WO2007115385A2 - Transfer plasmidic vector and recombinant canarypox virus - Google Patents

Abstract

A recombinant virus from the canarypox virus (CNPV) is provided, being the virus capable of acting in vivo as an expression vector of foreign genes inserted in genomic regions non-essential for viral replication, that show genetic stability, wherein said genomic regions correspond to at least a gene selected from CNPV018 (SEQ ID No 1), CNPV048 (SEQ ID No 2) and CNPV134 (SEQ ID No 3) of the canarypox virus genome. A plasmidic transfer vector susceptible of homologous recombination with a canarypox virus is provided. Vaccines and immunization methods are also provided.

Description

TRAJSISFER PLASMIDIC VECTOR AND RECOMBINANT CANARYPOX VIRUS Field of the Invention

The present invention relates to recombinant canarypox virus, which are able for acting in vivo as an expression vector of foreign genes useful to elicit immune response in hosts, such as mammals or avian species. More particularly, the invention relates to transfer vectors carrying homologue sequences of specific regions of the viral genome which will be used as target sites for insertion.

Background of the invention

The Poxviridae virus family (Moss B. Poxviridae. In Virology 3rd Ed., Vol. 2 , pp. 2637-2671. Fields B.N., Knipe D. M. and Howley P.M. eds . , Lippincott-Raven, Philadelphia, 1996) comprises a group of complex DNA virus which replicate in the cell cytoplasm of vertebrates and invertebrates . The general features of poxvirus are : 1- complex viral particle containing enzymes that synthesize early mRNA 2- genome formed by a linear double stranded DNA molecule of about 130-400 kpb, having a hairpin loop at each end 3- cytoplasmic replication

The viral particles of poxvirus are larger than those of other animal virus, they generally have a smooth appearance, with rectangular shape and round ends, the size being about 350 x 270 nm. Further, they have a membrane delimiting a layer of about 30 nm surrounding a homogeneous core.

Two infective particle types have been identified, according to their flotation density: a) intracellular mature virions (IMV) : isolated from the inside of the infected cell b) enveloped extracelular virions (EEV) : isolated from the culture media. As far as they have a further lipoproteic envelope, their flotation density is less than that of the IMV.

The poxvirus genome consists in a linear double stranded DNA molecule, which size varies between 130 kpb

(parapoxvirus) and 300 kpb (avipoxvirus) . The genome ends have inverted repeats (ITRs) , which are identical but with their sequences are oriented in opposite ways at both ends.

Both DNA genomic strands (gDNA) are linked by hairpin loops forming one continuous polynucleotide chain (they are covalently linked) . During last years the genomes of several virus have been sequenced entirely, the vaccinia virus among them (Goebel S.J. et al, The complete DNA sequence of vaccinia virus. Virology. 179:247-66, 517-63, 1990), fowlpox (Afonso CL. et al, The genome of fowlpox virus. J Virol. 74:3815-31, 2000) and canarypox (Tulman E. R. et al, The genome of canarypox virus. J Virol. 78:353- 66, 2004) . The comparison of their genomic sequences have shown a similar genetic structure among them, wherein the genes located at the center of the viral genome are relevant in general for the viral replication, encoding necessary enzymes for transcription, DNA replication and for virus structural proteins. On the contrary, the genes that are located close to the genome terminal are mostly nonessential for the viral replication, encoding proteins that affect the host range or the virulence.

A region of about 100 pb close to the loops is highly conserved, having sequences which are necessary for replication. The EEV are significant to spread the infection in animals and culture cells. The infectivity of

EEV is not neutralized by antibodies directed against IMV, this suggesting that different proteins are involved in their formation. The poxvirus replication occurs exclusively into the cytoplasm of the infected cells (Fenner F. Poxviruses. In Virology 3rd. Ed. pp. 2673-2702. Fields B.N., Knipe D. and Howley eds . Lippincott-Raven Press, Philadelphia, 1996) . The replicative cycle comprises several stages: virion bonding to the cell surface, core entrance into the cytoplasm, core stripping, viral gene expression, DNA viral replication and viral progeny morphogenesis. The cycle leads always to the lysis of the infected cell and completes within 12-24 hs . The genetic expression comprises three stages: early, intermediate and late. In the early stage, the early transcriptional apparatus is packed into the poxvirus infective particles core, allowing the viral mRNA synthesis in the infected cell cytoplasm. The early mRNAs of vaccinia virus are detected 20 min after the synchronic infection is produced, reaching the highest level at 1-2 hs post infection (hpi) ; subsequently, the early mRNAs decrease due to the increase of their degradation rate.

Early genes encode for proteins involved in the gDNA replication, in the intermediate gene expression and in the interaction with the host .

In the intermediate stage, the DNA replication precedes to a dramatic change of the viral gene expression. It was established the existence of an intermediate class of genes that expresses, after the gDNA replication, but before the late gene expression. In synchronic infections, the intermediate mRNA are detected at 100 min, reaching the highest level a bit later, and afterwards their expression diminishes . Some of the vaccinia virus genes belonging to the intermediate category encode for late expression gene transactivators .

It was demonstrated that the need for DNA replication for intermediate gene expression is due to the inaccessibility of gDNA by the transcription factors and RNA polymerases, which would be due to the presence of remaining virion proteins or to the presence of putative repressor proteins.

In the late stage the late mRNAs are detected by 140 min after the synchronic infection, and continuing by about 48 hs . The persistent synthesis of late proteins reflects a continued transcription, since the half, life of late mRNA is of about 30 min. Many of late proteins, including the major virion components, accumulate in great amounts during this long period. Late genes are, among others, those encoding proteins required for the late gene expression and those forming part of the virion core. During the viral morphogenesis, mature viral particle are assembled, acquiring a further membrane derived from the trans-face of Golgi apparatus, wherein viral proteins that will be present in the EEV, accumulate. For breaking it out, in vaccinia virus case, the presence of at least an IMV membrane protein (A27L of 14 kDa) and two EEV membrane proteins (F13L of 37 kDa and B5R of 42 kDa) is required. The mature viral particles, having two internal membranes derived apparently from the intermediate compartment and two external membranes derived from Golgi, are carrying through the actin microfilaments up to the plasmatic membrane and their fusion determines the externalisation of the virus, upon the loss of the most external membrane from those derived from Golgi .

Only a portion of the externalised virus are found in the extracellular media as EEV, since most of them remain attached to the cell surface and are designated as enveloped virions associated to the cell (CEV) . The released virus/attached virus ratio depends on the virus strain and the type of host cell.

Extracellular viral particles are important to the dissemination of viral infection. In monolayers of culture cells, attached virus may efficiently mediate cell-to-cell dissemination and lysis plaque formation; while EEV are responsible of longer distance dissemination.

Prophylaxis of diseases involves the determination of organism' s defense mechanisms and their activation before the interaction with specific pathogens, so that the host elicits a rapid response against the infection.

Vaccination is the most economic and effective prophylactic method. Different kinds of vaccines were developed and used since Edward Jenner, in 1776, used an attenuated vaccine against smallpox. The basic concept for designing a vaccine is the infection simulation in the host with the pathogen or, at least, those features of natural occurring infection that are important to elicit mechanisms intended to its elimination by activating immunologic memory. A vaccine safety and non-transmittal feature is the major advantage offered by dead virus or subunit virus vaccines . But great antigen amounts and multiple doses are required to obtain a protective immune response, only characterized by being of humoral type. On the other side, the major advantage of using live virus vaccines is the activation of all immune system phases, allowing locally and systemically humoral and cellular responses. This is very important in the case of mucosal infections, since local and systemic immunity are necessary therein to obtain protection. Live virus vaccines efficiently stimulate local response in hosts not previously vaccinated. Moreover, induced immunity is generally longer and more effective than that of non-live virus vaccines. The major disadvantage caused by their use would be the development of a persistent infection caused by the vaccinal virus.

During last thirty years, after molecular biology, genetic engineering and immunology advent, new strategies for vaccine development could be designed. Particularly, gene cloning and gene expression, structural characterization of pathogens and identification of immunodominant epitopes involved in humoral and cellular immune response, made it possible the transfer of genetic information from an organism to another non-related one and the design of new vaccination strategies that allowed overcome some of the difficulties related to classical vaccines .

In a broad sense, vectors are defined as vehicles used to mobilize genetic information among cells. Some viral vectors are modified viruses carrying foreign genes or integrated sequences in positions that are neither essential to viral replication nor to infectiveness . Recombinant viruses have been developed using systems such us adenovirus (Gorziglia M. and Kapikian A. Expression of the OSU rotavirus outer capsid protein VP4 by an adenovirus recombinant. J. Virol. 66: 4407-4412, 1992), pseudorabies virus (Thomsen D. R. et al . , Pseudorabies virus as a live virus vector for expression of foreign genes. Gene 57: 261-265, 1987) or poxviruses (Paoletti E. et al . , Modified vaccinia virus. United States Patent N° 4,603,112, 1982).

Particularly, poxviruses have been efficiently used as vectors for the expression of foreign genes and for the construction of vaccines against infectious diseases (Bostock C. Virus as vector. Vet. Microbiol. 23: 55-71,

1990; Tartaglia J. et al . , Poxvirus-based vector as vaccine candidates. Crit. Rev. Immun. 10: 13-30, 1990; Nazerian K. et al . , Protection against Marek' s disease by folwpox virus recombinant expressing the glycoprotein B of Marek' s disease virus. J. Virol. 66: 1309-1413, 1992; Gonczol E. y col., Preclinical evaluation of an ALVAC (canarypox) -human cytomegalovirus glycoprotein B vaccine candidate. Vaccine 13: 1080-1085, 1995; Pardo M et al . , Protection of dogs against canine distemper by vaccination with a canarypox virus recombinant expressing canine distemper virus fusion and hemagglutinin glycoproteins. Am. J. Vet. Res., 58: 833- 836, 1997) . The nature of the infection produced by its inoculation, introduces the foreign immunogen in a way such that the components of the immune system, either cellular or humoral, are induced. Some characteristics encouraging its utilization this way are: easy obtaining and isolation of recombinant virus, ability to insert big fragments of DNA, high expression level, and high genetic stability (Moss B. Poxviridae. In Virology 3rd Ed., Vol. 2 , pp. 2637- 2671. Fields B.N. et al . , eds . , Lippincott-Raven, Philadelphia, 1996; Paoletti E. Applications of poxvirus vectors to vaccination: an update. Proc . Natl. Acad. Sci . U.S.A. 93: 11349-11353, 1996).

Initially, major attention was paid to vaccinia virus, a prototype of orthopoxvirus genus (Hruby D. E. Present and future applications of vaccinia virus as a vector. Vet. Parasitol. 29: 281-292, 1988; Mahr A. and Payne L. G. Vaccinia recombinants as vaccine vectors. Immunobiol . 184: 126-146, 1992; Moss B. Vaccinia virus: a tool for research and vaccine development. Science 252: 1662-1667, 1991) because it shows a wide range of hosts and its molecular biology was broadly studied (Moss B. Regulation of vaccinia virus transcription. Ann. Rev. Biochem. 59: 661-688, 1990b). A great variety of foreign genes derived from different infectious agents were expressed in vaccinia virus (Belsham G. et al . , Intracellular expression and processing of foot-and-mouth disease virus capsid precursor using vaccinia virus vector: influence of the L proteasa. Virology 176: 524-530, 1990; Elango N. et al . , Resistance to human respiratory synctytial virus (RSV) infection induced by immunization of cotton rats with a recombinant vaccinia virus expressing the RSV G glycoprotein. Proc . Natl. Acad. Sci. U. S.A 83: 1906-1910, 1986; Paoletti E. et al . , Construction of live vaccine using genetically engineered poxviruses: biological activity of vaccinia virus recombinant expressing the hepatitis B virus surface antigen and the herpes simplex virus glycoprotein. Proc. Natl. Acad. Sci. U.S.A. 81: 193- 197, 1984; Macket M. et al . , Vaccinia virus: a selectable eukaryotic cloning and expression vector. Proc. Natl. Acad. Sci. U.S.A. 79: 7415-7419, 1982). However, certain side effects associated with inoculation, besides the wide range of hosts discouraged their utilization as expression systems for the development of live virus vaccines. Then, the interest in the use of recombinant poxviruses as vaccines focused on other family members possessing a narrower host range and allowing to employ the wide experience accumulated with vaccinia virus .

Within this context, avipoxviruses such as fowlpox virus and canarypox virus, as well as swinepox virus, occupy a unique positioning since their host range is highly restricted, and they cause productive infections only to their natural hosts (Matthews R. E. F. Classification and nomenclature of viruses. Intervirology 17:1-199, 1982). They have been used as safe vectors for recombinant live vaccines either in birds (Taylor J. et al . , Protective immunity against avian influenza induced by fowlpox virus recombinant. Vaccine 6: 504-508, 1988a; Taylor J. et al . , Newcastle disease virus fusion protein expressed in a fowlpox virus recombinant confers protection in chickens . J. Virol. 64: 1441-1450, 1990; Paoletti E. Applications of pox virus vectors to vaccination: an update Proc . Natl. Acad. Sci. U.S.A. 93: 11349-11353, 1996) or in mammals (Taylor J., and Paoletti E. Fowlpox virus as a vector in non-avian species. Vaccine 6: 466-468, 1988; Taylor, J. et al . , 1988a Taylor J. et al . , Recombinant fowlpox virus inducing protective immunity in non-avian species . Vaccine 6: 497-503, 1988b; Taylor, J. et al . , Efficacy studies on a canarypox-rabies recombinant virus. Vaccine 9: 190-193, 1991) . Fowlpox virus, a prototype of this genus, was successfully used as a recombinant vaccine in different chicken' s diseases including Newcastle disease (Boursnell M. et al., A recombinant fowlpox virus expressing the hemagglutinin-neuraminidase gene of Newcastle disease virus

(NDV) protects chickens against challenge by NDV. Virology

178: 297-300, 1990; Taylor J. et al . 1990), avian influenza

(Beard C. et al . , Protection of chicken against highly pathogenic avian influenza virus (H5N2) by recombinant fowlpox viruses. Avian Dis . 35: 356-359, 1991; Taylor J. et al., 1988a), Marek disease (Nazerian K. et al . , 1992) and Gumboro disease (Bayliss C. et al . , A recombinant fowlpox virus that expresses the VP2 antigen of infectious bursal disease virus induces protection against mortality caused by the virus. Arch. Virol. 120: 193-205, 1991) .

Avipoxviruses are capable of initiating an abortive infection by inoculation in cell lines derived from non- avian species, where the foreign antigens inserted in these vectors can be synthesized, processed and displayed on the cell surface without producing infectious viral progeny, eliciting a protective immune response (Taylor J. et al . , 1988b; Somogyi P. et al . Fowlpox virus host range restriction: gene expression, DNA replication and morphogenesis in nonpermissive mammalian cells . Virology 197: 439-444, 1993). This provides a high security profile to the use of recombinant avipoxviruses as expression vectors in mammals . Immunization is got in the absence of viral replication, without the possibility of vector dissemination in vaccinated animals and thus, dispersion by contact towards non-vaccinated animals or towards environment is not possible.

It will be appreciated that the provision of new recombinant avipoxvirus strains, particularly of recombinant canarypox virus, capable of acting in vivo as expression vectors of one or more foreign genes, with genetic stability and improved immune response in vaccinated animals, would turn into an important advance in the induction of immune responses in avian and non-avian species . Objects of the invention

It is therefore an object of this invention, to provide a recombinant virus from canarypox virus (CNPV) , capable of acting in vivo as expression vector of foreign genes that are inserted within nonessential genomic regions for the viral replication, with more genetic stability.

It is an object of present invention a canarypox virus comprising at least a foreign DNA sequence inserted into the genomic region corresponding to at least one gene selected from CNPV018 (SEQ ID N° 1) , CNPV048 (SEQ ID N° 2) and CNPV134 (SEQ ID N° 3) , of the canarypox virus genome, said foreign DNA sequence being capable of being expressed in a host cell into which the virus recombinant virus is introduced.

In one embodiment a recombinant canarypox virus is provided wherein the foreign DNA sequence encodes an antigenic polypeptide preferably selected from structural VPl protein or Pl precursor or P1-2A-3C chimeric protein of foot and mouth disease virus (FMDV) ; bovine herpes virus type 1 glycoprotein D (gD) ; bovine viral diarrhea virus glycoprotein E2 or Erns; rabies virus glycoprotein G; Newcastle disease virus fusion proteins (F) or hemagglutinin-neuraminidase (HN) ; Marek disease virus glycoprotein gB; VP2 protein or precursor polyprotein (VPX- VP4-VP-) of Gumboro disease virus; avian influenza virus type A hemagglutinin protein (HA) ; and alpha and beta interferon of porcine or bovine source.

Further, according to another aspect, the present invention provides recombinant virus with more than one gene of interest inserted within different regions of the CNPV virus genome, said regions being selected from CNPV018 (SEQ ID N° 1) , CNPV048 (SEQ ID N° 2) and CNPV134 (SEQ ID N° 3) , giving multivalent vaccines, so as to provide a single vaccine protecting against more than one pathogen.

A relevant object of present invention is a transfer plasmidic vector, susceptible of homologue recombination with a canarypox virus comprising: a) an expression cassette carrying a foreign gene encoding a polypeptide under control of a poxvirus early promoter, b) optionally an expression cassette carrying a marker gene under the control of another poxvirus early promoter, and a DNA sequence flanking at least one of a) or b) , wherein said DNA corresponds to genomic regions of a canarypox gene selected from CNPV018 (SEQ ID N° 1) , CNPV048 (SEQ ID N° 2) and CNPV134 (SEQ ID N° 3) .

Preferably, the marker gene cassette expression corresponds either to a uid A gene, which encodes the beta glucuronidase enzyme (beta-GUS) or to a lac Z gene, which encodes the beta galactosidasa enzyme (beta-gal) .

Further, the present invention provides a vaccine comprising an effective immunizing amount of the CNPV of the invention and a suitable pharmaceutically carrier or diluent.

Further, the present invention provides a method for immunizing an animal against a disease selected from at least one of foot and mouth disease, type 1 bovine herpes, bovine viral diarrhea, rabies, Newcastle disease, Marek disease, Gumboro disease, type A avian influenza, the method comprising administering the animal with an effective immunizing dose of the vaccine of the present invention.

Furthermore, the invention provides a method for administering an animal, preferably a mammal, with a suitable dose of alpha and/or beta of porcine or bovine source, the method comprising administering the animal with an effective dose of CNPV virus composition of the invention wherein the foreign gene encodes the expression of alpha and/or beta interferon of porcine or bovine source . Brief Description of the Drawings

Figure 1 shows the sequence of the cloning cassette of the pHGnot plasmid. Figure 2 shows the sequence of the (promoter E/L,

SMC, terminator) cloning cassette of the pE/Lnot plasmid.

Figure 3 shows the PCR amplification of the region encoding the gD glycoprotein in the selected CN048-GUSgD recombinant virus . Figure 4 shows a Southern blot analysis of the

CN048-GUSgD recombinant virus.

Figure 5 shows the result of an assay for the detection of gD glycoprotein expression by immunoperoxidase technique .

Figure 6 shows two Northern blot analyses of the expression of the gene encoding the gD glycoprotein.

Figure 7 shows a Western Blot analysis of the expression of the gene encoding the E2 glycoprotein.

Figure 8 shows the expression results of the CN048- GUS interferon beta (bovine) recombinant virus .

Figure 9 shows a Western blot detection analysis of BHV-I structural proteins. Figure 10 shows the results of the detection of anti-gD antibodies by the ELISA technique.

Figure 11 shows the results of Western blot detection of BHV-I structural proteins . Detailed description of the invention The present invention provides a recombinant virus from canarypox virus (CNPV) , capable of acting in vivo as expression vector of foreign genes that are inserted within nonessential genomic regions for the viral replication and capable of being expressed in a host cell into which the virus recombinant virus is introduced.

According to a particular embodiment, an attenuated canarypox virus strain called Abbatista95 strain, which is commercialized as a live attenuated vaccine preventive against the canary diphtheria-smallpox (DIFTERVAC, provided by LaDiPreVet laboratory, Argentina) was used as a starting canarypox virus .

Nonessential genes, able to be used as target genomic regions for the insertion of foreign genes, were identified from partial CNPV genomic library. It should be understood as "nonessential" genes regions those viral genomic regions that are not necessary for the virus replication in cell culture.

Although the nonessential gene selection was performed by homology analysis with genes reported as nonessential in other members of the poxvirus family, the teachings of the prior art anticipated difficulties in said selection. In fact, even though the locus corresponding to the TK gene is the most common insertion site for the vaccinia virus, it cannot be used for obtaining the recombinant avipoxvirus because it has been proved that it is essential for the replication of these viruses (Amano et al . , Identification of the canarypoxvirus thymidine kinase gene and insertion of foreign genes, Virology 256: 280-290, 1999; Letellier, Role of the TK+ phenotipe in the stability of pigeonpox virus recombinant, Arch. Virol. 131: 431-439, 1993; Scheiflinger et al . , Role of the fowlpox virus thymidine kinase gene for the growth of FPV recombinants in cell culture, Arch. Virol. 142(12): 2421-2431, 1997) . Moreover, the absence of chicken embryo fibroblasts (CEF) of the TK genotype eliminates the advantage of this site because selection with bromodeoxyuridine can not be used. Additionally, present inventors selected the CNPV186 and CNPV265 canarypox genes as potential target insertion sites given that they present homology with the genes H3L and A27L, respectively, described as nonessential in the vaccinia virus. Contrary to what was expected, the CNPV186 and CNPV265 genes would be essential for the replication of CNPV in culture -see Example 1 below- having to be discarded for use as a target site for obtaining the recombinant CNPV. The CNPV genes selected as insertion sites are designated with the nomenclature assigned to the genomic sequence of the Wheatley C93 strain of the canarypox virus (Tulman et . al . , 2004)

Transfer vectors carrying homologue sequences to those viral genome regions of CNPV virus are designed by identifying the nonessential genes CNPV018, CNPV048 and CNPV134, that will serve as insertion sites, thus allowing the obtaining of recombinant virus for in vivo recombination with wild CNPV virus, that have genetic stability and non-altered replication capacity in chicken embryo fibroblasts (CEF) . Such sequences are interrupted by an expression cassette having the gene of interest under regulation of a suitable promoter.

The transfer vectors used for obtaining the recombinant canarypox virus were obtained from sequential subcloning of the cassette for the expression of the foreign gene of interest in specific restriction sites present in plasmidic vectors specially constructed for the invention.

The foreign genomic regions codifying for the selected immunogenic proteins were amplified by RT-PCR or PCR using specific initiation oligonucleotides from the purified genome (RNA or DNA, respectively) of the pathogenic microorganism. In the case of genes codifying for cytokines, such as interferon alpha/beta, these were amplified from genomic DNA purified from cell lines (for example, PK15) or from bovine peripheral blood lymphocytes. In the following table, the immunogenic proteins that will be expressed according to various preferred embodiments of the present invention are detailed.

Given that the recombinant canarypox virus of the invention will be used as a viral non-replicative vector, the foreign gene is incorporated under the regulation of an early/late promoter such as the early/late H6 promoter or the synthetic early/late E/L promoter of the vaccinia virus. However, other alternative promoters may be used without departing from the spirit of the invention.

The preferred transfer vectors also contain marker genes codifying for products such as the bacterial enzymes beta-glucuronidase (GUS) and beta-galactosidase (beta-gal) , which allow for the detection of the recombinant virus. It shall be understood that other marker genes or selection genes may be used without departing from the spirit of the invention. The plasmidic vectors flanking the expression cassette for the selected foreign gene and marker gene, also contain an homologous genomic portion from the viral genome region that will serve as target for insertion, said portion being selected from the sequences CNPV018 (SEQ ID N° 1), CNPV048 (SEQ ID N° 2) and CNPV134 (SEQ ID N° 3). The selected CNPV genes selected as insertion sites were renamed according to the nomenclature assigned to the genomic sequence of the Wheatly C93 strain of the canarypox virus (Tulman y col., 2004) . The transfer vectors were then transfected into cells such as chicken embryo fibroblasts (CEF) infected with canarypox virus . Preferably, the performed transfection was mediated by cationic liposomes, even though other appropriate techniques such as electroporation or calcium phosphate precipitation may equally be used.

For the selection of the recombinant CNPVs, the cloning method of infective particles under agar was used. For this purpose, the viral suspension coming from the transfection was titrated in CEF monolayers. The infected cultures were incubated until visualization of the characteristic CNPV lysis plaques . A substrate such as X- Gluc (5-bromo-4-chloro-3-indolyl-beta-D-glucuronide) or Blue-gal (5-bromo-3-indolyl-beta-D-galactopyranoside) for the enzymes encoded by the marker genes such as for uid A or lac Z, respectively, were added to the culture media to select the recombinant virus . The infected cultures were grown until visualization of the blue lysis plaques .

Once the homogenous viral stock for the marker gene (that produces 100% blue lysis plaques) was obtained, the molecular and biological characterization was performed. The insertion of the gene of interest into the recombinant CNPV genome was confirmed by PCR and Southern blot techniques . The correct expression of the gene of interest in the recombinant CNPV was confirmed by the immunoperoxidase, Northern or Western blots techniques.

The mammals' immunization with the recombinant canarypox virus of the present invention will induce the production of a specific immune response against the foreign proteins and this response is protective against the challenging with pathogenic virulent strains against which they are directed.

The recombinant canarypox virus, purified by a 25% sucrose cushion (Ferrer M. F., Desarrollo y evaluaciόn de vacunas de nueva generaciόn para Ia prevenciόn de Ia diarrea viral bovina, Tesis de Licenciatura, Fac . de Cs. Exactas y Naturales, U. B.A., 2004) or by total extracts (cells and culture supernatant) of CEF infected with the recombinant canarypox virus, were obtained for the preparation of a vaccine. The viral suspension may be stored frozen (-20⁰C or -70⁰C) or freeze-dried, until its use . Typically, the virus concentration in the vaccine formulation will be of a minimum of 2xlO⁷ plaque forming units (pfu) per dose, even though it will depend on the expressed antigen and on the animal to be immunized. Upon vaccination time, the viral suspension will be thawed or reconstituted and will be admixed with a physiologically acceptable carrier such as water or physiological solution, or the same .

Alternatively, the vaccine of the present invention may also contain or be co-administered with known and conventional vaccines that induce a protective immune response against the same antigen.

The vaccine may be administered through different routes such as subcutaneous, intramuscular, oral, intradermal or intranasal. The immunization with the recombinant canarypox virus of the present invention, as live immunogens, induces antibodies (humoral) responses and T- lymphocytes cytotoxic (cellular) responses against the foreign antigen. This immunity is long-lasting even after only one inoculation. The induced immune response is protective against the challenge with pathogenic strains. The use of vaccines with the canarypox virus of the present invention allows differentiating naturally infected from vaccinated animals, because the recombinant canarypox virus expresses a particular set of antigens .

This feature is of great importance in order to be acquainted with the health state of the population and for quickly adopting epidemiologic control measures.

The following embodiment examples, provided below, are intended to be illustrative only and are not to be considered as limiting the present invention.

EXAMPLES

Example 1 - Preparation of CNPV genomic library

A partial CNPV genomic library was prepared. For said purpose, the viral genomic DNA was extracted from purified CNPV by means of a continuous 15-40% sucrose gradient. An attenuated canarypox virus strain called Abbatista95 (DIFTERVAC, Laboratorio LaDiPreVet, La Plata, AR) was used. In order to obtain a genomic library containing clones with overlapping inserts, a mechanical break-up of the genomic DNA was performed by sonication, the DNA ends were repaired with the Klenow and T4 ADN pol enzymes and it was fractioned by size in agarose gel. The fragments larger than 2 kpb were molecularly linked to the plasmid pUC18/SmaI/CIP (Amersham Biosciences) . E. coli DH5 D bacteria were transformed with the linkage products and the recombinant clones were identified by PCR. Finally, the insert ends of 129 recombinant clones were sequenced and the obtained sequences were compared with the GenBank database using the Blast Search program (Altschul S. F. et al . , Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402, 1997). This way, genes having homology with other genes in the poxvirus family and which codify for viral replication essential and nonessential proteins were identified.

The canarypox CNPV018, CNPV048, CNPV134, CNPV186 and CNPV265 genes were selected as potential target sites for the insertion of foreign genes, given that they presented homology with the genes described as nonessential in other members of the poxvirus family. Stable recombinant CNPVs could only be obtained for the first three cases.

CNPV186 and CNPV265 genes were selected because they presented homology with genes H3L and A27L respectively, described as nonessential in the vaccinia virus. Contrary to what was expected, the genes CNPV186 and CNPV265 would be essential for the CNPV replication in culture, as described below, having to be discarded for their use as a target site for obtaining the recombinant CNPV. Analysis of the CNPVl86 gene

In the vaccinia virus the H3L gene codifies for an immunodominant protein of 30-35 kDa, which is present in the membranes of IMV (intracellular mature virions) and its deletion yields a small lysis plaques phenotype (da Fonseca et al . , Characterization of the vaccinia virus H3L envelope protein: topology and posttranslational membrane insertion via the C-terminal hydrophobic tail, J. Virol. 74(16): 7508-7517 2000a; da Fonseca et al . , Effects of deletion or stringent repression of the H3L envelope gene on vaccinia virus replication, J. Virol. 74(16): 7518-7528 2000b). In order to obtain recombinant CNPV with the small lysis plaques phenotype and, taking into account that the CNPVl86 gene had a 30% homology with the H3L gene, a transfer vector was constructed that allowed deleting the CNPV186 gene by insertion.

In the process of CNPV recombinant virus generation with insertion in the CNPV186 gene, four additional screening passages were needed to achieve an homogeneous recombinant stock, when compared to those required for the stable recombinant virus obtained through insertion in the CNPV048 and CNPV134, . When the viral clones were characterized by PCR with specific oligonucleotide pairs, the recombinant viruses were found to carry the complete transfer vector within their genome, which might have occurred by recombination at a unique site and not through allele replacement of the wild CNPV186 gene. By means of a Western blot assay it was confirmed that the recombinant CNPV carried and expressed the wild CNPV186 protein.

In order to assess the genetic stability of these recombinant virus 8 blind passages through CEF were performed. When the 8th screening was made using X-gluc as a substrate, white lysis plaques were observed again. This result indicated that the uidA gene had been split by intramolecular homologous recombination, showing the genetic instability of the recombinant virus that had genomic duplications (complete CNPV186 gene and interrupted by the expression cassette "GUS").

As a consequence, the CNPVl86 gene was determined to be essential for the replication of the CNPV in culture and also that it may not be used as a target site for obtaining the recombinant CNPV. Analysis of the CNPV265 gene

Dallo et al . (A 14K envelope protein of vaccinia virus with an important role in virus-host cell interactions is altered during virus persistence and determines the plaque size phenotype of the virus, Virology 159(2): 423-432), showed that the changes in size of a vaccinia virus structural protein of 14 kDa, encoded by the A27L gene, determined the size phenotype of small lysis plaque. The fowlpox virus lacks the protein homologous encoded by the A27L gene and its absence could explain the EEV virions production by budding in this virus (Afonso et al., The genome of fowlpox virus, J. Virol. 74(8): 3815- 3831, 2000; Boulanger et al . , Morphogenesis and release of fowlpox virus. J. Gen. Virol. 81: 675-687, 2000). However, the carboxy-terminal region of the FPV191 protein showed a surprising similarity (53%) with the carboxy-terminal region of the 14 kDa protein encoded by the A27L gene of the vaccinia virus (Boulanger et al., Identification and characterization of three immunodominant structural proteins of fowlpox virus, J. Virol. 76(19): 9844-9855, 2002 b) . The FPV191 gene codifies for a protein that forms

ATI proteic bodies (inclusion bodies type A) (Afonso et . al . , 2000) . The family of genes homologous to ATIs proteins is highly conserved even though its organization is highly variable in the different poxvirus, indicating a complex pattern of genetic duplications and deletions.

It was proposed obtaining the recombinant CNPV of small plaque phenotype by insertion in the CNPV265 gene that presents homology with the A27L gene. The insertion of the "GUS" expression cassette in the CNPV265 gene of CNPV prevented the isolation of the stable recombinant virus, which suggested that the intact CNPV265 gene is essential for the efficient growth of CNPV in cell culture. This result coincides with the reports by Boulanger et al . (2002 b) , who were not able to isolate fowlpox virus having the FPV191 deleted gene, using either the dominant transient selection system or the direct insertional mutagenesis strategy. However, the 94 kDa and 14 kDa proteins of the W, which did not form ATIs, are not essential (Patel et al . , A poxvirus-derived vector that directs high levels of expression of cloned genes in mammalian cells, Proc . Natl.

Acad. Sci. U. S.A 85(24): 9431-9435, 1988; Rodriguez and Smith, IPTG-dependent vaccinia virus: identification of a virus protein enabling virion envelopment by Golgi membrane and egress, Nucleic Acids Res. 18: 5347-5351, 1990). As a consequence, the essential nature of this protein in two viruses belonging to the avipoxvirus genus may represent a novel feature of the ATI type proteins .

Furthermore, its presence in IMV virions as well as in EEV virions and its late expression was confirmed by- Western blot assays with specific antiserum directed against the CNPV265 protein. The features of this protein in the avipoxvirus suggest that it has different functions, as contrary to those reported for the homologous A27L protein of the vaccinia virus .

Example 2 - Design and preparation of intermediate plasmids for the cloning of the genes of interest Example 2A Using the pH6 promoter: A cloning cassette containing the early/late H6 promoter from vaccinia virus (Rosel J. L., Earl P. L., Weir J. P. and Moss B. Conserved TAAATG sequence at the transcriptional and translational initiation sites of vaccinia virus late genes deduced by structural and functional analysis of the HindIII H genome fragment . J Virol. 60: 436-49, 1986), a translation initiation codon in the appropriate context, a tri-linker and transcription termination sequences (Yuen L. and Moss B. Oligonucleotide sequence signaling transcriptional termination of vaccinia virus early genes. Proc . Natl. Acad. Sci. U.S.A. 84:6417-

21, 1987) were designed and obtained.

The H6 promoter used, present upstream of the vaccinia virus ORF H6 (positions -124 to -1) has the position -102 changed from A to G to avoid a potential initiation codon.

The designed tri-linker introduced three unique sites for restriction enzymes (Bam HI, Sma I and Stu I) and allows the subcloning of any gene of interest keeping a continuous reading frame from the AUG translation initiation codon. The insert called "cloning cassette" is flanked by recognition sites for a rare-cutting restriction enzyme (Not I) which was used for its later subcloning in the transfer vectors . The "cloning cassette" was obtained again from 4 partially overlapping synthetic oligonucleotides. These oligonucleotides were hybridized to each other and the inner sequences were filled using the T7 ^' phage DNA polymerase enzyme . The double chain DNA fragment thus obtained was directionally subcloned in the bacterial plasmid pBlueScript (Stratagene) , using the restriction enzymes Xba I and Kpn I. The recombinants, called pHδnot, were analyzed by restriction mapping and sequencing.

To perform the coupling of the partially overlapping oligonucleotides pH6-oli 1/2/3/4, 10 Dg of each were taken (final concentration 0.2 Dg/Dl) . They were boiled for 4 min. and cooled slowly to room temperature. The dNTPs (0.5 mM) were added, 13 U of the T7 DNA polymerase enzyme and the appropriate buffer. The mixture was incubated for 30 min. at 37°C. The enzyme was inactivated by heating' 10 min. at 70⁰C. The cloning cassette sequence of plasmid pHβnot (SEQ ID No 8) is shown in Figure 1. Example 2B Using the pEL synthetic promoter

Blasco and Moss (Blasco R. and Moss B. Selection of recombinant vaccinia virus on the basis of plaque formation, Gene. 158:157-62, 1995) obtained the pRB21 plasmid, which has a cloning cassette designed to clone ORFs either complete or incomplete. The cassette contains the strong early/late E/L synthetic promoter of the vaccinia virus, a multiple cloning site (MCS) and transcription termination sequences . The MCS has seven unique restriction sites downstream of the promoter, for the insertion of the gene. The translation termination codons in the three reading frames and a poxvirus early transcription termination signal TTTTTAT, are after the CMS.

The cloning cassette pE/L which contains the cassette present in the pRB21 plasmid, and another cloning cassette pE/Lnot, similar to pE/L but flanked by recognition sites for the rare-cutting restriction enzyme Not I, were obtained in our laboratory.

In order to produce the recombinant pEL plasmid, the cloning cassette pE/L was prepared by digestion of the pRB21 plasmid with the enzymes Xho I/Bam HI and was cloned directionally in the pBluescript plasmid (Stratagene) by digestion with the same enzymes.

In order to produce the recombinant pE/Lnot plasmid, the cloning cassette pE/L was prepared by digestion of the pRB21 plasmid with the enzymes Xho I/Bam HI, refilling its ends with the Klenow fragment. Subsequently, it was cloned in the pHβnot plasmid digested with Xba I (refilling its ends with the Klenow fragment) and Stu I. The cloning cassette sequences of the pE/Lnot plasmid (SEQ ID No 9) are shown in Figure 2. Example 3 - Construction of plasmidic vectors carrying selected genomic regions from CNPV

The nucleotidic positions indicated in the present description correspond to the genomic positions of the complete canarypox virus sequence deposited in the GenBank with the Accession Number AY318871 (Tulman et. al . , 2004). Example 3A - Construction of plasmidic vectors carrying the CNPVO48 gene

The clone 5000 was selected from the CNPV genomic library, wherein its insert, of approximately 2.3 kpb, has a portion of the canarypox virus CNPV048 gene. The insert comprises the genomic fragment from position 57248 (inside the CNPV046 gene) to position 59527 (inside the CNPV048 gene) . Inside the genomic region of the CNPVO48 gene of clone 5000, a recognition site for the rare-cutting restriction enzyme Not I (unique site within the clone) was added by directed mutagenesis. For said purpose, a fragment of approximately 600 pb was amplified by PCR using the oligonucleotides PClF (5' GAGGATCCCCGATTGAAGA - SEQ ID No

10) and PClR {5" GTATGCATGCGGCCGCTTGCACGGTTATTA - SEQ ID No

11) . The PClF oligonucleotide has a recognition site for the Bam HI enzyme and the oligonucleotide of negative polarity, PClR, includes the recognition site for the Not I enzyme together with the site for the Nsi I enzyme, present in the original gene. The clone 5000 has a unique cleavage site for Bam HI (in the multiple cloning site) and a unique cleavage site for Nsi I (in position 58963 of the CNPV048 gene) . Subsequently, the Bam HI/Nsi I fragment of the clone 5000 was replaced by the amplification fragment digested with the same enzymes .

Hence, the vector pUC-048, which has a unique restriction site for the Not I enzyme inside the CNPV048 gene, was obtained by insertional mutagenesis. The cassettes of interest may be cloned in this vector, for example, in the unique sites Not I and Nsi I. Example 3B - Construction of plasmidic vectors carrying the CNPVl34 gene The clone 5063 was selected from the CNPV genomic library, wherein its insert has a portion of the canarypox virus CNPV134 gene.

A fragment of 420 pb, comprising part of the CNPV134 gene and of the intergenic CNPV134-CNPV135 region, was amplified by PCR. The clone 0563 was used as a template and the oligonucleotides 107F (5" GGGGTACCATTAACAATTGTA, - SEQ ID No 12) and 107R, (5' TCCCCGCGGTATATTTATACTGT, - SEQ ID No 13) which include the recognition sites for the Kpn I and Sac II enzymes respectively, were used as primers. The amplification product digested with the restriction enzymes Kpn I and Sac II was directionally cloned in the pBluescript plasmid (Stratagene) , previously digested with the same enzymes, and the vector pBS-134 was obtained. The cassettes of interest may be cloned in this vector, for example, in the unique sites Hinc II and Nsi I, present in the pBS-134 clone sequence, corresponding to the genomic positions 157433 and 157567, respectively. Example 3C - Construction of plasmidic vectors carrying the CNPVO18 gene

The clone 5006 was selected from the CNPV genomic library, wherein its insert, of approximately 2 kpb, has a portion of the canarypox virus CNPV018 gene.

The clone 5006 was digested with the restriction enzyme Eco RI (that cleavages in position 23528 of the CNPV018 gene) and in the vector polylinker, and was relinked discarding a genomic fragment of approximately 1600 pb. The pUC-018 clone was thus obtained, comprising the canarypox virus genomic region between positions 23527 and 23989.

The cassettes of interest may be cloned in this vector, for example, in the unique site Spe I, present in the pUC-018 clone in the genomic region corresponding to position 23846. This site is not present in said position of the sequence deposited in the GenBank, with the Accession Number AY318871.

Example 4 - Preparation of the expression cassettes for the genes of interest

The genomic regions codifying for the selected immunogenic proteins were amplified by RT-PCR or PCR using specific initiation oligonucleotides from the purified genome (RNA or DNA, respectively) of the pathogenic microorganism.

In the case of genes codifying for cytokines (interferon alpha and beta) these were amplified from genomic DNA purified from cell lines (e.g. PK15) or from bovine peripheral blood lymphocytes. The amplification products were cloned in the pEL or pELnot plasmid in an oriented manner and under the regulation of the synthetic strong early/late E/L vaccinia virus promoter .

As an example, the preparation of a cassette for the gene codifying for the gD glycoprotein of the bovine herpes virus type 1 (BHV-I) is detailed below. The gene codifying for the gD glycoprotein of the bovine herpes virus type 1 (BHV-I) was amplified by PCR from the viral genomic DNA using specific initiation oligonucleotides (Zamorano P. et al . BHV-I DNA vaccination: effect of the adjuvant RN-205 on the modulation of the immune response in mice. Vaccine 20: 2656-2664, 2002) . In order to amplify the complete codifying sequence of the gD (membrane) glycoprotein the oligonucleotides S+ (5' AAGAATTCGGCTGCTGCGAGCGGGCCGAACA SEQ ID NO 14) and A- (5' AAGAATTCGGGGGCGGTCGGGGGAGG SEQ ID NO 15) were used. In order to amplify the codifying sequence of the gD glycoprotein that lacks the membrane anchorage region (gDs secreted version) the oligonucleotides S+ (SEQ ID No 14) and C- (5" AAGAATTCTCAGGCGTCGGGGGCCGCGGGCG SEQ ID No 16) were used. The recognition sites for the Eco RI enzyme present in the oligonucleotides are indicated underlined. The amplification fragment that codifies for the gDs was cloned in the commercial vector pGemTEasy (Promega) and, subsequently, it was subcloned in the Eco RI site of the pEL cloning plasmid previously digested con the same enzyme. A clone having the gD gene correctly oriented with respect to the E/L promoter was selected to obtain the pEL- gD plasmid. Subsequently, the E/L-gD-terminator expression cassette was released by restriction with the Bam HI and Xho I enzymes and the 5' protruding ends generated were refilled by treatment with the Klenow enzyme so as to obtain blunt ends .

In a similar way, the cassettes for expression of the genes codifying for the selected proteins: structural VPl protein or precursor Pl or chimeric protein P1-2A-3C of the foot and mouth disease virus; E2 or Erns glycoproteins of the bovine viral diarrhea virus,- G glycoprotein of the rabies virus; F or HN proteins of the Newcastle disease virus; VP2 protein or precursor polyprotein VPX-VP4-VP3 of the Gumboro disease virus; Hemagglutinin protein (HA) of the type A avian influenza virus; interferon alpha and beta of porcine or bovine source, were prepared.

Example 5 - Preparation of the expression cassettes for the marker genes

The genomic regions codifying for the bacterial enzymes D-glucuronidase (GUS) and D-galactosidase (D~gal) were cloned in the pH6not plasmid under the regulation of the early H6 promoter of the vaccinia virus .

The uid A gene, which codifies for the GUS enzyme, was prepared from the pBI121 plasmid (Clontech) by digestion with the enzymes Sac I (with removal of the 3' protruding end by treatment with the T4 DNA polymerase enzyme) and Bam HI. This fragment was directionally cloned in the pHβnot plasmid digested with the enzymes Bam HI and Stu I keeping the continuous reading frame between the initiator ATG and the ATG of the uid A gene. This plasmid was called pH6GUS .

The lac Z gene, which codifies for the D~gal enzyme, was obtained through PCR amplification using the initiator oligonucleotides lacZF [S" CCCCCCTTAATTAAACTGGCCGTCGTTTTACAACG - SEQ ID No 17) and lacZR (5' CCCCCCTCTAGATTTTTGACACCAGACCAACTGG - SEQ ID No 18) and the pEFL29 vector (Qingzhong et al . , Protection against turkey rhinotracheitis pneumovirus (TRTV) induced by a fowlpox virus recombinant expressing the TRTV fusion glycoprotein (F). Vaccine, 12:569-73, 1994) as a template. The amplification fragment was cloned in the commercial vector pGemT-Easy (Promega) to obtain the pGemT-LacZ plasmid. The insert of this plasmid was extracted by restriction with the Eco Ri enzyme (for which there are 2 recognition sites flanking the insert), the 5' protruding ends were refilled by treatment with the Klenow enzyme and it was subcloned in the pH6not plasmid. By mapping with restriction enzymes the recombinant plasmids which had the insert correctly oriented with respect to the H6 promoter were selected. Given the cloning strategy the reading frame is kept continuous between the ATG initiator and the fifth codon of the lacZ gene (incorporated along with the lacZF oligonucleotide, underlined) . This plasmid was called pH6D. Example 6 - Construction of the transfer vectors for obtaining the recombinant canarypox virus

The transfer vector used for obtaining the recombinant canarypox virus was prepared by sequential subcloning of the expression cassette of the gene of interest selected from those mentioned in Example 4 and the expression cassette for the marker gene such as those disclosed in Example 5 in the unique restriction sites present in the plasmidic vectors disclosed in Examples 3A, 3B and 3C (pUC-048, pBS-134 o pUC-018, respectively) .

As an example, the construction of the transfer vector called VT048-GTJSgD, which carries the expression cassettes EL-gD and H6-GUS in the plasmidic vector pUC-048, is described.

The expression cassette of the marker gene uid A

(which codifies for the GUS enzyme) present in the pH6-GUS plasmid (see Example 5) was released by restriction with the Not I enzyme and was subcloned in the unique Not I restriction site present in the plasmidic vector pUC-048 (see Example 3A) thus obtaining the construct called pO48- GUS.

The fragment containing the expression cassette E/L-gD-terminator which codifies for the gD glycoprotein of the bovine herpes virus type 1, obtained according to Example 4, was subcloned in the pO48—GUS plasmid at a unique blunt site generated by digestion with the Nsi I enzyme (unique cleavage site in position 58963 of the CNPV048 gene) and removal of the 3' protruding ends by treatment with the T4 DNA polymerase enzyme. This way, the transfer vector VT048-GUSgD was obtained, which carries the expression cassettes for the gene of interest (gene of the gD glycoprotein of the BHV-I under the regulation of the synthetic E/L promoter of the vaccinia virus) and the marker gene that will allow the selection of the recombinant virus {uid A gene under the regulation of the H6 promoter of the vaccinia virus) flanked by genomic regions of the canarypox virus that correspond to the CNPV048 gene, which will serve as recombination sites with the viral genome for obtaining the recombinant canarypox virus expressing the gD glycoprotein of BHV-I.

Following a similar process, the following transfer vectors were constructed:

VT048-GUSVP1, VT048-GUSP1, VT048 -GUSP1-2A-3C,

VT048-GUSE2, VT048-GUSE^rns, VT048-GUSG, VT048-GUSF, VT048-

GUSHN, VT048-GUSgB, VT048-GUSVP2 , VT048-GUSVPX-VP4-VP3 ,

VT048-GUSHA, VT048-GUS interferon alpha, VT048-GUS interferon beta;

VT048-βgalVPl, VT048-βgal Pl, VT048-βgalPl-2A-3C, VT048-βgal gD, VT048-βgalE2 , VT048-βgalE^rns, VT048-βgalG, VT048-βgalF, VT048-βgalHN, VT048-βgalgB, VT048-βgalVP2 , VT048-βgalVPX-VP4-VP3, VT048-βgalHA, VT048-βgal interferon alpha, VT048-βgal interferon beta;

VT134-GUSVP1, VT134-GUSPl, VT134-GUSP1-2A-3C,

VT134-GUSgD, VT134-GUSE2, VT134-GUSE^rns, VT134-GUSG, VT134-

GUSF, VT134-GUSHN, VT134-GUSgB, VT134-GUSVP2 , VT134-GUSVPX-

VP4-VP3, VT134-GUSHA, VT134-GUS interferon alpha, VT134-GUS interferon beta;

VT134-βgalVPl, VT134-βgal Pl, VT134-βgalPl-2A-3C, VT134-βgal gD, VT134-βgalE2 , VT134-βgalE^rns, VT134-βgalG, VT134-βgalF, VT134-βgalHN, VT134-βgalgB, VT134-βgalVP2 , VT134-βgalVPX-VP4-VP3, VT134-βgalHA, VT134-βgal interferon alpha, VT134-βgal interferon beta;

VT018-GUSVP1, VT018-GUSP1, VT018-GUSP1-2A-3C, VT018 -GUSgD, VT018-GUSE2, VT018-GUSE^rns, VT018-GUSG, VT018- GUSF, VT018-GUSHN, VT018-GUSgB, VT018-GUSVP2 , VT018-GUSVPX- VP4-VP3, VT018 -GUSHA, VT018-GUS interferon alpha, VT018-GUS interferon beta;

VT018-βgalVPl, VT018-βgal Pl, VT018 -βgalPl-2A-3C, VT018-βgal gD, VT018-βgalE2 , VT018-βgalE^rns, VT018-βgalG, VT018-βgalF, VT018-βgalHN, VT018-βgalgB, VT018-βgalVP2 , VT018-βgalVPX-VP4-VP3, VT018-βgalHA, VT018-βgal interferon alpha, VT018-βgal interferon beta.

Example 7 - Preparation of the recombinant canarypox virus The canarypox virus was amplified in primary chicken embryo fibroblast (CEFs) culture prepared from 9-10 days old embryo eggs, certified as specific pathogen free

(SPF), grown in IX Earle 199 medium supplemented with 2.95 mg/ml phosphate tryptose broth, 2.2 mg/ml sodium bicarbonate, 0.3 mg/ml L-glutamine, bovine fetal serum (10% for the growing media and 2% for the maintenance media) , 50 Dg/ml gentamicin, 66 Dg/ml streptomycin and 100 U/ml penicillin.

In order to obtain the recombinant canarypox virus (CNPV) , the foreign DNA is inserted by homologous recombination in vivo en the viral genome. To that end, a monolayer of CEFs grown to a 80-90% confluence in a 25 cm² plastic bottle, was infected with CNPV at a multiplicity of infection of 1. After 4 hs post infection, the transfer vector VT048-GUSgD, obtained according to Example 6 was introduced by transfection using Lipofectin (Invitrogen) , a cationic lipidic reagent that forms little monolayered liposomes in aqueous solution. The surface of these liposomes is positively charged and the DNA is electrostatically attracted (by the negative charges of the phosphates) . Furthermore, due to the fact that the cell surface is negatively charged, the DNA-liposomes complexes are linked to the cell wall and the DNA is released inside the cell. The DNA-lipofectin complexes were prepared using 10

Dg purified VT048-GUSgD transfer vector (high quality) with 30 ng lipofectin (Invitrogen) . Once the complexes are formed, they were added on to the CEFs monolayer. The day after, the medium was replaced by fresh culture medium, incubated until cytopathic effect was visualized and it was frozen at -70⁰C. Prior to the selection of the CN048-GUSgD recombinant canarypox virus, 3 freezing (-70⁰C) -thawing (37⁰C) cycles were carried out.

Following a similar procedure, the following recombinant canarypox virus were obtained:

CN048-GUSVP1, CN048-GUSP1, CN048-GUSP1-2A-3C,

CN048-GUSE2, CN048-GUSE^rns, CN048-GUSG, CN048-GUSF, CN048- GUSHN, CN048-GUSgB, CN048-GUSVP2, CN048-GUSVPX-VP4-VP3 ,

CN048-GUSHA, CN048-GUS interferon alpha, CN048-GUS interferon beta;

CN048-βgalVPl, CN048-βgal Pl, CN048-βgalPl-2A-3C, CN048-βgal gD, CN048-βgalE2, CN048-βgalE^rns, CN048-βgalG, CN048-βgalF, CN048-βgalHN, CN048-βgalgB, CN048-βgalVP2, CN048-βgalVPX-VP4-VP3, CN048-βgalHA, CN048-βgal interferon alpha, CN048-βgal interferon beta;

CN134 -GUSVPl, CN134 -GUSPl, CN134 -GUSPl-2A-3C,

CN134 -GUSgD, CN134-GUSE2, CN134-GUSE^rns, CN134-GUSG, CN134- GUSF, CN134-GUSHN, CN134-GUSgB, CN134-GUSVP2 , CN134-GUSVPX-

VP4-VP3, CN134-GUSHA, CN134-GUS interferon alpha, CN134-GUS interferon beta;

CN134-βgalVPl, CN134-βgal Pl, CN134-βgalPl-2A-3C, CN134-βgal gD, CN134-βgalE2, CN134-βgalE^rns, CN134-βgalG, CN134-βgalF, CN134-βgalHN, CN134-βgalgB, CN134-βgalVP2, CN134-βgalVPX-VP4-VP3, CN134-βgalHA, CN134-βgal interferon alpha, CN134-βgal interferon beta;

CN018-GUSVP1, CN018-GUSP1, CN018-GUSP1-2A-3C,

CNO18 -GUSgD, CN018-GUSE2, CN018-GUSE^rns, CNO18-GUSG, CNO18- GUSF, CN018-GUSHN, CN018-GUSgB, CN018-GUSVP2 , CN018-GUSVPX-

VP4-VP3, CN018-GUSHA, CN018-GUS interferon alpha, CN018-GUS interferon beta; CN018-βgalVPl, CN018-βgal Pl, CN018-βgalPl-2A-3C,

CN018-βgal gD, CN018-βgalE2, CN018-βgalE^rns, CNOlδ-βgalG,

CNOlδ-βgalF, CN018-βgalHN, CN018-βgalgB, CN018-βgalVP2,

CN018-βgalVPX-VP4-VP3, CN018-βgalHA, CN018-βgal interferon alpha, CN018-βgal interferon beta.

Example 8 - Selection of the recombinant canarypox virus

For the selection of the recombinant CNPV the infective particle cloning method under agar was used. For said purpose, the viral suspension from the transfection (see Example 7 above) was titrated in CEFs monolayers grown in 60 mm diameter plaques. The cultures were infected with serial decimal dilutions of the viral suspension; after 30- 45 min. the inocula were discarded and semisolid culture media was added (containing final 0.7% low melting point agarosa) . The infected cultures were incubated in a stove until visualization of the characteristic CNPV lysis plaques, which are seen 4-5 days post infection. In order to select the recombinant virus, semisolid culture medium containing the substrate (X-Gluc in the present case) of the enzyme codified by the uid A marker gene was added. The cells were incubated until visualization of the blue lysis plaques, which were pinched and transferred to a test tube containing 500 Dl culture medium, 3 freezing (-70⁰C)- thawing (37⁰C) cycles were carried out in order to release the virus.

This step constitutes the first screening step. The viral cloning was repeated at least 4-5 times until an homogeneous viral stock was obtained that produced 100% blue lysis plaques, which was amplified for its subsequent characterization.

According to a particular embodiment, 6 cloning steps of the infective particles were performed under agar, for obtaining a pure CN048-GUSdD stock. Example 9 - Characterization of the recombinant canarypox virus

Once the homogeneous recombinant viral stock for the marker gene was obtained (it produces 100% blue lysis plaques) its molecular and biological characterization was carried out.

Example 9A - Characterization of the insertion of the gene of interest in the viral genome

The insertion of the gene of interest in the recombinant CNPV genome, selected for their ability to form blue lysis plaques, was confirmed through PCR and Southern blot techniques. In all cases, the total DNA was extracted from the CEFs cultures infected with the recombinant virus and was used as a template in the PCR reactions or was digested with restriction enzymes for its subsequent analysis by Southern blot.

Particularly, in the exemplary recombinant virus CN048-GUSgD, the specific initiator oligonucleotides S+ (SEQ ID No 14) and C- (SEQ ID No 16) , that allow for the amplification of the region codifying for the gD glycoprotein of the BHV-I, were used for the PCR reactions, and total DNA from CEFs infected with the selected recombinant CN048-GUSgD virus that showed 100% blue lysis plaques (identified en this example as viral clones No. 14, 15 and 16) was used as a template. The cycling conditions were established in a particular way for each gene to be amplified. In the example provided, the conditions were similar to those used by Zamorano et . al . (2000), i.e.: Template gDNA from CNPV-gDs

Final concentration of : MgCl₂ 2 mM - Glicerol 10% DMSO 6%

Amplified pairs of bases

Aprox. 1100

Cycling

Initial Denaturalization 94°C, 5 min.

30 cycles Denaturalization 94 °C, 1 min. Hybridization 67 °c, 1 min. Elongation 72 ⁰C, 2 min.

Final elongation 72°C, 10 min.

Figure 3 shows a photograph of the resolution by agarose gel electrophoresis of the PCR amplification products of the gD glycoprotein codifying region in the selected recombinant CN048 -GUSgD virus that showed 100% blue lysis plaques, identified as viral clones No. 14, 15 and 16. NC represents a reaction negative control (without DNA added) ; PC represents a reaction positive control

(using the transfer vector VT048-GUSgD as a template) ; M represents a 1 kb ladder molecular weight marker

(Invitrogen) . The arrow indicates the 1.1 kpb amplification product corresponding to the gD gene. As shown in Figure 3, the recombinant viral clones CN048 -GUSgD No 14 and 16 carried the gD glycoprotein codifying region of BHV-I.

The Southern blot technique was used according to the protocol described by Ausubel et . al . , (Current Protocols in Molecular Biology, Edited by: Ausubel F. M. et al, 1994. Chapter 2, section IV, unit 2.9A). Briefly, the enzymatically digested viral DNA (in the case disclosed the restriction enzymes Hind III and Nde I were used) was resolved by agarose gel electrophoresis, transferred by capillarity to a nylon membrane and the nucleic acids were fixed by UV. After pre-hybridization, the radioactively marked probe was added (in the case disclosed, the PCR amplification fragment described in Example 4 was used) and it was hybridized in the rotary hybridization oven for 16- 18 hs at 65°C. Afterwards, the membrane was washed to remove the non-bound probe and an autoradiography was performed using an X-O-Mat (Kodak) film and intensifier screen at -70°C or room temperature for variable time periods .

To hybridize the nylon membrane with a different probe, the first bound probe was stripped-off with a 0.1% SDS solution preheated at 100⁰C.

The probes used correspond to PCR amplification fragments of the genes of interest or marker genes or genomic regions of CNPV that were used as target site for the insertion of genes . In all cases, it was confirmed by PCR and Southern blot that the selected recombinant virus forming 100% blue plaques had the gene of interest inserted in their genome .

Total DNA from CEFs infected with recombinant viral clones No 14 and 16 of the CN048-GUSgD recombinant virus or with non-recombinant CNPV (V) , was extracted and digested with the restriction enzymes Hind III or Nde I, and was analyzed by the Southern blot technique (see Figure 4) , using the probes corresponding to the genes gD (A) or CNPV048 (B) . Furthermore, checking the correct insertion in the CNPV genome of the gene of interest, gD in this case, by the Southern blot technique, its purity was confirmed, because by hybridizing the membrane with the probe corresponding to the insertion site (in the case described a PCR amplification fragment was used, as described in Example 3A) a differential band pattern between the recombinant virus CN048-GUSgD and the nonrecombinant one (Figure 4B) was always observed. Example 9B - Characterization of the expression of the gene of interest in the viral genome

The transcriptional apparatus that is packed inside the core of infective particles in the poxvirus allows for the synthesis of early viral raRNA within the cytoplasm of the infected cell. Due to the cloning strategy, the expression of the gene of interest is under the regulation of early promoter sequences of the vaccinia virus (E/L synthetic promoter) . In this way, the expression of the gene of interest is produced both in the cells where the CNPV replicates (CEFs) and in those cells where the CNPV does not replicate (for example, mammal cells) .

The correct expression of the gene of interest in the recombinant CNPV was confirmed by the immunoperoxidase techniques (modified from the Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. 0IE, 2004, CHAPTER 2.10.6. http: //www.oie.int/eng/normes/mmanual/A_00132.htm) , Northern o Western blots (Ausubel et al . , 1994) . Expression assessment of the recombinant CN048-GUSgD virus

The expression of the gene codifying for the gD glycoprotein of BHV-I from the CN048-GUSgD recombinant virus was assessed by the immunoperoxidase technique. For said purpose, BHK-21 infected cell cultures were fixed 24 hs post infection, incubated successively with a specific antiserum directed against the gD glycoprotein (anti- AcSupgD, Peralta A., Molinari P, Conte Grand D., Calamante G. y Taboga O. Un baculovirus quimerico expresa en su superficie Ia glicoproteina gD como vacuna contra el herpesvirus bovino. Revista Argentina de Microbiologla, Vol. 37, Supl. 1: 88, 2005) and with an anti-mouse antiserum conjugated to the horseradish peroxidase enzyme.

Subsequently, the peroxidase activity was detected in situ by using 3-amino-ethyl-carbazole and H₂O₂ as substrates. The stained cells were observed under an optical microscope (10Ox magnification) . The photographs of one of the non- stained (CNPV) and stained (CN048 -GUSgD) cells field are shown in Figure 5, confirming the expression of the gD glycoprotein in the latter cells. For the Northern blot assays, the total RNA from infected cells was extracted 24 hs post infection by a modification of the technique described by Chomczynski and Sacchi (Chomczynski P. and Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol- chloroform extraction. Anal. Biochem. 162: 156-9, 1987) which uses the Trizol reagent (Invitrogen) . The Northern blot technique was used according to the protocol described by Ausubel et. al . (1994; Chapter 4, section II, unit 4.9). Briefly, the total viral RNA was purified from culture of susceptible CEFs cells (Figure 6A) or non-susceptible BHK- 21 cells (Figure 6B) infected with the CN048-GUSgD recombinant virus (viral clones identified as No 14 and 16) or with the non-recombinant CNPV (V) . The purified viral RNA was resolved by denaturalizing agarose gel electrophoresis, transferred by capillarity to a nylon membrane and the nucleic acids were fixed by UV. After pre- hybridization, the radioactively marked probe was added (in the present example, the PCR amplification fragment described in Example 4 was used) and it was hybridized in the rotary hybridization oven for 16-18 hs at 65°C.

Afterwards, the membrane was washed to remove the non-bound probe and an autoradiography was performed using an X-O-Mat

(Kodak) film and intensifier screen at -70⁰C or room temperature for variable time periods . To hybridize the nylon membrane with a different probe, the first bound probe was stripped-off with a 0.1% SDS solution preheated at 100⁰C. The probes used correspond to PCR amplification fragments of the genes of interest or marker genes or genomic regions of CNPV that were used as target site for the insertion of genes. Figure 6 shows the expression level of the RNA of the gene encoding the gD glycoprotein of BHV- 1 from the CN048-GUSgD recombinant virus (14 and 16) . This expression is produced both in susceptible (CEFs, Figure 6A) and non-susceptible (BHK-21, Figure 6B) cells.

For the Western blot assays, a total extraction of proteins from the cells infected was performed 24 hs post infection. Shortly, the cells were harvested in inoculation buffer 2X (100 mM Tris-HCl, 20% glycerol, 4% SDS, 200 mM DTT, 0.2% bromophenol blue), boiled for 5 min. and sonicated at intermediate intensity. The protein extracts were resolved by denaturalizing polyacrylamide gel electrophoresis (PAGE-SDS) and subsequently electro- transferred to nitrocellulose membranes. For their analysis by Western blot assays (Ausubel et . al . 1994; Chapter 10, section III, unit 10.8), appropriate dilutions of specific antisera (directed against the protein of interest) and anti-species antibodies conjugated to alkaline phosphatase were successively used. The revelation was performed using the substrates nitroblue-tetrazolium and bromo-chloro- indolyl-phosphate .

Expression assessment of the recombinant CN048-GUSE2 virus

According to a particular embodiment and as an example, total protein extracts from CEFs cultures infected with the CN048-GUSE2 recombinant virus (CN-E2) or the CNPV non-recombinant (CN) virus were assessed this way. The monoclonal antibody (19f9fb) directed against the E2 glycoprotein of BVDV (gently provided by Dr. R. Donis of the University of Nebraska, USA) was used, and the Bench

Mark Prestained Protein Ladder (Invitrogen) was used as molecular weight (M) marker. The result of the assay is shown in Figure 7, wherein the detection of the expression of E2 glycoprotein from BVDV is observed.

Expression assessment of the porcine/bovine CN048- interferon beta and CN048 -interferon alpha recombinant viruses In order to determine their capacity to induce an antiviral state in MDBK cells, the infection supernatants of the recombinant canarypox virus carrying the porcine/bovine interferon alpha/beta genes were evaluated.

With the purpose of minimizing the cytopathic effect caused by the CNPV in MDBK cells, it was determined that the protocol producing the higher inactivation grade of the poxvirus in the infection supernatant consists of incubation at 56⁰C for 30 min. and subsequent filtering through a 0.2 Dm membrane . Afterwards, MDBK cell monolayers were optionally pre-treated with one-half dilution series (see rows A, B, C, E, F and G in Figure 8) of the infection supernatants of CNPV and CN048-GUS interferon beta (bovine) for 6 hs and then infected with VSV (vesicular stomatitis virus) . The assay was performed by triplicate (columns 1 to 3, 4 to 6, respectively) . Two rows (D and H) were treated only with the poxvirus infection supernatant but without being infected (poxvirus effect control) .

The pre-treatment of the cells with the infection supernatants of CN048-GUS interferon beta (bovine) protected the cytopathic effect produced by VSV. The antiviral effect is induced by the IFNs expressed by the recombinant CNPV, given that the pre-incubation with the infection supernatant of non-recombinant CNPV did not induce antiviral state. Similar results were observed with the infection supernatants of other recombinant CNPVs . This experiment showed that the IFNs expressed from the recombinant poxvirus are biologically active. Simultaneously, the antiviral activity of the infection supernatants of the recombinant poxvirus was assessed over IBRS-2 cell monolayers not producing endogenous IFN. In all cases, a similar effect to the one described above was observed.

Furthermore, the antiviral capacity of cell supernatants infected with the recombinant canarypox viruses (CN048-GUS interferon alpha and CN048-GUS interferon beta) for inhibiting the FMDV replication over IBRS-2 cells was analyzed. The methodology used was similar to the one described above. Briefly, IBRS-2 cells were incubated with the supernatants of cells infected with the recombinant virus; after the adequate time, the cells were infected with FMDV and subsequently, the dilution of each supernatant capable of protecting the IBRS-2 cells from FMDV infection was determined.

The results obtained are shown in the following table :

Virus Dilution showing protection

CN048-GUS interferon alpha (porcine) 1/10⁴

CN048-GUS interferon beta (porcine) 1/200

CN048-GUS interferon alpha (bovine) 1/1600

CN048-GUS interferon beta (bovine) 1/200

Example 9C - Evaluation of replication rate of the recombinant CNPV

Taking into consideration that new insertion sites were used in the present invention for obtaining the recombinant canarypox virus , determining that the insertion had not altered the replication capacity of the recombinant CNPV was essential .

For that purpose , a multiple step growth curve was performed wherein the CEFs cultures were infected at a low multiplicity of infection (0.1 - 0.01) with recombinant CN048-GUSgD and nonrecombinant (CNPV) virus, and the culture medium and cells were harvested at different post infection times. Subsequently, those viral extracts were separately titrated and the titer for each time point was calculated as the amount of lysis plaque forming units per ml. In the following table the results obtained are indicated.

between the titers obtained for the recombinant virus and the non-recombinant virus. Therefore, it was concluded that all the recombinant virus do not have an altered viral replication rate due to the insertion of the foreign gene in the CNPV genomic sites used in the present invention. Example 9D - Evaluation of replication of the recombinant CNPV in mammal cells

The absence of replication of the CN048-GUSgD and CN048-GUSVP1 recombinant CNPV was assessed in mammal cells. For said purpose, 4 blind passages of the recombinant virus were made in BHK-21 cells (baby hamster kidney cell line) and was subsequently titrated in susceptible cells (CEFs) . In all cases, the amount of recovered virus after one passage through BHK-21 cells was observed to be similar to or less than the one corresponding to the initial inoculum, inferring that the virus does not replicate in these cells. On the contrary, the result of the first passage of the same inoculum through susceptible cells shows that the viral titer increases about 100 times. From the second passage onwards, no virus presence in susceptible cells was detected by infection assays in CEFs nor was the viral genome detected by PCR. These results indicate that the recombinant and non-recombinant CNPV are incapable of replicating in the BHK-21 mammal cells.

In the following table, the values of viral titer (expressed as pfu/ml) are indicated.

Replication assessment in mammal cells of diverse sources

The absence of infectious viral progeny in mammal cells of diverse sources infected with the Abbatista 95 strain of CNPV or with the recombinant virus of present invention derived thereof, was verified. Four successive passages of CN048 -GUSVPl and CNPV were performed through the mammal cells MDBK, BHK-21, Vero, HeLa and PKl5. Cell monolayers were infected with the virus at a m.o.i. of 0.05

(inoculum: 2xlO⁴ pfu) and in the successive passages with the non-diluted viral suspension (in each case, with 300 Dl of the previous passage) . The cells were harvested with 1 ml PBS 5 days post-infection. When the viral suspensions of both virus corresponding to the first and second blind passage through the mammal cells were titrated in susceptible cells (CEF) , a general decrease of one and two orders, respectively, in the viral titer was evidenced. This indicated that the Abbatista 95 strain does not replicate in MDBK, BHK-21, Vero, HeLa and PK15 cells. In the following table, the viral titer (pfu/ml) obtained in CEF from the viral suspensions of CNPV-O48GUSVP1 corresponding to the first (1^st) and second (2^nd) passage through the mammal cells is shown.

Example 9E - Genetic stability of the inserted foreign genes

The genetic stability of the foreign genes inserted in the recombinant CNPV genome depends upon the insertion site thereof. For this reason, it is essential to determine whether the insertion of genes in the target sites which are a part of the present invention are kept stable in the recombinant CNPV genomes. For said purpose, the presence and expression of the gene of interest was assessed after 10 blind passages of the recombinant CNPV through the CEFs. This analysis was carried out for two of the types of recombinants obtained (with insertions in the viral genes CNPV048 and CNPV134) , which possess and express the foreign gene after the 10 passages through the CEFs.

Y: indicates the the expression of the protein of interest was detected. NA: indicates "not applying" because the recombinant virus does not carry the gene codifying for said protein. The activity of the GUS enzyme was detected in situ by adding the substrate X-Gluc and the presence of the gD glycoprotein was detected by the imraunoperoxidase assay.

Based on the methodologies described in Examples 7 to 9, the following recombinant CNPV were prepared and characterized:

a: PCR using specific oligonucleotides for the gene of interest; b: Southern blot with specific probe for the gene of interest; c: Northern blot with specific probe for the gene of interest; d: RT-PCR using specific oligonucleotides for the gene of interest; e: Western blot with specific antibodies against the protein of interest; f: immunoperoxidase technique with specific antibodies against the protein of interest; g: biological activity; h: Southern blot with specific probe for the insertion site; i: differential PCR using 3 specific oligonucleotides;

ND : not determined

Example 10 - Evaluation of the immune response induced by the recombinant canarypox viruses

Regarding the evaluation of the immune response induced in experimental animals, 3 examples are described. In all cases, the immunizations were carried out with recombinant and non-recombinant CNPV purified through sucrose cushion.

In the following examples the doses applied were

2xlO⁷ plaque forming units (pfu) in mice (intraperitoneal) or 2xlO⁸ pfu in bovine (intramuscular) .

Example 1OA - Recombinant canarypox virus expressing the VPl protein of the foot and mouth disease virus (FMDV)

The presence of total antibodies against the VPl protein of FMDV was determined to be clearly induced in the group of animals immunized with two or three CN048-GUSVPl doses, obtained in the same way as that described in Example 7. The differences between the groups immunized with CNPV and CN048 -GUSVPl were significant after two or three immunizations (p<0.001 in both cases). The statistical differences among groups were assessed by the

Student t-test (Zar J. H. Biostatistical Analysis. Prentice- Hall, New Jersey, 1984) using the Sigma Stat software.

Also, the re-vaccination effect was observed since the differences between the values in the CN048 -GUSVPl and

CNPV groups were even higher from the third immunization onwards .

CNPV CNO48 -GUSVPl

2 immunizations 0 .074 +/- 0. 008 0.198 +/- 0. 053

3 immunizations 0 .097 */- 0. 014 0.258 +/- 0. 049

The average optical density values at 405 nm per group and the standard deviation value per group are indicated in the table above . The animal serum were assessed in a 1/100 dilution.

Example 1OB - Recombinant canarypox virus expressing the E2 protein of the bovine viral diarrhea virus (BVDV)

By using a modification of the ELISA method described by Chimeno Zoth (Chimeno Zoth S.A. Estudio antigenico e inmunogenico de tres proteϊnas aisladas del virus de Ia diarrea viral bovina -BVDV- : su aplicaciόn al diagnόstico y al desarrollo de vacunas experimentales . Tesis doctoral. Facultad de Ciencias Exactas y Naturales, U. B.A., 2004) the levels of total antibodies directed against the E2 glycoprotein within the group immunized with CN048-GUSE2 (obtained in a similar way as that described in Example 7) were found to be significantly different from those in the control group immunized with CNPV after one or two immunizations (p=0.024 and p<0.001, respectively). Also, the specific response induced by CN048-GUSE2 significantly increased upon re-vaccination or booster (p<0.001). The statistical differences among groups were assessed by Student t-test (Zar J. H., 1984).

CNPV CN048-GUSE2

1 immunization 0.0063 +/- 0 .0005 0.234 +/- 0. 161

2 immunizations 0.030 +/- 0 .0246 0.648 +/- 0. 117

The average optical density values at 405 nm per group and the standard deviation value per group are indicated in the table above. The animals' sera were assessed in a 1/800 dilution. Also, through assays of reduction of the number of lysis plaque, this humoral immune response was confirmed to be able to neutralize the BVDV infection in cell culture, reaching serum-neutralizing titers of 2.88 and 3.35 after one or two immunizations, respectively. Finally, it was confirmed that the animal serum immunized with CN048-GUSE2 were capable of neutralizing in vitro cytopathic BVDV strains isolated from the field.

The serum-neutralizing titers were calculated by the Reed and Muench technique (Reed L.J. and Muench H. A simple method of estimating fifty percent endpoints, Am. J. Hyg. 27, 493-497, 1938) . The serum-neutralizing index (NI) was calculated as the ratio between the viral titer in absence of serum and in the presence of serum from animals immunized with CN048-GUSE2 (CN-E2) , and according to the used technique the difference between the titers is considered significant when the NI is equal to or higher than 1.7. CPE: cytopathic effect. TCID50: 50% tissue culture infective doses. Example 1OC - Recombinant canarypox virus expressing the gD glycoprotein of the bovine herpes virus type 1 (BHV-I)

With 5 mice per group in a first experiment, the presence of total antibodies against the gD protein of BHV- 1 was determined to be clearly induced in the mice group immunized with CN048 -GUSgD (obtained according to Example 7) . Further, the re-vaccination effect was observed since the differences between the values in the CN048-GUSgD and CNPV groups were even higher from the third immunization onwards .

CNPV CNO48 -GUSgD

1 immunization 0.3788 +/- 0. 0099 0. 667 + /- 0.0997

2 immunizations 0.7897 +/- 0 .069 1 .273 +/- 0.643

3 immunizations 0.633 +/- 0 .032 1 .848 +/- 0.266

The average optical density values at 492 nm per group and the standard deviation value per group are indicated in the table above. The sera from animals receiving 1 or 2 immunizations were assessed in a 1/50 dilution, while the sera from mice receiving 3 immunizations were assessed in a 1/100 dilution.

In a second experiment, with 10 mice per group, it was confirmed that the mice immunization with CN048-GUSgD was capable of inducing a specific humoral response directed against the gD protein of BHV-I after 2 or 3 immunizations .

CNPV CNO48 -GUSgD

1 immunization 0 .376 +/- 0 .052 0.543 +/- 0. 120

2 immunizations 0 .133 +/- 0 .023 1.171 +/- 0. 169

3 immunizations 0.09 +/- 0 .032 1.61 +/- 0. 127

The average optical density values at 492 nm per group and the standard deviation value per group are indicated in the table above. The sera from animals receiving 1 immunization were assessed in a 1/50 dilution, while the sera from mice receiving 2 or 3 immunizations were assessed in a 1/100 dilution. Besides, by Western blot assays it was demonstrated that the specific antibodies induced by CN048-GUSgD recognized the gD glycoprotein from purified BHV-I. The BHV-I virus purified through a sucrose gradient was resolved by 10%-PAGE-SDS electrophoresis and electrophoretically transferred to nitrocellulose membranes. The result of a Western blot assay is shown in Figure 9, wherein a serum pool from mice immunized with CN048-GUSgD (1) , CNPV (2) or inactivated BHV-I (3) was used. The sera were used in a 1/400 dilution. 20p2i: 20 days post 2 immunizations; 20dp3i: 20 days post 3 immunizations; 200dp3i: 200 days post 3 immunizations. The arrow indicates the position of gD glycoprotein of BHV-I.

With the purpose of evaluating the effect of re- vaccinations and the potency of the induced immune response, the titer of specific anti-gD antibodies were calculated at 20 and 78 days after 2 or 3 immunizations.

The anti-gD antibodies titer was calculated as the inverse of the highest serum dilution that at least duplicates the obtained value with the CNPV sera.

The obtained results indicate that there are no differences between the animals receiving 2 or 3 immunizations at short post-immunization (20 dpi) times, which show anti-gD antibodies titer of 12800. However, at 78 dpi the animals receiving 3 immunizations show an anti- gD antibodies titer of 6400, two-fold the value of animals receiving 2 immunizations.

Finally, the duration of humoral response in time induced by 3 immunizations with CN048-GUSgD was determined. To that end, the anti-gD antibodies present in the sera of mice immunized with CN048-GUSgD, CNPV or inactivated BHV-I (BHV-Ii) were assessed as pools in a 1/100 dilution, by the ELISA technique. The results shown in Figure 10 allowed determining that the humoral response induced by 3 immunizations with CN048-GUSgD was long-lasting in time, since high levels of anti-gD antibodies were detected during the subsequent 6 months of following immunization.

Based on the obtained results in the assays carried out in the murine model, a CN048-GUSgD immunization experiment in calf was designed. For these animals, it was determined that the levels of specific antibodies were always higher that those observed for animals immunized with non-recombinant (CNPV) virus.

The optical density values at 405 nm are indicated in the table above. The sera from animals were assessed in a 1/100 dilution. The asterisk indicates the days the animals were intramuscularly immunized with a 2xlO⁸ pfu/ml dose of CNPV or CN048-GUSgD purified through a sucrose cushion.

It was also determined by Western blot assays that the sera from animals immunized with CN048-GUSgD were capable of recognizing the gD glycoprotein from purified BHV-I. The BHV-I virus purified by a sucrose gradient was resolved by 10%-PAGE/SDS electrophoresis and was electrophoretically transferred to nitrocellulose membranes. Figure 11 shows the Western blot assay, using individually, the serum from bovine immunized with CNPV (1 and 2) or CN048-GUSgD (3 and 4) . The serum were used in a 1/100 dilution and came from the bleeding corresponding to day 50 (11 days post third immunization) . The arrow indicates the position of the gD glycoprotein from BHV-I.

Finally, it was determined that the white cells coming from the bovine immunized with three CN048-GUSgD doses specifically secreted interferon gamma in in vitro stimulation assays .

The optical density values at 405 nm at 40 min. reaction time are indicated in the table above. Control: non-immunized bovine, BHV-Ii: bovine immunized with a vaccine containing inactivated BHV-I.

These results show that the recombinant CN048 -GUSgD virus may be used as immunogens in bovine for the purpose of eliciting specific immune responses.

Claims

WE CLAIM:

1. A transfer plasmidic vector, susceptible of homologue recombination with a canarypox virus, the vector comprising: a. an expression cassette carrying a foreign gene encoding a polypeptide, under control of an early poxvirus promoter, b. optionally an expression cassette carrying a marker gene, under control of other early poxvirus promoter, and a DNA sequence flanking at least one of a) or b) , wherein said DNA corresponds to genomic regions of a canarypox gene selected from CNPV018 (SEQ ID N° 1) , CNPV048 (SEQ ID N° 2) and CNPV134 (SEQ ID N° 3) .

2. The transfer plasmidic vector according to claim

1, wherein the polypeptide is antigenic.

3. The transfer plasmidic vector according to claim

1 or 2, wherein the foreign gene encodes an antigenic polypeptide preferably selected from structural VPl protein, Pl precursor or P1-2A-3C chimeric protein of foot and mouth disease virus (FMDV) ; glycoprotein gD of the bovine herpes virus type 1 ; E2 or Erns glycoproteins of the bovine viral diarrhea virus,- glycoprotein G of the rabies virus,- Newcastle disease virus fusion proteins (F) or hemagglutinin-neuraminidase (HN) ; glycoprotein gB of the

Marek disease virus; VP2 protein or precursor polyprotein

(VPX-VP4-VP- ) of Gumboro disease virus; hemagglutinin protein (HA) of the avian influenza virus type A.

4. The transfer plasmidic vector according to claim 1, wherein the foreign gene encodes interferon alpha or beta from porcine or bovine source.

5. The transfer plasmidic vector according to claim 1, wherein the marker gene expression cassette comprises a gene selected from a uid A gene which encodes the β- glucuronidase (β-GUS) enzyme and a lac Z gene which encodes the β-glactosidase (β-gal) enzyme.

6. The transfer plasmidic vector according to claim 1, wherein the foreign gene is located downstream of a promoter selected from the synthetic E/L promoter of vaccinia virus and the H6 promoter of vaccinia virus.

7. The transfer plasmidic vector according to claim 1, comprising a gene which encodes glycoprotein gD of the bovine herpes virus type 1 , a marker gene uid A which encodes β-glucuronidase (β-GUS) enzyme and a DNA sequence which corresponds to a genomic region of the canarypox gene CNPV048 (SEQ ID N° 2) .

8. The transfer plasmidic vector according to claim 1, comprising a gene which encodes E2 glycoprotein of the bovine viral diarrhea virus, a marker gene uid A which encodes β-glucuronidase (β-GUS) enzyme and a DNA sequence which corresponds to a genomic region of the canarypox gene CNPV048 (SEQ ID N° 2) .

9. The transfer plasmidic vector according to claim 1, comprising a gene which encodes P1-2A-3C chimeric protein of foot and mouth disease virus (FMDV) , a marker gene uid A which encodes β-glucuronidase (β-GUS) enzyme and a DNA sequence which corresponds to a genomic region of the canarypox gene CNPVO48 (SEQ ID N° 2) .

10. The transfer plasmidic vector according to claim 1, comprising a gene which encodes interferon alpha of porcine or bovine source, a marker gene uid A which encodes β-glucuronidase (β-GUS) enzyme and a DNA sequence which corresponds to a genomic region of the canarypox gene CNPV048 (SEQ ID N° 2) .

11. The transfer plasmidic vector according to claim 1, comprising a gene which encodes interferon beta of porcine or bovine source, a marker gene uid A which encodes β-glucuronidase (β-GUS) enzyme and a DNA sequence which corresponds to a genomic region of the canarypox gene CNPV048 (SEQ ID N° 2) .

12. The transfer plasmidic vector according to claim 1, comprising a gene which encodes glycoprotein G of the rabies virus, a marker gene uid A which encodes β~ glucuronidase (β-GUS) enzyme and a DNA sequence which corresponds to a genomic region of the canarypox gene CNPV048 (SEQ ID N° 2) .

13. The transfer plasmidic vector according to claim 1, comprising a gene which encodes glycoprotein gB of the Marek disease virus, a marker gene uid A which encodes β-glucuronidase (β-GUS) enzyme and a DNA sequence which corresponds to a genomic region of the canarypox gene CNPV048 (SEQ ID N° 2) .

14. The transfer plasmidic vector according to claim 1, comprising a gene which encodes precursor polyprotein (VPX-VP4-VP) of Gumboro disease virus, a marker gene uid A which encodes β-glucuronidase (β-GUS) enzyme and a DNA sequence which corresponds to a genomic region of the canarypox gene CNPV048 (SEQ ID N° 2) .

15. The transfer plasmidic vector according to claim 1, comprising a gene which encodes VP2 protein of Gumboro disease virus, a marker gene uid A which encodes β- glucuronidase (β-GUS) enzyme and a DNA sequence which corresponds to a genomic region of the canarypox gene CNPV048 (SEQ ID N° 2) .

16. The transfer plasmidic vector according to claim 1, comprising a gene which encodes hemagglutinin protein (HA) of the avian influenza virus type A, a marker gene uid A which encodes β-glucuronidase (β-GUS) enzyme and a DNA sequence which corresponds to a genomic region of the canarypox gene CNPVO48 (SEQ ID N° 2) .

17. A recombinant canarypox virus, comprising at least one foreign DNA sequence inserted into a genomic region which corresponds at least to a canarypox gene selected from CNPV018 (SEQ ID N° 1) , CNPV048 (SEQ ID N° 2) and CNPV134 (SEQ ID N° 3) of the canarypox virus genome, wherein the foreign DNA is capable of being expressed in a host cell.

18. The recombinant canarypox virus according to claim 17, wherein the foreign DNA sequence encodes a polypeptide .

19. The recombinant canarypox virus according to claim 18, wherein the polypeptide is antigenic.

20. The recombinant canarypox virus according to claim 18, wherein the foreign DNA sequence encodes an antigenic polypeptide preferably selected from structural VPl protein, Pl precursor or P1-2A-3C chimeric protein of foot and mouth disease virus (FMDV) ; glycoprotein D of the bovine herpes virus type 1 ; E2 or Erns glycoprotein of the bovine viral diarrhea virus,- glycoprotein G of the rabies virus; Newcastle disease virus fusion proteins (F) or hemagglutinin-neuraminidase (HN) ; glycoprotein gB of the

Marek disease virus; VP2 protein or precursor polyprotein

(VPX-VP4-VP- ) of Gumboro disease virus; hemagglutinin protein (HA) of the avian influenza virus type A.

21. The recombinant canarypox virus according to claim 18, wherein the foreign DNA sequence encodes interferon alpha or beta of porcine or bovine source.

22. The recombinant canarypox virus according to claim 17, wherein said host cell is a mammal cell.

23. The recombinant canarypox virus according to claim 17, wherein said host cell is an avian cell.

24. A recombinant canarypox virus according to claim 17, comprising a DNA sequence which encodes glycoprotein D of the bovine herpes virus type 1 , said sequence being inserted within a genomic region corresponding to the canarypox gene CNPV048 (SEQ ID N" 2) .

25. A recombinant canarypox virus according to claim 17, comprising a DNA sequence which encodes glycoprotein E2 of the bovine viral diarrhea virus, said sequence being inserted within a genomic region corresponding to the canarypox gene CNPV048 (SEQ ID N° 2) .

26. A recombinant canarypox virus according to claim 17, comprising a DNA sequence which encodes P1-2A-3C polyprotein of foot and mouth disease virus (FMDV) , said sequence being inserted within a genomic region corresponding to the canarypox gene CNPV048 (SEQ ID N° 2) .

27. A recombinant canarypox virus according to claim 17, comprising a DNA sequence which encodes interferon alpha of porcine or bovine source, said sequence being inserted within a genomic region corresponding to the canarypox gene CNPV048 (SEQ ID N° 2) .

28. A recombinant canarypox virus according to claim 17, comprising a DNA sequence which encodes interferon beta of porcine or bovine source, said sequence being inserted within a genomic region corresponding to the canarypox gene CNPVO48 (SEQ ID N° 2) .

29. A recombinant canarypox virus according to claim 17, comprising a DNA sequence which encodes glycoprotein G of the rabies virus,- said sequence being inserted within a genomic region corresponding to the canarypox gene CNPV048 (SEQ ID N° 2) .

30. A recombinant canarypox virus according to claim 17, comprising a DNA sequence which encodes glycoprotein gB of the Marek disease virus ; said sequence being inserted within a genomic region corresponding to the canarypox gene CNPV048 (SEQ ID N° 2) .

31. A recombinant canarypox virus according to claim 17, comprising a DNA sequence which encodes polyprotein (VPX-VP4-VP- ) of Gumboro disease virus; said sequence being inserted within a genomic region corresponding to the canarypox gene CNPV048 (SEQ ID N° 2) .

32. A recombinant canarypox virus according to claim 17, comprising a DNA sequence which encodes VP2 protein of Gumboro disease virus; said sequence being inserted within a genomic region corresponding to the canarypox gene CNPVO48 (SEQ ID N° 2) .

33. A recombinant canarypox virus according to claim 17, comprising a DNA sequence which encodes hemagglutinin protein (HA) of the avian influenza virus type A; said sequence being inserted within a genomic region corresponding to the canarypox gene CNPV048 (SEQ ID N° 2) .

34. The recombinant canarypox virus according to claim 17, comprising two or three foreign DNA sequences which encode a polypeptide preferably selected from structural VPl protein, Pl precursor or P1-2A-3C chimeric protein of foot and mouth disease virus (FMDV) ; glycoprotein D of the bovine herpes virus type 1 ; E2 or Erns glycoprotein of the bovine viral diarrhea virus; glycoprotein G of the rabies virus; Newcastle disease virus fusion proteins (F) or hemagglutinin-neuraminidase (HN) ; glycoprotein gB of the Marek disease virus,- VP2 protein or precursor polyprotein (VPX-VP4-VP- ) of Gumboro disease virus; hemagglutinin protein (HA) of the avian influenza virus type A, interferon alpha and/or beta from porcine or bovine source, that are inserted within two or more genomic regions corresponding to the genes selected from CNPV018 (SEQ ID N° 1) , CNPV048 (SEQ ID N° 2) and CNPV134 (SEQ ID N° 3) of the canarypox virus genome, wherein said two or more foreign DNA sequences are capable of being expressed in a host cell.

35. A recombinant canarypox virus according to claim 34, comprising two DNA sequences which encode glycoprotein D of the bovine herpes virus type 1 and E2 glycoprotein of the bovine viral diarrhea virus, said sequences being inserted within a genomic region corresponding to canarypox genes CNPV048 (SEQ ID N° 2) or CNPV134 (SEQ ID N° 3) .

36. A recombinant canarypox virus according to claim 34, comprising two DNA sequences which encode precursor polyprotein (VPX-VP4-VP- ) of Gumboro disease virus and glycoprotein gB of the Marek disease virus, said sequences being inserted within a genomic region corresponding to canarypox genes CNPV048 (SEQ ID N" 2) or CNPV134 (SEQ ID N° 3) .

37. A vaccine for immunizing an animal comprising an effective immunizing amount of the recombinant canarypox virus according to any one of claims 17 to 36 and a physiologically suitable carrier.

38. A method for protecting susceptible animals from at least one disease selected from the group of foot and mouth disease, bovine herpes type 1, bovine viral diarrhea, rabies, Newcastle disease, Marek disease, Gumboro disease, avian influenza, the method comprising administering to said animals an effective immunizing dose of the vaccine according to claim 37.

39. The method according to claim 38, wherein the animal is a mammal.

40. The method according to claim 38, wherein the animal an avian.

41. A method of administering to an animal a suitable dose of interferon alpha and/or interferon beta from porcine or bovine source, the method comprising administering to the animal an effective dose of a composition comprising the recombinant canarypox virus according to any of claims 17, 18, 21 or 28, in a suitable physiologically carrier.

42. The method according to claim 41, wherein the animal is a mammal.

43. The method according to claim 41, wherein the animal is an avian.