amino acid position 111-209 was used in a first PCR PCR primers N7 (SEQ ID NO: 7) and N8 (SEQ ID NO: 8) PstI N7: 5 '- AAAAAAAGGCCTGCATTCCCA.CAGGGCCC - 3'
- Van91I N8 5 '-AAAAAACCaCgCTCtGGCTGCGTCTGGTTGAAGTCAAG-3'
- the FX DNA from Bp position 619-1362 was coding for the C-terminal region of the modified FX activation peptide and the FX protease domain from amino acid position 207-454 (sequence and amino acid sequence numbering corresponding to FIG. 3, WO 97 / 03027) using the PCR primers N9 (SEQ ID NO: 9) and N10 (SEQ ID NO: 10)
- the approx. 300 bp EGF2-AP DNA fragment of the 1st PCR was digested with the restriction endonucleases PstI and Van91I and the approx. 750 bp long FX DNA fragment of the 2nd PCR was digested with the restriction endonucleases Van91I and Hindlll.
- the approximately 285 bp PstI / Van91I-EGF2-AP DNA fragment with the 740 bp long Van91I / HindIII-FX DNA fragment and the approximately 2.56 kbp PstI / Hindlll pFX-EGF2-AP-CD Vector fragment ligated in a three fragment ligation.
- the desired plasmid pFX-EGF2-APau-CD was identified by restriction mapping (additional Van91I interface) and the FX-EGF2-APau-CD gene was checked by DNA sequencing.
- E. coli Kl 2 strain for example UT5600; Grodberg, J. and Dünn, JJ, J. Bacteriol. 170 (1988) 1245-1253
- pTRYI-GPK for example UT5600; Grodberg, J. and Dünn, JJ, J. Bacteriol. 170 (1988) 1245-1253
- pTRYI-GPK for example UT5600; Grodberg, J. and Dünn, JJ, J. Bacteriol. 170 (1988) 1245-1253
- pTRYI-GPK for example UT5600; Grodberg, J. and Dünn, JJ, J. Bacteriol. 170 (1988) 1245-1253
- pTRYI-GPK for example UT5600; Grodberg, J. and Dünn, JJ, J. Bacteriol. 170 (1988) 1245-1253
- the UT5600 / pUBS520 / cells transformed with the expression plasmids were shaken in DYT medium (1% (w / v) yeast extract, 1% (w / v) Bacto Tryptone, Difco, and 0.5% oCl) with 50- 100 mg / 1 ampicillin and 50 mg / 1 kanamycin at 37 ° C to an optical density at 550 nm (OD 550 ) of 0.6-0.9 and then induced with IPTG (1-5 mmol 1 final concentration).
- DYT medium 1% (w / v) yeast extract, 1% (w / v) Bacto Tryptone, Difco, and 0.5% oCl
- the cells were harvested by centrifugation (Sorvall RC-5B centrifuge, GS3 rotor, 6000 rpm, 15 min), with 50 mmol / 1 Tris-HCl buffer, pH 7.2 washed and stored at -20 ° C until further processing.
- the cell yield from a 1 1 shake culture was 4- 5 g (wet weight).
- the expression of the UT5600 / pUBS520 / cells transformed with the expression plasmids pTRYI-GPK, pTRYI-VGR, pTRYI-GPK-SS and pFX-EGF2-APau-CD was analyzed.
- cell pellets from in each case 1 ml centrifuged culture medium in 0.25 ml 10 mmol / 1 Tris-HCl, pH 7.2 and the cells resuspended by sonication (2 pulses of 30 s at 50%> intensity) with a Sonifier Cell Disruptor ® B15 from Branson (Heusenstamm, Germany) open-minded.
- the insoluble cell components were sedimented (Eppendorf 5415 centrifuge, 14000 rpm, 5 min) and the supernatant with 1/5 volume (vol) 5xSDS sample buffer (IxSDS sample buffer: 50 mmol / 1 Tris-HCl, pH 6.8, 1% SDS, 1%> mercaptoethanol, 10% glycerin, 0.001%> bromophenol blue).
- IxSDS sample buffer 50 mmol / 1 Tris-HCl, pH 6.8, 1% SDS, 1%> mercaptoethanol, 10% glycerin, 0.001%> bromophenol blue.
- the insoluble cell debris fraction (pellet) was resuspended in 0.3 ml IxSDS sample buffer with 6-8 M urea, the samples were incubated for 5 min at 95 ° C. and centrifuged again.
- the proteins were then separated by SDS-polyacrylamide gel electrophoresis (PAGE) (Laemmli, UK, Nature 227 (1970) 680-685) and stained with Coomassie Brilliant Blue R dye.
- PAGE SDS-polyacrylamide gel electrophoresis
- IBs inclusion bodies
- the cell pellet from 3 1 shake culture (approx. 15 g wet weight) was resuspended in 75 ml 50 mmol / 1 Tris-HCl, pH 7.2.
- the suspension was mixed with 0.25 mg / ml lysozyme and incubated at 0 ° C for 30 min.
- the cells were disrupted mechanically by means of high-pressure dispersion in a French press from SLM Amico (Urbana, IL, USA) .
- the DNA was then digested for 30 min at room temperature (RT).
- the purified IBs were at a concentration of 100 mg IB pellet (wet weight) / ml corresponding to 5-10 mg / ml protein in 6 mol / 1 guanidine-HCl, 100 mmol / 1 Tris-HCl, 20 mmol / 1 EDTA, 150 mmol / 1 GSSG and 15 mmol / 1 GSH, pH 8.0 dissolved with stirring at RT in 1-3 hours.
- the pH was then adjusted to pH 5.0 and the insoluble constituents were separated off by centrifugation (Sorvall RC-5B centrifuge, SS34 rotor, 16000 rpm, 10 min). The supernatant was dialyzed against 100 vol. 4-6 mol / 1 guanidine-HCl pH 5.0 for 24 hours at 4 ° C. c) Naturation
- the clear protease-containing supernatant was concentrated 10-15 times by cross-flow filtration in a Minisette (membrane type: Omega 3K) from Filtron (Karlstein, Germany) and to remove guanidine-HCl and arginine against 100 vol. 20 mmol / 1 Tris-HCl and 50 mmol / 1 NaCl, pH 8.2 dialyzed for 12-24 hours at 20-25 ° C.
- Minisette membrane type: Omega 3K
- Precipitated protein was separated by centrifugation (Sorvall RC-5B centrifuge, SS34 rotor, 16000 rpm, 20 min) and the clear supernatant was filtered with a Nalgene single-use filtration unit (pore diameter: 0.2 mm) from Nalge (Rochester, NY, U.S.A.).
- the active trypsin and rFXa protease variants rTRYI-GPK, rTRYI-VGR, rTRYI-GPK-SS and rFX-EGF2-APau-CD from the naturation approaches can be further purified if necessary using chromatographic methods which are known to the person skilled in the art. Purification of the protease variants by ion exchange chromatography on Q-Sepharose ff
- the bound material was eluted by a gradient of 50-500 mmol / 1 NaCl in 20 mmol / 1 Tris-HCl, pH 8.2 (2 SV / hour).
- the proteases were eluted at a NaCl concentration of 100-200 mmol / 1.
- the fractions containing proteases were identified by non-reducing and reducing SDS PAGE and the elution peak was pooled.
- the bound material was eluted by 10 mmol / 1 benzamidine in 20 mmol / 1 Tris-HCl and 200 mmol / NaCl, pH 8.2 (2 SV / hour).
- the protease-containing fractions were identified by non-reducing and reducing SDS PAGE and activity determination (see: Example 10).
- the activity determination of trypsin was carried out in accordance with the instructions of Walsh, KA and Wilcox, PE (Methods Enzymol. XIX (1970) 31-41) in a volume of 1 ml in 63 mmol / 1 sodium phosphate buffer, pH 7.6 and 0.23 mmol / 1 N-benzoyl-L-arginine ethyl ester hydrochloride (BAEE; Sigma-Aldrich Chemie GmbH, Deisenhofen, Germany, Cat.-No. B-4500) at 25 ° C.
- the reaction was started by adding 50 ⁇ l of trypsin-containing sample (dissolved in 1 mmol / 1 HC1, 300-600 U / ml) and the change in absorption / min ( ⁇ A / min) at 253 nm was determined.
- 1 BAEE unit trypsin is defined as the amount of enzyme that causes an absorption change ( ⁇ A / min 253 ) of 0.0032 under the specified test conditions.
- the specific activity of purified human trypsin under these test conditions is approximately 12000 U / mg protein.
- the activity and the kinetic constants were determined from the linear initial slope according to the Michaelis-Menten equation.
- the activity determination of trypsin was carried out in a volume of 1 ml in 50 mmol / 1 Tris-HCl, 150 mmol / 1 NaCl, 5 mmol / 1 CaCl 2 , 0.1% PEG 8000, pH 8.0 and 0.1 mmol / 1 of the chronic geneous substrate Chromozym TH ® (tosyl-Gly-Pro-Arg-pNA-4, Cat 838 268, Boehringer Mannheim GmbH, Mannheim, Germany) at 25 ° C.
- Chromozym TH ® tosyl-Gly-Pro-Arg-pNA-4, Cat 838 268, Boehringer Mannheim GmbH, Mannheim, Germany
- 1 Chromozym ® TH Unit Trypsin is defined as the amount of enzyme that releases 1 ⁇ mol pNitroaniline (pNA) from the chromozymic substrate per minute at 25 ° C.
- the FXa activity determination was carried out with the chromogenic substrate Chromozym X (0.1 mmol / 1, N-methoxycarbonyl-D-Nle-Gly-Arg-pNA, Boehringer Mannheim GmbH, Mannheim, Cat.No. 789763) in a volume of 1 ml at 25 ° C in 50 mmol / 1 Tris-HCl, 150 mmol / 1 NaCl, 5 mmol / 1 CaCl 2 , 0.1% PEG 8000, pH 8.0.
- Chromozym X 0.1 mmol / 1, N-methoxycarbonyl-D-Nle-Gly-Arg-pNA, Boehringer Mannheim GmbH, Mannheim, Cat.No. 789763
- FXa activity is defined as the amount of enzyme that releases 1 ⁇ mol pNA per min from the chromozymic substrate at 25 ° C.
- the activity and the kinetic constants were calculated from the linear initial slope according to the Michaelis The results are shown in Table 1.
- Bovine trypsin Bovine trypsin (Boehringer Mannheim GmbH, Mannheim, Germany, cat.no.
- the temperature stability of the different trypsins was determined by "differential scanning calorimetry" (DSC).
- DSC differential scanning calorimetry
- Tm denaturation point of the trypsins was determined in a defined solvent (1 mmol 1 HC1), at a defined protein concentration (40 mg / ml) and a defined heating rate (1 ° C / min) (see Table 2).
- Bovine trypsin Boehringer Mannheim GmbH, Mannheim, Germany, cat.-no.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Hematology (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA002301698A CA2301698A1 (en) | 1997-08-22 | 1998-08-12 | Zymogenic protease precursors that can be autocatalytically activated and their use |
| EP98945214A EP1012307B1 (de) | 1997-08-22 | 1998-08-12 | Autokatalytisch aktivierbare zymogene vorstufen von proteasen und deren verwendung |
| AT98945214T ATE294869T1 (de) | 1997-08-22 | 1998-08-12 | Autokatalytisch aktivierbare zymogene vorstufen von proteasen und deren verwendung |
| DE59812768T DE59812768D1 (de) | 1997-08-22 | 1998-08-12 | Autokatalytisch aktivierbare zymogene vorstufen von proteasen und deren verwendung |
| AU92605/98A AU9260598A (en) | 1997-08-22 | 1998-08-12 | Zymogenic protease precursors that can be autocatalytically activated and their use |
| DK98945214T DK1012307T3 (da) | 1997-08-22 | 1998-08-12 | Autokatalytisk aktiverbare zymogene proteaseforstadier og deres anvendelse |
| JP2000507811A JP3947653B2 (ja) | 1997-08-22 | 1998-08-12 | プロテアーゼの自己触媒的に活性化可能なチモーゲン前駆体及びそれらの使用 |
| IL13465398A IL134653A0 (en) | 1997-08-22 | 1998-08-12 | Zymogenic protease precursors that can be autocatalytically activated and their use |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP97114513.1 | 1997-08-22 | ||
| EP97114513 | 1997-08-22 | ||
| EP97117816 | 1997-10-15 | ||
| EP97117816.5 | 1997-10-15 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US09486102 A-371-Of-International | 2000-05-06 | ||
| US10/446,065 Continuation US20030207402A1 (en) | 1997-08-22 | 2003-05-27 | Autocatalytically activatable zymogenic precursors of proteases and their use |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO1999010503A1 true WO1999010503A1 (de) | 1999-03-04 |
Family
ID=26145739
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP1998/005094 Ceased WO1999010503A1 (de) | 1997-08-22 | 1998-08-12 | Autokatalytisch aktivierbare zymogene vorstufen von proteasen und deren verwendung |
Country Status (9)
| Country | Link |
|---|---|
| EP (1) | EP1012307B1 (https=) |
| JP (1) | JP3947653B2 (https=) |
| AT (1) | ATE294869T1 (https=) |
| AU (1) | AU9260598A (https=) |
| CA (1) | CA2301698A1 (https=) |
| DE (1) | DE59812768D1 (https=) |
| DK (1) | DK1012307T3 (https=) |
| IL (1) | IL134653A0 (https=) |
| WO (1) | WO1999010503A1 (https=) |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000071692A1 (en) * | 1999-05-19 | 2000-11-30 | Medical Research Council | Refolding method of thrombin |
| US6159722A (en) * | 1997-12-03 | 2000-12-12 | Boehringer Mannheim Gmbh | Chimeric serine proteases |
| WO2001011056A1 (en) * | 1999-08-09 | 2001-02-15 | Biochemie Gesellschaft M.B.H. | Production of proteins by autoproteolytic cleavage |
| WO2001011057A1 (en) * | 1999-08-09 | 2001-02-15 | Biochemie Gesellschaft M.B.H. | Production of proteins |
| WO2001019970A3 (en) * | 1999-09-15 | 2001-11-15 | Lilly Co Eli | Chymotrypsin-free trypsin |
| WO2001066771A3 (en) * | 2000-03-03 | 2002-03-21 | Zymogenetics Inc | Human serine protease |
| WO2004020612A1 (en) | 2002-08-30 | 2004-03-11 | Novozymes Biotech, Inc. | Methods for producing mammalian trypsins |
| WO2004111225A1 (en) * | 2003-06-11 | 2004-12-23 | Schering Aktiengesellschaft | Novel modified corin molecules having substitute activation sequences and uses thereof |
| EP1558731A4 (en) * | 2002-10-04 | 2007-01-10 | Schering Ag | MODIFIED HEPSINE MOLECULES COMPRISING A SUBSTITUTION ACTIVATION SEQUENCE AND USES THEREOF |
| US7276605B2 (en) | 2001-02-01 | 2007-10-02 | Roche Diagnostics Operations, Inc. | Method for producing recombinant trypsin |
| EP3604508A4 (en) * | 2017-03-24 | 2021-01-20 | Kaneka Corporation | METHOD OF PRODUCTION OF PROTEASE IN YEAST |
| WO2024110426A1 (en) | 2022-11-23 | 2024-05-30 | F. Hoffmann-La Roche Ag | Method for increasing recombinant protein expression |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2015092852A (ja) * | 2013-11-12 | 2015-05-18 | 倉敷紡績株式会社 | 生体組織分散用組成物 |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0319944A2 (en) * | 1987-12-08 | 1989-06-14 | Zymogenetics, Inc. | Co-expression in eukaryotic cells |
| EP0495398A1 (de) * | 1991-01-11 | 1992-07-22 | Roche Diagnostics GmbH | Rekombinante IgA-Protease |
| EP0597681A1 (en) * | 1992-11-13 | 1994-05-18 | Eli Lilly And Company | Expression vectors for the bovine trypsin and trypsinogen and host cells transformed therewith |
| WO1996017943A1 (en) * | 1994-12-09 | 1996-06-13 | Novo Nordisk A/S | A process of producing extracellular proteins in bacteria |
| WO1997000316A1 (en) * | 1995-06-16 | 1997-01-03 | Novo Nordisk A/S | A process for producing trypsin (trypsinogen) |
-
1998
- 1998-08-12 DE DE59812768T patent/DE59812768D1/de not_active Expired - Lifetime
- 1998-08-12 CA CA002301698A patent/CA2301698A1/en not_active Abandoned
- 1998-08-12 WO PCT/EP1998/005094 patent/WO1999010503A1/de not_active Ceased
- 1998-08-12 AU AU92605/98A patent/AU9260598A/en not_active Abandoned
- 1998-08-12 EP EP98945214A patent/EP1012307B1/de not_active Expired - Lifetime
- 1998-08-12 JP JP2000507811A patent/JP3947653B2/ja not_active Expired - Fee Related
- 1998-08-12 DK DK98945214T patent/DK1012307T3/da active
- 1998-08-12 IL IL13465398A patent/IL134653A0/xx unknown
- 1998-08-12 AT AT98945214T patent/ATE294869T1/de active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0319944A2 (en) * | 1987-12-08 | 1989-06-14 | Zymogenetics, Inc. | Co-expression in eukaryotic cells |
| EP0495398A1 (de) * | 1991-01-11 | 1992-07-22 | Roche Diagnostics GmbH | Rekombinante IgA-Protease |
| EP0597681A1 (en) * | 1992-11-13 | 1994-05-18 | Eli Lilly And Company | Expression vectors for the bovine trypsin and trypsinogen and host cells transformed therewith |
| WO1996017943A1 (en) * | 1994-12-09 | 1996-06-13 | Novo Nordisk A/S | A process of producing extracellular proteins in bacteria |
| WO1997000316A1 (en) * | 1995-06-16 | 1997-01-03 | Novo Nordisk A/S | A process for producing trypsin (trypsinogen) |
Non-Patent Citations (1)
| Title |
|---|
| BRODRICK J.W. ET AL.: "Human cationic trypsinogen", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 253, no. 8, 25 April 1978 (1978-04-25), pages 2732 - 2736, XP002055238 * |
Cited By (21)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6159722A (en) * | 1997-12-03 | 2000-12-12 | Boehringer Mannheim Gmbh | Chimeric serine proteases |
| US6171842B1 (en) | 1997-12-03 | 2001-01-09 | Boehringer Mannheim Gmbh | Chimeric serine proteases |
| US6660492B1 (en) | 1997-12-03 | 2003-12-09 | Boehringer Mannheim Gmbh | Chimeric serine proteases |
| WO2000071692A1 (en) * | 1999-05-19 | 2000-11-30 | Medical Research Council | Refolding method of thrombin |
| US6936455B1 (en) | 1999-08-09 | 2005-08-30 | Sandoz Ag | Production of heterologous proteins using an Npro autoprotease of a pestivirus and inclusion bodies |
| WO2001011056A1 (en) * | 1999-08-09 | 2001-02-15 | Biochemie Gesellschaft M.B.H. | Production of proteins by autoproteolytic cleavage |
| WO2001011057A1 (en) * | 1999-08-09 | 2001-02-15 | Biochemie Gesellschaft M.B.H. | Production of proteins |
| JP4820512B2 (ja) * | 1999-08-09 | 2011-11-24 | サンド・アクチエンゲゼルシヤフト | タンパク質の製造 |
| JP2003506093A (ja) * | 1999-08-09 | 2003-02-18 | バイオケミ・ゲゼルシヤフト・エム・ベー・ハー | タンパク質の製造 |
| CZ302366B6 (cs) * | 1999-08-09 | 2011-04-13 | Sandoz Ag | Zpusob rekombinantní produkce heterologního polypeptidu pomocí peptidu s autoproteolytickou aktivitou |
| US7378512B2 (en) | 1999-08-09 | 2008-05-27 | Biochemie Gesellschaft M.B.H | Production of proteins by autoproteolytic cleavage |
| WO2001019970A3 (en) * | 1999-09-15 | 2001-11-15 | Lilly Co Eli | Chymotrypsin-free trypsin |
| WO2001066771A3 (en) * | 2000-03-03 | 2002-03-21 | Zymogenetics Inc | Human serine protease |
| US7276605B2 (en) | 2001-02-01 | 2007-10-02 | Roche Diagnostics Operations, Inc. | Method for producing recombinant trypsin |
| US7666629B2 (en) | 2001-02-01 | 2010-02-23 | Roche Diagnostics Operations, Inc. | Method for producing recombinant trypsin |
| WO2004020612A1 (en) | 2002-08-30 | 2004-03-11 | Novozymes Biotech, Inc. | Methods for producing mammalian trypsins |
| EP1558731A4 (en) * | 2002-10-04 | 2007-01-10 | Schering Ag | MODIFIED HEPSINE MOLECULES COMPRISING A SUBSTITUTION ACTIVATION SEQUENCE AND USES THEREOF |
| US7176013B2 (en) | 2003-06-11 | 2007-02-13 | Schering Aktiengesellschaft | Modified corin molecules having substitute activation sequences and uses thereof |
| WO2004111225A1 (en) * | 2003-06-11 | 2004-12-23 | Schering Aktiengesellschaft | Novel modified corin molecules having substitute activation sequences and uses thereof |
| EP3604508A4 (en) * | 2017-03-24 | 2021-01-20 | Kaneka Corporation | METHOD OF PRODUCTION OF PROTEASE IN YEAST |
| WO2024110426A1 (en) | 2022-11-23 | 2024-05-30 | F. Hoffmann-La Roche Ag | Method for increasing recombinant protein expression |
Also Published As
| Publication number | Publication date |
|---|---|
| ATE294869T1 (de) | 2005-05-15 |
| IL134653A0 (en) | 2001-04-30 |
| DK1012307T3 (da) | 2005-09-05 |
| CA2301698A1 (en) | 1999-03-04 |
| EP1012307A1 (de) | 2000-06-28 |
| JP3947653B2 (ja) | 2007-07-25 |
| DE59812768D1 (de) | 2005-06-09 |
| EP1012307B1 (de) | 2005-05-04 |
| JP2001514003A (ja) | 2001-09-11 |
| AU9260598A (en) | 1999-03-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP0966536B1 (de) | Faktor x-analoge mit modifizierter proteasespaltstelle | |
| US7666629B2 (en) | Method for producing recombinant trypsin | |
| AT404838B (de) | Herstellung von proteinen aus pro-proteinen durch fusionsproteine abgeleitet von furin oder furinanalogen | |
| CA2153254C (en) | Cloning of enterokinase and method of use | |
| EP1012307B1 (de) | Autokatalytisch aktivierbare zymogene vorstufen von proteasen und deren verwendung | |
| EP0861325A1 (de) | Verfahren zur herstellung von peptiden über streptavidin-fusionsproteine | |
| EP1012303B1 (de) | Faktor x-deletionsmutanten und analoge davon | |
| DE60038312T2 (de) | Faktor x-analog mit einer verbesserten fähigkeit, aktiviert zu werden | |
| EP0917566B1 (de) | Rekombinante blutgerinnungsproteasen | |
| DE3786317T2 (de) | Proteinanaloge des gewebs-plasminogenaktivators. | |
| JP4472870B2 (ja) | 分子内シャペロン様配列を含有するキメラタンパク質およびインスリン製造へのその適用 | |
| DE19943177C2 (de) | Verfahren zur Herstellung von aktiven Serienproteasen und inaktiven Varianten | |
| WO1999010483A2 (de) | Autokatalytisch aktivierbare vorstufen von proteasen und deren verwendung | |
| US20030207402A1 (en) | Autocatalytically activatable zymogenic precursors of proteases and their use | |
| DK2561071T3 (en) | PROCEDURE FOR MANUFACTURING RECOMBINANT THROMBIN | |
| EP0927764B1 (de) | Chimäre Serinproteasen | |
| DE60033141T2 (de) | Verfahren zum entfernen von den n-terminalen alaninresten mit aeromonas aminopeptidase | |
| US20020164712A1 (en) | Chimeric protein containing an intramolecular chaperone-like sequence | |
| EP0750667B1 (de) | Verwendung von rekombinantem inhibitor aus erythrina caffra zur reinigung von serinproteasen | |
| DE4424171A1 (de) | Verwendung von rekombinantem Inhibitor aus Erythrina caffra zur Reinigung von Serinproteasen | |
| MXPA99007817A (en) | Factor x deletion mutants and analogues thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 134653 Country of ref document: IL |
|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM HR HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 1998945214 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2301698 Country of ref document: CA Ref country code: CA Ref document number: 2301698 Kind code of ref document: A Format of ref document f/p: F |
|
| NENP | Non-entry into the national phase |
Ref country code: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 09486102 Country of ref document: US |
|
| WWP | Wipo information: published in national office |
Ref document number: 1998945214 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| WWG | Wipo information: grant in national office |
Ref document number: 1998945214 Country of ref document: EP |