WO1996001316A1 - NOUVEAU FACTEUR DE CROISSANCE/DIFFERENCIATION DE LA FAMILLE DU TGF-$g(b) - Google Patents

NOUVEAU FACTEUR DE CROISSANCE/DIFFERENCIATION DE LA FAMILLE DU TGF-$g(b) Download PDF

Info

Publication number
WO1996001316A1
WO1996001316A1 PCT/EP1995/002552 EP9502552W WO9601316A1 WO 1996001316 A1 WO1996001316 A1 WO 1996001316A1 EP 9502552 W EP9502552 W EP 9502552W WO 9601316 A1 WO9601316 A1 WO 9601316A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
sequence
tgf
seq
leu
Prior art date
Application number
PCT/EP1995/002552
Other languages
German (de)
English (en)
Inventor
Gertrud Hötten
Helge Neidhardt
Rolf Bechtold
Jens Pohl
Original Assignee
Biopharm Gesellschaft Zur Biotechnologischen Entwicklung Von Pharmaka Mbh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from DE19511243A external-priority patent/DE19511243A1/de
Application filed by Biopharm Gesellschaft Zur Biotechnologischen Entwicklung Von Pharmaka Mbh filed Critical Biopharm Gesellschaft Zur Biotechnologischen Entwicklung Von Pharmaka Mbh
Priority to JP50354696A priority Critical patent/JP3859703B2/ja
Priority to DE19580745T priority patent/DE19580745D2/de
Priority to AU29798/95A priority patent/AU2979895A/en
Publication of WO1996001316A1 publication Critical patent/WO1996001316A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C07K14/495—Transforming growth factor [TGF]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/02—Stomatological preparations, e.g. drugs for caries, aphtae, periodontitis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/02—Drugs for disorders of the urinary system of urine or of the urinary tract, e.g. urine acidifiers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to a new growth / differentiation factor of the TGF / 3 family and DNA sequences coding therefor.
  • the TGF-jß family of growth factors include the BMP, TGF and activin / inhibin related proteins (Roberts and Sporn, Handbook of Experimental Pharmacology 95, 419-472 (1990)). They are relevant for a wide range of medical treatment methods and applications. These factors are useful in procedures related to wound healing and tissue repair. Furthermore, several members of the TGF-? Family tissue growth, such as bone growth.
  • the members of this group have significant structural similarities.
  • the precursor of the protein consists of an amino-terminal signal sequence, a propeptide and a carboxy-terminal sequence of 110 to 140 amino acids, which is cleaved from the precursor and represents the mature protein. Furthermore, their members are defined by an amino acid sequence homology.
  • the mature protein contains the most conserved sequences, particularly seven cysteine residues, which are conserved among family members.
  • the TGF-type proteins are multifunctional, hormonally active growth factors. They also exhibit related biological activities, such as chemotactic attraction of cells, promoting cell differentiation, and tissue-induced skills.
  • EP 0 222 491 AI discloses sequences of inhibin alpha and beta chains.
  • the proteins of the TGF-ß family show differences in their structure, which leads to considerable variations in their exact biological function. Furthermore, they are found in a wide range of different tissue types and stages of development. As a result, they may differ in their exact function, e.g. the required cellular physiological environment, their lifespan, their destinations, their requirements for auxiliary factors and their resistance to degradation. Although numerous proteins that show tissue-inductive potential have been described, their natural functions in the organism and, more importantly, their medical relevance still need to be researched in detail. The presence of as yet unknown members of the TGF-ß family, which are important for the differentiation / induction of different types of tissue, is assumed with great probability.
  • TGF- ⁇ -like proteins A major difficulty in isolating these new TGF- -like proteins, however, is that their functions cannot yet be described precisely enough for the development of a distinctive bioassay.
  • the expected nucleotide sequence homology to known members of the family is too low to allow screening by classic nucleic acid hybridization techniques.
  • the further isolation and characterization of new TGF- ⁇ -like proteins is urgently required in order to provide further induction and differentiation proteins which meet all the desired medical requirements. These factors could find medical application in the healing of damage and the treatment of degenerative diseases of different tissues.
  • Patent application PCT / EP93 / 00350 specifies a nucleotide and amino acid sequence for the TGF- ⁇ protein MP121, with a large part of the sequence corresponding to the mature peptide is specified. The full sequence of the MP121 propeptide is not disclosed.
  • the object on which the present invention is based is to provide DNA sequences which code for new members of the TGF- ⁇ protein family with mitogenic and / or differentiation-inductive potential.
  • the object of the present invention is to provide the complete DNA and amino acid sequence of the TGF protein MP121.
  • sequence (d) a sequence which differs from sequence (a) due to its origin from other vertebrates
  • SEQ ID NO. 1 shows the complete nucleotide sequence of the DNA coding for the human TGF- ⁇ protein MP121.
  • the ATG start codon begins with nucleotide 128.
  • the start of the fully mature protein particularly preferably begins with nucleotide 836.
  • SEQ ID NO.2 shows the complete amino acid sequence of the prepro protein of the human TGF- ⁇ protein MP121, which was derived from the nucleotide sequence shown in SEQ ID NO.l.
  • the start of the mature protein is preferably in the range of amino acids 217-240, particularly preferably at amino acid 236 or 237, most preferably at amino acid 237.
  • SEQ ID NO.3 shows the complete nucleotide sequence of the DNA coding for the TGF- ⁇ protein MP121 from mouse.
  • the coding region begins at the ATG start codon with nucleotide 131 and ends at the stop codon beginning with position 1187.
  • the start of the preferred mature protein begins with nucleotide 839.
  • genomic DNA there is an approximately 5.5 kb between position 446 and 447 big intron.
  • SEQ ID NO.4 shows the complete amino acid sequence of the prepro protein of the TGF-ß protein MP121 from mouse, which was derived from the nucleotide sequence shown in SEQ ID NO.3.
  • the beginning of the mature protein is analogous to the human MP121 in SEQ ID NO.2 in the range of amino acids 217-240.
  • the mature protein begins at amino acid 237, so that the mature portion, like the human MP121, consists of 116 amino acids.
  • Members of the TGF-ß family are often cut behind an RXXR cleavage site to separate the mature portion from the precursor (see ⁇ zkaynak et al., J.Biol.Chem. 267, 25220-25227 (1992) and the literature cited therein). In the case of MP121 from mouse, it is therefore also conceivable for the mature protein to begin at least in part with amino acid 236.
  • SEQ ID NO.5 shows the nucleotide sequence of the human MP121 gene at the exon / intron junctions. The nucleotides from both exons are identified by upper case letters, those of the intron by lower case letters.
  • Figure 1 shows a comparison of the amino acid sequence of human MP121 with some members of the TGF-ß family (inhibin ⁇ and ß chains) starting at the first of the seven conserved cysteine residues. * means that the amino acid is the same in all compared proteins; + means that the amino acid in at least one of the proteins matches in comparison to human MP121.
  • Figure 2 shows the nucleotide sequences of the oligonucleotide primers used in the present invention and a comparison of these sequences with known members of the TGF- ⁇ family.
  • M means A or C
  • S means C or G
  • R means A or G
  • K means G or T.
  • 2a shows the sequence of the primer OD
  • 2b shows the sequence of the primer OID.
  • Figure 3 shows a schematic Western blot with chicken antibodies against human MP121.
  • FIG. 4 shows the expression of MP121 in comparison to activin ⁇ A and ⁇ B in different mouse tissues.
  • FIG. 5 shows a positive influence on the survival of dopaminergic neurons by treatment with partially cleaned MP121.
  • the term "mature protein” also includes functional subregions of the total protein which have essentially the same biological activity and preferably those subregions which contain at least the region of the seven cysteines conserved in the TGF- ⁇ family include.
  • the N-terminus of the mature proteins is slightly modified, that is to say deviates from the sequences shown in SEQ ID NO.2 and 4. Additional amino acids that do not influence the functionality of the protein can be present here as well as amino acids missing, as far as the functionality is not compromised in this case either. is limited.
  • the human and the mouse protein contain all amino acids from amino acid 237 of the amino acid sequence shown in SEQ ID NO.2 and SEQ ID NO.4. It is already known from other family members of the TGF- ⁇ family that the addition of additional amino acids to the N-terminus of the mature protein does not impair the activity, with 6 additional histidines being attached to the N-terminus, among other things.
  • the present invention thus includes the portion coding for the mature protein as defined above and optionally further functional portions of the nucleotide sequence shown in SEQ ID NO.1 as well as sequences which correspond to this sequence in the context of the degeneration of the genetic code and all derivatives of such sequences .
  • the present invention also encompasses DNA sequences which code for a protein of the TGF- ⁇ family which have been obtained from other mammals and which have a sequence which differs to a small extent on account of their origin, but for proteins with the same biological function and in principle also code only slightly different sequence. Such sequences have very large correspondences with one another, as can be seen from a comparison of SEQ ID NO.1 and NO.3.
  • the present invention also comprises sequences hybridizing with such sequences, provided that such a DNA molecule completely contains at least the portion coding for a mature protein of the TGF- ⁇ family (according to the above definition) and that the biological activity is retained.
  • the term “functional part” in the sense of the present invention means a protein part which is capable of acting, for example, as a signal peptide, propeptide or mature protein part, ie performing at least one of the biological functions of the natural parts of MP121.
  • the region coding for the mature portion of the protein preferably extends from nucleotide 836 to the stop codon, which begins at nucleotide 1184 of the sequence shown in SEQ ID No. 1.
  • the DNA molecule can also comprise further functional parts of the sequence shown in SEQ ID NO.1, namely the nucleotide sequences coding for the signal and / or propeptide part.
  • the DNA molecule particularly preferably comprises the sequence for the signal and propeptide portion and the portion of the mature protein, ie the nucleotides 128 to 1184 of the sequence shown in SEQ ID NO.1.
  • the region coding for the mature portion of the protein preferably ranges from nucleotide 839 to the stop codon starting from position 1187 of the sequence shown in SEQ ID NO.3.
  • the DNA molecule can also comprise further functional parts of the sequence shown in SEQ ID NO.3, namely nucleotide sequences coding for signal and / or propeptide parts.
  • the DNA molecules can also contain functional signal and / or propeptide portions of other proteins, for example proteins with cystine knot motif (Cell, Vol. 73 (1993), pp. 421-424) and in particular of other proteins of the TGF-ß family, for example the activin / inhibin or BMP proteins mentioned above, in particular also MP52 (see PCT / EP94 / 02630).
  • proteins with cystine knot motif Cell, Vol. 73 (1993), pp. 421-424
  • other proteins of the TGF-ß family for example the activin / inhibin or BMP proteins mentioned above, in particular also MP52 (see PCT / EP94 / 02630).
  • MP52 see PCT / EP94 / 02630.
  • hybridization means customary hybridization conditions, preferably conditions with a salt concentration of 6 ⁇ SSC at 62 to 66 ° C., followed by a one-hour wash with 0.6 ⁇ SSC, 0.1% SDS at 62 to 66 ° C.
  • Preferred embodiments of the present invention are DNA sequences, as defined above, which are obtainable from vertebrates, preferably mammals, such as pigs, cows and rodents, such as rats or mice, and in particular from primates, such as humans, or corresponding sequences are reproduced.
  • vertebrates preferably mammals, such as pigs, cows and rodents, such as rats or mice, and in particular from primates, such as humans, or corresponding sequences are reproduced.
  • a particularly preferred embodiment of the present invention are those in SEQ ID NO. 1 and 3 and designated as human or mouse MP121 sequences.
  • the transcripts of MP121 were obtained from liver tissue and code for a protein which shows a considerable amino acid homology to the mature part of the inhibin / activin-like proteins (see FIG. 1).
  • Another object of the present invention is a vector which contains at least one copy of a DNA molecule according to the invention.
  • the DNA sequence according to the invention is preferably operatively linked to an expression control sequence.
  • Such vectors are suitable for the production of TGF- ⁇ -like proteins in stably or transiently transformed cells.
  • Various animal, plant, fungus and bacterial systems can be used for transformation and subsequent cultivation.
  • the vectors according to the invention preferably contain sequences necessary for replication in the host cell and can be replicated autonomously. Furthermore, the use of vectors which contain selectable marker genes is preferred, as a result of which the transformation of a host cell can be detected.
  • Another object of the invention is a host cell which is transformed with a DNA or a vector according to the invention.
  • suitable host cells include various eukaryotic and prokaryotic cells such as E.coli, insect cells, plant cells, mammalian cells and fungi such as yeast.
  • Another object of the invention is a protein of the TGF-ß family, which is encoded by a DNA sequence according to claim 1.
  • the protein according to the invention preferably has the amino acid sequence shown in SEQ ID NO.2 or SEQ ID NO.4 or, if appropriate, functional parts thereof (as defined above) and exhibits biological properties, such as tissue inductive capabilities, which may be relevant for therapeutic use are.
  • heterodimers include heterodimers composed of a monomer of the protein according to the invention and monomers of the a, ⁇ A or ⁇ B inhibin chains. The properties resulting from heterodimer formation can be shifted more towards the properties of activin or inhibins.
  • a heterodimer is formed with inhibin ⁇ proteins or with other inhibin ⁇ proteins
  • the MP 121 / inhibin ( ⁇ chain) or MP 121 / activin ( ⁇ A or ⁇ g chain) -Heterodimer could inhibit or activate the production of follicle stimulating hormone (FSH).
  • MP 121 / Aktivin heterodimers could also influence mesoderm development, for example. It can also be expected that heterodimeric forms with a member of the BMP group of TGF- ⁇ proteins lead to an increase in BMP-like activities, such as the ability to induce bone formation, cartilage formation or formation of connective tissue or to promote.
  • the invention therefore furthermore relates to heterodimeric proteins of a protein of the TGF- ⁇ family according to the invention, which is encoded by a DNA sequence according to claim 1, with a monomer of a protein with cystine knot motif, preferably another member of the TGF- ⁇ - Family.
  • a monomer of a protein with cystine knot motif preferably another member of the TGF- ⁇ - Family.
  • Similar heterodi- Other proteins are described in WO93 / 09229, EP 0 626 451 A2 and J. Biol. Chem. 265 (1990), 13198-13205.
  • Another object of the invention are chimeric proteins, the functional derivatives or portions of a protein of the invention encoded by a DNA sequence, as shown preferably in SEQ ID NO.2 or SEQ ID NO.4, in particular functional portions of the mature Have protein and also portions of another protein.
  • the other protein can in turn be a protein with cystine knot motif, which preferably also belongs to the TGF-ß family, e.g. especially MP 52 (PCT / EP94 / 02630).
  • parts of a completely different protein may also be present, e.g. Receptor-binding domains of proteins which give the original MP 121 protein a different specificity.
  • the biological properties of the proteins according to the invention can e.g. in assays according to Wrana et al. (Cell 71, 1003-1014 (1992)) Ling et al. (Proc. Natl. Acad. Of Science, 82, 7217-7221 (1985)), Takuwa et al. (Am. J. Physiol., 257, E797-E803 (1989)), Fann and Patterson (Proc. Natl. Acad. Of Science, 91, 43-47 (1994)), Broxmeyer et al. (Proc. Natl. Acad. Of Science, 85, 9052-9056 (1988)), Green et al. (Cell, 71, 731-739 (1992)), Partridge et al. (Endocrinology, 108, 213-219 (1981)) or Krieglstein et al. (EMBO J.14, 736-742 (1995)).
  • Another object of the present invention is a method for producing a protein of the TGF-ß family, which is characterized in that a host cell transformed with a DNA or a vector according to the invention is cultivated and the TGF- ⁇ protein is obtained from the cell and / or from the culture supernatant.
  • a method comprises culturing the transformed host cell in a suitable culture medium and purifying the TGF- ⁇ -like protein produced.
  • the host cell can be a bacterium such as Bacillus or E.
  • coli a fungus such as yeast
  • a plant cell such as tobacco, potato or Arabidopsis or an animal cell
  • a vertebrate cell line such as Mo-, Cos - or CHO cell lines or an insect cell line.
  • expression can also take place in insect larvae.
  • the protein according to the invention is produced in the form of inclusion bodies. These inclusion bodies are then renatured according to methods known per se and the protein is then obtained in an active form (see, for example, Jaenicke, R. and Rudolph, R., Protein Structure, ed. Creighton, TE, IRL Press, Chapter 9).
  • heterodimeric proteins For the production of heterodimeric proteins with other members of the TGF-ß family, both protein monomers are expressed either in the same cell or separately, a common renaturation also appearing suitable in the case of forms of inclusion bodies. When coexpressing in the same cell, viral systems such as the baculovirus system or the vaccina virus system are particularly suitable.
  • the production of heterodimeric proteins is known in principle to the person skilled in the art and is described, for example, in WO93 / 09229 and EP 0 626 451 A2.
  • Another object of the present invention is to provide pharmaceutical compositions which contain a pharmaceutically effective amount of a TGF-ß-like protein according to the invention as an active ingredient.
  • a composition optionally comprises a pharmaceutically acceptable carrier, auxiliary, diluent or filler.
  • a pharmaceutical composition can be used in wound healing and tissue restoration alone or in combination with other active ingredients, e.g. other proteins of the TGF-ß family or growth factors such as EGF (epidermal growth factor) or PDGF (platelet derived growth factor) can be used.
  • EGF epidermatitisen, fibroblast growth factor
  • PDGF platelet derived growth factor
  • compositions which contain heterodimeric proteins and / or chimeric proteins according to the invention.
  • the pharmaceutical composition according to the invention is preferably used for the treatment and prevention of bone, cartilage, connective tissue, skin, mucous membrane, endothelial, epithelial, neuronal, brain, renal or tooth damage, for use in dental implants , for use in wound healing or tissue restoration processes, as a morphogen for use for inducing liver tissue growth, inducing the proliferation of progenitor cells or bone marrow cells, for maintaining a state of differentiation and for treating fertility disorders or for contraception.
  • the pharmaceutical composition according to the invention can be used in the treatment of metabolic diseases such as diseases of the digestive system or diseases which affect the blood sugar level.
  • TGF- ⁇ -like protein is the use as a suppressor of the immune reaction to avoid rejection of organ transplants or an application in connection with angiogenesis.
  • the protein according to the invention can be used for increasing fertility or contraception.
  • the pharmaceutical composition according to the invention can also be used prophylactically or in cosmetic surgery.
  • the use of the composition is not restricted to humans, but can also include animals, in particular domestic and farm animals.
  • heterodimeric proteins and chimeric proteins the possible use and specificity can also be varied as desired by the proportion of the other protein or other monomer.
  • diseases which are related to the expression of MP 121 can be treated with the proteins according to the invention, on the one hand by increasing the amount or the activity of MP 121 present, and on the other hand by suppressing the MP 121 activity.
  • Another object of the invention is the production of antisense nucleic acids and ribozymes which inhibit the translation of MP 121. This inhibition can take place either by masking the mRNA with an antisense nucleic acid or by cleavage with a ribozyme.
  • antisense nucleic acids The production of antisense nucleic acids is known (Weintraub, HM, Scientific American 262: 40 (1990)). The antisense nucleic acids hybridize with the corresponding mRNA and form a double-stranded molecule, which can then no longer be translated. The use of antisense nucleic acids is, for example, from Marcus-Sekura, CJ, Anal. Biochem. 172 (1988), pp. 289-295.
  • Ribozymes are RNA molecules that have the ability to specifically cleave other single-stranded RNA molecules similar to DNA restriction endonucleases. The production of ribozymes is described in Cech, J. Amer. Med. Assn. 260 (1988), p. 3030.
  • MP 121 antisense polynucleotides can also be introduced into cells which show an undesired expression of MP 121.
  • the MP 121 activity can also be suppressed by binding molecules to the MP 121 receptors which, in contrast to MP 121, do not trigger signal transmission.
  • the MP 121 receptors on cells are therefore also of interest in the context of the invention.
  • different cell lines can first be tested for their binding behavior by radioactively labeled MP121 ( 15 J-MP121) with subsequent cross-linking.
  • a cDNA library can subsequently be created from cells that bind MP121 in an expression vector (available from InVitrogen). Cells transfected with receptor cDNA can then be selected by binding radiolabelled MP121.
  • These are methods known to the person skilled in the art, such as those used for the isolation of activin (Mathews, LS & Vale, WW, Cell 65 (1991), 973-982) and TGF- ⁇ receptors type II (Lin, HY et al.
  • the MP121 receptor is also a receptor complex belonging to this family, so that other methods known to the person skilled in the art, such as, for example, can be used to find parts of the heteromeric complex PCR with degenerate oligonucleotides can be used.
  • This method is e.g. also used for type I activin and TGF-ß receptors (Tsuchida et al., Proc. Natl. Acad. Sci. USA 90 (1993), 11242-11246; Attisano et al., Cell 75 ( 1993), 671-680; Franzen et al., Cell 75 (1993), 681-692).
  • Another object of the present invention is an antibody that can bind specifically to the proteins according to the invention, or such an antibody fragment (e.g. Fab or Fab ').
  • an antibody fragment e.g. Fab or Fab '.
  • Methods for producing such a specific antibody or antibody fragment are well within the ordinary skill in the art.
  • Such an antibody is preferably a monoclonal antibody.
  • Such antibodies or antibody fragments could also be suitable for diagnostic methods.
  • RNA-Guard Pharmacia
  • 2.5 ⁇ g oligo (dT) 12-18 Pharmacia
  • 5 x buffer 250 mmol / 1 Tris / HCl pH 8.5, 50 mmol / 1 MgCl 2 , 50 mmol / 1 DTT, 5 mmol / 1 of each dNTP, 600 mmol / 1 KC1
  • 20 U AMV reverse transcriptase Boehringer Mannheim
  • the reaction mixture (25 ⁇ l) was incubated at 42 ° C. for 2 hours.
  • the cDNA pool was kept at -20 ° C.
  • the deoxynucleotide primers OD and OID shown in FIG. 2 were produced on an automatic DNA synthesizer (biosearch).
  • the purification was carried out by denaturing polyacrylamide gel electophoresis and isolation of the main band from the gel by isotachophoresis.
  • the oligonucleotides were designed by comparing the nucleic acid sequences of known members of the TGF-ß family and selecting regions with high conservation. A comparison of this region is shown in Figure 2. To facilitate the cloning, both oligonucleotides contained Eco R1 sites and OD additionally contained an Nco I restriction site at its 5 'terminus.
  • RNA corresponding cDNA (see 1.2) was used as starting material in the PCR reaction.
  • the reaction was carried out in a volume of 50 ⁇ l and contained 1 ⁇ PCR buffer (16.6 mmol / 1 (NH 4 ) 2 SO 4 , 67 mmol / 1 Tris / HCl pH 8.8, 2 mmol / 1 MgCl 2 , 6.7 ⁇ mol / 1 EDTA, 10 ⁇ vmol / 1 ß-mercaptoethanol, 170 ⁇ g / ml bovine serum albumin (Gibco), 200 ⁇ mol / 1 of each dNTP (Pharmacia), 30 pmol of each oligonucleotide (OD and OID) and 1.5 U Taq polymerase (AmpliTaq, Perkin Elmer Cetus).
  • the reaction mixture was coated with paraffin and 40 PCR cycles were carried out.
  • the products of the PCR reaction were purified by phenol / chloroform extraction and concentrated by
  • Restrictions were carried out in 100 ⁇ l with 8 U enzyme at 37 ° C. for 2 to 12 hours (except for Tfi I at 65 ° C.).
  • a quarter or a fifth of the isolated DNA was reamplified using the same conditions as for the primary amplification, except that the number of cycles was reduced to 13.
  • the reamplification products were purified, cut with the same enzymes as above, and the uncut products were isolated from agarose gels as explained above for the amplification products. The reamplification step was repeated.
  • the clone was completed at the 3 'end of the cDNA according to the method described in detail by Frohmann (published by Perkin-Elmer Corp., Amplifications, 5, 11-15 (1990)).
  • the same liver mRNA used to isolate the first MP121 fragment was reversed as described above transcribed using Oligo dT (16mer) connected to the adapter primer (AGAATTCGCATGCCATGGTCGACGAAGC -T 16 ).
  • the amplification was carried out with the adapter primer (AGAATTCGCATGCCATGGTCGACG) and an internal primer (GGCTACGCCATGAACTTCTGCATA), prepared according to the MP121 sequence.
  • the amplification products were reamplified with a further internal primer (ACATAGCAGGCATGCCTGGTATTG), produced according to the MP-121 sequence, and the adapter primer. After restriction with Sph I, the reamplification products were cloned into the vector pT7 / T3 U19 (Pharmacia) which had also been cut and sequenced. The clones were characterized by their sequence overlap with the already known part of the MP121 sequence. A clone called pl21Lt 3 'MP13 was used to isolate an Nco I (blunted with T4 polymerase) / Sph I fragment.
  • This fragment was cloned into one of the pSK-MP121 (OD / OID) vectors mentioned above, the OD primer sequence of which was oriented to the T7 primer of the pSK multiple cloning site.
  • the vector was restricted with SphI and Smal.
  • the construct was named pMP121DFus6. It contains the MP121 sequence from position 922 to 1360 as shown in SEQ ID NO.1.
  • the cDNA was isolated from the phages via an EcoRI restriction and cloned into the pBluescript SK vector which had also been cleaved with EcoRI. Sequencing of one of the resulting plasmids, SK121L9.1, showed that the start codon begins at position 128 of SEQ ID NO.1 because three stop codons are in-frame in front of this start codon at positions 62, 77 and 92. The start of the mature MP121 is at position 836 of SEQ ID NO.1. If one bases the sequence analogy on other TGF-ß proteins, which corresponds to amino acid 237 in SEQ NO.2. The stop codon begins at position 1184 of SEQ ID NO.l.
  • the plasmid SK121L9.1 was deposited with the DSM on April 26, 1994 under the accession number 9177.
  • the primers ACGAATTCCGACGAGGCATCGACTGC and GCGTCGACTACCATGTCAGGTATGTC were synthesized from the human MP121 sequence with additional restriction sites at the 5 'end (EcoR I or Sal I). These primers were used for amplification on mouse genomic DNA. The resulting 0.35 kb fragment was subcloned into the " Bluescript vector (Stratagene) and used as a radioactive probe. Both a ⁇ bank with genomic mouse DNA and a bank with cDNA were screened according to standard methods. The cDNA was derived from RNA derived from Mouse liver was isolated, synthesized and cloned in ⁇ gtlO provided with EcoR I / Not I linkers.
  • MP121 clones were isolated from both the genomic and the cDNA library.
  • a cDNA containing the entire coding sequence was subcloned into the EcoRI interface of the vector Bluescript SK (Stratagene) and the resulting plasmid SKMP121 mouse was deposited with the DSM on May 10, 1995 (DSM 9964).
  • Complete sequencing gave the sequence shown in SEQ ID NO.3.
  • the start codon begins at position 131 in SEQ ID NO.3 and ends with the stop codon starting at position 1187.
  • the protein derived from the sequence is shown in SEQ ID NO.4.
  • MP121 is possible in both eukaryotic and prokaryotic systems.
  • MP121 Only the mature portion of MP121 was used for expression in prokaryotes. After purification, the mature MP121 protein expressed as a monomer in E. coli can then be folded back into a dimer. In order to simplify the purification of the MP121, 6 histidines can additionally be attached to the N-terminus of the mature protein, which facilitate the purification of the protein by binding to nickel chelate columns.
  • the mature portion of human MP121 (amino acids 237 to 352 in SEQ ID NO.2) with 13 additional amino acids including 6 histidines at the N-terminus (MHHHHHHKLEFAM) was expressed in the prokaryotic vector pBP4.
  • This vector is a pBR322 derivative with tetracycline resistance which additionally contains the T7 promoter from the pBluescript II SK plasmid (Stratagene).
  • the vector after the T7 promoter contains a ribosomal binding site and a start codon followed by 6 codons for Histidine.
  • a terminator follows behind several singular restriction interfaces such as Eco RI, Xho I, Sma I and Apa I for the insertion of inserts and stop codons in all three reading frames.
  • oligonucleotides contain restriction sites added at the ends (Eco RI and Nco I or Xho I and Hind III). The resulting 377 bp fragment was blunt-end cloned into the vector pBluescript II SK (Stra ⁇ tagene) restricted with Eco RV. A clone with the orientation of the 5 'end of MP121 to the T7 promoter was restricted with Eco RI and the resulting insert (0.38 kb) was cloned into the pBP4 vector which was also restricted with Eco RI.
  • the correct orientation of the insert in the resulting plasmid p-BP4MP121His was determined by restriction analysis and sequencing.
  • the plasmid pBP4MP121His was deposited with the DSM on January 30, 1995 (accession number: 9704).
  • MP121 protein can be expressed by simultaneously providing T7 RNA polymerase.
  • the T7-RNA polymerase can be provided by various methods, such as a second plasmid with a gene for T7 RNA polymerase or by infection with phages which code for the T7 RNA polymerase or by special bacterial strains which carry the gene for T7 Have integrated RNA polymerase.
  • a second plasmid with a gene for T7 RNA polymerase or by infection with phages which code for the T7 RNA polymerase or by special bacterial strains which carry the gene for T7 Have integrated RNA polymerase.
  • BL21 DE3
  • pLysS Nova ⁇ gen, # 69451-1
  • the protein in SDS-polyacrylamide gels (15%) has an apparent molecular weight of almost 16 kD (theoretical molecular weight: 14.2 kD), as is shown representatively in the Western blot of FIG. 3.
  • the bacteria transformed with pBP4 as controls each show no staining of specific bacteria. the. Because of the His tag, this protein can be obtained via nickel chelating columns as described, for example, in Hochuli et al. (BIO / Technology Vol. 6, 1321-1325 (1988)). Additional cleaning is possible using a reversed phase HPLC.
  • a reversed phase column (Nucleosil 300-7C4 from Macherey-Nagel, Art.
  • Antibodies from both chickens and rabbits make it possible to specifically detect expression of MP121.
  • chicken antibodies were used which via PEG precipitation (Thalley BS and Carroll, SB, BIO / Technology Vol. 8, 934-938 (1990)) and via membrane-bound antigen (Fusion protein (MS2-MP121)) (18.17 in Sambrook et al. Molecular Cloning, second edition, Cold Spring Harbor Laboratory Press 1989).
  • Anti-Chicken IgG with coupled alkaline phosphatase (Sigma A9171) was used as the second antibody.
  • Detection was carried out using the Tropix Western-Light Protein Detection Kit (Serva # WL10RC) according to the manufacturer's instructions.
  • the monomeric MP121 expressed and purified in E. coli can be combined into one dimeric MP121 can be folded back. This can be done using methods such as those described by Jaenicke, R. & Rudolph, R. (Protein structure, ed. Creighton, TE, IRL Press, chapter 9).
  • the vaccinia virus expression system was used, as described in detail in the Current Protocols in Molecular Biology (Ausubel et al., Greene Publishing Associates and Wiley-Interscience, Wiley & Sons) , hereinafter abbreviated to CP, is described under Chapter 16 Unit 16.15-16.18.
  • the system is based on the fact that foreign DNA can be integrated into the vaccinia virus genome using certain vectors by homologous recombination.
  • the vector used contains the TK (thymidine kinase) gene from the vaccinia genome.
  • the vector further contains the E.
  • gpt coli xanthine guanine phosphoribosyl transferase gene
  • the fragment obtained was intermediate cloned in Bluescript SK (Stratagene), sequenced and checked for agreement with the sequence shown in SEQ ID NO.1.
  • the Sph I / Eco RI fragment (0.22 kb) from the plasmid pBP4MP121His used.
  • the two end fragments of human MP121 were cut via internal restriction cuts (Xba I and Sph I) with the missing middle DNA sequence from the plasmid SK121L9.1 (DSM deposit number: 9177) according to standard methods (Sambrook et al. Molecular Cloning, second edition, Cold Spring Harbor Laboratory Press 1989).
  • the shortened cDNA thus obtained with the complete reading frame for MP121 (nucleotide 128 to nucleotide 1184 in SEQ ID No. 1) could be cloned into the vector pBPl, which had also been cut, by using the restriction sections Barn HI and Eco RI.
  • the resulting plasmid pBPlMP121 was deposited on January 12, 1995 with the DSM (accession number: 9665).
  • the plasmid pBPlMP121 was used for the production of recombinant vaccinia viruses.
  • 80% confluent 143B cells HuTk, ATCC CRL 8303
  • vaccinia wild-type virus in 1 ml PBS for 30 minutes at room temperature with occasional shaking (1 virus per 10 cells).
  • 2 ml of culture medium MEM, Gibco BRL # 041-01095 with penicillin diluted 1: 500 and streptomycin Gibco BRL # 043-05140
  • the medium was then removed and the transformation of these cells with 100 ng pBPlMP121, 2 ⁇ g carrier DNA (calf thymus, treated with ultrasound, Boehringer Mannheim # 104175) and 10 ⁇ l lipofectin (Gibco BRL # 18292-011) in 1 ml MEM for approx 15 h at 37 ° C. After adding 1 ml of MEM with 20% FCS (Sigma # F-7524), the mixture was incubated for a further 24 hours at 37 ° C. and the lysed cells were then frozen.
  • the gpt selection for the xanthine guanine phosphoribosyl transferase and the isolation and amplification of individual recombinant viruses was carried out essentially as in unit 16.17 of the CP described, with the difference that RK13 cells (ATCC CCL 37) were used.
  • the cells were cultivated according to the information provided by the distributors.
  • the confluent cells were infected with three times the number of viruses for 30 minutes at 37 ° C. and then the corresponding culture medium with 10% FCS and penicillin / streptomycin (1: 500, Gibco BRL # 043-05140) was added. After 6 hours at 37 ° C the medium was removed, the cells were washed twice with e.g.
  • HBSS HuTk or DMEM with 4.5 g / 1 glucose and NEAA (Gibco BRL # 11140-035) for NIH-3T3 each mixed with aprotinin (Fluka # 10820, 50 U / ml) and penicillin / streptomycin) added without FCS. After 20 to 22 hours of production, the cell supernatant was collected. Expression was analyzed by Western blots using standard methods (CP Unit 10.8).
  • the proteins were precipitated from 1 to 3 ml of cell culture supernatant by adding the equivalent volume of acetone and incubating on ice for at least one hour and centrifuging. After the pellet had been resuspended in application buffer (7 M urea, 1% SDS, 7 mM sodium dihydrogen phosphate, 0.01% bromophenol blue and optionally 1% ⁇ -mercaptoethanol), it was separated in 15% polyacrylamide gels. A pre-stained protein molecular weight standard was used as the marker protein
  • FIG. 3 A representative schematic drawing of the Western blot results in FIG. 3 shows that MP121-specific bands occur in the cells infected with recombinant viruses.
  • the expression of MP121 in NIH-3T3 cells leads to a secreted protein with a molecular weight of approximately 18 kD appearing in the gel under non-reducing conditions (expected theoretical molecular weight: 25 kD). Under reducing conditions, the protein runs in the gel at approximately 15 kD (expected theoretical molecular weight: 12.5 kD).
  • These results show that, as expected, MP121 is expressed as a dimeric mature protein.
  • the relatively little slower running behavior of the dimeric MP121 protein compared to the monomeric MP121 protein is probably due to a globular structure.
  • the processing of the precursor protein to the mature protein could also be demonstrated in HuTK cells. In cells infected with wild-type viruses (without integrated foreign DNA) (HuTK- or NIH-3T3), no bands appeared in the Western blot.
  • the vaccinia expression system is suitable for cotransfection with recombinant vaccinia viruses that code for different members of the TGF-ß family, especially for the formation of heterodimers. Affinity columns with specific antibodies against the individual TGF-ß family members then make it possible to separate heterodimers from homodimers. Of particular interest are the inhibins, as well as the ⁇ A and ⁇ B chains.
  • RNA from various tissues from 6-week-old mice and from embryonic stem cells was isolated using standard methods. 10 ⁇ g total RNA was used in an RNAse Protection Assay (RPA) from Ambion (RPA II Kit, # 1410) according to the manufacturer's instructions.
  • RPA RNAse Protection Assay
  • mouse genomic DNA 129Sv
  • Primers from the mature portion of the proteins, amplified.
  • EcoR I and / or BamH I or Hind III restriction sites were inserted at the ends of the primers.
  • the primers were derived from the mRNA from rats (GenBank Accession # M37482):
  • degenerate primers were derived from the human sequence (Mason et al., Molecular Endocrinology 3, 1352-1358 (1989):
  • GAGAATTCCA CA (GA) TT (TC) TT (CT) AT and GCAAGCTTT (GA) TA (TC) TC (GA) TC (GA) TC.
  • the resulting PCR fragments were subcloned into the vector pGEM-4 (Promega) and checked.
  • the activin-specific and thus protected in RPA sequences have the fragment size of 369 bp for activin ß A and 254 bp for activin ß ß .
  • the protected fragment comprises the sequence from position 887 to position 1164 in SEQ ID NO.3.
  • the fragments cloned in pGEM-4 were transcribed in vitro to produce the radioactively labeled antisense RNA samples. This was done according to the manufacturer's instructions (Promega, Riboprobe Gemini Systems) using 100 ⁇ m CTP and at the same time ⁇ 32 P-CTP (800 Ci / mmol, Amersham).
  • RNA was synthesized from the plasmid pTri-GAPDH (Ambion # 7431) linearized with Dde I, but using 1 mM CTP. After isolation of the 4 antisense RNA samples from polyacrylamide gels, these were incubated with the respective tissue RNA from mouse (10 ⁇ g total RNA per sample with lxl0 5 cpm) in the same mixture overnight at 42 ° C. The analysis was carried out in a denaturing gel according to standard methods with subsequent autoradiography over 4 days.
  • MP121 protein which was obtained by expression in the vaccinia system (see Example 2), could be partially purified using two columns.
  • confluent NIH-3T3 cells (DSM ACC 59, Swiss mouse embryo) were infected with the same number of recombinant viruses for 30 minutes at 37 ° C. and then the corresponding culture medium with 10% FCS and penicillin / streptomycin was added.
  • the medium was removed, the cells were washed twice and production medium (see Example 2) without FCS was added. After 20 to 22 hours of production, the cell supernatant was collected and centrifuged to remove the viruses (40,000 x g for 30 minutes at 4 ° C.) and filtered (0.1 ⁇ m pore size, Millex W, Millipore # SLW25LS). The control supernatant (wt) after infection by wild-type vaccinia viruses was obtained in a comparable manner. The expression of MP121 was checked by Western blot analysis and estimated to be 50-100 ⁇ g / l.
  • the protease inhibitor PMSF (1 ⁇ M) was added to the cell culture supernatant with MP121 (1.1 1), brought to a final concentration of 1 M (NH 4 ) 2 SO 4 , 20 mM Tris pH 8.0 and to a phenyl Sepharose (Fast Flow (high sub) Pharmacia # 17-0973-05) column (5 ml bed), equilibrated in buffer A (1 M (NH 4 ) 2 SO 4 , 20 mM Tris pH 8.0), loaded.
  • the loaded column was washed with 15 column volumes of buffer A and 10 column volumes of buffer B (20 mM Tris pH 8.0) and with a linear gradient to 100% buffer C (20 mM Tris pH 8.0, 80% ethylene glycol) at a flow rate of 1 ml / min eluted within 50 min (5 ml per fraction).
  • Western blot analysis showed that MP121 elutes between 50 and 80% ethylene glycol. Aliquots of these fractions were made in silver-colored 15% poly acrylamide gels (Silver Stain-II, Daiichi # SE140000) checked and the fractions containing MP121 pooled. The comparable fractions after purification of the control supernatant were also pooled after analysis in gels stained with silver.
  • the pooled fractions were further purified using a reversed phase HPLC.
  • a C8 column (Aquapore RP300, Applied Biosystems, particle size: 7 ⁇ m, pore size: 300 ⁇ ) was equilibrated with buffer A (0.1% trifluoroacetic acid / water). After the column had been loaded with the pooled fractions of the phenyl-Sepharose column containing MP121, the mixture was washed extensively with buffer A. The bound protein was eluted at a flow rate of 0.2 ml / min with a linear gradient of 1.5% buffer B (90% acetonitrile, 0.1% trifluoroacetic acid) per minute.
  • the partially purified MP121 lyophilized after the phenyl Sepharose and reversed phase HPLC was dissolved in 50% acetonitrile and added to the medium.
  • the final concentration of MP121 in the medium is 20 ng / ml (final concentration of acetonitrile is 0.3%).
  • a comparable amount of the comparable purified control supernatant (wt) was dissolved in 50% acetonitrile and used.
  • the medium control also contains 0.3% acetonitrile.
  • the cultures were fixed in 4% paraformaldehyde for 10 min at room temperature, the cells were permeabilized with acetone (10 min, -20 ° C.) and washed with PBS (phosphate buffered saline).
  • TH Tyrosine hydroxylase
  • TH is a limiting enzyme in the biosynthesis of dopamine and other catecholamines, so that TH can be used as a marker for dopa-inert neurons in the present cultures (cells containing noradrenaline are not isolated).
  • TH was demonstrated by incubation for one hour at 37 ° C with a mouse monoclonal antibody against rats TH (diluted 1: 200, Boehringer Mannheim) and subsequent detection with the Vectastain ABC kit (Vecto Labs). The TH-positive cells were counted in an area of 0.12 cm 2 . It can be seen from FIG. 5 that MP121 has a positive influence on the survival of dopaminergic neurons.
  • FIG. 5 shows the number of surviving TH-immunoreactive dopaminergic neurons after isolation from the midbrain of rat embryos (E14) and 8 days of cultivation.
  • the effect of 20 ng / ml partially cleaned MP121 was tested in equal to the equivalent amount of partially purified control supernatant (wt) and untreated neurons (control: medium with 0.3% acetonitrile).
  • the mean ⁇ SEM from a triple determination is shown.
  • FIG. 3 Schematic Western blot with chicken antibodies against MP121
  • Figure 4 Autoradiogram after gel analysis of an RNAse protection assay with specific samples against activin ß A (ß A ), activin ⁇ (ß B ), MP121 and as a control against GAPDH.
  • the unprotected antisense RNA samples used in the hybridization are plotted in lanes 8 and 15 and marked in brackets on the right with the expected fragment size. The bands for the protected fragments are marked on the left edge.
  • pBR322 was restricted with Msp I (Biolabs # 303) and end-labeled with ⁇ - 32 P-ATP (Amersham).
  • FIG. 5 shows the number of surviving TH-immunoreactive dopaminergic neurons after isolation from the midbrain of rat embryos (E14) and 8 days of culture. activation. The effect of 20 ng / ml of partially purified MP121 was tested in comparison to the equivalent amount of partially purified control supernatant (wt) and untreated neurons (control: medium with 0.3% acetonitrile). The mean value j + SEM from a triple determination is shown.
  • TAATACCAAC CTCACCTTGG CTACTCAGTA CCTGCTGGAG GTGGATGCCAGTGGCTGGCA 660
  • AGTGAACCCC AAAACTGAGG GTCCATGCCC AGCATGTTGG GGTGCCATCT TTGACCTGGA 240
  • REPLACEMENT BLA ⁇ (RULE 26) CAAGACGGAT ATACCTGACATGGTGGTCGA GGCCTGCGGG TGTAGTTAGC TTATGGGTGA 1200

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Diabetes (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Hematology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Urology & Nephrology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Obesity (AREA)
  • Endocrinology (AREA)
  • Reproductive Health (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne une protéine de la famille du TGF-β, l'ADN la codant ainsi qu'une composition pharmaceutique renfermant cette protéine.
PCT/EP1995/002552 1994-07-01 1995-06-30 NOUVEAU FACTEUR DE CROISSANCE/DIFFERENCIATION DE LA FAMILLE DU TGF-$g(b) WO1996001316A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP50354696A JP3859703B2 (ja) 1994-07-01 1995-06-30 ＴＧＦ−βファミリーの新規な成長／分化因子
DE19580745T DE19580745D2 (de) 1994-07-01 1995-06-30 Neuer Wachstums-/Differenzierungsfaktor der TGF-beta-Familie
AU29798/95A AU2979895A (en) 1994-07-01 1995-06-30 Novel growth or differentiation factor of the tgf-beta family

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
DE4423190 1994-07-01
DEP4423190.3 1994-07-01
DE19511243.1 1995-03-27
DE19511243A DE19511243A1 (de) 1994-07-01 1995-03-27 Neuer Wachstums-/Differenzierungsfaktor der TGF-beta-Familie

Publications (1)

Publication Number Publication Date
WO1996001316A1 true WO1996001316A1 (fr) 1996-01-18

Family

ID=25937933

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1995/002552 WO1996001316A1 (fr) 1994-07-01 1995-06-30 NOUVEAU FACTEUR DE CROISSANCE/DIFFERENCIATION DE LA FAMILLE DU TGF-$g(b)

Country Status (6)

Country Link
JP (1) JP3859703B2 (fr)
CN (1) CN1110558C (fr)
AU (1) AU2979895A (fr)
DE (1) DE19580745D2 (fr)
IL (1) IL114397A0 (fr)
WO (1) WO1996001316A1 (fr)

Cited By (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997003188A3 (fr) * 1995-07-12 1997-02-27 Bioph Biotech Entw Pharm Gmbh Utilisation de mp52 ou de mp121 pour la therapie et la prophylaxie de maladies du systeme nerveux
US5807713A (en) * 1992-02-12 1998-09-15 Biopharm Gesellschaft Zur Biotechnologischen Entwicklung DNA encoding growth/differentiation factor
US6171584B1 (en) 1992-02-12 2001-01-09 Biopharm Gesellschaft Zur Biotechnologischen Entwicklung Von Pharmaka Mbh Method of treatment with growth/differentiation factors of the TGF-β family
EP1074620A1 (fr) * 1999-08-06 2001-02-07 HyGene AG Protéine monomère de la famille TGF-beta
WO2005089829A2 (fr) 2004-03-10 2005-09-29 Scil Technology Gmbh Implants revetus, fabrication et utilisation de ceux-ci
US7025959B1 (en) 1992-02-12 2006-04-11 Biopharm Gesellschaft Zur Biotechnologischen Entwicklung Von Pharmaka Mbh MP121, a growth/differentiation factor of the TGF-β family
EP1719531A2 (fr) 1997-03-20 2006-11-08 Stryker Corporation Articles ostéogéniques et leur utilisation pour la régénération osseuse
US7147839B2 (en) 1998-05-29 2006-12-12 Curis, Inc. Methods for evaluating tissue morphogenesis and activity
WO2008082563A2 (fr) 2006-12-21 2008-07-10 Stryker Corporation Formulations à libération entretenue comprenant des cristaux, des gels macromoléculaires et des suspensions particulaires d'agents biologiques
EP1988395A1 (fr) 1997-05-30 2008-11-05 Curis, Inc. Procédés d'évaluation de la morphogénèse de tissus et activité
US7575751B2 (en) 2004-04-27 2009-08-18 Research Development Foundation Activin-A mutants
WO2010093941A2 (fr) 2009-02-12 2010-08-19 Stryker Corporation Composition et procédés d'administration systémique les moins invasifs possibles de protéines comprenant des membres de la superfamille des tgf-β
WO2010093925A2 (fr) 2009-02-12 2010-08-19 Stryker Corporation Administration périphérique de protéines et notamment de membres de la superfamille du tgf-β pour traiter les maladies et troubles systémiques
WO2010110974A1 (fr) 2009-03-24 2010-09-30 Stryker Corporation Procédés et compositions pour l'ingénierie tissulaire
WO2010144696A1 (fr) 2009-06-11 2010-12-16 Burnham Institute For Medical Research Différenciation dirigée de cellules souches
US7875273B2 (en) 2004-12-23 2011-01-25 Ethicon, Incorporated Treatment of Parkinson's disease and related disorders using postpartum derived cells
US7875272B2 (en) 2003-06-27 2011-01-25 Ethicon, Incorporated Treatment of stroke and other acute neuraldegenerative disorders using postpartum derived cells
WO2011031856A1 (fr) 2009-09-09 2011-03-17 Stryker Corporation Bmp-7 à utiliser dans le traitement de la douleur induite par les lésions et les maladies d'articulation
EP2298335A1 (fr) 2004-05-25 2011-03-23 Stryker Corporation Utilisation de protéines morphogéniques pour le traitement de défauts du cartilage
WO2011035094A1 (fr) 2009-09-17 2011-03-24 Stryker Corporation Tampons utilisés pour la régulation du ph des protéines morphogénétiques osseuses
US7947649B2 (en) 2008-04-14 2011-05-24 Advanced Technologies And Regenerative Medicine, Llc Liquid buffered GDF-5 formulations
US7956028B2 (en) 2006-12-14 2011-06-07 Johnson & Johnson Regenerative Therapeutics, Llc Protein stabilization formulations
US7964561B2 (en) 2007-06-29 2011-06-21 Advanced Technologies And Regenerative Medicine, Llc Protein formulations for use at elevated temperatures
EP2336298A2 (fr) 2003-06-27 2011-06-22 Ethicon, Incorporated Cellules isolées de placenta post-partum, méthodes pour leur préparation et leur utilisation.
WO2011087768A1 (fr) 2009-12-22 2011-07-21 Stryker Corporation Variants de la bmp-7 dotés d'une immunogénicité réduite
US8058237B2 (en) 2007-08-07 2011-11-15 Advanced Technologies & Regenerative Medicine, LLC Stable composition of GDF-5 and method of storage
EP2540310A1 (fr) 2006-05-17 2013-01-02 Stryker Corporation Procédés de traitement de défauts du cartilage à l'aide d'un complexe de protéine morphogénique soluble
US8372805B1 (en) 1997-03-20 2013-02-12 Stryker Corporation Osteogenic devices and methods of use thereof for repair of endochondral bone, osteochondral and chondral defects
US8741840B2 (en) 2008-02-13 2014-06-03 Washington University BMP-7 for use in treating neointimal hyperplasia
US9125906B2 (en) 2005-12-28 2015-09-08 DePuy Synthes Products, Inc. Treatment of peripheral vascular disease using umbilical cord tissue-derived cells
US9175261B2 (en) 2005-12-16 2015-11-03 DePuy Synthes Products, Inc. Human umbilical cord tissue cells for inhibiting adverse immune response in histocompatibility-mismatched transplantation
US9234172B2 (en) 2003-06-27 2016-01-12 DePuy Synthes Products, Inc. Repair and regeneration of ocular tissue using postpartum-derived cells
US9572840B2 (en) 2003-06-27 2017-02-21 DePuy Synthes Products, Inc. Regeneration and repair of neural tissue using postpartum-derived cells
US9592258B2 (en) 2003-06-27 2017-03-14 DePuy Synthes Products, Inc. Treatment of neurological injury by administration of human umbilical cord tissue-derived cells
US9611513B2 (en) 2011-12-23 2017-04-04 DePuy Synthes Products, Inc. Detection of human umbilical cord tissue derived cells
US9943552B2 (en) 2009-03-26 2018-04-17 DePuy Synthes Products, Inc. hUTC as therapy for Alzheimer's disease
US10179900B2 (en) 2008-12-19 2019-01-15 DePuy Synthes Products, Inc. Conditioned media and methods of making a conditioned media
US10557116B2 (en) 2008-12-19 2020-02-11 DePuy Synthes Products, Inc. Treatment of lung and pulmonary diseases and disorders

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105001320A (zh) * 2005-11-23 2015-10-28 阿塞勒隆制药公司 Activin-ActRIIa拮抗剂及其促进骨骼生长的应用

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0222491A1 (fr) * 1985-10-03 1987-05-20 Genentech, Inc. Acide nucléique codant les chaînes alpha ou bêta d'inhibine et méthode de synthèse de polypeptides par utilisation d'un tel acide nucléique
WO1993016099A2 (fr) * 1992-02-12 1993-08-19 Biopharm Gesellschaft Zur Biotechnologischen Entwicklung Von Pharmaka Mbh Sequences d'adn codant de nouveaux facteurs de croissance/differentiation

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0222491A1 (fr) * 1985-10-03 1987-05-20 Genentech, Inc. Acide nucléique codant les chaînes alpha ou bêta d'inhibine et méthode de synthèse de polypeptides par utilisation d'un tel acide nucléique
WO1993016099A2 (fr) * 1992-02-12 1993-08-19 Biopharm Gesellschaft Zur Biotechnologischen Entwicklung Von Pharmaka Mbh Sequences d'adn codant de nouveaux facteurs de croissance/differentiation

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
HÖTTEN, G. ET AL.: "Cloning of a new member of the TGF-beta family: A putative new activin-C chain", BIOCHEM. BIOPHYS. RES. COMMUN., vol. 206, no. 2, 17 January 1995 (1995-01-17), pages 608 - 613 *

Cited By (71)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7025959B1 (en) 1992-02-12 2006-04-11 Biopharm Gesellschaft Zur Biotechnologischen Entwicklung Von Pharmaka Mbh MP121, a growth/differentiation factor of the TGF-β family
US5807713A (en) * 1992-02-12 1998-09-15 Biopharm Gesellschaft Zur Biotechnologischen Entwicklung DNA encoding growth/differentiation factor
US6171584B1 (en) 1992-02-12 2001-01-09 Biopharm Gesellschaft Zur Biotechnologischen Entwicklung Von Pharmaka Mbh Method of treatment with growth/differentiation factors of the TGF-β family
US7129054B2 (en) 1992-02-12 2006-10-31 Biopharm Gesellschaft Zur Biotechnologischen Entwicklung Von Pharmaka Mbh Antibodies to a growth/differentiation factor of the TGF-β family
WO1997003188A3 (fr) * 1995-07-12 1997-02-27 Bioph Biotech Entw Pharm Gmbh Utilisation de mp52 ou de mp121 pour la therapie et la prophylaxie de maladies du systeme nerveux
US6531450B2 (en) 1995-07-12 2003-03-11 Biopharm Gesellschaft Zur Biotechnologischen Entwicklung Von Pharmaka Use of MP52 or MP121 for treating and preventing diseases of the nervous system
US8354376B2 (en) 1997-03-20 2013-01-15 Stryker Corporation Osteogenic devices and methods of use thereof for repair of endochondral bone, osteochondral and chondral defects
US8372805B1 (en) 1997-03-20 2013-02-12 Stryker Corporation Osteogenic devices and methods of use thereof for repair of endochondral bone, osteochondral and chondral defects
US8802626B2 (en) 1997-03-20 2014-08-12 Stryker Corporation Osteogenic devices and methods of use thereof for repair of endochondral bone, osteochondral and chondral defects
EP1719531A2 (fr) 1997-03-20 2006-11-08 Stryker Corporation Articles ostéogéniques et leur utilisation pour la régénération osseuse
EP1719532A2 (fr) 1997-03-20 2006-11-08 Stryker Corporation Articles ostéogéniques et leur utilisation pour la régénération osseuse
EP1988395A1 (fr) 1997-05-30 2008-11-05 Curis, Inc. Procédés d'évaluation de la morphogénèse de tissus et activité
EP2309261A1 (fr) 1997-05-30 2011-04-13 Stryker Corporation Procédés d'évaluation de la morphogénèse de tissus et activité
US7147839B2 (en) 1998-05-29 2006-12-12 Curis, Inc. Methods for evaluating tissue morphogenesis and activity
WO2001011041A1 (fr) * 1999-08-06 2001-02-15 Hygene Ag PROTEINE MONOMERE DE LA FAMILLE DES TGF-$g(b)
US6972321B1 (en) 1999-08-06 2005-12-06 Hygene Ag Monomeric protein of the TGF-β family
US7569227B2 (en) 1999-08-06 2009-08-04 Hygene Ag Monomeric protein of the TGF-β family
EP1574578A1 (fr) * 1999-08-06 2005-09-14 HyGene AG Protéine monomère de la famille TGF-beta
EP1074620A1 (fr) * 1999-08-06 2001-02-07 HyGene AG Protéine monomère de la famille TGF-beta
US10500234B2 (en) 2003-06-27 2019-12-10 DePuy Synthes Products, Inc. Postpartum cells derived from umbilical cord tissue, and methods of making and using the same
EP2338982A2 (fr) 2003-06-27 2011-06-29 Ethicon, Incorporated Cellules isolées de cordon ombilical post-partum, méthodes pour leur préparation et leur utilisation.
US10744164B2 (en) 2003-06-27 2020-08-18 DePuy Synthes Products, Inc. Repair and regeneration of ocular tissue using postpartum-derived cells
US11000554B2 (en) 2003-06-27 2021-05-11 DePuy Synthes Products, Inc. Postpartum cells derived from placental tissue, and methods of making and using the same
US7875272B2 (en) 2003-06-27 2011-01-25 Ethicon, Incorporated Treatment of stroke and other acute neuraldegenerative disorders using postpartum derived cells
US10383898B2 (en) 2003-06-27 2019-08-20 DePuy Synthes Products, Inc. Postpartum cells derived from placental tissue, and methods of making and using the same
US10220059B2 (en) 2003-06-27 2019-03-05 DePuy Synthes Products, Inc. Postpartum cells derived from placental tissue, and methods of making and using the same
US10195233B2 (en) 2003-06-27 2019-02-05 DePuy Synthes Products, Inc. Postpartum cells derived from placental tissue, and methods of making and using the same
US11179422B2 (en) 2003-06-27 2021-11-23 DePuy Synthes Products, Inc. Method of differentiating umbilical cord tissue into a chondrogenic phenotype
US10039793B2 (en) 2003-06-27 2018-08-07 DePuy Synthes Products, Inc. Soft tissue repair and regeneration using postpartum-derived cells and cell products
US9717763B2 (en) 2003-06-27 2017-08-01 DePuy Synthes Products, Inc. Postpartum cells derived from umbilical cord tissue, and methods of making and using the same
US9592258B2 (en) 2003-06-27 2017-03-14 DePuy Synthes Products, Inc. Treatment of neurological injury by administration of human umbilical cord tissue-derived cells
EP2336298A2 (fr) 2003-06-27 2011-06-22 Ethicon, Incorporated Cellules isolées de placenta post-partum, méthodes pour leur préparation et leur utilisation.
US10758576B2 (en) 2003-06-27 2020-09-01 DePuy Synthes Products, Inc. Soft tissue repair and regeneration using postpartum-derived cells and cell products
EP2341131A2 (fr) 2003-06-27 2011-07-06 Ethicon, Incorporated Utilisation de cellules dérivées postpartum pour la régénération et la réparation du cartilage et des os
US9579351B2 (en) 2003-06-27 2017-02-28 DePuy Synthes Products, Inc. Postpartum cells derived from placental tissue, and methods of making and using the same
US9572840B2 (en) 2003-06-27 2017-02-21 DePuy Synthes Products, Inc. Regeneration and repair of neural tissue using postpartum-derived cells
US8318483B2 (en) 2003-06-27 2012-11-27 Advanced Technologies And Regenerative Medicine, Llc Postpartum cells derived from umbilical cord tissue, and methods of making and using the same
US9504719B2 (en) 2003-06-27 2016-11-29 DePuy Synthes Products, Inc. Soft tissue repair and regeneration using postpartum-derived cells and cell products
US11191789B2 (en) 2003-06-27 2021-12-07 DePuy Synthes Products, Inc. Cartilage and bone repair and regeneration using postpartum-derived cells
US9234172B2 (en) 2003-06-27 2016-01-12 DePuy Synthes Products, Inc. Repair and regeneration of ocular tissue using postpartum-derived cells
US8703121B2 (en) 2003-06-27 2014-04-22 DePuy Synthes Products, LLC Postpartum-derived cells for use in treatment of disease of the heart and circulatory system
US9498501B2 (en) 2003-06-27 2016-11-22 DePuy Synthes Products, Inc. Postpartum cells derived from umbilical cord tissue, and methods of making and using the same
US8372419B2 (en) 2004-03-10 2013-02-12 Scil Technology Gmbh Coated implants, their manufacturing and use thereof
WO2005089829A2 (fr) 2004-03-10 2005-09-29 Scil Technology Gmbh Implants revetus, fabrication et utilisation de ceux-ci
US7575751B2 (en) 2004-04-27 2009-08-18 Research Development Foundation Activin-A mutants
EP2298335A1 (fr) 2004-05-25 2011-03-23 Stryker Corporation Utilisation de protéines morphogéniques pour le traitement de défauts du cartilage
US7875273B2 (en) 2004-12-23 2011-01-25 Ethicon, Incorporated Treatment of Parkinson's disease and related disorders using postpartum derived cells
US9175261B2 (en) 2005-12-16 2015-11-03 DePuy Synthes Products, Inc. Human umbilical cord tissue cells for inhibiting adverse immune response in histocompatibility-mismatched transplantation
US9125906B2 (en) 2005-12-28 2015-09-08 DePuy Synthes Products, Inc. Treatment of peripheral vascular disease using umbilical cord tissue-derived cells
US9585918B2 (en) 2005-12-28 2017-03-07 DePuy Synthes Products, Inc. Treatment of peripheral vascular disease using umbilical cord tissue-derived cells
EP2540310A1 (fr) 2006-05-17 2013-01-02 Stryker Corporation Procédés de traitement de défauts du cartilage à l'aide d'un complexe de protéine morphogénique soluble
US7956028B2 (en) 2006-12-14 2011-06-07 Johnson & Johnson Regenerative Therapeutics, Llc Protein stabilization formulations
US8435943B2 (en) 2006-12-14 2013-05-07 Advanced Technogies And Regenerative Medicine, Llc Protein stabilization formulations
US8895506B2 (en) 2006-12-14 2014-11-25 DePuy Synthes Products, LLC Protein stabilization formulations
WO2008082563A2 (fr) 2006-12-21 2008-07-10 Stryker Corporation Formulations à libération entretenue comprenant des cristaux, des gels macromoléculaires et des suspensions particulaires d'agents biologiques
US7964561B2 (en) 2007-06-29 2011-06-21 Advanced Technologies And Regenerative Medicine, Llc Protein formulations for use at elevated temperatures
US8058237B2 (en) 2007-08-07 2011-11-15 Advanced Technologies & Regenerative Medicine, LLC Stable composition of GDF-5 and method of storage
US8741840B2 (en) 2008-02-13 2014-06-03 Washington University BMP-7 for use in treating neointimal hyperplasia
US7947649B2 (en) 2008-04-14 2011-05-24 Advanced Technologies And Regenerative Medicine, Llc Liquid buffered GDF-5 formulations
US10179900B2 (en) 2008-12-19 2019-01-15 DePuy Synthes Products, Inc. Conditioned media and methods of making a conditioned media
US10557116B2 (en) 2008-12-19 2020-02-11 DePuy Synthes Products, Inc. Treatment of lung and pulmonary diseases and disorders
WO2010093941A2 (fr) 2009-02-12 2010-08-19 Stryker Corporation Composition et procédés d'administration systémique les moins invasifs possibles de protéines comprenant des membres de la superfamille des tgf-β
WO2010093925A2 (fr) 2009-02-12 2010-08-19 Stryker Corporation Administration périphérique de protéines et notamment de membres de la superfamille du tgf-β pour traiter les maladies et troubles systémiques
WO2010110974A1 (fr) 2009-03-24 2010-09-30 Stryker Corporation Procédés et compositions pour l'ingénierie tissulaire
US9943552B2 (en) 2009-03-26 2018-04-17 DePuy Synthes Products, Inc. hUTC as therapy for Alzheimer's disease
WO2010144696A1 (fr) 2009-06-11 2010-12-16 Burnham Institute For Medical Research Différenciation dirigée de cellules souches
WO2011031856A1 (fr) 2009-09-09 2011-03-17 Stryker Corporation Bmp-7 à utiliser dans le traitement de la douleur induite par les lésions et les maladies d'articulation
WO2011035094A1 (fr) 2009-09-17 2011-03-24 Stryker Corporation Tampons utilisés pour la régulation du ph des protéines morphogénétiques osseuses
WO2011087768A1 (fr) 2009-12-22 2011-07-21 Stryker Corporation Variants de la bmp-7 dotés d'une immunogénicité réduite
US10724105B2 (en) 2011-12-23 2020-07-28 DePuy Synthes Products, Inc. Detection of human umbilical cord tissue-derived cells
US9611513B2 (en) 2011-12-23 2017-04-04 DePuy Synthes Products, Inc. Detection of human umbilical cord tissue derived cells

Also Published As

Publication number Publication date
AU2979895A (en) 1996-01-25
JPH10502527A (ja) 1998-03-10
JP3859703B2 (ja) 2006-12-20
IL114397A0 (en) 1995-10-31
CN1110558C (zh) 2003-06-04
CN1151758A (zh) 1997-06-11
DE19580745D2 (de) 1999-03-11

Similar Documents

Publication Publication Date Title
WO1996001316A1 (fr) NOUVEAU FACTEUR DE CROISSANCE/DIFFERENCIATION DE LA FAMILLE DU TGF-$g(b)
DE69327645T2 (de) Dna-sequenzen kodierend für neuartige wachstums-/differentierungsfaktoren
EP0713529B1 (fr) Facteur de croissance et de differenciation de la famille de TGF-B
DE69432815T2 (de) Wachstumsfaktor-8
DE69229454T2 (de) Untereinheit-C des vaskulären endothelialen Zellwachstumsfaktors
DE69332221T2 (de) Hepatozytwachstumfaktor Variante
DE69629181T2 (de) Wachstumsfaktor-b, spezifisch für vaskuläre endothelzellen
DE3789859T2 (de) Formen des Koloniestimulierungsfaktors 1.
DE69731834T2 (de) Agouti verwandtes gen
DE69435038T2 (de) Aktivin rezeptor-ähnliche kinase (alk), gehörend zur tgf rezeptorfamilie und/oder zur bmp rezeptorfamilie
DE69332779T2 (de) Aktivin-rezeptor-ähnliche kinasen, proteine mit serin/threonin kinase domänen und deren anwendungen
DE69133591T2 (de) CNP-Gen und Vorläuferprotein aus Schwein
EP0837938B1 (fr) Utilisation de mp52 ou de mp121 pour la therapie et la prophylaxie de maladies du systeme nerveux
DE68928203T2 (de) Rekombinante dns-moleküle, wirte und dem menschlichen somatomedin-trägerprotein ähnliche polypeptide
DE69132814T2 (de) Neues insulinähnliches wachstumsfaktor bindendes protein igfbp-5
WO1995003328A2 (fr) Proteine d'inhibition de melanomes
DE68925199T2 (de) Peptide und polypeptide stammend von den submaxillaren drüsen der ratte, deren entsprechende monoklonale und polyklonale antikörper entsprechende hybridomen und verwendung dieser verbindungen in der diagnose bei bestimmungen und für pharmazeutische zwecke
DE69132813T2 (de) Genetisches igfbp-5 rodierendes material
WO1995018228A1 (fr) Cytokine humaine circulante cc-1
US7129054B2 (en) Antibodies to a growth/differentiation factor of the TGF-β family
US6171584B1 (en) Method of treatment with growth/differentiation factors of the TGF-β family
DE69233155T2 (de) Insulinartigen wachstumsfaktor bindendes protein
EP0805204B1 (fr) Protéine récepteur spécifique de l'épididyme et son utilisation
US5807713A (en) DNA encoding growth/differentiation factor
DE69534596T2 (de) Epil/plazentin

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 95193816.9

Country of ref document: CN

AK Designated states

Kind code of ref document: A1

Designated state(s): AM AT AU BB BG BR BY CA CH CN CZ DE DK EE ES FI GB GE HU IS JP KE KG KP KR KZ LK LR LT LU LV MD MG MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TT UA UG US UZ VN

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): KE MW SD SZ UG AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA

REF Corresponds to

Ref document number: 19580745

Country of ref document: DE

Date of ref document: 19990311

WWE Wipo information: entry into national phase

Ref document number: 19580745

Country of ref document: DE

REG Reference to national code

Ref country code: DE

Ref legal event code: 8607