WO1989003429A1 - Recombinant avipox virus - Google Patents

Recombinant avipox virus Download PDF

Info

Publication number
WO1989003429A1
WO1989003429A1 PCT/US1988/002816 US8802816W WO8903429A1 WO 1989003429 A1 WO1989003429 A1 WO 1989003429A1 US 8802816 W US8802816 W US 8802816W WO 8903429 A1 WO8903429 A1 WO 8903429A1
Authority
WO
WIPO (PCT)
Prior art keywords
virus
antigen
vertebrate
avipox
promoter
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1988/002816
Other languages
English (en)
French (fr)
Inventor
Enzo Paoletti
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Health Research Inc
Original Assignee
Health Research Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=27492413&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO1989003429(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to DE2003199031 priority Critical patent/DE10399031I1/de
Priority to DE2003199032 priority patent/DE10399032I1/de
Priority to DE3890874A priority patent/DE3890874C5/de
Priority to GB8908921A priority patent/GB2217718B/en
Priority to DE883890874T priority patent/DE3890874T1/de
Application filed by Health Research Inc filed Critical Health Research Inc
Priority to DE2002199049 priority patent/DE10299049I1/de
Priority to AT0900788A priority patent/AT408549B/de
Priority to KR1019890700753A priority patent/KR970011149B1/ko
Publication of WO1989003429A1 publication Critical patent/WO1989003429A1/en
Priority to DK198902036A priority patent/DK175904B1/da
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/20Antivirals for DNA viruses
    • A61P31/22Antivirals for DNA viruses for herpes viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16611Simplexvirus, e.g. human herpesvirus 1, 2
    • C12N2710/16622New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/24011Poxviridae
    • C12N2710/24041Use of virus, viral particle or viral elements as a vector
    • C12N2710/24043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2730/00Reverse transcribing DNA viruses
    • C12N2730/00011Details
    • C12N2730/10011Hepadnaviridae
    • C12N2730/10111Orthohepadnavirus, e.g. hepatitis B virus
    • C12N2730/10122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/15011Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15022New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011Details
    • C12N2760/16011Orthomyxoviridae
    • C12N2760/16111Influenzavirus A, i.e. influenza A virus
    • C12N2760/16122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011Details
    • C12N2760/18011Paramyxoviridae
    • C12N2760/18111Avulavirus, e.g. Newcastle disease virus
    • C12N2760/18122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011Details
    • C12N2760/20011Rhabdoviridae
    • C12N2760/20111Lyssavirus, e.g. rabies virus
    • C12N2760/20122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/20011Coronaviridae
    • C12N2770/20022New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • the present invention relates to methods for inducing an immunological response in vertebrates, including non-avian vertebrates, using synthetic recombinant avipox virus. More particularly, the invention relates to a method for inducing an immunological response in a vertebrate, particularly a mammal, to a vertebrate pathogen by inoculating the vertebrate with a synthetic recombinant avipox virus containing DNA which encodes for and expresses the antigenic determinants of said pathogen, and to vaccines comprising such a modified avipox virus. Further, the invention relates to modified avipox virus, to methods for making and using the same, and to certain DNA sequences produced or involved as intermediates in the production of modified avipox virus and to methods for making such sequences.
  • Avipox or avipoxvirus is a genus of closely related pox viruses which infect fowl.
  • the genus avipox includes the species fowlpox, canary pox., junco pox, pigeon pox, quail pox, sparrow pox, starling pox, and turkey pox.
  • the species fowlpox infects chickens, and is not to be confused with the human disease called chickenpox.
  • the genus avipox shares many characteristics with other pox viruses and is a member of the same subfamily, poxviruses of vertebrates, as vaccinia.
  • Pox viruses including vaccinia and avipox, replicate within eukaryotic host cells. These viruses are distinguished by their large size, complexity, and by the cytoplasmic site of replication. However, vaccinia and avipox are different genera and are dissimilar in their respective molecular weights, their antigenic determinants, and their host species, as reported in Intervirology Vol. 17, pages 42-44, Fourth Report of the International Committee on Taxonomy of Viruses (1982).
  • the avipox viruses do not productively infect non-avian vertebrates such as mammals, including humans. Further, avipox does not propagate when inoculated into mammalian (including human) cell cultures. In such mammalian cell cultures inoculated with avipox the cells will die because of a cytotoxic effect, but show no evidence of productive viral infection.
  • live virus vaccines provide immunity that is more effective and longer lasting than does inoculation with a killed pathogen or purified antigen vaccine.
  • vaccines composed of killed pathogen or purified antigenic components of such pathogens require production of larger quantities of vaccine material than is needed with live virus.
  • live virus vaccines comprises vaccinia virus. This virus is known in the prior art to be a useful one in which to insert DNA representing the genetic sequences of antigens of mammalian pathogens by recombinant DNA methods.
  • Unmodified vaccinia virus has a long history of relatively safe and effective use for inoculation against smallpox.
  • smallpox before the eradication of smallpox, when unmodified vaccinia was widely administered, there was a modest but real risk of complications in the form of generalized vaccinia infection, especially by those suffering from eczema or immunosuppression.
  • Another rare but possible complication that can result from vaccinia inoculation is post vaccination encephalitis. Most of these reactions resulted from inoculating individuals with skin diseases such as eczema or with impaired immune systems, or individuals in households with others who had eczema or impaired immunological responses.
  • Vaccinia is a live virus, and is normally harmless to a healthy individual. However, it can be transmitted between individuals for several weeks after inoculation. If an individual with an impairment of the normal immune response is infected either by inoculation or by contagious transmission from a recently inoculated individual, the
  • the virus is self-limiting, reducing the possibility of spreading to non-vaccinated hosts.
  • the present invention relates to a method for inducing an immunological response in a vertebrate to a pathogen by inoculating the vertebrate with a synthetic recombinant avipox virus modified by the presence, in a nonessential region of the avipox genome, of DNA from any source which encodes for and expresses an antigen of the pathogen.
  • the present invention is directed to a method for expressing a gene product or inducing an immunological response to an antigen in a vertebrate with a recombinant virus which does not productively replicate in the cells of the vertebrate but which does express the gene product or the antigen in those cells.
  • the present invention is directed to synthetic recombinant avipox virus modified by the insertion therein of DNA from any source, and particularly from a non-avipox source, into a nonessential region of the avipox genome.
  • Synthetically modified avipox virus recombinants carrying exogenous (i.e. non-avipox) genes encoding for and expressing an antigen, which recombinants elicit the production by a vertebrate host of immunological responses to the antigen, and therefore to the exogenous pathogen, are used according to the invention to create novel vaccines which avoid the drawbacks of conventional vaccines employing killed or attenuated live organisms, particularly when used to inoculate non-avian vertebrates.
  • avipox viruses can only productively replicate in or be passaged through avian species or avian cell lines.
  • DNA deoxyribonucleic acid
  • RNA ribonucleic acid
  • Homologous sections of nucleic acid are sections of nucleic acid (RNA or DNA) which have the same sequence of nucleotide bases.
  • Genetic recombination may take place naturally during the replication or manufacture of new viral genomes within the infected host cell.
  • genetic recombination between viral genes may occur during the viral replication cycle that takes place in a host cell which is co-infected with two or more different viruses or other genetic constructs.
  • a section of DNA from a first genome is used interchangeably in constructing the section of the genome of a second co-infecting virus in which the DNA is homologous with that of the first viral genome.
  • recombination can also take place between sections of DNA in different genomes that are not perfectly homologous. If one such section is from a first genome homologous with a section of another genome except for the presence within the first section of, for example, a genetic marker or a gene coding for an antigenic determinant inserted into a portion of the homologous DNA, recombination can still take place and the products of that recombination are then detectable by the presence of that genetic marker or gene.
  • the insertion must be into a nonessential region of the virus in order that the modified virus remain viable.
  • fowlpox nor the other avipox viruses have as yet demonstrated nonessential regions analogous to those described for the vaccinia virus. Accordingly, for the present invention nonessential regions of fowlpox were discovered by cleaving the fowlpox genome into fragments, then separating the fragments by size and inserting these fragments into plasmid constructs for amplification. (Plasmids are small circular DNA molecules found as extra chromosomal elements in many bacteria including E. coli.
  • the second condition for expression of inserted DNA is the presence of a promoter in the proper relationship to the inserted DNA.
  • the promoter must be placed so that it is located upstream from the DNA sequence to be expressed. Because avipox viruses are not well characterized and avipox promoters have not previously been identified in the art, known promoters from other pox viruses are usefully inserted upstream of the DNA to be expressed as part of the present invention. Fowlpox promoters also can be successfully used to carry out the methods and make the products of the invention. According to the present invention, fowlpox promoters, vaccinia promoters and entomopox promoters have been found to promote transcription in recombinant pox virus.
  • Fowlpox is a species of avipox which infects chickens in particular, but does not infect mammals.
  • the fowlpox strain designated herein as FP-5 is a commercial fowlpox virus vaccine strain of chicken embryo origin available from American Scientific
  • the fowlpox strain designated herein as FP-1 is a Duvette strain modified to be used as a vaccine in one-day old chickens.
  • the strain is a commercial fowlpox virus vaccine strain designated O DCEP 25/CEP67/ 2309 October 1980 and is available from Institute Merieux, Inc.
  • Canarypox is another species of avipox.
  • canarypox particularly infects canaries, but does not infect mammals.
  • the canarypox strain designated herein as CP is a commercial canarypox vaccine strain designated LF2 CEP 524 24 10 75 and is available from Institute Merieux, Inc.
  • the DNA genetic sequences inserted into these avipox viruses by genetic recombination according to the present invention include the Lac Z gene, of prokaryotic origin; the rabies glycoprotein (G) gene, an antigen of a non-avian (specifically mammalian) pathogen; the turkey influenza hemagglutinin gene, the antigen of a pathogenic avian virus other than an avipox virus; the gp51,30 envelope gene of the bovine leukemia virus, a mammalian virus; the fusion protein gene of the Newcastle disease virus (Texas strain), an avian virus; the FeLV envelope gene of the feline leukemia virus, a mammalian virus; the RAV-1 env gene of the rous associated virus which is an avian virus/poultry disease; the nucleoprotein (NP) gene of the Chicken/Pennsylvania/1/83 influenza virus, an avian virus; the matrix gene and peplomer gene of the infectious bronchitis virus (
  • the turkey influenza hemagglutinin gene is described by Kawaoka et al., Virology 158, 218-227 (1987).
  • the bovine leukemia virus gp51,30 env gene has been described by Rice et al., Virology 138, 82-93 (1984).
  • the fusion gene of the Newcastle disease virus (Texas strain) is available from Institute Merieux, Inc., as plasmid pNDV 108.
  • the feline leukemia virus env gene has been described by Guilhot et al., Virology 161, 252-258 (1987).
  • the rous associated virus type 1 is available from Institute Merieux, Inc., as two clones, penVRVIPT and mpl9env (190).
  • Chicken influenza NP gene is available from Yoshihiro Kawaoka of St. Jude Children's Research Hospital as plasmid pNP 33.
  • An infectious bronchitis virus cDNA clone of the IBV Mass 41 matrix gene and peplomer gene are available from Institute Merieux, Inc. as plasmid pIBVM63.
  • the herpes simplex virus gD gene is described in Watson et al., Science 218 , 381-384 (1982).
  • the recombinant avipox viruses described in more detail below incorporate one of three vaccinia promoters.
  • the Pi promoter from the Ava I H region of vaccinia, is described in Wachsman et al., J. of Inf. Dis. 155, 1188-1197 (1987). More in particular, this promoter is derived from the Ava I H (Xho I G) fragment of the L-variant WR vaccinia strain, in which the promoter directs transcription from right to left.
  • the map location of the promoter is approximately 1.3 Kbp (kilobase pair) from the left end of Ava IH, approximately 12.5 Kbp from the left end of the vaccinia genome, and about 8.5 Kbp left of the Hind III C/N junction.
  • the sequence of the promoter is: (GGATCCC) -ACTGTAAAAATAGAAACTATAATCATATAATAGTGTAGGTTGGT- AGTAGGGTACTCGTGATTAATTTTATTGTTAAACTTG- (AATTC) , wherein the symbols in parentheses are linker sequences.
  • the Hind III H promoter (also “HH” and “H6” herein) was defined by standard transcriptional mapping techniques. It has the sequence
  • the recombinant avipox viruses of the present invention are constructed in two steps known in the art and analogous to those disclosed in aforementioned U. S. Patent 4,603,112 for creating synthetic recombinants of the vaccinia virus.
  • the DNA gene sequence to be inserted into the virus is placed into an E. coli plasmid construct into which DNA homologous to a section of nonessential DNA of the avipox virus has been inserted.
  • the DNA gene sequence to be inserted is ligated to a promoter.
  • the promoter-gene linkage is then inserted into the plasmid construct so that the promoter-gene linkage is flanked on both ends by DNA homologous to a nonessential region of avipox DNA.
  • the resulting plasmid construct is then amplified by growth within E. coli bacteria.
  • Lasmid DNA is used to carry and amplify exogenous genetic material, and this method is well known in the art.
  • these plasmid techniques are described by Clewell, J. Bacteriol. 110, 667-676 (1972).
  • the techniques of isolating the amplified plasmid from the E. coli host are also well known in the art and are described, for instance, by Clewell et al. in Proc. Natl. Acad. Sci. U.S.A. 62, 1159-1166 (1969).)
  • the amplified plasmid material isolated after growth within E. coli is then used for the second step. Namely, the plasmid containing the DNA gene sequence to be inserted is transfected into a cell culture, e.g.
  • chick embryo fibroblasts along with the avipox virus (such as fowlpox strain FP-1 or FP-5).
  • avipox virus such as fowlpox strain FP-1 or FP-5.
  • HBSAg coding sequence linked to vaccinia virus promoter sequences. Fifty ug of each plasmid were transfected onto CEF cells infected with 10 pfu per cell of fowlpox virus or vaccinia virus. Infection was allowed to proceed for 24 hours and cells were then lysed by three successive cycles of freezing and thawing.
  • the amount of HBSAg in the lysate was estimated using the commercially available A ⁇ SRIA II -
  • HBSAg The presence or absence of HBSAg is expressed as a ratio of the net counts (sample minus background) of the unknown to a negative cutoff value pre- determined by the manufacturer. This results in a P/N (positive/negative) ratio. The results are shown in Table I.
  • vaccinia promoter sequences Three different vaccinia promoter sequences were used: the Pi promoter, recognized early in vaccinia infection before DNA replication; the 11K promoter, recognized late in vaccinia infection after the onset of DNA replication; and the Hind III H (HH) promoter, recognized both early and late in vaccinia infection. These promoters are described earlier herein.
  • the data indicate that HBSAg produced in the lysates of infected cells is the result of recognition of vaccinia promoters by either fowlpox or vaccinia transcriptional factors.
  • Example 2 CONSTRUCTION OF RECOMBINANT FOWLPOX VIRUS vFP-1 CONTAINING THE LAC Z GENE
  • a fragment in a nonessential region of the fowlpox virus was located and isolated as follows.
  • the nuclease Bal 31 was employed to remove the single stranded terminal hairpin loops of FP-5 DNA.
  • the Klenow (large) fragment of DNA polymerase I was used to create blunt ends. Following removal of the loops, the fragments were generated by restriction endonuclease digestion with Bgl II. This digestion produced a series of FP-5 fragments which were separated by agarose gel electrophoresis.
  • this plasmid was cleaved with Hind III to create two further fragments. A 6.7 Kbp fragment was discarded and the remaining 4.7 Kbp fragment was ligated onto itself to form a new plasmid designated pRW 699.
  • pRW 699 was cut with EcoRV, which cleaves the plasmid at only one site.
  • the UK promoted Lac Z segment was then inserted as a blunt ended Pstl-Bam HI fragment, creating a new plasmid designated pRW 702.
  • the Lac Z clone is from pMC 1871, as described in Casadaban et al., loc. cit.
  • the UK promoter was ligated to the eighth codon of the Lac Z gene via a Bam HI linker.
  • the pRW 702 plasmid was then recombined with the fowlpox virus FP-5 growing on chick embryo fibroblasts (CEF) using the following procedures to generate vFP-1.
  • Fifty ug of pRW 702 DNA was mixed in a final volume of 100 ul with 0.5 ug of whole genome fowlpox DNA.
  • Lac Z gene codes for the enzyme Beta-galactosidase, which cleaves the chromogeni ⁇ substrate 5-bromo-4-chloro-3-indolyl-Beta-D-galactoside (X-gal) releasing a blue indolyl derivative. Blue plaques were selected as positive recombinants.
  • Beta-galactosidase protein in the serum of the inoculated animals is Beta-galactosidase protein in the serum of the inoculated animals.
  • the recombinant vFP-1 was purified from host cell contaminants and inoculated intradermally at two sites on each side of two rabbits.
  • Both rabbits and mice inoculated with the recombinant vFP-1 produced an immune response to the Beta-galactosidase protein as detected in an ELISA assay. In both species the response was detectable by one week post-inoculation.
  • a 0.9 Kbp Pvu II fragment was obtained from FP-5 and inserted by standard techniques between the two Pvu II sites in pUC 9.
  • the resulting construct designated pRW 688.2, has two Hinc II sites, approximately 30 bp apart, asymmetric within the Pvu II fragment and thus forming a long arm and a short arm of the fragment.
  • Oligonucleotide adapters were inserted between these Hinc II sites using known techniques to introduce Pst I and Bam HI sites, thus creating plasmid pRW 694.
  • This plasmid was now cleaved with Pst I and Bam HI and the Lac Z gene having a linked UK vaccinia promoter described earlier was inserted to create the new plasmid pRW 700.
  • This construct was inserted at the Pst I site of pRW 700 to create plasmid pRW 735.1 having therein the foreign gene sequence Pi-rabies G-llK-Lac Z. This insert is so oriented within the plasmid that the long Pvu II-Hinc II arm of the FP-5 donor sequence is 3' to the Lac Z gene.
  • the resulting final construct was recombined with fowlpox virus FP-5 by infection/transfection of chick embryo fibroblasts by the methods previously described to create recombinant fowlpox virus vFP-2.
  • This recombinant virus was selected by X-gal staining.
  • vFP-2 embodiment of this invention is a successful recombinant virus carrying the genes for rabies G and Beta-galactosidase was obtained by inoculating two rabbits with vFP-2 virus. Both rabbits were inoculated intradermally with
  • rabbit 205 showed detectable levels of anti-Beta-galactosidase antibody by the
  • Prebleed anti-rabies 0 Week 3 200 Week 6 200 Week 10 100
  • rabies G gene is fully expressed by fowlpox strains other than FP-5, specifically by another strain of fowlpox virus designated FP-1.
  • Example 3 As in Example 3, a 0.9 Kbp Pvu II fragment was obtained from FP-1 on the assumption that, as in FP-5, the fragment would contain a nonessential region.
  • This fragment was inserted between the two Pvu II sites of pUC 9, generating a plasmid designated pRW 731.15R.
  • This plasmid has two Hinc II sites, approximately 30 bp apart, asymmetric within the Pvu II fragment and thus forming a long arm and a short arm of the fragment.
  • the ATG translational initiation codon of the open reading frame promoted by the HH promoter was superimposed on the initiation codon of the rabies G gene using a synthetic oligonucleotide spanning the
  • rabies antigen by both avian and non-avian cells infected with the vFP-3 virus was confirmed by the immune precipitation and immunofluorescence techniques earlier described.
  • vFP-3 embodiment of this invention is a successful recombinant virus expressing the genes for rabies G was obtained by intradermally inoculating pairs of rabbits with the recombinant virus. Two rabbits were inoculated intradermally with 1 x 10 8 pfu of vFP-3 per rabbit.
  • Both of these rabbits produced typical pox lesions reaching maximum size 5-6 days post-inoculation.
  • the rabbits were bled at weekly intervals and sera were tested by ELISA to detect the presence of antibody specific for the rabies glycoprotein.
  • the vFP-3 virus was chemically inactivated and inoculated into rabbits.
  • the purified virus was inactivated overnight at 4°C. in the presence of 0.001% of beta propiolactone and then pelleted by centrifugation. The pelleted virus was collected in 10mM Tris buffered saline, sonicated, and titrated to assure that no infectious virus remained. Two rabbits were inoculated intradermally with inactivated vFP-3 and two with an equivalent amount of untreated recombinant. Lesion sizes were monitored.
  • VERO were inoculated with FP-1 or vFP-3 at an input multiplicity of 10 pfu per cell.
  • the virus was released by three successive cycles of freezing and thawing and re-inoculated onto a fresh monolayer of the same cell line. This was repeated for six sequential passages and, at the end of the experiment, samples of each passage were titrated for virus infectivity on CEF monolayers.
  • the second dish was used to determine if virus, not detectable by direct titration, could be detected after amplification in the permissive CEF cells.
  • cells on the second dish were harvested by scraping and a third of the cells lysed and inoculated onto a fresh CEF monolayer.
  • CPE cytopathic effect
  • Recombinant viruses vFP-6 and vFP-7 were constructed by the following procedure. A 5.5 Kbp Pvu II fragment of FP-1 was inserted between the two Pvu II sites in pUC 9 to create the plasmid pRW 731.13. This plasmid was then cut at a unique Hinc II site and blunt ended HH-promoted rabies G gene inserted to create plasmids pRW 748A and B, representing opposite orientations of the insert. Plasmids pRW 748A and B were then used separately to transfeet CEF cells along with FP-1 virus to produce vFP-6 and vFP-7, respectively, by recombination. This locus is now designated as locus f7.
  • mice Groups of 20 female SPF mice, 4-6 weeks, were inoculated with 50 ul of vFP-3 in the footpad in doses ranging from 0.7 to 6.7 TCID 50 per mouse.
  • the TCID 50 or tissue culture infectious dose is that dose at which 50 percent of tissue culture cells suffer cytopathic effect.
  • mice in each group were sacrificed and serum samples collected for assay in the RFFI test.
  • the remaining 10 mice were challenged by inoculation of 10 LD 50 of CVS strain rabies by the intracerebral route and survivors calculated at 14 days post-challenge.
  • the total dose per animal corresponded to 40000 mouse LD 50 by an intracerebral route.
  • the animals were observed daily. All non-vaccinated animals died on the day indicated in Table VI with rabies symptoms. The vaccinated animals survived challenge and were observed for three weeks after the death of the last control animal. The results are shown in Table VI below.
  • TCID 50 the subcutaneous route.
  • the recombinant viruses vFP-2 and vFP-3 were inoculated into cattle by several different routes.
  • Cattle, cats, and rabbits were also inoculated intradermally with known amounts of fowlpox virus and scabs were collected from the animals after about a week. These were ground, suspended in saline, and titrated to determine virus levels.
  • Example 8 INOCULATION OF CHICKENS WITH vFP-3
  • the recombinant fowlpox virus vFP-3 was inoculated into chickens to demonstrate the expression of foreign DNA by a recombinant fowlpox virus in a system permitting productive replication of the vector
  • White leghorn chickens were inoculated intramuscularly with 9 log 10 TCID 50 vFP-3 or 3 log 10 TCID 50 vFP-3 by wing transfixion. Blood samples were taken for an RFFI test for rabies antibody titer 21 days after vaccination. Day 21 titers in inoculated chickens were significantly higher than day 21 titers in controls.
  • Avian species can be immunized against avian pathogens using the recombinant avipox viruses of the invention.
  • novel plasmid pRW 759 (described below), derived from fowlpox virus FP-1 and containing the Hind III H-promoted hemagglutinin gene (H5) of A/turkey/Ireland/1378/83 (TYHA) , was used to transfect CEF cells concurrently infected with parent virus FP-1.
  • Recombinant fowlpox virus vFP-11 was obtained by the techniques described earlier herein.
  • hemagglutinin molecule by VFP-11 infected cells was confirmed by immune precipitation from metabolically radiolabeled infected cell lysates using specific anti H5-antibody and standard techniques.
  • Plasmid pRW 759 was created as follows: pRW 742B (of. Example 4) is linearized by partial digestion with Pst I and the fragment is recut with EcoRV to remove the rabies G gene, leaving the HH promoter on the remaining fragment of about 3.4 Kbp.
  • This plasmid was linearized by partial digestion with Dra I, the linear fragment was cut with
  • pRW 759 was generated by inserting into the pRW 744 vector the isolated Sal I-Dra I coding sequence of TYHA, disclosed by Kawaoka et al., Virology
  • a second group of chickens was vaccinated with a conventional H5 vaccine consisting of an inactivated H5N2 strain in a water-in-oil emulsion.
  • H5N2 vaccine was prepared from A/Mallard/NY/189/82 (H5N2) influenza virus grown in 11 day embryonated chicken eggs; the infected allantoic fluid with an HA titer of 800/0.1ml and infectivity titer of 10 8.5 /0.1ml was inactivated with 0.1% propiolactone and suspended in water-in- oil emulsion as described in Stone et al., Avian Dis. 22, 666-674
  • a third and fourth group of chickens received parental virus FP-1 or no vaccine, respectively.
  • Chickens were challenged with approximately 10 3 LD 50 of the highly pathogenic A/Turkey/Ireland/1378/83 (H5N8) or A/Chick/Penn/1370/83 (H5N2) influenza virus by administering 0.1 ml to the nares of each bird. Two day old birds were challenged 6 weeks after vaccination and 5 week old birds were challenged at 5 weeks post vaccination. The birds were observed daily for disease signs indicated by swelling and cyanosis of the face and comb and hemorrhage of the legs (such birds could frequently not stand), paralysis and death. Most deaths occurred between 4 and 7 days after infection. Tracheal and cloacal swabs were taken of each live chicken 3 days after infection and screened for virus by inoculation into embryonated eggs.
  • Immunity to H5 influenza induced by the vFP-11 vaccination lasted for at least 4 to 6 weeks and was cross-reactive.
  • a group of 4 week old chickens was inoculated in the wing web with vFP-11 as described previously and chal- lenged at monthly intervals with the cross reactive Ck/Penn virus. Again, no HI antibodies were detectable prior to challenge. Nonetheless, birds were protected beyond four months.
  • the H5 expressed by vFP-11 also induces a protective immune response in turkeys.
  • Outbread white turkeys were vaccinated at 2 days and 4 weeks of age by wing-web inoculation as previously described. The results are shown in Table X.
  • Plasmid pNP 33 contains a cDNA clone of the influenza virus Chicken/Pennsylvania/1/83 nucleoprotein gene (NP). Only the 5' and 3' ends of the approximately 1.6 Kbp NP gene have been sequenced. NP was moved from pNP 33 into Sma I digested pUC 9 as a blunt ended 5' Cla I-Xho I 3' fragment, with the pUC 9 Eco RI site at the 31 end, generating pRW 714. The translational initiation codon (ATG) of NP contains the following underlined Aha II site: ATGGCGTC.
  • the vaccinia H6 promoter was joined to the NP with a double stranded synthetic oligonucleotide.
  • the synthetic oligonucleotide contained the H6 sequence from the Eco RV site to its ATG and into the NP coding sequence at the Aha II site.
  • the oligonucleotide was synthesized with Bam HI and Eco RI compatible ends for insertion into pUC 9 generating pRW 755. Starting at the Bam HI compatible end, with the ATG underlined, the sequence of the double stranded synthetic oligonucleotide is:
  • the Aha II linear partial digestion product of pRW 755 was isolated and recut with Eco RI.
  • the pRW 755 fragment containing a single Aha II cut at the ATG and recut with Eco RI was isolated, treated with phosphatase, and used as a vector for the pRW 714 digestion product below.
  • the isolated Aha II linear partial digestion product of pRW 714 was recut with Eco RI.
  • the complete H6 promoter was formed by adding the sequences upstream (5') of the Eco RV site.
  • the plasmid pRW 742B (described in Example 4) had the H6 sequence downstream (3') of the Eco RV site removed along with sequences through to pUC 9's Nde I site.
  • the isolated linear partial Eco RV digestion product of pRW 757 was re-isolated after Nde I digestion; this fragment contains the H6 promoter from the Eco RV site through NP to the pUC 9 Nde I site.
  • the pRW 757 fragment was inserted into the pRW 742B vector to form pRW 758.
  • the Eco RI fragment from pRW 758, containing the entire H6 promoted NP, was blunt ended with the Klenow fragment of DNA polymerase I and inserted into the pRW 731.13 Hinc II site generating pRW 760.
  • plasmid pRW 760 was used in an in vitro recombination test. Progeny plaques were assayed and plaque purified using in situ plaque hybridization. Expression of the gene has been confirmed by immune precipitation studies using a goat polyclonal anti-NP antiserum. The size of the protein specifically precipitated from a lysate of vFP-12 infected CEF cells was approximately 55 KD, within the published range of influenza virus nucleoproteins.
  • hemagglutinin (HA) gene from A/Tyr/Ire/1378/83 was previously described in the construction of vFP-11 (example 9) .
  • the HA gene was first moved to locus f8 previously defined in the construction of vFP-8 using plasmid pRW 731.15.
  • the plasmid used in the construction of vFP-11 was pRW 759.
  • the hemagglutinin gene linked to the H6 promoter was removed from this plasmid by a Pst I partial digest. This fragment was then blunt-ended with the Klenow fragment of DNA polymerase I and inserted into the blunt-ended Bam HI site of pRW 731.15 to create pRW 771.
  • Plasmid pRW 771 was then used in an in vitro recombination test using vFP-12 as the rescuing virus.
  • the vFP-12 recombinant virus contains the nucleoprotein gene linked to the H6 promoter at locus f7 defined in plasmid pRW 731.13.
  • Recombinant plaques now containing both insertions were selected and plaque purified by in situ hybridization and surface expression of the hemagglutinin confirmed by a
  • the following example demonstrates identification of four non-essential insertion loci in the canarypox genome and the construction of four recombinant canarypox viruses vCP-16, vCP-17, vCP-19 and vCP-20.
  • the recombinant canarypox vCP-16 was constructed as follows.
  • a 3.4 Kbp Pvu II canarypox DNA fragment was cloned into pUC 9 to produce pRW 764.2.
  • a unique Eco RI site was found asymmetrically located within the fragment with a short arm of 700 bp and a long arm of 2.7 Kbp.
  • the plasmid was digested with Eco RI and blunt-ended using the Klenow fragment of DNA polymerase I.
  • the blunt-ended H6/rabies G gene was then ligated into this site and used to transform E. coli.
  • the resulting plasmid pRW 775 was used in an in vitro recombination test. Progeny plaques positive on an immunoscreen were selected and plaque purified.
  • the resulting recombinant was designated vCP-16 and the insertion locus as C3.
  • the plasmid pRW 764.2 used in the construction above also contained a unique Bgl II site approximately 2.4 Kbp from the Eco RI site.
  • the H6/rabies G gene was ligated into plasmid pRW 764.2 at this site to produce pRW 774.
  • This plasmid was used in the construction of recombinant vCP-17 with the insertion locus designated as C4.
  • Plasmid pRW 764.5 contains an 850 bp Pvu II fragment of canarypox DNA with a unique Bgl II site assymmetric within the fragment 400 bp from one terminus.
  • the rabies G gene linked to the H6 promoter was inserted at this site to produce pRW 777.
  • the stable recombinant virus produced was designated vCP-19 and the insertion locus C5.
  • Plasmid pRW 764.7 contains a 1.2 Kbp Pvu II fragment with a unique Bgl II site 300 bases from one terminus.
  • the plasmid was digested with Bgl II and blunt-ended with the Klenow fragment of DNA polymerase I.
  • the blunt-ended UK promoted Lac Z gene was inserted to produce plasmid pRW 778.
  • the stable recombinant virus produced using this plasmid was designated vCP-20 and the insertion locus designated C6.
  • Plasmid pNDV 108 the cDNA clone of the fusion gene of NDV Texas Strain, consisted of an Hpa I cDNA fragment of approximately 3.3 Kbp containing the fusion protein coding sequence as well as additional NDV coding sequences cloned into the Sea I site of pBR 322. Steps in the production of the insertion plasmid are described below.
  • An FPV insertion vector, pCE 11, was constructed by inserting polylinkers at the Hinc II site of pRW 731.13 (designated as locus f7).
  • a 1.8 Kbp gel-purified Bam HI fragment containing all but 22 nucleotides from the 5' end of the fusion protein gene was inserted into the Bam HI site of pUC 18 to form pCE 13.
  • This plasmid was digested with Sal I which cuts in the vector 12 bases upstream of the 5' end of the coding sequence. The ends were filled in with the Klenow fragment of DNA Polymerase I and the plasmid further digested with Hind III which cuts 18 bases upstream of the Sal I site.
  • a gel purified 146 bp Sma I - Hind III fragment containing the vaccinia virus H6 promoter previously described in preferred embodiments as well as polylinker sequences at each termini was ligated to the vector and transformed into E.
  • the resulting plasmid was designated pCE 16.
  • pCE 16 In order to align the initiating ATG codon of the NDV fusion protein gene with the 3' end of the H6 promoter and to replace the 22 nucleotides missing from the NDV 5' end in pCE 16, complementary synthetic oligonucleotides were designed ending in Eco RV and Kpn I sites.
  • the oligonucleotide sequence was 5' ATC-CGT-TAA-GTT-TGT-ATC-GTA-ATG-GGC-TCC- AGA-TCT-TCT-ACC-AGG-ATC-CCG-GTA-C 3' .
  • the construct pCE 16 was then digested with Eco RV and Kpn I.
  • the Eco RV site occurs in the H6 promoter 24 bases upstream of the initiating ATG.
  • the Kpn I site occurs in the NDV coding sequence 29 bases downstream of the ATG.
  • Oligonucleotides were annealed, phosphorylated and ligated to the linearized plasmid and the resulting DNA used to transform E. coli cells. This plasmid was designated pCE 18.
  • a gel purified 1.9 Kbp Sma I-Hind III fragment of pCE 18 (cutting in the polylinker region) was ligated to a 7.8 Kbp Sma I-Hind III fragment of pCE 19 described above.
  • the transcriptional stop signal occurs 16 bases downstream of the Sma I site.
  • the resulting plasmid was designated pCE 20.
  • the plasmid pCE 20 was used in an in vitro recombination test using fowlpox virus FP-1 as the rescuing virus.
  • the resulting progeny were plated on CEF monolayers and the plaques subjected to a Beta-galactosidase linked Protein-A immunoscreen using a polyclonal anti-NDV chicken serum. Positively staining plaques were selected and subjected to four rounds of plaque purification to achieve a homogeneous population.
  • the recombinant was designated vFP-29.
  • the FeLV env gene contains the sequences which encode the p70 + pl5E polyprotem. This gene was initially inserted into the plasmid pSD467vC with the vaccinia H6 promoter juxtaposed 5' to the FeLV env gene.
  • the plasmid pSD467vC was derived by first inserting an 1802 bp Sal I/Hind III fragment containing the vaccinia hemagglutinin (HA) gene into a pUC18 vector. The location of the HA gene was defined previously (Shida, Virology 150, 451-462, [1988]).
  • the majority of the open reading frame encoding the HA gene product was deleted (nucleotide 443 through nucleotide 1311) and a multiple cloning site was inserted containing the Bgl II, Sma I, Pst I, and Eag I restriction endonuclease sites.
  • the resultant pSD467vC plasmid contains vaccinia flanking arms of 442 bp upstream of the multiple cloning site and 491 bp downstream from these restriction sites. These flanking arms enable genetic material inserted into the multiple cloning region to be recombined into the HA region of the Copenhagen strain of vaccinia virus.
  • the resultant recombinant progeny are HA negative.
  • the H6 promoter was synthesized by annealing four overlapping oligonucleotides which together comprised the complete sequence described above in preferred embodiments.
  • the resultant 132 bp fragment contained a Bgl II restriction site at the 5' end and a Sma I site at the 3' end. This was inserted into pSD467vC via the Bgl II and Sma I restriction site.
  • the resultant plasmid was designated pPT15.
  • the FeLV env gene was inserted into the unique Pst I site of pPT15 which is just downstream of the H6 promoter.
  • the resultant plasmid was designated pFeLVlA.
  • the 2.4 Kbp H6/FeLV env sequences were excised from pFeLVlA by digestion with Bgl II and partial digestion with Pst I.
  • the Bgl II site is at the 5' border of the H6 promoter sequence.
  • the Pst I site is located 420 bp downstream from the translation termination signal for the envelope glycoprotein open reading frame.
  • the 2.4 Kbp H6/FeLV env sequence was inserted into pCE 11 digested with Bam HI and Pst I.
  • the FP-1 insertion vector, pCE 11 was derived from pRW 731.13 by insertion of a multiple cloning site into the nonessential Hinc II site.
  • This insertion vector allows for the generation of FP-1 recombinants harboring foreign genes in locus f7 of the FP-1 genome.
  • the recombinant FP-1/FeLV insertion plasmid was then designated pFeLVFI.
  • This construction does not provide a perfect ATG for ATG substitution .
  • a Nru I/Sst II fragment of approximately 1.4 Kbp was derived from the vaccinia virus insertion vector, pFeLVIC.
  • the Nru I site occurs within the H6 promoter at a position 24 bp upstream from the ATG.
  • the Sst II site is located 1.4 Kbp downstream from the ATG and 1 Kbp upstream from the translation termination signal.
  • This Nru I/Sst II fragment was ligated to a 9.9 Kbp fragment which was generated by digestion with Sst II and by partial digestion with Nru I.
  • This 9.9 Kbp fragment contains the 5.5 Kbp of FP-1 flanking arms, the pUC vector sequences, 1.4 Kbp of FeLV sequence corresponding to the downstream portions of the env gene, and the 5'-most sequence (approx. 100 bp) of the H6 promoter.
  • the resultant plasmid was designated pFeFLVF2.
  • the ATG for ATG construction was confirmed by nucleotide sequence analysis.
  • a further FP-1 insertion vector, pFeLVF3, was derived from pFeLVF2 by removing the FeLV env sequences corresponding to the putative immunosuppressive region (Cianciclo et al., Science 230, 453-455 [1985]) (nucleotide 1548 to 1628 of coding sequence) . This was accomplished by isolating a Sst II/Pst I fragment (sites described above) of approximately 1 Kbp from the vaccinia virus insertion vector pFeLV1D.
  • the plasmid pFeLVID is similar to pFeLV1C except that the env sequences corresponding to the immunosupressive region (nucleotide 1548 to 1628) were deleted by oligonucleotide-directed mutagenesis (Mandecki, Proc. Natl. Acad. Sci. USA 83, 7177-7181 [1987]).
  • the 1 Kbp Sst II/Pst I fragment lacking nucleotides 1548 to 1628 was inserted into a 10.4 Kbp Sst II/Pst I fragment containing the remaining H6 :FeLV env gene derived from pFeLVF2.
  • the insertion plasmids, pFeLVF2 and pFeLVF3, were used in in vitro recombination tests with FP-1 as the rescuing virus.
  • Progeny of the recombination were plated on CEF monolayers and recombinant virus selected by plaque hybridization on CEF monolayers.
  • Recombinant progeny identified by hybridization analyses were selected and subjected to 4 rounds of plaque purification to achieve a homogeneous population.
  • An FP-1 recombinant harboring the entire FeLV env gene has been designated vFP-25 and an FP-1 recombinant containing the entire gene lacking the immunosuppressive region was designated vFP-32.
  • a 2.2 Kbp fragment containing the E6:FeLV env sequences was excised from pFeLVF2 by digestion with Sma I and Hpa I.
  • the Sma I site is at the 5' border of the H6 promoter sequence.
  • the Hpa I site is located 180 bp downstream from the translation termination signal for the envelope glycoprotein open reading frame.
  • the 2.2 Kbp H6/FeLV env sequence was inserted in the non-essential Eco RI site of the insertion plasmid pRW764.2 following blunt-ending of the Eco RI site.
  • This insertion vector allows for the generation of CP recombinants harboring foreign genes in locus C4 of the CP genome.
  • the recombinant CP insertion plasmid was then designated pFeLVCP2. This construction provides a perfect ATG for ATG substitution.
  • the insertion plasmid, pFeLVCP2 was used in an in vitro recombination test with CP as the rescuing virus. Progeny of the recombinant were plated on CEF monolayers and recombinant virus selected by means of a Betagalactosidase linked Protein-A immunoscreen using a bovine anti-FeLV commercial polyclonal serum
  • vCP-36 A recombinant expressing the entire FeLV env gene has been designated vCP-36.
  • the clone penvRV1PT of the RAV-1 envelope gene contains 1.1 Kbp of RAV-1 env DNA coding sequence cloned as a Kpn I-Sac I fragment into M13mp18. This fragment is intact at the 5' end but lacks part of the 3' sequence and was used in the following manipulations.
  • a gel purified 1.1 Kbp Eco Rl-Pst I fragment from penvRVIPT was inserted into the Eco RI and Pst I sites of pUC 9 to form pRW 756.
  • This plasmid was then digested with Kpn I and Hind III cutting in the vector 59 bases upstream of the ATG.
  • a 146 base pair Kpn I - Hind III fragment containing the previously described vaccinia H6 promoter was inserted to construct plasmid pCE 6.
  • oligonucleotide sequence was 5' ATC-CGT-TAA-GTT-TGT-ATC-GTA-ATG-AGG-CGA-GCC-3'.
  • the plasmid pCE 6 was digested with Eco RV which cuts in the H6 promoter 24 bases upstream of the ATG and Ban II which cuts in the RAV env coding sequence 7 bases downstream of the ATG.
  • the DNA segments were ligated and used to transform E. coli cells.
  • Clone mp19env (190), was found by restriction mapping to contain the entire RAV-1 env gene.
  • a 1.9 Kbp Kpn I-Sac I fragment of the mpl9env (190) containing the entire gene was inserted at the Kpn I and Sac I sites of pUC 18 to form pCE 3.
  • This plasmid was digested with Hpa I which cuts 132 bases downstream of the initiating ATG in the RAV-1 coding sequence and Sac I which cuts at the 3' terminus of the gene.
  • the FPV insertion vector pCE 11 previously described was digested with Sma I and Sac I cutting the plasmid in the polylinker region.
  • the Hpa I - Sac I fragment of pCE 3 was ligated with pCE 11 to form pCE 14.
  • Plasmid pCE 7 was then digested with Xho I and Hind III to provide a 332 base pair fragment containing the H6 promoter and correct 5' sequence. Plasmid pCE 14 was digested with Hind III cutting in the polylinker region of the vector and Xho I cutting in the coding sequence. This DNA was ligated with the Hind III - Xho I fragment obtained from pCE 7 to form pCE 15, the final RAV-1 envelope gene construct. This plasmid was used in an in vitro recombination test with fowlpox FP-1 as the rescuing virus.
  • Progeny of the recombination was plated on CEF monolayers and plaques screened by a Beta-galactosidase linked Protein A immunoassay using an anti-RAV-1 polyclonal serum. Positively staining plaques were selected and subjected to four rounds of plaque purification to produce a homogeneous population.
  • the recombinant produced was designated vFP-22.
  • Immunoprecipitation experiments using vFP-22 infected CEF lysates have demonstrated the specific precipitation of two proteins with apparent molecular weights of 76.5 Kd and 30 Kd corresponding to the two gene products of the envelope gene. No precursor gene product was apparent. In preliminary tests an immune response has been induced to the RAV-I envelope gene product in chickens inoculated with vFP-22.
  • the plasmids, pBLVF 1 and pBLVF 2 contain the gp51,30 env gene of BLV.
  • the BLV env gene is under the transcriptional control of the vaccinia virus H6 promoter and is cloned between fowlpox flanking arms (locus f7).
  • the nucleotide sequence of the two plasmids is identical, except at codon positions 268 and 269.
  • pBLVF 1 encodes a protein containing the amino acids Arg-Ser at these two positions
  • pBLVF 2 encodes a protein containing the amino acids Gln-Thr).
  • pBLVF 1 and pBLVF 2 were constructed by the following procedure.
  • Plasmid pNS97-l a plasmid containing the entire BLV env gene, was cut with Bam HI and partially cut with Mst II.
  • the 2.3 Kbp fragment containing the entire gp51,30 gene was isolated on an agarose gel and the sticky ends filled in with E. coli DNA polymerase I (Klenow fragment) .
  • Pst I linkers werethen ligated onto the ends of the fragment, which after Pst I digestion, was ligated into the Pst I site of pTP 15 (Example 15). This places the BLV gene next to the vaccinia H6 promoter.
  • pTP15 contains the vaccinia H6 promoter cloned at a nonessential locus in the vaccinia genome.
  • This plasmid was then cut with Eco RV and partially cut with Ava II. The 5.2 Kbp fragment was isolated and the oligonucleotides
  • the resulting plasmid was cut with Pst I and partially cut with Bgl II and the 1.7 Kbp fragment containing the H6 promoted-BLV gene cloned into the Bam Hl-Pst I site of pCE 11, the fowlpox virus insertion vector previously described using locus f7. This places the H6 promoted-BLV gene between fowlpox flanking arms.
  • This plasmid was designated pBLVF 1.
  • An identical procedure was used to construct pBLVF 2, with the exception that an additional in vitro mutagenesis step was performed before cloning the H6 promoted-BLV gene into pCE 11. This mutagenesis was performed by the following procedure.
  • Plasmid pNS97-1 was cut with Xma I and partially cut with Stu I. The 5.2 Kbp fragment was isolated and the oligonucleotides 5' -CCGGGTCAGACAAACTCCCGTCGCAGCCCTGACCTTAGG-3 ' and 5'-CCTAAGGTCAGGGCTGCGACGGGAGTTTGTCTGAC-3' used to recircularize the plasmid. This changes the nucleotide sequence of codons 268 and 269 from CGC-AGT to CAA-ACT.
  • (2) Construction of Recombinant Viruses The plasmids pBLVF 1 and pBLVF 2 were used in an in vitro recombination test using FP-1 as the rescuing virus.
  • Recombinant progeny was selected by in situ plaque hybridization and when the population was judged as pure by this criteria plaques were screened in an Beta-galactosidase - Protein A immunoassay using a BLV gp specific monoclonal antibody preparation. Both recombinants vFP 23 and vFP 24 produced from plasmid pBLVF 1 and pBLVF 2 respectively showed positive staining in the immunoscreen indicating that an immunologically recognizable glycoprotein was expressed on the infected cell surface.
  • the plasmids, pBLVK 4 and pBLVK 6 contain the BLV env gp51,30 gene and the BLV gp51,30 cleavage minus gene, respectively. Both genes are cloned into the unique Eco RI site of pRW 764.2 (locus C3) (pRW 764.2 is described in Example 13) and are under the transcriptional control of vaccinia H6 promoter.
  • the plasmids were derived by the following procedure: pBLVF 1 and pBLVF 2 were cut with the restriction enzyme Hind III.
  • the oligonucleotide BKL 1 (AGCTTGAATTCA) was cloned into this site, thereby generating an Eco RI site 3' to the BLV gene. Since there is also an Eco RI site 5' to the BLV gene, these plasmids (pBLVK 1 and pBLVK 2) were cut with Eco RI and the fragment containing the H6 promoted-BLV gene was cloned into the Eco RI site of pRW 764.2. The resulting plasmids were designated pBLVK 4 and pBLVK 6, respectively.
  • plasmids were used in an in vitro recombination test with canarypox as the rescuing virus. Recombinants were selected and purified on the basis of surface expression of the glycoprotein as detected in an immunoassay. The recombinants were designated vCP 27 and vCP 28 from plasmids pBLVK 4 and pBLVK 6, respectively.
  • Fowlpox recombinants vFP23 and vFP24 have been inoculated into sheep and bovines by a variety of routes. Animals were given two inoculations, the second at 45 days after the first. Serum samples were taken 5 weeks after the first inoculation and two weeks after the second inoculation. Antibody to gp51 was measured in a competitive ELISA test and the titer expressed as the reciprocal of the serum dilution giving a 50% reduction of competition. The results are shown in Table XI.
  • Plasmid pIBVM63 contains an infectious bronchitis virus (IBV) cDNA clone of the Mass 41 strain matrix gene.
  • An 8 Kbp Eco RI fragment of pIBVM63 contains the matrix gene with the peplomer gene upstream (5') and further upstream there is an Eco RV site.
  • Plasmid pRW 715 has an Eco RI linker joining the two Pvu II sites of pUC 9. The 8 Kbp Eco RI fragment from pIBVM63 was inserted into the pRW 715 Eco RI site generating pRW763. Plasmid pRW 776 was created to delete the 5' Eco RI site in pRW 763, leaving a unique Eco RI site downstream (3') of the matrix gene.
  • the isolated linear Eco RI partial digestion product of pRW 763 was recut with Eco RV. The largest fragment was isolated, blunt ended with the Klenow fragment of DNA polymerase I and self ligated generating pRW 776.
  • the construct pRW 776 has the complete IBV peplomer and matrix genes followed by a single Eco RI site.
  • the 5' sequence of the matrix gene contains the following underlined Rsa I site: ATGTCCAACGAGACAAATTGTAC .
  • the previously describe H6 promoter was joined to the matrix gene with a synthetic oligonucleotide.
  • the synthetic oligonucleotide contained the H6 sequence from its Eco RV site to the ATG and into the matrix coding sequence through the first Rsa I site.
  • the oligonucleotide was synthesized with Bam HI and Eco RI compatible ends for insertion into pUC 9 generating pRW 772.
  • the Eco RI end is 3' to the Rsa I site.
  • the sequence of the double stranded synthetic oligonucleotide is:
  • the Rsa I linear partial digestion product of pRW 772 was isolated and recut with Eco RI.
  • the pRW 772 fragment containing a single cut at the above Rsa I site and recut with Eco RI was isolated, treated with phosphatase, and used as a vector for the pRW 776 digestion product below.
  • the isolated Rsa I linear partial digestion product of pRW 776 was recut with Eco RI. Eco RI is just beyond the 3' end of the matrix gene.
  • the complete H6 promoter was formed by adding sequences 5' of the Eco RV site.
  • the H6 promoter 5' end was a Hinf I site blunt ended into the pUC 9 Sal I site creating an Eco RI site; 5' of the H6 promoter is the pUC 9 Hind III site.
  • the Hind III-Eco RV fragment containing the 5' H6 promoter was inserted between the pRW 783 Hind III and Eco RV sites generating pRW 786.
  • the pRW 786 Eco RI fragment, containing the complete H6 promoted matrix gene, was blunt ended with Klenow fragment of DNA polymerase I and inserted into the blunt ended Bam H1 site of pRW 731.15 (locus f8) generating pRW 789.
  • the pRW 731.15 Bam HI site is the FP-1 locus used in Example 6 for construction of vFP-8.
  • Plasmid pRW 789 was used in the construction of vFP-26. Recombinant plaques were selected and processed by in situ plaque hybridization. In preliminary tests an immune response has been induced to the IBV matrix protein in chickens inoculated with vFP-26.
  • the 5' end of the peplomer gene contains the following underlined Rsa I site: ATGTTGGTAACACCTCTTTTACTAGTGACTCTTTTGTGTGTAC.
  • the previously described H6 promoter was joined to the peplomer gene with a synthetic oligonucleotide.
  • the synthetic oligonucleotide contains the H6 promoter sequence from its Nru I site to ATG and into the peplomer coding sequence through its first Rsa I site.
  • the oligonucleotide was synthesized with Bam HI and Eco RI compatible ends for insertion into pUC 9 generating pRW 768.
  • the Eco RI end is 3' of the Rsa I site.
  • the sequence of the double stranded synthetic oligonucleotide is:
  • the pRW 768 isolated linear partial Rsa I digestion product was recut with Eco RI.
  • the pRW 768 fragment containing a single cut at the above Rsa I site and recut with Eco RI was isolated, treated with phosphatase, and used as a vector for the pRW 776 digestion product below.
  • the pRW 776 isolated linear partial Rsa I digestion product was recut with Eco RI.
  • the vector pRW 760 is described in Example 11; briefly, it is vaccinia H6 promoted influenza nucleoprotein flanked by the nonessential FP-1 locus f7.
  • the pRW 760 vector was made by removing the 3' H6 sequences from the Nru I site through the end of the nucleoprotein at Bam HI.
  • pRW 790 is H6 promoted IBV peplomer in the pRW 731.13 Hinc II site . Recombination of the donor plasmid pRW 790 with FP-1 resulted in vFP-31.
  • HSV herpes simplex virus
  • gD herpes simplex virus type 1 strain KOS glycoprotein D gene
  • the previously described vaccinia H6 promoter was joined to the HSV gD gene with a synthetic oligonucleotide.
  • the synthetic oligonucleotide contains the 3' portion of the H6 promoter from Nru I to ATG into the gD coding sequence through the Nco I site.
  • the oligonucleotide was synthesized with a 5' Pst I compatible end.
  • the gD clone in pUC9 was cut with Pst I and Nco I, and the 5' HSV sequence removed, for replacement with the synthetic oligonucleotide resulting in pRW 787.
  • the sequence of the double stranded synthetic oligonucleotide is :
  • Digestion of pRW 787 with Nru I and Bam HI generates an approximately 1.3 Kbp fragment containing the 3' H6 promoter, from the Nru I site, through the HSV gD coding sequence to the Bam HI site.
  • the pRW 760 vector, cut with Nru I and Bam HI, has been described in Example 11. Insertion of the 1.3 Kbp fragment into the pRW 760 vector generated pRW 791.
  • the pRW 791 vector contains the complete vaccinia H6 promoted HSV gD gene in the nonessential FP-1 Hinc II site in pRW 731.13. (locus f7) .
  • Poxviruses of insects are currently classified in the subfamily Entomopoxvirinae which is further subdivided into three genera (A, B, and C) corresponding to entomopoxviruses isolated from the insect orders Coleoptera, Lepidoptera, and Orthoptera respectively.
  • Entomopox viruses have a narrow host range in nature, and are not known to replicate in any vertebrate species.
  • the virus designated AmEPV, is the type species for genus B.
  • Wild-type AmEPV was obtained from Dr. R. Granados (Boyce Thompson Institute, Cornell University) as infectious hemolymph from infected Estigmene a ⁇ rea larvae.
  • the virus was found to replicate in an invertebrate cell line, IPLB-LD652Y, derived from ovarial tissues of Lymantria dispar (gypsy moth) (described by Goodwin et. al., In Vitro 14, 485-494 [1978]).
  • the cells were grown in IPL-528 media supplemented with 4% fetal calf and 4% chicken sera at 28°C.
  • the wild-type virus was plaque assayed on LD652Y cells and one plaque, designated V1, was selected for subsequent experiments.
  • This isolate produces numerous occlusion bodies (OBs) in the cytoplasm of the infected cells late in the infectious cycle.
  • OBs occlusion bodies
  • An oligonucleotide was chemically synthesized which contained the 107 bases 5' of the 42K gene translational start signal (hereafter referred to as the AmEPV 42K promoter) flanked by a Bgl II site at the 5' end and the first 14 bases of the hepatitis B virus pre-S2 coding region, which terminates in an Eco RI site, at the 3' end.
  • the AmEPV 42K promoter sequence is described below.
  • HBVsAg hepatitis B virus surface antigen
  • a pUC plasmid was constructed containing the hepatitis B virus surface antigen and pre-S2 coding region (type ayw described by Galibert et al., Nature 231, 646-650 [1979]) flanked by vaccinia virus arms in the non-essential region of the vaccinia virus genome which encodes the hemagglutinin (HA) molecule (HA arms described in Example 15; HA region described by Shida, Virology 150, 451-462 [1986]).
  • the oligonucleotide described above was inserted into this plasmid using the unique EcoR I site in the HBVsAg coding region and a unique Bgl II site in the HA vaccinia arm.
  • the resulting recombinant vaccinia virus was designated vP 547.
  • HBVsAg coding sequence under the control of the entomopox 42K promoter was confirmed using an immunoassay.
  • VP547 42K 44.9 Further experiments were conducted to ascertain the temporal nature of the regulation of the AmEPV 42K promoter in a vertebrate poxvirus background. Equivalent cultures of BSC-40 cells were infected with vP 547 in the presence or absence of 40 ug/ml of cytosine arabinoside, an inhibitor of DNA replication which therefore blocks late viral transcription. Levels of expression at 24 hours post-infection were assayed in an Ausria test. The results indicated that the 42K promoter was recognized as an early promoter in a vaccinia virus replication system.
  • AmEPV 42K promoter for the expression of foreign genes in a mammalian system is clearly distinct from the use of the Autographa californica NPV polyhedrin promoter for gene expression in invertebrate systems (Luckow and Summers, Biotechnology 6, 47-55 [1988]).
  • the polyhedrin. promoter is not recognized by the transcriptional apparatus in mammalian cells (Tjla et al., Virology 125, 107-117 [1983]).
  • the use of the AmEPV 42K promoter in mammalian cells represents the first time an insect virus promoter has been utilized for the expression of foreign genes in a non-insect viral vector in non-invertebrate cells.
  • Table XIII should be viewed in a qualitative sense. They indicate that the transcriptional apparatus of both fowlpox and canarypox is able to recognize the 42K promoter and allow transcription of the linked HBVsAg coding sequence. Although levels of expression are lower than those obtained with the vaccinia virus H6 promoter, levels are well above background levels obtained with the negative controls.
  • mice Groups of 20, four to six week old mice were inoculated in the footpad with 50 to 100 ul of a range of dilutions of either of two recombinants: (a) vFP-6- the fowlpox-rabies recombinant described in Example 6, and (b) vCP-16 - the canarypox-rabies recombinant described in Example 13.
  • mice from each group were sacrificed and the serum collected.
  • the anti-rabies titer in the serum was calculated using an RFFI test previously described in Example 7.
  • the remaining 10 mice in each group were challenged by intracerebral inoculation with the CVS strain of rabies virus used in Example 7.
  • Each mouse received 30 ul corresponding to
  • mice 16 mouse LD 50 .
  • PD 50 protective dose 50
  • mice found by inoculation of vFP-6 confirms the result found on inoculation of the fowlpox recombinant vFP-3 discussed in Example 7.
  • the level of protection afforded by inoculation of vCP-16 is considerably higher.
  • the canarypox-rabies recombinant is 100 times more effective in protection against rabies challenge than is the fowlpox-rabies recombinant.
  • FP-1 induced protein and showed that it is synthesized from 6 hours to 54 hours postinfection. At its peak level this FP-1 25.8KD protein accounts for approximately 5% to 10% of total protein present in the cell lysate.
  • FP-1 induced 25.8KD protein The abundance of the FP-1 induced 25.8KD protein suggested that the gene encoding this gene product is regulated by a strong FP-1 promoter element.
  • a polysome preparation was obtained from FP-1 infected CEF cells at 54 hours postinfection. RNA was isolated from this polysome preparation and when used to program a rabbit reticulocyte in vitro translation system generated predominantly the 25.8KD FP-1 protein.
  • the polysome RNA was also used as a template for first strand cDNA synthesis using oligo (dT) 12-18 as a primer.
  • the first strand cDNA was used as a hybridization probe in Southern blot analyses with FP-1 genomic digests. Results from these hybridization analyses suggested that the gene encoding the 25.8KD protein was contained in a 10.5 Kbp Hind III fragment. This genomic Hind III fragment was subsequently isolated and ligated into a commercial vector, pBS (Stratagene, La Jolla, CA.), and the clone was designated pFP23k-1.
  • This 270 nucleotide sequence provides 249 nucleotides of the region upstream of the initiation codon (ATG) for the 25.8KD gene product and the first 21 bp of the coding sequence.
  • ATG initiation codon
  • FP-1 insertion vector containing the FeLV env sequences.
  • This insertion vector enabled recombination with the f7 locus of the FP-1 genome. Insertion of the FP25.8K promoter upstream sequences 5' to the FeLV env gene and in the proper orientation was confirmed by sequence analysis. This insertion does not provide a perfect ATG for ATG substitution but the ATG provided by the 25.8KD gene is out of frame with the FeLV env ATG, so no fusion protein is formed.
  • the FP-1 insertion plasmid containing the FP25.8KD promoter upstream from the FeLV env gene was designated pFeLV25.8F1.
  • a similar construct was prepared using the vaccinia virus insertion vector, pFeLVlA, harboring the FeLV gene (see Example 15).
  • the H6 promoter was excised, from pFeLVlA by digestion with Bgl II and Sma I. Following blunt-ending of the Bgl II restriction site, the blunt ended 270 bp Eco RV/Eco RI fragment containing the FP25.8K promoter was inserted juxtaposed 5' to the FeLV env gene.
  • This construct was confirmed by sequence analysis. There is not a perfect ATG for ATG substitution in this recombinant either but the ATG from the 25.8KD gene is not in frame with the ATG from the FeLV gene.
  • the vaccinia (Copenhagen strain) insertion vector harboring the 25.8KD gene upstream region juxtaposed 5' to the FeLV gene was designated pFeLV25.81A.
  • the insertion plasmids, pFeLV25.8Fl and pFeLV25.81A, were used for in vitro recombination with FP-1 (pFeLV25.8Fl) and the Copenhagen strain of vaccinia virus (pFeLV25.81A) as the rescuing viruses.
  • Progeny of the recombination were plated on appropriate cell monolayers and recombinant virus selected by a beta-galactosidase linked Protein A Immunoscreen and a bovine anti-FeLV serum (Antibodies, Inc., Davis, CA.).
  • the two avipox recombinants vFP-6 and vCP-16 (described in Examples 6 and 13) were inoculated into 18 day old chicken embryos, 1 day old chickens and 28 day old chickens and the response of the birds evaluated on 3 criteria 1) effects of vaccination on hatchability, vaccinal reactions and mortality 2) the immune response induced to the rabies glycoprotein and 3) the immune response induced to fowlpox antigens.
  • the experiments performed are described below.
  • a limited serological response was observed with embryos inoculated with either vFP-6 or vCP-16 for both rabies and fowlpox antigens.
  • the fowlpox vector induced a serological response to both antigens in a greater number of birds than did canarypox but the response was still heterogenous.
  • Chickens inoculated at 1-day old with vFP-6 had a good serological response with all birds being seropositive to rabies and fowlpox antigens by 28 days post-inoculation.
  • the response to vCP-16 inoculation was much lower with 40% of birds being seropositive for rabies glycoprotein at 28 days and 10% seropositive for avipox antigens.
  • Chickens inoculated with vFP-6 by the intramuscular route at 28 days old showed 100% seroeonversion to both antigens by 14 days post-inoculation. Although the majority of birds also seroconverted after cutaneous inoculation, titers achieved were lower for both rabies and avipox antigens. As previously, chickens inoculated both by the intramuscular and cutaneous route with vCP-16 showed a variable response with a maximum of 70% seroeonversion to rabies by intramuscular inoculation. The low level of seroeonversion for avipox antigens after canarypox inoculation may reflect the degree of serological relatedness between the viruses.
  • vFP-6 and vCP-16 are safe for inoculation of chickens of a range of ages.
  • the fowlpox vector vFP-6 appears to be more efficient in inducing an immune response in chickens.
  • both recombinant avipox viruses, fowlpox and canarypox are shown to be useful for immunization in ovum.
  • Two groups of three piglets were inoculated with the recombinant vFP-6 by one of two routes: a) three animals received 8.1 log 10 TCID 50 by intramuscular inoculation; and b) three animals received the same dose by oral inoculation.
  • Piglets inoculated both by the intramuscular route and oral route developed a serological response to fowlpox antigens as measured by ELISA and serum neutralization. A secondary response was evident after the booster inoculation (results not shown). All piglets also developed an immunological response to rabies glycoprotein as measured in an RFFI test and a booster effect is evident by both routes. These results are shown in Table XVII.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Virology (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Biotechnology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Oncology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Communicable Diseases (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Hematology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/US1988/002816 1987-08-28 1988-08-24 Recombinant avipox virus Ceased WO1989003429A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
DE2003199031 DE10399031I1 (de) 1987-08-28 1987-08-24 Rekombinante Viren.
DE2003199032 DE10399032I1 (de) 1987-08-28 1987-08-24 Rekombinante Viren.
KR1019890700753A KR970011149B1 (ko) 1987-08-28 1988-08-24 재조합 아비폭스 바이러스
GB8908921A GB2217718B (en) 1987-08-28 1988-08-24 Recombinant viruses,vaccines containing them and in vitro cell cultures thereof
DE883890874T DE3890874T1 (de) 1987-08-28 1988-08-24 Rekombinante avipoxviren
DE3890874A DE3890874C5 (de) 1987-08-28 1988-08-24 Rekombinante Viren
DE2002199049 DE10299049I1 (de) 1987-08-28 1988-08-24 Rekombinante Viren.
AT0900788A AT408549B (de) 1987-08-28 1988-08-24 Virushältiger impfstoff, rekombinantes virus und verfahren zum exprimieren eines genproduktes
DK198902036A DK175904B1 (da) 1987-08-28 1989-04-27 Rekombinant avipoxvirus, viruset til anvendelse ved fremstilling af et lægemiddel til vertebrater og anvendelse af viruset ved fremstilling af et lægemiddel til behandling af pattedyr eller fugle for en infektion med et pattedyr- eller fuglepatogen

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
US9071187A 1987-08-28 1987-08-28
US11033587A 1987-10-20 1987-10-20
US18605488A 1988-04-25 1988-04-25
US23439088A 1988-08-23 1988-08-23
US186,054 1988-08-23
US090,711 1988-08-23
US110,335 1988-08-23
US234,390 1988-08-23

Publications (1)

Publication Number Publication Date
WO1989003429A1 true WO1989003429A1 (en) 1989-04-20

Family

ID=27492413

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1988/002816 Ceased WO1989003429A1 (en) 1987-08-28 1988-08-24 Recombinant avipox virus

Country Status (17)

Country Link
JP (3) JP3348156B2 (https=)
KR (1) KR970011149B1 (https=)
AR (1) AR241939A1 (https=)
AT (1) AT408549B (https=)
AU (2) AU2427588A (https=)
BE (1) BE1002134A5 (https=)
CH (2) CH679934A5 (https=)
DE (4) DE10399032I1 (https=)
DK (1) DK175904B1 (https=)
FR (1) FR2621487B1 (https=)
GB (1) GB2217718B (https=)
IL (1) IL87581A0 (https=)
IT (1) IT1229484B (https=)
LU (2) LU90951I2 (https=)
NL (4) NL195051C (https=)
NZ (1) NZ225970A (https=)
WO (1) WO1989003429A1 (https=)

Cited By (117)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1989012684A1 (en) * 1988-06-24 1989-12-28 National Research Development Corporation Fowlpox virus non-essential regions
WO1990002191A1 (en) * 1988-08-26 1990-03-08 Applied Biotechnology, Inc. Recombinant fowlpox virus
EP0365349A1 (en) * 1988-10-21 1990-04-25 Btg International Limited Avipox virus promoter
EP0338807A3 (en) * 1988-04-19 1990-09-12 Immuno Aktiengesellschaft Fur Chemisch-Medizinische Produkte Production of isolated proteinaceous materials using recombinant avipox virus vectors
WO1992003545A1 (en) * 1990-08-15 1992-03-05 Virogenetics Corporation Flavivirus recombinant poxvirus vaccine
WO1992007000A1 (fr) * 1990-10-23 1992-04-30 Transgene S.A. Composition pharmaceutique pour le traitement ou la prevention d'une tumeur maligne
WO1992016616A1 (en) * 1991-03-20 1992-10-01 Virogenetics Corporation Malaria recombinant poxvirus vaccine
WO1992022641A1 (en) * 1991-06-14 1992-12-23 Virogenetics Corporation Immunodeficiency virus recombinant poxvirus vaccine
US5204243A (en) * 1990-02-14 1993-04-20 Health Research Incorporated Recombinant poxvirus internal cores
GB2246784B (en) * 1989-04-17 1993-04-28 Health Research Inc Herpes virus recombinant poxvirus vaccine
EP0538496A1 (en) * 1991-08-26 1993-04-28 IMMUNO Aktiengesellschaft Recombinant fowlpox virus with intact FPV-tk-gene
US5286639A (en) * 1987-09-16 1994-02-15 Nippon Zeon Co., Ltd. Recombinant avipoxvirus
WO1994006921A1 (en) * 1992-09-21 1994-03-31 Viagene, Inc. Recombinant retroviral vector against felv and/or fiv
US5338679A (en) * 1991-01-08 1994-08-16 Her Majesty The Queen In Right Of Canada, As Represented By National Research Council Canada And Forestry Canada Vertebrate poxvoris expression vector under the control of entomopoxvirus spheroidin gene promoter
WO1994019014A1 (en) * 1993-02-26 1994-09-01 Syntro Corporation Recombinant fowlpox virus s-fpv-043 and uses thereof
GB2283021A (en) * 1990-11-20 1995-04-26 Virogenetics Corp Morbillivirus recombinant poxvirus vaccines
EP0623172A4 (en) * 1992-01-13 1995-08-09 Virogenetics Corp RECOMBINANT POXVIRUS AS A VACCINE AGAINST THE VIRUS OF MAREK DISEASE.
US5443831A (en) * 1991-10-29 1995-08-22 University Of Delaware Gene encoding glycoprotein B of Infectious Laryngotracheitis Virus
US5494807A (en) * 1991-03-07 1996-02-27 Virogenetics Corporation NYVAC vaccinia virus recombinants comprising heterologous inserts
US5496731A (en) * 1993-03-25 1996-03-05 Xu; Hong-Ji Broad-spectrum tumor suppressor genes, gene products and methods for tumor suppressor gene therapy
US5503834A (en) * 1990-11-20 1996-04-02 Virogenetics Corporation Measles virus recombinant poxvirus vaccine
US5514375A (en) * 1990-08-15 1996-05-07 Virogenetics Corporation Flavivirus recombinant poxvirus vaccine
EP0753581A1 (en) 1995-07-10 1997-01-15 Immuno Ag Improved recombinant eukaryotic cytoplasmic viruses, method for their production and their use as vaccines
US5631154A (en) * 1988-06-10 1997-05-20 Therion Biologics, Incorporated Self assembled, defective, non-self-propagating lentivirus particles
WO1997020054A1 (en) * 1995-12-01 1997-06-05 Virogenetics Corporation Recombinant poxvirus-feline infectious peritonitis virus, compositions thereof and methods for making and using them
US5756102A (en) * 1990-11-20 1998-05-26 Virogenetics Corporation Poxvirus-canine distemper virus (CDV) recombinants and compositions and methods employing the recombinants
US5759841A (en) * 1990-11-20 1998-06-02 Virogenetics Corporation Immunological composition of measles virus utilizing recombinant poxvirus
US5766598A (en) * 1991-03-07 1998-06-16 Virogenetics Corporation Recombinant attenuated ALVAC canarypoxvirus expression vectors containing heterologous DNA segments encoding lentiviral gene products
US5766597A (en) * 1991-03-07 1998-06-16 Virogenetics Corporation Malaria recombinant poxviruses
WO1998050571A1 (en) * 1997-05-07 1998-11-12 University Of Florida Entomopoxvirus-based gene delivery vector for vertebrates
US5843742A (en) * 1994-12-16 1998-12-01 Avigen Incorporated Adeno-associated derived vector systems for gene delivery and integration into target cells
US5863542A (en) * 1991-03-07 1999-01-26 Virogenetics Corporation Recombinant attenuated ALVAC canaryopox virus containing heterologous HIV or SIV inserts
US5869312A (en) * 1992-01-13 1999-02-09 Syntro Corporation Recombinant swinepox virus
WO1999007869A1 (en) * 1997-08-05 1999-02-18 University Of Florida Live recombinant vaccine comprising inefficiently or non-replicating virus
US5925358A (en) * 1993-02-26 1999-07-20 Syntro Corporation Recombinant fowlpox viruses and uses thereof
US6033904A (en) * 1992-01-13 2000-03-07 Syntro Corporation Recombinant swinepox virus
US6127163A (en) * 1992-01-13 2000-10-03 Syntro Corporation Recombinant swinepox virus
US6136318A (en) * 1993-02-26 2000-10-24 Cochran; Mark D. Recombinant fowlpox viruses and uses thereof
AU727278B2 (en) * 1993-02-26 2000-12-07 Syntro Corporation Recombinant fowlpox viruses and uses thereof II
US6214353B1 (en) * 1991-07-01 2001-04-10 Pasteur Merieux Serums Et Vaccins Malaria recombinant poxvirus vaccine
US6221349B1 (en) 1998-10-20 2001-04-24 Avigen, Inc. Adeno-associated vectors for expression of factor VIII by target cells
US6251403B1 (en) 1992-01-13 2001-06-26 Syntro Corporation Recombinant swinepox virus
EP1021526A4 (en) * 1997-10-08 2001-09-19 Biotrends Internat RECOMBINANT, GENETICALLY DELETED, PROVIRAL FeLV-DNA FOR THE PRODUCTION OF VACCINALS AGAINST FeLV.
US6309647B1 (en) 1999-07-15 2001-10-30 Aventis Pasteur Poxvirus—canine dispemper virus (CDV) or measles virus recombinants and compositions and methods employing the recombinants
US6328975B1 (en) 1992-01-13 2001-12-11 Syntro Corporation Recombinant swinepox virus
US6340462B1 (en) * 1981-12-24 2002-01-22 Health Research, Inc. Recombinant avipox virus
US6497882B1 (en) 1992-01-13 2002-12-24 Syntro Corporation Recombinant swinepox virus
WO2003053220A2 (en) 2001-12-17 2003-07-03 Corixa Corporation Compositions and methods for the therapy and diagnosis of inflammatory bowel disease
US6605465B1 (en) 1989-04-17 2003-08-12 Health Research, Inc. Methods for avoiding maternal immunity
WO2004062599A2 (en) 2003-01-06 2004-07-29 Corixa Corporation Certain aminoalkyl glucosaminide phosphate compounds and their use
WO2005007808A2 (en) 2003-05-15 2005-01-27 Chiron Corporation Hiv polynucleotides and polypeptides derived from botswana mj4
US6942864B2 (en) * 2001-03-08 2005-09-13 Akzo Nobel N.V. Leporipox-based vector vaccines
DE3890874C5 (de) * 1987-08-28 2005-10-20 Health Research Inc Rekombinante Viren
US6998252B1 (en) 1982-11-30 2006-02-14 The United States Of America As Represented By The Department Of Health And Human Services Recombinant poxviruses having foreign DNA expressed under the control of poxvirus regulatory sequences
EP1650221A2 (en) 2000-02-23 2006-04-26 GlaxoSmithKline Biologicals SA Novel compounds
US7351577B2 (en) 1998-10-20 2008-04-01 Genzyme Corporation Adeno-associated vector compositions for expression of Factor VIII
EP1961819A2 (en) 2000-06-28 2008-08-27 Corixa Corporation Composition and methods for the therapy and diagnosis of lung cancer
EP1988097A1 (en) 2001-05-09 2008-11-05 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
EP2105502A1 (en) 2000-12-12 2009-09-30 Corixa Corporation Compositions and methods for the therapy and diagnosis of lung cancer
EP2112225A1 (en) 1996-07-25 2009-10-28 The Government of the United States of America as represented by the Secretary of the Department of Health and Human Services Recombinant pox virus for immunization against tumor-associated antigens
US7678760B2 (en) 1999-06-28 2010-03-16 The Board Of Trustees Of The University Of Illinois Inhibitors of Memapsin 2 and use thereof
EP2172476A2 (en) 2001-10-30 2010-04-07 Corixa Corporation Compositions and methods for WT1 specific immunotherapy
EP2198882A2 (en) 2001-01-12 2010-06-23 Novartis Vaccines and Diagnostics, Inc. Nucleic acid mucosal immunization
EP2206785A1 (en) 1998-12-31 2010-07-14 Novartis Vaccines and Diagnostics, Inc. Improved expression of HIV polypeptides and production of virus-like particles
WO2010099472A2 (en) 2009-02-27 2010-09-02 The U.S.A. Of America, As Represented By The Secretary, Department Of Health And Human Services Spanx-b polypeptides and their use
EP2253957A1 (en) 2006-03-14 2010-11-24 Oregon Health and Science University Methods for producing an immune response to tuberculosis.
EP2258841A1 (en) 2003-06-23 2010-12-08 The Regents of the University of Colorado Methods for treating pain
EP2281832A2 (en) 2000-07-05 2011-02-09 Novartis Vaccines and Diagnostics, Inc. Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof
EP2292772A1 (en) 2001-07-05 2011-03-09 Novartis Vaccines and Diagnostics, Inc. HIV vaccination with a DNA encoding a HIV polypeptide and a HIV polypeptide
EP2298340A1 (en) 2004-09-22 2011-03-23 GlaxoSmithKline Biologicals S.A. Immunogenic composition for use in vaccination against staphylococcei
EP2360175A2 (en) 2005-11-22 2011-08-24 Novartis Vaccines and Diagnostics, Inc. Norovirus and Sapovirus virus-like particles (VLPs)
WO2011106705A2 (en) 2010-02-26 2011-09-01 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Dna-protein vaccination protocols
EP2412242A2 (en) 2001-07-05 2012-02-01 Novartis Vaccines and Diagnostics, Inc. Polynucleotides encoding antigenic HIV Type C polypeptides, polypeptides and uses thereof
EP2441846A2 (en) 2006-01-09 2012-04-18 The Regents Of the University of California Immunostimulatory combinations of TNFRSF, TLR, NLR, RHR, purinergic receptor, and cytokine receptor agoinsts for vaccines and tumor immunotherapy
WO2012106281A2 (en) 2011-01-31 2012-08-09 The General Hospital Corporation Multimodal trail molecules and uses in cellular therapies
WO2012151272A2 (en) 2011-05-02 2012-11-08 Tremrx, Inc. T-cell vaccination with viral vectors via mechanical epidermal disruption
WO2012177595A1 (en) 2011-06-21 2012-12-27 Oncofactor Corporation Compositions and methods for the therapy and diagnosis of cancer
US8425922B2 (en) 2009-01-05 2013-04-23 EpitoGenesis, Inc. Adjuvant compositions and methods of use
WO2013082106A1 (en) 2011-12-02 2013-06-06 The General Hospital Corporation Differentiation into brown adipocytes
WO2014035474A1 (en) 2012-08-30 2014-03-06 The General Hospital Corporation Compositions and methods for treating cancer
WO2014043535A1 (en) 2012-09-14 2014-03-20 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Compositions for the treatment of cancer
WO2014043518A1 (en) 2012-09-14 2014-03-20 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Brachyury protein, non-poxvirus non-yeast vectors encoding brachyury protein, and their use
US8691502B2 (en) 2008-10-31 2014-04-08 Tremrx, Inc. T-cell vaccination with viral vectors via mechanical epidermal disruption
WO2014172560A1 (en) 2013-04-17 2014-10-23 Genzyme Corporation Compositions and methods for treating and preventing macular degeneration
WO2014190040A1 (en) 2013-05-21 2014-11-27 President And Fellows Of Harvard College Engineered heme-binding compositions and uses thereof
WO2015120309A1 (en) 2014-02-06 2015-08-13 Genzyme Corporation Compositions and methods for treating and preventing macular degeneration
EP2918598A1 (en) 2007-02-28 2015-09-16 The Govt. Of U.S.A. As Represented By The Secretary Of The Department Of Health And Human Services Brachyury polypeptides and methods for use
EP2940027A1 (en) 2004-07-08 2015-11-04 Corixa Corporation Certain aminoalkyl glucosaminide phosphate compounds and their use
WO2016044707A1 (en) 2014-09-18 2016-03-24 Cedars-Sinai Medical Center Compositions and methods for treating fibrosis
WO2016154010A1 (en) 2015-03-20 2016-09-29 Makidon Paul Immunogenic compositions for use in vaccination against bordetella
WO2016168601A1 (en) 2015-04-17 2016-10-20 Khalid Shah Agents, systems and methods for treating cancer
WO2016172479A1 (en) 2015-04-22 2016-10-27 Cedars-Sinai Medical Center Enterically delivered bitter oligopeptides for the treatment for type 2 diabetes
WO2016183420A1 (en) 2015-05-13 2016-11-17 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Methods and compositions for inducing an immune response using conserved element constructs
WO2016196366A1 (en) 2015-05-29 2016-12-08 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Extension of replicative lifespan in diseases of premature aging using p53 isoforms
WO2017004022A2 (en) 2015-06-29 2017-01-05 The Board Of Trustees Of The Leland Stanford Junior University Degron fusion constructs and methods for controlling protein production
US9593340B2 (en) 2007-10-15 2017-03-14 Admedus Vaccines Pty Ltd. Expression system for modulating an immune response
WO2017096432A1 (en) 2015-12-09 2017-06-15 Admedus Vaccines Pty Ltd Immunomodulating composition for treatment
US9795658B2 (en) 2010-04-20 2017-10-24 Admedus Vaccines Pty Ltd Expression system for modulating an immune response
EP3263124A1 (en) 2009-11-20 2018-01-03 Oregon Health & Science University Methods for producing an immune response to tuberculosis
US10172916B2 (en) 2013-11-15 2019-01-08 The Board Of Trustees Of The Leland Stanford Junior University Methods of treating heart failure with agonists of hypocretin receptor 2
EP3472193A1 (en) 2016-06-20 2019-04-24 The Board of Trustees of the Leland Stanford Junior University Circular rnas and their use in immunomodulation
US10561720B2 (en) 2011-06-24 2020-02-18 EpitoGenesis, Inc. Pharmaceutical compositions, comprising a combination of select carriers, vitamins, tannins and flavonoids as antigen-specific immuno-modulators
US11285191B2 (en) 2016-07-26 2022-03-29 The Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College Immunostimulatory compositions and uses therefor
WO2023070072A1 (en) 2021-10-21 2023-04-27 The J. David Gladstone Institutes, A Testamentary Trust Established Under The Will Of J. David Gladstone Retroelement-generated transcription factor decoys
WO2023077147A2 (en) 2021-11-01 2023-05-04 Pellis Therapeutics, Inc. T-cell vaccines for patients with reduced humoral immunity
WO2023081756A1 (en) 2021-11-03 2023-05-11 The J. David Gladstone Institutes, A Testamentary Trust Established Under The Will Of J. David Gladstone Precise genome editing using retrons
WO2023141602A2 (en) 2022-01-21 2023-07-27 Renagade Therapeutics Management Inc. Engineered retrons and methods of use
WO2023183589A1 (en) 2022-03-25 2023-09-28 The J. David Gladstone Institutes, A Testamentary Trust Established Under The Will Of J. David Gladstone Rt-dna fidelity and retron genome editing
WO2023183588A1 (en) 2022-03-25 2023-09-28 The J. David Gladstone Institutes, A Testamentary Trust Established Under The Will Of J. David Gladstone Methods of assessing engineered retron activity, and uses thereof
WO2023183627A1 (en) 2022-03-25 2023-09-28 The J. David Gladstone Institutes, A Testamentary Trust Established Under The Will Of J. David Gladstone Production of reverse transcribed dna (rt-dna) using a retron reverse transcriptase from exogenous rna
WO2024020346A2 (en) 2022-07-18 2024-01-25 Renagade Therapeutics Management Inc. Gene editing components, systems, and methods of use
WO2024044723A1 (en) 2022-08-25 2024-02-29 Renagade Therapeutics Management Inc. Engineered retrons and methods of use
WO2024044673A1 (en) 2022-08-24 2024-02-29 The J. David Gladstone Institutes, A Testamentary Trust Established Under The Will Of J. David Gladstone Dual cut retron editors for genomic insertions and deletions
WO2024233791A1 (en) 2023-05-11 2024-11-14 Seelos Therapeutics, Inc. Methods of treating neurodegenerative disorders
WO2025081042A1 (en) 2023-10-12 2025-04-17 Renagade Therapeutics Management Inc. Nickase-retron template-based precision editing system and methods of use
WO2025155753A2 (en) 2024-01-17 2025-07-24 Renagade Therapeutics Management Inc. Improved gene editing system, guides, and methods
US12416015B2 (en) 2017-09-15 2025-09-16 The Board Of Trustees Of The Leland Stanford Junior University Multiplex production and barcoding of genetically engineered cells

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993003145A1 (en) * 1991-07-26 1993-02-18 Virogenetics Corporation Infectious bursal disease virus recombinant poxvirus vaccine
JPH11165762A (ja) 1997-12-01 1999-06-22 Lintec Corp チップ体搬送用カバーテープおよび封止構造体
JP4499311B2 (ja) * 2001-04-27 2010-07-07 シャープ株式会社 放送受信端末
US10917454B1 (en) 2019-08-01 2021-02-09 Rohde & Schwarz Gmbh & Co. Kg System and method for ATC voice quality assurance

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1986005806A1 (en) * 1985-03-29 1986-10-09 National Research Development Corporation Infectious bronchitis virus spike protein

Family Cites Families (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK489481A (da) * 1980-11-10 1982-05-11 Searle & Co Plasmidvektor og frmgangsmaade til fremstilling deraf
US4603112A (en) * 1981-12-24 1986-07-29 Health Research, Incorporated Modified vaccinia virus
AU570940B2 (en) * 1982-11-30 1988-03-31 United States of America, as represented by the Secretary, U.S. Department of Commerce, The Process for producing poxvirus recombinants for expression offoreign genes
FR2563434B1 (fr) * 1984-04-25 1986-07-25 Transgene Sa Vaccin contre la rage et procede pour sa preparation
EP0190254A4 (en) * 1984-07-05 1987-03-09 Genex Corp GENE CLONE AND PROCESS FOR THE PREPARATION AND USE THEREOF.
DD235669A1 (de) * 1985-03-26 1986-05-14 Akad Wissenschaften Ddr Verfahren zur herstellung eines blv-kodierten huellproteins
EP0213894A3 (en) * 1985-08-23 1987-10-21 Advanced Genetics Research Institute Defective viral particle vaccines and methods for their use
AU607399B2 (en) * 1985-09-09 1991-03-07 Cetus Corporation Infectious recombinant virus vaccine for feline leukemia
NZ217645A (en) * 1985-09-25 1991-11-26 Oncogen Recombinant viruses expressing lav/htlv-iii related epitopes and vaccine formulations
AU602875B2 (en) * 1985-12-18 1990-11-01 British Technology Group Limited Newcastle disease virus gene clones
AU8075787A (en) * 1986-09-22 1988-04-07 Australian National University, The Recombinant poxviruses
WO1988002022A1 (en) * 1986-09-22 1988-03-24 Commonwealth Scientific And Industrial Research Or Recombinant poxviruses
EP0261940A3 (en) * 1986-09-23 1989-07-05 Applied Biotechnology, Inc. Pseudorabies vaccines and dna vectors for recombination with pox viruses
AU605567B2 (en) * 1987-03-11 1991-01-17 Nippon Zeon Co., Ltd. Recombinant avipoxvirus
DE10399032I1 (de) * 1987-08-28 2004-01-29 Health Research Inc Rekombinante Viren.
GB8724885D0 (en) * 1987-10-23 1987-11-25 Binns M M Fowlpox virus promotors
FR2632863B2 (fr) * 1987-10-29 1990-08-31 Transgene Sa Virus du fowlpox recombinant et vaccins derives de ces virus
JP2538367B2 (ja) * 1988-06-24 1996-09-25 ブリティッシュ・テクノロジー・グループ・リミテッド Fowlpoxウィルスの非必須領域
WO1990010693A1 (en) * 1989-03-08 1990-09-20 Health Research, Inc. Recombinant poxvirus host selection system
DE69132311T2 (de) * 1990-09-25 2000-12-14 Cantab Pharmaceuticals Research Ltd., Cambridge Bei einer transkomplementenden zellinie erzeugter defektiver virenimpfstoff

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1986005806A1 (en) * 1985-03-29 1986-10-09 National Research Development Corporation Infectious bronchitis virus spike protein

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
BIOESSAYS, Volume 5, issued June 1986, (New York, New York, USA), PICCINI et al., "The Use of Vaccinia Virus for the Construction of Recombinant Vaccines", pages 249-251. *
BIOTECHNOLOGY: POTENTIALS AND LIMITATIONS, Dahlem Konferenzen 1986, (New York, New York, USA), PAOLETTI et al., "A Modern Approach to Live Vaccines: Recombinant Poxviruses", pages 155, 161-162. *
JOURNAL OF GENERAL VIROLOGY, Volume 67, issued December 1986, (Oxford, England), BOYLE et al., "Identification by a Random Sequencing Strategy of the fowlpoxvirus DNA Polymerase Gene, its Nucleotide Sequence and Comparison With Other Viral DNA Polymerases", page 6563. *
JOURNAL OF VIROLOGY, Volume 62, issued February 1988, (Washington, D.C., USA), EVANS et al., "High Levels of Genetic Recombination Among Cotransrected Plasmid DNAs in Poxvirus-Infected Mammalian Cells", page 367. *
VIROLOGY, Volume 156, issued March 1987, (New York, New York, USA), BOYLE et al., "Fowlpox Virus Thymidine Kinase: Nucleotide Sequence and Relationships to Other Thymidine Kinases", page 355. *
VIROLOGY, Volume 160, issued October 1987, (New York, New York, USA), DRILLEN et al., "Similar Genetic Organization Between a Region of Fowlpox Virus DNA and the Vaccinia Virus Hind III J Fragment Despite Divergent Location of the Thymidine Kinase Gene", page 203. *
VIRUS RESEARCH, Volume 10, issued January 1988, (Amsterdam, The Netherlands), SCHNITZLEIN et al., "Genomic and Antigenic Characterization of Avipoxviruses", page 65. *
VIRUS RESEARCH, Volume 10, July 1988, (Amsterdam, The Netherlands), BOYLE et al., "Construction of Recombinant Fowlpox Viruses as Vectors for Poultry Vaccines", page 343. *

Cited By (168)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5482713A (en) * 1981-12-24 1996-01-09 Health Research Incorporated Equine herpesvirus recombinant poxvirus vaccine
US6340462B1 (en) * 1981-12-24 2002-01-22 Health Research, Inc. Recombinant avipox virus
US6998252B1 (en) 1982-11-30 2006-02-14 The United States Of America As Represented By The Department Of Health And Human Services Recombinant poxviruses having foreign DNA expressed under the control of poxvirus regulatory sequences
US7015024B1 (en) 1982-11-30 2006-03-21 The United States Of America As Represented By The Department Of Health And Human Services Compositions containing recombinant poxviruses having foreign DNA expressed under the control of poxvirus regulatory sequences
US7045136B1 (en) 1982-11-30 2006-05-16 The United States Of America As Represented By The Department Of Health And Human Services Methods of immunization using recombinant poxviruses having foreign DNA expressed under the control of poxvirus regulatory sequences
US7045313B1 (en) 1982-11-30 2006-05-16 The United States Of America As Represented By The Department Of Health And Human Services Recombinant vaccinia virus containing a chimeric gene having foreign DNA flanked by vaccinia regulatory DNA
DE3890874C5 (de) * 1987-08-28 2005-10-20 Health Research Inc Rekombinante Viren
US5286639A (en) * 1987-09-16 1994-02-15 Nippon Zeon Co., Ltd. Recombinant avipoxvirus
EP0338807A3 (en) * 1988-04-19 1990-09-12 Immuno Aktiengesellschaft Fur Chemisch-Medizinische Produkte Production of isolated proteinaceous materials using recombinant avipox virus vectors
US5631154A (en) * 1988-06-10 1997-05-20 Therion Biologics, Incorporated Self assembled, defective, non-self-propagating lentivirus particles
GB2220941B (en) * 1988-06-24 1991-09-11 Nat Res Dev Fowlpox virus non-essential regions
WO1989012684A1 (en) * 1988-06-24 1989-12-28 National Research Development Corporation Fowlpox virus non-essential regions
EP0353851A1 (en) * 1988-06-24 1990-02-07 Btg International Limited Fowlpox virus non-essential regions
GB2220941A (en) * 1988-06-24 1990-01-24 Nat Res Dev Fowlpox virus non-essential regions
US5310671A (en) * 1988-06-24 1994-05-10 British Technology Group Limited Fowlpox virus non-essential regions
US5093258A (en) * 1988-08-26 1992-03-03 Therion Biologics Corporation Recombinant fowlpox virus and recombination vector
WO1990002191A1 (en) * 1988-08-26 1990-03-08 Applied Biotechnology, Inc. Recombinant fowlpox virus
WO1990004638A1 (en) * 1988-10-21 1990-05-03 National Research Development Corporation Fowlpox virus promoter
US5374558A (en) * 1988-10-21 1994-12-20 British Technology Group Ltd. Fowlpox virus promoter
EP0365349A1 (en) * 1988-10-21 1990-04-25 Btg International Limited Avipox virus promoter
GB2246784B (en) * 1989-04-17 1993-04-28 Health Research Inc Herpes virus recombinant poxvirus vaccine
US6605465B1 (en) 1989-04-17 2003-08-12 Health Research, Inc. Methods for avoiding maternal immunity
US5204243A (en) * 1990-02-14 1993-04-20 Health Research Incorporated Recombinant poxvirus internal cores
GB2269820A (en) * 1990-08-15 1994-02-23 Virogenetics Corp Flavivirus recombinant poxvirus vaccine
US5514375A (en) * 1990-08-15 1996-05-07 Virogenetics Corporation Flavivirus recombinant poxvirus vaccine
GB2269820B (en) * 1990-08-15 1995-03-29 Virogenetics Corp Recombinant pox virus encoding flaviviral structural proteins
US5744140A (en) * 1990-08-15 1998-04-28 Virgenetics Corporation Flavivirus recombinant poxvirus vaccine
WO1992003545A1 (en) * 1990-08-15 1992-03-05 Virogenetics Corporation Flavivirus recombinant poxvirus vaccine
US6328956B1 (en) 1990-10-23 2001-12-11 Transgene S.A. Pharmaceutical composition for the treatment or prevention of a malignant tumor
US5861381A (en) * 1990-10-23 1999-01-19 Transgene S.A. Pharmaceutical composition for the treatment of a malignant tumor
WO1992007000A1 (fr) * 1990-10-23 1992-04-30 Transgene S.A. Composition pharmaceutique pour le traitement ou la prevention d'une tumeur maligne
US5759841A (en) * 1990-11-20 1998-06-02 Virogenetics Corporation Immunological composition of measles virus utilizing recombinant poxvirus
GB2264949B (en) * 1990-11-20 1995-07-05 Virogenetics Corp Measles virus recombinant poxvirus vaccine
US5503834A (en) * 1990-11-20 1996-04-02 Virogenetics Corporation Measles virus recombinant poxvirus vaccine
US7144578B2 (en) 1990-11-20 2006-12-05 Connaught Technology Corporation Poxvirus-rabies recombinants and compositions and methods employing the recombinants
GB2283021A (en) * 1990-11-20 1995-04-26 Virogenetics Corp Morbillivirus recombinant poxvirus vaccines
GB2283021B (en) * 1990-11-20 1995-07-05 Virogenetics Corp A recombinant poxviral vaccine for canine distemper
US5756102A (en) * 1990-11-20 1998-05-26 Virogenetics Corporation Poxvirus-canine distemper virus (CDV) recombinants and compositions and methods employing the recombinants
US5338679A (en) * 1991-01-08 1994-08-16 Her Majesty The Queen In Right Of Canada, As Represented By National Research Council Canada And Forestry Canada Vertebrate poxvoris expression vector under the control of entomopoxvirus spheroidin gene promoter
US5762938A (en) * 1991-03-07 1998-06-09 Virogenetics Corporation Modified recombinant vaccinia virus and expression vectors thereof
US5766598A (en) * 1991-03-07 1998-06-16 Virogenetics Corporation Recombinant attenuated ALVAC canarypoxvirus expression vectors containing heterologous DNA segments encoding lentiviral gene products
US5766599A (en) * 1991-03-07 1998-06-16 Virogenetics Corporation Trova fowl pox virus recombinants comprising heterologous inserts
US5766597A (en) * 1991-03-07 1998-06-16 Virogenetics Corporation Malaria recombinant poxviruses
US5863542A (en) * 1991-03-07 1999-01-26 Virogenetics Corporation Recombinant attenuated ALVAC canaryopox virus containing heterologous HIV or SIV inserts
US5756103A (en) * 1991-03-07 1998-05-26 Virogenetics Corporation Alvac canarypox virus recombinants comprising heterlogous inserts
US5494807A (en) * 1991-03-07 1996-02-27 Virogenetics Corporation NYVAC vaccinia virus recombinants comprising heterologous inserts
WO1992016616A1 (en) * 1991-03-20 1992-10-01 Virogenetics Corporation Malaria recombinant poxvirus vaccine
WO1992022641A1 (en) * 1991-06-14 1992-12-23 Virogenetics Corporation Immunodeficiency virus recombinant poxvirus vaccine
US6214353B1 (en) * 1991-07-01 2001-04-10 Pasteur Merieux Serums Et Vaccins Malaria recombinant poxvirus vaccine
US5670367A (en) * 1991-08-26 1997-09-23 Immuno Aktiengesellschaft Recombinant fowlpox virus
EP0538496A1 (en) * 1991-08-26 1993-04-28 IMMUNO Aktiengesellschaft Recombinant fowlpox virus with intact FPV-tk-gene
US5443831A (en) * 1991-10-29 1995-08-22 University Of Delaware Gene encoding glycoprotein B of Infectious Laryngotracheitis Virus
US6497882B1 (en) 1992-01-13 2002-12-24 Syntro Corporation Recombinant swinepox virus
EP1489165A1 (en) * 1992-01-13 2004-12-22 Virogenetics Corporation Recombinant fowlpox vaccine for protection against marek's disease
US6328975B1 (en) 1992-01-13 2001-12-11 Syntro Corporation Recombinant swinepox virus
US5869312A (en) * 1992-01-13 1999-02-09 Syntro Corporation Recombinant swinepox virus
US6033904A (en) * 1992-01-13 2000-03-07 Syntro Corporation Recombinant swinepox virus
US6251403B1 (en) 1992-01-13 2001-06-26 Syntro Corporation Recombinant swinepox virus
EP0623172A4 (en) * 1992-01-13 1995-08-09 Virogenetics Corp RECOMBINANT POXVIRUS AS A VACCINE AGAINST THE VIRUS OF MAREK DISEASE.
US6127163A (en) * 1992-01-13 2000-10-03 Syntro Corporation Recombinant swinepox virus
WO1994006921A1 (en) * 1992-09-21 1994-03-31 Viagene, Inc. Recombinant retroviral vector against felv and/or fiv
AU727278B2 (en) * 1993-02-26 2000-12-07 Syntro Corporation Recombinant fowlpox viruses and uses thereof II
WO1994019014A1 (en) * 1993-02-26 1994-09-01 Syntro Corporation Recombinant fowlpox virus s-fpv-043 and uses thereof
US6123949A (en) * 1993-02-26 2000-09-26 Cochran; Mark D. Recombinant fowlpox virus S-FPV-043 and uses thereof
WO1994019015A1 (en) * 1993-02-26 1994-09-01 Syntro Corporation Recombinant fowlpox viruses and uses thereof
US5925358A (en) * 1993-02-26 1999-07-20 Syntro Corporation Recombinant fowlpox viruses and uses thereof
US6001369A (en) * 1993-02-26 1999-12-14 Syntro Corporation Recombinant fowlpox viruses and uses thereof
US6136318A (en) * 1993-02-26 2000-10-24 Cochran; Mark D. Recombinant fowlpox viruses and uses thereof
AU696247B2 (en) * 1993-02-26 1998-09-03 Syntro Corporation Recombinant fowlpox viruses and uses thereof
US5912236A (en) * 1993-03-25 1999-06-15 Baylor College Of Medicine Broad-spectrum tumor suppressor genes gene products and methods for tumor suppressor gene therapy
US5496731A (en) * 1993-03-25 1996-03-05 Xu; Hong-Ji Broad-spectrum tumor suppressor genes, gene products and methods for tumor suppressor gene therapy
US5843742A (en) * 1994-12-16 1998-12-01 Avigen Incorporated Adeno-associated derived vector systems for gene delivery and integration into target cells
EP0753581A1 (en) 1995-07-10 1997-01-15 Immuno Ag Improved recombinant eukaryotic cytoplasmic viruses, method for their production and their use as vaccines
WO1997020054A1 (en) * 1995-12-01 1997-06-05 Virogenetics Corporation Recombinant poxvirus-feline infectious peritonitis virus, compositions thereof and methods for making and using them
US5858373A (en) * 1995-12-01 1999-01-12 Virogenetics Corporation Recombinant poxvirus-feline infectious peritionitis virus, compositions thereof and methods for making and using them
EP2112225A1 (en) 1996-07-25 2009-10-28 The Government of the United States of America as represented by the Secretary of the Department of Health and Human Services Recombinant pox virus for immunization against tumor-associated antigens
US6106825A (en) * 1997-05-07 2000-08-22 University Of Florida Entomopoxvirus-vertebrate gene delivery vector and method
WO1998050571A1 (en) * 1997-05-07 1998-11-12 University Of Florida Entomopoxvirus-based gene delivery vector for vertebrates
WO1999007869A1 (en) * 1997-08-05 1999-02-18 University Of Florida Live recombinant vaccine comprising inefficiently or non-replicating virus
EP1021526A4 (en) * 1997-10-08 2001-09-19 Biotrends Internat RECOMBINANT, GENETICALLY DELETED, PROVIRAL FeLV-DNA FOR THE PRODUCTION OF VACCINALS AGAINST FeLV.
US7351577B2 (en) 1998-10-20 2008-04-01 Genzyme Corporation Adeno-associated vector compositions for expression of Factor VIII
US6221349B1 (en) 1998-10-20 2001-04-24 Avigen, Inc. Adeno-associated vectors for expression of factor VIII by target cells
EP2206785A1 (en) 1998-12-31 2010-07-14 Novartis Vaccines and Diagnostics, Inc. Improved expression of HIV polypeptides and production of virus-like particles
US7829669B2 (en) 1999-06-28 2010-11-09 Oklahoma Medical Research Foundation Catalytically active recombinant memapsin and methods of use thereof
US7678760B2 (en) 1999-06-28 2010-03-16 The Board Of Trustees Of The University Of Illinois Inhibitors of Memapsin 2 and use thereof
US6309647B1 (en) 1999-07-15 2001-10-30 Aventis Pasteur Poxvirus—canine dispemper virus (CDV) or measles virus recombinants and compositions and methods employing the recombinants
EP1650221A2 (en) 2000-02-23 2006-04-26 GlaxoSmithKline Biologicals SA Novel compounds
EP1961819A2 (en) 2000-06-28 2008-08-27 Corixa Corporation Composition and methods for the therapy and diagnosis of lung cancer
EP2311958A2 (en) 2000-07-05 2011-04-20 Novartis Vaccines and Diagnostics, Inc. Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof
EP2281832A2 (en) 2000-07-05 2011-02-09 Novartis Vaccines and Diagnostics, Inc. Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof
EP2105502A1 (en) 2000-12-12 2009-09-30 Corixa Corporation Compositions and methods for the therapy and diagnosis of lung cancer
EP2198882A2 (en) 2001-01-12 2010-06-23 Novartis Vaccines and Diagnostics, Inc. Nucleic acid mucosal immunization
US6942864B2 (en) * 2001-03-08 2005-09-13 Akzo Nobel N.V. Leporipox-based vector vaccines
EP1988097A1 (en) 2001-05-09 2008-11-05 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
EP2292772A1 (en) 2001-07-05 2011-03-09 Novartis Vaccines and Diagnostics, Inc. HIV vaccination with a DNA encoding a HIV polypeptide and a HIV polypeptide
EP2412242A2 (en) 2001-07-05 2012-02-01 Novartis Vaccines and Diagnostics, Inc. Polynucleotides encoding antigenic HIV Type C polypeptides, polypeptides and uses thereof
EP2172476A2 (en) 2001-10-30 2010-04-07 Corixa Corporation Compositions and methods for WT1 specific immunotherapy
WO2003053220A2 (en) 2001-12-17 2003-07-03 Corixa Corporation Compositions and methods for the therapy and diagnosis of inflammatory bowel disease
EP2224012A1 (en) 2001-12-17 2010-09-01 Corixa Corporation Compositions and methods for the therapy and diagnosis of inflammatory bowel disease
EP2940028A1 (en) 2003-01-06 2015-11-04 Corixa Corporation Certain aminoalkyl glucosaminide phosphate compounds and their use
WO2004062599A2 (en) 2003-01-06 2004-07-29 Corixa Corporation Certain aminoalkyl glucosaminide phosphate compounds and their use
WO2005007808A2 (en) 2003-05-15 2005-01-27 Chiron Corporation Hiv polynucleotides and polypeptides derived from botswana mj4
EP2258841A1 (en) 2003-06-23 2010-12-08 The Regents of the University of Colorado Methods for treating pain
EP2940027A1 (en) 2004-07-08 2015-11-04 Corixa Corporation Certain aminoalkyl glucosaminide phosphate compounds and their use
EP2305295A1 (en) 2004-09-22 2011-04-06 GlaxoSmithKline Biologicals SA Immunogenic composition for use in vaccination against staphylococcei
EP2305294A1 (en) 2004-09-22 2011-04-06 GlaxoSmithKline Biologicals SA Immunogenic composition for use in vaccination against staphylococcei
EP2893938A1 (en) 2004-09-22 2015-07-15 GlaxoSmithKline Biologicals SA Immunogenic composition for use in vaccination against Staphylococcei
EP2298340A1 (en) 2004-09-22 2011-03-23 GlaxoSmithKline Biologicals S.A. Immunogenic composition for use in vaccination against staphylococcei
EP2305296A1 (en) 2004-09-22 2011-04-06 GlaxoSmithKline Biologicals SA Immunogenic composition for use in vaccination against staphylococcei
EP2360175A2 (en) 2005-11-22 2011-08-24 Novartis Vaccines and Diagnostics, Inc. Norovirus and Sapovirus virus-like particles (VLPs)
EP2441846A2 (en) 2006-01-09 2012-04-18 The Regents Of the University of California Immunostimulatory combinations of TNFRSF, TLR, NLR, RHR, purinergic receptor, and cytokine receptor agoinsts for vaccines and tumor immunotherapy
EP2253957A1 (en) 2006-03-14 2010-11-24 Oregon Health and Science University Methods for producing an immune response to tuberculosis.
EP2428801A1 (en) 2006-03-14 2012-03-14 Oregon Health and Science University Methods for detecting a mycobacterium tuberculosis infection
EP2397855A2 (en) 2006-03-14 2011-12-21 Oregon Health and Science University Methods for detecting a mycobacterium tuberculosis infection
EP2918598A1 (en) 2007-02-28 2015-09-16 The Govt. Of U.S.A. As Represented By The Secretary Of The Department Of Health And Human Services Brachyury polypeptides and methods for use
US9593340B2 (en) 2007-10-15 2017-03-14 Admedus Vaccines Pty Ltd. Expression system for modulating an immune response
US8691502B2 (en) 2008-10-31 2014-04-08 Tremrx, Inc. T-cell vaccination with viral vectors via mechanical epidermal disruption
US9416371B2 (en) 2008-10-31 2016-08-16 Tremrx, Inc. T-cell vaccination with viral vectors via mechanical epidermal disruption
US9180184B2 (en) 2009-01-05 2015-11-10 EpitoGenesis, Inc. Adjuvant compositions and methods of use
US8425922B2 (en) 2009-01-05 2013-04-23 EpitoGenesis, Inc. Adjuvant compositions and methods of use
WO2010099472A2 (en) 2009-02-27 2010-09-02 The U.S.A. Of America, As Represented By The Secretary, Department Of Health And Human Services Spanx-b polypeptides and their use
EP3263124A1 (en) 2009-11-20 2018-01-03 Oregon Health & Science University Methods for producing an immune response to tuberculosis
EP3360566A1 (en) 2009-11-20 2018-08-15 Oregon Health&Science University Methods for detecting a mycobacterium tuberculosis infection
WO2011106705A2 (en) 2010-02-26 2011-09-01 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Dna-protein vaccination protocols
US9795658B2 (en) 2010-04-20 2017-10-24 Admedus Vaccines Pty Ltd Expression system for modulating an immune response
WO2012106281A2 (en) 2011-01-31 2012-08-09 The General Hospital Corporation Multimodal trail molecules and uses in cellular therapies
WO2012151272A2 (en) 2011-05-02 2012-11-08 Tremrx, Inc. T-cell vaccination with viral vectors via mechanical epidermal disruption
WO2012177595A1 (en) 2011-06-21 2012-12-27 Oncofactor Corporation Compositions and methods for the therapy and diagnosis of cancer
US10561720B2 (en) 2011-06-24 2020-02-18 EpitoGenesis, Inc. Pharmaceutical compositions, comprising a combination of select carriers, vitamins, tannins and flavonoids as antigen-specific immuno-modulators
WO2013082106A1 (en) 2011-12-02 2013-06-06 The General Hospital Corporation Differentiation into brown adipocytes
WO2014035474A1 (en) 2012-08-30 2014-03-06 The General Hospital Corporation Compositions and methods for treating cancer
WO2014043535A1 (en) 2012-09-14 2014-03-20 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Compositions for the treatment of cancer
WO2014043518A1 (en) 2012-09-14 2014-03-20 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Brachyury protein, non-poxvirus non-yeast vectors encoding brachyury protein, and their use
EP3741385A1 (en) 2013-04-17 2020-11-25 Genzyme Corporation Compositions for use in a method of treating and preventing macular degeneration
US12344842B2 (en) 2013-04-17 2025-07-01 Genzyme Corporation Compositions and methods for treating and preventing macular degeneration
US10640771B2 (en) 2013-04-17 2020-05-05 Genzyme Corporation Compositions and methods for treating and preventing macular degeneration
WO2014172560A1 (en) 2013-04-17 2014-10-23 Genzyme Corporation Compositions and methods for treating and preventing macular degeneration
EP3848044A1 (en) 2013-05-21 2021-07-14 President and Fellows of Harvard College Engineered heme-binding compositions and uses thereof
WO2014190040A1 (en) 2013-05-21 2014-11-27 President And Fellows Of Harvard College Engineered heme-binding compositions and uses thereof
EP3848045A1 (en) 2013-05-21 2021-07-14 President and Fellows of Harvard College Engineered heme-binding compositions and uses thereof
US10172916B2 (en) 2013-11-15 2019-01-08 The Board Of Trustees Of The Leland Stanford Junior University Methods of treating heart failure with agonists of hypocretin receptor 2
WO2015120309A1 (en) 2014-02-06 2015-08-13 Genzyme Corporation Compositions and methods for treating and preventing macular degeneration
WO2016044707A1 (en) 2014-09-18 2016-03-24 Cedars-Sinai Medical Center Compositions and methods for treating fibrosis
WO2016154010A1 (en) 2015-03-20 2016-09-29 Makidon Paul Immunogenic compositions for use in vaccination against bordetella
WO2016168601A1 (en) 2015-04-17 2016-10-20 Khalid Shah Agents, systems and methods for treating cancer
EP4194001A1 (en) 2015-04-22 2023-06-14 Cedars-Sinai Medical Center Enterically delivered bitter oligopeptides for the treatment for type 2 diabetes and obesity
WO2016172479A1 (en) 2015-04-22 2016-10-27 Cedars-Sinai Medical Center Enterically delivered bitter oligopeptides for the treatment for type 2 diabetes
EP4276106A2 (en) 2015-05-13 2023-11-15 The United States of America as represented by the Secretary of the Department of Health and Human Services Methods and compositions for inducing an immune response using conserved element constructs
WO2016183420A1 (en) 2015-05-13 2016-11-17 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Methods and compositions for inducing an immune response using conserved element constructs
WO2016196366A1 (en) 2015-05-29 2016-12-08 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Extension of replicative lifespan in diseases of premature aging using p53 isoforms
WO2017004022A2 (en) 2015-06-29 2017-01-05 The Board Of Trustees Of The Leland Stanford Junior University Degron fusion constructs and methods for controlling protein production
WO2017096432A1 (en) 2015-12-09 2017-06-15 Admedus Vaccines Pty Ltd Immunomodulating composition for treatment
EP3472193A1 (en) 2016-06-20 2019-04-24 The Board of Trustees of the Leland Stanford Junior University Circular rnas and their use in immunomodulation
US11285191B2 (en) 2016-07-26 2022-03-29 The Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College Immunostimulatory compositions and uses therefor
US12416015B2 (en) 2017-09-15 2025-09-16 The Board Of Trustees Of The Leland Stanford Junior University Multiplex production and barcoding of genetically engineered cells
WO2023070072A1 (en) 2021-10-21 2023-04-27 The J. David Gladstone Institutes, A Testamentary Trust Established Under The Will Of J. David Gladstone Retroelement-generated transcription factor decoys
WO2023077147A2 (en) 2021-11-01 2023-05-04 Pellis Therapeutics, Inc. T-cell vaccines for patients with reduced humoral immunity
WO2023081756A1 (en) 2021-11-03 2023-05-11 The J. David Gladstone Institutes, A Testamentary Trust Established Under The Will Of J. David Gladstone Precise genome editing using retrons
WO2023141602A2 (en) 2022-01-21 2023-07-27 Renagade Therapeutics Management Inc. Engineered retrons and methods of use
WO2023183627A1 (en) 2022-03-25 2023-09-28 The J. David Gladstone Institutes, A Testamentary Trust Established Under The Will Of J. David Gladstone Production of reverse transcribed dna (rt-dna) using a retron reverse transcriptase from exogenous rna
WO2023183588A1 (en) 2022-03-25 2023-09-28 The J. David Gladstone Institutes, A Testamentary Trust Established Under The Will Of J. David Gladstone Methods of assessing engineered retron activity, and uses thereof
WO2023183589A1 (en) 2022-03-25 2023-09-28 The J. David Gladstone Institutes, A Testamentary Trust Established Under The Will Of J. David Gladstone Rt-dna fidelity and retron genome editing
WO2024020346A2 (en) 2022-07-18 2024-01-25 Renagade Therapeutics Management Inc. Gene editing components, systems, and methods of use
WO2024044673A1 (en) 2022-08-24 2024-02-29 The J. David Gladstone Institutes, A Testamentary Trust Established Under The Will Of J. David Gladstone Dual cut retron editors for genomic insertions and deletions
WO2024044723A1 (en) 2022-08-25 2024-02-29 Renagade Therapeutics Management Inc. Engineered retrons and methods of use
WO2024233791A1 (en) 2023-05-11 2024-11-14 Seelos Therapeutics, Inc. Methods of treating neurodegenerative disorders
WO2025081042A1 (en) 2023-10-12 2025-04-17 Renagade Therapeutics Management Inc. Nickase-retron template-based precision editing system and methods of use
WO2025155753A2 (en) 2024-01-17 2025-07-24 Renagade Therapeutics Management Inc. Improved gene editing system, guides, and methods

Also Published As

Publication number Publication date
JP3826055B2 (ja) 2006-09-27
IT8821772A0 (it) 1988-08-29
DK175904B1 (da) 2005-06-06
IT1229484B (it) 1991-09-03
KR890701757A (ko) 1989-12-21
CH679934A5 (https=) 1992-05-15
LU91039I2 (fr) 2003-11-05
AR241939A1 (es) 1993-01-29
AU1628895A (en) 1995-08-17
DE10299049I1 (de) 2004-07-01
NL300130I1 (nl) 2003-09-01
CH679933A5 (https=) 1992-05-15
NZ225970A (en) 1991-01-29
DK203689D0 (da) 1989-04-27
NL300130I2 (nl) 2005-11-01
GB2217718A (en) 1989-11-01
GB2217718B (en) 1992-05-20
DE3890874C5 (de) 2005-10-20
IL87581A0 (en) 1989-01-31
JP2002186494A (ja) 2002-07-02
LU90951I2 (fr) 2003-01-15
FR2621487A1 (fr) 1989-04-14
DK203689A (da) 1989-06-27
NL300139I1 (nl) 2004-02-02
NL300138I2 (nl) 2004-03-01
DE10399031I1 (de) 2004-01-29
JPH02500879A (ja) 1990-03-29
GB8908921D0 (en) 1989-08-02
AU690210B2 (en) 1998-04-23
FR2621487B1 (fr) 1991-10-18
ATA900788A (de) 1995-05-15
NL300138I1 (nl) 2004-02-02
AU2427588A (en) 1989-05-02
BE1002134A5 (fr) 1990-07-24
KR970011149B1 (ko) 1997-07-07
JP3348156B2 (ja) 2002-11-20
JP2002348255A (ja) 2002-12-04
NL195051C (nl) 2003-07-01
AT408549B (de) 2001-12-27
NL8820679A (nl) 1989-07-03
DE10399032I1 (de) 2004-01-29
DE3890874C2 (de) 2003-03-13

Similar Documents

Publication Publication Date Title
US6340462B1 (en) Recombinant avipox virus
US5174993A (en) Recombinant avipox virus and immunological use thereof
AU690210B2 (en) Recombinant virus
US5225336A (en) Recombinant poxvirus host range selection system
US5453364A (en) Recombinant poxvirus host range selection system
US7144578B2 (en) Poxvirus-rabies recombinants and compositions and methods employing the recombinants
JP2002514885A (ja) ポックスウイルス−イヌジステンパーウイルス(cdv)組み換え体類および組成物類および前記組み換え体類を用いる方法
IT9020063A1 (it) Vaccino di poxvirus ricombinante di herpesvirus
US5858373A (en) Recombinant poxvirus-feline infectious peritionitis virus, compositions thereof and methods for making and using them
JP2007254489A (ja) Htlv抗原を発現する組換え弱毒化ポックスウイルスを含有する免疫原性組成物
EP0831899B1 (en) Recombinant poxvirus-calicivirus compositions and uses
WO1996039177A9 (en) Recombinant poxvirus-calicivirus [rabbit hemorrhagic disease virus (rhdv)] compositions and uses
WO2007115385A2 (en) Transfer plasmidic vector and recombinant canarypox virus
AU761321B2 (en) Recombinant viruses, vaccines containing them and in vitro cell cultures thereof
AU725985B2 (en) Recombinant virus
CA1341403C (en) Recombinant a vipox virus
DK175980B1 (da) Recombinante vacciniavira og anvendelsen af samme
DK176068B1 (da) Rekombinant kanaripoxvirus og anvendelsen af samme
DK176165B1 (da) Rekombinant fjerkræpoxvirus samt anvendelsen af samme
IE60309B1 (en) Recombinant viruses, vaccines containing them and in vitro cell cultures thereof
AU6247000A (en) Recombinant poxvirus-calicivirus (rabbit hemorrhagic disease virus (RHDV)) compositions and uses

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AT AU BG BR CH DE DK GB HU JP KP KR LU NL NO SE SU

WWE Wipo information: entry into national phase

Ref document number: 8908921.3

Country of ref document: GB

ENP Entry into the national phase

Ref document number: 1988 9007

Country of ref document: AT

Date of ref document: 19890420

Kind code of ref document: A

RET De translation (de og part 6b)

Ref document number: 3890874

Country of ref document: DE

Date of ref document: 19891221

WWE Wipo information: entry into national phase

Ref document number: 3890874

Country of ref document: DE