DK175980B1 - Antigen expression in vertebrates using recombinant virus - contg. specific DNA and incapable of replication, esp. avipox, useful as safe, live vaccines - Google Patents

Abstract

A gene product (i) is expressed in a vertebrate by inoculating with a recombinant virus contg. DNA which encodes and expresses (I) without productive replication of virus in the host. Also new are (1) recombinant avipox virus contg. DNA from a non-avipox source in a non-essential region of its genome; (2) recombinant poxvirus contg. DNA from any source under control of an ontomopox promoter, and (3) recombinant vaccinia virus contg. DNA from any source under control of an avipox promoter. Specifically the virus is fowlpox or canary pox virus, and is inoculated by subcutaneous intradermal, intramuscular or oral methods, or into an egg.

Description

DK 175980 B1

The present invention relates to the induction of an immunological response in vertebrates, including non-avian vertebrates, using synthetic recombinant vaccinia virus. In particular, the invention relates to a recombinant vaccinia virus and its use in the manufacture of a medicament for the treatment of vertebrate diseases.

BACKGROUND OF THE INVENTION

Avipox or avipox virus is a genus of closely related pox viruses that infect 10 birds. The genus avipox includes the species poultry pox, canary pox, snow bird pox, duepox, quail pox, sparrow pox, star pox and turkey pox. The genus avipox shares many characteristics with other poxviruses and is a member of the same subfamily, poxviruses in vertebrates, as vaccinia is. Poxviruses, including vaccinia and avipox, replicate in eukaryotic host cells. These viruses are distinguished by their large size, complexity and by the cytoplasmic replication site. However, vaccinia and avipox are different genera and do not differ in their respective molecular weights, antigenic determinants and host species, as reported in Intervirology, vol. 17, pages 42-44, Fourth Report of the International Committee on Taxonomy of Viruses (1982). .

20

The avipox viruses do not productively infect non-bird vertebrates such as mammals, including humans. Furthermore, avipox does not proliferate by inoculation in mammalian cell cultures (including humans). In such mammalian cell cultures inoculated with avipox, cells die due to a cytotoxic effect but show no evidence of productive viral infection.

Inoculation of a non-avian vertebrate, such as a mammal, with live avipox results in the formation of a lesion at the inoculation site similar to a vaccine inoculation. However, no productive viral infection is obtained. Nevertheless, it has now been found that a mammal thus inoculated responds immunologically to the avipox virus. This is an unexpected result.

2 DK 175980 B1 1

Vaccines consisting of killed pathogen or purified antigenic components of such pathogens must be injected in larger quantities than live virus vaccines to create an effective immune response. This is because live virus inoculation is a much more effective vaccination method.

A relatively small inoculum can produce an effective immune response because the antigens of interest are amplified during replication of the virus. From a medical point of view, live virus vaccines confer an immunity that is more effective and longer lasting than inoculation with a vaccine with a killed pathogen or purified antigen. Thus, vaccines consisting of killed pathogen or purified antigenic components of such pathogens require the production of greater amounts of vaccine material than is necessary with live virus.

From the previous discussion, it is clear that there are medical and financial benefits to using live virus vaccines. One such live virus vaccine includes vaccinia virus. This virus is known from the literature as a useful virus in which, by means of recombinant DNA methods, DNA representing the genetic sequences of mammalian pathogen gene antigens can be inserted.

Thus, in the literature, methods have been developed that allow the formation of recombinant vaccinia viruses by inserting DNA from any source (e.g., viral, prokaryotic, eukaryotic, synthetic) into a nonessential region of the vaccinia genome, including DNA sequences encoding the antigenic determinants of a pathogenic organism. Certain recombinant vaccinia viruses generated by these methods have been used to induce specific immunity in mammals against various mammalian pathogens, all as disclosed in U.S. Patent No. 4,603,122, which is incorporated herein by reference.

30 3 DK 175980 B1

Unmodified vaccinia-viais has long been known to be relatively safe and effective for use in inoculation against smallpox. However, before the eradication of smallpox, where it was common to administer unmodified vaccinia, there was a small but real risk of complications in the form of generalized vaccine infection, especially in those suffering from eczema or immunosuppression.

Another rare but possible complication that may result from vaccinia inoculation is encephalitis postvaccinalis. Most of these reactions resulted from inoculation of individuals with skin disorders such as eczema, or with weakened immune systems, or individuals in households where another 10 had eczema or attenuated immunological response. Vaccinia is a living virus and is usually harmless to a healthy individual. However, it can be transmitted between individuals for several weeks after inoculation. If an individual with a weakening of the normal immune response is infected, either by inoculation or by infectious transmission from a recently inoculated individual, it can have 15 serious consequences.

Thus, it will be appreciated that a method which provides the subject with the benefits of live virus inoculation but which reduces or eliminates the problems described above would be a highly desirable advance over the present technological state. This is even more important today in the emergence of the disease known as Acquired Immune Deficiency Syndrome (AIDS). Victims of this disease suffer from severe immunological dysfunction and could easily be harmed by an otherwise safe living virus preparation if they come into contact with such a virus, either directly or through contact with a person who has recently been immunized with a vaccine containing such live virus.

OBJECT OF THE INVENTION

It is an object of the invention to provide a recombinant vaccinia virus which can be advantageously used in a vaccine capable of immunizing vertebrates against a pathogenic organism which has the advantages of a live vaccine and which has few or none of the disadvantages of either a live virus vaccine or a killed virus vaccine as listed above, especially when used for immunizing non-avian vertebrates.

5

It is a further object of the invention to provide a use of a recombinant vaccinia virus in the manufacture of a medicament for the treatment of vertebrate diseases.

DESCRIPTION OF THE INVENTION

One aspect of the invention relates to a recombinant vaccinia virus containing DNA from any source ligated to an entomopox promoter for expression of the DNA, wherein the DNA and promoter are inserted into a non-essential region of the vaccinia genome.

Yet another aspect of the invention relates to the use of a recombinant vaccinia virus for the manufacture of a medicament for the treatment of vertebrate diseases.

20

It should again be noted that the avipox virus can only replicate productively in or be transmitted through bird species or cell lines from birds. The recombinant avipox viruses harvested from avian host cells form an inoculation lesion without productive replication of the avipox virus when inoculated into a non-avian vertebrate such as a mammal in a manner analogous to the inoculation of mammals with vaccinia virus. Despite the inability of the avipox virus to replicate productively in such inoculated non-avian vertebrate, there is sufficient expression of the virus that the inoculated animal responds immunologically to the recombinant avipox virus1 antigenic determinants and also to the antigenic determinants encoded in exogenous genes.

When used to inoculate bird species, such a synthetic recombinant avipox virus not only produces an immunological response to antigens encoded by exogenous DNA from any source that may be present therein, but also results in productive replication of the virus. the host with the induction 5 of an expected immunological response to the avipox vector as such.

Several researchers have suggested the formation of recombinant poultry pox, especially viruses for use as veterinary vaccines to protect poultry populations. Boyle and Coupar, J. Gen. Virol., 67: 1591-1600 (1986) and Binns et al., Isr. J. Vet. Med., 42: 124-127 (1986). Neither suggestions nor actual reports on the use of recombinant avipoxviruses as a method for inducing specific immunity in mammals have been presented.

15 Stickl and Mayer, Fortschr. With. 97 (40): 1781-1788 (1979) disclose injection of avipox virus, specifically poultry pox, into humans. However, these studies only address the use of common poultry pox to increase non-specific immunity in patients suffering from the aftermath of cancer chemotherapy. No recombinant DNA techniques are used. No avipox is disclosed in which 20 is inserted DNA encoding antigens from vertebrate pathogens or a method for inducing specific immunity in vertebrates. Instead, a general and non-specific tonic effect on the human host was considered in the literature.

A more in-depth discussion of the basis of genetic recombination may perhaps help to understand how the modified recombinant viruses of the present invention are formed.

In general, genetic recombination consists of the exchange of homologous 30 sections of deoxyribonucleic acid (DNA) between two DNA strands. (In some viruses, ribonucleic acid [RNA] can replace DNA). Homologous nucleic acid sections are | i I________ ___! 6 DK 175980 B1 nucleic acid sections (RNA or DNA) having the same nucleotide base sequence.

Genetic recombination may occur naturally during replication or during the generation of new viral genomes within the infected host cell. Thus, genetic recombination between viral genes can occur during the viral replication cycle that takes place in a host cell co-infected with two or more different viruses or other genetic constructs. A DNA section from a first genome is used interchangeably to construct the genome section of a second coinfecting virus, in which the DNA is homologous to the DNA of the first viral genome.

However, recombination may also occur between DNA sections in different genomes that are not completely homologous. If such a section is from a first genome homologous to a section of a second genome, with the exception of the presence in the first section of, for example, a genetic marker or gene encoding an antigenic determinant inserted into part of it homologous DNA, recombination may still occur and the products of this recombination are thus detectable in the presence of this genetic marker or gene.

Two conditions are required for the modified infectious virus to successfully express the inserted genetic DNA sequence.

25

First, the insertion must take place in a non-essential area of the virus in order for the modified virus to remain viable. Neither poultry pox nor the other avipox viruses have so far exhibited non-essential regions analogous to those described for the vaccinia virus. Therefore, in the present invention, non-essential regions of poultry pox were found by cleaving the poultry pox genome into fragments, subsequently separating the fragments by size and inserting these fragments into plasmid constructs for amplification. (Plasmids are small circular DNA molecules found as extrachromosomal elements in many bacteria including E. coli. Methods for inserting DNA sequences, such as the genes for antigenic determinants or other genetic markers, into plasmids are well known in the art and are described in detail in Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory New York [1982]). This was followed by insertion of genetic markers and / or genes encoding antigens into the cloned poultry pox fragments.

10 The fragments that led to successful recombination, as shown by successful recovery of the genetic marker or antigens, were those containing DNA inserted into a non-essential region of the poultry pox genome.

The second condition for expression of inserted DNA is the presence of a promoter at an appropriate location relative to the inserted DNA.

The promoter must be located so that it is upstream of the DNA sequence to be expressed. Because avipox viruses are not well characterized and no avipox promoters have been previously identified, promoters from other poxviruses can advantageously be inserted upstream of the DNA to be expressed as part of the present invention. Poultry pox promoters can also be successfully used to carry out the methods and make the products of the invention. According to the invention, promoters of poultry pox, vaccinia and entomopox have been found to promote transcription in recombinant pox virus.

25

Boyle and Coupar, J. Gen. Virol. 67: 1591 (1986) has published speculation that vaccinia promoters "might be expected to function in (poultry pox) virus". The authors located and cloned a poultry pox TK gene (Boyle et al.,

Virology 156: 355-365 [1987]) and inserted it into a vaccinia virus. This TK gene 30 was expressed, presumably because the poultry pox TK promoter sequence is recognized by vaccinia polymerase functions. However, despite their speculation, the authors did not insert any vaccinia promoter into a poultry pox virus or observe any expression of a foreign DNA sequence present in a poultry pox genome. It was not known before the present invention that promoters from other poxviruses, such as vaccinia promoters, would actually promote a gene in an avipox genome.

DESCRIPTION OF CERTAIN PREFERRED EMBODIMENTS

In particular, in PA 1989 02036, from which the present application is made, 10 poultry pox and canary pox viruses used as preferred avipox species are modified by recombination by incorporating exogenous DNA therein.

Poultry pox is a species of avipox that infects chickens in particular, but does not infect mammals. The poultry pox strain designated herein as FP-5 is a commercial poultry pox virus vaccine strain originating in chicken embryos, available from American Scientific Laboratories (Subdivision of Schering Corp.) Madison, Wl, United States Veterinary License No. 165,

Series # 30321.

20

The poultry pox strain designated herein FP-1 is a Duvette strain modified for use as a vaccine in day-old chicks. The strain is a commercial poultry pox virus vaccine strain designated O DCEP 25 / CEP67 / 2309 October 1980 and is available from Institute Merieux, Inc.

25

Canary pox is another avipox species. Analogous to poultry pox, canary pox infects canary birds in particular, but does not infect mammals. The Canary Pox strain designated here as CP is a commercial Canary Pox vaccine strain designated LF2 CEP 524 24 10 75 and is available from 30 Institute Merieux, Inc.

9 DK 175980 B1

The genetic DNA sequences inserted into these avipoxviruses by genetic recombination of the invention include the Lac Z gene of prokaryotic origin; the rabies glycoprotein (G) gene, which is an antigen from a non-avian pathogen (specifically of mammalian origin); the turkey flu-5 hemagglutinin gene, which is the antigen of a non-avipox virus pathogenic bird virus; the bovine leukemia virus gp51.30 envelope gene, which is a mammalian virus; the Newcastle disease (Texas strain) fusion protein gene, which is a bird virus; FeLV envelope gene from cat leukemia virus, which is a mammalian virus; The RAV-1 env gene from the Rous-associated virus, which is a 10 bird virus / poultry disease; the nucleoprotein (NP) gene from chicken / Pennsylvania / 1/83 influenza virus, which is a bird virus; the matrix gene and the peplomer gene from infectious bronchitis virus (strain Mass 41), which is a bird virus; and the glycoprotein D gene (gD) from a mammalian herpes simplex virus.

15

Isolation of the Lac Z gene is described by Casadaban et al., Methods in Enzymology 100: 293-308 (1983). For example, the structure of the rabies G gene is described by Anilionis et al., Nature 294: 275-278 (1981). Its incorporation into vaccinia and expression in this vector is discussed by Kieny et al., 20 Nature 312: 163-166 (1984). The turkey flu hemagglutinin gene is described by Kawaoka et al., Virology 158: 218-227 (1987). The bovine leukemia virus gp51.30 env gene has been described by Rice et al., Virology 138: 82-93 (1984). The Newcastle disease virus (Texas strain) fusion gene is available from Institute Merieux, Inc. as plasmid pNDV 108. The cat leukemia virus env gene has been described by Guilhot et al., Virology 161: 252-258 (1987). The Rous-associated virus type 1 is available from Institute Merieux, Inc. as two clones, penVRVIPT and mp19env (190). Chicken Flu NP gene is available from Yoshihiro Kawaoka, St. Jude Children's Research Hospital as plasmid pNP33. An infectious bronchitis 30 virus cDNA clone of the IBV Mass 41 matrix gene and the peplomer gene is available from Institute Merieux, Inc. as plasmid plBVM63. The herpes simplex virus gD gene is described in Watson et al., Science 218: 381-384 (1982).

The recombinant avipoxviruses, described in more detail below, include one of three vaccinia promoters. The Pi promoter, from the AvalH region of vaccinia, is described in Wachsman et al., J. of Inf. Haze. 155: 1188-1197 (1987). More specifically, this promoter is derived from the AvalH (XholG) fragment of the L variant WR vaccinia strain, in which the promoter directs the transcription from right to left. The short position of the promoter is approx. 1.3 kbp 10 (kilobase pairs) from the left end of AvalH, approx. 12.5 kbp from the left end of the vaccinia genome, and approx. 8.5 kbp to the left of the HindIII-C / N compound. The promoter sequence is: (GGATCCC) -ACTGTAAAAATAGAAACTATAATCATATAAT AGTGTAGGTT G GT -15 AGTAGGGTACTCGTGATTAATTTTATTGTTAAACTTG- (AATTC), wherein the symbols in parentheses are coupling sequences.

The HindIIIH promoter (also called "HH" and Ή6 "herein) was defined by 20 standard transcriptional mapping techniques. It has the sequence:

ATTCTTTATTCTATACTTAAAAAATGAAAA

TAAATACAAAGGTTCTTGAGGGTTGTGTTAAATTGAAAGCGAGAAATAATCATA-

AATT

in

25 ATTTCATTATCGCGATATCCGT

i.

TAAGTTTGTATCGTAATG.

The sequence is identical to that of Rosen et al., J. Virol. 60: 436-449 (1986) is described as being upstream from open reading frame H6.

The promoter is as described by Wittek, J. Virol. 49: 371-378 (1984) and Bertholet, C. et al., Proc. Natl. Acad. Sci. USA 82: 2096-2100 (1985).

The recombinant avipoxviruses are constructed at two steps known in the art that are analogous to those described in the aforementioned U.S. Patent 4,603,112 to form synthetic recombinants of the vaccinia virus.

First, the DNA sequence to be inserted into the virus is placed in an E. coli plasmid construct, which contains DNA homologous to a section of 10 non-essential DNA in the avipox virus. The DNA gene sequence to be inserted is ligated separately to a promoter. The promoter gene linkage is then inserted into the plasmid construct so that the promoter gene linkage at both ends is flanked by DNA homologous to a non-essential region of avipox DNA. The resulting plasmid construct is then amplified by growth in E. coli bacteria. (Plasmid DNA is used to carry and amplify exogenous genetic material and this method is well known in the art. These plasmid techniques are described, for example, by Clewell, J. Bacteriol. 110: 667-676 (1972). for isolation of the amplified plasmid from the E. coli host are also well known and are described, for example, by Clewell et al., in Proc. Natl. Acad.

Sci. USA 62: 1159-1166 (1969).)

The amplified plasmid material isolated after growth in E. coli is then used for the second step. Namely, transfection of the plasmid containing the DNA gene sequence to be inserted into a cell culture, e.g. fibroblasts from 25 chicken fetuses, along with the avipox virus (such as poultry pox strain FP-1 or FP-5). Recombination between homologous poultry epox DNA in the plasmid and viral genome, respectively, produces an avipox virus modified by the presence of non-poultry epox DNA sequences in a non-essential region of its genome.

The invention is further explained by the following examples.

EXAMPLE 1 - Transient Expression Tests to Demonstrate Fierce Creepox RNA Transcription Factors Recognition of Vaccinia Promoters 5

A number of plasmid constructs containing the coding sequence for Hepatitis B virus surface antigen (HBSAg) coupled to vaccinia virus promoter sequences were prepared. 50 µg of each plasmid was transfected on CEF cells infected with 10 pfu of poultry virus or vaccinia virus per cell.

The infection was allowed to continue for 24 hours, and the cells were then lysed by three successive cycles of freezing and thawing.

The amount of HBSAg in the lysate was calculated using that from the Abbott Laboratories, Diagnostic Division, commercially available AUSTRIA II - 125l-15 kit. The presence or absence of HBSAg is expressed as a ratio between the net counts (sample minus background) of the unknown value and a negative cut-off value predetermined by the manufacturer. This results in a P / N (positive / negative) ratio. The results are shown in Table I.

Three different vaccinia promoter sequences were used: the Pi promoter, recognized early by vaccinia infection, prior to DNA replication; The 11K promoter, recognized late by vaccinia infection, after the onset of DNA replication; and the HindIII H (HH) promoter, which is recognized both early and late by vaccinia infection. These promoters are previously described herein.

25

The data indicate that HBSAg formed in the lysate of infected cells is the result of recognition of vaccine promoters of transcription factors from either poultry pox or vaccinia.

30 in 13 DK 175980 B1

TABLE I

- i

Plasmid Virus Description P / N ratio pMP131piR2 Poultry Pox Case linked to 1.8 5 Vaccinia Pi Promoter 9.1 in pMPK22.13S Poultry Pox Case linked to 14 in Vaccinia 11K Promoter 2 10 pPDK22.5 Poultry Pox Case linked to 92.6

Vaccinia 11K Promoter 5.6 pRW668 Poultry Pox Case linked to 77

Vaccinia HH promoter 51.4 (no plasmid) Poultry pox 1.1 (no plasmid) Vaccinia 1.3 pMPK22.13S (no virus) 1.3 20! EXAMPLE 2 - Construction of recombinant wild crepe pox vFP-1 containing the Lac Z gene 25 A fragment in a non-essential region of the poultry pox virus was located and isolated as follows. !

Nuclease Bal31 was used to remove the single stranded terminal hairpin loops in FP-5 DNA. The large Klenow fragment of DNA polymerase I 30 was used to form blunt ends. After removing the loops, the fragments were generated by digestion with restriction endonuclease 14 DK 175980 B1

BglII. In this degradation, a number of FP-5 fragments were formed which were separated by agarose gel electrophoresis.

An 8.8 kbp BglII fragment with blunt ends was isolated and ligated into a commercially available plasmid, pUC9, which had been cleaved with BamHI and SmaI. The resulting plasmid was designated pRW698.

To reduce the size of the poultry pox fragment, this plasmid was cleaved with HindIII to form two further fragments. A 6.7 kbp 10 fragment was discarded and the remaining 4.7 kbp fragment was ligated to itself to form a new plasmid designated pRW699.

in

To incorporate an 11 K promoted Lac Z gene into this plasmid, pRW699 was cut with EcoRV, which cleaves the plasmid only in one place. The 11K-15 promoted Lac Z segment was then inserted as a blunt-ended PstI-BamHI fragment, creating a new plasmid designated pRW702.

The Lac Z clone is from pMC1871, as described in Casadaban et al., Loc. cit.! The 11 K promoter was ligated to the eighth codon of the Lac Z gene via a BamHI linker.

20

By recombination techniques as described for vaccinia in U.S. Patent 4,603,112, the pRW702 plasmid was then recombined with poultry pox FP-5, which grows on chicken fetal fibroblasts (CEF), using the following procedures to generate vFP-1. 50 µg of pRW702 DNA was mixed in a final volume of 100 µl with 0.5 µg of poultry pox DNA covering the entire genome.

To this were added 10 µl of 2.5 M CaCl 2 and 110 µl of 2 x HEBS buffer (pH 7) made of:

40 mM Hepes 30 300 mM NaCl

1.4 mM Na 2 HPO <15 DK 10 910 B1 10 mM KCI 12 mM dextrose.

After 30 minutes at room temperature, 200 μΙ of a poultry pox-5 virus pool diluted to 5 pfu / cell was added and the mixture inoculated on 60 mm petri dishes containing a monolayer of primary CEF. 0.7 ml of Eagles medium containing fetal bovine serum (FBS) was also added at this time. The petri dishes were incubated at 37 ° C for 2 hours, then an additional 3 ml of Eagles medium containing 2% FBS was added and the petri dishes incubated for 3 days. Cells were lysed by three successive cycles of freezing and thawing, and progeny of viruses were then tested for the presence of recombinants.

Evidence of successful insertion was achieved by recombination of the 11 K-promoted Lac Z gene in the genome of Iron Crepe FP-5 by testing for expression of the Lac Z gene. The Lac Z gene encodes the enzyme β-galactosidase that cleaves the chromogenic substrate 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-gal) upon release of a blue indolyl derivative. Blue plaques were selected as positive recombinants.

20

The successful insertion of Lac Z into the genus of poultry pox FP-5 and its expression was also confirmed by immunoprecipitation of β-galactosidase protein with commercially available antisera and standard techniques using vFP-1-infected CEF, BSC (monkey cell line 25 - ATCC CCL26 ), VERO (monkey kidney cell line - ATCC CC81) and MRC-5 (human diploid lung cell line -ATCC CCL171).

The expression of β-galactosidase of the recombinant virus vFP-1 was further confirmed in vivo by inoculation of rabbits and mice with the virus and by measuring a post-inoculation increase in the titers of antibody directed against the β-galactosidase protein in the serum of the inoculated animals. .

16 DK 175980 B1

Specifically, the recombinant vFP-1 was purified from host cell contaminants and inoculated intradermally two sites on each side of two rabbits. Each rabbit received a total amount of 108 pfu.

5

The animals were sampled weekly and the sera used in one ELISA assay using a commercially available preparation of purified β-galactosidase as an antigen source.

Both rabbits and mice inoculated with the recombinant vFP-1 produced an immune response to β-galactosidase protein as demonstrated by an ELISA assay. In both species, the response was detectable one week after inoculation.

EXAMPLE 3 - Construction from fierce creepox virus FP-5 of recombinant virus vFP-2 containing the rabies G gene and Lac Z

From FP-5, a 0.9 kbp Pvull fragment was obtained, which was inserted by standard techniques between the two Pvull sites in pUC9. The resulting construct, designated pRW688.2, has two Hincll sites with a distance of approx. 30 bp, located asymmetrically within the Pvull fragment, thus forming a long arm and a short arm of the fragment.

Using known techniques, oligonucleotide adapters were placed between these HincII sites to introduce PstI and BamHI sites, thereby forming 25 plasmid pRW694.

This plasmid was now cleaved with PstI and BamHI, and the Lac Z gene with a coupled 11K vaccinia promoter previously described was inserted to generate the new plasmid pRW700.

30 17 DK 175980 B1

To generate a Pi-promoted rabies G gene, the BglII site, which is 5 'proximal to the rabies gene (cf. Kieny et al. Loc. Cit.), Was blunt-ended and ligated to it. filled EcoRI site in the Pi promoter described earlier.

This construct was inserted into the PstI site of pRW700 to generate plasmid pRW735.1, which contains the foreign gene sequence Pi-rabies G-11 K-Lac Z. This insertion is so oriented within the plasmid that the long Pvull-HincIl arm of the FP-5 donor sequence is 3 'relative to the Lac Z gene.

10

The resulting final construct was recombined with poultry pox virus FP-5 by infection / transfection of chicken fetal fibroblasts by the methods described above to generate recombinant poultry pox virus vFP-2. This recombinant virus was selected by X-gal staining.

Proper insertion and expression of both the Lac Z marker gene and the rabies G gene were verified by a number of additional methods described below.

Localization of the rabies antigen by immunofluorescence with specific antibodies successfully demonstrated expression of rabies antigen on the surface of bird and non-bird cells infected with vFP-2 virus.

The expression of rabies antigen and β-galactosidase of bird and non-25 bird cells infected with the vFP-2 virus was confirmed, as before, by the immunoprecipitation method.

By inoculating two rabbits with vFP-2 virus, further evidence was obtained that the vFP-2 embodiment of the invention is a successful recombinant virus carrying the genes for rabies G and β-galactosidase.

Both rabbits were inoculated intradermally with 1 x 10 8 pfu vFP-2 per day. rabbit.

18 DK 175980 B1

Both of these rabbits formed typical pox lesions. The rabbits were sampled weekly and sera were tested by ELISA to detect the presence of specific antibodies against the rabies glyco protein and β-galactosidase protein.

5

As indicated in Table II below, rabbit 205 showed detectable amounts of anti-β-galactosidase antibody in the ELISA sample one week after inoculation. This increased by two weeks to a titer of 1 in 4000, maintained until 5 weeks after inoculation. Using the antigen capture ELISA assay, rabbit sera 105 showed detectable amounts of anti-rabies antibodies from 3 to 10 weeks after inoculation.

19 DK 175980 B1 | TABLE 11

Antibody formation of rabbit 205 against rabies antigen and B-oalactosidase protein 5

Time Antibody titre (reciprocal of serum dilution) 10 Before sampling anti-3-galactosidase of blood sample 0

Week 1 500

Weeks 2-5 (each) 4000

Week 6 500 15 Week 9 250 Before taking anti-rabies blood test 0

Week 3 200 20 Week 6 200

Week 10 100 EXAMPLE 4A - Construction from fierce creepox virus FP-1 of recombinant virus vFP-3 containing promoted rabies G-aen

This embodiment illustrates that the rabies G gene is fully expressed by poultry pox strains other than FP-5, specifically by another strain of poultry pox virus designated FP-1.

30 20 DK 175980 B1

As in Example 3, a 0.9 kbp Pvull fragment was obtained from FP-1, assuming that the fragment would contain a non-essential region, as was the case for FP-5.

This fragment was inserted between the two Pvull sites in pUC9, forming a plasmid designated pRW731.15R.

This plasmid has two HincII sites, with a distance of approximately. 30 bp located asymmetrically within the Pvull fragment, thus forming a 10 long arm and a short arm of the fragment.

A commercially available Pst coupling sequence (5 ') - CCTGCAGG - (3') was inserted between the two HincII sites to generate plasmid pRW741.

15

An HH-promoted rabies G gene was inserted into this plasmid at the Pst I site to generate the new plasmid pRW742B. By recombining this plasmid with FP-1 by infection / transfection of CEF cells, virus vFP-3 was obtained.

The ATG translation initiation codon in the open reading frame promoted by the HH promoter was superimposed on the initiation codon of the rabies G gene using a synthetic oligonucleotide spanning the EcoRV site of the HH promoter and HindIII site of the rabies G gene. . The 5 'end of this HH-promoted rabies gene was modified by known techniques to contain a Pst I site, and the construct was then ligated into the Pst I site of pRW741 to form pRW742B. The orientation of the construct in the plasmid is the same as in pRW735.1 previously discussed in Example 3.

Recombination was performed as described in Example 2. The resulting recombinant is called vFP-3.

21 DK 175980 B1

The expression of rabies antigen by both bird and non-bird cells infected with the vFP-3 virus was confirmed by the previously described immunoprecipitation and immunofluorescence techniques.

Further evidence that the vFP-3 embodiment of the invention is a successful recombinant pimple expressing genes for rabies G was obtained by inoculating rabbit pairs intradermally with the recombinant pimple. Two rabbits were inoculated intradermally with 1 x 10 6 pfu vFP-3 per ml. rabbit. Both of these rabbits formed typical pox lesions that reached maximal size 5-6 10 days after inoculation. The rabbits were sampled at weekly intervals and sera were tested by ELISA to detect the presence of specific antibody for the rabies glycoprotein.

Five rats were each also inoculated intradermally with 5 x 10 7 pfu vFP-3.

Resulting lesions were seen in all animals.

Both rabbits and rats produced detectable amounts of antibody specifically against rabies two weeks after inoculation. Two control rabbits inoculated intradermally with the parental FP-1 virus did not have detectable amounts of anti-rabies antibody.

To exclude the possibility that the antibody response was due to the introduction of the rabies antigen that coincided with the inoculum virus or was integrated into the membrane of the recombinant poultry pox vims, rather than being produced by the de novo synthesis of the rabies antigen by the recombinant vims in the animal as predicted. , the vFP-3 was chemically inactivated and inoculated in rabbits.

The purified vim was inactivated from one day to the next at 4 ° C in the presence of 0.001% β-propiolactone and then pelleted by centrifugation.

The pelleted virus was collected in 10 mM Tris-buffered saline, ultrasonically treated and titrated to ensure that no infectious virus remained. Two rabbits were inoculated intradermally with inactivated vFP-3 and two rabbits with an equivalent amount of untreated recombinant. The size of lesions was checked.

5

Both rabbits receiving untreated vFP-3 developed typical pox lesions classified 4-5 + 5 days after inoculation. Rabbits inoculated with inactivated virus also developed lesions, but these were classified as 2 * 5 days after 'inoculation.

10

The rabbits were sampled at weekly intervals, and sera were tested by ELISA for the presence of rabies-specific antibodies and iron-crayfish-specific antibodies. The results are shown in Table III below.

TABLE III

Live vFP-3 Inactivated vFP-3

Rabbit: No. 295 No. 318 No. 303 No. 320

Tested antibody: Rabies FP Rabies FP Rabies FP Rabies FP

Week after inoculation “0 0 0 0 0 0 0 0 5 2 250 4000 500 4000 0 50 0 1000 3 1000 4000 500 4000 0 4000 0 2000 4 1000 4000 2000 4000 0 4000 0 2000 5 4000 4000 2000 4000 0 2000 0 4000 6 4000 4000 4000 4000 0 2000 0 2000 In this test, the titration endpoint (expressed as the reciprocal of the serum dilution) is arbitrarily set to 0.2 after subtracting the absorbance values of all pre-challenge sera. Both rabbits 295 and 318 that received the live virus developed an immune response to the rabies glycoprotein and to poultry pox virus antigens. Rabbits 303 and 320 also developed an immune response to poultry pox virus antigens, although the titer was low. None of these rabbits developed a detectable response to the rabies glycoprotein.

This result indicates that the immunological response generated in the rabbit is 5 due to the de novo expression of the rabies glycoprotein gene carried in the recombinant virus, and not a response to a randomly enclosed glycoprotein contained in the inoculum virus.

EXAMPLE 4B - Construction from fiery Creole virus FP-1 of recombinant 10 virus vFP-5 containing unprompted rabies G gene

Expression of a foreign gene inserted by recombination into the poultry pox genome requires the presence of a promoter. This was shown by creating an additional recombinant, vFP-5 identical to vFP-3 except that the HH promoter is deleted. The presence of the rabies gene in this recombinant was confirmed by nucleic acid hybridization. However, no rabies antigen was detected in CEF cell cultures infected with the virus.

EXAMPLE 5 - In vitro transfer assay for determination of 20 wild crepe pox replicates in non-fual cells

An experiment was performed in which three cell systems, one from birds and two from non-birds, were inoculated with the parental FP-1 strain or the recombinant vFP-3. Two petri dishes each of respectively. CEF, MRC-5 and VERO 25 were inoculated with FP-1 or vFP-3 at an input multiplicity of 10 pfu cell.

After three days, one petri dish was harvested from each. The virus was released by three successive cycles of freezing and thawing and reinoculated on a fresh monolayer of the same cell line. This was repeated for six consecutive transfers and at the end of the experiment, samples from each transfer were titrated for virus infectivity on CEF monolayers.

24 DK 175980 B1

The results are shown in Table IVA and indicate that serial transfer of both FP-1 and vFP-3 is possible in CEF cells, but not in either of the two non-bird cell lines. Infectious virus cannot be detected after 3 or 4 transfers in VERO or MRC-5 cells.

5

The second petri dish was used to determine whether viruses not detectable by direct titration could be detected after amplification in the permissive CEF cells. On the third day, cells were harvested on the second petri dish by scraping and a third of the cells were lysed and inoculated on a fresh CEF monolayer. Upon achieving full cytopathic effect (CPE), or 7 days after infection, the cells were lysed and virus yield titrated.

The results are shown in Table IVB. When transmission in CEF cells was used to amplify any virus present, the virus could not be detected after four or five transfers.

15

Attempts to establish persistently infected cells failed.

In a further attempt to detect evidence of continued viral expression in non-avian cells, the samples used for viral titration above were used in a standard immunoprotection assay (immunodot assay) in which anti-poultry pox antibody and anti-rabies were used. antibody was used to detect the presence of the respective antigens. The results of these tests confirm the results obtained by titration.

i.

j 25 DK 175980 B1

TABLE IVA

Overførinasforsøg

Inoculum virus: FP-1 vFP-3

Cell type CEF VERO MRC-5 CEF VERO MRC-5

Transmission: 1 6.6a 4.8 4.9 6.6 5.4 66.2 2 6.7 2.9 3.7 6.5 4.2 5.1 3 6.4 1.4 1.0 6.4 1.7 4.4 4 6.1 idb Ld. 6.2 i.e. 1.0 5 6.4 i.d. i.d. 6.3 i.d. i.d.

6 5.7 i.d. i.d. 5.9 i.d. i.d.

3 - virus titer expressed as logio pfu / ml 5 b - not detectable

TABLE IVB

amplification experiments

Inoculum virus: FP-1 vFP-3

Cell type CEF VERO MRC-5 CEF VERO MRC-5

Transmission: 1 6.4a 6.2 6.4 6.5 6.3 6.4 2 7.5 6.3 6.0 6.5 6.3 5.5 3 6.2 6.7 5.3 5.9 6.1 6.3 4 5.6 4.6 3.9 5.7 4.8 5.8 5 6.3 4.1 id 6.1 4.7 4.7 6 6.2 i.d.b i.d. 6.2 i.d. i.d.

10 a - virus titers expressed as log-pfu / ml b - not detectable EXAMPLE 6 - Additional recombinants of wild crepe pox FP-1: vFP-6. VFP 7th vFP-8 or vFP-9

Recombinant viruses vFP-6 and vFP-7 were constructed as follows.

5

A 5.5 kbp Pvull fragment of FP-1 was inserted between the two Pvull sites in PUC9 to generate the plasmid pRW731.13. This plasmid was then cut into a unique HincII site and HH promoted rabies G gene with blunt ends inserted to generate plasmids pRW748A and pRW748B, representing opposite orientations of insertion. The plasmids pRW748A and B were then used separately to transfect CEF cells together with FP-1 virus to generate, respectively. vFP-6 and vFP-7 by recombination. This locus is now designated locus f7.

A 10 kbp Pvull fragment of FP-1 was inserted between the two Pvull sites in pUC9 to form pRW731.15. This plasmid was then cut into a unique BamHI site and an 11K promoted Lac Z gene fragment was inserted to form pRW749A and pRW749B, representing opposite orientations of insertion. Recombination of these donor plasmids with FP-1 resulted in! 20 and 20 respectively. vFP-8 and vFP-9. This locus is now designated locus f8.

vFP-8 and vFP-9 expressed the LacZ gene, as detected by X-gal. vFP-6 and vFP-7 expressed the rabies G gene as detected by rabies-specific antiserum.

Example 7 - Immunization with vFP-3 to protect DVR from challenge with live rabies virus

Groups of 20 SPF female mice, 4-6 weeks old, were inoculated underfoot with 50 μΙ of vFP-3 at doses ranging from 0.7 to 6.7 TCID 50 per day. mouse. [TCID 50 or 30 tissue culture infectious dose is the dose at which cytopathic effect is seen in 50% of cells in tissue culture). 14 days after the 27 vaccination, 10 mice were killed in each group and serum samples were taken for testing in the RFFI test. The remaining 10 mice were challenged by intracerebral inoculation of 10 LD50 rabies of the CVS strain and surviving mice counted 14 days after the challenge.

5th

The results are shown in Table VA below.

TABLE VA

10 vFP-3 dose of Rabies antibody titer

Loqin TCIDsn Logm Dilution * Survival 6.7 1.9 8/10 4.7 1.8 0/10 15 2.7 0.4 0/10 0.7 0.4 0/10

As measured by the Rapid Fluorescent Focus Inhibition (RFFI) test, Laboratory Techniques in Rabies, 3rd ed., 354-357, WHO, Geneva.

20

The experiment was repeated with 12.5 LD50 challenging rabies virus. The results are shown in Table VB below.

TABLE VB 25 vFP-3 dose of Rabies antibody titer

Loam TCIPw Loom Dilution * Survival 6.7 2.8 5/10 30 4.7 2.1 2/10 2.7 0.6 0/8 0.7 0.6 0/8

As measured by the Rapid Fluorescent Focus Inhibition (RFFI) test, 35 Laboratory Techniques in Rabies, 3rd ed., 354-357, WHO, Geneva.

28 DK 175980 B1

Two dogs and two cats were immunized with a single subcutaneous inoculation of 8 logio TCID 50 of the recombinant vFP-3. In addition, two dogs and four cats of similar age and weight were kept as non-vaccinated controls. Blood tests were performed on all animals at weekly intervals. On day 94 5, each dog was challenged by inoculation in the temporal muscle of two doses of 0.5 ml of a salivary gland homogenate of the NY strain, available from Institut Merieux, Inc. The total dose was equivalent to 10000 mice LD50 administered by intracerebral route. The six cats were similarly challenged by inoculation in the neck muscle with two doses of 0.5 ml of the same 10 virus suspension. The total dose per animals corresponded to 40000 mice LD50 administered by intracerebral route. The animals were observed daily. All non-vaccinated animals died with rabies symptoms on the day listed in Table VI.

The vaccinated animals survived the challenge and were observed for three weeks after the last control animal died. The results are shown in Table VI below.

TABLE VI

29 DK 175980 B1

Survival / Vaccine-Death ring Titer at postinoculation date 5 0 14 21 28 94

Cat 7015 vFP-3a 0 2.2b 2.4 2.4 1.5 + 7016 'vFP-3 0 1.7 1.9 2.0 1.3 + 10 8271 cc 0 0 0 0 0 d / 13d T10 c 0 0 0 0 0 d / 12 T41 c 0 0 0 0 0 d / 13 T42 c 0 0 0 0 0 d / 12 15 Dog 426 vFP-3 0 0.8 1.0 1.1 1.2 + 427 vFP-3 0 1.5 2.3 2.2 1.9 + 55 c 0 0 0 0 0 d / 15 8240 c 0 0 0 0 0 d / 16 20 a Both cats and dogs vaccinated with vFP-3 received 8 log10TCID50 by subcutaneous route.

b Titer expressed as logio highest serum dilution giving more than 50% reduction in the number of fluorescent wells in an RFFI test. * 25 c Non-vaccinated control animals.

d The animal died / death day after challenge.

In further experiments, the recombinant viruses vFP-2 and vFP-3 were inoculated in cattle by several different routes of administration.

30

Inoculated animals were tested for anti-rabies antibody on days 6, 14, 21, 28 and 35. As shown in the following Table VIIA, all animals exhibited a serological response to the rabies antigen.

TABLE VIIA

30 DK 175980 B1

Antibody titers in mammals inoculated with vFfr ^ anti-rabies neutralizing antibodies 5 RFF1 test loam dilution

Day 0 6 14 21 28 35

Cattle no.

7.3 logio TCID 50 1420 (intraderm.) NEG 0.6 2 1.7 13 17 8 log-ιο TCID50 1419 (subcutaneous) NEG 1.6 2.2 2.1 2 1 1 9 15 8 log-ιο TCID50 1421 (intramuscular) NEG 0.9 2.2 2.2 1.8 1.7 7.3 log ιο TCID50 1423 (intramuscular) NEG 0.9 1.1 * 1 * 1 * 1.1 * + Not significant.

Each piece of cattle was revaccinated with 8 logi TCIF 50 55 days after 25 inoculation and showed an anamnestic response to the rabies antigen. In booster revaccination, all cattle were inoculated subcutaneously except no.

1421, which was again inoculated intramuscularly. RFFI titers were determined on days 55, 57, 63, 70, 77 and 86. The results are shown in Table VIIB.

TABLE VIIB

31 DK 175980 B1

Day 55 57 63 70 77 86

Cattle no.

5 1419 1.7 1.5 2.9 2.9 2.6 2.9 1420 1.0 0.5 1.9 2.3 2.2 2.0 1421 1.3 1.2 2.9 2 , 7 2.5 2.5 10 1423 1.0 0.7 2.4 2.5 2.5 2.2

All figures are for vFP-3 except for animal # 1423 which is for vFP-2.

Cattle, cats and rabbits were also inoculated intradermally with known amounts of poultry pox virus and after one week wounds were collected from the animals.

These were ground, suspended in brine and titrated to determine the amounts of virus.

Only residual amounts of infectious virus could be recovered. This shows that there was no productive infection in vivo.

Example 8 - Inoculation of Chickens with vFP-3 The recombinant poultry pox virus vFP-3 was inoculated into chickens to show the expression of foreign DNA of a recombinant poultry pox virus in a system that allows productive replication of the vector.

White Italian chickens were inoculated intramuscularly with 9 log ™ 30 TCID50 vFP-3 or 3 log ™ TCID50 vFP-3 by wing piercing. Blood samples were taken for an RFFI test for rabies antibody titer 21 days after vaccination. Titers from day 21 in inoculated chickens were significantly higher than titers from day 21 in controls. The mean titer for the uninfected 32 controls was 0.6, the mean for the intramuscularly inoculated birds was 1.9 and the average for the wing-pierced birds was 1.2.

EXAMPLE 9 - Recombinant fiery crepe pox vFP-11. expressing the turkey-5 influenza H5-HA antia

Bird species can be immunized against bird pathogens using the recombinant avipox viruses of the invention.

Thus, the novel plasmid pRW759 (described below) derived from poultry pox virus FP-1 and containing the HindIII H promoted hemagglutinin gene (H5) from A / turkey / ireland / 1378/83 (TYHA) , used for transfection of CEF cells simultaneously infected with parental virus, FP-1. Recombinant poultry pox virus vFP-11 was obtained by the previously described techniques.

The synthesis of a hemagglutinin molecule of vFP-11 infected cells was confirmed by immunoprecipitation from metabolically radiolabeled infected cell lysates using specific anti-H5 antibody and standard techniques. Specific immunoprecipitation of precursor hemagglutinin having a molecular weight of about 20 was shown. 63 kd (kilodalton) and two cleavage products with molecular weights of 44 and 23 kd. No such proteins were precipitated from a lysate of uninfected CEF cells or cells infected with parental virus, FP-1.

25

Immunofluorescence studies were performed to determine that the HA molecule formed in cells infected with the recombinant poultry pox vFP-11 was expressed on the cell surface. CEF cells infected with the recombinant poultry pox virus vFP-11 showed strong fluorescent labeling on the surface.

30 In cells infected with the parental virus FP-1, no fluorescence was seen.

33 DK 175980 B1

Plasmid pRW759 was formed as follows: pRW742B (cf. Example 4) is made linear by partial degradation with PstI, and the fragment is cut again with EcoRV to remove the rabies G gene, leaving the HH promoter on the remaining fragment of ca. . 3.4 kbp.

This is treated with alkaline phosphatase and a synthetic oligonucleotide is inserted to join the HH promoter with TYHA by ATG to form pRW744.

This plasmid was made linear by partial degradation with Dral, the linear fragment cut with SalI and the largest fragment was re-isolated and treated with alkaline phosphatase.

Finally, pRW759 was generated by insertion into the pRW744 vector of the 15 isolated Sall-Dral coding sequence from TYHA, described by Kawaoka et al.

Virology 158: 218-227 (1987).

Example 10 - Immunization with vFP-11 to protect birds against challenge with live influenza virus 20

To assess the immunogenicity of the recombinant poultry pox virus vFP-11, vaccination and challenge experiments with chickens and turkeys were performed.

Particular pathogen-free chickens of white Italians were vaccinated at the age of 2 days and 25 weeks by double-needle wing tissue puncture, used for commercial vaccination of poultry with poultry pox virus. Each bird was administered approx. 2 μΙ containing 6 x 105 pfu vPF-1. Blood samples were taken from the older birds prior to vaccination and blood samples were taken from all birds prior to challenge and two weeks later.

30 34 DK 175980 B1

For comparative purposes, another group of chickens was vaccinated with a conventional H5 vaccine consisting of an inactivated H5N2 strain in a water-in-oil emulsion.

5 Inactivated H5N2 vaccine was prepared from A / Mallard / NY / 189/82 (H5N2) influenza virus cultured in 11-day-old embryonated chicken eggs. The infected allantoic fluid with a HA / titer of 800 / 0.1 ml and infectivity titer of 108.5 / 0.1 ml was inactivated with 0.1% propiolactone and suspended in water-in-oil emulsion as described in Stone et al. ., Avian Dis. 22: 666-674 (1978) and Brugh et al., Proc. Second Inter. Sym. on Avian Influenza, 283-292 (1986). The vaccine was administered in a volume of 0.2 ml subcutaneously on the inside of the thigh muscle for 2 days and 5 weeks old chicks by SPF white Italians.

15 A third and fourth group of chickens were given respectively. parental virus FP-1 or no vaccine.

The chickens were challenged with approx. 103 LD50 of the highly pathogenic A / Turkey / ireland / 1378/83 (H5N8) or A / Chick / Penn / 1370/83 (H5N2) 20 influenza virus by administering 0.1 ml to the nostrils of each bird. Two-day-old birds were challenged 6 weeks after vaccination, and 5-week-old birds were challenged 5 weeks after vaccination. The birds were observed daily for signs of disease, indicated by swelling and cyanosis of the face and crest, as well as bleeding in the legs (often such birds could not stand up), in 25 paralysis and death. Most deaths occurred between 4 and 7 days after infection. Grafting from trachea and sewage was taken on each of the live chickens 3 days after infection, which was examined for virus by inoculation in embryonated eggs. The chickens inoculated with either wild-type or recombinant poultry pox virus developed typical lesions on the wing tissue. '30 On the third day, pustules were formed at the site of each cannula, followed by cellular infiltration with ulceration and improvement on the 7th day. No secondary lesions were formed in 35 DK 175980 B1, and there was no evidence of spread to non-vaccinated contact chickens. The results of the challenge trial are shown in Table VIII and the related serological results in Table IX.

TABLE VIII

Protection of chickens mediated by H5 expressed in wild squid Detected 10 challenge Protection Virus

chickens

Virus_Vaccine age Sick / dead / total Trachea Sewerage_

Ty / ireland Fowlpox-H5 2 days 0/0/10 0/10 0/10 (H5N8) (vFP-11) 5 weeks 0/0/5 0/5 0/5 15

Inactivated 2 days 0/0/9 0/9 0/9 H5N2 5 weeks 0/0/5 0/5 0/5

Fowlpox 2 days 10/9/10 2/6 3/6 20 control 5 weeks 4/3/5 0/5 4/5

No 2 days 10/9/10 2/7 5/7 2 days' 2/1/2 2/2 2/2 5 weeks 2/2/5 0/5 1/5 25

Ck / Penn Fowlpox-H5 2 days 0/0/10 8/10 0/10 (H5N2) (vFP-11) 5 weeks 0/0/6 5/6 2/6

Inactivated 2 days 0/0/8 2/8 0/8 30 H5N2 5 week 0/0/5 3/5 0/5

Fowlpox 2 days 10/1/10 10/10 10/10 control 5 weeks 5/0/5 5/5 5/5 35 No 2 days 9/3/9 9/9 9/9 2 days 2/2/2 2/2 2/2 _5 weeks 5/2 / 5_5 / 5 5 / 5_

Four non-vaccinated birds stayed with and grew up with the 10-bird poultry pox-40 H5 group to test the spread of poultry pox-H5.

DK 175980 B1 CM - »* - OO i © ooo Ά cowo ιλ oo in o 5 LU r ^ cM rr t- tj · tj · cm r- ft S .. i £ · § s S. ° £ ~> SV © o «'SIld vv? ί v v v v .b £> © „ro σ s N C ^ o —o - c c ^ 2 o o o o o c. - <D 0) © 2o OO OO 02.

3 </> - jt- Ko ow oo o o c = i = ^ LU ^ t- T- CM 00 t- COS ·

CD C

.E CD

Έ5 3 2 S3 z> ^> i- © o o * = ¢ - o <o in T t

-i £ LU St- (OCM V V VV

ro c § ™ b © o o o o o o o _b «binooooooooooocvTtcDin - LU CD CM WCM CM CD CM CD 03 CO I ^ CM t-t- r- t-

_ C

31 © Y Ο Χ CL i _ I ^ u

% UJ ζ Ί å o§ oS

171 CD S ^ = - lu vv nr- vv vv vv cm t- vv vv <E 2 oi s- - cb cm 5 S 2 - "C -i- fe co ~" 0o - - 2 O) © CD oo O 00 CO oo east. so - tjC in oo oo cd cm oo to oo oo oco 3 c LU 1- NC S- CO t— T- OO CM CD CM CO ΙΩ CD O CO t- o © C Ϊ Ό> · ^ ro h «-„ > © sooo «^ inoorn mooo Q) LU TT- COCO VV VV T- 00 CD CO vv vv S3 oo Vl_ Q) φ u © I- © i- © I- © i_ © i_ y C i- CD 0) CD ® CD © CD O CD © CD 0) CD © CD © C ΐ (0 0) CD 05 (DO) (DO) (OO) CD O) (DO) CD O) CD O)

>> φ p OD Ό D "O D T3D" D D T3D T> D T3D

g ^ Ccdcd cm m cm m cm m cm in cm m cm m cm m cm m

ISLAND

D

ft,

® x „X X _ X

* - obo obo αϊα. U.S; island.

«£ s §> 8 · = § s> æ- a ·« · ^ M L · O ^ ^ ΛΙ L · O f ·

O # -¾ v u C V v L · C

o υ 1 = jtfZ ^ b © t = - * Z u b © co © m © m ©. o 2 © m rom © 5 cd 2> tTX £ l iT5 -E GTx £ x iT 5 £ ro? © c c b ro o- c Έ ® 5 ©

Ot / 3 2. Z Q_ i

= >> Hi O

in o m o in o

T- t— CM CM CO

37 DK 175980 B1 (Table IX continued) (a) The 5-week-old birds were sampled before vaccination and tested 5 by H1 and neutralization tests, none contained detectable antibody levels, and the results are not shown. The 2-day-old chickens were sampled 6 weeks after vaccination (After 1), and the 5-week-old birds were sampled 5 weeks after vaccination (After 1); both groups were sampled 2 weeks after challenge (After 10 2). The numbers are the mean antibody titers from the same chicken groups described in Table 1.

(b) The numbers in parentheses represent those who survived challenge.

(c) Hemagglutination inhibition (H1) assays were performed on microtiter plates using receptor-degrading enzyme-treated sera, 4 HA units of Ty / lre virus, and 0.5% chicken erythrocytes as described in Palmer et al., Immun. Series No. 6, 51-52, U.S. Dept. Health, Education and Welfare (1975). Tests for neutralizing infectivity were performed by incubating 103 EID50 Ty / lre virus with serum dilutions for 30 min at room temperature, 20 followed by inoculation of embryonated eggs with aliquots. Virus growth was determined by haemagglutination tests after incubating eggs for 2 days at 33 ° C.

<= less than 10.

Chickens inoculated with the poultry Pox H5 recombinant (vFP-11) or the inactivated H5N2 influenza vaccine in adjuvant were protected from challenge with the homologous Ty / lre (H5N8) influenza virus and the related but distinct Ck / Penn (H5N2) influenza virus. . In contrast, the majority of birds inoculated with parental FPV or who received no 30 vaccines showed clinical signs of highly pathogenic influenza, including swelling and cyanosis of the face and comb, leg haemorrhage and paralysis. Most of these birds died. The vaccinated birds did not secrete detectable levels of Ty / lre, but secreted Ck / Penn.

Both the inactivated and recombinant vaccines induced HI and 5 neutralizing antibodies against Ty / lre, but the amount of antibody induced by the poultry pox H5 recombinant, vFP-11, before challenge did not inhibit HA or neutralize the heterologous Ck / Penn H5. However, the chickens were protected against propagation with both Ty / lre and Ck / Penn influenza viruses.

Immune against H5 influenza induced by the vFP-11 vaccination lasted for at least 4 to 6 weeks and was cross-reactive. To further investigate the duration and specificity of the response, a group of 4-week-old chicks were inoculated into the wing tissue with vFP-11 as previously described and challenged at monthly intervals with the cross-reactive Ck / Penn virus.

15 Again, no H1 antibodies were detected before the challenge. Nevertheless, the birds were protected for more than 4 months.

The HFP expressed by vFP-11 also induces a protective immune response in turkeys. Outbred white turkeys were vaccinated at wing tissue inoculation aged 2 days and 4 weeks 20 as previously described. The results are shown in Table X.

DK 175980 B1 ® Φ fl) £ | tj -§

σ> 2> e co T- g Q

.2 ~ LU TJ- -sT T3 Ό O H- W Ό - O T- cd ^ φ in c ^ o ^

LU V T- V V

CN

Φ ΪΚ O a> • o ® O O Ό Ό

C 'S S CD Q Q

<D O LU T- (O -o Ό - C (Λ 0> <D · - i V w c 2: s? * -

__ 3 -1- <D O O O O

~ CD C. T-

2 Z LU V V V V

C

T3 3

<W CO

I E o in co cn cn ΐβ> ^ co δ cn cn T.

H— co ® —I ® c5 co σ> lu ^ ~ $

00 00 c w -C

<E - o

I— o -CO 2 in CD CN CN

^ 0. f— in CN CN CN

Φ c 3 5 w * ® o

** = c «S

. I ^ in %%

Q) -X UO CO CN CN

5 ^ ζ v S! ^

- * C CD (S) T— CN CN CN

10 Φ 00 10 <D m C X ._ Φ ® i-? Φ O) Φ Π) ® 4S o) co o> S'p ^ 3-03 li- CO 04 ^ CN ^ 4—1

C

CO

<u -½ -Λ CD

o T I -2 2 S ll o c £>% ί $ 2 m o in o T- ^ cn 40 DK 175980 B1

Significant survival against challenge was observed with the homologous Ty / lre virus in both age groups. Non-vaccinated contact control birds stayed with the vaccinated birds to test the spread of the recombinant virus. These birds did not survive challenge.

EXAMPLE 11 - Construction of fiery creepox virus FP-1 recombinant vFP-12 expressing quinine influenza nucleoprotein (NP) gene 10 Plasmid pNP33 contains a cDNA clone of the influenza virus

Chicken / Pennsylvania / 1/83 nucleoprotein gene (NP). Only the 5 'and 3' ends of the approx. The 1.6 kbp NP gene has been sequenced. NP, in the form of a 5'-Clal-Xhol-3 fragment with blunt ends, was moved from pNP333 into SmaI-degraded pUC9, with pUC9's EcoRI site at the 3-end producing pRW714.

The translation initiation codon (ATG) in NP contains the following under dashed Ahall site: ATGGCGTC. The previously described vaccinia H6 promoter was associated with NP with a double-stranded synthetic oligonucleotide. The synthetic oligonucleotide contained the H6 sequence from the EcoRV site to its ATG and into the NP coding sequence at the Ahall site. The oligo-20 nucleotide was synthesized with BamHI and EcoRI compatible ends for insertion into pUC9 to produce pRW755. Starting at the BamHI-compatible end, with ATG underlined, is the sequence of the double-stranded synthetic oligonucleotide:

25 GATCCGATATCCGTTAAGTTTGTATCGTAATGGCGTCG

GCTATAGGCAATTCAAACATAGCATTACCGCAGCTTAA

The linear partially Ahall degraded product of pRW755 was isolated and re-cut with EcoRI. The pRW755 fragment, containing a single Ahall-30 cut by ATG and re-cut with EcoRI, was isolated, treated with phosphatase and used as a vector for the pRW714 degradation product below.

The isolated linear partially Aha II degraded product of pRW714 was 5 cut with EcoRI. An isolated Ahall EcoRI fragment of ca. 1.6 kbp containing the NP code sequence was inserted into the aforementioned pRW755 vector to generate pRW757. The complete H6 promoter was formed by adding the sequences upstream (5 ') of the EcoRV site. Plasmid pRW742B (described in Example 4) had the H6 sequence downstream (3 ') of the EcoRV site removed along with sequences to the NdeI site of pUC9. The pRW742B EcoRV-Ndel fragment treated with phosphatase was used as a vector for the pRW757 fragment below. The isolated linear partial EcoRV degradation product of pRW757 was reinsulated after Nde I degradation; this fragment contains the H6 promoter from the 15 EcoRV site through NP to the Ndel site of pUC9. The pRW757 fragment was inserted into the pRW742B vector to generate pRW758. The EcoRI fragment from pRWW758, containing the complete H6 promoted NP, was blunt-ended with the Klenow fragment from DNA polymerase I and inserted into the HincII site of pRW731.13 to form pRW760. The HincII site in 20 pRW731.13 is the FP-1 locus used in Example 6 to construct vFP-6 and vFP-7.

Using poultry pox FP-1 as the rescue virus, plasmid pRW760 was used in an in vitro recombination assay. The offspring of plaques were tested and plaque purified using in situ plaque hybridization. Expression of the gene has been confirmed by immunoprecipitation studies using a goat polyclonal anti-NP antiserum. The size of the protein that specifically precipitated from a lysate of vFP-12-infected CEF cells was approx. 55 kD, which is within the described order of magnitude for influenza virus 30 nucleoproteins.

EXAMPLE 12 - Preparation of a fiery creepox virus double recombinant.

VFP 15th expressing the genes for the complete influenza nucleoprotein (NP) and hemogglutinin (HA) 5 The hemagglutinin (HA) gene of A / Tyr / lre / 1378/83 has been previously described in the construction of vFP-11 (Example 9). To produce a double recombinant, the HA gene was first moved to locus f8, previously defined by the construction of vFP-8, using plasmid pRW731.15.

10 To construct vFP-11, plasmid pRW759 was used. The hemagglutinin gene linked to the H6 promoter was removed from this plasmid by partial Pst I degradation. This fragment was blunt-ended with the Klenow fragment of DNA polymerase I and inserted into the blunt-ended BamHI site of pRW731.15 to generate pRW771.

15

Plasmid pRW771 was then used in an in vitro recombination assay using vFP-12 as the rescue virus. The recombinant vFP-12 virus contains the nucleoprotein gene linked to the H6 promoter at locus f7 of plasmid pRW731.13. Recombinant plaques, now containing both insertions, were selected and purified by in situ hybridization and surface expression of the hemagglutinin, confirmed by a protein A-β-galactosidase-linked immunoassay. Expression of both genes was confirmed by immunoprecipitation from lysates of cells infected with the double recombinant virus, vFP-15.

EXAMPLE 13 - Construction of Recombinant Canary Pox Viruses

The following example shows the identification of four nonessential insertion loci in the canary pox genome and the construction of four recombinant canary pox viruses, vCP-16, vCP-17, vCP-19 and vCP-20.

i! 43 DK 175980 B1

The recombinant canary epox vCP-16 was constructed in the following manner.

A 3.4 kbp PvuII fragment of 3.4 kbp canarypox DNA was cloned into pUC9 to form pRW764.2. A unique EcoRI site located asymmetrically within the fragment was found with a short arm of 700 bp and a long arm of 2.7 kbp. The plasmid was digested with Eco RI and blunt-ended using the Klenow fragment of DNA polymerase I. The blunt-ended H6 / rabies G gene was then ligated into this site and used to transform E. coli. The resulting plasmid, pRW775, was used in an in vitro assay for recombination. The offspring of plaques that were positive by an immune screening were selected and purified. The resulting recombinant was designated vCP-16 and the insertion site was designated C3.

The plasmid pRW764.2 used in the above construction also contained a unique BglII site, ca. 2.4 kbp from the EcoRI site. Using the same cloning strategy, the H6 / rabies G gene was ligated into plasrinid pRW764.2 j at this site to generate pRW774. This plasmid was used to construct recombinant vCP-17 with the insertion locus designated C4.

Plasmid pRW764.5 contains a Pvull fragment of canary pox DNA of 850 bp with a unique BglII site asymmetrically located within the 400 bp fragment from one terminus. Using the same cloning strategy as previously described, the rabies G gene linked to the H-6 promoter was inserted at this site to generate pRW777. The stable recombinant virus formed was designated vCP-19 and the insertion site was designated C5.

Plasmid pRW764.7 contains a 1.2 kbp Pvull fragment with a unique BglII site 300 bases from one terminus. The plasmid was digested with BglII and blunt-ended with the Klenow fragment of DNA polymerase I. The 30 blunt-ended 11 K promoted Lac Z gene was inserted to generate plasmid pRW7778. The stable recombinant virus formed using this plasmid was designated vCP-20 and the insertion site was designated C6.

Example 14- Construction of a fiery creepox virus recombinant, vFP-5 29. expressing the fusion protein of Newcastle disease virus

Plasmid pNDV108, the cDNA clone of the NDV Texas strain fusion gene, consisted of a HpaI cDNA fragment of ca. 3.3 kbp containing the coding sequence for the fusion protein as well as additional NDV coding sequences cloned into the Scal site of pBR322. The steps for forming the insertion plasmid are described below.

(1) Formation of plasmid pCE11 15

An FPV insertion vector, pCE11, was constructed by inserting polylinkers into the HincII site of pRW731.13 (designated as locus f7). pRW731.13 contains a 5.5 kbp Pvull fragment of FP-1 DNA. A non-essential locus had previously been defined in the HincII site by constructing the 20 stable recombinant vFP-6, described in Example 6. The polylines inserted into the HincII site contain sites for the following restriction enzymes: Nrul, EcoRI,

Sacl, Kpnl, Smal, BamHI, Xbal, Hindi, SalI, Accl, Pstl, Sphl, Hindlll and Hpal.

(2) Formation of plasmid pCE19 25

This plasmid is a further modification of pCE11 in which the transcription stop signal ATTTTTNT from vaccinia virus (L. Yuen and B. Moss, J. Virology 50: 320-323 [1986]) (where N in this case is an A) is have been inserted between the Sac1 and EcoRI sites of pCE11, with subsequent loss of the EcoRI site.

30 45 DK 175980 B1 (3) Insertion of NDV code sequences

A 1.8 kbp gel-purified BamHI fragment, containing all except 22 nucleotides from the 5 'end of the fusion protein gene, was inserted into the 5 BamHI site of pUC18 to form pCE13. This plasmid was digested with SalI, which cuts into the vector 12 bases upstream from the 5 'end of the coding sequence. The ends were filled with the Klenow fragment of DNA polymerase I, and the plasmid was further digested with HindIII, which cuts 18 bases upstream from the Sall site. A 10,146 bp Yellow-purified SmaI HindIII fragment containing the vaccinia virus H promoter previously described in preferred embodiments, as well as polylinker sequences at each terminus, was ligated to the vector and transformed into E. coli cells. The resulting plasmid was designated pCE16.

To align the initiating ATG codon of the NDV fusion protein gene with the 3-end of the H6 promoter and to replace the 22 nucleotides missing at the NDV-5 end of pCE16, complementary synthetic oligonucleotides were created which ends in EcoRV and Kpnl sites.

The oligonucleotide sequence was 5 'AT C-CGT-TAA-GTT-T GT -AT C-GTA-ATG-G GC-T CC-AG AT CT-T CT-ACC-AGG-ATC-CCG-GTA-C 3' .

The pCE16 construct was then degraded with EcoRV and KpnI. The EcoRV-25 site is found in the H6 promoter 24 bases upstream of the initiating ATG. The KpnI site is found in the NDV coding sequence 29 bases downstream of the ATG.

Oligonucleotides were fused, phosphorylated and ligated to the linearized plasmid, and the resulting DNA was used to transform 30 E. coli cells. This plasmid was designated pCE18.

46 DK 175980 B1

To insert the NDV coding sequence into an FPV insertion vector, a 1.9 kbp SmaI HindIII gel purified fragment of pCE18 (intersecting the polylinker region) was ligated to a SmaI HindIII fragment of 7.8 kbp from pCE19, they are described above. The transcription stop signal is found 16 bases 5 downstream of the Sma I site. The resulting plasmid was designated pCE20.

Plasmid pCE20 was used in an in vitro assay for recombination using poultry pox virus FP-1 as a rescue virus. The resulting progeny were plated on CEF monolayers and the plaques subjected to a β-galactosidase-coupled protein A immunoassay using a polyclonal anti-NDV chicken serum. Positively colored plaques were selected and subjected to four rounds of plaque purification to obtain a homogeneous population. The recombinant was designated vFP-29.

Example 15 - Construction of avipox virus recombinants. expressing the envelope protein envelope protein from cat leukemia virus (FeLV)

The FeLV env gene contains the sequences encoding the p70 + p15E 20 polyprotein. This gene was initially inserted into the plasmid pSD467vC with the vaccinia promoter H6 5 'juxtaposed with the FeLV env gene. The plasmid pSD467vC was derived by first inserting a 1802 bp SalI / HindIII fragment containing the vaccinia hemagglutinin (HA) gene into a pUC18 vector.

The location of the HA gene has been previously defined (Shida, Virology 150: 451-462 [1988]). The majority of the open reading frame encoding the HA gene product was deleted (nucleotide 443 through nucleotide 1311) and a multiple cloning site containing BglII, SmaI, PstI, and EagI restriction endonuclease sites was inserted. The resulting pSD467vC plasmid contains flanking vaccinia arms of 442 bp upstream from the multiple cloning site and 491 bp downstream from these restriction sites. These flanking arms allow genetic material inserted into the multiple cloning region to be recombined into the HA region of the Copenhagen strain of vaccinia virus. The resulting recombinant progeny is HA negative.

The H6 promoter was synthesized by fusing four overlapping oligonucleotides together to form the complete sequence described above under preferred embodiments. The resulting 132 bp fragment contained a BglII restriction site at the 5 'end and a Sma I site at the 3' end. This was inserted into pSD467vC via the BglII and SmaI restriction site.

The resulting plasmid was designated pPT15. The FeLV env gene was inserted into the unique PstI site of pPT15, located immediately downstream of the H6 promoter. The resulting plasmid was designated pFeLVIA.

To construct the FP-1 recombinant, the 2.4 kbp H6 / FeLV env sequences were excised from pFeLVIA by degradation with BglII and partial degradation with PstI. The BglII site is at the 5 'boundary of the H6 promoter sequence.

The Pstl site is located 420 bp downstream of the translational termination signal for the sheath glycoprotein open reading frame.

The 2.4 kbp H6 / FeLV env sequence was inserted into pCE11 digested with Bam HI and Pst I. The FP-1 insertion vector, pCE11, was derived from pRW731.13 by inserting a multiple cloning site into the non-essential HincII site.

This insertion vector allows the development of FP-1 recombinants j containing foreign genes in the locus f7 of the FP-1 genome. The recombinant FP-1 / FeLV insertion plasmid was then designated pFeLVFI. This construct does not provide a perfect ATG for ATG substitution.

To obtain the perfect ATG: ATG construct, a Nrul / SstII fragment of approx. 1.4 kbp derived from the vaccinia virus insertion vector pFeLVIC. The No-30 site occurs within the H6 promoter at a position 24 bp upstream of the ATG. The SstII site is located 1.4 kbp downstream from the ATG and 1 kbp 48 upstream from the translation termination signal. This Nrul / Sstll fragment was ligated to a 9.9 kbp fragment produced by degradation with SstII and by partial degradation with Nrul. This 9.9 kbp fragment contains the 5.5 kbp of FP-1 flanking arms, pUC vector sequences, 1.4 kbp of FeLV-5 sequence corresponding to the downstream portion of the env gene, and the sequence closest to the 5 end ( about 100 bp) of the H6 promoter. The resulting plasmid was designated pFeFLVF2. The ATG for ATG construction was confirmed by nucleotide sequence analysis.

An additional FP-1 insertion vector, pFeLVF3, was derived from pFeLVF2 by removing the FeLV env sequences corresponding to the putative immunosuppressive region (Cianciolo et al., Science 230: 453-455 (1985]) (nucleotides 1548 to 1628 This was done by isolating an SstII / PstI fragment (sites described above) of approximately 1 kbp from the vaccinia virus insertion vector pFeLVID, plasmid pFeLVID similar to pFeLVIC except that the env sequences correspond to the immunosuppressive region ( nucleotide 1548 to 1628) was deleted by oligonucleotide-directed mutagenesis (Mandecki, Proc. Natl. Acad. Sci. USA 83: 7177-7181 [1987]). The 1 kbp SstII / Pstl fragment lacking nucleotides 1548 to 1628, 20 was inserted into a 10.4 kbp SstII / PstI fragment containing the remaining H6 / FelV env gene derived from pFeLVF2.

The insertion plasmids pFeLVF2 and pFeLVF3 were used in in vitro recombination assays with FP-1 as the rescue virus. Offspring from the recombination were plated on CEF monolayers and recombinant virus selected by plaque hybridization on CEF monolayers. Recombinant progeny, identified by hybridization assays, were selected and subjected to 4 rounds of plaque purification to obtain homogeneous population. An FP-1 recombinant harboring the complete FeLV env gene has been designated 30 vFP-25, and an FP-1 recombinant containing the complete gene lacking the immunosuppressive region was designated vFP-32. Both 49 recombinants by immunoprecipitation using a bovine anti-FeLV polyclonal serum (Antibodies, Inc., Davis, CA) have been shown to express the appropriate gene product. It is noteworthy that these FP-1 recombinants express the foreign FeLV env gene in CRFK cell line 5 (ATCC # CCL94) derived from cats.

For the construction of canary pox (CP) recombinants, a 2.2 kbp fragment containing the H6 / FeLV env sequences was excised from pFeLVF2 by digestion with SmaI and HpaI. The narrow site is at the 5 'boundary of the H6-10 promoter sequence. The hpal site is located 180 bp downstream from the translation termination signal for the envelope protein's open reading frame.

The 2.2 kbp H6 / FeLV env sequence was inserted into the nonessential EcoRI site of the insertion plasmid pRW764.2 after the EcoRI site was blunt ended. This insertion vector allows formation of CP recombinants containing foreign genes in the C4 locus of the CP genome. The recombinant CP insertion plasmid was then designated pFeLVCP2. This construct provides a perfect ATG for ATG substitution.

The insertion plasmid pFeLVCP2 was used in an in vitro assay for recombination with CP as the rescue virus. Offspring of the recombinants were plated on monolayers of CEF and recombinant virus selected by a β-galactosidase-coupled protein A immunoassay using a bovine anti-FeLV commercial polyclonal serum (Antibodies, Inc., 25 Davis, CA). Positively colored plaques were selected and subjected to four rounds of plaque purification to obtain a homogeneous population. A recombinant expressing the entire FeLV env gene has been designated vCP-36.

EXAMPLE 16 - Construction of fiery creepox virus recombinant vFP-22.

expressing the Rous-associated virus type 1 (RAV-1) envelope (enν ') gene 5 The clone penVRVIPT of the RAV-1 envelope gene contains 1.1 kbp of RAV-1 env DNA coding sequence, cloned into M13mp18 as a KpnI-Sacl fragment. This fragment is intact at the 5-end but lacks a portion of the 3 'sequence and was used in the following operations. A 1.1 kbp gel-purified EcoRI-Pstl fragment from penvRVIPT was inserted into the EcoRI and Pstl sites of pUC9 to form pRW756. This plasmid was then digested with KpnI and HindIII, which cut into the vector 59 bases upstream of ATG. A 146 bp KpnI-H was inserted into 146 bp II fragment containing the vaccinia H6 promoter described above to generate plasmid pCE6.

To ensure that the initiating ATG of the RAV env gene was located adjacent to the 3 end of the foreign sequence H6 promoter, two complementary synthetic oligonucleotides were constructed with EcoRV and BanII sites in termini. The oligonucleotide sequence was 5'-AT C-CGT-TAA-GTT-T GT-AT C-GTA-AT G-AGG-CG A-GCC-3 '.

20

Plasmid pCE6 was digested with EcoRV cutting in the H6 promoter 24 bases upstream of ATG, and with Ban11 cutting in the RAV env code sequence 7 bases downstream of ATG. The DNA segments were ligated and used to transform cells of E. coli. The resulting plasmid, 25 pCE7, supplied the final construct with the H6 promoter and correct 5 'sequence.

The clone mpl9env (190) was found by restriction mapping to contain the entire RAV-1 env gene. A 1.9 kbp Kpnl-Sacl fragment of 1.9 kbp containing the entire gene was inserted into the Kpnl and Sacl sites of pUC18 to form pCE3. This plasmid was digested with HpaI that cuts 132 bases downstream of the initiating ATG in the coding sequence for RAV-1, and 51 DK 175980 B1

Sacl that intersects at the 3 'terminus of the gene. The previously described FPV insertion vector pCE11 was digested with Sma I and Sac I, which cut the plasmid into the polylinker region. The hpaI-Sac1 fragment of pCE3 was ligated with pCE11 to form pCE14.

5

Plasmid pCE7 was then digested with XhoI and HindIII to form a 332 bp fragment containing the H6 promoter and correct 5 'sequence.

Plasmid pCE14 was digested with HindIII that cut into the vector's polylinker region and XhoI that cut into the coding sequence. This DNA was ligated to the HindIII-10 XhoI fragment obtained from pCE7 to form pCE15, the final RAV-1 envelope gene construct.

This plasmid was used in an in vitro assay for poultry pox FP-1 recombination as a rescue virus. Offspring of the recombination were plated on CEF monolayers and the plaques subjected to a β-galactosidase-coupled protein A immunoassay using an anti-RAV-1 polyclonal serum. Positively colored plaques were selected and subjected to four rounds of plaque purification to obtain a homogeneous population. The recombinant was designated vFP-22. Immunoprecipitation experiments using 20 cell lysates infected with vFP-22 have demonstrated specific precipitation of two proteins with apparent molecular weights of 76.5 kD and 30 kD corresponding to the two gene products of the envelope gene. No precursor gene product was seen.

In preliminary experiments, an immune response to RAV-1-25 envelope gene product in chickens was inoculated with vFP-22.

Example 17 - Construction of avipox virus recombinants. expressing the GP51.30 envelope (env) gene from Oxelukemia Virus (BLV) 5 (1) Construction of pBLVFI and pBLVF2

Plasmids pBLVFI and pBLVF2 contain the gp51.30 env gene from BLV. In both plasmids, the BLV env gene is under transcriptional control of the H6 promoter of vaccinia virus and is cloned between flanking arms of 10 poultry pox (locus f7). The nucleotide sequence of the two plasmids is identical except in codon positions 268 and 269. (pBLVFI encodes a protein containing the amino acids Arg-Ser at these two positions, whereas pBLVF2 encodes a protein containing the amino acids Gln-Thr).

15 pBLVFI and pBLVF2 were constructed by the following procedure. Plasmid pNS97-1, a plasmid containing the entire BLV env gene, was cut with BamHI and partially cut with MstII. The 2.3 kbp fragment containing the entire gp51.30 gene was isolated on an agarose gel and the protruding ends filled with E. coli DNA polymerase I (Klenow fragment). There were then 20 ligated Pst I linkers to the ends of the fragment which, after digestion with Pst I, were ligated into the Pst I site of pTP 15 (Example 15). This places the BLV gene next to the Vaccinia H6 promoter. (pTP15 contains the Vaccinia H6 promoter cloned at a non-essential locus of the vaccinia genome).

This plasmid was then cut with EcoRV and partially cut with Avail. The 5.2 kbp fragment was isolated and the oligonucleotides 5-AT CCGTTAAGTTTGT AT CGTAATGCCCAAAG AACG ACG-3 'and S'-GACCGTCGTTCTTTGGGCATTACGATACAAACTTAACGGAT-3' used for plasmid recirculation. This eliminates unnecessary bases between the BLV gene and the H6 promoter.

53 DK 175980 B1

The resulting plasmid was cut with PstI and partially cut with BglII, and the 1.7 kbp fragment containing the H6-promoted BLV gene was cloned into the BamHI-PstI site of pCE11, the previously described poultry pox virus insertion vector, under using locus f7. This places the H6-5 promoted BLV gene between flanking arms of poultry pox. This plasmid was designated pBLVFI.

An identical procedure was used to construct pBLVF2 except that a further in vitro mutagenesis step was performed before cloning the ΗΘ-ΙΟ promoted BLV gene into pCE11. This mutagenesis was performed by the following procedure. Plasmid pNS97-1 was cut with Xmal and partially cut with Stul. The 5.2 kbp fragment was isolated and the oligonucleotides 5'-CCGGGTCAGACAAACTCCCGTCGCAGCCCTGACCTTAGG-3 'and 5-CCTAAGGT CAGGGCT GCG ACGGGAGTTT GT CT G AC-3' 15 were used to recycle plasmid. This alters the nucleotide sequence of in codons 268 and 269 from CGC-AGT to CAA-ACT. i (2) Construction of recombinant viruses 20 The plasmids pBLVFI and pBLVF2 were used in an in vitro assay for recombination using FP-1 as the rescue virus. In-offspring recombinant was selected by in situ plaque hybridization, and when the population by this criterion was judged to be pure, the plaques were examined by a β-galactosidase protein A immunoassay using a preparation of BLV-gp-specific monoclonal antibody. Both recombinants vFP23 and vFP24, generated from respectively. plasmid pBLVFI and pBLVF2, showed positive staining in the immunoassay, indicating that an immunologically recognizable glycoprotein was expressed on the surface of the infected cells.

30 t 54 DK 175980 B1

The plasmids pBLVK4 and pBLVK6 contain, respectively. The BLV env gp51.30 gene and the BLV gp51.30 cleavage minus gene. Both genes are cloned into the unique EcoRI site of pRW764.2 (locus C3) (pRW764.2 is described in Example 13) and are under transcriptional control by the Vaccinia H6 promoter.

5

The plasmids were obtained by the following procedure: pBLVFI and pBLVF2 were cut with the restriction enzyme HindIII. The oligonucleotide BKL1 (AGCTTGAATTCA) was cloned into this site, thereby forming an EcoRI site 3 'relative to the BLV gene. Since there is also an EcoRI site 5 'relative to the 10 BLV gene, these plasmids (pBLVKI and pBLVK2) were cut with EcoRI and the fragment containing the H6 promoted BLV gene was cloned into the EcoRI site of pRW764. 2nd The resulting plasmids were designated respectively. pBLVK4 and pBLVK6. These plasmids were used in an in vitro assay for recombination with canary pox as rescue virus. Recombinants were selected and purified on the basis of surface expression of the glycoprotein, shown by an immunoassay. The recombinants were designated vCP-27 and vCP-28, respectively. plasmids pBLVK4 and pBLVK6.

Poultry pox recombinants vFP-23 and vFP-24 have been inoculated in sheep and 20 cattle by various routes of administration. The animals received two inoculations, the second 45 days after the first. Serum samples were taken 5 weeks after the first inoculation and two weeks after the second inoculation. Antibody to gp51 was measured by a competitive ELISA assay and the titer expressed as the reciprocal of the serum dilution, giving a 50% reduction in competition. The results are shown in Table XI.

None of the species tested showed a detectable immune response after the first inoculation. Both sheep and cattle showed a significant antibody increase after the second inoculation.

55 DK 175980 B1

TABLE XI

Inoculation of sheep and cattle with vFP -? ^ Ng »fp.oa 5 Animals Virus Dose and inhalation route ELISA Titer First Second First Second

Cattle B56 FP-1 10 ^ 1083 108 + 108 o 0 B59 FP-1 ID subcut 0 0 10 Sheep M89 FP-1 0 0 M91 FP-1 0 0

Cattle B62 vFP-23 1 08 + 108 1 08 + 108 o 200b B63 vFP-23 ID subcut 0 80 15 Sheep M83 vFP-23 0 80 M84 vFP-23 0 500 M85 vFP-23 0 100

Cattle B52 vFP-24 1 08 + 108 1 08 + 108 0 200 20 B53 vFP-24 ID subcut 0 60 Sheep M87 vFP-24 0 200 M92 vFP-24 0 20 M93 vFP-24 0 20 25 a Intradermal injections were given two sites b Titer expressed as the reciprocal of the dilution, giving 50% competition.

Example 18 - Construction of fiery creepox virus FP-1 recombinant vFP-30 26. expressing infectious-bronchitis virus-Mass-41 matrix gene

Plasmid plBVM63 contains an infectious bronchitis virus (IBV) cDNA clone of the strain Mass-41 matrix gene. An 8 kbp EcoRI fragment of plBVM63 35 contains the matrix gene with the peplomer gene upstream (5 ') and further upstream there is an EcoRV site. Plasmid pRW715 has an EcoRI coupling sequence linking the two Pvull sites in pUC9. The 8 kbp EcoRI fragment of pBVM63 was inserted into the EcoRI site of pRW715 to form pRW763. Plasmid pRW776 was generated for deletion of the 5 'located Eco RI site of pRW763, leaving a unique Eco RI site downstream (3') from the matrix gene. The isolated linear partial EcoRI degradation product of 5 pRW763 was cut again with RcoRV. The largest fragment was isolated, blunt-ended with the Klenow fragment of DNA polymerase I, and self-ligated to form pRW776. Construction pRW776 has the complete IBV peplomer genes and IBV matrix genes followed by a single EcoRI site.

10

Only the 5 and 3 'ends of the matrix gene of approx. 0.9 kbp has been sequenced. Starting with the translation initiation codon (ATG), the 5 'sequence of the matrix gene contains the following stressed Rsal site: AT GT CCAACGAG ACAAATT GTAC. The previously described H6 promoter 15 was linked to the matrix gene with a synthetic oligonucleotide. The synthetic oligonucleotide contained the H6 sequence from its RcoRV site to ATG and into the matrix coding sequence through the first Rsal site. The oligonucleotide was synthesized with BamHI and EcoRI compatible ends for insertion into pUC9, thereby forming pRW772. The Eco RI end is 3 'to the Rsal-20 site. Beginning at the BamHI-compatible end, with ATG underlined, is the sequence of the double-stranded synthetic oligonucleotide:

GATCGCGATATCCGTTAAGTTTGTATCGTAATGTCCAACGAGACAAATTGTACG

CGCTATAGGCAATTCAAACATAGCATTACAGGTTGCTCTGTTTAACATGCTTAA

25

The linear partial Rsal degradation product of pRW772 was isolated and cut again with RcoRI. The pRW772 fragment, containing a single cut at the above Rsal site and cut again with EcoRI, was isolated, treated with phosphatase and used as a vector for the pRW776-30 degradation product below.

57 DK 175980 B1

The isolated linear partial Rsal degradation product of pRW776 was cut again with RcoRI. EcoRI is located just after the 3-end of the matrix gene. An isolated Rsal-EcoRI fragment of ca. 0.8 kbp, containing the matrix coding sequence from the above Rsal I site, was inserted into the above 5 pRW772 vector to form pRW783. The complete H6 promoter was formed by adding sequences 5 'to the EcoRV site. The 5-end of the H6 promoter was a Hinfl site that was blunt-ended into the SalI site of pUC9, thereby forming an EcoRI site; 5 'relative to the H6 promoter is the HindIII site of pUC9. The HindIII EcoRV fragment containing the 5 'H6-10 promoter was inserted between the HindIII and EcoRV sites of pRW783 to form pRW786. pRW786's EcoRI fragment, containing the complete H6 promoted matrix gene, was blunt-ended with Klenow DNA polymerase I fragment and inserted into the blunt-ended BamHI site at pRW731.15 (locus f8) to generate pRW789. pRW731.15-15 The BamHI site is the FP-1 locus used in Example 6 to construct vFP-8.

Plasmid pRW789 was used in the construction of vFP-26. Recombinant plaques were selected and treated by in situ plaque hybridization.

20

In preliminary tests, an immune response to the IBV matrix protein in chickens is inoculated with vFP-26.

Example 19 - Construction of fiery crepe pox virus FP-1 recombinant vFP-25 31. expressing infectious bronchitis virus (IBV1 peplomer

Infectious bronchitis virus (IBV) Mass-41 cDNA clone plBVM 63 and its subclone pRW776 have been described in the construction of vFP-26 in Example 18. Subclone pRW776 contains the 4 kbp IBV peplomer gene followed by the matrix gene with a unique EcoRI site at the 3 'end. Only the 5 'and 3' 58 ends of the IBV peplomer gene of approx. 4 kbp has been sequenced. A unique Xbal site separates the two genes. The 5 'end of the peplomer gene starting at the translation initiation codon (ATG) contains the following stressed Rsal site: 5 ATGTTGGTAACACCTCTTTTACTAGTGACTCTTTTGTGTGTAC. The previously described H6 promoter was linked to the peplomer gene by a synthetic oligonucleotide. The synthetic oligonucleotide contains the H6 promoter sequence from the Nrul site to ATG and into the peplomer coding sequence through the first Rsal site. The oligonucleotide was synthesized with 10 Bam HI and Eco RI compatible ends for insertion into pUC9 to form pRW768. The EcoRI end is 3 'relative to the Rsal site. Beginning at the BamHI-compatible end, with ATG underlined, is the sequence of the double-stranded synthetic oligonucleotide:

GATCTCGCGATATCCGTTAAGTTTGTATCGTAATGTTGGTAACACCTCTT 15 AGCGCTATAGGCAATTCAAACATAGCATTACAACCATTGTGGAGAA

TTACTAGTGACTCTTTTGTGTGTACG

AATGATCACTGAGGAAACACACATGCTTAA

The isolated linear partial Rsal degradation product of pRW768 was cut again with EcoRI. The pRW768 fragment containing a single cut at the above Rsal site and cut again with EcoRI was isolated, treated with phosphatase and used as a vector for the pRW776 degradation product below.

25

The isolated linear partial Rsal degradation product of pRW776 was cut again with RcoRI. the 5 kbp pRW776 fragment containing a single cut at the above Rsal site to the EcoRI site was isolated; the fragment contains IBV sequences from the above peplomeric Rsal site to the EcoRI site at the 3 end of the matrix gene. Insertion of the pRW776 fragment into the above pRW768 vector produced pRW788. The matrix gene was removed at the Xba site highlighted above. The 5 'H6 promoter was inserted into the Nrul site by inserting the 5 kbp blunt-ended pRW788-Nrul-Bbal fragment into the blunt-ended pRW760 Nrul-BamHI vector to generate pRW790. The vector pRW760 is described in Example 11; In brief, it is a Vaccinia-H6 promoted influenza nucleoprotein flanked by the non-essential FP-1 locus f7. The pRW760 vector was prepared by removing the 3 'H6 sequences from the Nrul site to the end of the nucleoprotein by BamHI. pRW790 is H6-promoted IBV peplomer i

The Hinel l site of pRW731.13. Recombination of the donor plasmid pRW790 with = 10 FP-1 resulted in vFP-31. Immunoprecipitation experiments using CEF lysates prepared from cells infected with vFP-31 have shown specific precipitation of a small amount of precursor protein having a molecular weight of about 180 kD and of the 90 kD cleavage products.

Example 20 - Construction of fiery creepox virus FP-1 recombinant vFP

30. expressing herpes simplex virus qD

Herpes simplex virus (HSV) type 1 strain KOS glycoprotein D gene (gD) was cloned into the pUC9 BamHI site as a 5 'BamHI coupled Hpall to 3' 20 BamHI coupled Nrul fragment; with the 5-end adjacent to pUC9's Pstl site. The 5-sequence of HSV-gD, beginning with the translation initiation codon (ATG), contains the following underlined NcoI site:

ATGGGGGGGGCTGCCGCCAGGTTGGGGGCCGTGATTTTGTTTGTCGTCATAGTGGG

cctccatgg. The previously described Vaccinia H6 promoter was linked to the HSV gD gene by a synthetic oligonucleotide. The synthetic oligonucleotide contains the 3 'portion of the H6 promoter from Nrul to ATG into the gD coding sequence of the NcoI site. The oligonucleotide was synthesized with a 5'-PstI compatible end. The gD clone in pUC9 was cut with Pstl and NcoI and the 5'-HSV sequence removed for replacement with the synthetic oligonucleotide, thereby forming pRW787. The sequence of the double-stranded synthetic oligonucleotide is.

60 DK 175980 B1 GTCGCGATATCCGTTAAGTTTGTATCGTAATGGGAGGTGCCG-ACGTCAGCGCTATAGGCAATTCAAACATAGCATTACCCTCCACGGC-5

CAGCTAGATTAGGTGCTGTTATTTTATTTGTAGTTATAGTAGGACTC

GTCGATCTAATCCACGACAATAAAATAAACATCAATATCATCCTGAGGTAC

Degradation of pRW787 with Nrul and BamHI produces a fragment of ca.

1.3 kbp containing the 3'-H6 promoter from the Nrul site, through the HSV-gD coding sequence to the BamHI site. The pRW760 vector, cut with Nrul and BamHI, is described in Example 11. Insertion of the 1.3 kbp fragment into the pRW760 vector led to pRW791. The pRW791 vector contains the complete vaccinia H6 promoted HSV gD gene in the non-essential FP-1 HincII site of pRW731.13 (locus f7).

Recombination of the donor plasmid pRW791 with FP-1 resulted in vFP-30. Surface expression of the glycoprotein was detected in recombinant plaques using a β-galactosidase-coupled protein-A immunoassay and 20 HS V-1-specific sera.

EXAMPLE 21 - Use of Entomopox Promoters to Regulate Expression of Alien Ants in Pox Virus Vectors 25 (a) Background. Insect pox viruses (entomopox) are currently classified into the subfamily Entomopoxvirinae, further subdivided into three genera (A, B and C) corresponding to entomopoxviruses isolated from the insect sequences, respectively. Coleoptera, Lepidoptera and Orthoptera. Entomopox viruses have a narrow host range in nature and are not known to replicate in any vertebrate species.

30 61 DK 175980 B1

The Entomopox virus used in these experiments was originally isolated from infected larvae of Amsacta moorei (Lepidoptera: arctildae) from India.

(Roberts and Granados, J. Invertebr. Pathol. 12: 141-143 (1968]). The virus, designated AmEPV, is the genus of genus B.

5

Wild type AmEPV was obtained from Dr. R. Granados (Boyce Thompson Institute,

Cornell University) as infectious hemolymph from infected larvae of Estigmene acrea. The virus was found to replicate in an invertebrate cell line, IPLB-LD652Y, derived from ovarian tissue of Lymantria dispar (gypsy moth) (described 10 by Goodwin et al., In Vitro 14: 485-494 [1978]). The cells were grown in IPL-528 media supplemented with 4% fetal calf and 4% chicken sera at 28 ° C.

The wild type virus was plaque tested on LD652Y cells and one plaque, designated V1, was selected for further testing. Late in the infection cycle, this isolate forms 15 numerous occlusion bodies (OB) in the cytoplasm of the infected cells.

(b) Promoter identification. The identification and mapping of an AmEPV promoter was achieved as follows. Total RNA from late infected 20 LD652Y cells (48 h after infection) was isolated and used to prepare 32P-labeled first-strand cDNA. The cDNA was then used for probe examination of images containing restriction degradation products of the AmEPV genome. This Southern blot revealed a strong 2.6 kbp ClI fragment signal, indicating that the fragment encoded a highly expressed gene. The fragment was cloned into a plasmid vector and its DNA sequence determined.

Analysis of the sequence data revealed an open reading frame capable of encoding a 42 kD polypeptide. In vitro translation of total RNA 48 hours after 30 infection and separation of the products by SDS-PAGE revealed a polypeptide of ca. 42 kD.

(C) Construction of a recombinant vaccinia virus expressing a foreign gene under the control of the entomopox promoter. To determine whether an entomopox promoter would function in a vertebrate poxvirus system, the following plasmid was constructed. Chemically, an oligonucleotide 5 containing the 107 bases located in the 5 'direction of the 42K gene translation start signal (hereafter referred to as the AmEPV-42K promoter) was flanked by a BglII site at the 5' end and the first 14 bases of the region encoding hepatitis B virus pre-S2 ending in an EcoRI site at the 3 'end. The AmEPV-42K promoter sequence is described below.

10

TCAAAAAAATATAAATGATTCACCATC

TGATAGAAAAAAAATTTATTGGGAAGA

ATATGATAATATTTTGGGATTTCAAA

ATTGAAAATATATAATTACAATATAAAATG

15 i

The AmpEPV-42K promoter was ligated to the hepatitis B virus surface antigen (HBVsAg) as follows. A pUC plasmid containing the hepatitis B surface antigen and the pre-S2 coding region (type ayw described by Galibert et al., Nature 281: 646-650 [1979]) was constructed flanked by vaccinia virus arms in the essential region of the vaccinia virus genome encoding the hemagglutinin (HA) molecule (HA arms described in Example 15; HA region described by Shida, Virology 150: 451-462 [1962]). The oligonucleotide described above was inserted into this plasmid using the unique Eco RI site in the HBVsAg coding region and a unique BglII site in the HA-25 vaccinia arm. The resulting recombinant vaccinia virus was designated vP547.

Expression of the inserted HBVsAg coding sequence under the control of the entomopox 42K promoter was confirmed using an immunoassay. Equivalent cultures of the mammalian cell line BSC-40 were infected with parentite vaccinia virus or recombinant vP547. Twenty-four hours after infection, the cells were lysed and the lysate in series dilutions applied to a nitrocellulose membrane. The membrane was first incubated with a goat anti-HBV serum and then with 125 I Protein A. After washing, the membrane was exposed to an X-ray film. Positive signals were detected in cultures 5 infected with vP547, but not in cultures infected with parental virus, indicating recognition of the AmEPV-42K promoter of vaccinia virus in mammalian cells.

These results were verified using an Ausria assay (see Example 10 for details) to detect HBVsAg in infected mammalian cells. Vaccinia virus recombinants containing the HBsAg gene linked to the AmEPV-42K promoter or vaccinia virus H6 promoter were used to infect BSC-40 cells and the expression level of sAg tested by the Ausria assay method. As seen in Table XII, the data shows; that the expression level of HBsAg using the 42K promoter was significant.

TABLE XII

Expression of HBVsAg in recombinant vaccinia virus 20

Recombinant virus Promoter Ausria P / N ratio vP410 Control 1.0 vP481 H6 24.3 25 vP547 42K 44.9

Further experiments were performed to determine the temporal factor in regulating the AmEPV-42K promoter in a vertebrate poxvirus background.

Equivalent cultures of BSC-40 cells were infected with vP547 in the presence of 30 or the absence of 40 µg / ml cytosine arabinoside, which is a DNA replication inhibitor, which therefore blocks late viral transcription. Expression levels 24 hours after infection were tested by an Ausria test. The results indicated that the 42K promoter was recognized as an early promoter in a vaccinia virus replication system.

5 Note that the use of the AmEPV-42K promoter to express foreign genes in a mammalian system is clearly different from the use of the Autographa californica NPV polyhedrin promoter for gene expression in invertebrate systems (Luckow and Summers, Biotechnology 6: 47-55 [ 1988]). The polyhedrin promoter is not recognized by the transcriptional apparatus in mammalian cells (Tjla et al., Virology 125: 107-117 [1983]). The use of the AmEPV-42K promoter in mammalian cells represents the first time an insect virus promoter has been used for the expression of foreign genes in a non-insect viral vector in non-invertebrate cells.

To determine if avipoxviruses would also recognize the 42K entomopox promoter, the following experiments were performed. Identical cultures of CEF cells were inoculated at 10 pfu cell of either poultry epoxic virus, canary epoxic virus or vaccinia virus and simultaneously transfected with 25 µg of one of the following plasmids: 1) plasmid 42K.17 containing the HBV pre-S2 + sAg coding sequence 20 linked to the 42K promoter or 2) plasmid pMP15. spsP containing the identical HBVsAg coding sequence linked to the previously described vaccinia virus H6 promoter. After 24 hours, the cultures were frozen, the cells lysed, and the lysate assayed for the presence of HBVsAg using an Ausria assay. (see Example 1).

25! The results shown in Table XIII must be viewed qualitatively. They indicate that both the poultry pox and canary epox transcription apparatus are able to recognize the 42K promoter and allow transcription of the linked HBVsAg code sequence. Although expression levels are lower than those obtained with the vaccinia virus H6 promoter, the levels are well above background levels obtained with the negative controls.

65 DK 175980 B1

TABLE XIII

in

Recognition of 42K Entomopox-Dromotor of Avipoxviruses; 5 Virus Promoter P / N ratio

Poultry Pox 42K 39.1 H6 356.8 10 Canary Pox 42K 90.2 H6 222.2

Vaccine 42K 369.4 H6 366.9 15

None 42K 7.8

No H6 7.2

Vaccinia - 7.2 20 Example 22 - Immunization with VCP-16 to protect mice against challenge with live rabies virus

Groups of twenty mice, 4 to 6 weeks old, were inoculated underfoot with 50 25 to 100 µl of a series of dilutions of either one or the other of two recombinants: (a) vFP-6, the poultry pox rabies recombinant described in Example 6, and (b) vCP-16, the canary pox rabies recombinant described in Example 13.

After 14 days, 10 mice from each group were killed and serum collected. The anti-rabies titer in the serum was calculated using an RFFI assay (described in Example 7). The remaining 10 mice in each group were challenged by intracerebral inoculation with the CVS strain of rabies virus used in Example 7. Each mouse received 30 μΙ, corresponding to 16 mouse LD 50.

After 28 days, surviving mice were assessed and the protective dose 50 (PD50) calculated, the results are shown in Table XIV.

66 DK 175980 B1

The level of protection of mice found by inoculation of vFP-6 confirms the result found after inoculation of the poultry pox recombinant vFP-3 discussed in Example 7. The level of protection obtained by inoculating 5 vCP-16 is significantly higher. On the basis of the calculated PDso, the canary pox rabies recombinant is 100 times more effective at protecting against rabies challenge than the poultry pox rabies recombinant.

TABLE XIV

10

Protective immunity against challenge with rabies virus triggered by two avipox rabies recombinants

Poultry pox vFP-6 Canary pox vCP-16 15

Inoculum RFFI Exercise Inoculum RFFI Exercise Dose_titer_relation_dose_titer ratio 7.5a 2.3b 7/10 6.5 2.5 10/10 20 5.5 1.8 5/10 4.5 1.9 8 / 10 3.5 0.7 0/10 2.5 1.1 1/10 1.5 0.6 0/10 0.5 0.4 0/10 1 PD50 = 6.17 1 PD50 = 4.18 a Virus titers expressed as log10 TCID 50.

25 b RFFI titer expressed as log of highest serum dilution yielding over 50% reduction in the number of fluorescent wells in an RFFI assay.

Example 23 - Use of fiery creepox promoter elements for expression of foreign genes I. Identification of the fiery creepox gene. which encodes a gene product of 25.8 5 kiloDaltons (kD)

Visualization of protein species present in poultry pox (FP-1) infected CEF lysates, by staining SDS polyacrylamide gels with Coomassie blue, revealed a large amount of species with an apparent mole-10 cool weight of 25.8 kD. This protein was not present in uninfected cell lysates. Impulse experiments using 35S-methionine to radiolabel synthesized proteins at specific times after infection again demonstrated the abundance of the FP-1-induced protein and showed that it is synthesized from 6 to 54 hours after infection. At its peak, this 15 FP-1 protein of 25.8 kD amounts to approx. 5% to 10% of total protein present in the cell lysate.

The abundant presence of the FP-1-induced 25.8 kD protein suggested that the gene encoding this gene product is regulated by a strong FP-1 promoter element. In order to localize this promoter element for use in expressing foreign genes in pox virus recombinants, a polysome preparation from FP-1-infected CEF cells was obtained 54 hours after infection. RNA was isolated from this polysome preparation and produced when used to program an in vitro rabbit reticulocyte translation system, preferably the 25.8 kD FP-1 protein.

25

The polysome RNA was also used as a template for synthesis of first-strand cDNA using oligo (dT) 12-18 as an initiator. The first-strand cDNA was used as one. hybridization probe by Southern blot assays with degradation products of the FP-1 genome. Results from these hybridization assays indicated that the gene encoding the 25.8 kD protein was contained in a 10.5 kbp Hind I II fragment. This 68 Hind 1751 genomic HindIII fragment was then isolated and ligated into a commercial vector, pBS (Stratagene, La Jolts, CA), and the clone was designated pFP23K-1. Further hybridization assays using the first-strand cDNA for probing degradation products of pFP23k-15 located the 25.8 kD gene to a 3.2 kbp EcoRV sub-fragment. The fragment was subcloned into pBS and designated pFP23k-2.

Ca. 2.4 kbp of this FP-1 EcoRV fragment has been sequenced by the Sanger dideoxy chain termination method (Sanger et al., Proc. Natl. Acad. Sci.

USA 74: 5463-5467 [1977]). Analysis of the sequence reveals an open reading frame (ORF) encoding a gene product with a molecular weight of 25.8 kD. In vitro transcription of this ORF by bacteriophage T7 polymerase (Stratagene, La Jolla, CA) in a pBS vector produces an RNA species which, when used to program an in vitro rabbit reticulocyte translation system (Promega Biotec, Madison, W1) provides a polypeptide species with an apparent molecular weight of 25.8 kD. In an SDS-polyacrylamide gel, this polypeptide moves together with the large amount of 25.8 kD protein observed in lysates from FP-1-infected CEF cells. The results suggest that this is the gene encoding the abundant 25.8 kD FP-1 induced gene product.

II. Use of the upstream promoter elements of the 25.8 kD FP-1 gene to express cat leukemia virus (FeLVI env gene in recombinants of FP-1 and vaccinia.

25

A 270 bp EcoRV / EcoRI fragment containing the regulatory region (FP25.8K promoter) of the 28.5 kD FP-1 gene and 21 bp of the 25.8 kD gene coding sequence was isolated from pFP23k-2. Below is shown the nucleotide sequence of the FP25.8K pnomotor region used to obtain 30 pFeLV25.8F1 and pFeLV25.81A. This 270 nucleotide sequence constitutes 69 upstream of the region upstream of the initiation codon (ATG) of the 25.8 kD gene product and the first 21 bp of the coding sequence.

5 '-GATATCCCCATCTCTCCAGAACAGCAGCATAGTGTTAGGACAATCATCTAA-5-TGCAATATCATATATGAATCTCACTCCGATAGGATACTTACCACAGCTATTATA CCTTAATGTATGTTCTATATATTTAAAAACAGAAACAAACGGCTATAAGTTTAT-ATGATGTCTATATTATAGTGAGTATATTATAAGTATGCGGGAATATCTTTGATT-TAACAG C GTAC GAT T C G T GATAAGT AAATAT AGGCAAT GGAT AGCAT AAAT -TTC GAA-3' 10 in

This fragment was blunt-ended and then inserted into a Sma I digested FP-1 insertion vector (pFeLVFI, see Example 15) containing the FeLV env sequences. This insertion vector allowed recombination with the f7 locus of the FP-1 genome. Insertion of the upstream sequences of the FP25.8K promoter 5 'relative to the FeLV env gene, and with the proper orientation, was confirmed by sequence analysis. This insert does not give an exact in substitution of ATG with ATG, but the ATGet of the 25.8 kD gene is out of frame with the FeLV env ATGet so no fusion protein is formed. The FP-1 insertion plasmid containing the FP25.8KD promoter upstream of the 20 FeLV env gene was designated pFeLV25.8F1.

A similar construct was prepared using the vaccinia virus insertion vector, pFeLVIA, harboring the FeLV gene (see Example 15). The hay promoter was removed from pFeLVIA by degradation with BglII and SmaI.

After the BglII restriction site was blunt-ended, the blunt-ended 270 bp EcoRV / EcoRI fragment containing the FP25.8K promoter was inserted juxtaposed 5 'to the FeLV env gene. This construct was confirmed by sequence analysis. There is also no exact substitution of ATG with ATG in this recombinant, but the ATG of the 25.8 kD gene is not in frame 30 with the ATG of the FeLV gene. The vaccine (Copenhagen strain) insertion vector 70, housing the 25.8 kD upstream region juxtaposed 5 'to the FeLV gene, was designated pFeLV25.81A.

The insertion plasmids pFeLV25.8F1 and pFeLV25.81A were used in in vitro recombination with FP-1 (pFeLV25.8F1) and the Copenhagen strain of vaccinia virus (pFeLV25.81A) as the rescue viruses. The progeny of the recombination were plated on appropriate cell monolayers and recombinant virus selected by a β-galactosidase-coupled protein-A immunoassay and a bovine anti-FeLV serum (Antibodies, Inc., Davis, CA). Preliminary results suggest that the FP25.8K promoter may regulate the expression of foreign genes in poxvirus recombinants.

Example 24 - Safety and efficacy of vFP-6 and vCP-16 in poultry 15

The two avipox recombinants, vFP-6 and vCP-16 (described in Examples 6 and 13), were inoculated into 18-day-old chicken fetuses, 1-day-old chickens and 28-day-old chicks, and the birds' response was evaluated by three criteria (1). of vaccination on hatching ability, vaccination reactions and mortality 2) induced immune response to the rabies glycoprotein. and 3) induced immune response to poultry pox antigens. The experiments performed are described below.

A. Security tests. Groups of twenty 18-day-old fetuses were inoculated into the allantoic cavity with 3.0 or 4.0 logio TCID50 of either vFP-6 or vCP-16. After hatching, the chickens were observed for 14 days, at which time they each received blood and sera were collected. The two recombinants inoculated into the chicken embryos had no effect on the hatching ability of the eggs, and the chicks remained healthy during the 14-day observation period.

71 DK 175980 B1

Groups of 10 SPF 1 day old chickens were inoculated by intramuscular administration with 3.0 log 10 TCID 50 of each of the recombinants. The chickens were observed for 28 days and serum samples collected 14 and 28 days after inoculation. No vaccination reaction was seen at the inoculation site with any of the recombinants, and the chicks remained healthy during the 28-day observation period.

Groups of ten 28-day-old chicks were inoculated with each of the recombinant viruses, receiving either 3.0 logio TCID50 by intramuscular administration or 3.0 log-TCID50 by cutaneous administration (wing membrane). Chickens were observed for 28 days and serum samples collected at 14 and 28 days after inoculation. No reaction was seen after intramuscular inoculation with any of the recombinants. Cutaneous inoculation resulted in a very small vaccination reaction to poultry pox with heterogeneous size lesions. Canary pox inoculation led to the formation of a normal cutaneous lesion at the inoculation site. All lesions were in decline at the end of the trial.

B. Immune Response. The RFFI assay described in Example 7 was used to assess the levels of antibody to the rabies glycoprotein. For each group, the results were expressed with the geometric mean titer of the individual serum converted to International Units (IU) according to a standard serum that. contained 23.4 IU. The minimum positivity level was set to one IU and used to determine% positive birds. Antibodies against the avipox viruses were tested by an ELISA method using the poultry pox virus strain as an antigen. Each serum sample was diluted 1/20 and 1/80. A standard curve was constructed using positive and negative sera. The minimum positivity level was calculated by averaging the different values of the negative sera added with two standard deviations.

30 72 DK 175980 B1

The results of serological studies are shown in Table XV for vFP-6 and Table XVI for vCP-16.

A limited serologic response was observed for both rabies and 5 poultry pox antigens with fetuses inoculated with either vFP-6 or vCP-16. The poultry epox vector induced a serological response to both antigens in a greater number of birds than was the case for canary epox, but the response was still heterogeneous.

10 1 day old chickens inoculated with vFP-6 had a good serological response, with all birds seropositive to rabies and poultry pox antigens 28 days after inoculation. The response to inoculation with vCP-16 was much lower, with 40% of birds seropositive to rabies glycoprotein on day 28 and 10% seropositive to avipox antigens.

15 28 day old chickens inoculated intramuscularly with vFP-6 showed 100% seroconversion for both antigens 14 days after inoculation. Although the majority of birds also seroconverted after cutaneous inoculation, the titers obtained were lower for both rabies and avipox antigens. As before, chicks, inoculated by both intramuscular and subcutaneous routes with vCP-16, exhibited a variable response with a maximum of 70% seroconversion against 1 rabies by intramuscular inoculation. The low seroconversion level of avipox antigens after canary pox inoculation may be indicative of the degree of serological kinship between the viruses.

25 i.

The results indicate that both vFP-6 and vCP-16 are safe to inoculate in chickens of different ages. The poultry pox vector vFP-6 seems more effective in inducing an immune response in chickens. However, it is significant that both recombinant avipox viruses, poultry pox and canary epoxis, have been shown to be useful for ovum immunization.

DK 175980 B1 α>> 52 vP vP vp S vPvP vP2 ^ o 'o; o 'o CL o' S 'o' o oo o ^

X oo * (£} oo OO OO

o θ 'U0' CT h-τ- T-T- T- 00 2 tg D -S °

*: ¾ S

(1) UL i =

S LU

φ ® m o o ^ r-. 5 $ i- £ - * 5 <N CM O CO T- to® J2 S T- T- T-_ CM CO - - o 2 o "o" o * o 'o "° o * ° k. ΙΟ) Q) σ 3 = _

c o D

> ~ ^ jé: c c 0)

<ω cn χρ 'S'S'S

• - - · - <-j .o .o o 'o' o '^ o

CD O o 'o' o 'O OO OoS

OL I SS g ° oo oo ^ £ C O)

ω ώ B

o .2 '-V

c? 9 to - Λ O ry · _

β Bl 1 In CO

CQ V S CM_ h- CO CM_ h- N- CD ID

<{g S O "t- '^ CD CM * t-' O * 5

CO

O O) Q »_ - § cc -2 ^ * * • l = i? c § ++ co ^ ro -m- co

, m h i w co n c- CM i- CM - «- CM

Q V) c 0 ω g

01 “Q I

* “W - v o U η 'B <*>«

tn Q i_ O o O O O

O ^^ T- T- T- ^ o

ISLAND

C

3

E

E

- _φ -c ω t: a)

£ cd j $ E jtø E

to 3 <03 to O t j £ CJ> _x O) Q> i o. <u g> cd X c σ> S 'c σ> S' + -

c £ i: ™ c S '£ c to £ c to C

3 w TO = to CO = TO CO 1 = Ό (0

Jr O CO >> C0> c0 3

O 11. r- ^ r-. £ CM .E ^ CN O

UO O ID O UO

T- T- CM CM

DK 175980 B1 03> 'ro S> 0 \ P v ° · νΡ V »νΟχΟ UL o' o 'o tf' S 'o' o 'o'

X o mm o 'Ο OO OO

0 o „CM CM O t- COCO CO T- Q.

2 ® g

p ro O

1 ro ro ro .g Qj _X ® COON-C »CO N T- T- ro 2 co m cg mo oo h- co £! 2 o_ o_ o_ o_ o_ o_ o cd ** -> _ I> o" o 'o ”o * o' o 'o' o * - Q)« - ar ω o I i 2. * <^ - ω is co

co g; o -o 'P

T- * U * - ___o o o 'o' o 'o' o 'o'

J OvP o 'o' Ο Ο OO OO

CL t o '0 <0 i- ^ h> C0 τ- Ο Q-> o - y • i Ψ å> 2 S3 X Ο Λ i

tj- —i y o; -S

| sL LU - -g ^ CX> CO -r- t- · ^ · Tj-T- m σ S T-1-T-CN CO CM CO T- <w o 'o' o 'o' o "o 'o' o 'h- ® S3 ro w.

XD) Ο l_ £ - q ω -c -Τ 'CD C ma> c φ σ> · ςτ -µε:! 2 -g § T + ro l— 2 ^ + co t co ^ co -a: .b con TN v- cm T- cm • ro a ro § «" δ S S9 * “f ') (J ro n ro co

L "1 µ_ Ο Ο Ο Ο O

ISLAND

o o c 3

E

.2 ro t: a> t _g>

E q>. $ E _ $ E

ro ο ro 3 ro O) £, χ O) _X O) 05 »« 0) 3 fl) ® “Φ® g £ ro E'SI £> £ ε § -¾ Ό = ro ro = τ> ro = τ > ro

Jr O CO >> "° -t> co te> C0 3 O U- t— ^ T-. £ *: cg * cm omo in o in χ- χ- cm cm 75 DK 175980 B1 EXAMPLE 25 - Security and Immunogenicity of vFP-6 inoculins in small-scale

Two groups of three piglets were inoculated with the recombinant vFP-6 by one of two routes of administration: a) three animals received 8.1 log10 TCID5o by intramuscular inoculation, and b) three animals received the same dose by oral inoculation.

All animals were sampled weekly and received booster-10 inoculation of the same dose by the same route of administration on day 35. The piglets were observed daily for clinical signs. Sera were tested for anti-poultry pox antibodies by an ELISA assay and a serum neutralization assay. Rabies antibodies were tested by an RFFI assay.

15

All piglets remained healthy and no lesions were observed after inoculation. Temperature curves were normal with no apparent difference between inoculated and uninoculated animals.

20 Pigs inoculated by both intramuscular and oral route of administration developed a serological response to poultry pox antigens as measured by ELISA and serum neutralization. A secondary response was evident after booster inoculation (results not shown). All piglets also developed an immunological response to rabies glycoprotein as measured by an RFFI-25 assay, and a booster effect is evident in both routes of administration.

These results are shown in Table XVII.

The results indicate that inoculation of a poultry pox / rabies recombinant is harmless in piglets and that the recombinant is capable of producing a significant immune response to the rabies glycoprotein by oral or intramuscular inoculation.

Use according to claim 10, wherein the avian pathogen is selected from the group consisting of avian influenza virus, Newcastle disease virus, Rous-associated virus and infectious bronchitis virus.

5

Claims (11)

1. Recombinant vaccinia virus, characterized in that it contains DNA from any source ligated to an entomopox promoter for expression of the DNA, wherein the DNA and promoter are inserted into a non-essential region of the vaccinia genome. The virus of claim 1, wherein the DNA encodes an antigen of a vertebrate pathogen. j j The virus of claim 2, wherein the DNA encodes an antigen of a mammalian pathogen. The virus of claim 3, wherein the antigen is selected from the group consisting of 10 rabies antigen, rabies G antigen, gp51.30 coat antigen from bovine leukemia virus, FeLV coat antigen from cat leukemia virus and glycoprotein D antigen from herpes simplex virus . The virus of claim 2, wherein the DNA encodes an antigen of a bird pathogen. The virus of claim 5 wherein the antigen is selected from the group consisting of 15 avian influenza hemagglutinin antigen, a Newcastle disease virus fusion protein antigen, a Rous-envelope antigen of Rous-associated virus, avian influenza nucleoprotein antigen, a matrix antigen of the infectious bronchitis virus and peplomer antigen of the infectious bronchitis virus. Use of a recombinant virus according to any one of claims 20 to 6 in the manufacture of a medicament for the treatment of vertebrate diseases. Use according to claim 7 in the manufacture of a medicament for treating mammals for an infection with a mammalian pathogen. Use according to claim 8, wherein the mammalian pathogen is selected from the group consisting of rabies virus, bovine leukemia virus, cat leukemia virus and herpes simplex virus. Use according to claim 7 in the manufacture of a medicament for treating birds for an infection with a bird pathogen. ______ Å DK 175980 B1 Use according to claim 10, wherein the bird pathogen is selected from the group consisting of avian influenza virus, Newcastle disease virus, Rous-associated virus and infectious bronchitis virus. 5 L_____