WO1994006921A1

WO1994006921A1 - Recombinant retroviral vector against felv and/or fiv

Info

Publication number: WO1994006921A1
Application number: PCT/US1993/009070
Authority: WO
Inventors: William T. L. Lee; John J. Serbin; Douglas J. Jolly; Jack R. Barber; Sunil Chada; Stephen M. W. Chang
Original assignee: Viagene, Inc.
Priority date: 1992-09-21
Filing date: 1993-09-21
Publication date: 1994-03-31
Also published as: AU5138293A; CA2142325A1; JPH08501452A; EP0662139A1

Abstract

The present invention provides methods for treating or preventing feline leukemia virus infections comprising, administering to a feline a vector construct which directs the expression of at least one immunogenic portion of a feline leukemia virus antigen, such that a cellular immune response is generated. Also provided are methods and vector constructs for treating or preventing feline immunodeficiency virus infections, either separately or in combination with the above-described methods for treating or preventing feline leukemia virus infections.

Description

RECOMBINANT RETROVIRAL VECTOR AGAINST FELV AND/OR FIV.

Technical Field

The present invention relates generally to methods for treating felines, and more specifically, to methods and compositions for treating feline leukemia virus and feline immunodeficiency virus infections, as well as vaccines for preventing these infections.

Background of the Invention

Feline leukemia virus ("FeLV") and feline immunodeficiency virus ("FIV") are the two most common pathogenic retroviruses reported in feline populations. In a major U.S. study of symptomatic and high-risk domestic cats, it was found that 13% were positive for FeLV antigens, 7% were positive for FTV antibodies, and only 2% were positive for both viruses (see O'Connor et al., JAVMA 99:1348-1359, 1991). Although most studies indicate that FeLV and FIV are acquired independently of each other, it has been reported that FeLV infected cats are 1.5 to 4 times more susceptible to FIV infection than are FeLV-negative cats (see Cohen et al., JAVMA 197:220:225, 1990; Moraillon, Vet Rec. 126:68-69, 1990), and that dually infected cats have a more severe disease course than do cats infected with either virus alone (see Hosie et al., Vet. Rec. 125:293-291, 1989). Responses to FeLV infection can generally be classified into three groups: acute infection, chronic viremia, and immunity. The outcome for any specific animal depends on a variety of viral, host, and environmental factors. In acute infection, FeLV first replicates in the lymphocytes and macrophages of the tonsils, and within 2 to 12 days is carried throughout the cat to the bone marrow, thymus, spleen, intestine, and lymph nodes. If the cat does not mount an adequate immune response, it will develop chronic viremia within 4 to 6 weeks after initial exposure.

Chronic viremia is confirmed when infective FeLV can be recovered from the blood by use of a viral infectivity (VI) assay, by immunofluorescent antibody (IF A) detection of p27 in circulating neutrophils and platelets, or by detection of soluble p27 antigens through an enzyme-linked immunosorbent assay (ELISA) (see Fischinger et al., /. Virol. 74:177-179, 1974; Hardy et al, "Detection of the Feline Leukemia Virus and Other Mammalian Oncornaviruses by Immunofluorescence", Unifying Concepts of Leukemia, Dutcher, and Chieco- Bianchi, (eds.) Karger (pub.), Basal, Switzerland: 778-799, 1973). In this stage, the cat is highly contagious, and excretes large quantities of virus in its saliva and urine. It is also predisposed to death via a FeLV-related disease within months if it is a kitten, or within 2 to 3 years if it is older. Examples of FeLV-related diseases include lymphomas, non-lymphoid leukemias, myeloproliferative disorders, fibrosarcomas, cytosuppresive diseases, and myelosuppresion, anemia and leukopenia syndromes (see Hoover, JAVMA 799:1287-97, 1991). If the cat mounts an effective immune response, it will curtail viral replication and expression within 4 to 8 weeks after initial exposure. However, many cats do not completely eliminate the virus, and harbor a low-grade, latent, nonexpressed, FeLV infection of the bone marrow and lymph nodes for weeks to years. If such a cat is severely stressed, the latent virus may subsequently be reactivated, leading to FeLV-related diseases, and death of the cat.

A cat diagnosed with FeLV infection will generally die within 24 to 36 months. To prevent disease transmission, it has been strongly suggested that FeLV-infected cats be isolated from other cats, regardless of whether or not the other cats have been vaccinated for FeLV. In order to prevent FeLV, a number of vaccines have been developed. More specifically, eight FeLV vaccines have been licensed by the USD A, all of which are based upon an inactivated virus or purified subunit. Most studies suggest that present commercial FeLV vaccines provide only a 60 to 90% efficacy in preventing cats from developing persistent infection (see Pollock et al., JAVMA 799:1406-1409, 1991). All of these vaccines require a second dose and annual boosts to maintain antibody persistance. In addition, one difficulty with present vaccines is, that if the diagnostic test which was utilized to check for previous infection was inaccurate, not available, or too expensive to be utilized, vaccination of an infected animal may take place. Conventional vaccines are not expected to be therapeutic, and therefore, infected animals which are subsequently vaccinated may nevertheless develop FeLV. This has led to the perception by some feline owners that vaccines are either ineffective, or may actually even lead to infection, and therefore are unnecessary.

Clinical management of feline leukemia virus infections has generally been limited to treatment of FeLV-related diseases. In particular, a number of researchers have experimented with therapeutic regimes, including for example, administration of BCG, levamisole, mixed bacterial toxins (see Cotter, Proceedings, 7th Am. Coll. Vet. Int. Med. For., 909-912, 1989, high doses of human alpha interferon, and 3'-azido-3'-deoxythymidine ("AZT') (see Zeidner et al., Antimicrob. Agen. Chemo. 34:1749-1156, 1990). These treatments, however, have met with limited success. Moreover, some of these therapeutics, such as AZT, are additionally accompanied by undesirable side-effects, including for example AZT- related hepatotoxicosis, and inability to eliminate viremia after incorporation of the virus into hematopoietic cells. Thus, there exists a need for effecatious methods and compositions for both treating and preventing FeLV infections, without undesirable side effects. Similar to feline leukemia virus, feline immunodeficiency virus is found worldwide in both pet and stray cats (see Hoise et al., Vet. Rec. 125:293-291, 1989; Ishida et al., Jpn. J. Vet. Set 50:39-44, 1988; Pederson et al., "Prevalence of infection with feline immunodeficiency virus, feline leukemia virus and toxoplasma gondii in feral cat population (Abstract), First International Conference of Feline Immunodeficiency Virus Researchers, University of California, Davis, Calif., Sep. 4-7, 1991). The virus is believed to be transmitted primarily through infected saliva during fighting, (see Wasmien et al., 'Transmission of feline immunodeficiency virus from infected queens to kittens (Abstract), First International Conference, supra), and therefore, cats which are most at risk are stray males over the age of 3 (see Yamamoto et al., JAVMA 194:213-220, 1989). The incidence of feline immunodeficiency virus in these high- risk animals ranges from 6 - 14% in the United States (see August, JAVMA 799:1472-1477, 1991; Macy et al., "The clinical findings and prevalence of FTV and FeLV in Colorado cats (Abstract), First International Conference, supra; O'Connor et al., JAVMA 799:11348-1359, 1991), 18% in Denmark (see Peterson et al. supra), and 44% in Japan (see Ishida et al, Jpn. J. Vet. Sci. 50:39-44, 1988). In addition, vertical transmission from infected queens to kittens has been observed (see Callahan et al, "Natural transmission of FIV in kittens. (Abstract), First International Conference, supra; Wasmoen et al, supra), although the epidemiological significance of this route of infection has yet to be determined. In the general population of low-risk, in-door cats, feline immunodeficiency virus infection is estimated to be 1 - 3 % (see Peterson et al., supra). Unlike the human immunodeficiency virus ("HIV"), feline immunodeficiency virus infection does not seem to be spread by sexual contact (see Gardner and Luciw, FASEB J. 3:2593- 2606, 1989).

Feline immunodeficiency virus induces an immunodeficiency disease in its host by the gradual and persistent depletion of CD4⁺ lymphocytes with no apparent changes in the levels of CD8 ⁺ , CTL, and T suppressor cells (see Ackley et al., /. Virol. 64:5652-5655, 1990). This leads to an inversion of the CD4⁺/CD8⁺ cell ratio which may be measured in order to determine the immunological status of a feline. The course of disease caused by feline immunodeficiency virus is very similar to that caused by HIV. More specifically, in the initial stage of infection, generalized lymphoadenopathy, fever malaise, and leukopenia may be exhibited (see Jarret et al., AIDS 4:S163-S165, 1990). This is followed by a relatively asymptomatic latent stage which does not present clinical signs. The terminal stage, which can take months or years to appear, is usually characterized by a number of chronic infections of a secondary or opportunistic nature. Coinfection with other viral or parasitic agents drastically shortens the second stage latency period, and accelerates the progression of the terminal stage (see Pedersen et al., Science 235:190-193, 1987). Clinical manifestations of this stage include oral cavity infections, chronic upper respiratory infections, chronic enteritis, chronic conjunctivitis, and neurological abnormalities. Feline immunodeficiency virus positive cats also present a high incidence of neoplasms including lymphoma, squamous cell carcinoma, and myelodysplastic disease (see Hutson et al., JAVMA 199:1351-1362, 1991). Three types of tests are currently available to determine if cats are infected with feline immunodeficiency virus. They are the enzyme-linked i munosorbent assay (ELISA), the immunofluorescent antibody (IFA) test, and the immunoblot test, the latter of which is considered to be the standard for methodology comparisons. Generally, as compared to an immunoblot test, an ELISA or IFA can produce results with a sensitivity of 93-95%, and a specificity of 98% (see Barr et a\., JAVMA 799:1377-1381, 1991).

After cats have been diagnosed with the feline immunodeficiency virus, the average survival period is about 24 months. Clinical management of these animals is minimal, but includes isolating them from other cats to help prevent them from developing other life-shortening opportunistic infections (see August et al., supra) as well as to prevent the spread of feline immunodeficiency virus to non-infected cats.

Presently, for research purposes, the anti-retroviral human AIDS drugs AZT and 9-(2-phosphonomethoxyethyl)-adenine (PMEA) have been utihzed in cats with feline immunodeficiency virus. These drugs improve the clinical condition of infected cats by increasing their CD4⁺/CD8⁺ ratio. However, both cause decreased hematocrit and hemoglobin levels which precludes their use as long term therapies (see Hartmann et al, "Use of two virustatica (AZT, PMEA) in the treatment of FIV- and FeLV-seropositive cats with clinical symptoms," (Abstract), First International Conference, supra). In addition, the discovery of AZT-resistant mutants of the feline immunodeficiency virus (see North et al., "Drug resistant mutants of feline immunodeficiency virus isolated in vitro, (Abstract), First International Conference, supra) may further restrict the utility of AZT in feline immunodeficiency virus therapy.

The present invention provides compositions and methods for treating FeLV and FIV, vaccines for preventing FeLV and FIV, and additionally provides other related advantages.

Summary of the Invention

As noted above, the present invention provides methods for preventing or treating feline viral infections. Briefly, within one aspect of the present invention methods of treating or preventing feline leukemia virus infections are provided, comprising, administering to a feline a vector construct which directs the expression of at least one immunogenic portion of a feline leukemia virus antigen, such that a cellular immune response is generated. Within one embodiment of the invention, vector constructs are provided which direct the expression of an antigen selected from the group consisting of pl5gag, pl2gag, p21gag, plOgag, pl4pol, p&Opol, p46pol, gp70env, and p!5env. Within a particularly preferred embodiment, vector constructs are provided which direct the expression of gp85env.

Within another aspect of the present invention, methods of treating or preventing feline immunodeficiency virus infections are provided, comprising, administering to a feline a vector construct which directs the expression of at least one immunogenic portion of a feline immunodeficiency virus antigen, such that a cellular immune response is generated. Within one embodiment, vector constructs are provided which direct the expression of an antigen selected from the group consisting of pl5gag, p24gag, plOgag, pl3pol, p62pol, pl5pol and p36po/. Within a particularly preferred embodiment, vector constructs are provided with direct the expression of gp68em>, gp27env and rev.

Within another aspect of the present invention, methods of treating or preventing feline leukemia virus and feline immunodeficiency virus infections are provided, comprising, administering to a feline a vector construct which directs the co-expression of at least one immunogenic portion of a feline leukemia virus antigen, and at least one immunogenic portion of a feline immunodeficiency virus antigen, such that a cellular immune response is to said viruses is generated.

Also provided within the present invention are vector constructs which direct the expression of at least one immunogenic portion of a feline leukemia virus, vector constructs which direct the expression of at least one immunogenic portion of a feline immunodeficiency virus, and vector constructs which direct the co-expression of at least one immunogenic portion of a feline immunodeficiency virus, and at least one immunogenic portion of a feline leukemia virus. Within various embodiments, the above-described vector constructs are carried by recombinant retroviruses, or by a recombinant virus selected from the group consisting of poliovirus, rhinovirus, pox virus (e.g., the canary pox virus or the vaccinia virus), influenza virus, adenovirus, parvovirus (e.g., the adeno- associated virus B19 or MVN), herpes virus, SV40, HIV, measles, and alpha viruses such as the Sindbis virus. Also provided are target cells infected with the above-described viruses.

Within yet another embodiment of the invention, pharmaceutical compositions are provided, comprising the above described recombinant retroviral or recombinant viral constructs, in combination with a pharmaceutically acceptable carrier or diluent.

These and other aspects of the present invention will become evident upon reference to the following detailed description and attached drawing. In addition, all references which have been cited below are hereby incorporated by reference in their entirety.

Brief Description of the Drawings

Figure 1 is a schematic illustration of the construction of a multivalent FIV - FeLV, retroviral vector.

Detailed Description of the Invention

Prior to setting forth the invention, it may be helpful to an understanding thereof to first set forth definitions of certain terms that will be used hereinafter.

"Immunogenic portion" as utilized within the present invention, refers to a portion of the respective antigen which is capable, under the appropriate conditions, of causing a cellular (Le., cell-mediated or humoral) immune response. "Portions" may be of variable size, but generally should be at least 9 amino acids long, and may include the entire antigen. Representative assays which may be utilized to determine immunogenicity (e.g., cell-mediated immune response), are described in more detail below, as well as in Example 10A. Cellular immune responses may be mediated through Major Histocompatibility ("MHC") Class I presentation, MHC Class II presentation, or both.

"Vector construct" refers to an assembly which is capable of directing the expression of the sequence(s) or gene(s) of interest. The vector construct must include promoter element(s), as well as at least one sequence which, when transcribed, is operably linked to the sequence(s) or gene(s) of interest and acts as a translation initiation sequence. Optionally, the vector construct may also include a selectable marker such as Neo, SV2 Neo, TK, hygromycin, phleomycin, histidinol, or DHFR, a signal which directs polyadenylation, a translation termination sequence, and one or more restriction sites. In addition, if the vector construct is placed into a retrovirus* the vector construct must include a packaging signal and long terminal repeats (LTRs) appropriate to the retrovirus used (if these are not already present).

As noted above, the present invention is generally directed towards compositions and methods for treating, as well as vaccines for preventing, various feline diseases, including for example feline leukemia virus and feline immunodeficiency virus infections. Briefly, the ability to recognize and defend against foreign pathogens is central to the function of the immune system. This system, through immune recognition, is capable of distinguishing "self' from "nonself (foreign), and is essential to ensure that defensive mechanisms are directed towards invading entities rather than against host tissues. The fundamental features of the immune system are highly polymorphic cell surface recognition structures (receptors), and effector mechanisms (antibodies and cytolytic cells), which act to destroy invading pathogens.

One cell type of particular importance in immune recognition is the Cytotoxic T Lymphocyte ("CTL"), which is primarily restricted in recognition to antigens which have been processed in association with MHC class I products. Briefly, CTLs are normally induced by the display of processed pathogen-specific peptides in conjunction with MHC molecules along with molecules such as CD3, ICAM-1, ICAM-2, LFA-1, LFA-3, 3-microglobulin, chaperones, and analogs thereof (e.g., Altmann et al., Nature 338:512, 1989). Other genes coding for proteins that enhance the stimulation or recognition of cell mediated responses may also be used in this context. Antigenic peptide presentation in association with MHC Class I molecules leads to CD8⁺ CTL production. Peptides presented in association with MHC Class II molecules leads to production of antibodies, helper cells and B-cell memory, and may induce CD4⁺ CTLs. The methods which are described in greater detail below provide an effective means of inducing potent class I-restricted protective and therapeutic CTL responses, as well as humoral responses.

As noted above, within one aspect of the present invention methods for treating or preventing feline leukemia virus infections are provided, comprising administering to a feline a vector construct which directs the expression of at least one immunogenic portion of a feline leukemia virus antigen, such that a cellular immune response is generated.

Briefly, feline leukemia virus (FeLV) is a retrovirus of the oncornavirus subfamily. FeLV is presently believed to exist in three subgroups - A, B or C - which are differentiated by their envelope antigens gp70 and pl5E. FeLV is also comprised of a number of core antigens, including pl5, pl2, p27, and plO, which are highly conserved for all subgroups of FeLV (see Geering et al., Vir. 56:678-680, 1968; Hardy et al., JAVMA 755:1060-1069, 1971; Hardy et al., Science 766:1019-1021, 1969). As noted above, within one embodiment of the invention, vector constructs are provided which direct the expression of at least one portion of a feline leukemia virus antigen selected from the group consisting of pl5gag, pl2gag, p21gag, plOgag, pl4pol, p80pol, p46pol, gplOenv, and pl5env. Within a particularly preferred embodiment, vector constructs are provided which direct the expression of gp85eπv. Sequences which encode these antigens may be readily obtained given the disclosure provided herein (see Donahue et al., /. Vir. 62(3):722-731, 1988; Stewart et al., /. Vir. 55(3):825-834, 1986; Kumar et al., /. Vir. 63(5):2319-2384, 1989; Elder et al., /. Vir. 46(3):871-880, 1983; Berry et al., /. Vir. 62(10):3631-3641, 1988; Laprevotte et al.,/. Vir. 50(3):884-894, 1984).

Within another aspect of the present invention, a method for treating or preventing feline immunodeficiency virus infections is provided, comprising administering to a feline a vector construct which directs the expression of at least one immunogenic portion of a feline immunodeficiency virus antigen, such that a cellular immune response is generated.

Briefly, feline immunodeficiency virus (FIV) has been classified as a retrovirus of the lentivirus subfamily, based upon the magnesium requirement for reverse transcriptase (RT) and the morphology of viral particles (see Pederesen et al., Science 235:190-193, 1987). The feline immunodeficiency virus is morphologically and antigenically distinct from other feline retroviruses, including feline leukemia virus, type C oncorna virus (RD-114), and feline syncytium- forming virus (FeSFV) (see Yamamoto et al., "Efficacy of experimental FIV vaccines, (Abstract), First International Conference of Feline Immunodeficiency Virus Researchers, University of California, Davis, CA, Sep. 4-7, 1991). As noted above, within one embodiment of the invention, vector constructs are provided which direct the expression of at least one immunogenic portion of an feline immunodeficiency virus antigen selected from the group consisting of pl5gag, p24gag, plOgag, pl3pol, p62pol, p!5pol and p36po/. Within a particularly preferred embodiment, vector constructs are provided which direct the expression of ~p68env, gp21env and rev. Within the context of the present invention, "rev" is understood to refer to the antigen corresponding to the rev open reading frame (see, Phillips et al., First International Conference, supra). Sequences which encode these antigens may be readily obtained by one of skill in the art given the disclosure provided herein (see Phillips et al., /. Vir. 6 (10):4605-4613, 1990; Olmsted et al., PNAS 56:2448-2452, 1989; Talbott et al., PNAS 86:5143-5141, 1989).

Sequences which encode the above-described feline leukemia virus and feline immunodeficiency virus antigens may be prepared as described within the references cited above, or obtained from a variety of sources. For example, sequences which encode the envelope protein of FeLV may be readily obtained from the American Type Culture Collection ("ATCC"; Rockville, Maryland) (see for example, ATCC Nos. 39528, 39529, and 39530). Similarly, the AIDS Repository (Division of AIDS, National Institute of Allergy and Infections Disease, Bethesda, Maryland; see NIH Publication No. N2-1536) holds a deposit of a plasmid clone which contains a sequence encoding a full-length, replication competent FeLV (e.g., clone p61E-FeLV, Catalog No. 109), as well as a deposit of a plasmid clone which contains a sequence encoding a feline immunodeficiency virus (e.g., clone pFIV-14-Petaluma, Catalog No. 851).

Alternatively, sequences which encode the above-described feline viral antigens may be readily obtained from cells which express or contain sequences which encode these viruses (e.g., from cats which have been infected with FeLV or FIV). Briefly, within one embodiment, primers are prepared on either side of the desired sequence, which is subsequently amplified by polymerase chain reaction ("PCR") (see U.S. Patent Nos. 4,683,202, 4,683,195 and 4,800,159) (see also, PCR Technology: Principles and Applications for DNA Amplification, Erlich (ed.), Stockton Press, 1989). In particular, a double stranded DNA is denatured by heating in the presence of heat stable Taq polymerase, sequence specific DNA primers, ATP, CTP, GTP and TTP. Double-stranded DNA is produced when synthesis is complete. This cycle may be repeated many times, resulting in a factorial amplification of the desired DNA.

Sequences which encode the above-described feline viral antigens may also be synthesized, for example, on an Applied Biosystems Inc. DNA synthesizer (e.g., ABI DNA synthesizer model 392 (Foster City, California)). Such sequences may also be linked together through complementary ends, followed by PCR amplification, in order to form long double-stranded DNA molecules.

As noted above, at least one immunogenic portion of a feline viral antigen, including for example, a feline leukemia virus antigen, a feline immunodeficiency virus antigen, any of the feline viral antigens which are described in greater detail below, or any combination of these antigens, is incorporated into a vector construct. The immunogenic portion(s) which are incorporated into the vector construct may be of varying length, although it is generally preferred that the portions be at least 9 amino acids * long, and preferably, include the entire antigen. Immunogenicity of a particular sequence is often difficult to predict, although T cell epitopes may be predicted utilizing computer algorithms such as TSites (Medlmmune, Maryland), in order to scan coding regions of FeLV gag, env, FIV gag, env and rev for potential T-helper sites and CTL sites. This analysis is primarily based upon 1) structural properties of the proteins (principally alpha-helical periodicity and amphipathicity), and 2) motifs found in sequences recognized by MHC Class I and Class II molecules. In general however, it is preferable to determine immunogenicity in an assay. Representative assays include an ELISA which detects the presence of antibodies against a newly introduced vector, as well as assays which test for T helper cells, such as gamma-interferon assays, IL-2 production assays, and proliferation assays. A particularly preferred assay is described in more detail below in Example 10A.

Immunogenic proteins of the present invention may also be manipulated by a variety of methods known in the art, in order to render them more immunogenic. Representative examples of such methods include: adding amino acid sequences that correspond to T helper epitopes; promoting cellular uptake by adding hydrophobic residues; by forming paniculate structures; or any combination of these (see generally, Hart, op. cit., Milich et al., Proc. Natl Acad. Set USA 55:1610-1614, 1988; Willis, Nature 340:323-324, 1989; Griffiths et al., /. Virol 65:450-456, 1991).

Particularly preferred immunogenic portions for incorporation into a vector construct include, for feline leukemia virus the gp85env antigen, and for feline immunodeficiency virus the gp68env, gp27env, and rev antigens. Within a particularly preferred embodiment of the invention, a vector construct is provided which expresses both FeLV and FIV envelope antigens (gp85e«v; and gp68tvzv, gp27βnv, and rev, respectively) or both FeLV and FIV gag antigens (pl5gαg, p!2gag, p21gag, plOgag, and pUpol; and pl5gαj , p24gag, plOgag, and rev, respectively).

In addition, as noted above more than one immunogenic portion may be incorporated into a vector construct. More specifically, within one embodiment of the invention, multivalent vector constructs are provided which may be utilized for more than one disease. For example, a vector construct may express (either separately or as one construct) all or portions of a feline leukemia virus antigen, a feline immunodeficiency virus antigen, as well as antigens which are associated with other feline diseases. Representative examples of such antigens include VP1 and VP2 for feline panleukopenia virus (see Martyn et al., "Nucleotide sequence of feline panleukopenia virus: comparison with canine parvovirus identifies host-specific differences", /. Gen. Vir. 77:2747-2753, 1990; Parrish, "Mapping Specific Functions in the Capsid Structure of Canine Parvovirus and Feline Panleukopenia Virus Using Infectious Plasmid Clones", Vir. 183:195- 205, 1991); the capsid protein of Feline Calicivirus (see Neill et al., "Nucleotide Sequence and Expression of the Capsid Protein Gene of Feline Calicivirus", /. Vir. 65(10):5440-5447, 1991; Tohya et al., "Sequence Analysis of the 3' end of Feline Calicivirus Genome", Vir. 755:810-814, 1991; Carter et al., "Monoclonal antibodies to Feline Calicivirus", /. Gen. Vir. 70:2191-2200, 1989); the "N" or nucleoprotein of the Rabies virus (see Ertl et al., "Induction of Rabies Virus-Specific T-Helper Cells by Synthetic Peptides that carry dominant T-Helper Cell Epitopes of the Viral Ribonucleoprotein", /. Vir. 63 (l):2885-2892, 1989); and the surface glycoprotein of Feline Herpesvirus (see Nunberg et al., "Identification of the Thymidine Kinase Gene of Feline Herpesvirus: Use of Degenerate Oligonucleotides in the Polymerase Chain Reaction to Isolate Herpesvirus Gene Homologs",/. Vir. 65(8):3240-3249, 1989).

Within a further embodiment of the present invention, one or more of the above-described immunogenic portions may be co-expressed with an immunomodulatory cofactor. Briefly, as utilized within the context of the present invention, an "immunomodulatory cofactor" refers to factors which, when manufactured by one or more of the cells involved in an immune response, or, which when added exogenously to the cells, causes the immune response to be different in quality or potency from that which would have occurred in the absence of the cofactor. The quality or potency of a response may be measured by a variety of assays known to one of skill in the art, including for example, in vitro assays which measure cellular proliferation (e.g., ³H thymidine uptake), and in vitro cytotoxic assays (e.g., which measure ⁵¹Cr release) (see Warner et al., AIDS Res. and Human Retroviruses 7:645-655, 1991). Immunomodulatory cofactors may be active both in vivo and ex vivo. Representative examples of such cofactors include alpha interferons (Finter et al., Drugs 42(5):149-165, 1991; U.S. Patent No. 4,892,743; U.S. Patent No. 4,966,843; WO 85/02862; Nagata et al., Nature 284:316- 320, 1980; Familletti et al., Methods in Enz. 75:387-394, 1981; Twu et al., Proc. Natl Acad. Set USA 56:2046-2050, 1989; Faktor et al., Oncogene 5:867-872, 1990), beta interferons (Seif et al., /. Virology 65:664-671, 1991), gamma interferons (Radford et al., The American Society of Hepatology 20082015, 1991; Watanabe et al., PNAS 56:9456-9460, 1989; Gansbacher et al., Cancer Research 50:1820-1825, 1990; Maio et al., Can. Immunol Immunother. 30:34-42, 1989; U.S. Patent No. 4,762,791; U.S. Patent No. 4,727,138), GCSF (U.S. Patent Nos. 4,999,291 and 4,810,643), GMCSF (WO 85/04188), TNFs (Jayaraman et al., /. Immunology 144:942-951, 1990), Interleukin 2 ("IL-2") (Karupiah et al., /. Immunology 144:290- 298, 1990; Weber et al., /. Exp. Med. 166:1116-1133, 1987; Gansbacher et al., /. Exp. Med. 172:1211-1224, 1990; U.S. Patent No. 4,738,927), Interleukin-4 ("IL-4") (Tepper et al., Cell 57:503-512, 1989; Golumbek et al., Science 254:113-116, 1991; U.S. Patent No. 5,017,691), Interleukin-6 ("IL-6") (Brakenhof et al., /. Immunol 759:4116-4121, 1987; WO 90/06370), ICAM-1 (Altaian et al., Nature 555:512-514, 1989), ICAM-2, LFA-1, LFA-3, MHC class I molecules, MHC class II molecules, ø-microglobulin, chaperones, CD3, or analogs thereof. Sequences which encode the above-described immunomodulatory cofactors may be readily obtained from a variety of sources, including for example, the American Type Culture Collection (ATCC, Rockville, Maryland), or from commercial sources such as British Bio-technology Limited (Cowley, Oxford England). Representative examples include BBG 12 (containing the GM-CSF gene coding for the mature protein of 127 amino acids), BBG 6 (which contains sequences encoding gamma interferon), ATCC No. 39656 (which contains sequences encoding TNF), ATCC No. 20663 (which contains sequences encoding alpha interferon), ATCC Nos. 31902, 31902 and 39517 (which contains sequences encoding beta interferon), ATCC Nos. 39405, 39452, 39516, 39626 and 39673 (which contains sequences encoding Interleukin-2), ATCC No. 57592 (which contains sequences encoding Interleukin-4), and ATCC 67153 (which contains sequences encoding Interleukin-6). The choice of which immunomodulatory cofactor to include within a vector construct may be based upon known therapeutic effects of the cofactor, or determined experimentally. For example, blood samples may be taken from a feline with a particular disease, for use in CTL assays. Briefly, peripheral blood lymphocytes (PBLs) are separated from the blood, and stimulated in vitro with concanavalin A, Interleukin-2, bovine T-cell growth factor, and autologous irradiated cells, followed by transduction with the above-described recombinant retroviruses which direct the expression of an immunogenic portion of an antigen which is associated with the above described diseases, and an immunomodulatory cofactor. Stimulated PBLs are used as effectors in a CTL assay with the autologous transduced cells as both restimulators and targets. An increase in CTL response over that seen in the same assay performed using autologous stimulator and target cells transduced with a vector encoding the antigen alone, indicates a useful immunomodulatory cofactor. Once the immunogenic portion(s) discussed above ■- have been selected, genes which encode these proteins are placed into a vector construct which directs their expression. In general, such retroviral vectors encode only these genes, and no selectable marker. Vectors encoding and leading to expression of a specific antigen(s) may be readily constructed by those skilled in the art. In particular, construction of vector constructs as well as administration of retroviral constructs by direct injection is described in greater detail in an application entitled "Recombinant Retroviruses" (U.S.S.N. 07/586,603, filed September 21, 1990), which is herein incorporated by reference in its entirety. These vector constructs may be used to generate transduction competent retroviral vector particles by introducing them into appropriate packaging cell lines (see U.S.S.N. 07/800,921).

Within a particularly preferred embodiment, vector constructs may be constructed to include a promoter such as SV40 (see Kriegler et al., Cell 35:483, 1984), cytomegalovirus ("CMV") (see Boshart et al., Cell 47:521-530, 1991), or an Internal Ribosomal Binding Site ("IRBS"). Briefly, with respect to IRBS, the five prime untranslated region of the immunoglobulin heavy chain binding protein has been shown to support the internal engagement of a bicistronic message (see Jacejak and Sarnow, Nature 353:90-94, 1991). This sequence is small (300 bp), and may readily be incorporated into a retoviral vector in order to express multiple genes from a multi-cistronic message whose cistrons begin with this sequence. A representative vector construct utilizing IRBS is set forth in more detail below in Example 4. In addition, vector constructs may also be developed and utilized with other viral carriers including, for example, poliovirus (Evans et al, Nature 339:385-388, 1989, and Sabin, J. of Biol. Standardization 7:115-118, 1973); rhinovirus (Arnold, /. Cell Biochem. L401-405, 1990); pox viruses, such as canary pox virus or vaccinia virus (Fisher-Hoch et al., PNAS 56:317-321, 1989; Flexner et <ύ., Ann. N.Y. Acad. Sc 569:86-103, 1989; Flexner et al., Vaccine 5:17-21, 1990; U.S. Patent Nos. 4,603,112 and 4,769,330; WO 89/01973); SV40 (Mulligan et al., Nature 277:108-114, 1979); influenza virus (Luytjes et al., Cell 59:1107-1113, 1989; McMicheal et al., The New England Journal of Medicine 309:13-11, 1983; and Yap et al., Nature 273:238-239, 1978); adenovirus (Berkner, Biotechniques 6:616-627, 1988, and Rosenfeld et al., Science 252:431-434, 1991); parvovirus such as adeno- associated virus (Samulski et al., Journal of Virology 63:3822-3828, 1989, and Mendelson et al., Virology 766:154-165, 1988); herpes (Kit, Adv. Exp. Med. Biol 215:219-236, 1989); SV40; HIV; measles (EP 0 440,219); and Sindbis virus (Xiong et al., Science 234:1188-1191, 1989). Furthermore, viral carriers may be homologous, non-pathogenic (defective), replication competent virus (e.g., Overbaugh et al., Science 239:906-910, 1988), and yet induce cellular immune responses, including CTL.

Once the above-described vector constructs have been constructed, they may be tested for tumorigenicity prior to administration to felines, for example, by determining the extent of tumor formation in nude mice, or by evaluating colony formation in soft agar. Briefly, tumor formation in nude mice is a particularly important and sensitive method for determining tumorigenicity. Nude mice lack a functional cellular immune system, do not possess mature T- cells, and therefore provide a useful in vivo model in which to test the tumorigenic potential of cells. Normal non-tumorigenic cells do not display uncontrolled growth properties if injected into nude mice. However, transformed cells will rapidly proliferate and generate tumors in nude mice. In one embodiment the vector construct is administered by injection into nude mice. The mice are visually examined for a period of 4 to 16 weeks after injection in order to determine tumor growth. The mice may also be sacrificed and autopsied in order to determine whether tumors are present. (Giovanella et al., /. Natl Cancer Inst. 45:1531-1533, 1972; Furesz et al., 'Tumorigenicity testing of cell lines considered for production of biological drugs," Abnormal Cells, New Products and Risk, Hopps and Petricciani (eds.), Tissue Culture Association, 1985; and Levenbook et al., /. Biol Std. 73:135-141, 1985). Tumorigenicity may also be assessed by visualizing colony formation in soft agar (MacPherson and Montagnier, Vir. 23:291-294, 1964). Briefly, one property of normal non-tumorigenic cells is anchorage-dependent growth. More specifically, normal non-tumorigenic cells will stop proliferating when they are plated in a semi-solid agar medium, whereas tumorigenic cells will continue to proliferate and form colonies in soft agar.

Once a vector construct has been prepared, it may also be administered to a feline in order to treat the above-described feline diseases. Similarly, the vector construct may be administered prophylactically, in order to prevent the above-described feline diseases. Methods for administering a vector construct via a retroviral vector (such as by direct injection of the retroviral construct) are described in greater detail in an application entitled "Recombinant Retroviruses" (U.S.S.N. 07/586,603).

Within another aspect of the present invention, methods are provided for treating or preventing a feline disease, comprising the steps of (a) removing cells from a feline, (b) administering to the removed cells a vector construct which directs the expression of at least one immunogenic portion of a feline leukemia virus antigen, a feline immunodeficiency virus antigen, or both, and (c) returning the cells to a feline, such that a cellular immune response is generated. Within the context of the present invention, it should be understood that the removed cells need not necessarily be returned to the same feline, but may be utilized within other cats as well. In such a case it is generally preferable to have histocompatibility matched felines (although not always, see e.g.,

Yamamoto et al., "Efficacy of Experimental FIV Vaccines," First International Conference of FIV Researchers, University of California at Davis, September

1991).

Cells may be removed from a variety of locations, including for example from the skin (dermal fibroblasts) and the blood (peripheral blood leukocytes). If desired, particular fractions of cells such as a T cell subset or stem cells may also be removed from the blood for administration of the vector construct (e.g., PCT WO 91/16116, an application entitled "Immunoselection Device and Method"). Vector constructs may then be administered to the removed cells utilizing any of the above-described techniques, followed by the return of the cells to the feline. Within another aspect of the present invention, a vector construct is provided which directs the expression of an immunogenic portion as described above, and directs the expression of a prodrug activator. For example, within one embodiment, genes for an immunogenic portion and a prodrug activator, such as Herpes Simplex Virus Thymidine Kinase (HSVTK), are incorporated into a vector construct. This vector construct is then administered to cells, which can then be eliminated by administration of an exogenous substance, such as acyclovir, which kills cells that express the HSVTK. As one of ordinary skill in the art will readily appreciate, this vector construct may be utilized to ensure that even if the delivered genes contribute to a tumorigenic event in cells which have taken up the vector, these cells can be killed by, for example, exogenous application of acyclovir. In addition to the recombinant viral vectors discussed above, other methods may also be utilized to administer vector constructs of the present invention, or nucleic acids which encode the immunogenic portion(s) discussed above, to felines, or to feline cells ex vivo. Such methods include, for example, transfection by methods utilizing various physical methods, such as lipofection (Feigner et al., Proc. Natl Acad. Scl USA 54:7413-7417, 1989), direct DNA injection (Acsadi et al., Nature 352:815-818, 1991); microprojectile bombardment (Williams et al., PNAS 55:2726-2730, 1991); liposomes (Wang et al., PNAS 54:7851-7855, 1987); CaP0₄ (Dubensky et al., PNAS 57:7529-7533, 1984); or DNA ligand (Wu et al,/. of Biol Chem. 264:16985-16981, 1989). Furthermore, a cellular response (including CTL) may also be generated by administration of a bacteria which expresses the immunogenic portion(s) discussed above. Representative examples include BCG (Stover, Nature 357:456-458, 1991), salmonella (Newton et al., Science 244:10-12, 1989), and Listeria (Schafer et al.,/. Imm. 149:53-59, 1992). Cell mediated and humoral responses may also be induced against feline leukemia virus or feline immunodeficiency virus, by administration of the immunogenic portion(s) discussed above. Briefly, immunogenic portions carrying relevant epitopes can be produced in a number of known ways (Ellis and Gerety, /. Med. Virol 37:54-58, 1990), including chemical synthesis (Bergot et al., Applied Biosystems Peptide Synthesizer User Bulletin No. 16, 1986, Applied Biosystems, Foster City California) and DNA expression in recombinant systems, such as the insect-derived baculovirus system (Doerfler, Current Topics in Immunology 737:51- 68, 1986), mammalian-derived systems (such as CHO cells) (Berman et al., /. Virol 63:3489-3498, 1989), yeast-derived systems (McAleer et al., Nature 307: 178-180), and prokaryotic systems (Burrel et al., Nature 279:43-41, 1979).

The immunogenic proteins or peptides of the present invention may also be purified by conventional means, and delivered by a number of methods in order to induce cell-mediated responses, including class I and class II responses. These methods include the use of adjuvants of various types, such as ISCOMS (Morein, Immunology Letters 25:281-284, 1990; Takahashi et al, Nature 344:813- 875, 1990), squalene/Tween-80/pluronic L121 (Monow et al., Poster #32, "Advances in AIDS Vaccine Development, Proceedings of the Fifth Annual Meeting of the National Cooperative Vaccine Dev. Group for AIDS", Aug, 1992), saponin (Wu, Poster #16, Advances, supra), proteoliposomes (Letvin, "Vaccination of Rhesus monkeys with synthetic peptide in a fusogenic proteoliposome elicits FIV specific CD8 ⁺ cytotoxic T-lymphocytes" "Proceedings, supra), liposomes (Gergoriadis et al., Vaccine 5:145-151, 1987), lipid conjugation (Deres et al., Nature 342:561-564, 1989), coating of the peptide on autologous cells (Staerz et al., Nature 329:449-451, 1987), pinosomes (Moore et al., Cell 54:111-185, 1988), alum, complete or incomplete Freund's adjuvants (Hart et al., Proc. Natl Acad. Set USA 55:9448-9452, 1991), or various other useful adjuvants (e.g., Allison and Byars, Vaccines 57:56-59, Cold Spring Harbor Laboratory, 1987)^,nhat allow effective parenteral administration.

Alternatively, the proteins or peptides conesponding to the immunogenic portion(s) discussed above, can be encapsidated for oral or rectal administration to elicit an immune response in enteric capsules (Channock et al., /. Amer. Med. Assoc. 795:445-452, 1966), or other suitable carriers, such as poly (DL-lactide-co-glycolate) spheres (Eldridge et al. in Proceedings of the International Conference on Advances in AIDS Vaccine Development, DAIDS, NIAID, U.S. Dept of Health & Human Services, 1991), for gastrointestinal release. Within a further aspect of the present invention, pharmaceutical compositions are provided comprising one of the above described recombinant viruses, such as a recombinant retrovirus or recombinant virus selected from the group consisting of poliovirus, rhinovirus, pox virus, canary pox virus, vaccinia virus, influenza virus, adenovirus, parvovirus, adeno-associated virus herpes virus, SV40, HIV, measles and Sindbis virus, in combination with a pharmaceutically acceptable carrier or diluent. The composition may be prepared either as a liquid solution, or as a solid form (e.g., lyophilized) which is suspended in a solution prior to administration. In addition, the composition may be prepared with suitable carriers or diluents for either injection, oral, or rectal administration. Generally, the recombinant virus is utilized at a concentration ranging from 0.25% to 25%, and preferably about 5% to 20% before formulation. Subsequently, after preparation of the composition, the recombinant virus will constitute about 1 ug of material per dose, with about 10 times this amount material (10 ug) as copurified contaminants. Preferably, the composition is prepared in 0.1-1.0 ml of aqueous solution formulated as described below. In addition, the composition may contain an adjuvant such as, for example, aluminum hydroxide, saponin, and squalene. Pharmaceutically acceptable carriers or diluents are nontoxic to recipients at the dosages and concentrations employed. Representative examples of carriers or diluents for injectable solutions include water, isotonic saline solutions which are preferably buffered at a physiological pH (such as phosphate- buffered saline or Tris-buffered saline), mannitol, dextrose, glycerol, and ethanol, as well as polypeptides or proteins such as feline serum albumin. A particularly prefened composition comprises a vector or recombinant virus in 10 mg/ml mannitol, 1 mg/ml feline serum albumin, 20mM Tris pH=7.2 and 150mM NaCl. In this case, since the recombinant vector represents approximately 1 μg of material, it may be less than 1% of high molecular weight material, and less than 1/100,000 of the total material (including water). This composition is^stable at - 70°C for at least six months. The composition may be injected intravenously (i.v.) or subcutaneously (s.c), although it is generally preferable to inject it intramuscularly (i.m.), or by aerosol administration intranasally. These are administered at one to four week intervals for three or four doses initially. Subsequent booster shots may be given as one or two doses after 6-12 months, and thereafter annually.

Oral formulations may also be employed with carriers or diluents such as cellulose, lactose, mannitol, poly (DL-lactide-co-glycolate) spheres, and/or carbohydrates such as starch. The composition may take the form of, for example, a tablet, gel capsule, pill, solution, or suspension, and additionally may be formulated for sustained release. For rectal administration, preparation of a suppository may be accomplished with traditional carriers such as polyalkalene glucose, or a triglyceride.

The following examples are offered by way of illustration and not by way of limitation. EXAMPLES

EXAMPLE 1

A. Preparation of Retroviral Backbone KT-3

The Moloney murine leukemia virus (MoMLV) 5' long terminal repeat (LTR) EcoR I-EcoR I fragment, including gag sequences, from the N2 vector (Armentano et al., /. Vir. 67:1647-1650, 1987; Eglitas et al., Science 230:1395-1398, 1985) is ligated into the plasmid SK+ (Stratagene, Calif.). The resulting construct is designated N2R5. The N2R5 construct is mutated by site- directed in vitro mutagenesis to change the ATG start codon to ATT preventing gag expression. This mutagenized fragment is 200 base pairs (bp) in length and flanked by Pst I restriction sites. The Pst I-Pst I mutated fragment is purified from the SK+ plasmid and inserted into the Pst I site of N2 MoMLV 5' LTR: in plasmid pUC31 to replace the non-mutated 200 bp fragment. The plasmid pUC31 is derived from pUC19 (Stratagene, Calif.) in which additional restriction sites Xho I, Bgl II, BssH II and Neo I are inserted between the EcoR I and Sac I sites of the polylinker. This construct is designated pUC31/N2R5gM. _v A 1.0 Kilobase (Kb) MoMLV 3' LTR EcoR I-EcoR I fragment from

N2 is cloned into plasmid SK+ resulting in a construct designated N2R3-. A 1.0 Kb Cla I-Hind HI fragment is purified from this construct.

The Cla I-Cla I dominant selectable marker gene fragment from pAFVXM retroviral vector (Kriegler et al., Cell 38:483, 1984; St. Louis et al., PNAS 55:3150-3154, 1988), comprising a SV40 early promoter driving expression of the neomycin phosphotransf erase gene, is cloned into the SK+ plasmid. A 1.3 Kb Cla I-BstB I gene fragment is purified from the SK+ plasmid.

The expression vector is constructed by a three part ligation in which the Xho I-Cla I fragment containing the gene of interest and the 1.0 Kb MoMLV 3' LTR Cla I-Hind III fragment are inserted into the Xho I-Hind III site of pUC31/N2R5gM plasmid. The 1.3 Kb Cla I-BstB I neo gene fragment from the pAFVXM retroviral vector is then inserted into the Cla I site of this plasmid in the sense orientation. B. Preparation of Retroviral Backbone KT-1

The KT-1 retroviral backbone vector is constructed essentially as described for KT-3 in Example 1 A, with the exception that the dominant selectable marker gene, neo, is not inserted into the expression vector.

EXAMPLE 2

PREPARATION OF SEQUENCES UTILIZING PCR

A. PCR of the FeLV gag/prot gene

In order to obtain the FeLV gag/prot gene, a plasmid containing a FeLV sequence (p61E-FeLV) is obtained from the NIH Research and Reference

Reagent Program, Maryland. A reaction mixture is then prepared according to procedures specified by Perkin Elmer Cetus (Emeryville, Calif.). More specifically, a reaction mixture is prepared containing 1 μg purified plasmid, 10 μl of 10X PCR reaction buffer, 2 μl 2.5 mM of each dATP, dCTP, dGTP, and dTTP, 0.5 2.5 units/lOO μl Taq polymerase, 10 μl of 10 mM MgCl2, and 0.5-1.0 ug of the primiers specificied below (Sequence ID No. 1 and Sequence ID No. 2).

The sense primer sequence is from the 5' region of the FeLV gag/prot gene upstream from the ATG start codon at position 609 of the FGA provirus. The 5' end of the primer contains two consecutive Xho I restriction sites.:

(Sequence ID No. 1)

5'-3': CC CTC GAG CTC GAG GGC GGT GGG ATC GAA GGA GCT GAC

G

The anti-sense primer sequence is complementary to a sequence at position 2800 of the FGA provirus and contains two consecutive stop codons in frame with FeLV gag/prot gene. The 5' end of the primer contains two consecutive

Cla I restriction sites.:

(Sequence ID No. 2)

5'-3': CC ATC GAT ATC GAT CTA TCA TGG CTC AAA TAG CCG ATA CTC TTC TTC The reaction mixture is the brought to 100 μl with DI H2O, and each tube is placed into a PCR machine (Gene Amp PCR System 9600, Perkin- Elmer, Cetus, Calif.). The PCR program regulates the temperature of the reaction vessel first at 94°C for 2 minutes, next at 56°C for 30 seconds, 72°C for 30 seconds, and finally, 94°C for 30 seconds. This cycle is repeated 35 times. After the 35th cycle, the reactions are held at 4°C.

B. Isolation of PCR DNA

The PCR reaction is transfened into a 1.5 ml microfuge tube, and

50 μl of 3 M sodium acetate is added. Next, 500 μl of chlorofoπn:isoamyl alcohol (24:1) is added to the solution, which is vortexed and then spun for 5 minutes. The upper aqueous phase is transfened to a fresh microfuge tube and 1 ml 100% EtOH is added. The solution is incubated at -20°C for 4.5 hours, and then spun for 20 minutes. The supernatant is decanted, and the pellet rinsed with 500 μl 70% EtOH. The pellet is dried by spinning under a vacuum, and then resuspended in 10 μl H2O.

EXAMPLE 3

CONSTRUCTION OF RETROVIRAL VECTORS

A. Construction of FeLV env Retroviral Vector

The 2.0 Kb Pst I fragment from FeLV-A-Gardner-Arnstein [FGA] provirus (Donahue et al., /. Vir. 62:122-131, 1988) is subcloned into the Pst I site of the psp72 vector (Promega Biotech, Wise). Subclones containing FeLV env in the sense orientation with respect to the 5' Xho I and 3' Cla I sites are selected by restriction enzyme analysis. This construct is designated psp72 FeLV env. The Xho I-Cla I fragment is then excised and inserted into the KT-3 backbone.

B. Construction of FeLV zag/prot Retroviral Vector

DNA encoding the FeLV gag/prot gene is prepared as described above in Example 2, and placed into the Xho I and Cla I sites of the pBluescript KS 11+ plasmid (Stratagene, Calif.) and verified by DNA sequencing. This construct is designated pBluescript KS 11+ FeLV gag/prot. The Xho I-Cla I fragment is then excised and inserted into the KT-3 backbone.

C. Construction of FIV env/rev/RRE Retroviral Vector

Sequences encoding the FIV env/rev/RRE gene are amplified and isolated from plasmid pFIV-14-Petaluma (NIH Research and Reference Reagent

Program, Maryland), essentially as described in Example 2 above, using the following primers: The sense primer sequence has two consecutive Xho I restriction sites that are placed at the 5' end at position 6020 of clone 34F10 (Talbott et al.,

PNAS 86:5743-5747, 1989).:

(Sequence ID No. 3)

5'-3': CC CTC GAG CTC GAG GGG TCA CTG AGA AAC TAG AAA AAG AAT TAG

The antisense primer sequence is complementary to a sequence at position 9387 of clone 34F10. The 5' end of the primer has two consecutive Cla I sites: (Sequence ID No. 4)

5'-3': CC ATC GAT ATC GAT GTA TCT GTG GGA GCC TCA AGG GAG AAC

The PCR product is placed in the pBluescript KS 11+ plasmid (Stratagene, Calif.) and verified by DNA sequencing. This construct is designated pBluescript KS 11+ FIV env/rev/RRE. The Xho I-Cla I fragment is then excised and inserted into the KT-3 backbone.

D. Construction of FIV gag/rev /RRE Retroviral Vector

The Cla I site in the sp72 (Promega, Wise.) plasmid is first killed by 1) Cla I digestion; 2) blunted by Klenow fragment; and 3) religated. i. Construction of psp72 BIP-FIV gag

In order to construct the FIV gag open reading frame with Sph I and Bgl II restriction sites flanking the open reading frame, a PCR reaction is undertaken utilizing the following primers: The sense primer sequence is from position 612 of the clone 34F10. Two consecutive Sph I restriction sites are placed at the 5' end of the primer: (Sequence ID No. 5)

5'-3': CC GCATGC GCATGC GAG ATT CTA CAG CAA CATGGG GAA TGGACAG

The antisense primer sequence is complementary to a sequence at position 1959 of the 34F10 clone. Two consecutive Bgl II sites are placed at the 5' end of the primer. This oligonucleotide contains two consecutive in-frame stop codons with the FIV gag open reading frame: (Sequencing ID No. 6)

5'-3': CC AGATCT AGA TCT CTATCA CTC CAT TGG AGG TGC AGA TGGCATTTACTG

The resultant PCR product is designated Sph I-Bgl II/FIV gag.

In a three-part ligation, the Bgl II-Sph I BIP fragment (Peter

Sarnow, Univ. of Colo. Health Sciences Center, Denver, Human Immunoglobulin heavy chain binding protein), Sph I-Bgl II/FIV gag PCR product is ligated into the

CLP (calf intestinal phosphatase, New England Biolabs, Mass.) treated Bgl II site of the re-engineered psp72 vector, without the Cla I site. The insert is verified by

DNA sequencing. This construct is designated psp72 BIP-FTV gag. The Bgl II fragment containing BIP-FIVgαj is excised and used in the ligation below, ii. Construction of pBluescript KSII+ /FIV rev/RRE The FIV rev/RRE is constructed by PCR site directed mutagenesis (Ho et al., Gene 77:51-59, 1989) with the sense primer sequence ID No. 3 and antisense sequence ID No.4 used in generating the FIV env/rev/RRE with two additional oligonucleotides: the sense primer sequence

(Sequence ID No. 7)

5'-3': TGA TAG AGA CTT CCA CCA TTA GTA GTC CCA G and the antisense primer sequence

(Sequence ID No. 8)

5'-3':GTCTCTATCACCATACTACCTGAGCGCCGGCTGTC

Embedded within primers Sequence ID Nos. 7 and 8 are two consecutive stop codons in frame with the FIV env gene at position 6798 of the 34F10 clone. The primers Sequence ID Nos. 3 and 8 are used in the first PCR reaction to generate the amino terminal region of FIV env with two in-frame stop codons. This double stranded DNA is designated FIV env /amino /stop. The primers Sequence ID Nos. 7 and 4 are used in the second PCR reaction to generate the carboxyl terminal region of FIV env with a complementary region encompassing both stop codons of FIV env/amino/stop. This double stranded DNA is designated FIV env/carboxyl/stop. The PCR products, FIV env/amino/stop and FIV env/carboxyl/stop are denatured, reannealed, and allowed to undergo a third PCR reaction with primers Sequence ID Nos. 3 and 4. This double stranded DNA is designated FIV rev/RRE. The FIV rev/RRE DNA is digested with Xho I and Cla I, and subcloned into the Xho I and Cla I sites of the pBluescript KS 11+ plasmid and verified by DNA sequencing. This intermediate construct was designated pBluescript KSII + /FTV rev/RRE.

iii. Construction of KT-3 FIV gag/rev/RRE pBluescript KSII + /FIV rev/RRE is digested with Bel I at position 7249 (Talbott et al, PNAS 56:5743-5747, 1989) and CIP treated. The Bgl II BIP- FTV gag fragment is excised from psp72 BIP-FIV gag and inserted in the Bel I site in the sense orientation. This construct is designated pBluescript KSII+/BIP-FTV gag/rev/RRE. The construct is cleaved at the Apa I site blunted by Klenow fragment followed by cleavage with Cla I. The Xho I site of the KT-3 backbone is cleaved by Xho I and blunted with Klenow fragment followed by cleavage with Cla I. The BIP-FTV gag/rev/RRE fragment from the blunted Apa I to the Cla I site is inserted into the blunted Xho I site and Cla I sites of the KT-3 backbone.

EXAMPLE 4

CONSTRUCTION OF MULTΓVALENT RETROVIRAL VECTORS

A. Construction of FIV env/rev/RRE. FeLV env Retroviral Vector

i. Multivalent env Retroviral Vector with IRBS

The Cla I-Hind III fragment containing the IRBS (BIP) from psp72 is first inserted in the respective sites within the pBluescript KS 11+ plasmid. The

2.0 Kb FeLV env Pst I fragment is inserted at the Pst I site in the sense orientation with respect to BIP. This construct is designated pBluescript KSII + / BIP-FeLV env.

The FIV env/rev/RRE is first excised from pBluescript KS 11+ /FTV env/rev/RRE plasmid by Xho I and Cla I digestion and inserted into the Xho I-Cla I sites of the KT-1 backbone. This construct is cleaved at the Cla I site and blunted by Klenow fragment. The Cla I-BamH I fragment from pBluescript

KSII+ /BIP-FeLV env is then isolated, blunted by Klenow fragment, and inserted in the sense orientation at the blunted Cla I sites of the KT-1 retroviral backbone.

ii. Multivalent env Retroviral Vector with CMV Promoter

The FIV env/rev/RRE is first excised from pBluescript KS 11+ /FTV env/rev/RRE plasmid by Xho I and Cla I digestion and inserted into the Xho I-Cla I sites of the KT-1 backbone. This construct is cleaved at the Cla I site and blunted by Klenow fragment. The Xho I-Cla I FeLV env fragment is isolated from the cloning intermediate psp72-FeLV env vector and substituted for Xho I - Cla I insert into pUC 18 CMV gag/pol/CAR. The CMV FeLV env is then excised as a Pst I fragment, blunted by T4 DNA polymerase (New England Biolabs, Mass.) and inserted in the sense orientation at the blunted Cla I sites of the KT-1 retroviral backbone.

The pUC 18 CMV gag/pol/CAR is constructed essentially as follows. Briefly, from pAF/CMV/Env^R (U.S. Patent Application No. 07/395,932), the 4.7 Kb CMV Env^R Pst-RI fragment is isolated, and inserted into pUC 18 (New England Biolabs, Mass.) at the Pst I and RI sites. This construct is designated pUC 18 CMV Env^R. To generate CMV gag/pol/CAR, HIV-1 IIIB CAR is subcloned as a Sau 3A fragment into the Bam HI site of pBluescript II KS⁺ /CAR. The CAR fragment is excised from pBluescript II KS ⁺ /CAR as a Xba I-Cla I fragment. The Xho I- Xba I HJV-1 IIIB gag/pol fragment is excised from SK⁺ gag/pol SD delta (U.S. Patent Application No. 07/395,932). The plasmid backbone containing the CMV promoter is excised from pUC18 CMV/Env^R with Xho I and Cla I. In a three part ligation, the Xho I-Xba I HIV lug 8^ag~P°l fragment, the Xba I-Cla I CAR fragment is inserted into the Xho I- Cla I sites of the pUC 18 CMV/Env^R backbone to generate pUC 18 CMV_. gag/pol/CAR.

B. Construction of FIV gas/rev /RRE. FeLV gag Retroviral Vector

i. Multivalent gag Retroviral Vector with IRBS

In order to construct a FeLV gag/prot with flanking Xho I restriction sites, a PCR reaction is undertaken with the following primers. The sense primer sequence is from the 5' region of the FeLV gag/prot gene upstream from the ATG start codon at position 609 of the FGA provirus. The 5' end of the primer contains two consecutive Xho I restriction sites: (Sequence ID No. 1)

5'-3': CC CTC GAG CTC GAG GGC GGT GGG ATC GAA GGA GCT GAC G

The antisense primer sequence is complementary to a sequence at position 2800 of the FGA provirus and contains two consecutive stop codons in frame with FeLV gag/prot gene. The 5' end of the primer contains two consecutive

Xho I restriction sites:

(Sequence ID No. 9)

5'-3': CC CTC GAG CTC GAG CTA TCA TGG CTC AAA TAG CCG ATA CTC TTC TTC

The resultant PCR product is inserted at the Xho I site in the sense orientation with respect to BIP of the sp72 BIP plasmid, and is designated psp72

BIP-FeLV gag/prot.

The BIP-FIV gag/rev/RRE fragment is isolated from pBluescript KSII + /BIP-FIV gag/rev/RRE, cleaved at the Apa I site, blunted by Klenow fragment, followed by cleavage with Cla I. This fragment is inserted into the Xho

I blunted-Cla I sites of the KT-1 backbone and is designated KT-l/BIP-FTV gag/rev/RRE. KT-1/BIP-FIV gag/rev/RRE is then cleaved at the Cla I site and blunted by Klenow fragment. The Cla I-Nde I BIP-FeLV gag/prot fragment from psp72 BIP-FeLV gag/prot is blunted by Klenow fragment, and inserted in the sense orientation at the blunted Cla I sites of the KT-1 retroviral backbone.

ii. Multivalent gag Retroviral Vector with CMV Promoter

The pBluescript KSII + /BIP-FIV gag/rev/RRE is cleaved at the Apa

I site, blunted by Klenow fragment and cleaved with Cla I. This BIP-FTV gag/rev/RRE fragment from the blunted Apa I to the Cla I site is inserted into the Xho I blunted and Cla I sites of the KT-1 backbone. This construct is then cleaved at the Cla I site and blunted by Klenow fragment. The Xho I-Cla I fragment of FeLV gag/prot is isolated from the pBluescript KS 11 + /FeLV gag/prot and substituted for the Xho I Cla I insert in pUC 18 CMV gag/pol/CAR. The CMV-FeLV gag/prot fragment is excised as a Pst I fragment, blunted by T4 DNA polymerase, and inserted in the sense orientation at the blunted Cla I sites of the KT-1 retroviral backbone.

EXAMPLE 5

TRANSIENT TRANSFECΠON AND TRANSDUCTION OF PACKAGING CELL LINES DX AND DA

A. Plasmid DNA Transfection

DX cells (W092/05266) are seeded at 5 x 10⁵ confluence on a 6 cm tissue culture dish on Day 1. On Day 2, the media is replaced with a 4 ml fresh media 4 hours prior to transfection. A standard calcium phosphate-DNA coprecipitation is performed by mixing 25 μl 2.0 M CaCl2, 10 μg plasmid DNA (in 10 mM Tris-Cl, pH 7.5) and water to make 200 μl total. Precipitation buffer is freshly prepared by mixing 100 μl 500 mM HEPES-NaOH (pH 7.1), 125 μl 2.0 M NaCl, 10 μl 150 mM Na2HPθ4-NaH2Pθ4 (pH 7.0) and water to make 1 ml total. DNA-CaCl2 solution (200 μl) is added dropwise with constant agitation to 200 μl precipitation buffer. After 30 min. at room temperature the resultant fine precipitate is added to a dish of cells. Cells are exposed to the DNA precipitate until Day 3 when the medium is aspirated and fresh medium is added. On Day 4 the virus-containing medium is removed, and passed through a 0.45 μm filter.

B. Packaging cell line transduction

DA (WO92/05266) cells are seeded at 1 x 10⁵ cells/6 cm dish. Half a ml of the freshly collected virus-containing DX medium is added to the DA cells with fresh medium containing 4 μg/ml Polybrene (Sigma, Missouri). The following day, G418 (800 μg/ml) is added to these cells and a drug resistant pool is generated over the following week. The pool of cells is dilution cloned by adding 0.8-1.0 cells to each well of 96 well plates. Forty-eight clones are expanded to 24 well plates, then to 6 well plates, at which time cell supernatants are collected for titer. From producer cells expressing vectors containing the selectable marker neo, 1.0 ml of producer cell line supernatant is diluted five fold to 10"^ dilution and each dilution is used to transduce 5 x 10- Crandell feline kidnev (CRFK, ATCC CCL 94) cells. The following day G418 is added to the cells and 14 days later G418 resistant colonies are scored at each dilution.

DA producer cell expressing neo- multivalent vector are dilution cloned 3 days after transduction of 0.5 ml of freshly collected virus-containing DX medium with fresh medium containing 4 μg/ml Polybrene. Forty-eight clones are expanded to 24 well plates and cell supernatants titered in Example 6.

EXAMPLE 6

TΠΈRING FOR MULTI-VALENT VECTORS

Since the multivalent vectors do not contain a selectable marker such as the neomycin gene, another way of titering the vector is described. More specifically, 1.0 ml of vector supernatant is diluted five fold until 10^'9 dilution, and each dilution is then used to transduce 5 x 10-* CRFK cells. One week later, DNA is extracted from each dish (Willis et al, /. Biol Chem. 259:7842-7849, 1984). The

FTV gag or FTV env is amplified by PCR using the following PCR primers. For FTV gag, the sense primer sequence: (Sequence ID No. 10)

5'-3': GAGATTCTACAGCAACATGGGGAATGGACAG is from position 612 of the clone 34F10.

The antisense primer sequence:

(Sequence ID No. 11) 5'-3': CTC CAT TGG AGG TGC AGA TGG CAT TAC TG is complementary to position 1959 of the 34F10 clone. For FIV env, the sense primer sequence:

(Sequence ID No. 12)

5'-3': GGG TCA CTG AGA AAC TAG AAA AAG AAT TAG is from position 6020 of clone 34F10.

The antisense primer sequence:

(Sequence ID No. 13)

5'-3': GTATCTGTGGGAGCCTCAAGGGAGAAC is from position 9387 of clone 34F10. The PCR products are analyzed by Southern blot analysis with the appropriate probes (Sambrook et al. Molecular Cloning, a Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989). Signal is expected to be seen in all the lower dilutions and fall off at a certain dilution with all higher dilutions not having signal. The last dilution where a signal is visible yields the infectious U/ml of the vector.

EXAMPLE 7

A. Transduction of Murine Cells with Vector Construct

The murine fibroblast cell line BC10ME (Patek et al, Cell Imm.

72:113-121, 1992) (BC, H-2d) is grown in Dulbecco's modified eagle medium (DMEM), 4500 mg/1 glucose with L-glutamine (Irvine Scientific, Santa Ana, California), containing 10% fetal bovine serum (FBS) (Gemini, Calabasas, California). The BC10ME cell line is transduced with the retroviral vector and clones are selected using 800 μgm/ml G418 for 14 days as described in Example 5B. Cells are lysed to assay for protein expression using Western blots When the BC10ME cell line is transduced with a multivalent vector, these cells are transduced at a multiplicity of infection of 20 U/cell. One week after transduction, cells are lysed and assayed for protein expression using Western blot analysis.

B. Transduction of Feline Cells with Vector Constructs

The feline kidney cell line (CRFK) is grown in DMEM containing

10% FBS. CRFK cells are transduced with the vector construct as described in Example 5B, above and used to show vector expression in feline cells using Western blot analysis.

Established autologous feline T-cell (as described in Example 10B, below) lines are transduced by cocultivation with the vector producer cell line. 1 x 10" DA (vector producer cell line) is inadiated (10,000 rads, room temperature) and plated for three days with 1 x 10" T-cells from the established autologous T-cell line. These cells are then cocultivated two more times with the vector producer line in the same method as above. After the third cocultivation, these cells are placed under G418 selection. These cells are then assayed for expression of the desired protein by Western blot analysis. EXAMPLE 8

EXPRESSION OF TRANSDUCED GENES BY WESTERN BLOT ANALYSIS

Proteins are separated according to their molecular weight (MW) by means of SDS polyacrylamide gel electrophoresis. Proteins are then transfened from the gel to a IPVH Immobilon-P membrane (Millipore Corp, Bedford, Mass.). The Hoefer HSI TTE transfer apparatus (Hoefer Scientific Instruments, Calif.) is used to transfer proteins from the gel to the membrane. The membrane is then probed with polyclonal antibodies that react specifically with the expressed protein. The bound antibody is detected using 125j-labeled protein A, which allows visualization of the transduced protein by autoradiography.

EXAMPLE 9

TUMORIGENICITY AND TRANSFORMATION

A. " Tumorigenicity Assay

Tumor formation in nude mice is a particularly important and sensitive method for determining tumorigenicity. Nude mice do not possess mature T-cells, and therefore lack a functional cellular immune system, providing a useful in vivo model in which to test the tumorigenic potential of cells. Normal non-tumorigenic cells do not display uncontrolled growth properties if injected into nude mice. However, transformed cells will rapidly proliferate and generate tumors in nude mice. Briefly, the vector construct is administered by injection into nude mice. The mice are visually examined for a period of 4 to 16 weeks after injection in order to determine tumor growth. The mice may also be sacrificed and autopsied in order to determine whether tumors are present. (Giovanella et al, /. Natl Cancer Inst. 45:1531-1533, 1972; Furesz et al, 'Tumorigenicity testing of cell lines considered for production of biological drugs," Abnormal Cells, New Products and Risk, Hopps and Petricciani (eds.), Tissue Culture Association, 1985; and Levenbook et al, /. Biol Std. 73:135-141, 1985). This test is performed by Quality Biotech Inc., NJ. B. Transformation Assay

Tumorigenicity may also be assessed by visualizing colony formation in soft agar (MacPherson etal, Vir. 23:291-294, 1964). Briefly, one property of normal non-tumorigenic cells is anchorage dependent growth. Normal non- tumorigenic cells will stop proliferating when they are in semi-solid agar support medium, whereas tumorigenic cells will continue to proliferate and form colonies in soft agar. HT1080, (ATCC CCL 121) a neoplastic cell line derived from human fibrosarcoma and known to cause tumors in 100% of nude mice is used as the assay positive control. WI-38, (ATCC CCL 75) a diploid embryonic human lung cell line which is not tumorigenic in nude mice, is used as the assay negative control. Primary feline fibroblasts or WI-38 cell lines are tranduced with the vector construct as described in Example 6B. Duplicate samples of each of the transduced cell lines, HT1080, and WI-38, are cultured in agar. Briefly, a lower layer of 5.0 ml 0.8% Bactoagar (Difco, Michigan) in DMEM 17% FBS is set on 60 mm tissue culture plates. This is overlaid with 2.0 ml 0.3% Bactoagar in the same medium with the cells suspended at a concentration of 5 x 10-* cells per ml. To reduce background clumps, each cell line is strained through a 70 μm nylon mesh before suspending in the agar solution. The plates are incubated at 37°C in a humidified atmosphere of 5% CO2 for 14 days. Within 24 hours of plating, representative plates of each cell line are examined for cell clumps present at the time of plating. On day 13, the plates are stained with 1.0 ml INT viral stain (Sigma, Missouri) and on day 14, they are scanned for colonies of >150 μm in diameter using a 1 mm eyepiece reticle.

Only colonies spanning 150 μm in any orientation are scored, because colomes of this size can be readily observed in all planes under the microscope and non-transformed cells rarely form colonies of this size. At the end of the assay, the plating efficiencies for each cell line are calculated as b/a x 100, where b = the sum of colomes on all plates, and a = the total number of cells plates. A non-transformed cell line is one which has a plating efficiency of lower than or equal to 0.001%. Therefore, a transformed cell line will have a plating efficiency of greater than 0.001% (see, Risser et al, Vir. 59:477-489, 1974). EXAMPLE 10

CYTOTOXICΠΎ ASSAY

A. Mice

Six- to eight-week- old female BALB/c mice (Harlan Sprague- Dawley, Indianapolis, Indiana) are injected twice intraperitoneally (i.p.) with 1 x 10' inadiated (10,000 rads at room temperature) vector transduced cells. Animals are sacrificed 7 days later and the splenocytes (3 x 10"/ml) cultured in vitro with inadiated syngeneic transduced cells (6 x 10 /ml) in flasks (T-25, Corning, Corning, New York). Culture medium consists of RPMI 1640 (Irvine Scientific, Santa Ana, Calif, heat-inactivated fetal bovine serum (5%, Hyclone, Logan, Utah), sodium pyruvate (1 mM), gentamicin (50 ug/ml) and 2- mercaptoethanol (10^"5 M, Sigma Chemical, St. Louis, Missouri.). Effector cells are harvested 4-7 days later and tested using various EffectoπTarget cell ratios in 96 well microtiter plates (Corning, Corning, New York) in a standard 4-6 hour assay. The assay employs Na2 Crθ4-labeled (Amersham, Arlington Heights, Illinois) (100 uCi, 1 hr at 37°C) target cells (1 x 10⁴ cells/well) in a final volume of 200 ul. Following incubation, 100 ul of culture medium is removed and analyzed in a Beckman gamma spectrometer. Spontaneous release (SR) is determined as CPM from targets plus medium and maximum release (MR) is determined as CPM from targets plus 1M HC1. Percent target cell lysis is calculated as: [(Effector cell + target CPM) - (SR)/(MR) - (SR)] x 100. Spontaneous release values of targets are typically 10%-20% of the MR.

B. Felines

Since the vectors which are described above are to be utilized for treating felines, an assay demonstrating immunological efficacy in felines is needed. The following is a description of the generation of the autologous T-cell lines needed for restimulators and target cells for the standard -^Cr release assay (Brown et al, /. Vir. 65:3359-3364, 1991). Peripheral blood mononuclear cells (PBMC) are obtained following venipuncture and Ficoll-sodium diatrizoate (Histopaque-1077; Sigma, St. Louis, Mo.) density gradient centrifugation. These PBMCs are stimulated by 5 μg/ml concanavalin A (Con A, Sigma) for three days, and maintenance in medium containing 25 U/ml human recombinant interleukin- 2 (IL-2) (Boehringer Mannheim Biochemicals, Indianapolis, Ind.) and 10% bovine T-cell growth factor (TCGF). Cells are seeded into round-bottom 96-well micro titer plates at an average of 1 or 0.3 cells per well with 5 x 10 irradiated (3,000 rads) autologous PBMC, 10% bovine TCGF, and 25 U/ml of IL-2 in a final volume of 200 μl of complete RPMI. Complete RPMI consisted of RPMI 1640 medium containing 10% FBS, 2 mM L-glutamine, 5 x 10^"^ M 2-mercaptoethanol, and 50 μg of gentamicin per ml. Clones are expanded sequentially to 48-well and 24-well plates. After several weeks, cells are transduced with retroviral vectors expressing either FeLV or FIV gag or env genes as in Example 7B. Expression of these cell lines are monitored by Western blot analysis as in Example 8. Cell lines expressing high levels of the desired protein function as restimulators and targets in a standard ⁵¹Cr release assay as in Example 10A.

From the foregoing, it will be appreciated that, although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope of the invention. Accordingly, the invention is not limited except as by the appended claims.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT:

NAME: Viagene, Inc. STREET: 11075 Roselle Street CITY: San Diego, California COUNTRY: USA POSTAL CODE: 92121 TELEPHONE: (619) 452-1288 TELEFAX: (619) 453-0095

INVENTORS: Lee, William T.L. Serbin, John J. Jolly, Douglas J. Barber, Jack R. Chada, Sunil Chang, Stephen M.W.

(ii) TITLE OF INVENTION: COMPOSITIONS AND METHODS FOR TREATING FELINE LEUKEMIA VIRUS AND FELINE IMMUNODEFICIENCY VIRUS

(iii) NUMBER OF SEQUENCES: 13

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Seed and Berry

(B) STREET: 6300 Columbia Center, 701 Fifth Avenue

(C) CITY: Seattle

(D) STATE: Washington

(E) COUNTRY: U.S.A.

(F) ZIP: 98104

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: Patentln Release #1.0, Version #1.25

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER: N/A

(B) FILING DATE: N/A

(C) CLASSIFICATION: N/A

(viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: McMasters, David D.

(B) REGISTRATION NUMBER: 33,963

(C) REFERENCE/DOCKET NUMBER: 930049.415PC

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 206-622-4900

(B) TELEFAX: 206-682-6031

(C) TELEX: 3723836

(2) INFORMATION FOR SEQ ID NO:l:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 39 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

CCCTCGAGCT CGAGGGCGGT GGGATCGAAG GAGCTGACG 39

(2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 47 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:

CCATCGATAT CGATCTATCA TGGCTCAAAT AGCCGATACT CTTCTTC 47

(2) INFORMATION FOR SEQ ID N0:3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 44 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:

CCCTCGAGCT CGAGGGGTCA CTGAGAAACT AGAAAAAGAA TTAG 44

(2) INFORMATION FOR SEQ ID N0:4:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 41 base pairs (B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:4:

CCATCGATAT CGATGTATCT GTGGGAGCCT CAAGGGAGAA C 41

(2) INFORMATION FOR SEQ ID N0:5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 45 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:5:

CCGCATGCGC ATGCGAGATT CTACAGCAAC ATGGGGAATG GACAG 45

(2) INFORMATION FOR SEQ ID N0:6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 50 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:6: CCAGATCTAG ATCTCTATCA CTCCATTGGA GGTGCAGATG GCATTTACTG 50

(2) INFORMATION FOR SEQ ID N0:7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 31 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:7:

TGATAGAGAC TTCCACCATT AGTAGTCCCA G 31

(2) INFORMATION FOR SEQ ID N0:8:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 35 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:8:

GTCTCTATCA CCATACTACC TGAGCGCCGG CTGTC 35

(2) INFORMATION FOR SEQ ID N0:9: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 47 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:9:

CCCTCGAGCT CGAGCTATCA TGGCTCAAAT AGCCGATACT CTTCTTC 47

(2) INFORMATION FOR SEQ ID NO:10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 31 base pairs

(B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:

GAGATTCTAC AGCAACATGG GGAATGGACA G 31

(2) INFORMATION FOR SEQ ID NO:11:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 29 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:

CTCCATTGGA GGTGCAGATG GCATTACTG 29

(2) INFORMATION FOR SEQ ID NO:12:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 30 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:

GGGTCACTGA GAAACTAGAA AAAGAATTAG 30

(2) INFORMATION FOR SEQ ID NO:13:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 27 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO (xi) SEQUENCE DESCRIPTION: SEQ ID N0:13:

GTATCTGTGG GAGCCTCAAG GGAGAAC 27

Claims

1. A method of treating or preventing feline leukemia virus infections, comprising administering to a feline a vector construct which directs the expression of at least one immunogenic portion of a feline leukemia virus antigen, such that a cellular immune response is generated.

2. The method of claim 1 wherein said vector construct directs the expression of an antigen selected from the group consisting of pl5gag, pl2gag, p21gag, plOgag, pl4pol, p80pol, p46pol, gp70env, and

3. The method of claim 1 wherein said vector construct directs the expression of gp85env.

4. A method of treating or preventing feline immunodeficiency virus infections comprising, administering to a feline a vector construct which directs the expression of at least one immunogenic portion of a feline immunodeficiency virus antigen, such that a cellular immune response is generated.

5. The method of claim 4 wherein said vector construct directs the expression of an antigen selected from the group consisting of pl5gag, p24gag, plOgag, pl3pσ/, p62pσ/, pl5pol and p36pol.

6. The method of claim 4 wherein said vector construct directs the expression of gp68env, ~p21env and rev.

7. A method of treating or preventing feline leukemia virus and feline immunodeficiency virus infections, comprising administering to a feline a vector construct which directs the co-expression of at least one immunogenic portion of a feline leukemia virus antigen, and at least one immunogenic portion of a feline immunodeficiency virus antigen, such that a cellular immune response to said viruses is generated.

8. The method of claim 7, wherein said vector construct also directs the expression of an immunogenic portion of a feline virus selected from the group consisting of feline panleukopenia vims, feline calicivirus, the rabies vims, and feline herpesvirus.

9. The method of claims 1, 4, or 7 wherein said vector construct is carried by a recombinant retrovirus.

10. The method of claims 1, 4 or 7 wherein said vector construct is carried by a recombinant virus selected from the group consisting of poliovirus, rhinovirus, pox vims, influenza vims, adenovims, parvovirus, herpes vims, SV40, HIV, measles and Sindbis vims.

11. A vector construct which directs the co-expression of at least one immunogemc portion of a feline immunodeficiency virus antigen, and at least one immunogenic portion of a feline leukemia vims antigen.

12. The vector construct of claim 11, wherein said feline leukemia vims antigen is gp85em>, and said feline immunodeficiency vims antigen is gp68env, gp27env, and rev.

13. A recombinant retrovirus caπying a vector construct according to claims 11 or 12.

14. A recombinant retrovirus carrying a vector construct which directs the expression of at least one immunogenic portion of a feline leukemia vims antigen.

15. A recombinant retrovirus carrying a vector construct which directs the expression of at least one immunogenic portion of a feline immunodeficiency vims antigen.

16. A recombinant virus carrying a vector construct according to claims 11 or 12, said vims selected from the group consisting of poliovirus, rhinovirus, pox vims, influenza vims, adenovims, parvovirus, herpes vims, SV40, HTV, measles and Sindbis vims.

17. Target cells infected with the recombinant retrovirus of claims 13, 14 or 15.

18. A pharmaceutical composition comprising the recombinant retrovims of claims 13, 14 or 15, in combination with a pharmaceutically acceptable carrier or diluent.

19. A pharmaceutical composition comprising the recombinant virus of claim 16, in combination with a pharmaceutically acceptable carrier or diluent.