WO1998004740A1 - Nanoparticles having oligonucleotides attached thereto and uses therefor - Google Patents

Nanoparticles having oligonucleotides attached thereto and uses therefor Download PDF

Info

Publication number
WO1998004740A1
WO1998004740A1 PCT/US1997/012783 US9712783W WO9804740A1 WO 1998004740 A1 WO1998004740 A1 WO 1998004740A1 US 9712783 W US9712783 W US 9712783W WO 9804740 A1 WO9804740 A1 WO 9804740A1
Authority
WO
WIPO (PCT)
Prior art keywords
nanoparticles
oligonucleotides
nucleic acid
sequence
attached
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1997/012783
Other languages
English (en)
French (fr)
Other versions
WO1998004740A9 (en
Inventor
Chad A. Mirkin
Robert L. Letsinger
Robert C. Mucic
James J. Storhoff
Robert Elghanian
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanosphere LLC
Northwestern University
Original Assignee
Nanosphere LLC
Northwestern University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanosphere LLC, Northwestern University filed Critical Nanosphere LLC
Priority to CA002262018A priority Critical patent/CA2262018C/en
Priority to EP97938010A priority patent/EP0918885B1/en
Priority to AU40434/97A priority patent/AU4043497A/en
Priority to DE69737598T priority patent/DE69737598T2/de
Priority to JP50891798A priority patent/JP4245664B2/ja
Publication of WO1998004740A1 publication Critical patent/WO1998004740A1/en
Publication of WO1998004740A9 publication Critical patent/WO1998004740A9/en
Anticipated expiration legal-status Critical
Priority to US09/344,667 priority patent/US6361944B1/en
Priority to US09/603,830 priority patent/US6506564B1/en
Priority to US09/693,005 priority patent/US6495324B1/en
Priority to US09/693,352 priority patent/US6417340B1/en
Priority to US09/760,500 priority patent/US6767702B2/en
Priority to US09/820,279 priority patent/US6750016B2/en
Priority to US09/923,625 priority patent/US6773884B2/en
Priority to US09/927,777 priority patent/US20020172953A1/en
Priority to US09/961,949 priority patent/US6582921B2/en
Priority to US09/957,318 priority patent/US6759199B2/en
Priority to US09/957,313 priority patent/US6645721B2/en
Priority to US09/967,409 priority patent/US6740491B2/en
Priority to US09/966,312 priority patent/US6673548B2/en
Priority to US09/966,491 priority patent/US6610491B2/en
Priority to US09/973,788 priority patent/US6720411B2/en
Priority to US09/974,007 priority patent/US7259252B2/en
Priority to US09/974,500 priority patent/US6709825B2/en
Priority to US09/973,638 priority patent/US6878814B2/en
Priority to US09/975,498 priority patent/US6861221B2/en
Priority to US09/975,376 priority patent/US20030054358A1/en
Priority to US09/975,384 priority patent/US7098320B1/en
Priority to US09/975,059 priority patent/US6828432B2/en
Priority to US09/975,062 priority patent/US6677122B2/en
Priority to US09/976,968 priority patent/US6818753B2/en
Priority to US09/976,863 priority patent/US6986989B2/en
Priority to US09/976,378 priority patent/US6969761B2/en
Priority to US09/976,601 priority patent/US6903207B2/en
Priority to US09/976,617 priority patent/US6730269B2/en
Priority to US09/976,900 priority patent/US6902895B2/en
Priority to US09/976,971 priority patent/US6682895B2/en
Priority to US09/976,577 priority patent/US6720147B2/en
Priority to US09/976,618 priority patent/US6812334B1/en
Priority to US09/981,344 priority patent/US6777186B2/en
Priority to US10/008,978 priority patent/US6984491B2/en
Priority to US10/266,983 priority patent/US7169556B2/en
Priority to US10/410,324 priority patent/US6962786B2/en
Priority to US10/640,618 priority patent/US7208587B2/en
Priority to US10/716,829 priority patent/US7250499B2/en
Priority to US11/050,983 priority patent/US20060068378A1/en
Priority to US11/702,002 priority patent/US8323888B2/en
Priority to US12/348,909 priority patent/US20100081134A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6834Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B82NANOTECHNOLOGY
    • B82YSPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y15/00Nanotechnology for interacting, sensing or actuating, e.g. quantum dots as markers in protein assays or molecular motors
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B82NANOTECHNOLOGY
    • B82YSPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y30/00Nanotechnology for materials or surface science, e.g. nanocomposites
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B82NANOTECHNOLOGY
    • B82YSPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y5/00Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6816Hybridisation assays characterised by the detection means
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6834Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00277Apparatus
    • B01J2219/00497Features relating to the solid phase supports
    • B01J2219/005Beads
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00585Parallel processes
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00596Solid-phase processes
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00603Making arrays on substantially continuous surfaces
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00603Making arrays on substantially continuous surfaces
    • B01J2219/00646Making arrays on substantially continuous surfaces the compounds being bound to beads immobilised on the solid supports
    • B01J2219/00648Making arrays on substantially continuous surfaces the compounds being bound to beads immobilised on the solid supports by the use of solid beads
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00603Making arrays on substantially continuous surfaces
    • B01J2219/00653Making arrays on substantially continuous surfaces the compounds being bound to electrodes embedded in or on the solid supports
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00603Making arrays on substantially continuous surfaces
    • B01J2219/00659Two-dimensional arrays
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/0068Means for controlling the apparatus of the process
    • B01J2219/00702Processes involving means for analysing and characterising the products
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00718Type of compounds synthesised
    • B01J2219/0072Organic compounds
    • B01J2219/00722Nucleotides
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B82NANOTECHNOLOGY
    • B82BNANOSTRUCTURES FORMED BY MANIPULATION OF INDIVIDUAL ATOMS, MOLECULES, OR LIMITED COLLECTIONS OF ATOMS OR MOLECULES AS DISCRETE UNITS; MANUFACTURE OR TREATMENT THEREOF
    • B82B1/00Nanostructures formed by manipulation of individual atoms or molecules, or limited collections of atoms or molecules as discrete units
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00Libraries per se, e.g. arrays, mixtures
    • C40B40/04Libraries containing only organic compounds
    • C40B40/06Libraries containing nucleotides or polynucleotides, or derivatives thereof
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10STECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10S977/00Nanotechnology
    • Y10S977/902Specified use of nanostructure
    • Y10S977/904Specified use of nanostructure for medical, immunological, body treatment, or diagnosis
    • Y10S977/924Specified use of nanostructure for medical, immunological, body treatment, or diagnosis using nanostructure as support of dna analysis

Definitions

  • the invention relates to methods of detecting nucleic acids, whether natural or synthetic, and whether modified or unmodified. This invention also relates to methods of nanofabrication. Finally, the invention relates to methods of separating a selected nucleic acid from other nucleic acids.
  • the method comprises contacting a nucleic acid with one or more types of nanoparticles having oligonucleotides attached thereto (nanoparticle-oligonucleotide conjugates) .
  • the nucleic acid has at least two portions, and the oligonucleotides on each of the types of nanoparticles have a sequence complementary to the sequence of one of the portions of the nucleic acid.
  • the contacting takes place under conditions effective to allow hybridization of the oligonucleotides on the nanoparticles with the nucleic acid.
  • the hybridization of the oligonucleotides on the nanoparticles with the nucleic acid results in a detectable change.
  • the method comprises contacting a nucleic acid with at least two types of nanoparticles having oligonucleotides attached thereto.
  • the oligonucleotides on the first type of nanoparticles have a sequence complementary to a first portion of the sequence of the nucleic acid.
  • the oligonucleotides on the second type of nanoparticles have a sequence complementary to a second portion of the sequence of the nucleic acid.
  • the method comprises providing a substrate having a first type of nanoparticles attached thereto.
  • the first type of nanoparticles has oligonucleotides attached thereto, and the oligonucleotides have a sequence complementary to a first portion of the sequence of a nucleic acid.
  • the substrate is contacted with the nucleic acid under conditions effective to allow hybridization of the oligonucleotides on the nanoparticles with the nucleic acid.
  • a second type of nanoparticles having oligonucleotides attached thereto is provided.
  • the oligonucleotides have a sequence complementary to one or more other portions of the sequence of the nucleic acid, and the nucleic acid bound to the substrate is contacted with the second type of nanoparticle-oligonucleotide conjugates under conditions effective to allow hybridization of the oligonucleotides on the second type of nanoparticles with the nucleic acid.
  • a detectable change may be observable at this point.
  • the method may further comprise providing a binding oligonucleotide having a selected sequence having at least two portions, the first portion being complementary to at least a portion of the sequence of the oligonucleotides on the second type of nanoparticles.
  • the binding oligonucleotide is contacted with the second type of nanoparticle-oligonucleotide conjugates bound to the substrate under conditions effective to allow hybridization of the binding oligonucleotide to the oligonucleotides on the nanoparticles.
  • a third type of nanoparticles having oligonucleotides attached thereto, the oligonucleotides having a sequence complementary to the sequence of a second portion of the binding oligonucleotide is contacted with the binding oligonucleotide bound to the substrate under conditions effective to allow hybridization of the binding oligonucleotide to the oligonucleotides on the nanoparticles.
  • the detectable change produced by these hybridizations is observed.
  • the method comprises contacting a nucleic acid with a substrate having oligonucleotides attached thereto, the oligonucleotides having a sequence complementary to a first portion of the sequence of the nucleic acid.
  • the contacting takes place under conditions effective to allow hybridization of the oligonucleotides on the substrate with the nucleic acid.
  • the nucleic acid bound to the substrate is contacted with a first type of nanoparticles having oligonucleotides attached thereto, the oligonucleotides having a sequence complementary to a second portion of the sequence of the nucleic acid.
  • the contacting takes place under conditions effective to allow hybridization of the oligonucleotides on the nanoparticles with the nucleic acid.
  • the first type of nanoparticle- oligonucleotide conjugates bound to the substrate is contacted with a second type of nanoparticles having oligonucleotides attached thereto, the oligonucleotides on the second type of nanoparticles having a sequence complementary to at least a portion of the sequence of the oligonucleotides on the first type of nanoparticles, the contacting taking place under conditions effective to allow hybridization of the oligonucleotides on the first and second types of nanoparticles.
  • a detectable change produced by these hybridizations is observed.
  • the method comprises contacting a nucleic acid with a substrate having oligonucleotides attached thereto, the oligonucleotides having a sequence complementary to a first portion of the sequence of the nucleic acid.
  • the contacting takes place under conditions effective to allow hybridization of the oligonucleotides on the substrate with the nucleic acid.
  • the nucleic acid bound to the substrate is contacted with liposomes having oligonucleotides attached thereto, the oligonucleotides having a sequence complementary to a portion of the sequence of the nucleic acid.
  • This contacting takes place under conditions effective to allow hybridization of the oligonucleotides on the liposomes with the nucleic acid.
  • the liposome-oligonucleotide conjugates bound to the substrate are contacted with a first type of nanoparticles having at least a first type oligonucleotides attached thereto.
  • the first type of oligonucleotides have a hydrophobic group attached to the end not attached to the nanoparticles, and the contacting takes place under conditions effective to allow attachment of the oligonucleotides on the nanoparticles to the liposomes as a result of hydrophobic interactions. A detectable change may be observable at this point.
  • the method may further comprise contacting the first type of nanoparticle-oligonucleotide conjugates bound to the liposomes with a second type of nanoparticles having oligonucleotides attached thereto.
  • the first type of nanoparticles have a second type of oligonucleotides attached thereto which have a sequence complementary to at least a portion of the sequence of the oligonucleotides on the second type of nanoparticles, and the oligonucleotides on the second type of nanoparticles having a sequence complementary to at least a portion of the sequence of the second type of oligonucleotides on the first type of nanoparticles.
  • the method comprises providing nanoparticles having oligonucleotides attached thereto and providing one or more types of binding oligonucleotides.
  • Each of the binding oligonucleotides has two portions. The sequence of one portion is complementary to the sequence of one of the portions of the nucleic acid, and the sequence of the other portion is complementary to the sequence of the oligonucleotides on the nanoparticles.
  • the nanoparticle-oligonucleotide conjugates and the binding oligonucleotides are contacted under conditions effective to allow hybridization of the oligonucleotides on the nanoparticles with the binding oligonucleotides.
  • the nucleic acid and the binding oligonucleotides are contacted under conditions effective to allow hybridization of the binding oligonucleotides with the nucleic acid. Then, a detectable change is observed.
  • the nanoparticle-oligonucleotide conjugates may be contacted with the binding oligonucleotides prior to being contacted with the nucleic acid, or all three may be contacted simultaneously.
  • the method comprises contacting a nucleic acid with at least two types of particles having oligonucleotides attached thereto.
  • the oligonucleotides on the first type of particles have a sequence complementary to a first portion of the sequence of the nucleic acid and have energy donor molecules on the ends not attached to the particles.
  • the oligonucleotides on the second type of particles have a sequence complementary to a second portion of the sequence of the nucleic acid and have energy acceptor molecules on the ends not attached to the particles.
  • the contacting takes place under conditions effective to allow hybridization of the oligonucleotides on the particles with the nucleic acid, and a detectable change brought about by this hybridization is observed.
  • the energy donor and acceptor molecules may be fluorescent molecules.
  • the invention further provides kits for detecting nucleic acids.
  • the kit comprises at least one container, the container holding at least two types of nanoparticles having oligonucleotides attached thereto.
  • the oligonucleotides on the first type of nanoparticles have a sequence complementary to the sequence of a first portion of a nucleic acid.
  • the oligonucleotides on the second type of nanoparticles have a sequence complementary to the sequence of a second portion of the nucleic acid.
  • the kit may comprise at least two containers.
  • the first container holds nanoparticles having oligonucleotides attached thereto which have a sequence complementary to the sequence of a first portion of a nucleic acid.
  • the second container holds nanoparticles having oligonucleotides attached thereto which have a sequence complementary to the sequence of a second portion of the nucleic acid.
  • the kit comprises at least one container.
  • the container holds metallic or semiconductor nanoparticles having oligonucleotides attached thereto.
  • the oligonucleotides have a sequence complementary to portion of a nucleic acid and have fluorescent moelcules attached to the ends of the oligonucleotides not attached to the nanoparticles.
  • the kit comprises a substrate, the substrate having attached thereto nanoparticles, the nanoparticles having oligonucleotides attached thereto which have a sequence complementary to the sequence of a first portion of a nucleic acid.
  • the kit also includes a first container holding nanoparticles having oligonucleotides attached thereto which have a sequence complementary to the sequence of a second portion of the nucleic acid.
  • the kit further includes a second container holding a binding oligonucleotide having a selected sequence having at least two portions, the first portion being complementary to at least a portion of the sequence of the oligonucleotides on the nanoparticles in the first container.
  • the kit also includes a third container holding nanoparticles having oligonucleotides attached thereto, the oligonucleotides having a sequence complementary to the sequence of a second portion of the binding oligonucleotide.
  • the kit comprises a substrate having oligonucleotides attached thereto which have a sequence complementary to the sequence of a first portion of a nucleic acid, a first container holding nanoparticles having oligonucleotides attached thereto which have a sequence complementary to the sequence of a second portion of the nucleic acid, and a second container holding nanoparticles having oligonucleotides attached thereto which have a sequence complementary to at least a portion of the oligonucleotides attached to the nanoparticles in the first container.
  • the kit comprises a substrate, a first container holding nanoparticles, a second container holding a first type of oligonucleotides having a sequence complementary to the sequence of a first portion of a nucleic acid, a third container holding a second type of oligonucleotides having a sequence complementary to the sequence of a second portion of the nucleic acid, and a fourth container holding a third type of oligonucleotides having a sequence complementary to at least a portion of the sequence of the second type of oligonucleotides.
  • the kit comprises a substrate having oligonucleotides attached thereto which have a sequence complementary to the sequence of a first portion of a nucleic acid.
  • the kit also includes a first container holding liposomes having oligonucleotides attached thereto which have a sequence complementary to the sequence of a second portion of the nucleic acid and a second container holding nanoparticles having at least a first type of oligonucleotides attached thereto, the first type of oligonucleotides having a hydrophobic group attached to the end not attached to the nanoparticles so that the nanoparticles can be attached to the liposomes by hydrophobic interactions.
  • the kit may further comprise a third container holding a second type of nanoparticles having oligonucleotides attached thereto, the oligonucleotides having a sequence complementary to at least a portion of the sequence of a second type of oligonucleotides attached to the first type of nanoparticles.
  • the second type of oligonucleotides attached to the first type of nanoparticles have a sequence complementary to the sequence of the oligonucleotides on the second type of nanoparticles.
  • the kit comprises a first container holding nanoparticles having oligonucleotides attached thereto.
  • the kit also includes one or more additional containers, each container holding a binding oligonucleotide.
  • Each binding oligonucleotide has a first portion which has a sequence complementary to at least a portion of the sequence of oligonucleotides on the nanoparticles and a second portion which has a sequence complementary to the sequence of a portion of a nucleic acid to be detected.
  • the sequences of the second portions of the binding oligonucleotides may be different as long as each sequence is complementary to a portion of the sequence of the nucleic acid to be detected.
  • the kit comprises a container holding one type of nanoparticles having oligonucleotides attached thereto and one or more types of binding oligonucleotides.
  • Each of the types of binding oligonucleotides has a sequence comprising at least two portions. The first portion is complementary to the sequence of the oligonucleotides on the nanoparticles, whereby the binding oligonucleotides are hybridized to the oligonucleotides on the nanoparticles in the container (s) .
  • the second portion is complementary to the sequence of a portion of the nucleic acid.
  • the kit comprises at least three containers.
  • the first container holds nanoparticles.
  • the second container holds a first oligonucleotide having a sequence complementary to the sequence of a first portion of a nucleic acid.
  • the third container holds a second oligonucleotide having a sequence complementary to the sequence of a second portion of the nucleic acid.
  • the kit may further comprise a fourth container holding a binding oligonucleotide having a selected sequence having at least two portions, the first portion being complementary to at least a portion of the sequence of the second oligonucleotide, and a fifth container holding an oligonucleotide having a sequence complementary to the sequence of a second portion of the binding oligonucleotide .
  • the kit comprises one or two containers, the container (s) holding two types of particles.
  • the first type of particles having oligonucleotides attached thereto that have a sequence complementary to a first portion of the sequence of a nucleic acid and have energy donor molecules attached to the ends not attached to the nanoparticles.
  • the second type of particles having oligonucleotides attached thereto that have a sequence complementary to a second portion of the sequence of a nucleic acid and have energy acceptor molecules attached to the ends not attached to the nanoparticles.
  • the energy donors and acceptors may be fluorescent molecules.
  • the invention also provides a substrate having nanoparticles attached thereto.
  • the nanoparticles may have oligonucleotides attached thereto which have a sequence complementary to the sequence of a first portion of a nucleic acid.
  • the invention further provides a method of nanofabrication.
  • the method comprises providing at least one type of linking oligonucleotide having a selected sequence, the sequence of each type of linking oligonucleotide having at least two portions.
  • the method further comprises providing one or more types of nanoparticles having oligonucleotides attached thereto, the oligonucleotides on each type of nanoparticles having a sequence complementary to a portion of the sequence of a linking oligonucleotide.
  • the linking oligonucleotides and nanoparticles are contacted under conditions effective to allow hybridization of the oligonucleotides on the nanoparticles to the linking oligonucleotides so that a desired nanomaterial or nanostructure is formed.
  • the invention provides another method of nanofabrication.
  • This method comprises providing at least two types of nanoparticles having oligonucleotides attached thereto.
  • the oligonucleotides on the first type of nanoparticles have a sequence complementary to that of the oligonucleotides on the second type of nanoparticles.
  • the oligonucleotides on the second type of nanoparticles have a sequence complementary to that of the oligonucleotides on the first type of nanoparticle- oligonucleotide conjugates.
  • the first and second types of nanoparticles are contacted under conditions effective to allow hybridization of the oligonucleotides on the nanoparticles to each other so that a desired nanomaterial or nanostructure is formed.
  • the invention further provides nano aterials or nanostructures composed of nanoparticles having oligonucleotides attached thereto, the nanoparticles being held together by oligonucleotide connectors.
  • the invention also provides a composition comprising at least two types of nanoparticles having oligonucleotides attached thereto.
  • the oligonucleotides on the first type of nanoparticles have a sequence complementary to the sequence of a first portion of a nucleic acid or a linking oligonucleotide.
  • the oligonucleotides on the second type of nanoparticles have a sequence complementary to the sequence of a second portion of the nucleic acid or linking oligonucleotide.
  • the invention further provides an assembly of containers comprising a first container holding nanoparticles having oligonucleotides attached thereto, and a second container holding nanoparticles having oligonucleotides attached thereto.
  • the oligonucleotides attached to the nanoparticles in the first container have a sequence complementary to that of the oligonucleotides attached to the nanoparticles in the second container.
  • the oligonucleotides attached to the nanoparticles in the second container have a sequence complementary to that of the oligonucleotides attached to the nanoparticles in the first container.
  • the invention also provides a nanoparticle having a plurality of different oligonucleotides attached to it.
  • the invention provides a method of separating a selected nucleic acid having at least two portions from other nucleic acids.
  • the method comprises providing one or more types of nanoparticles having oligonucleotides attached thereto, the oligonucleotides on each of the types of nanoparticles having a sequence complementary to the sequence of one of the portions of the selected nucleic acid.
  • the selected and other nucleic acids are contacted with the nanoparticles under conditions effective to allow hybridization of the oligonucleotides on the nanoparticles with the selected nucleic acid so that the nanoparticles hybridized to the selected nucleic acid aggregate and precipitate.
  • a "type of oligonucleotides” refers to a plurality of oligonucleotide molecules having the same sequence.
  • a “type of nanoparticles having oligonucleotides attached thereto” refers to a plurality of nanoparticles having the same type(s) of oligonucleotides attached to them.
  • Nanoparticles having oligonucleotides attached thereto are also sometimes referred to as “nanoparticle-oligonucleotide conjugates” or, in the case of the detection methods of the invention, “nanoparticle-oligonucleotide probes," “nanoparticle probes,” or just “probes.”
  • Figure 1 Schematic diagram illustrating the formation of nanoparticle aggregates by combining nanoparticles having complementary oligonucleotides attached to them, the nanoparticles being held together in the aggregates as a result of the hybridization of the complementary oligonucleotides.
  • X represents any covalent anchor (such as -S (CH 2 ) 3 0P(0) (0 ⁇ )-, where S is joined to a gold nanoparticle) .
  • oligonucleotide is shown to be attached to each particle but, in fact, each particle has several oligonucleotides attached to it.
  • the relative sizes of the gold nanoparticles and the oligonucleotides are not drawn to scale.
  • Figure 2 Schematic diagram illustrating a system for detecting nucleic acid using nanoparticles having oligonucleotides attached thereto.
  • the oligonucleotides on the two nanoparticles have sequences complementary to two different portions of the single-stranded DNA shown. As a consequence, they hybridize to the DNA producing detectable changes (forming aggregates and producing a color change) .
  • FIG 3 Schematic diagram of a variation of the system shown in Figure 2.
  • the oligonucleotides on the two nanoparticles have sequences complementary to two different portions of the single-stranded DNA shown which are separated by a third portion which is not complementary to the oligonucleotides on the nanoparticles.
  • an optional filler oligonucleotide which can be used to hybridize with the noncomplementary portion of the single-stranded DNA.
  • Figure Schematic diagram illustrating reversible aggregation of nanoparticles having oligonucleotides attached thereto as a result of hybridization and de- hybridization with a linking oligonucleotide.
  • the illustrated linking oligonucleotide is a double-stranded DNA having overhanging termini (sticky ends) which are complementary to the oligonucleotides attached to the nanoparticles .
  • Figure 5 Schematic diagram illustrating the formation of nanoparticle aggregates by combining nanoparticles having oligonucleotides attached thereto with linking oligonucleotides having sequences complementary to the oligonucleotides attached to the nanoparticles .
  • FIG. 6 Cuvettes containing two types of gold colloids, each having a different oligonucleotide attached thereto and a linking double-stranded oligonucleotide with sticky ends complementary to the oligonucleotides attached to the nanoparticles (see Figure 4).
  • Figure 8A is a graph of change in absorbance versus temperature/time for the system illustrated in Figure 4.
  • gold nanoparticles having oligonucleotides attached thereto aggregate due to hybridization with linking oligonucleotides (see Figure 4) .
  • high temperature (80oQ ) the nanoparticles are de-hybridized. Changing the temperature over time shows that this is a reversible process.
  • Figure 8B is a graph of change in absorbance versus temperature/time performed in the same manner using an aqueous solution of unmodified gold nanoparticles. The reversible changes seen in Figure 8A are not observed.
  • Figures 9A-B Transmission Electron Microscope (TEM) images.
  • Figure 9A is a TEM image of aggregated gold nanoparticles held together by hybridization of the oligonucleotides on the gold nanoparticles with linking oligonucleotides.
  • Figure 9B is a TEM image of a two- dimensional aggregate showing the ordering of the linked nanoparticles.
  • Figure 10 Schematic diagram illustrating the formation of thermally-stable triple-stranded oligonucleotide connectors between nanoparticles having the pyrimidine:purine:pyrimidine motif. Such triple- stranded connectors are stiffer than double-stranded connectors.
  • one nanoparticle has an oligonucleotide attached to it which is composed of all purines, and the other nanoparticle has an oligonucleotide attached to it which is composed of all pyrimidines.
  • the third oligonucleotide for forming the triple-stranded connector (not attached to a nanoparticle) is composed of pyrimidines.
  • Figure 11 Schematic diagram illustrating the formation of nanoparticle aggregates by combining nanoparticles having complementary oligonucleotides attached to them, the nanoparticles being held together in the aggregates as a result of the hybridization of the complementary oligonucleotides.
  • the circles represent the nanoparticles
  • the formulas are oligonucleotide sequences
  • s is the thio-alkyl linker
  • the squiggles on the circles represent other oligonucleotide molecules of the same sequence as indicated that cover the surface of the nanoparticles.
  • the multiple oligonucleotides on the two types of nanoparticles can hybridize to each other, leading to the formation of an aggregate structure.
  • Figure 12 Schematic diagrams illustrating systems for detecting nucleic acid using nanoparticles having oligonucleotides attached thereto. Oligonucleotide- nanoparticle conjugates 1 and 2 and single-stranded oligonucleotide targets 3, 4, 5, 6 and 7 are illustrated. In Figure 12, the circles represent the nanoparticles, the formulas are oligonucleotide sequences, and the dotted lines represent connecting links of nucleotide.
  • Figures 13A-B Schematic diagrams illustrating systems for detecting DNA (analyte DNA) using nanoparticles and a transparent substrate.
  • Figure 14A is a graph of absorbance versus wavelength in nm showing changes in absorbance when gold nanoparticles having oligonucleotides attached thereto (one population of which is in solution and one population of which is attached to a transparent substrate as illustrated in Figure 13B) aggregate due to hybridization with linking oligonucleotides.
  • Figure 14B a graph of change in absorbance for the hybridized system referred to in Figure 14A as the temperature is increased (melted) .
  • Figure 15 Schematic diagrams illustrating systems for detecting nucleic acid using nanoparticles having oligonucleotides attached thereto. Oligonucleotide- nanoparticle conjugates 1 and 2 and single-stranded oligonucleotide targets 3, 4, 5, 6, 7 and 8 are illustrated. In Figure 15, the circles represent the nanoparticles, the formulas are oligonucleotide sequences, and S represents the thio-alkyl linker.
  • Figure 16 Schematic diagrams illustrating systems for detecting nucleic acid using nanoparticles having oligonucleotides attached thereto. Oligonucleotide- nanoparticle conjugates 1 and 2, single-stranded oligonucleotide targets of different lengths, and filler oligonucleotides of different lengths are illustrated. In Figure 16, the circles represent the nanoparticles, the formulas are oligonucleotide sequences, and S represents the thio-alkyl linker.
  • Figure 17 Schematic diagrams illustrating nanoparticle-oligonucleotide conjugates and systems for detecting nucleic acid using nanoparticles having oligonucleotides attached thereto.
  • Figure 17 Schematic diagram illustrating a system for detecting nucleic acid using liposomes (large double circle) , nanoparticles (small dark circles) and a transparent substrate.
  • the filled-in squares represent cholesteryl groups
  • the squiggles represent oligonucleotides
  • the ladders represent double-stranded (hybridized) oligonucleotides.
  • Figure 19A is a graph of absorbance versus wavelength in nm showing changes in absorbance when gold nanoparticle-oligonucleotide conjugates assemble in multiple layers on a transparent substrate as illustrated in Figure 13A.
  • Figure 19B is a graph of change in absorbance for the hybridized system referred to in Figure 19A as the temperature is increased (melted) .
  • Figures 20A-B Illustrations of schemes using fluorescent-labeled oligonucleotides attached to metallic or semiconductor quenching nanoparticles (Figure 20A) or to non-metallic, non-semiconductor particles ( Figure 20B) .
  • Nanoparticles useful in the practice of the invention include metal (e.g., gold, silver, copper and platinum), semiconductor (e.g., CdSe and CdS) and magnetic (e.g., ferromagnetite) colloidal materials.
  • metal e.g., gold, silver, copper and platinum
  • semiconductor e.g., CdSe and CdS
  • magnetic e.g., ferromagnetite colloidal materials.
  • nanoparticles useful in the practice of the invention include ZnS, ZnO, Ti0 2 , Agl, AgBr, Hgl 2 , PbS, PbSe, ZnTe, CdTe, In 2 S 3 , In 2 Se 3 , Cd 3 P 2 , CdjAs 2 , InAs, and
  • the size of the nanoparticles is preferably from about 5 nm to about 150 nm (mean diameter) , more preferably from about 5 to about 50 nm, most preferably from about 10 to about 30 nm.
  • Methods of making metal, semiconductor and magnetic nanoparticles are well-known in the art. See, e.g., Schmid, G. (ed.) Clusters and Colloids (VCH, Weinheim, 1994); Hayat, M.A. (ed.) Colloidal Gold: Principles, Methods, and Applications (Academic Press, San Diego,
  • Suitable nanoparticles are also commercially available from, e.g., Ted Pella, Inc. (gold), Amersham Corporatrion (gold) and Nanoprobes, Inc. (gold) .
  • Presently preferred for use in detecting nucleic acids are gold nanoparticles.
  • Gold colloidal particles have high extinction coefficients for the bands that give rise to their beautiful colors. These intense colors change with particle size, concentration, interparticle distance, and extent of aggregation and shape (geometry) of the aggregates, making these materials particularly attractive for colorimetric assays. For instance, hybridization of oligonucleotides attached to gold nanoparticles with oligonucleotides and nucleic acids results in an immediate color change visible to the naked eye (see, e.g., the Examples).
  • Gold nanoparticles are also presently preferred for use in nanofabrication for the same reasons given above and because of their stability, ease of imaging by electron microscopy, and well-characterized modification with thiol functionalities (see below) .
  • the nanoparticles, the oligonucleotides or both are functionalized in order to attach the oligonucleotides to the nanoparticles.
  • Such methods are known in the art.
  • oligonucleotides functionalized with alkanethiols at their 3 '-termini or 5 '-termini readily attach to gold nanoparticles. See Whitesides, Proceedings of the Robert A. Welch Foundation 39th Conference On Chemical Research Nanophase Chemistry,
  • Oligonucleotides terminated with a 5' thionucleoside or a 3' thionucleoside may also be used for attaching oligonucleotides to solid surfaces.
  • Gold nanoparticles may be attached to oligonucleotides using biotin-labeled oligonucleotides and streptavidin- gold conjugate colloids; the biotin-streptavidin interaction attaches the colloids to the oligonucleotide.
  • each nanoparticle will have a plurality of oligonucleotides attached to it.
  • each nanoparticle-oligonucleotide conjugate can bind to a plurality of oligonucleotides or nucleic acids having the complementary sequence.
  • Oligonucleotides of defined sequences are used for a variety of purposes in the practice of the invention. Methods of making oligonucleotides of a predetermined sequence are well-known. See, e.g., Sambrook et al . , Molecular Cloning: A Laboratory Manual (2nd ed. 1989) and F.
  • the invention provides methods of detecting nucleic acids. Any type of nucleic acid may be detected, and the methods may be used, e.g., for the diagnosis of disease and in sequencing of nucleic acids.
  • nucleic acids that can be detected by the methods of the invention include genes (e.g., a gene associated with a particular disease) , viral RNA and DNA, bacterial DNA, fungal DNA, cDNA, mRNA, RNA and DNA fragments, oligonucleotides, synthetic oligonucleotides, modified oligonucleotides, single-stranded and double-stranded nucleic acids, natural and synthetic nucleic acids, etc.
  • genes e.g., a gene associated with a particular disease
  • viral RNA and DNA e.g., viral RNA and DNA, bacterial DNA, fungal DNA, cDNA, mRNA, RNA and DNA fragments
  • oligonucleotides e.g., synthetic oligonucleotides
  • examples of the uses of the methods of detecting nucleic acids include: the diagnosis and/or monitoring of viral diseases (e.g., human immunodeficiency virus, hepatitis viruses, herpes viruses, cytomegalovirus, and Epstein-Barr virus), bacterial diseases (e.g., tuberculosis, Lyme disease, H. pylori, Escherichia coli infections, Legionella infections, Mycoplasma infections, Salmonella infections), sexually transmitted diseases ( e. g. , gonorrhoea), inherited disorders (e.g., cystic fibrosis, Duchene muscular dystrophy, phenylketonuria, sickle cell anemia), and cancers ( e. g. , genes associated with the development of cancer); in forensics; in DNA sequencing; for paternity testing; for cell line authentication; for monitoring gene therapy; and for many other purposes.
  • viral diseases e.g., human immunodeficiency virus, hepatitis viruses,
  • the methods of detecting nucleic acids based on observing a color change with the naked eye are cheap, fast, simple, robust (the reagents are stable) , do not require specialized or expensive equipment, and do not require any instrumentation. This makes them particularly suitable for use in, e.g., research and analytical laboratories in DNA sequencing, in the field to detect the presence of specific pathogens, in the doctor's office for quick identification of an infection to assist in prescribing a drug for treatment, and in homes and health centers for inexpensive first-line screening.
  • the nucleic acid to be detected may be isolated by known methods, or may be detected directly in cells, tissue samples, biological fluids (e. g. , saliva, urine, blood, serum) , solutions containing PCR components, solutions containing large excesses of oligonucleotides or high molecular weight DNA, and other samples, as also known in the art. See, e.g., Sambrook et ai.. Molecular Cloning: A Laboratory Manual (2nd ed. 1989) and B.D.
  • a nucleic acid may be amplifed by methods known in the art. See, e.g., Sambrook et al . , Molecular Cloning: A Laboratory Manual (2nd ed. 1989) and B.D. Hames and S.J. Higgins, Eds., Gene Probes 1 (IRL Press, New York, 1995) . Preferred is polymerase chain reaction (PCR) amplification.
  • PCR polymerase chain reaction
  • One method for detecting nucleic acid comprises contacting a nucleic acid with one or more types of nanoparticles having oligonucleotides attached thereto.
  • the nucleic acid to be detected has at least two portions. The lengths of these portions and the distance (s), if any, between them are chosen so that when the oligonucleotides on the nanoparticles hybridize to the nucleic acid, a detectable change occurs. These lengths and distances can be determined empirically and will depend on the type of particle used and its size and the type of electrolyte which will be present in solutions used in the assay (certain electrolytes affect the conformation of nucleic acids) .
  • the portions of the nucleic acid to which the oligonucleotides on the nanoparticles are to bind must be chosen so that they contain sufficient unique sequence so that detection of the nucleic acid will be specific. Guidelines for doing so are well known in the art.
  • nucleic acids may contain repeating sequences close enough to each other so that only one type of oligonucleotide-nanoparticle conjugate need be used, this will be a rare occurrence.
  • the chosen portions of the nucleic acid will have different sequences and will be contacted with nanoparticles carrying two or more different oligonucleotides, preferably attached to different nanoparticles.
  • An example of a system for the detection of nucleic acid is illustrated in Figure 2. As can be seen, a first oligonucleotide attached to a first nanoparticle has a sequence complementary to a first portion of the target sequence in the single-stranded DNA.
  • a second oligonucleotide attached to a second nanoparticle has a sequence complementary to a second portion of the target sequence in the DNA. Additional portions of the DNA could be targeted with corresponding nanoparticles. See Figure 17. Targeting several portions of a nucleic acid increases the magnitude of the detectable change.
  • the contacting of the nanoparticle-oligonucleotide conjugates with the nucleic acid takes place under conditions effective for hybridization of the oligonucleotides on the nanoparticles with the target sequence (s) of the nucleic acid.
  • hybridization conditions are well known in the art and can readily be optimized for the particular system employed. See, e. g. , Sambrook et al . , Molecular Cloning: A Laboratory Manual (2nd ed. 1989) .
  • Preferably stringent hybridization conditions are employed.
  • Faster hybridization can be obtained by freezing and thawing a solution containing the nucleic acid to be detected and the nanoparticle-oligonucleotide conjugates.
  • the solution may be frozen in any convenient manner, such as placing it in a dry ice-alcohol bath for a sufficient time for the solution to freeze (generally about 1 minute for 100 ⁇ L of solution) .
  • the solution must be thawed at a temperature below the thermal denaturation temperature, which can conveniently be room temperature for most combinations of nanoparticle-oligonucleotide conjugates and nucleic acids.
  • the hybridization is complete, and the detectable change may be observed, after thawing the solution.
  • the rate of hybridization can also be increased by warming the solution containing the nucleic acid to be detected and the nanoparticle-oligonucleotide conjugates to a temperature below the dissociation temperature (Tm) for the complex formed between the oligonucleotides on the nanoparticles and the target nucleic acid.
  • rapid hybridization can be achieved by heating above the dissociation temperature (Tm) and allowing the solution to cool.
  • the rate of hybridization can also be increased by increasing the salt concentration (e.g., from 0.1 M to 0.3 M NaCl) .
  • the detectable change that occurs upon hybridization of the oligonucleotides on the nanoparticles to the nucleic acid may be a color change, the formation of aggregates of the nanoparticles, or the precipitation of the aggregated nanoparticles.
  • the color changes can be observed with the naked eye or spectroscopically.
  • the formation of aggregates of the nanoparticles can be observed by electron microscopy or by nephelometry.
  • the precipitation of the aggregated nanoparticles can be observed with the naked eye or microscopically.
  • Particularly preferred is a color change observable with the naked eye.
  • the observation of a color change with the naked eye can be made more readily against a background of a contrasting color.
  • a color change is facilitated by spotting a sample of the hybridization solution on a solid white surface (such as silica or alumina TLC plates, filter paper, cellulose nitrate membranes, and nylon membranes, preferably a C-18 silica TLC plate) and allowing the spot to dry. Initially, the spot retains the color of the hybridization solution (which ranges from pink/red, in the absence of hybridization, to purplish-red/purple, if there has been hybridization) .
  • a blue spot develops if the nanoparticle-oligonucleotide conjugates had been linked by hybridization with the target nucleic acid prior to spotting.
  • the spot In the absence of hybridization (e.g., because no target nucleic acid is present), the spot is pink.
  • the blue and the pink spots are stable and do not change on subsequent cooling or heating or over time. They provide a convenient permanent record of the test. No other steps (such as a separation of hybridized and unhybridized nanoparticle-oligonucleotide conjugates) are necessary to observe the color change.
  • An alternate method for easily visualizing the assay results would be to spot a sample of nanoparticle probes hybridized to a target nucleic acid on a glass fiber filter (e.g., Borosilicate Microfiber Filter, 0.7 micron pore size, grade FG75, for use with gold nanoparticles 13 nm in size), while drawing the liquid through the filter. Subsequent rinsing with water washes the excess, non- hybridized probes through the filter, leaving behind an observable spot comprising the aggregates generated by hybridization of the nanoparticle probes with the target nucleic acid (retained because these aggregates are larger than the pores of the filter) . This technique may provide for greater sensitivity, since an excess of nanoparticle probes can be used.
  • a glass fiber filter e.g., Borosilicate Microfiber Filter, 0.7 micron pore size, grade FG75, for use with gold nanoparticles 13 nm in size
  • nanoparticle probes stick to all other solid surfaces that have been tried (silica slides, reverse-phase plates, and nylon, nitrocellulose, cellulose and other membranes), making glass fiber filters the only solid surface known to date which can be be employed in such a washing format.
  • An important aspect of the detection system illustrated in Figure 2 is that obtaining a detectable change depends on cooperative hybridization of two different oligonucleotides to a given target sequence in the nucleic acid. Mismatches in either of the two oligonucleotides will destabilize the interparticle connection.
  • the target sequence of the nucleic acid may be contiguous, as in Figure 2, or the two portions of the target sequence may be separated by a third portion which is not complementary to the oligonucleotides on the nanoparticles, as illustrated in Figure 3.
  • a filler oligonucleotide which is free in solution and which has a sequence complementary to that of this third portion (see Figure 3) .
  • the filler oligonucleotide hybridizes with the third portion of the nucleic acid, a double- stranded segment is created, thereby altering the average distance between the nanoparticles and, consequently, the color.
  • the system illustrated in Figure 3 may increase the sensitivity of the detection method.
  • Some embodiments of the method of detecting nucleic acid utilize a substrate. By employing a substrate, the detectable change (the signal) can be amplified and the sensitivity of the assay increased.
  • Suitable substrates include transparent solid surfaces (e.g., glass, quartz, plastics and other polymers), opaque solid surface (e.g., white solid surfaces, such as TLC silica plates, filter paper, glass fiber filters, cellulose nitrate membranes, nylon membranes), and conducting solid surfaces (e.g., indium- tin-oxide (ITO) ) .
  • transparent solid surfaces e.g., glass, quartz, plastics and other polymers
  • opaque solid surface e.g., white solid surfaces, such as TLC silica plates, filter paper, glass fiber filters, cellulose nitrate membranes, nylon membranes
  • conducting solid surfaces e.g., indium- tin-oxide (ITO)
  • the substrate can be any shape or thickness, but generally will be flat and thin.
  • transparent substrates such as glass (e.g., glass slides) or plastics (e.g., wells of microtiter plates) .
  • oligonucleotides are attached to the substrate.
  • the oligonucleotides can be attached to the substrates as described in, e.g., Chrisey et al., Nucleic Acids Res . , 24, 3031-3039 (1996); Chrisey et al., Nucleic Acids Res . , 24, 3040-3047 (1996); Mucic et al., Chem. Co mun. , 555 (1996); Zimmermann and Cox, Nucleic Acids Res . , 22, 492 (1994); Bottomley et al., J. Vac. Sci . Technol . A, 10, 591 (1992); and Hegner et al., FEBS Lett .
  • the oligonucleotides attached to the substrate have a sequence complementary to a first portion of the sequence of the nucleic acid to be detected.
  • the nucleic acid is contacted with the substrate under conditions effective to allow hybridization of the oligonucleotides on the substrate with the nucleic acid. In this manner the nucleic acid becomes bound to the substrate. Any unbound nucleic acid is preferably washed from the substrate before adding nanoparticle-oligonucleotide conjugates.
  • the nucleic acid bound to the substrate is contacted with a first type of nanoparticles having oligonucleotides attached thereto.
  • the oligonucleotides have a sequence complementary to a second portion of the sequence of the nucleic acid, and the contacting takes place under conditions effective to allow hybridization of the oligonucleotides on the nanoparticles with the nucleic acid. In this manner the first type of nanoparticles become bound to the substrate. After the nanoparticle-oligonucleotide conjugates are bound to the substrate, the substrate is washed to remove any unbound nanoparticle-oligonucleotide conjugates and nucleic acid.
  • the oligonucleotides on the first type of nanoparticles may all have the same sequence or may have different sequences that hybridize with different portions of the nucleic acid to be detected.
  • each nanoparticle may have all of the different oligonucleotides attached to it or, preferably, the different oligonucleotides are attached to different nanoparticles.
  • Figure 17 illustrates the use of nanoparticle-oligonucleotide conjugates designed to hybridize to multiple portions of a nucleic acid.
  • the first type of nanoparticle- oligonucleotide conjugates bound to the substrate is contacted with a second type of nanoparticles having oligonucleotides attached thereto.
  • oligonucleotides have a sequence complementary to at least a portion of the sequence (s) of the oligonucleotides attached to the first type of nanoparticles, and the contacting takes place under conditions effective to allow hybridization of the oligonucleotides on the first type of nanoparticles with those on the second type of nanoparticles.
  • the substrate is preferably washed to remove any unbound nanoparticle-oligonucleotide conjugates.
  • each of the first type of nanoparticles has multiple oligonucleotides (having the same or different sequences) attached to it, each of the first type of nanoparticle-oligonucleotide conjugates can hybridize to a plurality of the second type of nanoparticle-oligonucleotide conjugates.
  • the first type of nanoparticle-oligonucleotide conjugates may be hybridized to more than one portion of the nucleic acid to be detected.
  • the amplification provided by the multiple hybridizations may make the change detectable for the first time or may increase the magnitude of the detectable change. This amplification increases the sensitivity of the assay, allowing for detection of small amounts of nucleic acid.
  • additional layers of nanoparticles can be built up by successive additions of the first and second types of nanoparticle-oligonucleotide conjugates. In this way, the number of nanoparticles immobilized per molecule of target nucleic acid can be further increased with a corresponding increase in intensity of the signal.
  • nanoparticles bearing oligonucleotides that would serve to bind the nanoparticles together as a consequence of hybridization with binding oligoncleotides could be used.
  • Nanoparticles are attached to the substrate.
  • Nanoparticles can be attached to substrates as described in, e.g., Grabar et al., Analyt . Chem. , 67, 73-743 (1995); Bethell et al., J. Electroanal . Chem. , 409, 137 (1996); Bar et al . , Langmuir, 12, 1172 (1996); Colvin et al., J. Am. Chem. Soc , 114, 5221 (1992) .
  • oligonucleotides are attached to the nanoparticles.
  • oligonucleotides attached to the nanoparticles have a sequence complementary to a first portion of the sequence of a nucleic acid.
  • the substrate is contacted with the nucleic acid under conditions effective to allow hybridization of the oligonucleotides on the nanoparticles with the nucleic acid. In this manner the nucleic acid becomes bound to the substrate. Unbound nucleic acid is preferably washed from the substrate prior to adding further nanoparticle- oligonucleotide conjugates. Then, a second type of nanoparticles having oligonucleotides attached thereto is provided.
  • oligonucleotides have a sequence complementary to a second portion of the sequence of the nucleic acid, and the nucleic acid bound to the substrate is contacted with the second type of nanoparticle-oligonucleotide conjugates under conditions effective to allow hybridization of the oligonucleotides on the second type of nanoparticle-oligonucleotide conjugates with the nucleic acid.
  • the second type of nanoparticle-oligonucleotide conjugates becomes bound to the substrate.
  • any unbound nanoparticle-oligonucleotide conjugates and nucleic acid are washed from the substrate.
  • a change (e. g. , color change) may be detectable at this point.
  • the oligonucleotides on the second type of nanoparticles may all have the same sequence or may have different sequences that hybridize with different portions of the nucleic acid to be detected.
  • each nanoparticle may have all of the different oligonucleotides attached to it or, preferably, the different oligonucleotides may be attached to different nanoparticles. See Figure 17.
  • a binding oligonucleotide having a selected sequence having at least two portions, the first portion being complementary to at least a portion of the sequence of the oligonucleotides on the second type of nanoparticles is contacted with the second type of nanoparticle-oligonucleotide conjugates bound to the substrate under conditions effective to allow hybridization of the binding oligonucleotide to the oligonucleotides on the nanoparticles.
  • the binding oligonucleotide becomes bound to the substrate.
  • unbound binding oligonucleotides are washed from the substrate.
  • nanoparticles having oligonucleotides attached thereto have a sequence complementary to the sequence of a second portion of the binding oligonucleotide.
  • the nanoparticle-oligonucleotide conjugates are contacted with the binding oligonucleotide bound to the substrate under conditions effective to allow hybridization of the binding oligonucleotide to the oligonucleotides on the nanoparticles. After the nanoparticles are bound, unbound nanoparticle- oligonucleotide conjugates are washed from the substrate.
  • each of the second type of nanoparticles has multiple oligonucleotides (having the same or different sequences) attached to it, each of the second type of nanoparticle- oligonucleotide conjugates can hybridize to a plurality of the third type of nanoparticle-oligonucleotide conjugates (through the binding oligonucleotide) .
  • the second type of nanoparticle-oligonucleotide conjugates may be hybridized to more than one portion of the nucleic acid to be detected.
  • the amplification provided by the multiple hybridizations may make the change detectable for the first time or may increase the magnitude of the detectable change. The amplification increases the sensitivity of the assay, allowing for detection of small amounts of nucleic acid.
  • additional layers of nanoparticles can be built up by successive additions of the binding oligonucleotides and second and third types of nanoparticle-oligonucleotide conjugates.
  • the nanoparticles immobilized per molecule of target nucleic acid can be further increased with a corresponding increase in intensity of the signal.
  • binding oligonucleotide can be eliminated, and the second and third types of nanoparticle-oligonucleotide conjugates can be designed so that they hybridize directly to each other.
  • oligonucleotides are attached to a substrate.
  • Suitable substrates are those described above, and the oligonucleotides can be attached to the substrates as described above.
  • the substrate is glass, this can be accomplished by condensing the oligonucleotides through phosphoryl or carboxylic acid groups to aminoalkyl groups on the substrate surface (for related chemistry see Grabar et al., Anal . Chem. , 67, 735-743 (1995)).
  • the oligonucleotides attached to the substrate have a sequence complementary to a first portion of the sequence of the nucleic acid to be detected.
  • the nucleic acid is contacted with the substrate under conditions effective to allow hybridization of the oligonucleotides on the substrate with the nucleic acid. In this manner the nucleic acid becomes bound to the substrate. Any unbound nucleic acid is preferably washed from the substrate before adding additional components of the system.
  • the nucleic acid bound to the substrate is contacted with liposomes having oligonucleotides attached thereto.
  • the oligonucleotides have a sequence complementary to a second portion of the sequence of the nucleic acid, and the contacting takes place under conditions effective to allow hybridization of the oligonucleotides on the liposomes with the nucleic acid. In this manner the liposomes become bound to the substrate. After the liposomes are bound to the substrate, the substrate is washed to remove any unbound liposomes and nucleic acid.
  • the oligonucleotides on the liposomes may all have the same sequence or may have different sequences that hybridize with different portions of the nucleic acid to be detected.
  • each liposome may have all of the different oligonucleotides attached to it or the different oligonucleotides may be attached to different liposomes.
  • oligonucleotide-liposome conjugates To prepare oligonucleotide-liposome conjugates, the oligonucleotides are linked to a hydrophobic group, such as cholesteryl (see Letsinger et al., J. Am. Chem. Soc , 115, 7535-7536 (1993)), and the hydrophobic- oligonucleotide conjugates are mixed with a solution of liposomes to form liposomes with hydrophobic- oligonucleotide conjugates anchored in the membrane (see Zhang et al., Tetrahedron Lett . , 37, 6243-6246 (1996)).
  • cholesteryl see Letsinger et al., J. Am. Chem. Soc , 115, 7535-7536 (1993)
  • hydrophobic- oligonucleotide conjugates are mixed with a solution of liposomes to form liposomes with hydrophobic- oligonucleo
  • the loading of hydrophobic-oligonucleotide conjugates on the surface of the liposomes can be controlled by controlling the ratio of hydrophobic-oligonucleotide conjugates to liposomes in the mixture. It has been observed that liposomes bearing oligonucleotides attached by hydrophobic interaction of pendent cholesteryl groups are effective in targeting polynucleotides immobilized on a nitrocellulose membrane ( Id. ) . Fluorescein groups anchored in the membrane of the liposome were used as the reporter group. They served effectively, but sensitivity was limited by the fact that the signal from fluorescein in regions of high local concentration (e.g., on the liposome surface) is weakened by self quenching.
  • the liposomes are made by methods well known in the art. See Zhang et al.. Tetrahedron Lett. , 37, 6243 (1996) .
  • the liposomes will generally be about 5-50 times the size (diameter) of the nanoparticles used in subsequent steps. For instance, for nanoparticles about 13 nm in diameter, liposomes about 100 nm in diameter are preferably used.
  • the liposomes bound to the substrate are contacted with a first type of nanoparticles having at least a first type of oligonucleotides attached thereto.
  • the first type of oligonucleotides have a hydrophobic group attached to the end not attached to the nanoparticles, and the contacting takes place under conditions effective to allow attachment of the oligonucleotides on the nanoparticles to the liposomes as a result of hydrophobic interactions. A detectable change may be observable at this point.
  • the method may further comprise contacting the first type of nanoparticle-oligonucleotide conjugates bound to the liposomes with a second type of nanoparticles having oligonucleotides attached thereto.
  • the first type of nanoparticles have a second type of oligonucleotides attached thereto which have a sequence complementary to at least a portion of the sequence of the oligonucleotides on the second type of nanoparticles, and the oligonucleotides on the second type of nanoparticles have a sequence complementary to at least a portion of the sequence of the second type of oligonucleotides on the first type of nanoparticles.
  • the contacting takes place under conditions effective to allow hybridization of the oligonucleotides on the first and second types of nanoparticles.
  • This hybridization will generally be performed at mild temperatures (e.g., 5°C to 60°C) , so conditions (e.g., 0.3-1.0 M NaCl) conducive to hybridization at room temperature are employed.
  • mild temperatures e.g., 5°C to 60°C
  • conditions e.g., 0.3-1.0 M NaCl
  • unbound nanoparticle- oligonucleotide conjugates are washed from the substrate.
  • the combination of hybridizations produces a detectable change.
  • the detectable changes are the same as those described above, except that the multiple hybridizations result in an amplification of the detectable change.
  • each of the liposomes since each of the liposomes has multiple oligonucleotides (having the same or different sequences) attached to it, each of the liposomes can hybridize to a plurality of the first type of nanoparticle-oligonucleotide conjugates. Similarly, since each of the first type of nanoparticles has multiple oligonucleotides attached to it, each of the first type of nanoparticle-oligonucleotide conjugates can hybridize to a plurality of the second type of nanoparticle-oligonucleotide conjugates. Also, the liposomes may be hybridized to more than one portion of the nucleic acid to be detected. The amplification provided by the multiple hybridizations may make the change detectable for the first time or may increase the magnitude of the detectable change. This amplification increases the sensitivity of the assay, allowing for detection of small amounts of nucleic acid.
  • additional layers of nanoparticles can be built up by successive additions of the first and second types of nanoparticle-oligonucleotide conjugates.
  • the number of nanoparticles immobilized per molecule of target nucleic acid can be further increased with a corresponding increase in the intensity of the signal.
  • Further enhancement can also be obtained by employing silver staining of gold nanoparticles (Bassell, et al., J. Cell Biol . , 126, 863-876 (1994); Braun-Howland et al., Biotechniques, 13, 928-931 (1992)).
  • nanoparticles bearing oligonucleotides that would serve to bring the nanoparticles together as a consequence of hybridization with binding oligonucleotides could be used.
  • the hybridization of the first type of nanoparticle-oligonucleotide conjugates to the liposomes may produce a detectable change. In the case of gold nanoparticles, a pink/red color may be observed or a purple/blue color may be observed if the nanoparticles are close enough together.
  • the hybridization of the second type of nanoparticle- oligonucleotide conjugates to the first type of nanoparticle-oligonucleotide conjugates will produce a detectable change. In the case of gold nanoparticles, a purple/blue color will be observed. All of these color changes may be observed with the naked eye.
  • a substrate When a substrate is employed, a plurality of the initial types of nanoparticle-oligonucleotide conjugates or oligonucleotides can be attached to the substrate in an array for detecting multiple portions of a target nucleic acid, for detecting multiple different nucleic acids, or both.
  • a substrate may be provided with rows of spots, each spot containing a different type of oligonucleotide or oligonucleotide- nanoparticle conjugate designed to bind to a portion of a target nucleic acid.
  • a sample containing one or more nucleic acids is applied to each spot, and the rest of the assay is performed in one of the ways described above using appropriate oligonucleotide-nanoparticle conjugates, oligonucleotide-liposome conjugates and binding oligonucleotides.
  • a nanoparticle-oligonucleotide conjugate which may be used in an assay for any nucleic acid is illustrated in Figure 17, parts IV and V.
  • This "universal probe" has oligonucleotides of a single sequence attached to it. These oligonucleotides can hybridize with a binding oligonucleotide which has a sequence comprising at least two portions. The first portion is complementary to at least a portion of the sequence of the oligonucleotides on the nanoparticles. The second portion is complementary to a portion of the sequence of the nucleic acid to be detected.
  • a plurality of binding oligonucleotides having the same first portion and different second portions can be used, in which case the "universal probe", after hybridization to the binding oligonucleotides, can bind to multiple portions of the nucleic acid to be detected or to different nucleic acid targets .
  • oligonucleotides attached to metal and semiconductor nanoparticles can have a fluorescent molecule attached to the end not attached to the nanoparticles.
  • Metal and semiconductor nanoparticles are known fluorescence quenchers, with the magnitude of the quenching effect depending on the distance between the nanoparticles and the fluorescent molecule.
  • the oligonucleotides attached to the nanoparticles interact with the nanoparticles, so that significant quenching will be observed. See Figure 20A.
  • the fluorescent molecule Upon hybridization to a target nucleic acid, the fluorescent molecule will become spaced away from the nanoparticles, diminishing quenching of the fluorescence. See Figure 20A.
  • oligonucleotides should give rise to larger changes in fluorescence, at least until the fluorescent groups are moved far enough away from the nanoparticle surfaces so that an increase in the change is no longer observed.
  • Useful lengths of the oligonucleotides can be determined empirically.
  • Metallic and semiconductor nanoparticles having fluorescent- labeled oligonucleotides attached thereto can be used in any of the assay formats described above, including those performed in solution or on substrates.
  • oligonucleotides Methods of labeling oligonucleotides with fluorescent molecules and measuring fluorescence are well known in the art. Suitable fluorescent molecules are also well known in the art and include the fluoresceins, rhodamines and Texas Red. The oligonucleotides will be attached to the nanoparticles as described above.
  • Suitable particles include polymeric particles, such as polystyrene particles, polyvinyl particles, acrylate and methacrylate particles, glass particles, latex particles, Sepharose beads and others like particles well known in the art. Methods of attaching oligonucleotides to such particles are well known in the art.
  • a wide variety of functional groups are availble on the particles or can be incorporated into such particles. Functional groups include carboxylic acids, aldehydes, amino groups, cyano groups, ethylene groups, hydroxyl groups, mercapto groups, and the like. Nanoparticles, including metallic and semiconductor nanoparticles can also be used.
  • the two fluorophores are designated d and a for donor and acceptor.
  • a variety of fluorescent molecules useful in such combinations are well known in the art and are available from, e.g., Molecular Probes.
  • An attractive combination is fluorescein as the donor and Texas Red as acceptor.
  • the two types of nanoparticle- oligonucleotide conjugates with d and a attached are mixed with the target nucleic acid, and fluorescence measured in a fluorimeter. The mixture will be excited with light of the wavelength that excites d, and the mixture will be monitored for fluorescence from a. Upon hybridization, d and a will be brought in proximity (see Figure 20B) .
  • hybridization will be shown by a shift in fluorescence from that for d to that for a or by the appearance of fluorescence for a in addition to that for d.
  • the flurophores will be too far apart for energy transfer to be significant, and only the fluorescence of d will be observed.
  • hybridization In the case of metallic and semiconductor nanoparticles, lack of hybridization will be shown by a lack of fluorescence due to d or a because of quenching (see above) . Hybridization will be shown by an increase in fluorescence due to a.
  • the above described particles and nanoparticles having oligonucleotides labeled with acceptor and donor fluorescent molecules attached can be used in the assay formats described above, including those performed in solution and on substrates.
  • the oligonucleotide sequences are preferably chosen so that they bind to the target nucleic acid as illustrated in Figure 15.
  • the binding oligonucleotides may be used to bring the acceptor and donor fluorescent molecules on the two nanoparticles in proximity.
  • the oligonucleotides attached the substrate may be labeled with d.
  • other labels besides fluorescent molecules can be used, such as chemiluminescent molecules, which will give a detectable signal or a change in detectable signal upon hybridization.
  • kits for detecting nucleic acids comprising at least one container, the container holding at least two types of nanoparticles having oligonucleotides attached thereto.
  • the oligonucleotides on the first type of nanoparticles have a sequence complementary to the sequence of a first portion of a nucleic acid.
  • the oligonucleotides on the second type of nanoparticles have a sequence complementary to the sequence of a second portion of the nucleic acid.
  • the container may further comprise filler oligonucleotides having a sequence complementary to a third portion of the nucleic acid, the third portion being located between the first and second portions.
  • the filler oligonucleotide may also be provided in a separate container.
  • the kit comprises at least two containers.
  • the first container holds nanoparticles having oligonucleotides attached thereto which have a sequence complementary to the sequence of a first portion of a nucleic acid.
  • the second container holds nanoparticles having oligonucleotides attached thereto which have a sequence complementary to the sequence of a second portion of the nucleic acid.
  • the kit may further comprise a third container holding a filler oligonucleotide having a sequence complementary to a third portion of the nucleic acid, the third portion being located between the first and second portions.
  • kits can have the oligonucleotides and nanoparticles in separate containers, and the oligonucleotides would have to be attached to the nanoparticles prior to performing an assay to detect a nucleic acid.
  • the oligonucleotides and/or the nanoparticles may be functionalized so that the oligonucleotides can be attached to the nanoparticles.
  • the oligonucleotides and/or nanoparticles may be provided in the kit without functional groups, in which case they must be functionalized prior to performing the assay.
  • the kit comprises at least one container.
  • the container holds metallic or semiconductor nanoparticles having oligonucleotides attached thereto.
  • the oligonucleotides have a sequence complementary to a portion of a nucleic acid and have fluorescent molecules attached to the ends of the oligonucleotides not attached to the nanoparticles.
  • the kit comprises a substrate, the substrate having attached thereto nanoparticles.
  • the nanoparticles have oligonucleotides attached thereto which have a sequence complementary to the sequence of a first portion of a nucleic acid.
  • the kit also includes a first container holding nanoparticles having oligonucleotides attached thereto which have a sequence complementary to the sequence of a second portion of the nucleic acid.
  • the oligonucleotides may have the same or different sequences, but each of the oligonucleotides has a sequence complementary to a portion of the nucleic acid.
  • the kit further includes a second container holding a binding oligonucleotide having a selected sequence having at least two portions, the first portion being complementary to at least a portion of the sequence of the oligonucleotides on the nanoparticles in the first container.
  • the kit also includes a third container holding nanoparticles having oligonucleotides attached thereto, the oligonucleotides having a sequence complementary to the sequence of a second portion of the binding oligonucleotide.
  • the kit comprises a substrate having oligonucleotides attached thereto which have a sequence complementary to the sequence of a first portion of a nucleic acid.
  • the kit also includes a first container holding nanoparticles having oligonucleotides attached thereto which have a sequence complementary to the sequence of a second portion of the nucleic acid.
  • the oligonucleotides may have the same or different sequences, but each of the oligonucleotides has a sequence complementary to a portion of the nucleic acid.
  • the kit further includes a second container holding nanoparticles having oligonucleotides attached thereto which have a sequence complementary to at least a portion of the oligonucleotides attached to the nanoparticles in the first container.
  • kits can have the substrate, oligonucleotides and nanoparticles in separate containers.
  • the substrate, oligonucleotides, and nanoparticles would have to be appropriately attached to each other prior to performing an assay to detect a nucleic acid.
  • the substrate, oligonucleotides and/or the nanoparticles may be functionalized to expedite this attachment.
  • the substrate, oligonucleotides and/or nanoparticles may be provided in the kit without functional groups, in which case they must be functionalized prior to performing the assay.
  • the kit comprises a substrate having oligonucleotides attached thereto which have a sequence complementary to the sequence of a first portion of a nucleic acid.
  • the kit also includes a first container holding liposomes having oligonucleotides attached thereto which have a sequence complementary to the sequence of a second portion of the nucleic acid and a second container holding nanoparticles having at least a first type of oligonucleotides attached thereto, the first type of oligonucleotides having a cholesteryl group attached to the end not attached to the nanoparticles so that the nanoparticles can attach to the liposomes by hydrophobic interactions.
  • the kit may further comprise a third container holding a second type of nanoparticles having oligonucleotides attached thereto, the oligonucleotides having a sequence complementary to at least a portion of the sequence of a second type of oligonucleotides attached to the first type of nanoparticles.
  • the second type of oligonucleotides attached to the first type of nanoparticles have a sequence complementary to the sequence of the oligonucleotides on the second type of nanoparticles.
  • the kit may comprise a first container holding nanoparticles having oligonucleotides attached thereto.
  • the kit also includes one or more additional containers, each container holding a binding oligonucleotide.
  • Each binding oligonucleotide has a first portion which has a sequence complementary to at least a portion of the sequence of oligonucleotides on the nanoparticles and a second portion which has a sequence complementary to the sequence of a portion of a nucleic acid to be detected.
  • the sequences of the second portions of the binding oligonucleotides may be different as long as each sequence is complementary to a portion of the sequence of the nucleic acid to be detected.
  • the kit comprises a container holding one type of nanoparticles having oligonucleotides attached thereto and one or more types of binding oligonucleotides.
  • Each of the types of binding oligonucleotides has a sequence comprising at least two portions.
  • the first portion is complementary to the sequence of the oligonucleotides on the nanoparticles, whereby the binding oligonucleotides are hybridized to the oligonucleotides on the nanoparticles in the container (s) .
  • the second portion is complementary to the sequence of a portion of the nucleic acid.
  • kits may comprise one or two containers holding two types of particles.
  • the first type of particles having oligonucleotides attached thereto which have a sequence complementary to the sequence of a first portion of a nucleic acid.
  • the oligonucleotides are labeled with an energy donor on the ends not attached to the particles.
  • the second type of particles having oligonucleotides attached thereto which have a sequence complementary to the sequence of a second portion of a nucleic acid.
  • the oligonucleotides are labeled with an energy acceptor on the ends not attached to the particles.
  • the energy donors and acceptors may be fluorescent molecules.
  • the kits may also contain other reagents and items useful for detecting nucleic acid.
  • the reagents may include PCR reagents, hybridization reagents, buffers, etc.
  • Other items which may be provided as part of the kit include a solid surface (for visualizing hybridization) such as a TLC silica plate, syringes, pipettes, cuvettes, containers, and a thermocycler (for controlling hybridization and de-hybridization temperatures) .
  • Reagents for functionalizing the nucleotides or nanoparticles may also be included in the kit.
  • the precipitation of aggregated nanoparticles provides a means of separating a selected nucleic acid from other nucleic acids. This separation may be used as a step in the purification of the nucleic acid.
  • Hybridization conditions are those described above for detecting a nucleic acid. If the temperature is below the Tm (the temperature at which one-half of an oligonuceotide is bound to its complementary strand) for the binding of the oligonucleotides on the nanoparticles to the nucleic acid, then sufficient time is needed for the aggregate to settle.
  • the temperature of hybridization e. g. , as measured by Tm
  • the temperature of hybridization e. g. , as measured by Tm
  • Salt compositions and concentrations are selected to promote hybridization of the oligonucleotides on the nanoparticles to the nucleic acid at convenient working temperatures without inducing aggregation of the colloids in the absence of the nucleic acid.
  • the invention also provides a method of nanofabrication.
  • the method comprises providing at least one type of linking oligonucleotide having a selected sequence.
  • a linking oligonucleotide used for nanofabrication may have any desired sequence and may be single-stranded or double-stranded. It may also contain chemical modifications in the base, sugar, or backbone sections.
  • the sequences chosen for the linking oligonucleotides and their lengths and strandedness will contribute to the rigidity or flexibility of the resulting nanomaterial or nanostructure, or a portion of the nanomaterial or nanostructure.
  • the use of a single type of linking oligonucleotide, as well as mixtures of two or more different types of linking oligonucleotides, is contemplated.
  • the number of different linking oligonucleotides used and their lengths will contribute to the shapes, pore sizes and other structural features of the resulting nanomaterials and nanostructures.
  • the sequence of a linking oligonucleotide will have at least a first portion and a second portion for binding to oligonucleotides on nanoparticles.
  • the first, second or more binding portions of the linking oligonucleotide may have the same or different sequences.
  • binding portions of a linking oligonucleotide have the same sequence, only a single type of nanoparticle with oligonucleotides having a complementary sequence attached thereto need be used to form a nanomaterial or nanostructure. If the two or more binding portions of a linking oligonucleotide have different sequences, then two or more nanoparticle- oligonucleotide conjugates must be used. See, e. g. , Figure 17.
  • the oligonucleotides on each of the nanoparticles will have a sequence complementary to one of the two or more binding portions of the sequence of the linking oligonucleotide
  • the number, sequence (s) and length (s) of the binding portions and the distance (s), if any, between them will contribute to the structural and physical properties of the resulting nanomaterials and nanostructures.
  • the linking oligonucleotide comprises two or more portions
  • the sequences of the binding portions must be chosen so that they are not complementary to each other to avoid having one portion of the linking nucleotide bind to another portion.
  • the linking oligonucleotides and nanoparticle- oligonucleotide conjugates are contacted under conditions effective for hybridization of the oligonucleotides attached to the nanoparticles with the linking oligonucleotides so that a desired nanomaterial or nanostructure is formed wherein the nanoparticles are held together by oligonucleotide connectors.
  • hybridization conditions are well known in the art and can be optimized for a particular nanofabrication scheme (see above) . Stringent hybridization conditions are preferred.
  • the invention also provides another method of nanofabrication. This method comprises providing at least two types of nanoparticle-oligonucleotide conjugates.
  • the oligonucleotides on the first type of nanoparticles have a sequence complementary to that of the oligonucleotides on the second type of nanoparticles.
  • the oligonucleotides on the second type of nanoparticles have a sequence complementary to that of the oligonucleotides on the first type of nanoparticles.
  • the nanoparticle-oligonucleotide conjugates are contacted under conditions effective to allow hybridization of the oligonucleotides on the nanoparticles to each other so that a desired nanomaterial or nanostructure is formed wherein the nanoparticles are held together by oligonucleotide connectors. Again, these hybridization conditions are well-known in the art and can be optimized for a particular nanofabrication scheme.
  • nanoparticles having one or more different types of oligonucleotides attached thereto are contemplated.
  • the number of different oligonucleotides attached to a nanoparticle and the lengths and sequences of the one or more oligonucleotides will contribute to the rigidity and structural features of the resulting nanomaterials and nanostructures.
  • the size, shape and chemical composition of the nanoparticles will contribute to the properties of the resulting nanomaterials and nanostructures. These properties include optical properties, optoelectronic properties, stability in various solutions, pore and channel size variation, ability to separate bioactive molecules while acting as a filter, etc.
  • the use of mixtures of nanoparticles having different sizes, shapes and/or chemical compositions, as well as the use of nanoparticles having uniform sizes, shapes and chemical composition are contemplated.
  • the nanoparticles in the resulting nanomaterial or nanostructure are held together by oligonucleotide connectors.
  • the sequences, lengths, and strandedness of the oligonucleotide connectors, and the number of different oligonucleotide connectors present will contribute to the rigidty and structural properties of the nanomaterial or nanostructure. If an oligonucleotide connector is partially double-stranded, its rigidity can be increased by the use of a filler oligonucleotide as described above in connection with the method of detecting nucleic acid.
  • the rigidity of a completely double-stranded oligonucleotide connector can be increased by the use of one or more reinforcing oligonucleotides having complementary sequences so that they bind to the double- stranded oligonucleotide connector to form triple- stranded oligonucleotide connectors.
  • the use of quadruple-stranded oligonucleotide connectors based on deoxyquanosine or deoxycytidine quartets is also contemplated.
  • An attractive system for spacing nanoparticles involves the addition of one free linking oligonucleotide as illustrated in Figure 2.
  • the sequence of the linking oligonucleotide will have at least a first portion and a second portion for binding to oligonucleotides on nanoparticles.
  • This system is basically the same as utilized in the nucleic acid detection method, except that the length of the added linking oligonucleotide can be selected to be equal to the combined lengths of oligonucleotides attached to the nanoparticles.
  • the related system illustrated in Figure 3 provides a convenient means to tailor the distance between nanoparticles without having to change the sets of nanoparticle-oligonucleotide conjugates employed.
  • FIG. 4 A further elaboration of the scheme for creating defined spaces between nanoparticles is illustrated in Figure 4.
  • a double stranded segment of DNA or RNA containing overhanging ends is employed as the linking oligonucleotide.
  • Hybridization of the single- stranded, overhanging segments of the linking oligonucleotide with the oligonucleotides attached to the nanoparticles affords multiple double-stranded oligonucleotide cross-links between the nanoparticles.
  • Stiffer nanomaterials and nanostructures, or portions thereof, can be generated by employing triple- stranded oligonucleotide connectors between nanoparticles.
  • the triple strand In forming the triple strand, one may exploit either the pyrimidine:purine:pyrimidine motif (Moser, H.E. and Dervan, P.B. Science, 238, 645-650 (1987) or the purine:purine:pyrimidine motif (Pilch, D.S. et al. Biochemistry, 30, 6081-6087 (1991).
  • An example of the organization of nanoparticles by generating triple- stranded connectors by the pyrimidine:purine:pyrimidine motif are illustrated in Figure 10. In the system shown in Figure 10, one set of nanoparticles is conjugated with a defined strand containing pyrimidine nucleosides and the other set is conjugated with a complementary oligonucleotide containing purine nucleosides.
  • Attachment of the oligonucleotides is designed such that the nanoparticles are separated by the double-stranded oligonucleotide formed on hybridization. Then, a free pyrimidine oligonucleotide with an orientation opposite that for the pyrimidine strand linked to the nanoparticle is added to the system prior to, simultaneously with, or just subsequent to mixing the nanoparticles. Since the third strand in this system is held by Hoogsteen base pairing, the triple strand is relatively unstable thermally. Covalent bridges spanning the breadth of the duplex are known to stabilize triple-stranded complexes (Salunke, M., Wu, T., Letsinger, R.L., J. Am, Chem.
  • thiophosphoryl oligonucleotides do not react with gold nanoparticles under the conditions employed in attaching mercaptoalkyl-oligonucleotides to gold nanoparticles enables one to prepare gold nanoparticle-oligonucleotide conjugates anchored through the mercapto group to the nanoparticles and containing a terminal thiophosphoryl group free for the coupling reaction.
  • a related coupling reaction to lock the assembled nanoparticle system in place utilizes displacement of bromide from a terminal bromoacetylaminonucleoside by a terminal thiophosphoryl-oligonucleotide as described in Gryaznov and Letsinger, J. Am. Chem. Soc , 115, 3808. This reaction proceeds much like the displacement of tosylate described above, except that the reaction is faster. Nanoparticles bearing oligonucleotides terminated with thiophosphoryl groups are prepared as described above.
  • oligonucleotide terminated at one end by an aminonucleoside e. g. , either 5'-amino- 5' -deoxythymidine or 3'-amino-3' -deoxythymidine
  • aminonucleoside e. g. , either 5'-amino- 5' -deoxythymidine or 3'-amino-3' -deoxythymidine
  • Molecules of this oligoncleotide are then anchored to the nanoparticles through the mercapto groups, and the nanoparticle-oligonucleotide conjugate is then converted the N-bromoacetylamino derivative by reaction with a bromoacetyl acylating agent.
  • a fourth coupling scheme to lock the assemblies in place utilizes oxidation of nanoparticles bearing oligonucleotides terminated by thiophosphoryl groups.
  • Mild oxidizing agents such as potassium triiodide, potassium ferricyanide (see Gryaznov and Letsinger, Nucleic Acids Research, 21, 1403) or oxygen, are preferred.
  • the properties of the nanomaterials and nanostructures can be altered by incorporating into the interconnecting oligonucleotide chains organic and inorganic functions that are held in place by covalent attachment to the oligonucleotide chains.
  • organic and inorganic functions that are held in place by covalent attachment to the oligonucleotide chains.
  • backbone, base and sugar modifications are well known (see for example Uhlmann, E., and Peyman, A. Chemical
  • oligonucleotide chains could be replaced by "Peptide Nucleic Acid” chains (PNA) , in which the nucleotide bases are held by a polypeptide backbone (see Wittung, P. et al . , Nature, 368, 561-563 (1994).
  • PNA Peptide Nucleic Acid
  • the nanofabrication method of the invention is extremely versatile.
  • the nanomaterials and nanostructures that can be made by the nanofabrication method of the invention include nanoscale mechanical devices, separation membranes, bio-filters, and biochips. It is contemplated that the nanomaterials and nanostructures of the invention can be used as chemical sensors, in computers, for drug delivery, for protein engineering, and as templates for biosynthesis/nanostructure fabrication/directed assembly of other structures. See generally Seeman et al.. New J. Chem. , 17, 739 (1993) for other possible applications. It is to be noted that the term “a” or “an” entity refers to one or more of that entity. For example, "a characteristic” refers to one or more characteristics or at least one characteristic. As such, the terms “a” (or “an”), “one or more” and “at least one” are used interchangeably herein. It is also to be noted that the terms “comprising”, “including”, and “having” have been used interchangeably.
  • Gold colloids (13 nm diameter) were prepared by reduction of HAuCl 4 with citrate as described in Frens, Nature Phys. Sci . , 241, 20 (1973) and Grabar, Anal . Chem. , 67, 735 (1995). Briefly, all glassware was cleaned in aqua regia (3 parts HC1, 1 part H ⁇ 0 3 ) , rinsed with Nanopure H 2 0, then oven dried prior to use. HAuCl ⁇ and sodium citrate were purchased from Aldrich Chemical Company. Aqueous HAuCl 4 (1 mM, 500 mL) was brought to reflux while stirring. Then, 38.8 mM sodium citrate (50 L) was added quickly.
  • Au colloids were characterized by UV-vis spectroscopy using a Hewlett Packard 8452A diode array spectrophotometer and by Transmission Electron Microscopy (TEM) using a Hitachi 8100 transmission electron microscope. Gold particles with diameters of 13 nm will produce a visible color change when aggregated with target and probe oligonucleotide sequences in the 10-35 nucleotide range.
  • Thiol-Modifier C3 S-S CPG support was purchased from Glen Research and used in the automated synthesizer. During normal cleavage from the solid support (16 hr at 55 ⁇ C) , 0.05 M dithiothreitol (DTT) was added to the NH 4 OH solution to reduce the 3' disulfide to the thiol. Before purification by reverse phase high pressure liquid chromatography (HPLC) , excess DTT was removed by extraction with ethyl acetate.
  • DTT dithiothreitol
  • 5 '-Thiol-Modifier C 6 - phosphoramidite reagent was purchased from Glen Research, 44901 Falcon Place, Sterling, Va 20166. The oligonucleotides were synthesized, and the final DMT protecting group removed. Then, 1 ml of dry acetonitrile was added to 100 ⁇ mole of the 5' Thiol Modifier C 6 - phosphora idite.
  • I 2 /H 2 0/pyridine mixture (oxidizer solution) was introduced into the column, and was then pumped back and forth through the column with two syringes for 30 second.
  • the support was then washed with a 1:1 mixture of CH 3 CN/pyridine (2 x 1 mL) for 1 minute, followed by a final wash with dry acetonitrile (2 x 1 mL) with subsequent drying of the column with a stream of nitrogen.
  • the trityl protecting group was not removed, which aids in purification.
  • Reverse phase HPLC was performed with a Dionex DX500 system equipped with a Hewlett Packard ODS hypersil column (4.6 x 200 mm, 5 mm particle size) using 0.03 M Et 3 NH + OAc- buffer (TEAA) , pH 1 , with a 1%/min. gradient of 95% CH 3 CN/5% TEAA. The flow rate was 1 mL/ min. with UV detection at 260 nm. Preparative HPLC was used to purify the DMT-protected unmodified oligonucleotides (elution at 27 in) .
  • TEAA Et 3 NH + OAc- buffer
  • the DMT was cleaved from the oligonucleotides by treatment with 80% acetic acid for 30 min at room temperature. The solution was then evaporated to near dryness, water was added, and the cleaved DMT was extracted from the aqueous oligonucleotide solution using ethyl acetate. The amount of oligonucleotide was determined by absorbance at 260 n , and final purity assessed by reverse phase HPLC (elution time 14.5 minutes) .
  • the same protocol was used for purification of the 3'-thiol-oligonucleotides, except that DTT was added after extraction of DMT to reduce the amount of disulfide formed. After six hours at 40°C, the DTT was extracted using ethyl acetate, and the oligonucleotides repurified by HPLC (elution time 15 minutes) .
  • the oligonucleotide solution ( ⁇ 50 OD) was then transferred onto a desalting NAP-5 column (Pharmacia Biotech, Uppsala, Sweden) for purification (contains DNA Grade Sephadex G-25 Medium for desalting and buffer exchange of oligonucleotides greater than 10 bases) .
  • the amount of 5' thiol modified oligonucleotide was determined by UV- vis spectroscopy by measuring the magnitude of the absorbance at 260 nm.
  • oligonucleotide-modified nanoparticles are stable at elevated temperatures (80°C) and high salt concentrations (1M NaCl) for days and have not been observed to undergo particle growth. Stability in high salt concentrations is important, since such conditions are required for the hybridization reactions that form the basis of the methods of detection and nanofabrication of the invention.
  • Example 2 Formation Of Nanoparticle Aggregates
  • non-thiolated oligonucleotides having sequences complementary to the sticky ends of the linking oligonucleotide and reacted with nanoparticles did not produce reversible aggregation when the nanoparticles were combined with the linking oligonucleotide.
  • the method of attaching thiol-oligonucleotides to gold nanoparticles described in Example 1 was found not to produce satisfactory results in some cases.
  • the oligonucleotide-colloid conjugates were not stable in the presence of a large excess of high molecular weight salmon sperm DNA used as model for the background DNA that would normally be present in a diagnostic system.
  • Longer exposure of the colloids to the thiol- oligonucleotides produced oligonucleotide-colloid conjugates that were stable to salmon sperm DNA, but the resulting conjugates failed to hybridize satisfactorily.
  • Further experimentation led to the following procedure for attaching thiol-oligonucleotides of any length to gold colloids so that the conjugates are stable to high molecular weight DNA and hybridize satisfactorily.
  • a 1 mL solution of the gold colloids (17nM) in water was mixed with excess (3.68 ⁇ M) thiol-oligonucleotide (28 bases in length) in water, and the mixture was allowed to stand for 12-24 hours at room temperature. Then, 100 ⁇ L of a 0.1 M sodium hydrogen phosphate buffer, pH 7.0, and 100 ⁇ L of 1.0 M NaCl were premixed and added. After 10 minutes, 10 ⁇ L of 1% aqueous NaN 3 were added, and the mixture was allowed to stand for an additional 40 hours. This "aging" step was designed to increase the surface coverage by the thiol-oligonucleotides and to displace oligonucleotide bases from the gold surface.
  • the supernatant was removed, and the residue was resuspended in about 200 ⁇ L of buffer (10 mM phosphate, 0.1 M NaCl) and recentrifuged. After removal of the supernatant solution, the residue was taken up in 1.0 mL of buffer (10 mM phosphate, 0.1 M NaCl) and 10 ⁇ L of a 1% aqueous solution of NaN 3 . Dissolution was assisted by drawing the solution into, and expelling it from, a pipette several times.
  • the resulting red master solution was stable (i.e., remained red and did not aggregate) on standing for months at room temperature, on spotting on silica thin-layer chromatography (TLC) plates (see Example 4), and on addition to 2 M NaCl, 10 mM MgCl 2 , or solutions containing high concentrations of salmon sperm DNA.
  • the oligonucleotide-gold colloid conjugates I and II illustrated in Figure 11 were prepared as described in Example 3. The hybridization of these two conjugates was extremely slow. In particular, mixing samples of conjugates I and II in aqueous 0.1 M NaCl or in 10 mM MgCl 2 plus 0.1 M NaCl and allowing the mixture to stand at room temperature for a day produced little or no color change . Two ways were found to improve hybridization. First, faster results were obtained by freezing the mixture of conjugates I and II (each 15 nM contained in a solution of 0.1 M NaCl) in a dry ice-isopropyl alcohol bath for 5 minutes and then thawing the mixture at room temperature.
  • the thawed solution exhibited a bluish color.
  • a standard C-18 TLC silica plate Alltech Associates
  • a strong blue color was seen immediately.
  • the hybridization and consequent color change caused by the freeze-thawing procedure were reversible.
  • the solution On heating the hybridized solution to 80°C, the solution turned red and produced a pink spot on a TLC plate.
  • Subsequent freezing and thawing returned the system to the (blue) hybridized state (both solution and spot on a C-18 TLC plate) .
  • the spot obtained on the C-18 TLC plate was pink.
  • oligonucleotide-gold colloid conjugates 1 and 2 illustrated in Figure 12 were prepared as described in Example 3, and the oligonucleotide target 3 illustrated in Figure 12 was prepared as described in Example 2.
  • oligonucleotides were synthesized on a 40 nmol scale and purified on an reverse phase C18 cartridge (OPC) . Their purity was determined by performing ion exchange HPLC.
  • hybridization was achieved by heating rapidly and then cooling rapidly to the stringent temperature. For example, hybridization was carried out in 100 ⁇ L of 0.1 M NaCl plus 5 mM MgCl 2 containing 15 nM of each oligonucleotide-colloid conjugate 1 and 2, and 3 nanomoles of target oligonucleotide 3, 4, 5, 6, or 7, heating to 74°C, cooling to the temperatures indicated in Table 1 below, and incubating the mixture at this temperature for 10 minutes. A 3 ⁇ L sample of each reaction mixture was then spotted on a C-18 TLC silica plate. On drying (5 minutes), a strong blue color appeared if hybridization had taken place. The results are presented in Table 1 below. Pink spots signify a negative test (i .
  • Hybridization at 50°C yielded blue spots with both targets 3 and 6.
  • Hybridization at 45°C gave blue spots with targets 3, 5 and 6.
  • a target containing a single mismatch T nucleotide was found to give a positive test at 58°C (blue color) and a negative test (red color) at 64°C with conjugates 1 and 2.
  • the fully-matched target (3) gave a positive test at both temperatures, showing that the test can discriminate between a target that is fully matched and one containing a single mismatched base.
  • hybridization was carried out in 100 ⁇ L of 0.1 M NaCl containing 15 nM of each oligonucleotide-colloid conjugate 1 and 2, and 10 picomoles of target oligonucleotide 3, 4, 5, 6, or 7, freezing in a dry ice- isopropyl alcohol bath for 5 minutes, thawing at room temperature, then warming rapidly to the temperatures indicated in Table 2 below, and incubating the mixture at this temperature for 10 minutes. A 3 ⁇ L sample of each reaction mixture was then spotted on a C-18 TLC silica plate. The results are presented in Table 2.
  • the high degree of discrimination may be attributed to two features.
  • the first is the alignment of two relatively short probe oligonucleotide segments (15 nucleotides) on the target is required for a positive signal. A mismatch in either segment is more destabilizing than a mismatch in a longer probe (e.g., an oligonucleotide 30 bases long) in a comparable two- component detection system.
  • the signal at 260 nm, obtained on hybridization of the target oligonucleotides with the nanoparticle conjugates in solution is nanoparticle-based, not DNA-based. It depends on dissociation of an assembly of nanoparticles organized in a polymeric network by multiple oligonucleotide duplexes.
  • a master solution containing 1 nmol of target 3 was prepared in 100 ⁇ l of hybridization buffer (0.3 M NaCl, 10 mM phosphate, pH 7) .
  • One ⁇ l of this solution corresponds to 10 picomole of target oligonucleotide.
  • Serial dilutions were performed by taking an aliquot of the master solution and diluting it to the desired concentration with hybridization buffer.
  • Table 3 shows the sensitivity obtained using 3 ⁇ l of a mixutre of probes 1 and 2 with different amounts of target 3. After performing the hybridization using freeze-thaw conditions, 3 ⁇ l aliquots of these solutions were spotted onto C-18 TLC plates to determine color. In Table 3 below, pink signifies a negative test, and blue signifies a positive test.
  • DNA modified nanoparticles were adsorbed onto modified transparent substrates as shown in Figure 13B, panels 1-6. This method involved the linking of DNA modified nanoparticles to nanoparticles that were attached to a glass substrate, using DNA hybridization interactions.
  • Nanoparticles were adsorbed onto the thiol terminated surface of the slides by soaking in solutions containing the 13 nm diameter gold nanoparticles (preparation described in Example 1) . After 12 hours in the colloidal solutions, the slides were removed and rinsed with water. The resulting slides have a pink appearance due to the adsorbed nanoparticles and exhibit similar UV-vis absorbance profiles (surface plasmon absorbance peak at 520 nm) as the aqueous gold nanoparticle colloidal solutions. See Figure 14A.
  • DNA was attached to the nanoparticle modified surface by soaking the glass slides in 0.2 OD (1.7 ⁇ M) solution containing freshly purified 3' thiol oligonucleotide (3' thiol ATGCTCAACTCT [SEQ ID NO:33]) (synthesized as described in Examples 1 and 3) . After 12 hours of soaking time, the slides were removed and rinsed with water. To demonstrate the ability of an analyte DNA strand to bind nanoparticles to the modified substrate, a linking oligonucleotide was prepared.
  • the linking oligonucleotide (prepared as described in Example 2) was 24 bp long (5' TACGAGTTGAGAATCCTGAATGCG [SEQ ID NO: 34]) with a sequence containing a 12 bp end that was complementary to the DNA already adsorbed onto the substrate surface (SEQ ID NO: 33).
  • the substrate was then soaked in a hybridization buffer (0.5 M NaCl, 10 mM phosphate buffer pH 7) solution containing the linking oligonucleotide (0.4 OD, 1.7 ⁇ M) for 12 hours.
  • the substrate was soaked in a solution containing 13 nm diameter gold nanoparticles which had been modified with an oligonucleotide (TAGGACTTACGC 5' thiol [SEQ ID NO: 35]) (prepared as described in Example 3) that is complementary to the unhybridized portion of the linking oligonucleotide attached to the substrate.
  • an oligonucleotide (TAGGACTTACGC 5' thiol [SEQ ID NO: 35]) (prepared as described in Example 3) that is complementary to the unhybridized portion of the linking oligonucleotide attached to the substrate.
  • the substrate was removed and rinsed with the hybridization buffer.
  • the substrate color had darkened to a purple color and the UV-vis absorbance at 520 nm approximately doubled ( Figure 14A) .
  • a melting curve was performed.
  • the substrate was placed in a cuvette containing 1 mL of hybridization buffer and the same apparatus used in Example 2, part B, was used.
  • the absorbance signal due to the nanoparticles (520 nm) was monitored as the temperature of the substrate was increased at a rate of 0.5°C per minute.
  • the nanoparticle signal dramatically dropped when the temperature passed 60°C. See Figure 14B.
  • a first derivative of the signal showed a melting temperature of 62°C, which corresponds with the temperature seen for the three DNA sequences hybridized in solution without nanoparticles. See Figure 14B.
  • the detection system illustrated in Figure 15 was designed so that the two probes 1 and 2 align in a tail- to-tail fashion onto a complementary target 4 (see Figure 15) . This differs from the system described in Example 5 where the two probes align contiguously on the target strand (see Figure 12) .
  • the oligonucleotide-gold nanoparticle conjugates 1 and 2 illustrated in Figure 15 were prepared as described in Example 3, except that the nanoparticles were redispersed in hybridization buffer (0.3 M NaCl, 10 mM phosphate, pH 7) .
  • the final nanoparticle-oligonucleotide conjugate concentration was estimated to be 13 nM by measuring the reduction in intensity of the surface plasmon band at 522 nm which gives rise to the red color of the nanoparticles.
  • the oligonucleotide targets illustrated in Figure 15 were purchased from the Northwestern University Biotechnology Facility, Evanston, IL.
  • the T m for the aggregate formed from the perfect complement 4 of probes 1 and 2 was compared with the T m 's for aggregates formed from targets that contained one base mismatches, deletions, or insertions ( Figure 15) .
  • All of the gold nanoparticle- oligonucleotide aggregates that contained imperfect targets exhibited significant, measurable destabilization when compared to the aggregates formed from the perfect complement, as evidenced by T m values for the various aggregates (see Figure 15) .
  • the solutions containing the imperfect targets could easily be distinguished from the solution containing the perfect complement by their color when placed in a water bath held at 52.5°C.
  • the colorimetric transition that can be detected by the naked eye occurs over less than 1 ° C, thereby allowing one to easily distinguish the perfect target 4 from the targets with mismatches (5 and 6) , an end deletion (7), and a one base insertion at the point in the target where the two oligonucleotide probes meet (8) (see Table 4) .
  • the colorimetric transition T c is close in temperature, but not identical, to T m . In both controls, there were no signs of particle aggregation or instability in the solutions, as evidenced by the pinkish red color which was observed at all temperatures, and they showed negative spots (pink) in the plate test at all temperatures (Table 4) .
  • the results indicate that any one base mismatch along the target strand can be detected, along with any insertions into the target strand.
  • the temperature range over which a color change can be detected is extremely sharp, and the change occurs over a very narrow temperature range. This sharp transition indicates that there is a large degree of cooperativity in the melting process involving the large network of colloids which are linked by the target oligonucleotide strands. This leads to the remarkable selectivity as shown by the data.
  • Nanoparticle-oligonucleotide conjugates 1 and 2 illustrated in Figure 16 were incubated with targets of different lengths (24, 48 and 72 bases in length) and complementary filler oligonucleotides, as illustrated in
  • the color changes observed in this and other examples occur when the distance between the gold nanoparticles (the interparticle distance) is approximately the same or less than the diameter of the nanoparticle.
  • the size of the nanoparticles, the size of the oligonucleotides attached to them, and the spacing of the nanoparticles when they are hybridized to the target nucleic acid affect whether a color change will be observable when the oligonucleotide-nanoparticle conjugates hybridize with the nucleic acid targets to form aggregates.
  • gold nanoparticles with diameters of 13 nm will produce a color change when aggregated using oligonucleotides attached to the nanoparticles designed to hybridize with target sequences 10-35 nucleotides in length.
  • the spacing of the nanoparticles when they are hybridized to the target nucleic acid adequate to give a color change will vary with the extent of aggregation, as the results demonstrate.
  • the results also indicate that the solid surface enhances further aggregation of already- aggregated samples, bringing the gold nanoparticles closer together.
  • the color change observed with gold nanoparticles is attributable to a shift and broadening of the surface plasmon resonance of the gold. This color change is unlikely for gold nanoparticles less than about 4 nm in diameter because the lengths of the oligonucleotides necessary for specific detection of nucleic acid would exceed the nanoparticle diameter.
  • a solution containing 12.5 microliters of each probe 1 and 2 and 0.25 microliters of target 3 was heated to 70°C. After cooling to room temperature, 2.5 microliters of a saliva solution (human saliva diluted 1:10 with water) was added. After the resultant solution was frozen, thawed and then spotted onto a C-18 TLC plate, a blue spot was obtained, indicating hybridization of the probes with the target. In control experiments with no target added, blue spots were not observed.
  • a saliva solution human saliva diluted 1:10 with water
  • Example 10 Assays Using Nanoparticle- Oligonucleotide Conjugates An assay was performed as illustrated in Figure 13A. First, glass microscope slides, purchased from Fisher scientific, were cut into approximately 5 x 15 mm pieces. using a diamond tipped scribing pen. Slides were cleaned by soaking for 20 minutes in a solution of 4:1 H 2 S0 4 :H 2 0 2 at 50°C. Slides were then rinsed with copious amounts of water, then ethanol, and dried under a stream of dry nitrogen. Thiol-modified DNA was adsorbed onto the slides using a modified procedure reported in the literature (Chrisey et al.. Nucleic Acids Res .
  • the slides were soaked in a 1% solution of trimethoxysilylpropyldiethyltriamine (DETA, purchased from United Chemical Technologies, Bristol, PA) in 1 mM acetic acid in Nanopure water for 20 minutes at room temperature. The slides were rinsed with water, then ethanol. After drying with a dry nitrogen stream, the slides were baked at 120°C for 5 minutes using a temperature-controlled heating block.
  • DETA trimethoxysilylpropyldiethyltriamine
  • the slides were allowed to cool, then were soaked in a 1 mM succinimidyl 4- (malemidophenyl)-butyrate (SMPB, purchased from Sigma Chemicals) solution in 80:20 methanol:dimethoxysulfoxide for 2 hours at room temperature. After removal from the SMPB solution and rinsing with ethanol, amine sites that were not coupled to the SMPB crosslinker were capped as follows. First, the slides were soaked for 5 minutes in a 8:1 THF:pyridine solution containing 10% 1-methyl i idazole. Then the slides were soaked in 9:1 THF: acetic anhydride solution for five minutes. These capping solutions were purchased from Glen Research, Sterling, VA.
  • SMPB succinimidyl 4- (malemidophenyl)-butyrate
  • the linking oligonucleotide was 24 bp long (5' TACGAGTTGA GAATCCTGAATGCG [SEQ ID NO: 34]) with a sequence containing a 12 bp end that was complementary to the DNA already adsorbed onto the substrate surface.
  • the substrate was then soaked in a hybridization buffer (0.5 M NaCl, 10 mM phosphate buffer pH 7) solution containing the linking oligonucleotide (0.4 OD, 1.7 ⁇ M) for 12 hours.
  • the substrate was soaked in a solution containing 13 nm diameter gold nanoparticles which had been modified with an oligonucleotide (TAGGACTTACGC 5' thiol [SEQ ID NO:35]) that is complementary to the unhybridized portion of the linking oligonucleotide attached to the substrate.
  • an oligonucleotide TAGGACTTACGC 5' thiol [SEQ ID NO:35]
  • the substrate was removed and rinsed with the hybridization buffer.
  • the glass substrate's color had changed from clear and colorless to a transparent pink color. See Figure 19A.
  • Additional layers of nanoparticles were added to the slides by soaking the slides in a solution of the linking oligonucleotide as described above and then soaking in a solution containing 13 nm gold nanoparticled having oligonucleotides (3' thiol ATGCTCAACTCT [SEQ ID NO:33]) attached thereto. After soaking for 12 hours, the slides were removed from the nanoparticle solution and rinsed and soaked in hybridization buffer as described above. The color of the slide had become noticeably more red. See Figure 19A.
  • a final nanoparticle layer was added by repeating the linking oligonucleotide and nanoparticle soaking procedures using 13 nm gold nanoparticles which had been modified with an oligonucleotide (TAGGACTTACGC 5' thiol [SEQ ID NO:35]) as the final nanoparticle layer. Again, the color darkened, and the UV-vis absorbance at 520 nm increased. See Figure 19A.
  • a melting curve was performed.
  • a slide was placed in a cuvette containing 1.5 mL of hybridization buffer, and an apparatus similar to that used in Example 2, part B, was used.
  • the absorbance signal due to the nanoparticles (520 nm) was monitored at each degree as the temperature of the substrate was increased from 20°C to 80°C, with a hold time of 1 minute at each integral degree.
  • the nanoparticle signal dramatically dropped when the temperature passed 52°C. See Figure 19B.
  • a first derivative of the signal showed a melting temperature of 55°C, which corresponds with the temperature seen for the oligonucleotide-nanoparticle conjugates and linking oligonculeotides hybridized in solution. See Figure 19B.
  • ADDRESSEE SHERIDAN ROSS P.C.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Nanotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Medical Informatics (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Composite Materials (AREA)
  • Condensed Matter Physics & Semiconductors (AREA)
  • General Physics & Mathematics (AREA)
  • Materials Engineering (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Saccharide Compounds (AREA)
  • Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
PCT/US1997/012783 1996-07-29 1997-07-21 Nanoparticles having oligonucleotides attached thereto and uses therefor Ceased WO1998004740A1 (en)

Priority Applications (46)

Application Number Priority Date Filing Date Title
CA002262018A CA2262018C (en) 1996-07-29 1997-07-21 Nanoparticles having oligonucleotides attached thereto and uses therefor
EP97938010A EP0918885B1 (en) 1996-07-29 1997-07-21 Nanoparticles having oligonucleotides attached thereto and uses therefor
AU40434/97A AU4043497A (en) 1996-07-29 1997-07-21 Nanoparticles having oligonucleotides attached thereto and uses therefor
DE69737598T DE69737598T2 (de) 1996-07-29 1997-07-21 Nanopartikel mit daran angehefteten oligonukleotiden sowie deren verwendungen
JP50891798A JP4245664B2 (ja) 1996-07-29 1997-07-21 オリゴヌクレオチドを備えた金ナノ粒子を使用して標的該酸を検出する方法
US09/344,667 US6361944B1 (en) 1996-07-29 1999-06-25 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/603,830 US6506564B1 (en) 1996-07-29 2000-06-26 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/693,005 US6495324B1 (en) 1996-07-29 2000-10-20 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/693,352 US6417340B1 (en) 1996-07-29 2000-10-20 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/760,500 US6767702B2 (en) 1996-07-29 2001-01-12 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/820,279 US6750016B2 (en) 1996-07-29 2001-03-28 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/923,625 US6773884B2 (en) 1996-07-29 2001-08-07 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/927,777 US20020172953A1 (en) 1996-07-29 2001-08-10 Movement of biomolecule-coated nanoparticles in an electric field
US09/961,949 US6582921B2 (en) 1996-07-29 2001-09-20 Nanoparticles having oligonucleotides attached thereto and uses thereof
US09/957,318 US6759199B2 (en) 1996-07-29 2001-09-20 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/957,313 US6645721B2 (en) 1996-07-29 2001-09-20 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/967,409 US6740491B2 (en) 1996-07-29 2001-09-28 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/966,312 US6673548B2 (en) 1996-07-29 2001-09-28 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/966,491 US6610491B2 (en) 1996-07-29 2001-09-28 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/973,788 US6720411B2 (en) 1996-07-29 2001-10-10 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/974,007 US7259252B2 (en) 1996-07-29 2001-10-10 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/974,500 US6709825B2 (en) 1996-07-29 2001-10-10 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/973,638 US6878814B2 (en) 1996-07-29 2001-10-10 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/975,498 US6861221B2 (en) 1996-07-29 2001-10-11 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/975,376 US20030054358A1 (en) 1996-07-29 2001-10-11 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/975,384 US7098320B1 (en) 1996-07-29 2001-10-11 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/975,059 US6828432B2 (en) 1996-07-29 2001-10-11 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/975,062 US6677122B2 (en) 1996-07-29 2001-10-11 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/976,968 US6818753B2 (en) 1996-07-29 2001-10-12 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/976,863 US6986989B2 (en) 1996-07-29 2001-10-12 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/976,378 US6969761B2 (en) 1996-07-29 2001-10-12 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/976,601 US6903207B2 (en) 1996-07-29 2001-10-12 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/976,617 US6730269B2 (en) 1996-07-29 2001-10-12 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/976,900 US6902895B2 (en) 1996-07-29 2001-10-12 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/976,971 US6682895B2 (en) 1996-07-29 2001-10-12 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/976,577 US6720147B2 (en) 1996-07-29 2001-10-12 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/976,618 US6812334B1 (en) 1996-07-29 2001-10-12 Nanoparticles having oligonucleotides attached thereto and uses therefor
US09/981,344 US6777186B2 (en) 1996-07-29 2001-10-15 Nanoparticles having oligonucleotides attached thereto and uses therefor
US10/008,978 US6984491B2 (en) 1996-07-29 2001-12-07 Nanoparticles having oligonucleotides attached thereto and uses therefor
US10/266,983 US7169556B2 (en) 1996-07-29 2002-10-08 Nanoparticles having oligonucleotides attached thereto and uses therefor
US10/410,324 US6962786B2 (en) 1996-07-29 2003-04-09 Nanoparticles having oligonucleotides attached thereto and uses therefor
US10/640,618 US7208587B2 (en) 1996-07-29 2003-08-13 Nanoparticles having oligonucleotides attached thereto and uses therefor
US10/716,829 US7250499B2 (en) 1996-07-29 2003-11-18 Nanoparticles having oligonucleotides attached thereto and uses therefor
US11/050,983 US20060068378A1 (en) 1996-07-29 2005-02-04 Nanoparticles having oligonucleotides attached thereto and uses therefor
US11/702,002 US8323888B2 (en) 1996-07-29 2007-02-02 Nanoparticles having oligonucleotides attached thereto and uses therefor
US12/348,909 US20100081134A1 (en) 1997-07-21 2009-01-05 Bio-barcode based detection of target analytes

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US3180996P 1996-07-29 1996-07-29
US60/031,809 1996-07-29

Related Child Applications (5)

Application Number Title Priority Date Filing Date
US24075599A Continuation-In-Part 1996-07-29 1999-01-29
US09240775 Continuation-In-Part 1999-01-29
US09/344,667 Continuation-In-Part US6361944B1 (en) 1996-07-29 1999-06-25 Nanoparticles having oligonucleotides attached thereto and uses therefor
US10/008,978 Continuation-In-Part US6984491B2 (en) 1996-07-29 2001-12-07 Nanoparticles having oligonucleotides attached thereto and uses therefor
US10/266,983 Continuation-In-Part US7169556B2 (en) 1996-07-29 2002-10-08 Nanoparticles having oligonucleotides attached thereto and uses therefor

Publications (2)

Publication Number Publication Date
WO1998004740A1 true WO1998004740A1 (en) 1998-02-05
WO1998004740A9 WO1998004740A9 (en) 1998-04-30

Family

ID=21861513

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1997/012783 Ceased WO1998004740A1 (en) 1996-07-29 1997-07-21 Nanoparticles having oligonucleotides attached thereto and uses therefor

Country Status (8)

Country Link
US (1) US6773884B2 (https=)
EP (2) EP0918885B1 (https=)
JP (4) JP4245664B2 (https=)
AU (1) AU4043497A (https=)
CA (1) CA2262018C (https=)
DE (1) DE69737598T2 (https=)
ES (1) ES2287956T3 (https=)
WO (1) WO1998004740A1 (https=)

Cited By (189)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5939021A (en) * 1997-01-23 1999-08-17 Hansen; W. Peter Homogeneous binding assay
EP0990903A1 (en) * 1998-09-18 2000-04-05 Massachusetts Institute Of Technology Biological applications of semiconductor nanocrystals
WO2000028088A1 (en) 1998-11-10 2000-05-18 Biocrystal Limited Nanocrystals having polynucleotide strands and their use to form dendrimers in a signal amplification system
WO2000017642A3 (en) * 1998-09-18 2000-07-13 Massachusetts Inst Technology Biological applications of semiconductor nanocrystals
WO2000055631A1 (en) * 1999-03-01 2000-09-21 The Regents Of The University Of California Semiconductor nanocrystal probes for biological applications
EP1039291A1 (en) * 1999-03-26 2000-09-27 Sony International (Europe) GmbH Optochemical sensor and method for its construction
WO2000029617A3 (en) * 1998-09-24 2000-11-09 Advanced Res & Tech Inst Water-soluble luminescent quantum dots and bioconjugates thereof
WO2000068692A1 (en) * 1999-05-07 2000-11-16 Quantum Dot Corporation A method of detecting an analyte using semiconductor nanocrystals
US6177555B1 (en) 1998-09-18 2001-01-23 Nexstar Pharmaceuticals, Inc. Homogeneous detection of a target through nucleic acid ligand-ligand beacon interaction
WO2001006257A1 (en) * 1999-07-16 2001-01-25 Wm. Marsh Rice University Metal nanoshells for biosensing applications
US6207229B1 (en) 1997-11-13 2001-03-27 Massachusetts Institute Of Technology Highly luminescent color-selective materials and method of making thereof
US6251303B1 (en) 1998-09-18 2001-06-26 Massachusetts Institute Of Technology Water-soluble fluorescent nanocrystals
WO2001046474A1 (en) 1999-12-21 2001-06-28 Ortho-Clinical Diagnostics, Inc. Detection of nucleic acids
US6261783B1 (en) 1997-12-15 2001-07-17 Gilead Sciences, Inc. Homogeneous detection of a target through nucleic acid ligand-ligand beacon interaction
US6264825B1 (en) 1998-06-23 2001-07-24 Clinical Micro Sensors, Inc. Binding acceleration techniques for the detection of analytes
US6306610B1 (en) 1998-09-18 2001-10-23 Massachusetts Institute Of Technology Biological applications of quantum dots
WO2001090225A1 (en) * 2000-05-22 2001-11-29 Kabushiki Kaisya Advance Novel method for forming polymer pattern
US6326144B1 (en) 1998-09-18 2001-12-04 Massachusetts Institute Of Technology Biological applications of quantum dots
WO2001057522A3 (en) * 2000-02-07 2002-02-14 Quantum Dot Corp Immunochromatographic methods which employ semiconductor nanocrystals
US6361944B1 (en) 1996-07-29 2002-03-26 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
WO2002028507A2 (en) 2000-10-03 2002-04-11 Minerva Biotechnologies Corporation Electronic detection of interaction based on the interruption of flow
EP1186659A4 (en) * 2000-03-16 2002-07-17 Matsushita Electric Industrial Co Ltd NUCLEOTIDE DETECTOR, METHOD FOR THE PRODUCTION THEREOF AND METHOD FOR PRODUCING A MEMBRANE FROM FINE PARTICLES
US6423551B1 (en) 1997-11-25 2002-07-23 The Regents Of The University Of California Organo luminescent semiconductor nanocrystal probes for biological applications and process for making and using such probes
WO2002002810A3 (de) * 2000-07-01 2002-09-19 Clondiag Chip Tech Gmbh Verfahren zum qualitativen und/oder quantitativen nachweis von molekularen wechselwirkungen auf sonden-arrays
WO2002079764A1 (en) * 2001-01-26 2002-10-10 Nanoplex Technologies, Inc. Surface-enhanced spectroscopy-active sandwich nanoparticles
US6506564B1 (en) 1996-07-29 2003-01-14 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
JP2003503699A (ja) * 1999-06-25 2003-01-28 ナノスフェアー インコーポレイテッド オリゴヌクレオチドが付着しているナノ粒子およびその利用法
WO2001051665A3 (en) * 2000-01-13 2003-01-30 Nanosphere Inc Nanoparticles having oligonucleotides attached thereto and uses therefor
WO2001073123A3 (en) * 2000-03-28 2003-02-06 Nanosphere Inc Nanoparticles having oligonucleotides attached thereto and uses therefor
WO2002046483A3 (en) * 2000-12-06 2003-03-06 Univ Northwestern Silver stain removal from dna detection chips by cyanide etching or sonication
US6541617B1 (en) 1998-10-27 2003-04-01 Clinical Micro Sensors, Inc. Detection of target analytes using particles and electrodes
US6579726B1 (en) 1999-07-30 2003-06-17 Surromed, Inc. Instruments, methods and reagents for surface plasmon resonance
US6582921B2 (en) 1996-07-29 2003-06-24 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses thereof
JP2003522962A (ja) * 2000-02-16 2003-07-29 クァンタム・ドット・コーポレイション 半導体ナノクリスタルを使用するマイクロアレイ法
US6602671B1 (en) 1998-09-18 2003-08-05 Massachusetts Institute Of Technology Semiconductor nanocrystals for inventory control
US6602669B2 (en) 2000-07-11 2003-08-05 Northwestern University Method of detection by enhancement of silver staining
WO2002048399A3 (de) * 2000-12-13 2003-08-21 Inst Physikalische Hochtech Ev Verfahren zum simultanen positionsspezifischen schneiden von fadenförmigen organischen molekülketten, insbesonere dna
WO2002018643A3 (en) * 2000-08-11 2003-09-04 Nanosphere Inc Nanoparticles having oligonucleotides attached thereto and uses therefor
WO2002046472A3 (en) * 2000-12-08 2003-09-04 Nanosphere Inc Nanoparticles having oligonucleotides attached thereto and uses therefor
WO2002031191A3 (en) * 2000-10-12 2003-09-12 Yissum Res Dev Co Dendritically amplified detection method
US6645517B2 (en) 1998-03-11 2003-11-11 William Rice Marsh Rice University Temperature-sensitive polymer/nanoshell composites for photothermally modulated drug delivery
US6686150B1 (en) 1998-01-27 2004-02-03 Clinical Micro Sensors, Inc. Amplification of nucleic acids with electronic detection
US6699723B1 (en) 1997-11-25 2004-03-02 The Regents Of The University Of California Organo luminescent semiconductor nanocrystal probes for biological applications and process for making and using such probes
US6699724B1 (en) 1998-03-11 2004-03-02 Wm. Marsh Rice University Metal nanoshells for biosensing applications
WO2004027095A1 (en) * 2002-09-20 2004-04-01 Intel Corporation Controlled alignment of nanobarcodes encoding specific information for scanning probe microscopy (spm) reading
US6750016B2 (en) 1996-07-29 2004-06-15 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
EP1425411A4 (en) * 1999-06-07 2004-06-23 Yeda Res & Dev DNA MOLECULARALLY CONTROLLED SEMICONDUCTOR RESISTANCE BASED DETECTOR
US6773884B2 (en) 1996-07-29 2004-08-10 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
EP1392872A4 (en) * 2001-05-25 2004-08-11 Univ Northwestern NON-ALLOY CORE SHELL NANOPARTICLES
WO2004086046A1 (en) * 2003-03-25 2004-10-07 Biacore Ab Immobilization method and kit therefor
US6812334B1 (en) 1996-07-29 2004-11-02 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6819692B2 (en) 2000-03-14 2004-11-16 Massachusetts Institute Of Technology Optical amplifiers and lasers
EP1379693A4 (en) * 2001-03-28 2004-12-22 Nanosphere Inc BIO STICK CODES BASED ON OLIGONUCLEOTIDE-MODIFIED PARTICLES
WO2005003394A2 (en) 2003-06-27 2005-01-13 Nanosphere, Inc. Bio-barcode based detection of target analytes
EP1266032A4 (en) * 2000-02-18 2005-01-19 Biocrystal Ltd FUNCTIONALIZED ENCAPSULATED FLUORESCENT NANOCRYSTALS
US6861155B2 (en) 1997-11-13 2005-03-01 Massachusetts Institute Of Technology Highly luminescent color selective nanocrystalline materials
US6875619B2 (en) 1999-11-12 2005-04-05 Motorola, Inc. Microfluidic devices comprising biochannels
WO2005042785A1 (en) * 2003-10-30 2005-05-12 North Carolina State University Electrochemical detection of nucleic acid hybridization
JP2005513999A (ja) * 2000-11-15 2005-05-19 ミナーヴァ・バイオテクノロジーズ・コーポレーション オリゴヌクレオチド識別子
US6921496B2 (en) 2000-03-20 2005-07-26 Massachusetts Institute Of Technology Inorganic particle conjugates
EP1084390A4 (en) * 1998-06-09 2005-07-27 California Inst Of Techn COLLOIDAL PARTICLES USED IN A SENSOR MOSAIC
US6934022B1 (en) * 1998-12-17 2005-08-23 Leica Microsystems Heidelberg Gmbh Method for differentiated investigation of diverse structures in preferably biological preparations
US6960467B2 (en) 1999-11-12 2005-11-01 Clinical Micro Sensors, Inc. Biochannel assay for hybridization with biomaterial
AU2001245628B2 (en) * 2000-03-10 2005-11-10 Dynavax Technologies Corporation Immunomodulatory formulations and methods for use thereof
US6974669B2 (en) 2000-03-28 2005-12-13 Nanosphere, Inc. Bio-barcodes based on oligonucleotide-modified nanoparticles
US6984491B2 (en) 1996-07-29 2006-01-10 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
EP1511862A4 (en) * 2002-05-14 2006-01-18 Nanosphere Inc ELECTRICAL DETECTION OF DNA HYBRIDIZATION AND SPECIFIC BINDING EVENTS
EP1546983A4 (en) * 2002-09-20 2006-03-15 Intel Corp CONTROLLED ALIGNMENT OF SPECIFIC INFORMATION FOR MEASURES OF RASTER TERM MICROSCOPY (SPM) CODING NANO BAR CODES
US7014992B1 (en) 1996-11-05 2006-03-21 Clinical Micro Sensors, Inc. Conductive oligomers attached to electrodes and nucleoside analogs
EP1483794A4 (en) * 2001-07-17 2006-05-03 Ciphergen Biosystems Inc ADSORBENT CHIP BASED ON LATEX
EP1495139A4 (en) * 2002-03-29 2006-06-28 Genentech Inc METHOD AND COMPOSITIONS FOR DETECTING AND QUANTIFYING NUCLEIC ACID ANALYSTS
US7087148B1 (en) 1998-06-23 2006-08-08 Clinical Micro Sensors, Inc. Binding acceleration techniques for the detection of analytes
US7090804B2 (en) 1998-01-27 2006-08-15 Clinical Mirco Sensors, Inc. Amplification of nucleic acids with electronic detection
EP1532274A4 (en) * 2002-06-28 2006-09-27 Purdue Research Foundation MAGNETIC NANOMATERIALS AND METHODS FOR DETECTING BIOLOGICAL MATERIALS
US7138121B2 (en) 2003-01-23 2006-11-21 Spangler Brenda D Biosensors utilizing dendrimer-immobilized ligands and there use thereof
US7160613B2 (en) 2002-08-15 2007-01-09 Massachusetts Institute Of Technology Stabilized semiconductor nanocrystals
US7169556B2 (en) 1996-07-29 2007-01-30 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US7172897B2 (en) 2000-01-11 2007-02-06 Clinical Micro Sensors, Inc. Devices and methods for biochip multiplexing
WO2006078289A3 (en) * 2004-05-12 2007-02-08 Nanosphere Inc Bio-barcode based detection of target analytes
US7181266B2 (en) 2003-03-04 2007-02-20 Massachusetts Institute Of Technology Materials and methods for near-infrared and infrared lymph node mapping
US7186814B2 (en) 2001-11-09 2007-03-06 Nanosphere, Inc. Bioconjugate-nanoparticle probes
US7190870B2 (en) 2001-09-17 2007-03-13 Massachusetts Institute Of Technology Semiconductor nanocrystal composite
WO2006104979A3 (en) * 2005-03-29 2007-03-15 Nanosphere Inc Method for detecting a target analyte
US7192708B2 (en) 2000-06-27 2007-03-20 The Board Of Trustees Of The University Of Illinois Nucleic acid enzyme biosensors for ions
US7192778B2 (en) 1999-10-06 2007-03-20 Natan Michael J Surface enhanced spectroscopy-active composite nanoparticles
US7229497B2 (en) 2003-08-26 2007-06-12 Massachusetts Institute Of Technology Method of preparing nanocrystals
EP1712622A4 (en) * 2003-12-29 2007-06-13 Universal Bio Research Co Ltd METHOD FOR DETECTING TARGET SUBSTANCE
JP2007516426A (ja) * 2003-05-16 2007-06-21 ユニバーシティー オブ ロチェスター オリゴヌクレオチドの検出のための比色法および蛍光法
US7250403B2 (en) 2000-03-10 2007-07-31 Dynavax Technologies Corporation Biodegradable immunomodulatory formulations and methods for use thereof
US7253277B2 (en) 2002-07-02 2007-08-07 Nanosphere, Inc. Nanoparticle polyanion conjugates and methods of use thereof in detecting analytes
US7297553B2 (en) 2002-05-28 2007-11-20 Nanosphere, Inc. Method for attachment of silylated molecules to glass surfaces
WO2005116226A3 (en) * 2004-05-24 2007-11-29 Midatech Ltd Nanoparticles comprising rna ligands
US7316967B2 (en) 2004-09-24 2008-01-08 Massachusetts Institute Of Technology Flow method and reactor for manufacturing noncrystals
US7319709B2 (en) 2002-07-23 2008-01-15 Massachusetts Institute Of Technology Creating photon atoms
US7321829B2 (en) 1999-05-19 2008-01-22 Eppendorf Array Technologies (E.A.T.) Method for the identification and/or the quantification of a target compound obtained from a biological sample upon chips
US7326365B2 (en) 2001-02-09 2008-02-05 Massachusetts Institute Of Technology Composite material including nanocrystals and methods of making
US7332283B2 (en) 2002-05-10 2008-02-19 The Board Of Trustees Of The University Of Illinois Fluorescence based biosensor
US7361310B1 (en) 2001-11-30 2008-04-22 Northwestern University Direct write nanolithographic deposition of nucleic acids from nanoscopic tips
US7375890B2 (en) 2002-09-12 2008-05-20 Cyvera Corporation Method of manufacturing of a diffraction grating-based optical identification element
US7390568B2 (en) 2002-08-13 2008-06-24 Massachusetts Institute Of Technology Semiconductor nanocrystal heterostructures having specific charge carrier confinement
EP1848823A4 (en) * 2005-01-21 2008-06-25 Univ Rochester METHOD FOR SEPARATING SHORT INDIVIDUAL STRUCTURAL NUCLEIC ACID OF LONG SINGLE AND DOUBLE STRANDUCLEIC ACID AND ASSOCIATED BIOMOLECULAR TESTS
US7394094B2 (en) 2005-12-29 2008-07-01 Massachusetts Institute Of Technology Semiconductor nanocrystal heterostructures
US7399643B2 (en) 2002-09-12 2008-07-15 Cyvera Corporation Method and apparatus for aligning microbeads in order to interrogate the same
US7433123B2 (en) 2004-02-19 2008-10-07 Illumina, Inc. Optical identification element having non-waveguide photosensitive substrate with diffraction grating therein
WO2008076414A3 (en) * 2006-12-15 2008-10-09 Univ New York Self-replicating materials
US7441703B2 (en) 2002-08-20 2008-10-28 Illumina, Inc. Optical reader for diffraction grating-based encoded optical identification elements
US7449237B2 (en) 2004-07-26 2008-11-11 Massachusetts Institute Of Technology Microspheres including nanoparticles in the peripheral region
US7485419B2 (en) 2004-01-13 2009-02-03 The Board Of Trustees Of The University Of Illinois Biosensors based on directed assembly of particles
US7508608B2 (en) 2004-11-17 2009-03-24 Illumina, Inc. Lithographically fabricated holographic optical identification element
US7517496B2 (en) 2001-07-17 2009-04-14 Bio-Rad Laboratories, Inc. Latex based adsorbent chip
US7534560B2 (en) 2002-05-10 2009-05-19 The Board Of Trustees Of The University Of Illinois Simple catalytic DNA biosensors for ions based on color changes
US7553621B2 (en) 2001-09-07 2009-06-30 Biomerieux Reading, detection or quantification method, hybrids or complexes used in said method and the biochip using same
US7564245B2 (en) 2005-08-31 2009-07-21 T2 Biosystems, Inc. NMR device for detection of analytes
US7602952B2 (en) 2004-11-16 2009-10-13 Illumina, Inc. Scanner having spatial light modulator
US7604173B2 (en) 2004-11-16 2009-10-20 Illumina, Inc. Holographically encoded elements for microarray and other tagging labeling applications, and method and apparatus for making and reading the same
US7612185B2 (en) 2003-03-07 2009-11-03 The Board Of Trustees Of The University Of Illinois Nucleic acid biosensors
US7619819B2 (en) 2002-08-20 2009-11-17 Illumina, Inc. Method and apparatus for drug product tracking using encoded optical identification elements
US7623624B2 (en) 2005-11-22 2009-11-24 Illumina, Inc. Method and apparatus for labeling using optical identification elements characterized by X-ray diffraction
US7655129B2 (en) 1998-06-23 2010-02-02 Osmetech Technology Inc. Binding acceleration techniques for the detection of analytes
US7723100B2 (en) 2006-01-13 2010-05-25 Becton, Dickinson And Company Polymer coated SERS nanotag
WO2010089098A1 (de) 2009-02-05 2010-08-12 Deklatec Gmbh Verfahren und mittel für die tuberkulose diagnostik
US7799554B2 (en) 2006-03-16 2010-09-21 The Board Of Trustees Of The University Of Illinois Lateral flow devices
US7807372B2 (en) 2007-06-04 2010-10-05 Northwestern University Screening sequence selectivity of oligonucleotide-binding molecules using nanoparticle based colorimetric assay
EP2129803A4 (en) * 2007-02-27 2010-11-03 Univ Northwestern APPLICATION OF MOLECULES TO NANOPARTICLES
US7830575B2 (en) 2006-04-10 2010-11-09 Illumina, Inc. Optical scanner with improved scan time
US7829275B2 (en) 2001-07-20 2010-11-09 North Carolina State University Light addressable electrochemical detection of duplex structures
US7829350B2 (en) 2001-06-06 2010-11-09 The General Hospital Corporation Magnetic-nanoparticle conjugates and methods of use
US7847238B2 (en) 2006-11-07 2010-12-07 New York University Holographic microfabrication and characterization system for soft matter and biological systems
US7887885B2 (en) 2000-10-20 2011-02-15 Northwestern University Nanolithography methods and products therefor and produced thereby
US7892734B2 (en) 2005-08-11 2011-02-22 The Board Of Trustees Of The University Of Illinois Aptamer based colorimetric sensor systems
US7912653B1 (en) 2003-04-17 2011-03-22 Nanosys, Inc. Nanocrystal taggants
US7919237B2 (en) * 2001-07-03 2011-04-05 Nanostring Technologies, Inc. Methods for detection and quantification of analytes in complex mixtures
US7935481B1 (en) 1999-07-26 2011-05-03 Osmetech Technology Inc. Sequence determination of nucleic acids using electronic detection
US7955561B2 (en) 1998-06-09 2011-06-07 The California Institute Of Technology Colloidal particles used in sensing array
US7964347B2 (en) * 2006-06-15 2011-06-21 Krassen Dimitrov Labels for electronic detection of individual molecules and methods for their detection
WO2011079356A1 (pt) * 2009-12-30 2011-07-07 Universidade Federal De Minas Gerais - Ufmg Conjugado de nanotubos de carbono para inibir estruturas de infecção de patógenos em vegetais
US7985539B2 (en) 2002-05-07 2011-07-26 Northwestern University Nanoparticle probes with raman spectroscopic fingerprints for analyte detection
US8058415B2 (en) 2007-04-24 2011-11-15 The Board Of Trustees Of The University Of Illinois Aptamer- and nucleic acid enzyme-based systems for simultaneous detection of multiple analytes
US8062893B2 (en) 2008-10-10 2011-11-22 The Board Of Trustees Of The University Of Illinois Fluorescent sensor for mercury
US8092859B2 (en) 2004-08-17 2012-01-10 Life Technologies Corporation Synthesis of highly luminescent colloidal particles
US8134175B2 (en) 2005-01-11 2012-03-13 Massachusetts Institute Of Technology Nanocrystals including III-V semiconductors
US8174742B2 (en) 2008-03-14 2012-05-08 New York University System for applying optical forces from phase gradients
EP2320231A3 (en) * 1999-01-23 2012-07-18 Minerva Biotechnologies Corporation Assays involving sam-modified colloids and non-colloidal structures
CN102872463A (zh) * 2004-05-24 2013-01-16 Mida科技有限公司 含有rna配体的纳米颗粒
US8368402B2 (en) 2006-11-08 2013-02-05 T2 Biosystems, Inc. NMR systems for in vivo detection of analytes
US8367416B2 (en) 2007-08-10 2013-02-05 The Board Of Trustees Of The University Of Illinois Nucleic acid based fluorescent sensor for mercury detection
US8409863B2 (en) 2005-12-14 2013-04-02 Becton, Dickinson And Company Nanoparticulate chemical sensors using SERS
US8409800B2 (en) 2007-07-16 2013-04-02 The Board Of Trustees Of The University Of Illinois Nucleic acid based fluorescent sensor for copper detection
US8415461B2 (en) 2007-01-19 2013-04-09 The Board Of Trustees Of The University Of Illinois Amphiphilic substances and functionalized lipid vesicles including the same
US8421458B2 (en) 2007-09-28 2013-04-16 T2 Biosystems, Inc. NMR diagnostics by means of a plastic sample container
US8497131B2 (en) 1999-10-06 2013-07-30 Becton, Dickinson And Company Surface enhanced spectroscopy-active composite nanoparticles comprising Raman-active reporter molecules
US8519708B2 (en) 2007-11-06 2013-08-27 T2 Biosystems, Inc. Small magnet and RF coil for magnetic resonance relaxometry
US8535949B2 (en) 2005-05-09 2013-09-17 The General Hospital Corporation Water relaxation-based sensors
US8568690B2 (en) 2007-07-31 2013-10-29 The Board Of Trustees Of The University Of Illinois MRI contrast agents and high-throughput screening by MRI
EP2666778A1 (en) * 2012-05-21 2013-11-27 Samsung Electronics Co., Ltd Nanoparticle, nanoparticle complex and method of preparing a nanoparticle
US8658733B2 (en) 1999-04-09 2014-02-25 Life Technologies As Process for the preparation of monodisperse polymer particles
US8815156B2 (en) 2010-07-19 2014-08-26 Andalyze, Inc. Sensor housing and reagent chemistry
WO2015013675A1 (en) 2013-07-25 2015-01-29 Aurasense Therapeutics, Llc Spherical nucleic acid-based constructs as immunoregulatory agents
US8999947B2 (en) 2005-06-14 2015-04-07 Northwestern University Nucleic acid functionalized nanoparticles for therapeutic applications
US9046493B2 (en) 2010-10-22 2015-06-02 T2 Biosystems, Inc. NMR systems and methods for the rapid detection of analytes
US9051583B2 (en) 2011-12-19 2015-06-09 Northwestern University Modified silica shell particles, and methods of making and using the same
US9097644B2 (en) 2007-08-17 2015-08-04 Massachusetts Institute Of Technology Magnetic resonance-based viscometers and methods
US9139827B2 (en) 2008-11-24 2015-09-22 Northwestern University Polyvalent RNA-nanoparticle compositions
US9157974B2 (en) 2008-10-29 2015-10-13 T2 Biosystems, Inc. NMR detection of coagulation time
WO2016004168A1 (en) * 2014-07-01 2016-01-07 Aurasense Therapeutics, Llc Spherical nanoparticles as antibacterial agents
US9268983B2 (en) 2003-01-22 2016-02-23 Illumina, Inc. Optical system and method for reading encoded microbeads
US9371563B2 (en) 2005-12-23 2016-06-21 Nanostring Technologies, Inc. Nanoreporters and methods of manufacturing and use thereof
US9376690B2 (en) 2009-10-30 2016-06-28 Northwestern University Templated nanoconjugates
US9488648B2 (en) 2010-10-22 2016-11-08 T2 Biosystems, Inc. NMR systems and methods for the rapid detection of analytes
US9506056B2 (en) 2006-06-08 2016-11-29 Northwestern University Nucleic acid functionalized nanoparticles for therapeutic applications
US9562271B2 (en) 2012-04-20 2017-02-07 T2 Biosystems, Inc. Compositions and methods for detection of Candida species
US9599627B2 (en) 2011-07-13 2017-03-21 T2 Biosystems, Inc. NMR methods for monitoring blood clot formation
US9739733B2 (en) 2012-12-07 2017-08-22 T2 Biosystems, Inc. Methods for monitoring tight clot formation
US9890427B2 (en) 2007-02-09 2018-02-13 Northwestern University Particles for detecting intracellular targets
US9889209B2 (en) 2011-09-14 2018-02-13 Northwestern University Nanoconjugates able to cross the blood-brain barrier
US10098958B2 (en) 2009-01-08 2018-10-16 Northwestern University Delivery of oligonucleotide functionalized nanoparticles
US10208310B2 (en) 2014-10-06 2019-02-19 Exicure, Inc. Anti-TNF compounds
US10301622B2 (en) 2013-11-04 2019-05-28 Northwestern University Quantification and spatio-temporal tracking of a target using a spherical nucleic acid (SNA)
US10328026B2 (en) 2010-01-19 2019-06-25 Northwestern University Synthetic nanostructures including nucleic acids and/or other entities
US10413565B2 (en) 2014-04-30 2019-09-17 Northwestern University Nanostructures for modulating intercellular communication and uses thereof
US10620205B2 (en) 2011-09-21 2020-04-14 T2 Biosystems, Inc. NMR methods for endotoxin analysis
CN111751355A (zh) * 2020-07-22 2020-10-09 攀钢集团研究院有限公司 测定Fe(Ⅱ)-EDTA络合脱硝液中二价铁离子含量的方法
US11213593B2 (en) 2014-11-21 2022-01-04 Northwestern University Sequence-specific cellular uptake of spherical nucleic acid nanoparticle conjugates
US11364304B2 (en) 2016-08-25 2022-06-21 Northwestern University Crosslinked micellar spherical nucleic acids
US11519016B2 (en) 2016-01-21 2022-12-06 T2 Biosystems, Inc. NMR methods and systems for the rapid detection of bacteria
US11696954B2 (en) 2017-04-28 2023-07-11 Exicure Operating Company Synthesis of spherical nucleic acids using lipophilic moieties
WO2023196818A1 (en) 2022-04-04 2023-10-12 The Regents Of The University Of California Genetic complementation compositions and methods
US11866700B2 (en) 2016-05-06 2024-01-09 Exicure Operating Company Liposomal spherical nucleic acid (SNA) constructs presenting antisense oligonucleotides (ASO) for specific knockdown of interleukin 17 receptor mRNA
US11957788B2 (en) 2014-06-04 2024-04-16 Exicure Operating Company Multivalent delivery of immune modulators by liposomal spherical nucleic acids for prophylactic or therapeutic applications

Families Citing this family (62)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2004205147B2 (en) * 1996-07-29 2008-01-10 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses thereof
US20050037397A1 (en) * 2001-03-28 2005-02-17 Nanosphere, Inc. Bio-barcode based detection of target analytes
US6770479B1 (en) * 1998-07-10 2004-08-03 The United States Of America As Represented By The Secretary Of The Army Anthrax vaccine
EP1135682B1 (en) 1998-11-30 2007-07-11 Nanosphere, Inc. Nanoparticles with polymer shells
US20030096321A1 (en) * 1999-05-19 2003-05-22 Jose Remacle Method for the identification and/or the quantification of a target compound obtained from a biological sample upon chips
US20060040286A1 (en) * 2001-03-28 2006-02-23 Nanosphere, Inc. Bio-barcode based detection of target analytes
US20030113740A1 (en) * 2001-04-26 2003-06-19 Mirkin Chad A. Oligonucleotide-modified ROMP polymers and co-polymers
US7147687B2 (en) 2001-05-25 2006-12-12 Nanosphere, Inc. Non-alloying core shell nanoparticles
US20030186245A1 (en) * 2002-03-28 2003-10-02 Roitman Daniel B. Biomolecular sensors and detection methods utilizing photoinduced charge separation
US7863038B2 (en) * 2002-03-29 2011-01-04 Board Of Regents, The University Of Texas System Implantable biosensor from stratified nanostructured membranes
EP1387169B1 (en) * 2002-08-02 2006-05-24 Sony Deutschland GmbH Method of attaching hydrophilic species to hydrophilic macromolecules and immobilizing the hydrophilic macromolecules on a hydrophobic surface
US8020433B2 (en) * 2003-03-25 2011-09-20 Tearlab Research, Inc. Systems and methods for a sample fluid collection device
US7810380B2 (en) 2003-03-25 2010-10-12 Tearlab Research, Inc. Systems and methods for collecting tear film and measuring tear film osmolarity
JP2007524347A (ja) * 2003-02-27 2007-08-30 ナノスフェアー インコーポレイテッド マイクロアレイ形式のアッセイにおける、万能ナノ粒子プローブを用いた標識不要の遺伝子発現プロファイリング
DE10315074A1 (de) * 2003-04-02 2004-10-14 Clondiag Chip Technologies Gmbh Vorrichtung zur Vervielfältigung und zum Nachweis von Nukleinsäuren
US20050250094A1 (en) * 2003-05-30 2005-11-10 Nanosphere, Inc. Method for detecting analytes based on evanescent illumination and scatter-based detection of nanoparticle probe complexes
US7354706B2 (en) * 2003-09-09 2008-04-08 The Regents Of The University Of Colorado, A Body Corporate Use of photopolymerization for amplification and detection of a molecular recognition event
US20090163375A1 (en) 2003-09-09 2009-06-25 Bowman Christopher N Use of Photopolymerization for Amplification and Detection of a Molecular Recognition Event
US7279280B2 (en) * 2003-09-25 2007-10-09 Mgp Biotech, Inc. Apparatus and method for detecting genetic mutations and single nucleotide polymorphisms
FR2860872A1 (fr) 2003-10-09 2005-04-15 Commissariat Energie Atomique Micro-capteurs et nano-capteurs d'especes chimiques et biologiques a plasmons de surface
WO2005040755A2 (en) * 2003-10-20 2005-05-06 The Regents Of The University Of California Nanoscale transduction systems for detecting molecular interactions
US20080286880A1 (en) * 2004-07-07 2008-11-20 The Penn State Research Foundation Methods and Systems for Nanoparticle Enhancement of Signals
JP2008507296A (ja) * 2004-07-26 2008-03-13 ナノスフェアー インコーポレイテッド 混合培養物中でメチシリン耐性黄色ブドウ球菌とメチシリン感受性黄色ブドウ球菌とを区別する方法
US9494581B2 (en) 2004-08-24 2016-11-15 University Of Wyoming System and method for Raman spectroscopy assay using paramagnetic particles
US7485471B1 (en) * 2004-12-17 2009-02-03 Intel Corporation Detection of enhanced multiplex signals by surface enhanced Raman spectroscopy
JP2006247492A (ja) * 2005-03-09 2006-09-21 Ebara Corp 固相合成装置
WO2006125124A2 (en) * 2005-05-18 2006-11-23 Nanosphere, Inc. Substrate functionalization method for high sensitivity applications
EP1909104B1 (en) 2005-05-26 2010-07-21 Japan Science and Technology Agency Novel sugar-immobilized metal nanoparticle, method for measuring sugar-protein interaction using the same and method for recovering protein from sugar-protein interactant
WO2007002567A2 (en) * 2005-06-23 2007-01-04 Nanosphere, Inc. Selective isolation and concentration of nucleic acids from complex samples
JP4822753B2 (ja) * 2005-07-11 2011-11-24 一般社団法人オンチップ・セロミクス・コンソーシアム 細胞構成物質分取チップならびに細胞構成物質解析システム及びこれらを用いる細胞構成物質解析法
US20110229579A1 (en) * 2005-07-21 2011-09-22 Roberta Carbone Support Having Nanostructured Titanium Dioxide Film And Uses Thereof
WO2007009994A1 (en) * 2005-07-21 2007-01-25 Tethis S.R.L. Support having nanostructured titanium dioxide film and uses thereof
US8512946B2 (en) 2005-08-10 2013-08-20 Northwestern University Composite particles
JP2009505106A (ja) * 2005-08-19 2009-02-05 ナノスフェアー インコーポレイテッド Dna及び抗体を含むハイブリッド基板を調製するための方法及びその使用
WO2007092941A2 (en) * 2006-02-08 2007-08-16 Oxonica, Inc. Sers nanotag assays
US20090280188A1 (en) * 2006-06-23 2009-11-12 Northwestern University Asymmetric functionalizated nanoparticles and methods of use
WO2008035565A1 (en) * 2006-09-19 2008-03-27 Konica Minolta Medical & Graphic, Inc. Biomolecule detection reagent and biomolecule detection method using the same
JP2008154493A (ja) 2006-12-22 2008-07-10 Rohm Co Ltd 分離精製方法とマイクロ流体回路
US20080293588A1 (en) * 2007-05-11 2008-11-27 Northwestern University Nanodisk codes
US7829735B2 (en) * 2007-10-26 2010-11-09 Northwestern University Universal phosphoramidite for preparation of modified biomolecules and surfaces
US20090137405A1 (en) * 2007-11-16 2009-05-28 Christopher Bowman Detection of nucleic acid biomarkers using polymerization-based amplification
US20100105024A1 (en) * 2008-01-14 2010-04-29 Transgenex Nanobiotech, Inc. Rapid test including genetic sequence probe
US20090181361A1 (en) * 2008-01-14 2009-07-16 Weidong Xu Rapid test for detecting infection
EP2268571B1 (en) * 2008-03-24 2017-10-25 Universidade Federal De Pernambuco - UFPE Fluorescent nanoparticle composites themselves, process for the preparation of such composites, and use in rapid diagnosis systems with affinity to biological molecules
US10001476B2 (en) * 2009-10-28 2018-06-19 Genmark Diagnostics, Inc. Capture ligand controls, blocking probes, masking probes and methods of using the same
US8445228B2 (en) 2009-11-16 2013-05-21 Massachusetts Institute Of Technology Enhancement of in vitro translation by nanoparticle conjugates
US9335292B2 (en) 2011-10-13 2016-05-10 Auburn University Electrochemical proximity assay
EP2594942A1 (en) * 2011-11-16 2013-05-22 Koninklijke Philips Electronics N.V. Long rigid spacers to enhance binding kinetics in immunoassays
US9801953B2 (en) 2012-10-15 2017-10-31 Emory University Nanoparticles carrying nucleic acid cassettes for expressing RNA
US9512468B2 (en) 2012-11-06 2016-12-06 Industrial Technology Research Institute Detection method uses magnetic and detectable nanoparticles with oligonucleotides attached thereto
US11366061B2 (en) 2013-01-24 2022-06-21 Grace Bio-Labs, Inc. Protein microarray assay imager
BR112017005121A2 (pt) 2014-09-23 2018-07-31 Tearlab Res Inc sistemas e métodos para integração de coleta de lágrima microfluídica e análise de fluxo lateral de analitos de interesse.
WO2016081585A1 (en) 2014-11-20 2016-05-26 Ampliwise Inc. Compositions and methods for nucleic acid amplification
WO2016113622A1 (en) 2015-01-12 2016-07-21 Nanomark Pesquisa E Desenvolvimento Tecnológico Ltda Magnetic nanocomposite retrieval of nucleotide sequence
WO2018165566A1 (en) 2017-03-09 2018-09-13 Auburn University Differential circuit for background correction in electrochemical measurements
US11505799B2 (en) 2017-07-07 2022-11-22 Innamed, Inc. Aptamers for measuring lipoprotein levels
US11331019B2 (en) 2017-08-07 2022-05-17 The Research Foundation For The State University Of New York Nanoparticle sensor having a nanofibrous membrane scaffold
WO2019094670A1 (en) * 2017-11-10 2019-05-16 Dnp123 Company Molecular detection via programmable self-assembly
US11560565B2 (en) 2018-06-13 2023-01-24 Auburn University Electrochemical detection nanostructure, systems, and uses thereof
KR102239459B1 (ko) * 2019-09-16 2021-04-12 한국화학연구원 산화 그래핀, DNAzyme 및 PNA를 포함하는 온도 센서용 조성물 및 이를 이용한 온도 센싱 방법
US12195787B2 (en) * 2020-06-29 2025-01-14 Government Of The United States Of America, As Represented By The Secretary Of Commerce DNA nanotechnology-based biomarker measurement platform
JP7535407B2 (ja) * 2020-08-07 2024-08-16 日鉄環境株式会社 ナノ粒子を用いた視認判定可能な簡易分析技術

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5460831A (en) * 1990-06-22 1995-10-24 The Regents Of The University Of California Targeted transfection nanoparticles
US5543158A (en) * 1993-07-23 1996-08-06 Massachusetts Institute Of Technology Biodegradable injectable nanoparticles
US5665582A (en) * 1990-10-29 1997-09-09 Dekalb Genetics Corp. Isolation of biological materials

Family Cites Families (52)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA1190838A (en) * 1981-07-17 1985-07-23 Cavit Akin Homogeneous nucleic acid hybridization diagnostics by non-radiative energy transfer
US5288609A (en) 1984-04-27 1994-02-22 Enzo Diagnostics, Inc. Capture sandwich hybridization method and composition
CA1260372A (en) * 1984-04-27 1989-09-26 Elazar Rabbani Hybridization method for the detection of genetic materials
TW203120B (https=) * 1985-10-04 1993-04-01 Abbott Lab
US4996143A (en) * 1985-12-23 1991-02-26 Syngene, Inc. Fluorescent stokes shift probes for polynucleotide hybridization
US5137827A (en) 1986-03-25 1992-08-11 Midwest Research Technologies, Inc. Diagnostic element for electrical detection of a binding reaction
US5360895A (en) 1987-04-22 1994-11-01 Associated Universities, Inc. Derivatized gold clusters and antibody-gold cluster conjugates
US5451463A (en) * 1989-08-28 1995-09-19 Clontech Laboratories, Inc. Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides
ES2116977T3 (es) * 1990-05-11 1998-08-01 Microprobe Corp Soportes solidos para ensayos de hibridacion de acidos nucleicos y metodos para inmovilizar oligonucleotidos de modo covalente.
JPH06510363A (ja) * 1990-10-29 1994-11-17 ディカルブ プラント ジェネティクス 磁気性粒子を使用する生物学的材料の単離
JPH04197200A (ja) * 1990-11-28 1992-07-16 Canon Inc 核酸の検出方法
WO1993010564A1 (en) 1991-11-22 1993-05-27 The Regents Of The University Of California Semiconductor nanocrystals covalently bound to solid inorganic surfaces using self-assembled monolayers
GB9212164D0 (en) 1992-06-09 1992-07-22 Medical Res Council Preparation of nucleic acids
US5472881A (en) 1992-11-12 1995-12-05 University Of Utah Research Foundation Thiol labeling of DNA for attachment to gold surfaces
US5384265A (en) * 1993-03-26 1995-01-24 Geo-Centers, Inc. Biomolecules bound to catalytic inorganic particles, immunoassays using the same
US5637508A (en) 1993-03-26 1997-06-10 Geo-Centers, Inc. Biomolecules bound to polymer or copolymer coated catalytic inorganic particles, immunoassays using the same and kits containing the same
AU690124B2 (en) * 1993-06-09 1998-04-23 Gamera Bioscience Corporation Magnetic cycle reaction
JPH07227299A (ja) * 1994-02-14 1995-08-29 Kyoto Daiichi Kagaku:Kk Dnaの特定塩基配列の検出方法及びその装置
US5521289A (en) * 1994-07-29 1996-05-28 Nanoprobes, Inc. Small organometallic probes
US5599668A (en) 1994-09-22 1997-02-04 Abbott Laboratories Light scattering optical waveguide method for detecting specific binding events
US6586193B2 (en) 1996-04-25 2003-07-01 Genicon Sciences Corporation Analyte assay using particulate labels
JP2000510582A (ja) * 1996-04-25 2000-08-15 ゼニコン・サイエンシーズ・コーポレーション 微粒子標識を使用した分析物アッセイ
DE69737598T2 (de) 1996-07-29 2007-12-27 Nanosphere Inc., Skokie Nanopartikel mit daran angehefteten oligonukleotiden sowie deren verwendungen
US6361944B1 (en) 1996-07-29 2002-03-26 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6242264B1 (en) 1996-09-04 2001-06-05 The Penn State Research Foundation Self-assembled metal colloid monolayers having size and density gradients
WO1998017317A2 (de) 1996-10-23 1998-04-30 Skw Trostberg Aktiengesellschaft Verfahren zur herstellung von biologisch aktiven polymernanopartikel-nucleinsäure-konjugaten
US5830986A (en) 1996-10-28 1998-11-03 Massachusetts Institute Of Technology Methods for the synthesis of functionalizable poly(ethylene oxide) star macromolecules
US5900481A (en) 1996-11-06 1999-05-04 Sequenom, Inc. Bead linkers for immobilizing nucleic acids to solid supports
US5922537A (en) 1996-11-08 1999-07-13 N.o slashed.AB Immunoassay, Inc. Nanoparticles biosensor
US5939021A (en) 1997-01-23 1999-08-17 Hansen; W. Peter Homogeneous binding assay
AUPP004497A0 (en) 1997-10-28 1997-11-20 University Of Melbourne, The Stabilized particles
JP2002509443A (ja) 1997-10-31 2002-03-26 ジェン−プローブ・インコーポレーテッド 核酸検出法
US5990479A (en) 1997-11-25 1999-11-23 Regents Of The University Of California Organo Luminescent semiconductor nanocrystal probes for biological applications and process for making and using such probes
US5972615A (en) 1998-01-21 1999-10-26 Urocor, Inc. Biomarkers and targets for diagnosis, prognosis and management of prostate disease
US6287765B1 (en) 1998-05-20 2001-09-11 Molecular Machines, Inc. Methods for detecting and identifying single molecules
US6290839B1 (en) 1998-06-23 2001-09-18 Clinical Micro Sensors, Inc. Systems for electrophoretic transport and detection of analytes
US6406921B1 (en) 1998-07-14 2002-06-18 Zyomyx, Incorporated Protein arrays for high-throughput screening
US6306610B1 (en) 1998-09-18 2001-10-23 Massachusetts Institute Of Technology Biological applications of quantum dots
US6251303B1 (en) 1998-09-18 2001-06-26 Massachusetts Institute Of Technology Water-soluble fluorescent nanocrystals
US6203989B1 (en) 1998-09-30 2001-03-20 Affymetrix, Inc. Methods and compositions for amplifying detectable signals in specific binding assays
IL126776A (en) 1998-10-27 2001-04-30 Technion Res & Dev Foundation A method of investing gold
EP1135682B1 (en) 1998-11-30 2007-07-11 Nanosphere, Inc. Nanoparticles with polymer shells
US6277489B1 (en) 1998-12-04 2001-08-21 The Regents Of The University Of California Support for high performance affinity chromatography and other uses
WO2001000876A1 (en) 1999-06-25 2001-01-04 Mirkin Chad A Nanoparticles having oligonucleotides attached thereto and uses therefor
CA2396113C (en) 2000-01-13 2009-04-07 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
CA2402955C (en) 2000-03-28 2010-03-09 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
AU5667901A (en) 2000-05-11 2001-11-20 Center For Advanced Science And Technology Incubation, Ltd. Polymer composition for forming surface of biosensor
DE60119170T2 (de) 2000-07-11 2007-05-24 Northwestern University, Evanston Nachweismethode mittels verstärkter silberfärbung
CA2418502A1 (en) 2000-08-11 2002-03-07 Nanosphere Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
CN1507357A (zh) 2000-10-31 2004-06-23 PRҩƷ���޹�˾ 提高生物活性分子传递的方法和组合物
WO2002046483A2 (en) 2000-12-06 2002-06-13 Northwestern University Silver stain removal from dna detection chips by cyanide etching or sonication
WO2002046472A2 (en) 2000-12-08 2002-06-13 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5460831A (en) * 1990-06-22 1995-10-24 The Regents Of The University Of California Targeted transfection nanoparticles
US5665582A (en) * 1990-10-29 1997-09-09 Dekalb Genetics Corp. Isolation of biological materials
US5543158A (en) * 1993-07-23 1996-08-06 Massachusetts Institute Of Technology Biodegradable injectable nanoparticles

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP0918885A4 *

Cited By (343)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6902895B2 (en) 1996-07-29 2005-06-07 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6740491B2 (en) 1996-07-29 2004-05-25 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US7169556B2 (en) 1996-07-29 2007-01-30 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US7208587B2 (en) 1996-07-29 2007-04-24 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US7250499B2 (en) 1996-07-29 2007-07-31 Nanosphere Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US7098320B1 (en) 1996-07-29 2006-08-29 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US7259252B2 (en) 1996-07-29 2007-08-21 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6610491B2 (en) 1996-07-29 2003-08-26 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6986989B2 (en) 1996-07-29 2006-01-17 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6984491B2 (en) 1996-07-29 2006-01-10 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6969761B2 (en) 1996-07-29 2005-11-29 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6962786B2 (en) 1996-07-29 2005-11-08 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US8323888B2 (en) 1996-07-29 2012-12-04 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6903207B2 (en) 1996-07-29 2005-06-07 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6878814B2 (en) 1996-07-29 2005-04-12 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6720411B2 (en) 1996-07-29 2004-04-13 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6861221B2 (en) 1996-07-29 2005-03-01 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6828432B2 (en) 1996-07-29 2004-12-07 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6818753B2 (en) 1996-07-29 2004-11-16 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6645721B2 (en) 1996-07-29 2003-11-11 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6812334B1 (en) 1996-07-29 2004-11-02 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6777186B2 (en) 1996-07-29 2004-08-17 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6773884B2 (en) 1996-07-29 2004-08-10 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6767702B2 (en) 1996-07-29 2004-07-27 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6759199B2 (en) 1996-07-29 2004-07-06 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6361944B1 (en) 1996-07-29 2002-03-26 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6750016B2 (en) 1996-07-29 2004-06-15 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6417340B1 (en) 1996-07-29 2002-07-09 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6582921B2 (en) 1996-07-29 2003-06-24 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses thereof
US6730269B2 (en) 1996-07-29 2004-05-04 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6720147B2 (en) 1996-07-29 2004-04-13 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6709825B2 (en) 1996-07-29 2004-03-23 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6682895B2 (en) 1996-07-29 2004-01-27 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6677122B2 (en) 1996-07-29 2004-01-13 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6673548B2 (en) 1996-07-29 2004-01-06 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6495324B1 (en) 1996-07-29 2002-12-17 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6506564B1 (en) 1996-07-29 2003-01-14 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US7381533B2 (en) 1996-11-05 2008-06-03 Clinical Micro Sensors, Inc. Electrodes linked via oligomers to nucleic acids
US7014992B1 (en) 1996-11-05 2006-03-21 Clinical Micro Sensors, Inc. Conductive oligomers attached to electrodes and nucleoside analogs
US5939021A (en) * 1997-01-23 1999-08-17 Hansen; W. Peter Homogeneous binding assay
US6861155B2 (en) 1997-11-13 2005-03-01 Massachusetts Institute Of Technology Highly luminescent color selective nanocrystalline materials
US6207229B1 (en) 1997-11-13 2001-03-27 Massachusetts Institute Of Technology Highly luminescent color-selective materials and method of making thereof
US9441156B2 (en) 1997-11-13 2016-09-13 Massachusetts Institute Of Technology Highly luminescent color-selective nanocrystalline materials
US9790424B2 (en) 1997-11-13 2017-10-17 Massachusetts Institute Of Technology Highly luminescent color-selective nanocrystalline materials
US7125605B2 (en) 1997-11-13 2006-10-24 Massachusetts Institute Of Technology Highly luminescent color-selective nanocrystalline materials
US6322901B1 (en) 1997-11-13 2001-11-27 Massachusetts Institute Of Technology Highly luminescent color-selective nano-crystalline materials
US7566476B2 (en) 1997-11-13 2009-07-28 Massachusetts Institute Of Technology Highly luminescent color-selective nanocrystalline materials
US7374824B2 (en) 1997-11-13 2008-05-20 Massachusetts Institute Of Technology Core-shell nanocrystallite comprising tellurium-containing nanocrystalline core and semiconductor shell
US7060243B2 (en) 1997-11-13 2006-06-13 Massachusetts Institute Of Technology Tellurium-containing nanocrystalline materials
US6927069B2 (en) 1997-11-25 2005-08-09 The Regents Of The University Of California Organo luminescent semiconductor nanocrystal probes for biological applications and process for making and using such probes
US6727065B2 (en) 1997-11-25 2004-04-27 The Regents Of The University Of California Methods of use of semiconductor nanocrystal probes for treating a material
US6423551B1 (en) 1997-11-25 2002-07-23 The Regents Of The University Of California Organo luminescent semiconductor nanocrystal probes for biological applications and process for making and using such probes
US6699723B1 (en) 1997-11-25 2004-03-02 The Regents Of The University Of California Organo luminescent semiconductor nanocrystal probes for biological applications and process for making and using such probes
US9530928B2 (en) 1997-11-25 2016-12-27 The Regents Of The University Of California Semiconductor nanocrystal probes for biological applications and process for making and using such probes
US7314764B2 (en) 1997-11-25 2008-01-01 The Regents Of The University Of California Organo luminescent semiconductor nanocrystal probes for biological applications and process for making and using such probes
US6207392B1 (en) 1997-11-25 2001-03-27 The Regents Of The University Of California Semiconductor nanocrystal probes for biological applications and process for making and using such probes
US7101718B2 (en) 1997-11-25 2006-09-05 The Regents Of The University Of California Organo luminescent semiconductor nanocrystal probes for biological applications and process for making and using such probes
US6531286B2 (en) 1997-12-15 2003-03-11 Gilead Sciences, Inc. Homogeneous detection of a target through nucleic acid ligand-ligand beacon interaction
US6261783B1 (en) 1997-12-15 2001-07-17 Gilead Sciences, Inc. Homogeneous detection of a target through nucleic acid ligand-ligand beacon interaction
US7090804B2 (en) 1998-01-27 2006-08-15 Clinical Mirco Sensors, Inc. Amplification of nucleic acids with electronic detection
US6686150B1 (en) 1998-01-27 2004-02-03 Clinical Micro Sensors, Inc. Amplification of nucleic acids with electronic detection
US6645517B2 (en) 1998-03-11 2003-11-11 William Rice Marsh Rice University Temperature-sensitive polymer/nanoshell composites for photothermally modulated drug delivery
US6699724B1 (en) 1998-03-11 2004-03-02 Wm. Marsh Rice University Metal nanoshells for biosensing applications
US7955561B2 (en) 1998-06-09 2011-06-07 The California Institute Of Technology Colloidal particles used in sensing array
EP1084390A4 (en) * 1998-06-09 2005-07-27 California Inst Of Techn COLLOIDAL PARTICLES USED IN A SENSOR MOSAIC
US7655129B2 (en) 1998-06-23 2010-02-02 Osmetech Technology Inc. Binding acceleration techniques for the detection of analytes
US7087148B1 (en) 1998-06-23 2006-08-08 Clinical Micro Sensors, Inc. Binding acceleration techniques for the detection of analytes
US6264825B1 (en) 1998-06-23 2001-07-24 Clinical Micro Sensors, Inc. Binding acceleration techniques for the detection of analytes
US6290839B1 (en) 1998-06-23 2001-09-18 Clinical Micro Sensors, Inc. Systems for electrophoretic transport and detection of analytes
US6617583B1 (en) 1998-09-18 2003-09-09 Massachusetts Institute Of Technology Inventory control
US6251303B1 (en) 1998-09-18 2001-06-26 Massachusetts Institute Of Technology Water-soluble fluorescent nanocrystals
US6855551B2 (en) 1998-09-18 2005-02-15 Massachusetts Institute Of Technology Biological applications of quantum dots
US6444143B2 (en) 1998-09-18 2002-09-03 Massachusetts Institute Of Technology Water-soluble fluorescent nanocrystals
WO2000017642A3 (en) * 1998-09-18 2000-07-13 Massachusetts Inst Technology Biological applications of semiconductor nanocrystals
US6602671B1 (en) 1998-09-18 2003-08-05 Massachusetts Institute Of Technology Semiconductor nanocrystals for inventory control
JP2003523718A (ja) * 1998-09-18 2003-08-12 マサチューセッツ インスティテュート オブ テクノロジー 在庫管理
EP1271154A3 (en) * 1998-09-18 2005-08-17 Massachusetts Institute Of Technology Biological applications of semiconductor nanocrystals
US6177555B1 (en) 1998-09-18 2001-01-23 Nexstar Pharmaceuticals, Inc. Homogeneous detection of a target through nucleic acid ligand-ligand beacon interaction
EP0990903A1 (en) * 1998-09-18 2000-04-05 Massachusetts Institute Of Technology Biological applications of semiconductor nanocrystals
US6326144B1 (en) 1998-09-18 2001-12-04 Massachusetts Institute Of Technology Biological applications of quantum dots
US6774361B2 (en) 1998-09-18 2004-08-10 Massachusetts Institute Of Technology Inventory control
US7235361B2 (en) 1998-09-18 2007-06-26 Massachusetts Institute Of Technology Biological applications of quantum dots
US6306610B1 (en) 1998-09-18 2001-10-23 Massachusetts Institute Of Technology Biological applications of quantum dots
WO2000017103A3 (en) * 1998-09-18 2000-08-31 Massachusetts Inst Technology Inventory control
US7943552B2 (en) 1998-09-18 2011-05-17 Massachusetts Institute Of Technology Inventory control
US6319426B1 (en) 1998-09-18 2001-11-20 Massachusetts Institute Of Technology Water-soluble fluorescent semiconductor nanocrystals
WO2000029617A3 (en) * 1998-09-24 2000-11-09 Advanced Res & Tech Inst Water-soluble luminescent quantum dots and bioconjugates thereof
US6468808B1 (en) 1998-09-24 2002-10-22 Advanced Research And Technology Institute, Inc. Water-soluble luminescent quantum dots and biomolecular conjugates thereof and related compositions and method of use
JP2002530630A (ja) * 1998-09-24 2002-09-17 アドヴァンスト リサーチ アンド テクノロジー インスティチュート、インコーポレイティッド 水溶性発光量子ドットおよびその生体分子コンジュゲート
US7192785B2 (en) 1998-09-24 2007-03-20 Indiana University Research And Technology Corporation Water-soluble luminescent quantum dots and biomolecular conjugates thereof and related compositions and methods of use
US8012743B2 (en) 1998-10-27 2011-09-06 Osmetech Technology Inc. Detection of target analytes using particles and electrodes
US6541617B1 (en) 1998-10-27 2003-04-01 Clinical Micro Sensors, Inc. Detection of target analytes using particles and electrodes
EP1157133A4 (en) * 1998-11-10 2004-05-19 Biocrystal Ltd POLYNUCLEOTIDE STRANDS CONTAINING NANOCRYSTALS AND THEIR USE FOR THE FORMATION OF DENDRIMERS IN A SIGNAL REINFORCEMENT SYSTEM
WO2000028088A1 (en) 1998-11-10 2000-05-18 Biocrystal Limited Nanocrystals having polynucleotide strands and their use to form dendrimers in a signal amplification system
US6934022B1 (en) * 1998-12-17 2005-08-23 Leica Microsystems Heidelberg Gmbh Method for differentiated investigation of diverse structures in preferably biological preparations
EP1147416B1 (en) * 1999-01-23 2013-05-29 Minerva Biotechnologies Corporation Assays involving colloids and non-colloidal structures
EP2320231A3 (en) * 1999-01-23 2012-07-18 Minerva Biotechnologies Corporation Assays involving sam-modified colloids and non-colloidal structures
EP2287614A1 (en) * 1999-03-01 2011-02-23 The Regents of The University of California Semiconductor nanocrystal probes for biological applications
EP2180321A1 (en) * 1999-03-01 2010-04-28 The Regents Of The University Of California Semiconductor nanocrystal probes for biological applications
WO2000055631A1 (en) * 1999-03-01 2000-09-21 The Regents Of The University Of California Semiconductor nanocrystal probes for biological applications
US7223367B1 (en) 1999-03-26 2007-05-29 Sony International (Europe) Gmbh Chemical sensor arrangement
EP1039291A1 (en) * 1999-03-26 2000-09-27 Sony International (Europe) GmbH Optochemical sensor and method for its construction
US9309368B2 (en) 1999-04-09 2016-04-12 Life Technologies As Process for the preparation of monodisperse polymer particles
US8658733B2 (en) 1999-04-09 2014-02-25 Life Technologies As Process for the preparation of monodisperse polymer particles
US6630307B2 (en) 1999-05-07 2003-10-07 Quantum Dot Corporation Method of detecting an analyte in a sample using semiconductor nanocrystals as a detectable label
US6274323B1 (en) 1999-05-07 2001-08-14 Quantum Dot Corporation Method of detecting an analyte in a sample using semiconductor nanocrystals as a detectable label
WO2000068692A1 (en) * 1999-05-07 2000-11-16 Quantum Dot Corporation A method of detecting an analyte using semiconductor nanocrystals
US7321829B2 (en) 1999-05-19 2008-01-22 Eppendorf Array Technologies (E.A.T.) Method for the identification and/or the quantification of a target compound obtained from a biological sample upon chips
EP1425411A4 (en) * 1999-06-07 2004-06-23 Yeda Res & Dev DNA MOLECULARALLY CONTROLLED SEMICONDUCTOR RESISTANCE BASED DETECTOR
JP2003503699A (ja) * 1999-06-25 2003-01-28 ナノスフェアー インコーポレイテッド オリゴヌクレオチドが付着しているナノ粒子およびその利用法
EP1198591A4 (en) * 1999-06-25 2007-10-24 Nanosphere Inc NANOPARTICLES WITH BONDED OLIGONUCLEOTIDES AND ITS USES
WO2001006257A1 (en) * 1999-07-16 2001-01-25 Wm. Marsh Rice University Metal nanoshells for biosensing applications
JP2003504642A (ja) * 1999-07-16 2003-02-04 ダブリューエム・マーシュ・ライス・ユニバーシティー 生体感知用途のための金属微細シェル
US7935481B1 (en) 1999-07-26 2011-05-03 Osmetech Technology Inc. Sequence determination of nucleic acids using electronic detection
US6579726B1 (en) 1999-07-30 2003-06-17 Surromed, Inc. Instruments, methods and reagents for surface plasmon resonance
US6579721B1 (en) 1999-07-30 2003-06-17 Surromed, Inc. Biosensing using surface plasmon resonance
US9201013B2 (en) 1999-10-06 2015-12-01 Becton, Dickinson And Company Method for tagging material with surface-enhanced spectroscopy (SES)-active composite nanoparticles
US7192778B2 (en) 1999-10-06 2007-03-20 Natan Michael J Surface enhanced spectroscopy-active composite nanoparticles
US7443489B2 (en) 1999-10-06 2008-10-28 Oxonica, Inc. Surface enhanced spectroscopy-active composite nanoparticles
US8497131B2 (en) 1999-10-06 2013-07-30 Becton, Dickinson And Company Surface enhanced spectroscopy-active composite nanoparticles comprising Raman-active reporter molecules
US8918161B2 (en) 1999-10-06 2014-12-23 Becton, Dickinson And Company Methods of use for surface enhanced spectroscopy-active composite nanoparticles
US6960467B2 (en) 1999-11-12 2005-11-01 Clinical Micro Sensors, Inc. Biochannel assay for hybridization with biomaterial
US6875619B2 (en) 1999-11-12 2005-04-05 Motorola, Inc. Microfluidic devices comprising biochannels
WO2001046474A1 (en) 1999-12-21 2001-06-28 Ortho-Clinical Diagnostics, Inc. Detection of nucleic acids
EP1242626A4 (en) * 1999-12-21 2005-03-16 Ortho Clinical Diagnostics Inc DETECTION OF NUCLEIC ACIDS
US7172897B2 (en) 2000-01-11 2007-02-06 Clinical Micro Sensors, Inc. Devices and methods for biochip multiplexing
JP2004501340A (ja) * 2000-01-13 2004-01-15 ナノスフェアー インコーポレイテッド オリゴヌクレオチドを付着させたナノ粒子とその使用方法
WO2001051665A3 (en) * 2000-01-13 2003-01-30 Nanosphere Inc Nanoparticles having oligonucleotides attached thereto and uses therefor
WO2001057522A3 (en) * 2000-02-07 2002-02-14 Quantum Dot Corp Immunochromatographic methods which employ semiconductor nanocrystals
EP1255866A4 (en) * 2000-02-16 2004-12-22 Quantum Dot Corp MICROARRAY METHODS USING SEMICONDUCTOR NANOCRYSTALS
JP2003522962A (ja) * 2000-02-16 2003-07-29 クァンタム・ドット・コーポレイション 半導体ナノクリスタルを使用するマイクロアレイ法
EP1266032A4 (en) * 2000-02-18 2005-01-19 Biocrystal Ltd FUNCTIONALIZED ENCAPSULATED FLUORESCENT NANOCRYSTALS
US8124590B2 (en) 2000-03-10 2012-02-28 Dynavax Technologies Corporation Biodegradable immunomodulatory formulations and methods for use thereof
US7129222B2 (en) 2000-03-10 2006-10-31 Dynavax Technologies Corporation Immunomodulatory formulations and methods for use thereof
US7250403B2 (en) 2000-03-10 2007-07-31 Dynavax Technologies Corporation Biodegradable immunomodulatory formulations and methods for use thereof
AU2001245628B2 (en) * 2000-03-10 2005-11-10 Dynavax Technologies Corporation Immunomodulatory formulations and methods for use thereof
US7183111B2 (en) 2000-03-10 2007-02-27 Dynavax Technologies Corporation Immunomodulatory formulations and methods for use thereof
US8669237B2 (en) 2000-03-10 2014-03-11 Dynavax Technologies Corporation Biodegradable immunomodulatory formulations and methods for use thereof
US6819692B2 (en) 2000-03-14 2004-11-16 Massachusetts Institute Of Technology Optical amplifiers and lasers
EP1186659A4 (en) * 2000-03-16 2002-07-17 Matsushita Electric Industrial Co Ltd NUCLEOTIDE DETECTOR, METHOD FOR THE PRODUCTION THEREOF AND METHOD FOR PRODUCING A MEMBRANE FROM FINE PARTICLES
US7129047B2 (en) 2000-03-16 2006-10-31 Matsushita Electric Industrial Co., Ltd. Method for manufacturing a nucleotide detector
US7470379B2 (en) 2000-03-20 2008-12-30 Massachusetts Institute Of Technology Inorganic particle conjugates
US6921496B2 (en) 2000-03-20 2005-07-26 Massachusetts Institute Of Technology Inorganic particle conjugates
US8192646B2 (en) 2000-03-20 2012-06-05 Massachusetts Institute Of Technology Inorganic particle conjugates
US8034259B2 (en) 2000-03-20 2011-10-11 Massachusetts Institute Of Technology Inorganic particle conjugates
US7323309B2 (en) 2000-03-28 2008-01-29 Northwestern University Bio-barcodes based on oligonucleotide-modified particles
US6974669B2 (en) 2000-03-28 2005-12-13 Nanosphere, Inc. Bio-barcodes based on oligonucleotide-modified nanoparticles
WO2001073123A3 (en) * 2000-03-28 2003-02-06 Nanosphere Inc Nanoparticles having oligonucleotides attached thereto and uses therefor
JP2006288406A (ja) * 2000-03-28 2006-10-26 Nanosphere Inc オリゴヌクレオチドを付着させたナノ粒子とその使用方法
WO2001090225A1 (en) * 2000-05-22 2001-11-29 Kabushiki Kaisya Advance Novel method for forming polymer pattern
US8206915B2 (en) 2000-06-27 2012-06-26 Board Of Trustees Of The University Of Illinois Nucleic acid enzyme biosensors for ions
US7192708B2 (en) 2000-06-27 2007-03-20 The Board Of Trustees Of The University Of Illinois Nucleic acid enzyme biosensors for ions
US7902353B2 (en) 2000-06-27 2011-03-08 The Board Of Trustees Of The University Of Illinois Nucleic acid enzyme biosensors for ions
WO2002002810A3 (de) * 2000-07-01 2002-09-19 Clondiag Chip Tech Gmbh Verfahren zum qualitativen und/oder quantitativen nachweis von molekularen wechselwirkungen auf sonden-arrays
US6602669B2 (en) 2000-07-11 2003-08-05 Northwestern University Method of detection by enhancement of silver staining
WO2002018643A3 (en) * 2000-08-11 2003-09-04 Nanosphere Inc Nanoparticles having oligonucleotides attached thereto and uses therefor
WO2002028507A2 (en) 2000-10-03 2002-04-11 Minerva Biotechnologies Corporation Electronic detection of interaction based on the interruption of flow
US7615340B2 (en) 2000-10-03 2009-11-10 Minerva Biotechnologies Corporation Electronic detection of interaction and detection of interaction based on the interruption of flow
US7585682B2 (en) 2000-10-03 2009-09-08 Minerva Biotechologies Corporation Magnetic in situ dilution
WO2002031191A3 (en) * 2000-10-12 2003-09-12 Yissum Res Dev Co Dendritically amplified detection method
US7887885B2 (en) 2000-10-20 2011-02-15 Northwestern University Nanolithography methods and products therefor and produced thereby
JP2005513999A (ja) * 2000-11-15 2005-05-19 ミナーヴァ・バイオテクノロジーズ・コーポレーション オリゴヌクレオチド識別子
JP2010142244A (ja) * 2000-11-15 2010-07-01 Minerva Biotechnologies Corp オリゴヌクレオチド識別子
EP2360275A1 (en) * 2000-11-15 2011-08-24 Minerva Biotechnologies Corporation Oligonucleotide identifiers
US6726847B2 (en) 2000-12-06 2004-04-27 Northwestern University Silver stain removal by chemical etching and sonication
WO2002046483A3 (en) * 2000-12-06 2003-03-06 Univ Northwestern Silver stain removal from dna detection chips by cyanide etching or sonication
WO2002046472A3 (en) * 2000-12-08 2003-09-04 Nanosphere Inc Nanoparticles having oligonucleotides attached thereto and uses therefor
WO2002048399A3 (de) * 2000-12-13 2003-08-21 Inst Physikalische Hochtech Ev Verfahren zum simultanen positionsspezifischen schneiden von fadenförmigen organischen molekülketten, insbesonere dna
US6861263B2 (en) 2001-01-26 2005-03-01 Surromed, Inc. Surface-enhanced spectroscopy-active sandwich nanoparticles
WO2002079764A1 (en) * 2001-01-26 2002-10-10 Nanoplex Technologies, Inc. Surface-enhanced spectroscopy-active sandwich nanoparticles
US9297766B2 (en) 2001-01-26 2016-03-29 Becton, Dickinson And Company Method of tagging materials with surface-enhanced spectroscopy-active sandwich particles
US7326365B2 (en) 2001-02-09 2008-02-05 Massachusetts Institute Of Technology Composite material including nanocrystals and methods of making
US7690842B2 (en) 2001-02-09 2010-04-06 Massachusetts Institute Of Technology Composite material including nanocrystals and methods of making
EP1379693A4 (en) * 2001-03-28 2004-12-22 Nanosphere Inc BIO STICK CODES BASED ON OLIGONUCLEOTIDE-MODIFIED PARTICLES
EP1392872A4 (en) * 2001-05-25 2004-08-11 Univ Northwestern NON-ALLOY CORE SHELL NANOPARTICLES
AU2002341539B2 (en) * 2001-05-25 2007-06-28 Northwestern University Non-alloying core shell nanoparticles
US7829350B2 (en) 2001-06-06 2010-11-09 The General Hospital Corporation Magnetic-nanoparticle conjugates and methods of use
US8569078B2 (en) 2001-06-06 2013-10-29 The General Hospital Corporation Magnetic-nanoparticle conjugates and methods of use
US8492094B2 (en) 2001-07-03 2013-07-23 The Institute For Systems Biology Methods for detection and quantification of analytes in complex mixtures
US9920380B2 (en) 2001-07-03 2018-03-20 The Institute For Systems Biology Methods for detection and quantification of analytes in complex mixtures
US8148512B2 (en) 2001-07-03 2012-04-03 The Institute For Systems Biology Methods for detection and quantification of analytes in complex mixtures
US7919237B2 (en) * 2001-07-03 2011-04-05 Nanostring Technologies, Inc. Methods for detection and quantification of analytes in complex mixtures
EP1483794A4 (en) * 2001-07-17 2006-05-03 Ciphergen Biosystems Inc ADSORBENT CHIP BASED ON LATEX
US7517496B2 (en) 2001-07-17 2009-04-14 Bio-Rad Laboratories, Inc. Latex based adsorbent chip
US7829275B2 (en) 2001-07-20 2010-11-09 North Carolina State University Light addressable electrochemical detection of duplex structures
US7553621B2 (en) 2001-09-07 2009-06-30 Biomerieux Reading, detection or quantification method, hybrids or complexes used in said method and the biochip using same
US7190870B2 (en) 2001-09-17 2007-03-13 Massachusetts Institute Of Technology Semiconductor nanocrystal composite
US7186814B2 (en) 2001-11-09 2007-03-06 Nanosphere, Inc. Bioconjugate-nanoparticle probes
US7361310B1 (en) 2001-11-30 2008-04-22 Northwestern University Direct write nanolithographic deposition of nucleic acids from nanoscopic tips
US7951334B2 (en) 2001-11-30 2011-05-31 Northwestern University Direct write nanolithographic deposition of nucleic acids from nanoscopic tips
EP1495139A4 (en) * 2002-03-29 2006-06-28 Genentech Inc METHOD AND COMPOSITIONS FOR DETECTING AND QUANTIFYING NUCLEIC ACID ANALYSTS
US7985539B2 (en) 2002-05-07 2011-07-26 Northwestern University Nanoparticle probes with raman spectroscopic fingerprints for analyte detection
US8043802B2 (en) 2002-05-10 2011-10-25 The Board Of Trustees Of The University Of Illinois Fluorescence based biosensor
US7332283B2 (en) 2002-05-10 2008-02-19 The Board Of Trustees Of The University Of Illinois Fluorescence based biosensor
US7906320B2 (en) 2002-05-10 2011-03-15 The Board Of Trustees Of The University Of Illinois Fluorescence based biosensor
US7534560B2 (en) 2002-05-10 2009-05-19 The Board Of Trustees Of The University Of Illinois Simple catalytic DNA biosensors for ions based on color changes
EP1511862A4 (en) * 2002-05-14 2006-01-18 Nanosphere Inc ELECTRICAL DETECTION OF DNA HYBRIDIZATION AND SPECIFIC BINDING EVENTS
US7297553B2 (en) 2002-05-28 2007-11-20 Nanosphere, Inc. Method for attachment of silylated molecules to glass surfaces
US7485469B2 (en) 2002-05-28 2009-02-03 Nanosphere. Inc. Method for attachment of silylated molecules to glass surfaces
US7476550B2 (en) 2002-05-28 2009-01-13 Nanosphere, Inc. Method for attachment of silylated molecules to glass surfaces
US7482173B2 (en) 2002-05-28 2009-01-27 Nanosphere, Inc. Method for attachment of silylated molecules to glass surfaces
US7485470B2 (en) 2002-05-28 2009-02-03 Nanosphere, Inc. Method for attachment of silylated molecules to glass surfaces
EP1532274A4 (en) * 2002-06-28 2006-09-27 Purdue Research Foundation MAGNETIC NANOMATERIALS AND METHODS FOR DETECTING BIOLOGICAL MATERIALS
US7253277B2 (en) 2002-07-02 2007-08-07 Nanosphere, Inc. Nanoparticle polyanion conjugates and methods of use thereof in detecting analytes
US7319709B2 (en) 2002-07-23 2008-01-15 Massachusetts Institute Of Technology Creating photon atoms
US7390568B2 (en) 2002-08-13 2008-06-24 Massachusetts Institute Of Technology Semiconductor nanocrystal heterostructures having specific charge carrier confinement
US9410959B2 (en) 2002-08-13 2016-08-09 Massachusetts Institute Of Technology Devices comprising coated semiconductor nanocrystal heterostructures
US7825405B2 (en) 2002-08-13 2010-11-02 Massachusetts Institute Of Technology Devices comprising coated semiconductor nanocrystals heterostructures
US8277942B2 (en) 2002-08-13 2012-10-02 Massachusetts Institute Of Technology Semiconductor nanocrystal heterostructures
US7601424B2 (en) 2002-08-15 2009-10-13 Massachusetts Institute Of Technology Stabilized semiconductor nanocrystals
US8481162B2 (en) 2002-08-15 2013-07-09 Massachusetts Institute Of Technology Stabilized semiconductor nanocrystals comprising a coating of polydentate ligand
US7160613B2 (en) 2002-08-15 2007-01-09 Massachusetts Institute Of Technology Stabilized semiconductor nanocrystals
US7441703B2 (en) 2002-08-20 2008-10-28 Illumina, Inc. Optical reader for diffraction grating-based encoded optical identification elements
US7619819B2 (en) 2002-08-20 2009-11-17 Illumina, Inc. Method and apparatus for drug product tracking using encoded optical identification elements
US7399643B2 (en) 2002-09-12 2008-07-15 Cyvera Corporation Method and apparatus for aligning microbeads in order to interrogate the same
US7375890B2 (en) 2002-09-12 2008-05-20 Cyvera Corporation Method of manufacturing of a diffraction grating-based optical identification element
US7361821B2 (en) 2002-09-20 2008-04-22 Intel Corporation Controlled alignment of nanobarcodes encoding specific information for scanning probe microscopy (SPM) reading
US7531726B2 (en) 2002-09-20 2009-05-12 Intel Corporation Controlled alignment of nanobarcodes encoding specific information for scanning probe microscopy (SPM) reading
WO2004027095A1 (en) * 2002-09-20 2004-04-01 Intel Corporation Controlled alignment of nanobarcodes encoding specific information for scanning probe microscopy (spm) reading
US7476786B2 (en) 2002-09-20 2009-01-13 Intel Corporation Controlled alignment of nano-barcodes encoding specific information for scanning probe microscopy (SPM) reading
EP1546983A4 (en) * 2002-09-20 2006-03-15 Intel Corp CONTROLLED ALIGNMENT OF SPECIFIC INFORMATION FOR MEASURES OF RASTER TERM MICROSCOPY (SPM) CODING NANO BAR CODES
US7705222B2 (en) 2002-09-20 2010-04-27 Intel Corporation Controlled alignment of nano-barcodes encoding specific information for scanning probe microscopy (SPM)
US9268983B2 (en) 2003-01-22 2016-02-23 Illumina, Inc. Optical system and method for reading encoded microbeads
US7138121B2 (en) 2003-01-23 2006-11-21 Spangler Brenda D Biosensors utilizing dendrimer-immobilized ligands and there use thereof
US7181266B2 (en) 2003-03-04 2007-02-20 Massachusetts Institute Of Technology Materials and methods for near-infrared and infrared lymph node mapping
US7612185B2 (en) 2003-03-07 2009-11-03 The Board Of Trustees Of The University Of Illinois Nucleic acid biosensors
WO2004086046A1 (en) * 2003-03-25 2004-10-07 Biacore Ab Immobilization method and kit therefor
US7912653B1 (en) 2003-04-17 2011-03-22 Nanosys, Inc. Nanocrystal taggants
US7917298B1 (en) 2003-04-17 2011-03-29 Nanosys, Inc. Nanocrystal taggants
EP1634050A4 (en) * 2003-05-16 2008-06-18 Univ Rochester COLORIMETRIC AND FLUORESCENCE METHODS FOR THE PERCEPTION OF OLIGONUCLEOTIDES
JP2007516426A (ja) * 2003-05-16 2007-06-21 ユニバーシティー オブ ロチェスター オリゴヌクレオチドの検出のための比色法および蛍光法
WO2005003394A3 (en) * 2003-06-27 2005-07-28 Nanosphere Inc Bio-barcode based detection of target analytes
WO2005003394A2 (en) 2003-06-27 2005-01-13 Nanosphere, Inc. Bio-barcode based detection of target analytes
US7229497B2 (en) 2003-08-26 2007-06-12 Massachusetts Institute Of Technology Method of preparing nanocrystals
WO2005042785A1 (en) * 2003-10-30 2005-05-12 North Carolina State University Electrochemical detection of nucleic acid hybridization
EP1712622A4 (en) * 2003-12-29 2007-06-13 Universal Bio Research Co Ltd METHOD FOR DETECTING TARGET SUBSTANCE
US7485419B2 (en) 2004-01-13 2009-02-03 The Board Of Trustees Of The University Of Illinois Biosensors based on directed assembly of particles
US7433123B2 (en) 2004-02-19 2008-10-07 Illumina, Inc. Optical identification element having non-waveguide photosensitive substrate with diffraction grating therein
AU2005325273B2 (en) * 2004-05-12 2009-07-02 Nanosphere, Inc. Bio-barcode based detection of target analytes
WO2006078289A3 (en) * 2004-05-12 2007-02-08 Nanosphere Inc Bio-barcode based detection of target analytes
EP2330208A1 (en) * 2004-05-24 2011-06-08 Midatech Ltd. Nanoparticles comprising RNA ligands
WO2005116226A3 (en) * 2004-05-24 2007-11-29 Midatech Ltd Nanoparticles comprising rna ligands
CN102872463A (zh) * 2004-05-24 2013-01-16 Mida科技有限公司 含有rna配体的纳米颗粒
US9708184B2 (en) 2004-07-26 2017-07-18 Massachusetts Institute Of Technology Microspheres including nanoparticles
US7449237B2 (en) 2004-07-26 2008-11-11 Massachusetts Institute Of Technology Microspheres including nanoparticles in the peripheral region
US7862892B2 (en) 2004-07-26 2011-01-04 Massachusetts Institute Of Technology Microspheres including nanoparticles
US8092859B2 (en) 2004-08-17 2012-01-10 Life Technologies Corporation Synthesis of highly luminescent colloidal particles
US7316967B2 (en) 2004-09-24 2008-01-08 Massachusetts Institute Of Technology Flow method and reactor for manufacturing noncrystals
US7604173B2 (en) 2004-11-16 2009-10-20 Illumina, Inc. Holographically encoded elements for microarray and other tagging labeling applications, and method and apparatus for making and reading the same
US7602952B2 (en) 2004-11-16 2009-10-13 Illumina, Inc. Scanner having spatial light modulator
US7508608B2 (en) 2004-11-17 2009-03-24 Illumina, Inc. Lithographically fabricated holographic optical identification element
US8748933B2 (en) 2005-01-11 2014-06-10 Massachusetts Institute Of Technology Nanocrystals including III-V semiconductors
US8134175B2 (en) 2005-01-11 2012-03-13 Massachusetts Institute Of Technology Nanocrystals including III-V semiconductors
EP1848823A4 (en) * 2005-01-21 2008-06-25 Univ Rochester METHOD FOR SEPARATING SHORT INDIVIDUAL STRUCTURAL NUCLEIC ACID OF LONG SINGLE AND DOUBLE STRANDUCLEIC ACID AND ASSOCIATED BIOMOLECULAR TESTS
WO2006104979A3 (en) * 2005-03-29 2007-03-15 Nanosphere Inc Method for detecting a target analyte
US8535949B2 (en) 2005-05-09 2013-09-17 The General Hospital Corporation Water relaxation-based sensors
US8999947B2 (en) 2005-06-14 2015-04-07 Northwestern University Nucleic acid functionalized nanoparticles for therapeutic applications
US10370661B2 (en) 2005-06-14 2019-08-06 Northwestern University Nucleic acid functionalized nanoparticles for therapeutic applications
US9719089B2 (en) 2005-06-14 2017-08-01 Northwestern University Nucleic acid functionalized nonoparticles for therapeutic applications
US7892734B2 (en) 2005-08-11 2011-02-22 The Board Of Trustees Of The University Of Illinois Aptamer based colorimetric sensor systems
US8470532B2 (en) 2005-08-11 2013-06-25 The Board Of Trustees Of The University Of Illinois Aptamer-based colorimetric sensor systems
US8102176B2 (en) 2005-08-31 2012-01-24 T2 Biosystems, Inc. NMR device for detection of analytes
US8344731B2 (en) 2005-08-31 2013-01-01 T2 Biosystems, Inc. NMR device for detection of analytes
US8624592B2 (en) 2005-08-31 2014-01-07 T2 Biosystems, Inc. NMR device for detection of analytes
US7564245B2 (en) 2005-08-31 2009-07-21 T2 Biosystems, Inc. NMR device for detection of analytes
US8310231B2 (en) 2005-08-31 2012-11-13 T2 Biosystems, Inc. NMR device for detection of analytes
US8334693B2 (en) 2005-08-31 2012-12-18 T2 Biosystems, Inc. NMR device for detection of analytes
US8310232B2 (en) 2005-08-31 2012-11-13 T2 Biosystems, Inc. NMR device for detection of analytes
US7623624B2 (en) 2005-11-22 2009-11-24 Illumina, Inc. Method and apparatus for labeling using optical identification elements characterized by X-ray diffraction
US8409863B2 (en) 2005-12-14 2013-04-02 Becton, Dickinson And Company Nanoparticulate chemical sensors using SERS
US9371563B2 (en) 2005-12-23 2016-06-21 Nanostring Technologies, Inc. Nanoreporters and methods of manufacturing and use thereof
US9890419B2 (en) 2005-12-23 2018-02-13 Nanostring Technologies, Inc. Nanoreporters and methods of manufacturing and use thereof
US7394094B2 (en) 2005-12-29 2008-07-01 Massachusetts Institute Of Technology Semiconductor nanocrystal heterostructures
US7723100B2 (en) 2006-01-13 2010-05-25 Becton, Dickinson And Company Polymer coated SERS nanotag
US7799554B2 (en) 2006-03-16 2010-09-21 The Board Of Trustees Of The University Of Illinois Lateral flow devices
US7830575B2 (en) 2006-04-10 2010-11-09 Illumina, Inc. Optical scanner with improved scan time
US10370656B2 (en) 2006-06-08 2019-08-06 Northwestern University Nucleic acid functionalized nanoparticles for therapeutic applications
US9506056B2 (en) 2006-06-08 2016-11-29 Northwestern University Nucleic acid functionalized nanoparticles for therapeutic applications
US7964347B2 (en) * 2006-06-15 2011-06-21 Krassen Dimitrov Labels for electronic detection of individual molecules and methods for their detection
US8431884B2 (en) 2006-11-07 2013-04-30 New York University Holographic microfabrication and characterization system for soft matter and biological systems
US7847238B2 (en) 2006-11-07 2010-12-07 New York University Holographic microfabrication and characterization system for soft matter and biological systems
US8836334B2 (en) 2006-11-08 2014-09-16 T2 Biosystems, Inc. NMR systems for in vivo detection of analytes
US8368402B2 (en) 2006-11-08 2013-02-05 T2 Biosystems, Inc. NMR systems for in vivo detection of analytes
WO2008076414A3 (en) * 2006-12-15 2008-10-09 Univ New York Self-replicating materials
US9206471B2 (en) 2006-12-15 2015-12-08 New York University Self-replicating materials
US8415461B2 (en) 2007-01-19 2013-04-09 The Board Of Trustees Of The University Of Illinois Amphiphilic substances and functionalized lipid vesicles including the same
US9890427B2 (en) 2007-02-09 2018-02-13 Northwestern University Particles for detecting intracellular targets
EP2129803A4 (en) * 2007-02-27 2010-11-03 Univ Northwestern APPLICATION OF MOLECULES TO NANOPARTICLES
US8058415B2 (en) 2007-04-24 2011-11-15 The Board Of Trustees Of The University Of Illinois Aptamer- and nucleic acid enzyme-based systems for simultaneous detection of multiple analytes
US7807372B2 (en) 2007-06-04 2010-10-05 Northwestern University Screening sequence selectivity of oligonucleotide-binding molecules using nanoparticle based colorimetric assay
US8409800B2 (en) 2007-07-16 2013-04-02 The Board Of Trustees Of The University Of Illinois Nucleic acid based fluorescent sensor for copper detection
US8568690B2 (en) 2007-07-31 2013-10-29 The Board Of Trustees Of The University Of Illinois MRI contrast agents and high-throughput screening by MRI
US8367416B2 (en) 2007-08-10 2013-02-05 The Board Of Trustees Of The University Of Illinois Nucleic acid based fluorescent sensor for mercury detection
US9097644B2 (en) 2007-08-17 2015-08-04 Massachusetts Institute Of Technology Magnetic resonance-based viscometers and methods
US8421458B2 (en) 2007-09-28 2013-04-16 T2 Biosystems, Inc. NMR diagnostics by means of a plastic sample container
US8519708B2 (en) 2007-11-06 2013-08-27 T2 Biosystems, Inc. Small magnet and RF coil for magnetic resonance relaxometry
US9632154B2 (en) 2007-11-06 2017-04-25 T2 Biosystems, Inc. Small magnet and RF coil for magnetic resonance relaxometry
US8174742B2 (en) 2008-03-14 2012-05-08 New York University System for applying optical forces from phase gradients
US8062893B2 (en) 2008-10-10 2011-11-22 The Board Of Trustees Of The University Of Illinois Fluorescent sensor for mercury
US9157974B2 (en) 2008-10-29 2015-10-13 T2 Biosystems, Inc. NMR detection of coagulation time
US10126314B2 (en) 2008-10-29 2018-11-13 T2 Biosystems, Inc. NMR detection of coagulation time
US9844562B2 (en) 2008-11-24 2017-12-19 Northwestern University Polyvalent RNA-nanoparticle compositions
US10391116B2 (en) 2008-11-24 2019-08-27 Northwestern University Polyvalent RNA-nanoparticle compositions
US9139827B2 (en) 2008-11-24 2015-09-22 Northwestern University Polyvalent RNA-nanoparticle compositions
US10098958B2 (en) 2009-01-08 2018-10-16 Northwestern University Delivery of oligonucleotide functionalized nanoparticles
US11633503B2 (en) 2009-01-08 2023-04-25 Northwestern University Delivery of oligonucleotide-functionalized nanoparticles
WO2010089098A1 (de) 2009-02-05 2010-08-12 Deklatec Gmbh Verfahren und mittel für die tuberkulose diagnostik
US9757475B2 (en) 2009-10-30 2017-09-12 Northwestern University Templated nanoconjugates
US9376690B2 (en) 2009-10-30 2016-06-28 Northwestern University Templated nanoconjugates
WO2011079356A1 (pt) * 2009-12-30 2011-07-07 Universidade Federal De Minas Gerais - Ufmg Conjugado de nanotubos de carbono para inibir estruturas de infecção de patógenos em vegetais
US10328026B2 (en) 2010-01-19 2019-06-25 Northwestern University Synthetic nanostructures including nucleic acids and/or other entities
US11285106B2 (en) 2010-01-19 2022-03-29 Northwestern University Synthetic nanostructures including nucleic acids and/or other entities
US8815156B2 (en) 2010-07-19 2014-08-26 Andalyze, Inc. Sensor housing and reagent chemistry
US9714940B2 (en) 2010-10-22 2017-07-25 T2 Biosystems, Inc. NMR systems and methods for the rapid detection of analytes
US9702852B2 (en) 2010-10-22 2017-07-11 T2 Biosystems, Inc. NMR systems and methods for the rapid detection of analytes
US9488648B2 (en) 2010-10-22 2016-11-08 T2 Biosystems, Inc. NMR systems and methods for the rapid detection of analytes
US9046493B2 (en) 2010-10-22 2015-06-02 T2 Biosystems, Inc. NMR systems and methods for the rapid detection of analytes
US10697984B2 (en) 2011-07-13 2020-06-30 T2 Biosystems, Inc. NMR methods for monitoring blood clot formation
US9797914B2 (en) 2011-07-13 2017-10-24 T2 Biosystems, Inc. NMR methods for monitoring blood clot formation
US9599627B2 (en) 2011-07-13 2017-03-21 T2 Biosystems, Inc. NMR methods for monitoring blood clot formation
US9889209B2 (en) 2011-09-14 2018-02-13 Northwestern University Nanoconjugates able to cross the blood-brain barrier
US10398784B2 (en) 2011-09-14 2019-09-03 Northwestern Univerity Nanoconjugates able to cross the blood-brain barrier
US10620205B2 (en) 2011-09-21 2020-04-14 T2 Biosystems, Inc. NMR methods for endotoxin analysis
US9051583B2 (en) 2011-12-19 2015-06-09 Northwestern University Modified silica shell particles, and methods of making and using the same
US9562271B2 (en) 2012-04-20 2017-02-07 T2 Biosystems, Inc. Compositions and methods for detection of Candida species
US11098378B2 (en) 2012-04-20 2021-08-24 T2 Biosystems, Inc. Compositions and methods for detection of candida species
US9334301B2 (en) 2012-05-21 2016-05-10 Samsung Electronics Co., Ltd. Nucleic acid construct and method of preparing nanoparticle using the same
EP2666778A1 (en) * 2012-05-21 2013-11-27 Samsung Electronics Co., Ltd Nanoparticle, nanoparticle complex and method of preparing a nanoparticle
US9739733B2 (en) 2012-12-07 2017-08-22 T2 Biosystems, Inc. Methods for monitoring tight clot formation
WO2015013675A1 (en) 2013-07-25 2015-01-29 Aurasense Therapeutics, Llc Spherical nucleic acid-based constructs as immunoregulatory agents
US10301622B2 (en) 2013-11-04 2019-05-28 Northwestern University Quantification and spatio-temporal tracking of a target using a spherical nucleic acid (SNA)
US10413565B2 (en) 2014-04-30 2019-09-17 Northwestern University Nanostructures for modulating intercellular communication and uses thereof
US11957788B2 (en) 2014-06-04 2024-04-16 Exicure Operating Company Multivalent delivery of immune modulators by liposomal spherical nucleic acids for prophylactic or therapeutic applications
WO2016004168A1 (en) * 2014-07-01 2016-01-07 Aurasense Therapeutics, Llc Spherical nanoparticles as antibacterial agents
US10760080B2 (en) 2014-10-06 2020-09-01 Exicure, Inc. Anti-TNF compounds
US10208310B2 (en) 2014-10-06 2019-02-19 Exicure, Inc. Anti-TNF compounds
US11213593B2 (en) 2014-11-21 2022-01-04 Northwestern University Sequence-specific cellular uptake of spherical nucleic acid nanoparticle conjugates
US11519016B2 (en) 2016-01-21 2022-12-06 T2 Biosystems, Inc. NMR methods and systems for the rapid detection of bacteria
US11866700B2 (en) 2016-05-06 2024-01-09 Exicure Operating Company Liposomal spherical nucleic acid (SNA) constructs presenting antisense oligonucleotides (ASO) for specific knockdown of interleukin 17 receptor mRNA
US11364304B2 (en) 2016-08-25 2022-06-21 Northwestern University Crosslinked micellar spherical nucleic acids
US11696954B2 (en) 2017-04-28 2023-07-11 Exicure Operating Company Synthesis of spherical nucleic acids using lipophilic moieties
CN111751355A (zh) * 2020-07-22 2020-10-09 攀钢集团研究院有限公司 测定Fe(Ⅱ)-EDTA络合脱硝液中二价铁离子含量的方法
WO2023196818A1 (en) 2022-04-04 2023-10-12 The Regents Of The University Of California Genetic complementation compositions and methods

Also Published As

Publication number Publication date
EP0918885A4 (en) 2001-11-14
JP2004194669A (ja) 2004-07-15
CA2262018C (en) 2007-10-02
EP0918885A1 (en) 1999-06-02
EP0918885B1 (en) 2007-04-11
JP2008029351A (ja) 2008-02-14
JP4245664B2 (ja) 2009-03-25
EP1818417A2 (en) 2007-08-15
EP1818417A3 (en) 2010-01-20
DE69737598D1 (de) 2007-05-24
DE69737598T2 (de) 2007-12-27
ES2287956T3 (es) 2007-12-16
US6773884B2 (en) 2004-08-10
JP2008067711A (ja) 2008-03-27
US20020137058A1 (en) 2002-09-26
JP2000516460A (ja) 2000-12-12
EP1818417B1 (en) 2014-02-12
CA2262018A1 (en) 1998-02-05
AU4043497A (en) 1998-02-20

Similar Documents

Publication Publication Date Title
EP0918885B1 (en) Nanoparticles having oligonucleotides attached thereto and uses therefor
US6417340B1 (en) Nanoparticles having oligonucleotides attached thereto and uses therefor
WO1998004740A9 (en) Nanoparticles having oligonucleotides attached thereto and uses therefor
US7259252B2 (en) Nanoparticles having oligonucleotides attached thereto and uses therefor
AU784040B2 (en) Nanoparticles having oligonucleotides attached thereto and uses therefor
US6709825B2 (en) Nanoparticles having oligonucleotides attached thereto and uses therefor
US7098320B1 (en) Nanoparticles having oligonucleotides attached thereto and uses therefor
AU770201B2 (en) Nanoparticles having oligonucleotides attached thereto and uses thereof
AU2004205147B2 (en) Nanoparticles having oligonucleotides attached thereto and uses thereof

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH KE LS MW SD SZ UG ZW AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL

COP Corrected version of pamphlet

Free format text: PAGES 1/21-21/21, DRAWINGS, REPLACED BY NEW PAGES 1/22-22/22; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE

121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase

Ref document number: 2262018

Country of ref document: CA

Ref country code: CA

Ref document number: 2262018

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1997938010

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1997938010

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 1997938010

Country of ref document: EP