WO1991006645A1 - Verfahren zur mutagenese von doppelsträngiger zirkulärer dna - Google Patents
Verfahren zur mutagenese von doppelsträngiger zirkulärer dna Download PDFInfo
- Publication number
- WO1991006645A1 WO1991006645A1 PCT/EP1990/001939 EP9001939W WO9106645A1 WO 1991006645 A1 WO1991006645 A1 WO 1991006645A1 EP 9001939 W EP9001939 W EP 9001939W WO 9106645 A1 WO9106645 A1 WO 9106645A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- dna
- strand
- mutagenesis
- exonuclease
- dna molecule
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
Definitions
- the invention relates to a method for mutagenesis of double-stranded circular DNA using oligonucleotides.
- nucleotide analogs are incorporated into a region of the mutated DNA strand.
- the wild-type DNA can be selectively destroyed, since it is possible to introduce single-strand breaks in a targeted manner in the unmodified wild-type DNA strand.
- Changing the nucleotide sequence of a gene or a regulatory element by site-specific mutagenesis is one of the most important methods used in molecular biology to research structure-function relationships. In order to obtain a high mutation efficiency in oligonucleotide-specific mutagenesis, it is necessary to carry out a selection against the wild-type sequence. Some methods have already been developed for this purpose, but it is necessary that the gene in question is in single-stranded form (Kunkel et al.
- the relevant DNA sequences have to be subcloned into a single-stranded vector such as M13 (essing (1983), Methods in Enzymology 101 (part C), 20-78) or into a special vector, whose DNA can be isolated either in single-stranded or double-stranded form (Vieira and Messing (1987), Methods in Enzymology, 153 (Part D), 3-11).
- a single-stranded vector such as M13 (essing (1983), Methods in Enzymology 101 (part C), 20-78) or into a special vector, whose DNA can be isolated either in single-stranded or double-stranded form (Vieira and Messing (1987), Methods in Enzymology, 153 (Part D), 3-11).
- the object of the invention was accordingly to develop a generally applicable method for mutagenesis of double-stranded circular DNA which has a high mutation efficiency through specific destruction of the wild-type sequences.
- the object of the invention is achieved by a method for mutagenesis of double-stranded circular DNA, wherein (a) a first specific single-strand break (nick) is introduced in the DNA molecule in the vicinity of the mutagenesis site, (b) performing a first exonuclease treatment which partially degrades the nodded strand of DNA to create a limited single stranded region on the DNA molecule which also includes the mutagenesis site,
- a mutagenesis primer and optionally a further oligonucleotide hybridizes to the single-stranded region of the DNA molecule
- the partially single-stranded DNA molecule from (f) is treated with polymerase to produce a mutated homodomplex DNA molecule.
- the method according to the invention is in principle suitable for mutagenesis of all double-stranded circular DNA molecules.
- Plasmid DNA which can be produced by known biochemical methods, is preferably used.
- the quality of the plasmid DNA is decisive for the success of the method according to the invention.
- Bad results are obtained if the DNA preparation contains small RNA fragments which cannot be removed even by ultracentrifugation in a cesium chloride gradient. These RNA fragments arise during an RNAse treatment during DNA preparation and are made visible in an agarose gel electrophoresis by the application of a large amount of DNA.
- RNA fragments reduce the efficiency of the binding of the mutagenesis oligonucleotide primer, either by competing for the same binding site on the DNA or by binding directly to the primer.
- the RNA fragments are separated by spin dialysis with a Centrikon 30 microconcentrator.
- a reduction in the mutation efficiency was also observed when a larger proportion of the plasmid DNA with lower gel electrophoresis mobility was present than double-stranded closed-circular DNA.
- These additional DNA bands are believed to be from more concatemic plasmid forms. It was surprisingly found that the amplification of the DNA with chloramphenicol reduces the ratio of concatener DNA to double-stranded closed circular DNA. If it should nevertheless be necessary, the DNA with a higher molecular weight can be separated using a nucleogen anion exchanger HPLC column (Macherey-Nagel).
- a first specific single strand break in the DNA molecule in the vicinity of the mutagenesis site.
- the distance of the nick from the mutagenesis site can be approximately 10 to 3500 nucleotides, preferably approximately 10 to 1300 nucleotides. If the plasmid pUC19 with a length of 2.6 kb is used as the double-stranded circular DNA molecule, any position on the plasmid is suitable for introducing the nick.
- the nick can be introduced, for example, by adding an oligonucleotide which is complementary to the cleavage region and carries a complex metal ion at its end.
- the complexed metal ion can be, for example, Fe 1 '/ EDTA (Moser and Dervan, (1987) Science 238, 645-650), Ca 1 ' / phenanthroline (Chen and Sigman (1986) Proc. Natl. Acad. Sci. USA 83, 7147 -7151) or other suitable metal complexes.
- the complementary DNA strand can be cleaved in a manner known per se by adding a suitable activator, for example ascorbic acid, dithiothreitol or mercaptopropionic acid.
- the first specific single-strand break can also be introduced by incubation with a suitable restriction endonuclease in the presence of ethidium bromide.
- suitable restriction enzymes are, for example, HindIII or EcoRI.
- EcoRI EcoRI
- the proportion of nodded versus linear product increases when Co 2 + instead of Mg 2 + is used for the reaction.
- the method according to the invention is not restricted to these two restriction endonucleases mentioned, since suitable reaction conditions for specific single strand cleavage in the presence of ethidium bromide are also known for many other restriction enzymes (Dalbadie-McFarland et al., (1982), Proc. Natl. Acad Sei. USA, 19, 6409-6413; Parker (1977) Proc. Natl. Acad. Sei.
- the next reaction step is a first partial degradation reaction of the nodded DNA strand with an exonuclease in order to produce a limited single-stranded area on the DNA molecule which also includes the mutagenesis site.
- Either a 3 ' ⁇ 5' or a 5 ' ⁇ ⁇ ' exonuclease can be used as the exonuclease.
- the choice of the direction of degradation depends on the position of the nick with respect to the mutagenesis site, so that the exonuclease degradation proceeds from the nick in the direction of the mutagenesis site.
- the cleavage site should not be more than half the nucleotides of the circular DNA molecule from the mutagenesis site with respect to the direction of exonuclease degradation.
- the exonuclease used should have a low processivity in this reaction, since in this way it is easy to control the extent of the single-stranded area on the DNA molecule.
- Exonuclease III or T5 gene D15 exonuclease are preferably used, but other exonucleases with low processivity are also well suited.
- Exonucleases with high processivity, such as the T7 exonuclease are less suitable for this step.
- the subsequent hybridization of the mutagenesis primer and, if appropriate, a further nucleotide to the single-stranded region of the DNA molecule can be carried out using known biochemical methods.
- the hybridization conditions are to be selected depending on the length and base composition of the oligonucleotide (s) used.
- a closed heteroduplex DNA molecule is generated by treating the partially single-stranded DNA molecule with DNA polymerase and ligase.
- the method described by the preceding one Exonuclease degradation generated single-stranded DNA region are filled with a polymerase reaction in which at least one of the normal deoxyribonucleoside triphosphates (dNTPs) is replaced by a modified nucleotide.
- the polymerase reaction itself is carried out according to known biochemical processes, care being taken that the DNA polymerase used in each case accepts the modified nucleotide used in each case as a substrate.
- nucleotide analogs which inhibit (subsequent) cleavage with a restriction enzyme, but cannot be incorporated enzymatically into the DNA, by incorporation into the mutagenesis pri er or into another To insert the oligonucleotide covering the cleavage site of the second restriction enzyme into the mutated DNA strand.
- modified nucleotides is therefore to be understood quite generally as base, phosphate and / or sugar analogs.
- the sugar analogs used can preferably be 2 • -deoxy-2'-fluoronucleotides, ribonucleotides and / or 3 • -deoxy-3 * -thionucleotides.
- the base analogs used are preferably 4-thiothymine, 2-thiothymine, uracil, 2-aminopurine, 2,6-diaminopurine, 6-thiopurine, 6-thio-2-aminopurine, 7-deazaguanine, 7-deazaadenine, purine, hypoxanthine or / and 5-methylcytosine used.
- Phosphonates, phosphorodithioates and / or phosphorothioates are preferably used as phosphate analogs.
- the use of one or more [ ⁇ -S] deoxyribonucleoside triphosphates ([ ⁇ -S] dNTPs) as modified nucleotides is particularly preferred.
- the next step is the introduction of a second specific single strand break in the non-mutated strand of the heteroduplex DNA molecule. This is preferably done by cleavage with a suitable restriction enzyme.
- the restriction enzyme When choosing the restriction enzyme, it should be noted here that its activity can be inhibited by incorporating nucleotide analogs into the mutated strand of the heteroduplex DNA molecule, so that there is no linearization, but only a specific cleavage of the non-mutated strand. This is the case if modified nucleotides are located in the mutated DNA strand at the recognition site of the restriction enzyme. Therefore, the cleavage site (or the cleavage sites) of the enzyme must lie exclusively within the range which was made single-stranded by the first partial ex nuclease degradation of the DNA molecule. However, if there are only normal nucleotides at the recognition site of the restriction enzyme in both DNA strands, linearization takes place.
- restriction enzymes can be used for the mutagenesis method according to the invention in order to introduce specific single-strand breaks in double-stranded DNA molecules which contain nucleotide analogs, by carrying out the reaction in the presence of ethidium bromide if necessary (Sayers et al.,
- the restriction enzyme EcoRV is also suitable for introducing a single strand break even when a DNA strand
- the next step in the process is a second, possibly partial, exonuclease degradation of the non-mutated, nodded strand of the heteroduplex DNA molecule.
- the aim of this degradation is to destroy the non-mutated wild-type DNA strand at the mutagenesis site.
- care must be taken that the degradation of the non-mutated strand is in the direction of the mutagenesis site takes place.
- a non-processive exonuclease for example the T5 exonuclease or exonuclease III, is preferably also used for the second degradation reaction. This is particularly advisable if the mutation site is located within a few 100 base pairs from the site of the single strand break.
- FIG. 1 The diagram shown in FIG. 1 is intended to illustrate the course of the individual reaction steps in a preferred embodiment of the process according to the invention.
- FIG. 1A A double-stranded, closed, circular plasmid is assumed ( Figure 1A).
- a single-stranded DNA region must be generated, to which the mutagenesis primer can attach. For this it is necessary to introduce a nick near the mutagenesis site. This can be done by cleaving the DNA with the restriction endonuclease HindIII in the presence of ethiium bromide. However, this split is not strand-specific. Therefore, in addition to linearized and still intact DNA molecules, a mixture of double-stranded DNA molecules is formed, in which the nick is either on the coding or on the non-coding strand ( Figure 1B).
- the nick in turn serves as the starting point for a degradation reaction with either a 3 ' ⁇ 5' or a 5 ' ⁇ 3' exonuclease.
- the product of the degradation reaction in which the DNA strand complementary to the mutagenesis primer remains intact is called “Productive degradation product” called ( Figure IC).
- a plasmid molecule in which the strand complementary to the mutagenesis primer is degraded, on the other hand, is the "unproductive degradation product".
- the exonuclease reaction must proceed beyond the mutagenesis site, so that the mutagenesis primer can attach to the single-stranded area of the productive degradation product.
- the hybridization takes place selectively.
- the gap in both strands is filled by a polymerization reaction in which at least one of the normal nucleotides is replaced by a nucleotide analog (here [ ⁇ -S] dGTP).
- a nucleotide analog here [ ⁇ -S] dGTP.
- the choice of the nucleotide analog depends on the restriction enzyme used in the next reaction step.
- One of the products of this first polymerisation reaction is a mutated heteroduplex DNA molecule that contains the desired mutation in one of the two strands ( Figure 1D).
- the enzyme should be inhibited by the built-in nucleotide analog.
- the cleavage site for the enzyme must lie in the single-stranded region produced in the first degradation reaction.
- the enzyme PstI was used in the reaction shown in Figure 1.
- the second restriction cleavage ensures that the original plasmid DNA, which had remained intact in the previous reaction steps, is linearized ( Figure 1E).
- those DNA molecules are also linearized which have no nucleotide analog at the recognition site of the enzyme (here: PstI) incorporated into the DNA. It is about by approximately 50% of the total number of DNA molecules that have arisen from "unproductive degradation products" and therefore do not contain any [-S] dGTP at the Pstl site ( Figure 1E).
- the Pstl reaction destroys all molecules that contain the wild-type sequence at the mutagenesis site.
- the "productive breakdown products” contain [ ⁇ -S] dGTP in the mutated strand and normal phosphate bonds in the wild-type strand in the region of the recognition site of PstI. Thus, treatment with PstI creates a nick in the non-mutated DNA strand.
- Exonuclease III (100 U / ⁇ l), HindIII (20 U / ⁇ l), EcoRI (20 U / ⁇ l) and PstI (20 U / ⁇ l) were obtained from New England Biolabs.
- T7 Gen 6 exonuclease (30 or 100 U / ul) was from United States Biochemicals.
- Partially purified T5 gene D15 exonuclease (1 mg / ml) came from J. Sayers, Göttingen. ATP and dNTPs were from Boehringer Mannheim.
- the dNTP analog Sp-dGTP S was synthesized according to Ludwig and Eckstein (1989) J. Org. Chem. 54., 631-635 or obtained from Amersham.
- DNA polymerase I, T4 DNA nuclease and the Klenow frag ent of DNA polymerase I were prepared according to Sayers et al., (1988), Nucleic Acids Res. H, 791-802.
- Oligonucleotides were as follows, the mutagenesis
- ACO 5'-d (GGTACCCGGGGATCCTCTAGAGTCG) -3 ';
- oligonucleotides were made using the phosphoramidite method using an applied biosystem
- the plasmid DNA was enriched from a culture amplified with chloramphenicol according to Miller (1987), Methods in Enzymology 152, 145-170. Deviating from this, the RNase A was added together with the EDTA solution and after centrifuging the cellular residues, the plasmid DNA was precipitated by adding a third volume of a 30% polyethylene glycol 6000 solution with 1.5 mol / 1 NaCl during one three hour incubation on ice. After centrifugation in a cesium chloride-ethidium bromide gradient, the DNA was further purified by spin dialysis with a Centricon-30 microconcentrator from Amicon.
- the nodded double-stranded DNA was for 6 minutes at 37 ° C. with exonuclease III (100 units) in a reaction volume of 95 ⁇ l with 110 mmol / 1 NaCl, 10 mmol / 1 Tris-HCl, pH 8, 7 mmol / 1 MgCl 2 and 7 mmol / 1 DTT treated.
- the reaction was carried out under the same conditions as for exonuclease III, except that the buffer contained 60 mmol / 1 NaCl and the Tris-HCl buffer, pH 8, by 30 mmol / 1 ethanolamine buffer, pH 9, 3, has been replaced. After the incubation, the enzymes were denatured by heat treatment at 70 ° C. for 10 minutes and 2 ⁇ l of the DNA solution were removed for gel electrophoresis.
- the NaCl concentration of the first degradation reaction was increased to 150 mmol / l and 2 ⁇ l of the 5 '-phosphorylated mutagenesis primer (25 pmol), which was taken directly from the batch for a phosphorylation reaction, was added.
- the solution was incubated at 70 ° C. for 10 minutes and then cooled in a thermoblock from 56 ° C. to 25 ° C. over 30 minutes. Formation of the heteroduplex DNA:
- the DNA solution was made up to 25 mmol / 1 Tris-HCl, pH 8, 70 mmol / 1 NaCl, 5 mmol / 1 DTT, 8 mmol / 1 MgCl 2 , 1.2 mmol / 1 ATP, each 280 ⁇ mol / 1 of dATT, dCTP, dTTP and Sp-dGTP S, 10 units of Klenow fragment and 15 units of T4 DNA ligase in a total volume of 210 ⁇ l.
- the reaction mixture was incubated at 16 ° C. for 16 hours. 5 ⁇ l were then removed for a gel electrophoretic analysis and 2 ⁇ l for the transformation of competent cells.
- the polymerization solution was extracted with phenol and spin dialyzed using a Centrikon 30 microconcentrator. This was followed by a reaction with 70 units of PstI in 100 ⁇ l reaction volume with 100 mmol / 1 NaCl, 10 mmol / 1 Tris-HCl, pH 7.5 and 10 mmol / 1 MgCl 2 . After incubation at 37 ° C. for 80 minutes and heat inactivation at 70 ° C. for 10 minutes, 4 ⁇ l were removed for gel electrophoretic analysis and 2 ⁇ l for transformation.
- Second degradation reaction of the nodded plasmid the DNA solution was extracted with phenol and the buffer was exchanged using a Centrikon 30 microconcentrator. The solution contained in a volume of 100 ⁇ l 10 mmol / 1 Tris-HCl, pH 8, 60 mmol / 1 NaCl, 7 mmol / 1 MgCl 2 and 7 mmol / 1 DTT.
- the degradation reactions with exonuclease III or T5 exonuclease were carried out as already described under "First degradation reaction".
- Degradation with T7 exonuclease was carried out for 3 (mimes) under the same conditions as described for the T5 exonuclease, except that the 30 mmol / l ethanolamine buffer was replaced by Tris-HCl, pH 8 After incubation, the samples were heated at 70 ° C for 10 minutes and then cooled in a thermoblock from 56 ° C to 25 ° C over 30 minutes. 8 ⁇ l were removed for gel electrophoresis and 2 ⁇ l for transformation.
- the DNA solution was diluted to 220 ul.
- DNA polymerase I (10 units), 4 dNTPs, ATP, MgCl 2 , Tris-HCl, pH 8, DTT and T4 ligase were added in the same concentrations as already described under "formation of the heteroduplex DNA" .
- 14 ⁇ l were removed for gel electrophoretic analysis and 2 ⁇ l for the transformation of competent cells.
- Competent TG-1 cells were according to Chung et al. (1989) Proc. Natl. Acad. Be. USA, .86, 2172-2175 and used for all transformations.
- 2 ⁇ l of control plasmid (wild-type pUC19 or pUC19 amber DNA, 10 ng / ml) or mutated plasmid DNA (taken directly from the various enzyme reactions) were carefully mixed with 100 ⁇ l of the competent cells and incubated on ice for 30 minutes. Then 2, 10 and 80 ⁇ l of the transformed cells were spread on plates containing ampicillin, IPTG, X-Gal with 2xYT agar medium. The plates were incubated at 30 ° C for 16 hours and the mutation efficiency was determined by counting the blue and white colonies.
- Table 1 shows a summary of the results of several plasmid mutagenesis experiments using different combinations of restriction enzymes and exonucleases. From this it can be seen that the efficiency is generally between 70 and 80%. The lesser Efficiency in reactions 4 and 5 is believed to result from impurities in the T5 exonuclease preparation.
- the Hindlll site is at position 447, the EcoRI site at position 396 and the Pstl site at position 435 of pUCl9
- BL means blue colonies, CL colorless colonies on IPTG, X-Gal containing plates
- Trp codon (TGG) is converted into an amber stop codon (TAG) at position 366 within the plasmid-encoded LacZ gene.
- This plasmid was mutagenized according to reaction 1. The DNA sequence of 3 colorless colonies was determined, all of which contained the desired mutation. This plasmid was produced by mutagenesis under non-optimized conditions.
- This double mutagenesis converts an ocher stop codon (TAA) into an Asp codon (GAA) at positions 419 and 421 within the pUCl9 polylinker. Average of two experiments
- Table 2 shows the mutation efficiency of the plasmid mutagenesis at various intermediate stages of the method using the enzyme combination HindIII / ExoIII / PstI / T7 exonuclease (Table 1, reaction 3). It can be seen from this that the mutation efficiency of the DNA is already relatively high after the second degradation reaction and the final repolymerization step can therefore possibly be omitted.
Landscapes
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DEP3936258.2 | 1989-10-31 | ||
| DE19893936258 DE3936258C1 (https=) | 1989-10-31 | 1989-10-31 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO1991006645A1 true WO1991006645A1 (de) | 1991-05-16 |
Family
ID=6392593
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP1990/001939 Ceased WO1991006645A1 (de) | 1989-10-31 | 1990-10-30 | Verfahren zur mutagenese von doppelsträngiger zirkulärer dna |
Country Status (2)
| Country | Link |
|---|---|
| DE (1) | DE3936258C1 (https=) |
| WO (1) | WO1991006645A1 (https=) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1995009915A1 (en) * | 1993-10-05 | 1995-04-13 | Nbl Gene Sciences Limited | In vitro method for circular single-stranded dna |
| WO2001029212A1 (en) * | 1999-10-19 | 2001-04-26 | Enchira Biotechnology Corporation | Methods for chimeragenesis of whole genomes or large polynucleotides |
| EP1103606A3 (en) * | 1995-11-30 | 2001-08-22 | Maxygen, Inc. | Methods for generating polynucleotides having desired characteristics by iterative selection and recombination |
| WO2001029211A3 (en) * | 1999-10-19 | 2002-01-24 | Enchira Biotechnology Corp | Method for directed evolution by random chimeragenesis on transient templates |
| EP1176204A1 (en) * | 2000-07-24 | 2002-01-30 | Fermentas AB | Nuclease |
| US6420175B1 (en) | 1994-02-17 | 2002-07-16 | Maxygen, Inc. | Methods for generating polynucleotides having desired characteristics by iterative selection and recombination |
| WO2002030945A3 (en) * | 2000-10-13 | 2002-07-18 | Medical Res Council | Concatenated nucleic acid sequences |
| US7166466B2 (en) | 1997-12-08 | 2007-01-23 | California Institute Of Technology | Method for creating polynucleotide and polypeptide sequences |
| EP1626978A4 (en) * | 2003-02-06 | 2007-05-02 | Rensselaer Polytech Inst | POLYMERASE-BASED PROTOCOLS FOR INTRODUCING DELETIONS AND INSERTIONS |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE10030376A1 (de) * | 2000-06-21 | 2002-01-24 | Bayer Ag | Neues Verfahren zum Auffinden neuer Wirkstoffe |
-
1989
- 1989-10-31 DE DE19893936258 patent/DE3936258C1/de not_active Expired - Lifetime
-
1990
- 1990-10-30 WO PCT/EP1990/001939 patent/WO1991006645A1/de not_active Ceased
Non-Patent Citations (3)
| Title |
|---|
| Nucleic Acids Research, Band 13, Nr. 24, 1985, J.W. Taylor et al.: "The rapid generation of oligonucleotide-directed mutations at high frequency using phosphorothioate-modified DNA", Seiten 8765-8785 * |
| Nucleic Acids Research, Band 16, Nr. 3, 1988, J.R. Sayers et al.: "5'-3' Exonucleases in phosphorothioate-based oligonucleotide-directed mutagenesis", Seiten 792-802 * |
| Proceedings of the National Academy of Sciences, Band 87, Nr. 4, Februar 1990, (Washington, DC, US) D.B. Olsen et al.: "High-efficiency oligonucleotide-directed plasmid mutagenesis" Seiten 1451-1455 * |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1995009915A1 (en) * | 1993-10-05 | 1995-04-13 | Nbl Gene Sciences Limited | In vitro method for circular single-stranded dna |
| US6420175B1 (en) | 1994-02-17 | 2002-07-16 | Maxygen, Inc. | Methods for generating polynucleotides having desired characteristics by iterative selection and recombination |
| US6573098B1 (en) | 1994-02-17 | 2003-06-03 | Maxygen, Inc. | Nucleic acid libraries |
| US7288375B2 (en) | 1994-02-17 | 2007-10-30 | Maxygen, Inc. | Methods for generating polynucleotides having desired characteristics by iterative selection and recombination |
| EP1103606A3 (en) * | 1995-11-30 | 2001-08-22 | Maxygen, Inc. | Methods for generating polynucleotides having desired characteristics by iterative selection and recombination |
| US7166466B2 (en) | 1997-12-08 | 2007-01-23 | California Institute Of Technology | Method for creating polynucleotide and polypeptide sequences |
| WO2001029212A1 (en) * | 1999-10-19 | 2001-04-26 | Enchira Biotechnology Corporation | Methods for chimeragenesis of whole genomes or large polynucleotides |
| WO2001029211A3 (en) * | 1999-10-19 | 2002-01-24 | Enchira Biotechnology Corp | Method for directed evolution by random chimeragenesis on transient templates |
| EP1176204A1 (en) * | 2000-07-24 | 2002-01-30 | Fermentas AB | Nuclease |
| WO2002030945A3 (en) * | 2000-10-13 | 2002-07-18 | Medical Res Council | Concatenated nucleic acid sequences |
| EP1626978A4 (en) * | 2003-02-06 | 2007-05-02 | Rensselaer Polytech Inst | POLYMERASE-BASED PROTOCOLS FOR INTRODUCING DELETIONS AND INSERTIONS |
Also Published As
| Publication number | Publication date |
|---|---|
| DE3936258C1 (https=) | 1991-04-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| DE69611102T2 (de) | Verstärkung der mutagenese von nukleinsäuren | |
| DE69527171T2 (de) | Strangverdrängungsamplifikation unter Verwendung von thermophilen Enzymen | |
| DE69232457T2 (de) | Verwendung einer exo-nukleotidprobe in der genklonierung | |
| DE68915202T2 (de) | Verfahren zur Vermehrung und zum Nachweis von Nukleinsäuresequenzen. | |
| DE69031043T2 (de) | In vitro-dns-synthesereaktionen unter verwendung von geändertem phi-29-dns-polymerase und für besagte polymerase kodierendes dns-bruchstück | |
| DE69713866T2 (de) | Verfahren zur direkten, exponentiellen Amplifikation und Sequenzierung von DNA-Molekülen und seine Anwendung | |
| DE69130800T2 (de) | Verringerung von nicht spezifischer amplifikation während einer (in vitro) nukleinsäure amplifikation unter verwendung von modifizierten nukleinsäure basen | |
| DE3750288T2 (de) | T7-DNS-Polymerase. | |
| DE69629077T2 (de) | Thermostabile DNA Polymerase | |
| DD284692A5 (de) | Verfahren zur herstellung prozessiver dna-polymerase | |
| DE502588T1 (de) | Verfahren zur Amplifizierung von Nukleinsäuresequenzen. | |
| EP1047706A2 (de) | Verfahren zur synthese von nucleinsäuremolekülen | |
| DE10119005A1 (de) | Verfahren zur Proteinexpression ausgehend von stabilisierter linearer kurzer DNA in zellfreien in vitro-Transkription/Translations-Systemen mit Exonuklease-haltigen Lysaten oder in einem zellulären System enthaltend Exonukleasen | |
| DE3936258C1 (https=) | ||
| DE3485834T2 (de) | Verfahren zum bestimmen von nukleinsaeuresequenzen. | |
| DE69232768T2 (de) | Einzelsträngige hybride DNS-RNS Moleküle und Methoden zur Herstellung | |
| DE60300389T2 (de) | Verfahren zur selektiven zufallsmutagenese von polynukleotiden | |
| DE60029225T2 (de) | Zusammensetzungen und verfahren zu höhere empfindlichkeit und spezifität von nukleinsäuresynthese | |
| EP0292802B1 (de) | Verfahren zur Herstellung von doppelsträngiger DNA | |
| DE3782365T2 (de) | Verfahren fuer die mutagenese durch eine oligonukleotidgeleitete reparatur eines strangbruchs. | |
| EP0093948A1 (de) | Doppelstrangiger Vektor und ihn verwendendes Verfahren | |
| DE3534359C1 (de) | Vektoren und deren Verwendung zur Herstellung von cDNA-Genbanken | |
| DE4332463A1 (de) | Verfahren zur spezifischen Klonierung von Nukleinsäuren | |
| DE3877337T2 (de) | Verfahren zur mutagenese mittels oligonukleotid-gerichteter reparatur eines strandbruchs. | |
| EP1772523A2 (de) | Polymerase-Kettenreaktionsverfahren unter Einsatz einer DNA-Polymerase mit Proofreading-Eigenschaften |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): JP US |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE CH DE DK ES FR GB GR IT LU NL SE |