DK175904B1 - Recombinant avipox virus, the virus for use in the preparation of a drug for vertebrates and the use of the virus in the manufacture of a drug for treating mammals or birds for infection with a mammal or bird pathogen - Google Patents

Description

DK 175904 B1

This invention relates to a recombinant avipox virus which is peculiar in that it contains DNA from a non-avipox source that encodes an antigen of a vertebrate pathogen and is ligated to a promoter for expression of the DNA wherein said DNA and promoter are inserted. in a non-essential region of the avipox-5 genome. The invention also relates to the virus for use in the manufacture of a medicament for vertebrates, and more particularly to the use of such a virus in the manufacture of a medicament for treating mammals for an infection with a mammalian pathogen or a medicament for treating birds for an infection with a bird pathogen.

10

Thus, the recombinant avipox virus of the invention can be used in methods of inducing an immunological response in vertebrates, including non-bird vertebrates, and in particular a method of inducing an immunological response in a vertebrate, especially a mammal, against a vertebrate pathogen. by inoculating the vertebrate with the recombinant avipox virus containing DNA encoding and expressing the antigenic determinants of said pathogen, and for preparing vaccines containing such modified avipox virus.

BACKGROUND OF THE INVENTION

Avipox or avipox virus is a genus of closely related pox viruses that infect birds. The genus avipox includes the species poultry pox, canary pox, snow bird pox, duepox, quail pox, sparrow pox, star pox and turkey pox. The genus avipox shares many characteristics with other poxviruses and is a member of the same subfamily, poxviruses in vertebrates, as vaccinia is. Poxviruses, including vaccinia and avipox, replicate in eukaryotic host cells. These viruses are distinguished by their large size, complexity and by the cytoplasmic replication site. However, vaccinia and avipox are different genera and are not similar in their respective molecular weights, antigenic determinants, and host species reported by

I DK 175904 B1 I

I 2 I

In Ported in Intervirology, vol. 17, pages 42-44, Fourth Report of the International I

In Committee on Taxonomy of Viruses (1982). IN

The avipox viruses do not productively infect non-avian vertebrates such as I

In 5 mammals, including humans. Furthermore, avipox does not proliferate in inoculation

In clay in mammalian cell cultures (including humans). In such mammals- I

cell cultures inoculated with avipox die cells due to a cytotoxic I

In effect, but shows no evidence of productive viral infection. IN

Inoculation of a non-avian vertebrate, such as a mammal, with live avipox I

You result in the formation of a lesion at the inoculation site similar to a vac I

In china inoculation. However, no productive viral infection is obtained. Nevertheless you

To a lesser extent, it has now been found that a mammal thus inoculated responds im

I monologically on the avipox virus. This is an unexpected result. IN

I 15 I

In Vaccines consisting of killed pathogen or purified antigenic compo- I

Nests of such pathogens should be injected in larger quantities than live I

In virus vaccines to create an effective immune response. This is because inoku- I

In live virus clay is a much more effective vaccination method. And I

In relatively small inoculum can produce an effective immune response because they are anti-I

Genes of interest are amplified during replication of the virus. From an I

From a medical point of view, live virus vaccines confer immunity that is more I

In effective and longer lasting than inoculation with a vaccine with a killed I

In pathogenic or purified antigen. Thus, vaccines consisting of killed I

In pathogenic or purified antigenic components of such pathogens I

In the production of larger quantities of vaccine material than is necessary for I

In live virus. IN

From the previous discussion it is clear that there are medical and financial

In 30 benefits of using live virus vaccines. Such a live virus vaccine

In ne includes vaccinia virus. This virus is known in the literature as a useful I

| 3 DK 175904 B1 virus in which, by recombinant DNA methods, DNA representing the genetic sequences for mammalian pathogen antigens can be inserted.

Thus, in the literature, methods have been developed that allow the formation of recombinant vaccinia viruses by inserting DNA from any source (e.g., viral, prokaryotic, eukaryotic, synthetic) into a non-essential region of vaccine genome, including DNA sequences encoding the antigenic determinants of a pathogenic organism. Certain recombinant vaccinia viruses generated by these methods have been used to induce specific immunity in mammals against various mammalian pathogens, all as described in U.S. Pat.

4 603 112.

Unmodified vaccinia virus has long been known to be relatively safe and effective for use in inoculation against smallpox. However, prior to the eradication of smallpox, where it was common to administer unmodified vaccinia, there was a small but real risk of complications in the form of generalized vaccinia infection, especially in those suffering from eczema or immunosuppression. Another rare but possible complication that may result from vaccinia inoculation is encephalitis postvaccinalis. Most of these reactions resulted from inoculation of individuals with skin disorders such as eczema, or with weakened immune systems, or individuals in households where others had eczema or impaired immunological response. Vaccinia is a living virus and is usually harmless to a healthy individual. However, it can be transmitted between 25 individuals for several weeks after inoculation. Infecting an individual with a weakening of the normal immune response, either by inoculation or by infectious transmission from a newly inoculated individual, can have serious consequences.

Thus, it will be appreciated that a method which provides the subject with the benefits of live virus inoculation but which reduces or eliminates the above

DK 175904 B1 I

for described problems, would be a very desirable step in relation to I

to the current state of technology. This is even more important today with you

the onset of the disease known as acquired immunodeficiency syndrome I

(AIDS). Victims of this disease suffer from severe immunological dysfunction and I

5 could easily be damaged by an otherwise safe live virus preparation if they entered

contact with such a virus, either directly or through contact with a virus

recently immunized with a vaccine containing such a drug

reverse virus. IN

WO-A-8605806 discloses a recombinant vaccinia virus containing DNA from I

a non-avipox source which encodes an antigen of a vertebrate pathogen and is I

ligated to a promoter for expression of the DNA, wherein the DNA and promoter I

is inserted into a non-essential region of the vaccinia virus genome; and its application

reversal for in vitro expression of the spike protein of IBV in mammalian cells. The ten

15 recombinant viruses of the present invention differ from that of I

disclosed in WO-A-8605806 by targeting recombinant avipox-I

virus, while WO-A-8605806 indicates only a recombinant vaccinia virus. IN

DK-A-1985 06062 discloses a recombinant vaccinia virus containing DNA I

20 from a non-avipox source which encodes an antigen of a vertebrate pathogen and is

ligated to a promoter for expression of the DNA, wherein the DNA and promoter I

is inserted into a non-essential region of the vaccinia virus genome; and its application

reversal for in vivo expression of the rabbit glycoprotein in rabbits. It recom-

binant viruses of the present invention differ from what is I

25 described in DK-A-1985 06062 by targeting recombinant avipox virus, I

whereas DK-A-1985 06062 indicates only a recombinant vaccinia virus. IN

DK-A-1987 00878 discloses a recombinant vaccinia virus containing DNA I

from a non-avipox source that encodes an antigen of a vertebrate pathogen and is

30 is ligated to a promoter for expression of the DNA, wherein the DNA and promoter I

is inserted into a non-essential region of the vaccinia virus genome; and its application

5 DK 175904 B1 reversal for in vitro expression of human IL-2 in mammalian cells. The recombinant virus of the present invention differs from that described in DK-A-1987 00878 in that it is directed to recombinant avipox virus, while DK-A-1987 00878 indicates only a recombinant vaccinia virus.

5

OBJECT OF THE INVENTION

It is an object of the invention to provide synthetic, recombinant avipoxviruses for use in a drug capable of immunizing vertebrates against a pathogenic organism which has the benefits of a live vaccine and has few or none of the disadvantages of either a live virus vaccine or a killed virus vaccine as enumerated above, especially when used for immunization of non-bird vertebrates.

It is also an object of the invention to provide a synthetic recombinant avipox virus which can induce an immunological response in vertebrates which may be birds or non-birds, to an antigen by inoculating the vertebrate with the recombinant virus, and as in cases of non-avian vertebrates such as mammals cannot productively replicate in the animal with the production of infectious virus. In this case, the virus is self-limiting with a reduced possibility of spread to unvaccinated hosts.

DESCRIPTION OF THE INVENTION

An aspect of the invention relates to synthetic recombinant avipox virus modified by insertion of DNA from a non-avipox source encoding an antigen of a vertebrate pathogen and ligated to a promoter for expression of the DNA in a non-essential region of avipox genome. Synthetically modified avipox virus recombinants carrying exogenous (i.e., non-avipox) genes encoding and expressing an antigen and in a vertebrate host trigger the formation of immunological responses to the antigen and therefore to the exogenous pathogen.

I DK 175904 B1 I

I I

is given to produce novel vaccines which do not have the disadvantages of convention

In oral vaccines using killed or attenuated living organisms,

Especially when used for inoculation of non-bird vertebrates. IN

I 5 It should again be emphasized that the avipox virus can only reproduce productively in or I

You are passed on through bird species or cell lines from birds. The recombinant I

In avipoxviruses harvested from bird host cells, an inoculation lesion forms without

In productive replication of the avipox virus when inoculated in a non-avian I

In vertebrate, such as a mammal, in a manner analogous to the inoculation of I

10 mammals with vaccinia virus. Despite the inability of the avipox virus to

replicate productively in such inoculated non-bird vertebrate, I

In sufficient expression of the virus that the inoculated animal responds im

I monologically on the recombinant avipox virus1 antigenic determinants and I

Also refer to the antigenic determinants encoded in exogenous genes therein. IN

When used to inoculate bird species, such a synthetic I produces

In recombinant avipox virus, not only an immunological response to antigens induces I

You encode exogenous DNA from any source that may be present therein, but

also results in productive replication of the virus in the host with the developer I

of an expected immunological response to the avipox vector as such. IN

I 20 I

Several researchers have proposed the formation of recombinant poultry pox, speci- I

In any viruses for use as veterinary vaccines to protect poultry populations; see I.

In e.g. Boyle and Coupar, J. Gen. Virol., 67: 1591-1600 (1986) and Binns et al.,

In Isr. J. Vet. Med., 42: 124-127 (1986). Neither proposal I has been submitted

In 25 or actual reports regarding the use of recombinant avipoxviruses as an I

In way of inducing specific immunity in mammals. IN

In Stickl and Mayer, Fortschr. With. 97 (40): 1781-1788 (1979) disclose injection I

I of avipox virus, specifically poultry pox, in humans. These studies relate to I

However, only the use of ordinary poultry pox to increase non-specific immunity in 1 I

In patients suffering from the after effects of cancer chemotherapy. I use

7 DK 175904 B1 no recombinant DNA techniques. There is no information on an avipox containing DNA encoding vertebrate pathogen antigens or on a method for inducing specific immunity in vertebrates. Instead, literature in the literature has a general and non-specific tonic effect on the human host.

A more in-depth discussion of the basis of genetic recombination may help to understand how the modified recombinant viruses of the present invention are formed.

10

In general, genetic recombination consists of the exchange of homologous sections of deoxyribonucleic acid (DNA) between two DNA strands. (In some viruses, ribonucleic acid [RNA] can replace DNA). Homologous nucleic acid sections are nucleic acid sections (RNA or DNA) having the same nucleotide base sequence.

Genetic recombination can occur naturally during replication or in the generation of new viral genomes within the infected host cell. Thus, genetic recombination between viral genes can occur during the viral replication cycle occurring in a host cell co-infected with two or more different viruses or other genetic constructs. A DNA section from a first genome is used interchangeably to construct the genome section of a second coinfecting virus, in which the DNA is homologous to the DNA of the first viral genome.

25

However, recombination may also occur between DNA sections in different genomes that are not completely homologous. If such a section is from a first genome that is homologous to a section of a second genome, except for the presence in the first section of, for example, a genetic marker or gene encoding an antigenic determinant inserted into a portion of it homologous DNA, recombination can still occur, and pro-

I DK 175904 B1 I

thus, the products of this recombination are detectable by presence

late of this genetic marker or gene. IN

Two conditions are required for the modified infectious virus to pass through

Figure 5 shows successful expression of the inserted genetic DNA sequence. IN

First, the insertion must take place in a non-essential region of the virus, for I

that the modified virus remains viable. Neither poultry pox nor those I

other avipoxviruses have so far shown non-essential regions analogous to those I

10 described for the vaccinia virus. Therefore, by the present I

invention found non-essential areas in poultry pox by splitting poultry I

pox genome up into fragments with subsequent separation of the fragments I

after size and insertion of these fragments into plasmid constructs I

for the purpose of amplification. (Plasmids are small circular DNA molecules, I

15 which exist as extrachromosomal elements in many bacteria incl. E. coli. IN

Methods for inserting DNA sequences, such as the genes for antigenic I

determinants or other genetic markers in plasmids are well known in the art

for the art and is described in detail in Maniatis et al., Molecular Cloning: A La- I

boratory Manual, Cold Spring Harbor Laboratory New York [1982]). This I

20 was followed by insertion of genetic markers and / or genes encoding I

for antigens, in the cloned poultry pox fragments. The fragments that led to I

successful recombination, as shown by successful recovery of the genetic I

marker or antigens were those containing DNA inserted into a non-essential I

region of the poultry pox genome. IN

25 I

The second condition for expression of inserted DNA is the presence of I

a promoter with a convenient location relative to the inserted DNA. IN

The promoter must be located so that it is upstream from the I

DNA sequence to be expressed. Because avipox viruses are not well characterized- I

30, and no avipox promoters have been previously identified, promoters from I

other poxviruses are advantageously inserted upstream of the DNA to be expressed

9 DK 175904 B1 as part of the present invention. Poultry pox promoters can also be successfully used to prepare the products of the invention. According to the invention, promoters of poultry pox, vaccinia and entomopox have been found to promote transcription in recombinant pox virus.

5

Boyle and Coupar, J. Gen. Virol. 67: 1591 (1986) has published speculation that vaccinia promoters "might be expected to function in (poultry pox) virus".

The authors located and cloned a poultry pox TK gene (Boyle et al., Virology 156: 355-365 [1987]) and inserted it into a vaccinia virus. This TK gene was expressed, presumably because the poultry pox TK promoter sequence is recognized by vaccinia polymerase functions. However, despite their speculation, the authors did not insert any vaccinia promoter into a poultry pox virus or observe any expression of a foreign DNA sequence present in a poultry pox genome. It was not known before the present invention that promoters from other poxviruses, such as vaccinia promoters, would actually promote a gene in an avipox genome.

DESCRIPTION OF CERTAIN PREFERRED EMBODIMENTS

In particular, according to the present invention, poultry pox and canary poxviruses have been used as preferred avipox species that are modified by recombination by incorporating exogenous DNA therein. ! 25

Poultry pox is a species of avipox that infects hens in particular, but does not infect mammals. The poultry pox strain designated herein as FP-5 is a commercial poultry pox virus vaccine strain originating in chicken embryos, available from American Scientific Laboratories (Subdivision of 30 Schering Corp.) Madison, WL, United States Veterinary License # 165 , Serial No. 30321.

I DK 175904 B1 I

I 10 I

In the 1 Poultry Pox strain designated herein FP-1 is a Duvette strain I

I in modified for use as a vaccine in day-old chickens. The tribe is you

a commercial poultry pox virus vaccine strain designated O DCEP I

In October 25 / CEP67 / 2309 October 1980 and is available from the Institute Merieux, Inc. IN

I 5 I

In Canary Pox is another avipox species. Analogous to poultry pox, infects cana- I

In riepox especially canaries, but do not infect mammals. Canary Pox Tribe, I

In what is designated here as CP is a commercial canary pox vaccine strain I

designated LF2 CEP 524 24 10 75 and is available from Institute Merieux, Inc. IN

I 10 I

In The genetic DNA sequences inserted into these avipoxviruses by genetic recom

In the combination of the invention, the Lac comprises the Z gene of prokaryotic origin; IN

In the rabies glycoprotein (G) gene which is an antigen from a non-avian pathogen (

In mammalian origin); the turkey flu hemagglutinin gene which is I

In the antigen of a pathogenic bird virus that is not an avipox virus; cutting gene I

In gp51.30 from bovine leukemia virus there is a mammalian virus; the fusion protein gene I

In the Newcastle disease virus (Texas strain) there is a bird virus; FeLV- I

In the cat gene from cat leukemia virus there is a mammalian virus; The RAV-1 env gene I

In the Rous-associated virus there is a bird virus / poultry disease; nucleo- I

In the 20 protein (NP) gene from chicken / Pennsylvania / 1/83 influenza virus there is a bird I

In levirus; the matrix gene and the peplomer gene from infectious bronchitis virus (strain I)

In Mass 41) there is a bird virus; and the glycoprotein D gene (gD) from herpes I

In simplex virus there is a mammalian virus. IN

I Isolation of the Lac Z gene is described by Casadaban et al., Methods in Enzy-I

In Mology 100: 293-308 (1983). For example, the structure of the rabies G gene is I

In described by Anilionis et al., Nature 294: 275-278 (1981). Its incorporation in I

In vaccinia and expression in this vector are discussed by Kieny et al., Nature I

I 312: 163-166 (1984). The turkey flu hemagglutinin gene is described by I

In Kawaoka et al., Virology 158: 218-227 (1987). The bovine leukemia virus I

The gp51.30 env gene has been described by Rice et al., Virology 138: 82-93 I

11 DK 175904 B1 in (1984). The Newcastle disease virus (Texas strain) fusion gene is available from Institute Merieux, Inc. as plasmid pNDV 108. The cat leukemia virus env gene has been described by Guilhot et al., Virology 161: 252-258 (1987).

The Rous-associated virus type 1 is available from Institute Merieux, Inc.

5 as two clones, penVRVIPT and mp19env (190). Chicken Flu NP gene is available from Yoshihiro Kawaoka, St. Jude Children's Research Hospital as plasmid pNP33. An infectious bronchitis virus cDNA clone of the IBV Mass 41 matrix gene and the peplomer gene is available from Institute Merieux, Inc. as plasmid plBVM63. The herpes simplex virus gD gene is described in Watson et al., Science 218: 381-384 (1,982).

The recombinant avipoxviruses, described in more detail below, comprise one of three vaccinia promoters. The Pi promoter, from the AvalH region of vaccinia, is described in Wachsman et al., J. of Inf. Haze. 155: 1188-1197 (1987). More specifically, this promoter is derived from the AvalH (XholG) fragment of the L variant WR vaccinia strain, in which the promoter directs the transcription from right to left. The short position of the promoter is approx. 1.3 kbp (kilobase pairs) from the left end of AvalH, approx. 12.5 kbp from the left end of the vaccine genome, and approx. 8.5 kbp to the left of the HindIII-C / N compound. The sequence of the promoter is: (GGATCCC) -ACTGTAAAAATAGAAACTATAATCATATAATAGTGTAGGT- TGGTAGTAGGGTACTCGTGATTAATTTTATTGTTAAACTTG-iAATTC), wherein the symbols in parentheses are linker sequences.

The Hind III H promoter (also called "HH" and "H6" herein) was defined by standard transcriptional mapping techniques.

30 ATT CTTT ATT CTATACTT AAAAAAT G AAAA

T AAAT ACAAAGGTT CTT G AGG GTTGT GTT AAATT G AAAGCG AG AAAT AAT CATA

I DK 175904 B1 I

I I

AATT I

I ATTT C ATTAT CGCG ATATCCGT I

I TAAGTTTGTATCGTAATG. IN

The sequence is identical to that of Rosen et al., J. Virol. 60: 436-449 I

I 5 (1986) is described as being upstream from open reading frame H6. IN

In the 11K promoter, as described by Wittek, J. Virol. 49: 371-378 (1984) and I

In Bertholet, C. et al., Proc. Natl. Acad. Sci. USA 82: 2096-2100 (1985). IN

The recombinant avipox viruses of the invention are constructed at two within I

Known steps known in the art analogous to those described in the aforementioned U.S. Patent I

No. 4,603,122 to form synthetic recombinants of vaccinia virus

In set. IN

First, the DNA sequence to be inserted into the virus is placed in an E. coli I

In plasmid construction, in which is inserted DNA homologous to a section of I

nonessential DNA in the avipox virus. The DNA gene sequence to be inserted, I

You are ligated separately to a promoter. The promoter gene link is then inserted into I

In the plasmid construct, so that the promoter gene link at both ends is I

In 20 flanked by DNA homologous to a non-essential region of avipox DNA. The I

In resultant plasmid construction, it is then amplified by growth in E. coli I

In bacteria. (Plasmid DNA is used to carry and amplify exogenous genetic I

In material, this method is well known in the art. These plasmid techniques

In pots, e.g. described by Clewell, J. Bacteriol. 110: 667-676 (1972). Technical I

In 25 nuclei for isolation of the amplified plasmid from the E. coli host are also I

In well known and e.g. described by Clewell et al. in Proc. Natl. Acad. Sci. USA I

I 62: 1159-1166 (1969).) I

I The amplified plasmid material isolated after growth in E. coli is used

I 30 then to the second step. Namely, transfection of the plasmid containing DNA-I

13 DK 175904 B1 gene sequence to be inserted into a cell culture, e.g. chicken embryo fibroblasts, along with the avipox virus (such as poultry pox strain FP-1 or FP-5). Recombination between homologous tarppox DNA in the plasmid and the viral genome, respectively, produces an avipox virus modified by the presence of non-poultry-pox DNA sequences in a non-essential region of its genome.

The invention is further explained by the following examples.

EXAMPLE 1 - Transient Expression Testing to Demonstrate Fierce Creepox RNA Transcription Factors Recognition of Vaccinia Promoters

A number of plasmid constructs containing the coding sequence for Hepatitis B virus surface antigen (HBSAg) coupled to vaccinia virus promoter sequences were prepared. 50 µg of each plasmid was transfected on CEF cells infected with 10 pfu of poultry virus or vaccinia virus per cell. The infection was allowed to continue for 24 hours and the cells were then lysed by three successive cycles of freezing and thawing.

The amount of HBSAg in the lysate was calculated using the commercially available AUSTRIA II - 125l kit from Abbott Laboratories, Diagnostic Division. The presence or absence of HBSAg is expressed as a ratio of the net counts (sample minus background) of the unknown value to a negative cut-off value predetermined by the manufacturer. This results in a P / N (positive / negative) ratio. The results are shown in Table I.

Three different vaccinia promoter sequences were used: the Pi promoter, recognized early by vaccinia infection, prior to DNA replication; The 11K promoter, recognized late by vaccinia infection, after the onset of DNA replication; and the HindIII H (HH) promoter, which is recognized both early and late by vaccinia infection. These promoters are previously described herein.

I DK 175904 B1 I

I 14 I

I | The data indicate that HBSAg formed in the lysate of infected cells is the result I

I of recognition of transcription factor vaccinia promoters from either I

In poultry pox or vaccinia. IN

I 5 I

I TABLE I

In Plasmid Virus Description P / N ratio I

In pMP131piR2 Poultry Pox Case connected to 1.8 I

I 10 Vaccinia Pi promoter 9.1 I

In pMPK22.13S Poultry Pox Case connected to 14 I

I Vaccinia 11 K promoter 2 I

In 15 pPDK22.5 Poultry Pox Case coupled to 92.6 I

In Vaccinia 11 K promoter 5.6 I

In pRW668 Poultry Pox Case connected to 77 I

In Vaccinia HH promoter 51.4 I

I 20 I

I (no plasmid) Poultry pox 1.1 I

In (no plasmid) Vaccinia 1.3 I

In pMPK22.13S (no virus) 1.3 I

I 25 I

In Example 2 - Construction of recombinant fiery creepox virus vFP-1 I

In containing the Lac Z oene I

A fragment in a non-essential region of the poultry pox virus was located I

In 30 and isolated as follows. IN

15 DK 175904 B1

Nuclease Bal31 was used to remove the single stranded terminal hairpin loops in FP-5 DNA. The large Klenow fragment of DNA polymerase I was used to form blunt ends. After removing the loops, the fragments were generated by digestion with restriction endonuclease 5 BgIII. In this degradation, a number of FP-5 fragments were formed which were separated by agarose gel electrophoresis.

An 8.8 kbp BglII fragment with blunt ends was isolated and ligated into a commercially available plasmid, pUC9, which had been cleaved with Bam HI and 10 SmaI. The resulting plasmid was designated pRW698.

To reduce the size of the poultry pox fragment, this plasmid was cleaved with HindIII to form two further fragments. A 6.7 kbp fragment was discarded and the remaining 4.7 kbp fragment was ligated to itself to form a new plasmid designated pRW699.

To incorporate an 11K promoted Lac Z gene into this plasmid, pRW699 was cut with EcoRV, which cleaves the plasmid only in one place. The 11K-promoted Lac Z segment was then inserted as a blunt-ended PstI-BamHI fragment 20, creating a new plasmid designated pRW702.

The Lac Z clone is from pMC1871, as described in Casadaban et al., Loc. cit.

The 11 K promoter was ligated to the eighth codon of the Lac Z gene via a BamHI linker.

By recombination techniques as described for vaccines in U.S. Patent 4,603,112, the pRW702 plasmid was then recombined with poultry pox FP-5 growing on chicken fetal fibroblasts (CEF) using the following procedures to generate vFP-1. 50 µg of pRW702 DNA was mixed in a final volume of 100 µΙ with 0.5 µg of poultry pox DNA covering the entire genome.

To this were added 10 µl of 2.5 M CaCfe and 110 µl of 2 x HEBS buffer (pH 7) made of:

DK 175904 B1 I

16 I

40 mM Hepes I

300 mM NaCl I

1.4 mM Na2HPC> 4 I

10 mM KCI I

5 12 mM dextrose. IN

After 30 minutes at room temperature, 200 µl of a poultry pox I was added

virus pool diluted to 5 pfu / cell and the mixture was inoculated on 60 mm pet I

rice bowls containing a monolayer of primary CEF. 0.7 ml of Eagles media contained I

Ten holding fetal bovine serum (FBS) were also added at this time. Pet- I

the rice dishes were incubated at 37 ° C for 2 hours, then an additional 3 ml of Eagles I

medium containing 2% FBS was added and the petri dishes incubated for 3 days. IN

Cells were lysed by three successive cycles of freezing I

and thawing, and progeny of virus were then tested for the presence of re- I

15 combiners. IN

Evidence of successful recombination insertion was obtained

nation of the 11 K-promoted Lac Z gene in the poultry pox FP-5 genome at I

to test for expression of the Lac Z gene. The Lac Z gene encodes the enzyme β-I

20 galactosidase cleaving the chromogenic substrate 5-bromo-4-chloro-3-indolyl-β-I

D-galactoside (X-gal) upon release of a blue indolyl derivative. Blue plaques became you

selected as positive recombinants. IN

The successful insertion of Lac Z into the genome of poultry pox FP-I

25 as well as its expression was also confirmed by immunoprecipitation of β-I

galactosidase protein with commercially available antisera and standard text

nodding using vFP-1-infected CEF, BSC (monkey kidney cell line - I

ATCC CCL26), VERO (monkey cell line - ATCC CC81) and MRC-5 (human I

diploid lung cell line-ATCC CCL171). IN

30 I

17 DK 175904 B1

The expression of β-galactosidase of the recombinant virus vFP-1 was further confirmed in vivo by inoculation of rabbits and mice with the virus and by measuring a post-inoculation increase in the antibody titers directed against the β-galactosidase protein in the serum of the inoculated animals.

5

Specifically, the recombinant vFP-1 was purified from host cell contaminants and inoculated intradermally two sites on each side of two rabbits. Each rabbit received a total amount of 108 pfu.

The animals were sampled weekly and the sera used in an ELISA assay using a commercially available preparation of purified β-galactosidase as an antigen source.

Both rabbits and mice inoculated with the recombinant vFP-1 produced an immune response to β-galactosidase protein as demonstrated by an ELISA assay. In both species, the response was detectable one week after inoculation.

EXAMPLE 3 - Construction from fierce creepox virus FP-5 of recombinant virus vFP-2 containing the rabies G gene and Lac Z

20

From FP-5, a 0.9 kbp Pvull fragment was obtained, which was inserted by standard techniques between the two Pvull sites in pUC9. The resulting construct, designated pRW688.2, has two Hincll sites with a distance of approx.

30 bp, located asymmetrically within the Pvull fragment, thus forming 25 a long arm and a short arm of the fragment.

Using known techniques, oligonucleotide adapters were placed between these HincII sites to introduce PstI and BamHI sites, thereby forming plasmid pRW694.

30 1

DK 175904 B1 I

18 I

This plasmid was now cleaved with Pst I and Bam HI, and the Lac Z gene with an I

coupled 11K vaccinia promoter previously described was inserted into dan

formation of the new plasmid pRW700. IN

To generate a Pi-promoted rabies G gene, the BglII site, which is 5'-I

proximal to the rabies gene (cf. Kieny et al., loc. cit.), blunt-ended I

and ligated to the filled Eco RI site of the Pi promoter described earlier. IN

This construct was inserted into the Pst I site of pRW700 to generate plasm I

10 mid pRW735.1, which contains the foreign gene sequence Pi-rabies G-11K-I

Lac Z. This insertion is so oriented within the plasmid that the I

long Pvull-HincIl arm of the FP-5 donor sequence is 3 'relative to the Lac Z gene. IN

The resulting final construct was recombined with poultry pox I

15 virus FP-5 by infection / transfection of chicken fetal fibroblasts at I

the methods described above to form recombinant I

poultry pox virus vFP-2. This recombinant virus was selected by X-gal I

staining. IN

20 Correct insertion and expression of both Lac Z marker gene and rabies G-I

the gene was verified by a number of additional methods described below. IN

Localization of the rabies antigen by immunofluorescence with specific an- I

antibodies successfully expressed rabies antigen expression on the surface of birds ι I

25 and non-avian cells infected with vFP-2 virus. IN

The expression of rabies antigen and β-galactosidase of birds and non-I

bird cells infected with the vFP-2 virus were confirmed, as before, by I

immunpræcipiteringsmetoden. IN

30 I

19 DK 175904 B1

By inoculating two rabbits with vFP-2 virus, further evidence was obtained that the vFP-2 embodiment of the invention is a successful recombinant virus carrying the genes for rabies G and β-galactosidase. Both rabbits were inoculated intradermally with 1x10® pfu vFP-2 per ml. rabbit. Both of these rabbits formed typical pox lesions. The rabbits were sampled weekly, and sera were tested by ELISA to detect the presence of specific antibodies against the rabies glycoprotein and the galactosidase protein.

As indicated in Table II below, rabbit 205 showed detectable amounts of anti-β-galactosidase antibody in the ELISA sample one week after inoculation. This increased by two weeks to a titer of 1 in 4000, maintained until 5 weeks after inoculation. Using the antigen capture ELISA assay, rabbit sera 205 showed detectable amounts of anti-rabies antibodies from 3 to 10 weeks after inoculation.

I DK 175904 B1 I

I 20 I

TABLE II

In antibody formation of rabbit 205 against I

In the rabies antia and β-aalactosidase protein I

I 5 I

In Time Antibody titer I

(reciprocated by I

In serum dilution) I

I Before taking anti-β-galactosidase I

I of blood sample 0 I

In Week 1 500 I

In Weeks 2-5 (each) 4000 I

In Week 6,500 I

I 15 Week 9 250 I

Before taking anti-rabies

I of blood sample 0 I

In Week 3,200 I

For 20 Week 6,200 I

In Week 10 100 I

In Example 4A - Construction from recombinant I wild squamous virus FP-1

In virus vFP-3 containing promoted rabies G gene I

I 25 I

In this embodiment, the rabies G gene is fully expressed by I

In poultry pox strains other than FP-5, specifically of another strain of I

In poultry epox virus designated FP-1. IN

21 DK 175904 B1

As in Example 3, a 0.9 kbp Pvull fragment was obtained from FP-1, assuming that the fragment would contain a non-essential region, as was the case for FP-5.

This fragment was inserted between the two Pvull sites in pUC9, forming a plasmid designated pRW731.15R.

This plasmid has two Hinell sites, with a distance of about. 30 bp, located asymmetrically within the Pvull fragment, thus forming a long arm and a short arm of the fragment.

A commercially available Pst coupling sequence (5 ') - CCTGCAGG - (3') was inserted between the two Hinel I sites to generate plasmid pRW741.

15

An HH-promoted rabies G gene was inserted into this plasmid at the Pst I site to generate the new plasmid pRW742B. By recombining this plasmid with FP-1 by infection / transfection of CEF cells, virus vFP-3 was obtained.

The ATG translation initiation codon in the open reading frame promoted by the HH promoter was superimposed on the initiation codon of the rabies G gene using a synthetic oligonucleotide spanning the EcoRV site of the HH promoter and HindIII site of the rabies G gene. . The 5 'end of this HH-promoted rabies gene was modified by known techniques to contain a Pst I site, and the construct was then ligated into the Pst I site of pRW741 to form pRW742B. The orientation of the construct in the plasmid is the same as in pRW735.1 previously discussed in Example 3.

Recombination was performed as described in Example 2. The resulting recombinant is called vFP-3.

I DK 175904 B1 I

The expression of rabies antigen by both bird and non-bird cells infected I

with the vFP-3 virus was confirmed by the immunoprecipitation described previously

curing and immunofluorescence techniques. IN

5 Further proof that the vFP-3 embodiment of the invention is a good one

successful recombinant virus expressing genes for rabies G was obtained by I

inoculate rabbit pairs intradermally with the recombinant virus. Two rabbits became you

inoculated intradermally with 1x10® pfu vFP-3 per ml. rabbit. Both of these rabbits

formed typical pox lesions reaching maximum size 5-6 days after I

10 inoculation. The rabbits were sampled at weekly intervals and I

sera were tested at ELISA to detect presence I

of specific antibody for the rabies glycoprotein. IN

Five rats were each also inoculated intradermally with 5 x 10 7 pfu vFP-3. IN

Resulting lesions were seen in all animals.

Both rabbits and rats produced detectable amounts of antibody specifically against rabies two weeks after inoculation. Two control rabbits inoculated intradermally with the parental FP-1 virus did not have detectable amounts of anti-rabies antibody.

In order to exclude the possibility that the antibody response was due to the introduction of the rabies antigen that coincidentally accompanies the inoculum virus or was integrated into the membrane of the recombinant poultry pox virus, rather than having been produced by de novo synthesis of the rabies antigen by the recombinant virus in animal as predicted, the vFP-3 virus was chemically inactivated and inoculated in rabbits.

The purified virus was inactivated one day to another at 4 ° C in the presence of 0.001% β-propiolactone and then pelleted by centrifugation.

The pelleted virus was collected in 10 mM Tris-buffered saline, ultrasonically treated and titrated to ensure that no infectious virus remained. Two rabbits were inoculated intradermally with inactivated vFP-3 and two rabbits with an equivalent amount of untreated recombinant. The size of lesions was checked.

5

Both rabbits receiving untreated vFP-3 developed typical pox lesions classified 4-5 + 5 days after inoculation. Rabbits inoculated with inactivated virus also developed lesions, but these were classified as 2 * 5 days after inoculation.

10

The rabbits were sampled at weekly intervals and sera were tested by ELISA for the presence of rabies-specific antibodies and poultry-specific antibodies. The results are shown in Table III below.

TABLE III

•

Live vFP-3 Inactivated vFP-3

Rabbit: No. 295 No. 318 No. 303 No. 320

Tested antibody: Rabies FP Rabies FP Rabies FP Rabies FP

Week after inoculation "O 0 0 0 0 0 0 6 0 2 250 4000 500 4000 0 50 0 1000 3 1000 4000 500 4000 0 4000 0 2000 4 1000 4000 2000 4000 0 4000 0 2000 5 4000 4000 2000 4000 0 2000 0 4000 6 4000 4000 4000 4000 0 2000 0 2000 In this assay, the titration endpoint (expressed as the reciprocal of the serum dilution) was arbitrarily set at 0.2 after subtracting the absorption values of all pre-challenge sera. Rabbits 303 and 320 also developed an immune response to poultry pox virus antigens, although the titer was low, none of which produced a detectable response to rabies glycoprotein and to poultry pox virus antigens. rabies glycoprotein.

This result indicates that the immunological response produced in the rabbit is 5 due to the de novo expression of the rabies glycoprotein gene carried in the recombinant virus, and not a response to a random accompanying glycoprotein contained in the inoculum virus.

In EXAMPLE 4B - Construction from fiery creepox virus FP-1 of recombinant virus vFP-5 containing unprompted rabies G gene I Expression of a foreign gene inserted by recombination in the poultry pox I genome requires the presence of a promoter. This was shown by creating an additional recombinant vFP-5 identical to vFP-3 except that the HH promoter is deleted. The presence of the rabies gene in this I recombinant was confirmed by nucleic acid hybridization. However, no rabies antigen was detected in CEF cell cultures infected with the virus.

In Example 5 - In vitro transfer assay to determine I 20 squamous cell virus replicates in non-bird cells I An experiment was performed in which three cell systems, one from birds and two from non-birds, were inoculated with the parental FP-1. strain or the recombinant vFP-3. Two petri dishes each of respectively. CEF, MRC-5 and VERO were inoculated with FP-1 or vFP-3 at an input multiplicity of 10 pfu cell.

After three days, one petri dish was harvested from each. The virus was released by three successive cycles of freezing and thawing and reinoculated on a fresh monolayer of the same cell line. This was repeated for six consecutive transfers and at the end of the experiment, samples were obtained! I from each transfer titrated for viral infectivity on CEF monolayers.

DK 175904 B1 25

The results are shown in Table IVA and indicate that serial transfer of both FP-1 and vFP-3 is possible in CEF cells, but not in either of the two non-bird cell lines. Infectious virus cannot be detected after 3 or 4 transfers in VERO or MRC-5 cells.

5

The second petri dish was used to determine whether viruses not detectable by direct titration could be detected after amplification in the permissive CEF cells. On the third day, cells were harvested on the second petri dish by scraping and a third of the cells were lysed and inoculated on a fresh CEF monolayer. Upon achieving full cytopathic effect (CPE), or 7 days after infection, the cells were lysed and virus yield titrated. The results are shown in Table IVB. When transmission in CEF cells was used to amplify any virus present, the virus could not be detected after four or five transfers.

15

Attempts to establish persistently infected cells failed.

In a further attempt to demonstrate evidence of continued viral expression in non-avian cells, the samples used for viral titration above were used in a standard immunoprotection assay (immunodot assay) in which anti-poultry pox antibody and -rabies antibody was used to detect the presence of the respective antigens. The results of these tests confirm the results obtained by titration.

DK 175904 B1 I

| 26 I

TABLE IVA I

Transfer attempt I

Inoculum- I

virus: FP-1 vFP-3 I

Cell type CEF VERO MRC-5 CEF VERO MRC-5 I

Transmission: I

1 6.6a 4.8 4.9 6.6 5.4 66.2 I

2 6.7 2.9 3.7 6.5 4.2 5.1 I

3 6.4 1.4 1.0 6.4 1.7 4.4 I

4 6.1 i.d.b i.d. 6.2 i.e. 1.0 I

6.4 i.d. i.d. 6.3 i.d. i.d. IN

6 5.7 i.d. i.d. 5.9 i.d. i.d. IN

a - virus titer expressed as log ™ pfu / ml I

5 b - not detectable

TABLE IVB I

Amplification Experiment I

Inoculum- I

virus: FP-1 vFP-3 I

Cell type CEF VERO MRC-5 CEF VERO MRC-5 I

Transmission: I

1 6.4a 6.2 6.4 6.5 6.3 6.4 6.4

2 7.5 6.3 6.0 6.5 6.3 5.5 I

3 6.2 6.7 5.3 5.9 6.1 6.3 I

4 5.6 4.6 3.9 5.7 4.8 5.8 I

6.3 4.1 i.d. 6.1 4.7 4.7 I

6 6.2 i.d.b i.d. 6.2 i.d. i.d. IN

10 α - virus titers expressed as log ™ pfu / ml I

b - not detectable

EXAMPLE 6 - Additional recombinants of wild crepe pox FP-1: vFP-6. VFP 7th vFP-8 or vFP-9

Recombinant viruses vFP-6 and vFP-7 were constructed as follows.

5

A 5.5 kbp Pvull fragment of FP-1 was inserted between the two Pvull sites in | PUC9 to generate the plasmid pRW731.13. This plasmid was then cut into a unique HincII site and HH promoted rabies G gene with blunt ends inserted to generate plasmids pRW748A and pRW748B, representing 10 opposite orientations of insertion. The plasmids pRW748A and B were then used separately to transfect CEF cells together with FP-1 virus to generate, respectively. vFP-6 and vFP-7 by recombination. This locus is now designated locus f7.

A 10 kbp Pvull fragment of FP-1 was inserted between the two Pvull sites in pUC9 to form pRW731.15. This plasmid was then cut into a unique BamHI site and an 11 K promoted Lac Z gene fragment was inserted to generate pRW749A and pRW749B, representing opposite orientations of insertion. Recombination of these donor plasmids with FP-T resulted in 20 and 10, respectively. vFP-8 and vFP-9. This locus is now designated locus f8.

vFP-8 and vFP-9 expressed the LacZ gene, as detected by X-gal. vFP-6 and vFP-7 expressed the rabies G gene as detected by rabies-specific antiserum.

Example 7 - Immunization with vFP-3 to protect animals from challenge with live rabies virus

Groups of 20 SPF female mice, 4-6 weeks old, were inoculated underfoot with 50 μΙ of vFP-3 at doses ranging from 0.7 to 6.7 TCID 50 per day. mouse. [TCID50 or tissue culture infectious dose (the tissue culture infectious dose) is the dose at which cytopathic effect is seen in 50% of cells in tissue culture). 14 days after vaccination

I DK 175904 B1 I

10 mice were killed in each group and serum samples I were taken

for testing in the RFFI test. The remaining 10 mice I

bark challenged by intracerebral inoculation of 10 LDgo rabies by CVS-I

the strain and surviving mice counted 14 days after the challenge. IN

The results are shown in Table VA below. IN

TABLE VA I

10 vFP-3 dose of Rabies antibody titer I

Loom TCIDsn Loom Dilution * Survival I

6.7 1.9 8/10 I

4.7 1.8 0/10 I

2.7 0.4 0/10 I

0.7 0.4 0/10 I

As measured by the Rapid Fluorescent Focus Inhibition (RFFI) test, I

Laboratory Techniques in Rabies, 3rd ed., 354-357, WHO, Geneva. IN

The experiment was repeated with 12.5 LD50 challenging rabies virus. The results I

are shown in Table VB below. IN

TABLE VB I

vFP-3 dose of Rabies antibody titer I

Logm TCIDsn Loqm Dilution 'Survival I

6.7 2.8 5/10 I

4.7 2.1 2.1 / 10 I

2.7 0.6 0/8 'I

0.7 0.6 0/8 I

As measured by the Rapid Fluorescent Focus Inhibition (RFFI) test, I

35 Laboratory Techniques in Rabies, 3rd ed., 354-357, WHO, Geneva. IN

DK 175904 B1 29

Two dogs and two cats were immunized with a single subcutaneous inoculation of 8 logio TCID 50 of the recombinant vFP-3. In addition, two dogs and four cats of similar age and weight were kept as non-vaccinated controls. Blood tests were performed on all animals at weekly intervals. On day 94 5, each dog was challenged by inoculation in the temporal muscle of two 0.5 ml doses of a salivary gland homogenate. rabies virus of the NY strain, available from Institut Merieux, Inc. The total dose was equivalent to 10000 mice LD50 administered by intracerebral route. The six cats were similarly challenged by inoculation in the neck muscle with two doses of 0.5 ml of the same vi-10 russus suspension. The total dose per animals corresponded to 40000 mice LD50 administered by intracerebral route. The animals were observed daily. All non-vaccinated animals died with rabies symptoms on the day listed in Table VI. The vaccinated animals survived the challenge and were observed for three weeks after the last control animal died. The results are shown in Table VI below.

! i j i j

30 I

DK 175904 B1 I

TABLE VI I

Survive- I

Vaccine / Death- I

dvr ring Titer at the postinoculars at that timeInd I

5 I

0 14 21 28 94 I

Cat. IN

7015 vFP-3a 0 2.2b 2.4 2.4 1.5 + I

7016 vFP-3 0 1.7 1.9 2.0 1.3 + I

10 8271 cc 0 0 0 0 0 d / 13d I

T10 c 0 0 0 0 0 d / 12 I

T41 c 0 0 0 0 0 d / 13 I

T42 c 0 0 0 0 0 d / 12 I

15 Dog I

426 vFP-3 0 0.8 1.0 1.1 1.2 + I

427 vFP-3 0 1.5 2.3 2.2 1.9 + I

55 c 0 0 0 0 0 d / 15 I

8240 c 0 0 0 0 0 d / 16 I

20 I

a Both cats and dogs vaccinated with vFP-3 received 8 logioTCID 50 ad sub-I

cutan road. IN

b Titer expressed as log10 highest serum dilution yielding more than 50% I

reduction in the number of fluorescent wells in an RFFI test. IN

25 c Non-vaccinated control animals. IN

d The animal died / death day after challenge. IN

In further experiments, the recombinant viruses vFP-2 and vFP-3 were inoculated into I

cattle by several different routes of administration. IN

30 I

Inoculated animals were tested for anti-rabies antibody on days 6, 14, 21, 28 I

and 35. As shown in the following Table VIIA, all animals exhibited a serologic response

sponge on the rabies antigen. IN

DK 175904 B1 31

TABLE VHA

Antibody titers in mammals inoculated with vFP-3 anti-rabies neutralizing antibodies 5 RFFI test loam dilution

Day 0 6 14 21 28 35

Cattle no.

7.3 log 10 TCID 50 1420 (intraderm) NEG 0.6 2 1.7 1.8 1.7 8 log 10 TCID 50 1419 (subcutaneous) NEG 1.6 2.2 2.1 2.1 1.9 1.9 8 I0910 TCIDgo 1421 (intramuscular) NEG 0.9 2.2 2.2 1.8 1.7 7.3 logio TCID50 20 1423 (intramuscular) NEG 0.9 1.Γ 1+ 1+ 1.1 * + Not significant.

Each piece of cattle was revaccinated with 8 logio TCIF 50 55 days after inoculation and showed an anamnestic response to the rabies antigen. Upon booster revaccination, all cattle were inoculated subcutaneously except for # 1421, which was again inoculated intramuscularly. RFFI titers were determined on days 55, 57, 63, 70, 77 and 86. The results are shown in Table VIIB.

I DK 175904 B1 I

I 32 I

I TABLE VIIB I

I 'Daa 55 57 63 70 77 86 I

In Cattle No. I

I 5 1419 1.7 1.5 2.9 2.9 2.6 2.9 I

I 1420 1.0 0.5 1.9 2.3 2.2 2.0 I

1421 1.3 1.2 2.9 2.7 2.5 2.5 I

10 I

I 1423 1.0 0.7 2.4 2.5 2.5 2.2 I

In All Figures is for vFP-3 with the exception of animal # 1423 which is for vFP-2. IN

In cattle, cats and rabbits were also inoculated intradermally with known quantities

In there of poultry pox virus, and after a week, wounds were collected from the animals. These I

was ground, suspended in brine and titrated to determine I

In the viruses. IN

In 20 Only residual amounts of infectious virus could be recovered. This shows that you

In vivo, no productive infection occurred. IN

In Example 8 - Inoculations of chickens with vFP-3 I

The recombinant poultry pox virus vFP-3 was inoculated into chickens to show I

In the expression of foreign DNA of a recombinant poultry pox virus in a system, I

In that allows productive replication of the vector. IN

In Chickens of white Italian chickens were inoculated intramuscularly with 9 logio I

In 30 TCID50 vFP-3 or 3 log10 TOID50 vFP-3 by wing piercing. There, I-

Blood samples were taken for an RFFI test for rabies antibody titers 21 days after I

In vaccination. Titers from day 21 in inoculated chickens were significantly higher

In than titers from day 21 in controls. The average titer of the uninfected con- I

The trolls were 0.6, the average for the intramuscularly inoculated birds was 1.9, and the average for the wing-pierced birds was 1.2.

EXAMPLE 9 - Recombinant fiery crepe pox vFP-11. expressing turkey-5 influenza HS-HA antigen

Bird species can be immunized against bird pathogens using the recombinant avipox viruses of the invention.

Thus, the novel plasmid pRW759 (described below) derived from poultry pox virus FP-1 and containing the HindIII H promoted hemagglutinin gene (H5) from A / turkey / ireland / 1378/83 (TYHA) , used for transfection of CEF cells simultaneously infected with parental virus, FP-1. Recombinant poultry pox virus vFP-11 was obtained by the previously described techniques.

The synthesis of a hemagglutinin molecule of vFP-11 infected cells was confirmed by immunoprecipitation from metabolically radiolabeled infected cell lysates using specific anti-H5 antibody and standard techniques. Specific immunoprecipitation of precursor hemagglutinin having a molecular weight of about 20 was shown. 63 kd (kilodalton) and two cleavage products with molecular weights of 44 and 23 kd. No such proteins were precipitated from a lysate of uninfected CEF cells or cells infected with parental virus, FP-1.

25

Immunofluorescence studies were performed to determine that the HA molecule formed in cells infected with the recombinant poultry pox vFP-11 was expressed on the cell surface. CEF cells infected with the recombinant poultry pox virus vFP-11 showed strong fluorescent labeling on the surface.

30 In cells infected with the parental virus FP-1, no fluorescence was seen.

!

DK 175904 B1 I

34 I

Plasmid pRW759 was formed as follows: I

pRW742B tough. Example 4) is made linear by partial decomposition with Pst I, I

and the fragment is cut again with EcoRV to remove the rabies G gene, which I

5 leaves the HH promoter on the remaining fragment of ca. 3.4 kbp. IN

This is treated with alkaline phosphatase and a synthetic oligonucleotide I

; was inserted to join the HH promoter with TYHA by ATG to Dan

In accordance with pRW744. IN

This plasmid was made linear by partial degradation with Dral, the linear I

fragment cut with Sal and the largest fragment was reinsulated and treated

diet with alkaline phosphatase. IN

Finally, pRW759 was formed by insertion into the pRW744 vector of the isolate I

15 honored Sall-Dral coding sequence from TYHA, described by Kawaoka et al., Virol-I

and 158: 218-227 (1987). IN

EXAMPLE 10 - Immunization with vFP-11 to protect Fuole against I

live flu challenge we intoxicated

20 I

To assess the immunogenicity of the recombinant poultry pox virus vFP-I

11, vaccination and challenge trials were conducted with chickens and turkeys. IN

Particular pathogen-free chickens of white Italians turned 2 years old and 5 l

25 weeks vaccinated by wing tissue puncture with a double needle used I

for commercial vaccination of poultry with ironpox pox virus. Each bird became you

filed approx. 2 µl containing 6 x 10 5 pfu vPF-1. Blood samples were taken

from the older birds before vaccination, and blood samples were taken from all birds I

before challenge and two weeks later. IN

30 I

DK 175904 B1 35

For comparative purposes, another group of chickens was vaccinated with a conventional H5 vaccine consisting of an inactivated H5N2 strain in a 1 water-in-oil emulsion.

5 Inactivated H5N2 vaccine was prepared from A / Mallard / NY / 189/82 (H5N2) influenza virus cultured in 11-day-old embryonated chicken eggs. The infected allantoic fluid with a HA / titer of 800 / 0.1 ml and infectivity titer of 1 08.5 / 0.1 ml was inactivated with 0.1% propiolactone and suspended in water-in-oil emulsion as described in Stone et al. al., Avian Dis. 22: 666-674 (1978) and Brugh et al., Proc. Second Inter. Sym. on Avian Influenza, 283-292 (1986). The vaccine was administered in a volume of 0.2 ml subcutaneously on the inside of the thigh muscle for 2 days and 5 weeks old chicks by SPF white Italians.

A third and fourth group of chickens were given respectively. parental virus FP-1 or no vaccine.

The chickens were challenged with approx. 103 LD50 of the highly pathogenic A / Turkey / ireland / 1378/83 (H5N8) or A / Chick / Penn / 1370/83 (H5N2) influenza virus by administration of 0.1 ml into the nostrils of each bird. Two day old 20 birds were challenged 6 weeks after vaccination and 5 week old birds were challenged 5 weeks after vaccination. The birds were observed daily for signs of disease, indicated by swelling and cyanosis of the face and comb, as well as leg bleeds (often such birds could not stand up), paralysis and death.

Most deaths occurred between 4 and 7 days after infection. 25 trachea and sewage inoculations were taken on each of the live chickens 3 days after infection, which was examined for virus by inoculation in embryonated eggs. The chickens inoculated with either wild-type or recombinant poultry pox virus developed typical lesions on the wing tissue. On the third day, pus-tules were formed at the site of each cannula, followed by cellular infiltration with wound formation and improvement on the 7th day. No secondary lesions were formed and there was no evidence of spread to unvaccinated contact coolers.

36 I

DK 175904 B1 I

offices. The results of the challenge trial are shown in Table VIII and the corresponding I

serological results in Table IX. IN

TABLE VIII I

5 I

Protection of chickens mediated by H5 expressed in wild crayfish pox I

Proven I

challenge Protection Virus I

10 Chickens I

Virus Vaccine age Sick / dead / total Trachea Sewer |

Ty / lreland Fowlpox-H5 2 days 0/0/10 0/10 0/10 I

(H5N8) (vFP-11) 5 weeks 0/0/5 0/5 0/5 I

15 Inactivated 2 days 0/0/9 0/9 0/9 I

H5N2 5 weeks 0/0/5 0/5 0/5 I

Fowlpox 2 days 10/9/10 2/6 3/6 I

control 5 weeks 4/3/5 0/5 4/5 I

20 I

No 2 days 10/9/10 2/7 5/7 I

2 days' 2/1/2 2/2 2/2 I

5 weeks 2/2/5 0/5 1/5 I

25 Ck / Penn Fowlpox-H5 2 days 0/0/10 8/10 0/10 I

(H5N2) (vFP-11) 5 weeks 0/0/6 5/6 2/6 I

Inactivated 2 days 0/0/8 2/8 0/8 I

H5N2 5 week 0/0/5 3/5 0/5 I

30 I

Fowlpox 2 days 10/1/10 10/10 10/10 I

control 5 weeks 5/0/5 5/5 5/5 I

No 2 days 9/3/9 9/9 9/9 I

35 2 days' 2/2/2 2/2 2/2 I

_5 weeks 5/2 / 5_5 / 5 5 / 5_ I

* Four non-vaccinated birds stayed with and grew up with poultry pox-I

The H5 group of 10 birds for testing the spread of poultry pox H5. IN

40 I

DK 175904 B1 fe O OO 1 C 0001000100¾

111 N- CM ^ τ- -tf -'i 'rg N S

® .. i t • i 5 & 2 m> ^ * "> is u S o • © c o o

W'glD VV ^ -T-VVVV

.¾ Z

> ro - ro □ a N C ^ eO _Ολ c C i- So o o a o a ~ ω © 52 So oo oo os 3 S _ c So oo oo oo = -σ LU ^ T- r ~ CM CO -r- CO h-

7 = CO C

.E ^ ro M 3 0) CD »i C zsr>>“ æ o o '1 = H o cd in ^ -X LUr-T-cocMVVvv ro c <5 ™

Js fe o __ o o oo oo o o o o o o o o o oo cm m- coo - c LU O CM O CM CM CD CM CO O CO CM t-t- t- t- _ c

II CD

Thaw.

X Q. iS

O, ^ I- ϊο UJ Ό Q o § o o

^ CQ m> 2 LU V V CO T- V V V V V V CM t- V V V V

<1 £ H σ & c t cm S a a ~ • c qp> - a o ^ o © -.

η) -1- © CD o O Orø and O OO EAST SO

- -rj 4i O OO O O CO CM OO OO O O O O O CD

J g LU t— Tf N- CD T-T- CO CM CD CM CO O CD 05 CD * - o% .E £ "O λ ^ CD i— * -"> ® s o o o _ o o o o oooo

Q) LU T-T- COCO VV VV T- CO CD CO VV VV

ω υ 3 IVUO L. Φ U Φ U (D k. Φ L. Φ U ID b T3 c 05 © OS 05 05 © 05 05 05 <15 0505 0505 0505 C: = U5 © CO 05 CO 05 CO 05 CO 05 CO 05 (005 (005 (005 -> .0) 2 "OOO 3" 03 Ό3 OD Ό 3 "O 3" 03

[2 05 CO CM LO CM ID CM CD CM ID CM CD CM CD CM ID CM ID

0

Q

1 'I I I

<D X _ X X _ X

2 S. 8. 2 O.

1 f 8 .icM 8θ C 8 .Icm 8 "gcoo" S 2 z "i £ £ © -if 2z if <0 05 and ro ΙΟ © § 05 0 U5 ro ID. © § 05 2> iLi £ l iTS £ ιΓχ -Ξ X iTJz =

<D

C

05 C C

1: (0 <r- c Έ O 2 ® O CO O Z Q_ D> h £ o m o m o m o T- T- CM C \ l co

38 I

DK 175904 B1 I

(Table IX continued)

(a) The 5-week-old birds had a blood sample taken prior to vaccination and tested I

5 by H1 and neutralization tests, none contained detectable data

antibody volumes and the results are not shown. The 2 day old chickens I

received a blood sample 6 weeks after vaccination (After 1) and the 5 weeks I

old birds were sampled 5 weeks after vaccination (After 1); IN

both groups were sampled 2 weeks after challenge (After 2). IN

The numbers are the mean antibody items from the same chicken groups described 1 I

know in Table 1. I

(b) The numbers in parentheses represent those who survived challenge. IN

(c) Hemagglutination Inhibition (H1) Tests were performed on I

microtiter plates using receptor-breaking I

15 enzyme-treated sera, 4 HA units of Ty / lre virus, and 0.5% chicken I

erythrocytes as described in Palmer et al., Immun. Series No. 6, 51-52, I

US Dept. Health, Education and Welfare (1975). Tests for I

Neutralization of infectivity was performed by incubating 103 EID 50 I

Bullet virus with serum dilutions for 30 min at room temperature, I

20 followed by inoculation of embryonated eggs with aliquots. Virus growth

was determined by hemagglutination assays after incubating eggs in I

2 days at 33 ° C. IN

<= less than 10. I

Chickens inoculated with the poultry Pox H5 recombinant (vFP-11) or the I

inactivated H5N2 influenza vaccine was adjuvanted

claim with the homologous Ty / lre (H5N8) influenza virus and with the I

related but distinguishable Ck / Penn (H5N2) influenza virus. By contrast, you showed

the majority of birds inoculated with parental FPV or who received no I

30 vaccines, clinical signs of high pathogenic influenza, including swelling and I

'cyanosis of the face and crest, bleeding in the legs and paralysis. Largest I

Part of these birds died. The vaccinated birds did not secrete detectable levels of Ty / lre, but secreted Ck / Penn.

Both the inactivated and recombinant vaccines induced HI and neutralizing antibodies against Ty / lre, but the amount of antibody induced by the poultry Pox H5 recombinant, vFP-11, before challenge did not inhibit HA or neutralize the heterologous Ck / Penn H5. However, the chickens were protected against propagation with both Ty / lre and Ck / Penn influenza viruses.

10 Immunity to H5 influenza induced by the vFP-11 vaccination lasted for at least 4 to 6 weeks and was cross-reactive. To further investigate the duration and specificity of the response, a group of 4-week-old chicks were inoculated into the wing tissue with vFP-11 as previously described and challenged at monthly intervals with the cross-reactive Ck / Penn virus. Again, 15 antibodies were not detected before the challenge. Nevertheless, the birds were protected for more than 4 months.

The HFP expressed by vFP-11 also induces a protective immune response in turkeys. Outbred white turkeys were vaccinated at 2 days and 4 weeks by wing tissue inoculation as previously described. The results are shown in Table X.

DK 175904 B1 I

® fc CM CO -g -g I

O) 2 Γ. B 8

- UJ τί T3 "O

O I—

»O H

O T-

© ^ <i> to I.

£ T- o

LU V T- V V

CM I

φ Jr © © o ® o O TJ T3

© sS ^ S-o® I

- S S 2 I

OL = two i_ u_ 2j.h-

- g jg O O O O

2 Z LU V V V V

c

"ISLAND

^ <«Ro

X E? O JO CO CM CM

tf>> id CO O CM CM

X

x ro π I

§ W ^ c © I

^ cQ f wr <E 5 o {- © · · © 2 iQ £ S ™ ™

^ CL K lO CM CM CM

© c 3 -

5 © I

® η I

+ = (Λ .2 (0 -rr ~

s §.1 I

φ - * in CO CM CM

§ ® “^ H: <5 ™ I

-S £ GO (/) x— CM CM CM

cn ©

CO

cn

© m I

C gj ._ © © «_ S * © σ> ©" rjj © -S 03 CD O)

3] 3 73 => T3 3 I

Li. ro N TT CM ^

Ή I

ro

© 5 »i« I

r- r · JJ ^ =

~ T- E ro O

CJ I X 4- »

O LI- 9 c C I

>> £ 5 5 I

two o to o I

«-« - CM

DK 175904 B1 41

Significant survival against challenge was observed with the homologous Ty / lre virus in both age groups. Non-vaccinated contact control birds stayed with the vaccinated birds to test the spread of the recombinant virus. These birds did not survive challenge.

EXAMPLE 11 - Construction of fiery creepox virus FP-1 recombinant vFP-12 expressing squamous line influenza nucleoprotein (NP) gene 10 Plasmid pNP33 contains a cDNA clone of the Chicken / Pennsylvania / 1/83 nucleoprotein gene (NP) gene. Only the 5 'and 3' ends of the approx. The 1.6 kbp NP gene has been sequenced. NP, in the form of a 5'-Clal-Xhol-3 'fragment with blunt ends, was moved from pNP333 into SmaI degraded pUC9, with pUC9's EcoRI site at the 3-end, producing pRW714.

The translation initiation codon (ATG) in NP contains the following stressed Ahall site: ATGGCGTC. The previously described vaccinia H6 promoter was associated with NP with a double-stranded synthetic oligonucleotide. The synthetic oligonucleotide contained the H6 sequence from the EcoRV site to its ATG and into the NP coding sequence at the Ahall site. The oligonucleotide was synthesized with BamHI and EcoRI compatible ends for insertion into pUC9 to produce pRW755. Starting at the BamHI compliant end, with ATG underlined, is the sequence of the double-stranded synthetic oligonucleotide: 25 gatccgatatccgttaagtttgtatcgtaatggcgtcg

GCTATAGGCAATTCAAACATAGCATTACCGCAGCTTAA

The linear partially Ahall degraded product of pRW755 was isolated and re-cut with EcoRI. The pRW755 fragment, containing a single Ahall-30 cut by ATG and re-cut with EcoRI, was isolated, treated with

42 I

DK 175904 B1 I

phosphatase and used as a vector for the pRW714 degradation product ne- I

denfor. IN

The isolated linear partially Ahall degraded product of pRW714 became I

5 re-cut with EcoRI. An isolated Ahall EcoRI fragment of ca. 1.6 kbp inside I

holding the NP code sequence was inserted into the above pRW755 vector

to form pRW757. The complete H6 promoter was formed by I

add the sequences upstream (5 ') of the EcoRV site. Plasmid pRW742B I

(described in Example 4) obtained the H6 sequence downstream (3 ') of EcoRV site I

10 removed along with sequences to pUC9's Ndel site. pRW742B EcoRV- I

The Ndel fragment treated with phosphatase was used as an I

vector for the pRW757 fragment below. The isolated linear partial I

EcoRV degradation product of pRW757 was reinsulated following Nde I

refraction; this fragment contains the H6 promoter from the EcoRV site gene I

15 easy NP to pUC9's Ndel site. The pRW757 fragment was inserted into pRW742B-I

the vector to form pRW758. The EcoRI fragment from pRWW758, contains I

the complete H6 promoted NP was blunt ended with I

The Klenow fragment from DNA polymerase I and inserted into the Hinell site of I

pRW731.13 to form pRW760. The HincII site in pRW731.13 is FP-1- I

The locus used in Example 6 to construct vFP-6 and vFP-7. IN

Using poultry pox FP-1 as the rescue virus, plasmid pRW760 I

used in an in vitro recombination assay. The offspring of plaques were tested

and plaque purified using in situ plaque hybridization. Expression of I

The gene has been confirmed by immunoprecipitation studies using I

of a goat polyclonal anti-NP antiserum. The size of the protein speci- I

fictitiously precipitated from a lysate of vFP-12-infected CEF cells was approx. 55 kD, I

which is within the described magnitude of influenza virus I

nucleoproteins. IN

30 I

EXAMPLE 12 - Preparation of a fiery creepox virus double recombinant.

VFP 15th expressing the genes of the avian influenza nucleo protein (NP) and hemagglutinin (HA) 5 The hemagglutinin (HA) gene of A / Tyr / lre / 1378/83 has been previously described in the construction of vFP-11 (Example 9). To produce a double recombinant, the HA gene was first moved to locus f8, previously defined by the construction of vFP-8, using plasmid pRW731.15.

10 To construct vFP-11, plasmid pRW759 was used. The hemagglutinin gene linked to the H6 promoter was removed from this plasmid by partial PstI degradation. This fragment was blunt-ended with the Klenow fragment of DNA polymerase I and inserted into the blunt-ended BamHI site of pRW731.15 to generate pRW771.

15

Plasmid pRW771 was then used in an in vitro recombination assay using vFP-12 as the rescue virus. The recombinant vFP-12 virus contains the nucleoprotein gene linked to the H6 promoter at locus f7 of plasmid pRW731.13. Recombinant plaques now containing both insertions were selected and purified by in situ hybridization and surface expression of the hemagglutinin, confirmed by a protein A-3-galactosidase-linked immune assay. Expression of both genes was confirmed by immunoprecipitation from lysates of cells infected with the double recombinant virus, vFP-15.

EXAMPLE 13 - Construction of Recombinant Canary Pox Viruses

The following example shows the identification of four nonessential insertion loci in the canary pox genome and the construction of four recombinant canary pox viruses, vCP-16, vCP-17, vCP-19 and vCP-20.

44 I

DK 175904 B1 I

The recombinant canary epox vCP-16 was constructed in the following manner. IN

A 3.4 kbp Pvull fragment of 3.4 kbp canarypox DNA was cloned into pUC9 to I

formation of pRW764.2. A unique EcoRI site located in I was found

5 asymmetrically inside the fragment with a short arm of 700 bp and a long arm of I

2.7 kbp. The plasmid was digested with Eco RI and blunt-ended underneath

reversal of the Klenow fragment from DNA polymerase I. It blunt-ended I

The H6 / rabies G gene was then ligated into this site and used for transformation

on E. coli. The resulting plasmid, pRW775, was used by an in vitro I

10 test for recombination. Offspring of plaques that were positive by an im

mouth screening, was selected and plaque cleansed. The resulting re- I

Combined, vCP-16 was designated and the insertion site was designated C3. IN

The plasmid pRW764.2 used in the above construction also contained I

15 a unique BglII site approx. 2.4 kbp from the EcoRI site. Using the same clone I

The H6 / rabies G gene was ligated into plasmid pRW764.2 in I.

site to form pRW774. This plasmid was used to construct I

recombinant vCP-17 with the insertion locus designated C4. IN

Plasmid pRW764.5 contains a Pvull fragment of canary pox DNA of 850 I

bp with a unique BglII site located asymmetrically within the 400 bp I fragment

from one terminus. Using the same cloning strategy as before I

written, the rabies G gene linked to the H-6 promoter was inserted at this site

to form pRW777. The stable recombinant virus formed was then dissociated

25 ignored vCP-19 and the insertion site was designated C5. IN

Plasmid pRW764.7 contains a 1.2 kbp Pvull fragment with a unique I

BglII site 300 bases from one terminus. The plasmid was digested with BglII I

and blunt-ended with the Klenow fragment of DNA polymerase I. Det

30 blunt-ended 11K-promoted Lac Z genes were inserted to generate plasm I

! 45 DK 175904 B1 mid pRW7778. The stable recombinant virus formed using this plasmid was designated vCP-20 and the insertion site was designated C6.

Example 14- Construction of a fiery creepox virus recombinant. vFP-5 29. expressing the fusion protein for Newcastle disease virus

Plasmid pNDV108, the cDNA clone of the NDV Texas strain fusion gene, consisted of a HpaI cDNA fragment of ca. 3.3 kbp containing the code sequence of the fusion protein as well as additional NDV code sequences cloned into the Scal site of pBR322. The steps for forming the insertion plasmid are described below.

(1) Formation of plasmid pCE11 15

An FPV insertion vector, pCE11, was constructed by inserting polylinkers into the HincII site of pRW731.13 (designated as locus f7). pRW731.13 contains a 5.5 kbp PvuIl fragment of FP-1 DNA. A non-essential locus had previously been defined in the HincII site by constructing the 20 stable recombinant vFP-6, described in Example 6. The polylinks inserted into the HincII site contain sites for the following restriction enzymes: Nrul, EcoRI,

Sacl, Kpnl, Smal, BamHI, Xbal, Hindi, SalI, Accl, Pstl, Sphl, Hindlll and Hpal.

(2) Formation of plasmid pCE19 25

This plasmid is a further modification of pCE11 in which the transcription stop signal ATTTTTNT from vaccinia virus (L. Yuen and B. Moss, J. Virology 60: 320-323 [1986]) (where N in this case is an A) is have been inserted between the Sac1 and EcoRI sites of pCE11, with subsequent loss of the EcoRI site.

30

46 I

DK 175904 B1 I

(3) Insertion of NDV code sequences I

A 1.8 kbp gel purified BamHI fragment, containing all with und I

22 nucleotides from the 5 'end of the fusion protein gene were inserted into I

5 The BamHI site of pUC18 to form pCE13. This plasmid was degraded

with Sal I cutting in the vector 12 bases upstream from the 5 'end of the code sequence.

vensen. The ends were filled with the Klenow fragment of DNA polymerase I, I

and the plasmid was further digested with HndIII, which cuts 18 bases up

downstream from the Sall location. A 146 bp, narrowly-purified Smal-Hind I II fragment, in- I

10 containing the vaccinia virus H promoter previously described in I

preferred embodiments, as well as polylinker sequences at each term

nus, was ligated to the vector and transformed into cells of E. coli. It re- I

suiting plasmid was designated pCE16. IN

To bring the initiating ATG codon of the NDV fusion protein gene on line I

with the 3 'end of the H6 promoter and to replace the 22 nucleotides that I

defects in the NDV-5 'end of pCE16, complementary synthetic I was created

oligonucleotides ending in EcoRV and KpnI sites. Oligonucleotide Sequence- I

20 then was "I

5 'AT C-CGT-TAA-GTT-T GT -AT C-GT A-ATG-GGC-T CC-AGA-T CT-T CT - I

ACC-AGG-ATC-CCG-GTA-C 3 '. IN

The pCE16 construct was then degraded with EcoRV and KpnI. EcoRV-I

25 site is found in the H6 promoter 24 bases upstream of the initiating ATG. IN

The KpnI site is found in the NDV coding sequence 29 bases downstream of the ATG. IN

Oligonucleotides were fused, phosphorylated and ligated to the linear I

plasmid and the resulting DNA was used to transform E.I.

30 coli cells. This plasmid was designated pCE18. IN

DK 175904 B1 47

To insert the NDV coding sequence into an FPV insertion vector, a 1.9 kbp SmaI Hind II II gel purified fragment of pCE18 (intersecting the poly in the linker region) was ligated to a SmaI HindIII fragment of 7, 8 kbp from pCE19, they are described above. The transcription stop signal is found 16 bases downstream 5 of the SmaI site. The resulting plasmid was designated pCE20.

Plasmid pCE20 was used in an in vitro assay for recombination using poultry pox virus FP-1 as a rescue virus. The resulting progeny were plated on CEF monolayers and the plaques subjected to a β-10 galactosidase-coupled protein A immunoassay using a polyclonal anti-NDV chicken serum. Positively colored plaques were selected and subjected to four rounds of plaque purification to obtain a homogeneous population. The recombinant was designated vFP-29.

Example 15 - Construction of avipox virus recombinants. expressing the sheath of the cat alcoprotein from cat leukemia virus fFeLVi

The FeLV env gene contains the sequences encoding the p70 + p15E polypeptide. This gene was initially inserted into the plasmid pSD467vC with the vaccine promoter H6 5 'juxtaposed with the FeLV env gene. The plasmid pSD467vC was derived by first inserting a 1802 bp SalI / HindIII fragment containing the vaccinia hemagglutinin (HA) gene into a pUC18 vector. The location of the HA gene has been previously defined (Shida, Virology 150: 451-462 [1988]).

The majority of the open reading frame encoding the HA gene product was deleted (nucleotide 443 through nucleotide 1311) and a multiple cloning site containing BglII, SmaI, PstI and EagI restriction endonuclease sites was inserted. The resulting pSD467vC plasmid contains flanking vaccinia arms of 442 bp upstream from the multiple cloning site and 491 bp downstream from these restriction sites. These flanking arms allow for genetic material inserted into the multiple cloning gene.

I DK 175904 B1 I

I 48 I

In region to be recombined into the HA region of the Copenhagen strain of I

In vaccinia virus. The resulting recombinant progeny is HA negative. IN

In the H6 promoter was synthesized by fusing four overlapping I

In 5 oligonucleotides which together form the complete sequence described I

In preferred embodiments above. The resulting 132 bp frag- I

Intended contained a BglII restriction site at the 5-end and a SmaI site at the 3-end. IN

I This was inserted into pSD467vC via the BglII and SmaI restriction site. It re- I

In suiting plasmid, pPT15 was designed. The FeLV env gene was inserted into it

In 10 unique Pstl sites in pPT15, located immediately downstream of H6-I

In the promoter. The resulting plasmid was designated pFeLVIA. IN

To construct the FP-1 recombinant, the H6 / FeLV env sequences of I

I 2.4 kbp cut out of pFeLVIA by degradation with BglII and partial degradation

In 15 with Pstl. The BglII site is at the 5 'boundary of the H6 promoter sequence. IN

In the Pstl site, 420 bp is located downstream from translation termination I

In the signal for the envelope glycoprotein's open reading frame. IN

In the 2.4 kbp H6 / FeLV env sequence inserted into pCE11 was digested with I

In 20 BamHI and Pstl. The FP-1 insertion vector, pCE11, was derived from pRW731.13 I

By inserting a multiple cloning site into the non-essential Hinell site. IN

This insertion vector allows development of FP-1 recombinants to contain I

In the same foreign genes in the FP-1 genome locus f7. The recombinant FP-I

In 1 / FeLV insertion plasmid, pFeLVFI was then designated. This con- I

In structure, a perfect ATG does not provide ATG substitution. IN

In order to obtain the perfect ATG: ATG construct, a Nrul / SstII fragment I was added

I in approx. 1.4 kbp derived from the vaccinia virus insertion vector pFeLVIC. Nrul- I

Instead, inside the H6 promoter occurs at a position 24 bp upstream of I

In 30 ATG. The SstII site is located 1.4 kbp downstream of the ATG and 1 kbp upstream

In the current from the translation termination signal. This Nrul / SstII fragment became I

DK 175904 B1 49 ligated to a 9.9 kbp fragment produced by degradation with SstII and by partial degradation with Nrul. This 9.9 kbp fragment contains the 5.5 kbp of FP-1 flanking arms, pUC vector sequences, 1.4 kbp of FeLV sequence corresponding to the downstream portion of the env gene, and the sequence 5 closest to the 5 end ( about 100 bp) of the H6 promoter. The resulting plasmid was designated pFeFLVF2. The ATG for ATG construction was confirmed by nucleotide sequence analysis.

An additional FP-1 insertion vector, pFeLVF3, was derived from pFeLVF210 by removing the FeLV env sequences corresponding to the putative immunosuppressive region (Cianciolo et al., Science 230: 453-455 [1985]) (nucleotide ✓ 1548 to 1628 in the code sequence). This was done by isolating an SstII / PstI fragment (sites described above) of ca. 1 kbp from the vaccinia virus insertion vector pFeLVID. The plasmid pFeLVID is similar to pFeLN / 1 C except that the env sequences corresponding to the immunosuppressive region (nucleotide 1548 to 1628) were deleted by oligonucleotide-directed mutagenesis (Man-decki, Proc. Natl. Acad. Sci. USA 83: 7177 -7181 [1987]). The 1 kbp SstII / PstI fragment lacking nucleotides 1548 to 1628 was inserted into a 10.4 kbp SstII / PstI fragment containing the residual H6 / FeLV env gene derived from 20 pFeLVF2.

The insertion plasmids pFeLVF2 and pFeLVF3 were used in in vitro recombination assays with FP-1 as the rescue virus. Offspring from the recombination were plated on CEF monolayers and recombinant virus selected by plaque hybridization on CEF monolayers. Recombinant progeny, identified by hybridization assays, were selected and subjected to 4 rounds of plaque purification to obtain homogeneous population. An FP-1 recombinant harboring the complete FeLV env gene has been designated vFP-25, and an FP-1 recombinant containing the complete gene lacking the immunosuppressive region was designated vFP-32. Both recombinants are immunoprecipitated using a bovine anti-FeLV polyclonal

50 I

DK 175904 B1 I

serum (Antibodies, Inc., Davis, CA) shown to express the appropriate gene protein

product. Remarkably, these FP-1 recombinants express it

foreign FeLV env gene in the CRFK cell line (ATCC # CCL94) originating in

from cats. IN

For the construction of canary pox (CP) recombinants, a 2.2 kbp fragment I was added

containing the H6 / FeLV env sequences cut from pFeLVF2 at down I

wrestling with Smal and Hpal. The narrow site is on the 5 'boundary of H6-I

promoter sequence. The Hpal site is located 180 bp downstream of the transla I

10, the termination signal for the envelope protein's open reading frame. IN

The 2.2 kbp H6 / FeLV env sequence was inserted into the non-essential EcoRI-I

site in the insertion plasmid pRW764.2 after the EcoRI site was made I

blunt-ended. This insertion vector allows formation of CP-I

Fifteen recombinants contain foreign genes in the C4 locus of the CP genome. It re- I

combining CP insertion plasmid was then designated pFeLVCP2. This one

construction provides a perfect ATG for ATG substitution. IN

The insertion plasmid pFeLVCP2 was used in an in vitro assay for I

20 recombination with CP as the rescue virus. Progeny of the recombinants I

were plated on CEF monolayer and recombinant virus selected by means of I

of a β-galactosidase-coupled protein A immunoassay under an- I

reversal of a bovine anti-FeLV commercial polyclonal serum (Antibodies, I

Inc., Davis, CA). Positively colored plaques were selected and submitted to four I

25 rounds of plaque purification to obtain a homogeneous population. A recom- I

binant expressing the entire FeLV env gene has been designated vCP-36. IN

EXAMPLE 16- Construction of fiery creepox virus recombinant vFP-22.

expressing the Rous-associated virus type 1 (RAV-1) envelope (env) gene 5 The clone penvRVIPT of the RAV-1 envelope gene contains 1.1 kbp of RAV-1 and env DNA coding sequence, cloned into M13mp18 as a KpnI-SacI fragment. This fragment is intact at the 5 'end but lacks part of the 3' sequence and was used in the following operations. A 1.1 kbp gel purified EcoRI-Pstl fragment from penvRVIPT was inserted into the EcoRI and Pstl sites of pUC9 to form pRW756. This plasmid was then digested with KpnI and HindIII, which cut into the vector 59 bases upstream of ATG. A 146 bp KpnI-HindIII fragment containing the vaccinia H6 promoter described above to insert plasmid pCE6 was inserted.

To ensure that the initiating ATG of the RAV env gene was located adjacent to the 3 end of the foreign sequence H6 promoter, two complementary synthetic oligonucleotides were constructed with EcoRV and BanII sites in termini. The oligonucleotide sequence was 5-AT C-CGT-TAA-GTT-T GT-AT C-GTA-ATG-AGG-CG A-GCC-3 '.

20

Plasmid pCE6 was digested with EcoRV cutting in the H6 promoter 24 bases upstream of ATG, and with Ban11 cutting in the RAV env code sequence 7 bases downstream of ATG. The DNA segments were ligated and used to transform cells of E. coli. The resulting plasmid, 25 pCE7, supplied the final construct with the H6 promoter and correct 5 sequence.

The clone mp19env (190) was found to contain the entire RAV-1 env gene by restriction mapping. A 1.9 kbp KpnI-Sacl fragment of 1.9 kbp containing the whole gene was inserted into the KpnI and Sacl sites of pUC18 to form pCE3. This plasmid was digested with HpaI, which cuts 132 bases downstream of the initiating ATG in the coding sequence of RAV-1, and Sac1, which

52 I

DK 175904 B1 I

intersects at the 3 'terminus of the gene. The FPV insertion vector pCE11, previously I

described, was digested with SmaI and Sac1, which cut the plasmid into poly-I

linker region. The hpaI-Sac1 fragment of pCE3 was ligated with pCE11 to I

formation of pCE14. IN

Plasmid pCE7 was then digested with XhoI and Hindill to form an I

332 bp fragment containing the H6 promoter and correct 5 'sequence. IN

Plasmid pCE14 was digested with Hindill, which cut into the polylinker I vector of the vector

region, and Xhol, which cut into the code sequence. This DNA was ligated to Hindill-I

The Xho I fragment obtained from pCE7, forming pCE15 which was the I

final RAV-1 mantle gene construction. IN

This plasmid was used in an in vitro assay for recombination with I

poultry pox FP-1 as a rescue virus. The offspring of the recombination were plated

15 on CEF monolayers and the plaques subjected to β-galactosidase-coupled pro-I

tein-A immunoassay using an anti-RAV-1 polyclonal I

serum. Positively colored plaques were selected and submitted to four laps I

plaque purification to obtain a homogeneous population. The recombinant became I

designated vFP-22. Immunoprecipitation experiments using cell I

Twenty lysates infected with vFP-22 have demonstrated specific precipitation of two proteins I

with apparent molecular weights of 76.5 kD and 30 kD corresponding to Chapter I

the two gene products of the pointer. No precursor gene product was seen. IN

In preliminary experiments, an immune response to RAV-1-I is induced

25 coat gene product in chickens inoculated with vFP-22. IN

EXAMPLE 17 - Construction of avipox virus recombinants. expressing the GP51.30 mantle (env) gene from Bovine Leukemia Virus (BLV) 5 (1) Construction of pBLVFI and pBLVF2

Plasmids pBLVFI and pBLVF2 contain the gp51.30 env gene from BLV. In both plasmids, the BLV env gene is under transcriptional control of the H6 promoter of vaccinia virus and is cloned between flanking arms of 10 poultry pox (locus f7). The nucleotide sequence of the two plasmids is identical except in codon positions 268 and 269. (pBLVFI encodes a protein containing the amino acids Arg-Ser at these two positions, whereas pBLVF2 encodes a protein containing the amino acids Gln-Thr).

15 pBLVFI and pBLVF2 were constructed by the following procedure. Plasmid pNS97-1, a plasmid containing the entire BLV env gene, was cut with BamHI and partially cut with MstII. The 2.3 kbp fragment containing the entire gp51.30 gene was isolated on an agarose gel and the protruding ends filled with E. coli DNA polymerase I (Klenow fragment). Pst I linkers were then ligated to the ends of the fragment, which, after digestion with Pst I, was ligated into the Pst I site of pTP 15 (Example 15). This places the BLV gene next to the Vaccinia H6 promoter. (pTP15 contains the Vaccinia H6 promoter cloned at a non-essential locus of the vaccinia genome).

This plasmid was then cut with EcoRV and partially cut with Avail.

The 5.2 kbp fragment was isolated and the oligonucleotides S'-ATCCGTTAAGTTTGTATCGTAATGCCCAAAGAACGACG-S 'and 5'-GACCGTCGTTCTTTGGGCATTACGATACAAACTTAACGGAT-3' used for recirculation of plasmid. This eliminates unnecessary bases between the BLV gene and the H6 promoter.

!

54 I

DK 175904 B1 I

The resulting plasmid was cut with Pstl and partially cut with Bgltl, and

The 1.7 kbp fragment containing the H6 promoted BLV gene was cloned into I

in the Bam HI-Pst I site of pCE11, the previously described poultry epox virus virus.

sentence vector, using locus f7. This places it H6-I

5 promoted BLV gene between flanking arms of poultry pox. This plasmid

was designated pBLVFI. IN

An identical procedure was used to construct pBLVF2 with sub-I

assuming that an additional in vitro mutagenesis step was performed prior to the H6-I

10 promoted BLV genes were cloned into pCE11. This mutagenesis was carried out

by the following procedure. Plasmid pNS97-1 was cut with Xmal and partial I

cut with Chair. The 5.2 kbp fragment was isolated and the oligonucleotides I

5-CCGGGT CAGACAAACT CCCGT CGCAGCCCTGACCTTAGG-3 'and I

5'-CCTAAGGT CAGGGCTGCG ACGGGAGTTT GT CT GAC-3 'I

15 used to recirculate the plasmid. This alters the nucleotide sequence of I

codons 268 and 269 from CGC-AGT to CAA-ACT. IN

(2) Construction of recombinant viruses I

The plasmids pBLVFI and pBLVF2 were used in an in vitro assay for I

recombination using FP-1 as rescue virus. Recombinant I

offspring were selected by in situ plaque hybridization and when the population at I

this criterion was judged to be clean, the plaques were examined by I

a β-galactosidase protein A immunoassay using an I

Preparation of BLV-gp-specific monoclonal antibody. Both recombinants I

vFP23 and vFP24, formed from respectively. plasmid pBLVFI and pBLVF2, exhibited posi- I

tive staining by the immunoassay, indicating that an immunological I

recognizable glycoprotein was expressed on the surface of the infected cells. IN

The plasmids pBLVK4 and pBLVK6 contain, respectively. The BLV env gp51.30 gene and I

BLV gp51.30-cleavage-less gene. Both genes are cloned into the unique I

DK 175904 B1 55

EcoRI site of pRW764.2 (locus C3) (pRW764.2 is described in Example 13) and is under transcriptional control of the Vaccinia H6 promoter.

The plasmids were obtained by the following procedure: pBLVFI and pBLVF2 were cut with the restriction enzyme HindIII. The oligonucleotide BKL1 (AGCTTGAATTCA) was cloned into this site, thereby forming an EcoRI site 3 'relative to the BLV gene. Since there is also an EcoRI site 5 'relative to the BLV gene, these plasmids (pBLVKI and pBLVK2) were cut with EcoRI and the fragment containing the H6 promoted BLV gene was cloned into the EcoRI site of pRW764. 2nd The resulting plasmids were designated respectively. pBLVK4 and pBLVK6. These plasmids were used in an in vitro assay for recombination with canary pox as rescue virus. Recombinants were selected and purified on the basis of surface expression of the glycoprotein, shown by an immunoassay. The recombinants were designated vCP-27 and vCP-15 28, respectively. plasmids pBLVK4 and pBLVK6.

Poultry pox recombinants vFP-23 and vFP-24 have been inoculated in sheep and cattle by various routes of administration. The animals received two inoculations, the second 45 days after the first. Serum samples were taken 5 weeks after the first inoculation and two weeks after the second inoculation. Antibody to gp51 was measured by a competitive ELISA assay and the titer expressed as the reciprocal of serum dilution, giving a 50% reduction in competition. The results are shown in Table XI.

None of the tested species exhibited a detectable immune response after the first inoculation. Both sheep and cattle showed a significant antibody increase after the second inoculation.

56 I

DK 175904 B1 I

TABLE XI I

Inoculation of sheep and cattle with vFP-23 and vFP-24

5 Animals Vims Dose and route of administration ELISA Titer I

First Second First Second I

j Cattle B56 FP-1 loVlO83 108 + 108 0 0 I

B59 FP-1 ID subcut 0 0 I

10 Get M89 FP-1 0 0 I

M91 FP-1 0 0 I

Cattle B62 vFP-23 108 + 108 1 08 + 108 0 200b I

B63 vFP-23 ID subcut 0 80 I

15 Get M83 vFP-23 0 80 M84 vFP-23 0 500

• M85 vFP-23 0 100 I

Cattle B52 vFP-24 1 08 + 108 1 08 + 108 0 200 I

20 B53 vFP-24 ID subcut 0 60 I

Get M87 vFP-24 0 200 I

M92 vFP-24 0 20 I

M93 vFP-24 0 20 I

25 a Intradermal injections were given at two sites I

b Titer expressed as the reciprocal of the dilution, I

providing 50% competition. IN

Example 18 - Construction of wild crepe pox FP-1 recombinant vFP-I

30 26. expressing infectious-bronchitis-vims-Mass-41-I

the matrix gene I

Plasmid plBVM63 contains an infectious bronchitis virus (IBV) cDNA clone of I

strain Mass-41 matrix gene. An 8 kbp EcoRI fragment of p1BM63 in- I

35 contains the matrix gene with the peplomer gene upstream (51), and further upstream I

there is an EcoRV site. Plasmid pRW715 has an EcoRI coupling sequence which I

connects the two Pvull sites in pUC9. The 8 kbp EcoRI fragment from p1BM63 I

DK 175904 B1 57 was inserted into the EcoRI site of pRW715, thereby forming pRW763. Plasmid j pRW776 was generated for deletion of the 5-site Eco RI site in pRW763. leaving a unique EcoRI site downstream (3 *) of the matrix gene. The isolated linear partial EcoRI degradation product of pRW763 was cut again with RcoRV. The largest fragment was isolated, blunt-ended with the Klenow fragment of DNA polymerase I, and self-ligated to form pRW776. Construction pRW776 has the complete IBV peplomer genes and IBV matrix genes followed by a single EcoRI site.

10 Only the 5 'and 3 ends of the matrix gene of ca. 0.9 kbp has been sequenced. Starting at the translation initiation codon (ATG), the 5 'sequence of the matrix gene contains the following stressed Rsal site: ATGTCCAACGAGACAAATTGTAC. The previously described H6 promoter was linked to the matrix gene with a synthetic oligonucleotide. The synthetic oligonucleotide contained the H6 sequence from its RcoRV site to ATG and into the matrix coding sequence through the first Rsal site. The oligonucleotide was synthesized with BamHI and EcoRI compatible ends for insertion into pUC9, thereby forming pRW772. The EcoRI end is 3 'relative to the Rsal site. Starting at the BamHI-compliant end, with ATG underlined, is the sequence of the double-stranded synthetic oligonucleotide:

GATCGCGATATCCGTTAAGTTTGTATCGTAATGTCCAACGAGACAAATTGTACG

CGCTATAGGCAATTCAAACATAGCATTACAGGTTGCTCTGTTTAACATGCTTAA

The linear partial Rsal degradation product of pRW772 was isolated and cut again with RcoRI. The pRW772 fragment, containing a single cut at the above Rsal site and cut again with EcoRI, was isolated, treated with phosphatase and used as a vector for the pRW776 degradation product below.

30

58 I

DK 175904 B1 I

The isolated linear partial Rsal degradation product of pRW776 was I

cut again with RcoRI. EcoRI is located just after the 3-end of the matrix gene. And I

isolated Rsal-EcoRI fragment of ca. 0.8 kbp, containing matrix I

the code sequence from the above Rsal site, was inserted into the above I

5 pRW772 vector to form pRW783. The complete H6 promoter became I

formed by adding sequences 5 'to the EcoRV site. H6- I

the 5 'end of the promoter was a Hinfl site that was blunt-ended into pUC9's SalI-I

site thereby forming an EcoRI site; 5 'relative to the H6 promoter is I

pUC9 HindIII site. The HindIII EcoRV fragment containing 5 'H6-I

The promoter was inserted between the HindIII and EcoRV sites of pRW783 to I

formation of pRW786. pRW786's EcoRI fragment, containing the full I

constant H6 promoted matrix gene, was blunt-ended with Klenow-I

DNA polymerase I fragment and inserted into the blunt-ended BamHI site of I

pRW731.15 {locus fS) to form pRW789. The pRW731.15 BamHI site is I

15 shows the FP-1 locus used in Example 6 for constructing vFP-8. IN

Plasmid pRW789 was used in the construction of vFP-26. Recombinant I

plaques were selected and treated by in situ plaque hybridization. IN

20 Initial tests induced an immune response to IBV-I

the matrix protein in chickens inoculated with vFP-26. IN

EXAMPLE 19 - Construction of fiery creepox virus FP-1 recombinant vFP-I

31. expressing infectious-bronchitis virus flBV) * I

25 peplomer I

Infectious bronchitis virus (IBV) Mass-41 cDNA clone pIBVM 63 and its I

subclone pRW776 has been described in the construction of vFP-26 in Example I

pel 18. Subclone pRW776 contains the 4 kbp IBV peplomer gene followed by I

30 of the matrix gene with a unique EcoRI site at the 3 'end. Only the 5 'and 3' ends of I

The IBV peplomer gene of ca. 4 kbp has been sequenced. A unique Xbal site I

DK 175904 B1 59 separates the two genes. The 5'-end of the peplomer gene starting at the translation initiation codon (ATG) contains the following stressed Rsal site: ATGTTGGTAACACCTCTTTTACTAGTGACTCTTTTGTGTGTAC. The previously described H6 promoter was associated with the peplomer gene by a synthetic oligonucleotide. The synthetic oligonucleotide contains the H6 promoter sequence from the Nrul site to ATG and into the peplomer coding sequence through the first Rsal site. The oligonucleotide was synthesized with BamHI and EcoRI compatible ends for insertion into pUC9, thereby forming pRW768. The EcoRI end is 3 'relative to the Rsal site. Starting at the BamHI-compatible end, with ATG underlined, is the sequence of the double-stranded synthetic oligonucleotide:

GATCTCGCGATATCCGTTAAGTTTGTATCGTAATGTTGGTAACACCTCTT

AGCGCTATAGGCAATTCAAACATAGCATTACAACCATTGTGGAGAA

15 TTACTAGTGACTCTTTTGTGTGTACG

AATGATCACTGAGGAAACACACATGCTTAA

The isolated linear partial Rsal degradation product of pRW768 was cut again with EcoRI. The pRW768 fragment containing a single cut at the above Rsal site and cut again with EcoRI was isolated, treated with phosphatase and used as a vector for the pRW776 degradation product below.

The isolated linear partial Rsal degradation product of pRW776 was cut again with RcoRI. the 5 kbp pRW776 fragment containing a single cut at the above Rsal site to the EcoRI site was isolated; the fragment contains IBV sequences from the above peplomer-Rsal site to the EcoRI site at the 3-end of the matrix gene. Insertion of the pRW776 fragment into the above pRW768 vector produced pRW788. The matrix gene was removed at the Xba site highlighted above. The 5 'H6 promoter was inserted into the Nrul site by insertion of the blunt-ended pRW788-Nrul-Bbal fragment.

I DK 175904 B1 I

I 60 I

Intended at 5 kbp in the blunt-ended pRW760 Nrul-BamHI vector for production.

In bringing the pRW790. The vector pRW760 is described in Example 11; card I

As described, it is a Vaccinia H6 promoted influenza nucleoprotein flanked I

I of the non-essential FP-1 locus f7. The pRW760 vector was prepared by I

In 5, remove the 3 'Ηδ sequences from the Nrul site to the end of the nucleoprotein at I

In BamHI. pRW790 is H6-promoted IBV peplomer in the HincII site of I

In pRW731.13. Recombination of the donor plasmid pRW790 with FP-1 re-I

You cited in vFP-31. Immunoprecipitation experiments using CEF-I

In lysates prepared from cells infected with vFP-31, specific precipitator I has been shown

In 10 µg of a small amount of precursor protein with a molecular weight of approx. 180 kD I

In and out of the 90 kD cleavage products. IN

In Example 20 - Construction of fiery creepox virus FP-1 recombinant vFP-I

I 30. expressing herpes simplex virus qD I

I 15 I

In Herpes simplex virus (HSV) type 1 strain KOS glycoprotein D gene (gD) I

I was cloned into the pUC9 BamHI site as a 5 'BamHI coupled Hpall to 3' I

In BamHI, the Nrul fragment is linked; with the 5-end adjacent to pUC9's Pstl site. 5'- I.

In the sequence of HSV-gD, beginning with the translation initiation codon I

I 20 (ATG), contains the following underlined NcoI site: I

I ATGGGGGGGGCTGCCGCCAGGTTGGGGGCCGTGATTTTGTTTGTCGTCATAGTGGG I

In cctccatgg. The previously described Vaccinia H6 promoter was linked I

I with the HSV gD gene at a synthetic oligonucleotide. The synthetic oligonucleotide

In leotide, the 3 'portion of the H6 promoter from Nrul to ATG contains into gD code I

In the sequence to the Ncol site. The oligonucleotide was synthesized with a 5'-PstI-I

At compatible end. The gD clone in pUC9 was cut with Pst I and Nco I, and 5'-I

In the HSV sequence removed for replacement with the synthetic oligonucleotide, I

In which pRW787 was formed. The sequence of the double stranded synthetic I

In oligonucleotide:

I 30 I

DK 175904 B1 61 GTCGCGATATCCGTTAAGTTTGTATCGTAATGGGAGGTGCCG-ACGTCAGCGCTATAGGCAATTCAAACATAGCATTACCCTCCACGGC -

CAGCTAGATTAGGTGCTGTTATTTTATTTGTAGTTATAGTAGGACTC 5 GTCGATCTAATCCACGACAATAAAATAAACATCAATATCATCCTGAGGTAC

Degradation of pRW787 with Nrul and BamHI produces a fragment of ca.

1.3 kbp containing the 3'-H6 promoter from the Nrul site, through the HSV-gD coding sequence to the BamHI site. The pRW760 vector, cut with Nrul and 10 BamHI, is described in Example 11. Insertion of the 1.3 kbp fragment into the pRW760 vector led to pRW791. The pRW791 vector contains the complete vaccinia H6 promoted HSV gD gene in the non-essential FP-1 HincII site of pRW731.13 (locus f7).

Recombination of the donor plasmid pRW791 with FP-1 resulted in vFP-30. Surface expression of the glycoprotein was detected in recombinant plaques using a β-galactosidase-coupled protein-A immunoassay and HSV-1-specific sera.

Example 21 - Use of entomopox promoters to regulate foreign gene expression in pox virus vectors (a) Background. Insect pox viruses (entomopox) are currently classified into the subfamily Entomopoxvirinae, further subdivided into three genera '25 (A, B and C) corresponding to entomopoxviruses isolated from the insect sequences, respectively. Col- eoptera, Lepidoptera and Orthoptera. Entomopox viruses have a narrow host range in nature and are not known to replicate in any vertebrate species.

The Entomopox virus used in these experiments was initially isolated from infected 30 larvae of Amsacta moorei (Lepidoptera: arctildae) from India. (Roberts

62 I

DK 175904 B1 I

and Granados, J. Invertebr. Pathol. 12: 141-143 [1968]). The virus, designated I

AmEPV, is the type species for genus B. I

Wild type AmEPV was obtained from Dr. R. Granados {Boyce Thompson Institute, I

5 Cornell University) as infectious hemolymph from infected larvae of Estig- I

mene acrea. The virus was found to replicate in an invertebrate cell line, IPLB-I

LD652Y, derived from ovarian tissue of Lymantria dispar (gypsy moth) (described in

by Goodwin et al., In Vitro 14: 485-494 [1978]). The cells were grown in IPL-528-1

media supplemented with 4% fetal calf and 4% chicken sera at 28 ° C. IN

10 I

The wild type virus was plaque tested on LD652Y cells and one plaque designated V1, I

was selected for further experimentation. This isolate forms late in the infection cycle

numerous occlusion bodies (OB) in the cytoplasm of the infi

cells. IN

15 I

(b) Promoter identification. The identification and mapping of an AmEPV-I

promoter was obtained as follows. Total RNA from Late Infected I

LD652Y cells (48 hours after infection) were isolated and used to prepare I

32P-labeled first-strand cDNA. The cDNA was then used for probe I

20 examination of imprints containing restriction degradation products of I

AmEPV genome. This Southern blot revealed a strong signal on Clal-I

2.6 kbp fragment, indicating that the fragment encoded a strong I

expressed gene. The fragment was cloned into a plasmid vector and its DNA-I

sequence determined. IN

25 I

Analysis of the sequence data revealed an open reading frame capable of encoding I

! for a 42 kD polypeptide. In vitro translation of total RNA 48 hours after I

infection and separation of the products by SDS-PAGE revealed a polypeptide

time of approx. 42 kD. IN

30 I

(C) Construction of a recombinant vaccinia virus expressing a foreign gene under the control of the entomopox promoter. To determine whether an entomopox promoter would function in a vertebrate poxvirus system, the following plasmid was constructed. Chemically, an oligonucleotide 5 containing the 107 bases located in the 5 'direction of the 42K gene translation start signal (hereinafter referred to as the AmEPV-42K promoter) was flanked by a BglII site at the 5' end and the first 14 bases of the region encoding hepatitis B virus pre-S2 ending in an EcoRI site at the 3 'end. The AmEPV-42K promoter sequence is described below.

10

TCAAAAAAATATAAATGATTCACCATC TGATAGAAAAAAAATTTATTGGGAAGA ATATGATAATATTTTGGGATTTCAAA AT TGAAAATATATAATTACAATATAAAATG

15

The AmpEPV-42K promoter was ligated to the hepatitis B virus surface antigen (HBVsAg) as follows. A pUC plasmid containing the hepatitis B surface antigen and the pre-S2 coding region (type ayw described by Galibert et al., Nature 281: 646-650 [1979]) was constructed flanked by vaccinia virus arms in the essential region of the vaccinia virus genome encoding the hemagglutinin (HA) molecule (HA arms described in Example 15; HA region described by Shida, Virology 150: 451-462 [1962]). The oligonucleotide described above was inserted into this plasmid using the unique Eco RI site in the HBVsAg coding region and a unique BglII site in the HA-25 vaccinia arm. The resulting recombinant vaccinia virus was designated vP547.

Expression of the inserted HBVsAg coding sequence under the control of the entomopox 42K pnomotor was confirmed using an immunoassay. Equivalent cultures of the mammalian cell line BSC-40 were infected with parental vaccinia virus or recombinant vP547. 24 hours after

64 I

DK 175904 B1 I

infection, the cells were lysed and the lysate in serial dilutions applied to a nitro cell I

lulosemembran. The membrane was first incubated with a goat anti-HBV-I

serum and then with 125 I Protein A. After washing, the membrane was exposed

erected on an x-ray film. Positive signals were detected in cultures infected I

5 with vP547, but not in cultures infected with parental virus, indicating I

recognition of the AmEPV-42K promoter of vaccinia virus in mammalian cells. IN

These results were verified using an Ausria test (see I

Example 1 for details) for detection of HBVsAg in infected mammalian cells. IN

10 Vaccinia virus recombinants containing the HBsAg gene linked to AmEPV-I

The 42K promoter or vaccinia virus H6 promoter was used for infection I

of BSC-40 cells, and the expression level of sAg tested by Ausria-I

testing method. As seen in Table XII, the data show that the expression I

the level of HBsAg using the 42K promoter was significant. IN

15 I

TABLE XII I

Expression of HBVsAo in recombinant vaccinia virus I

Recombinant virus Promoter Ausria P / N ratio I

vP410 Control 1.0 I

vP481 H6 24.3 I

VP547 42K 44.9 I

25 I

Further experiments were performed to determine the temporal factor at I

the regulation of the AmEPV-42K promoter in a vertebrate poxvirus background. IN

Equivalent cultures of BSC-40 cells were infected with vP547 in presence I

or the absence of 40 µg / ml cytosine arabinoside, which is a DNA replication

30 cation inhibitor, which therefore blocks late viral transcription. Expressive I

Levels 24 hours after infection were tested by an Ausria test. Result I

DK 175904 B1 65 indicated that the 42K promoter was recognized as an early promoter in a vaccinia virus replication system.

Note that the use of the AmEPV-42K promoter to express foreign 5 genes in a mammalian system is clearly different from the use of the Autographa califorinica NPV polyhedrin promoter for gene expression in invertebrate systems (Luckow and Summers, Biotechnology 6: 47-55 [ 1988]). The polyhedrin promoter is not recognized by the transcriptional apparatus in mammalian cells (Tjla et al., Virology 125: 107-117 [1983]). The use of the AmEPV-42K promoter in 10 mammalian cells represents the first time an insect virus promoter has been used for the expression of foreign genes in a non-insect viral vector in non-invertebrate cells.

To determine whether avipoxviruses would also recognize the 42K entomopox-15 promoter, the following experiments were performed. Identical cultures of CEF cells were inoculated at 10 pfu cell of either poultry epoxic virus, canary epoxic virus or vaccinia virus and simultaneously transfected with 25 µg of one of the following plasmids: 1) plasmid 42K.17 containing the HBV pre-S2 + sAg coding sequence linked to the 42K promoter or 2) plasmid pMP15.spsP containing the 20 identical HBVsAg coding sequence linked to the previously described vaccinia virus H6 promoter. After 24 hours, the cultures were defeated, the cells lysed, and the lysate assayed for the presence of HBVsAg using an Ausria assay. (see Example 1).

The results shown in Table XIII must be viewed qualitatively. They indicate that both the poultry pox and canary epox transcription apparatus are able to recognize the 42K promoter and allow transcription of the linked HBVsAg coding sequence. Although the expression levels are lower than those obtained with the vaccinia virus H6 promoter, the levels are well above the background levels obtained with the negative controls.

I DK 175904 B1 I

I 66 I

I TABLE XIII I

In Recognition of the 42K EntomoDox Dromotor of Avipoxviruses I

I 5 Virus Promoter P / N ratio I

I Poultry Box 42K 39.1 I

I H6 356.8 I

I 10 Canary Pox 42K 90.2 I

I H6 222.2 I

I Vaccinia 42K 369.4 I

I H6 366.9 I

I 15 I

I None 42K 7.8 I

I No H6 7.2 I

In Vaccinia 7.2 I

I 20 I

In Example 22 - Immunization with VCP-16 to protect mice against I

In challenge with live rabies virus

In Groups of twenty mice, 4 to 6 weeks old, were inoculated under the foot with 50 I

In 25 to 100 µΙ of a series of dilutions of either one or the other of two re · I

In combinants: (a) vFP-6, the poultry pox rabies recombinant described in Eq.

In Example 6, and (b) vCP-16, the canary pox rabies recombinant described in Eq.

In Sample 13. I

For 30 days, 14 mice from each group were killed and serum collected. IN

In the Anti-rabies titer in the serum was calculated using an RFFI test I

I (described in Example 7). The remaining 10 mice in each group were excised

In required by intracerebral inoculation with the CVS strain of rabies virus an- I

In Reverse Example 7. Each mouse received 30 μΙ, corresponding to 16 mouse LD 50. After I

For 35 28 days, surviving mice were assessed and the protective dose 50 (PD50) I

In calculated, the results are shown in Table XIV. IN

DK 175904 B1 67

The level of protection of mice found by inoculation of vFP-6 confirms the result found after inoculation of the poultry pox recombinant vFP-3 discussed in Example 7. The level of protection obtained by inoculating vCP-5 16 is significantly higher. On the basis of the calculated PDso, the canary pox rabies recombinant is 100 times more effective at protecting against rabies challenge than the poultry pox rabies recombinant.

! TABLE XIV

10

Protective immunity against challenge with rabies virus triggered by two avipox rabies recombinants

Poultry pox vFP-6 Canary pox vCP-16 15

Inoculum RFFI Exercise Inoculum RFFI Exercise Dose_titer_relation_dose_titer_relation_ 7.5a 2.3b 7/10. 6.5 2.5 10/10 20 5.5 1.8 5/10 4.5 1.9 8/10 3.5 0.7 0/10 2.5 1.1 1/10 1.5 0.6 0 / 10 0.5 0.4 0/10 Ϊ PDso = 6.17 1 PD50 = 4.18 a Virus titers expressed as log «) TCID50.

25 b RFFI titers expressed as logio of highest serum dilution giving over 50% reduction in the number of fluorescent wells in an RFFI test.

I DK 175904 B1 I

I 68 I

EXAMPLE 23 - Use of fiery creepox promoter elements for expression I

In the presence of alien spirits

I I. Identification of the fiery crepe pox. which encodes a gene product of 25.8 I

I 5 kiloDalton (kDI I

In Visualization of Protein Species Present in Poultry Pox (FP-1), CEF-I Infected

In lysates, by staining SDS-polyacrylamide gels with Coomassie blue, I

You blurred a large amount of species with an apparent mole

In 10 cooling weights of 25.8 kD. This protein was not present in uninfected cell lysates. IN

In Pulse experiments using 35S-methionine for radiolabelling I

In synthesized proteins at specific times after infection, visible I

You did again the abundance of the FP-1-induced protein and showed that it

I is synthesized from 6 to 54 hours after infection. At its peak, this makes up you

In FP-1 protein of 25.8 kD approx. 5% to 10% of total protein present in the cell lysate. IN

The abundant presence of the FP-1-induced 25.8 kD protein suggested that I

The gene encoding this gene product is regulated by a strong FP-1- I

In promoter element. In order to locate this promoter element for the purpose I

In 20 more applications in the expression of foreign genes in pox virus I

In recombinants, a polysome preparation was obtained from FP-1-infected CEF-I

In cells 54 hours after infection. RNA was isolated from this polysome I

preparation and produced when used to program an in vitro rabbit I

In reticulocyte translation system, preferably the FP-1 protein of 25.8 kD. IN

I 25 I

The Polysome RNA was also used as a template for the synthesis of I

first-strand cDNA using oligo (dT) 12-18 as an initiator. IN

The first-strand cDNA was used as a hybridization probe at South I

In EM blot analyzes with degradation products of the FP-1 genome. Results I

In 30 from these hybridization assays, the gene encoding 25.8 kD-I indicated

In the protein, was contained in a HindIII fragment of 10.5 kbp. This genomic I

DK 175904 B1 69

HindIII fragment was then isolated and ligated into a commercial vector, pBS (Stratagene, La Jolls, CA), and the clone was designated pFP23K-1. Further hybridization assays using the first-strand cDNA for probing degradation products of pFP23k-1 located the 25.8 kD gene 5 to a 3.2 kbp EcoRV sub-fragment. The fragment was subcloned into pBS and designated pFP23k-2.

Ca. 2.4 kbp of this FP-1 EcoRV fragment has been sequenced by the Sanger dideoxy chain termination method (Sanger et al., Proc. Natl. Acad. Sci.

USA 74: 5463-5467 [1977]). Analysis of the sequence reveals an open reading frame (ORF) encoding a gene product with a molecular weight of 25.8 kD. In vitro transcription of this ORF by bacteriophage T7 polymerase (Stratagene, La Jolla, CA) in a pBS vector produces an RNA species which, when used to program an in vitro rabbit reticulocyte translation system (Promega Biotec, Madison, W1), gives a polypeptide species with an apparent molecular weight of 25.8 kD. In an SDS-polyacrylamide gel, this polypeptide moves together with the large amount of 25.8 kD protein observed in lysates from FP-1-infected CEF cells. The results suggest that this is the gene encoding the abundant 25.8 kD FP-1 induced gene product.

II. Use of the upstream promoter elements of the 25.8 kD FP-1 gene to express the cat leukemia virus (FeLV) env gene in FP-1 and vaccinia recombinants.

25

A 270 bp EcoRV / EcoRI fragment containing the regulatory region (FP25.8K promoter) of the 28.5 kD FP-1 gene and 21 bp of the 25.8 kD gene coding sequence was isolated from pFP23k-2. Below is shown the nucleotide sequence of the FP25.8K promoter region used to obtain pFeLV25.8F130 and pFeLV25.81A. This 270 nucleotide sequence amounts to 249 nucleotides

I DK 175904 B1 I

I I

I of the region upstream of the initiation codon (ATG) of the 25.8 kD gene product I

I and the first 21 bp of the code sequence. IN

I 5'-GATATCCCCATCTCTCCAGAACAGCAGCATAGTGTTAGGACAATCATCTAA-I

I TGCAATATCATATATGAATCTCACTCCGATAGGATACTTACCACAGCTATTATA-I

I CCTTAATGTATGTTCTATATATTTAAAAACAGAAACAAACGGCTATAA6TTTAT- I

I ATGATGTCTATATTATAGTGAGTATATTATAAGTATGCGGGAATATCTTTGATT- I

I TAACAGCGTACGATTCGTGATAAGTAAATATAGGCAATGGATAGCATAAATGAA- I

In TTC-3 'I

I 10 I

This fragment was blunt-ended and then inserted into a Narrow-degraded I

In FP-1 insertion vector (pFeLVFI, see Example 15) containing FeLV-I

In the env sequences. This insertion vector allowed recombination with I

In the f7 locus of the FP-1 genome. Insertion of the FP25.8K promoter upstream

In 15 sequences 5 'relative to the FeLV env gene, and with the correct orientation, I

You were confirmed by sequence analysis. This insert does not provide an exact

In substitution of ATG with ATG, but the ATG of the 25.8 kD gene is out of frame I

With the FeLV env ATGet, no fusion protein is formed. FP-1- I

In the insertion plasmid containing the FP25.8KD promoter upstream of I

In the 20 FeLV env gene, pFeLV25.8F1 was designated. IN

I A similar construct was prepared using vaccinia virus I

In the insertion vector, pFeLVIA, harboring the FeLV gene (see Example 15). H6- I

In the promoter, pFeLVIA was removed by degradation with BglII and SmaI. IN

After the BglII restriction site was blunt-ended, the blunt-ended I

In 270 bp EcoRV / EcoRI fragment containing the FP25.8K promoter inserted I

In juxtaposition 5 'to the FeLV env gene. This construction was confirmed in

I by sequence analysis. There is also no exact substitution of ATG with I

I ATG in this recombinant, but the ATGet of the 25.8 kD gene is not in frame I

In 30 with the ATGet of the FeLV gene. Vaccinia (Copenhagen strain) insertion I

The vector, harboring the upstream region of the 25.8 kD gene parallel to 5 'relative to the FeLV gene, was designated pFeLV25.81 A.

The insertion plasmids pFeLV25.8F1 and pFeLV25.81A were used in in vitro recombination with FP-1 (pFeLV25.8F1) and the Copenhagen strain of vaccinia virus (pFeLV25.81A) as the rescue viruses. The progeny of the recombination were plated on appropriate cell monolayers and recombinant virus selected by a β-galactosidase-coupled protein-A immunoassay and a bovine anti-FeLV serum (Antibodies, Inc., Davis, CA). Preliminary results suggest that the FP25.8K promoter may regulate the expression of foreign genes in pox virus recombinants.

Example 24 - Security and efficacy of vFP-6 and vCP-16 in poultry 15

The two avipox recombinants, vFP-6 and vCP-16 (described in Examples 6 and 13), were inoculated into 18-day-old chickens, 1-day-old chickens and 28-day-old chicks, and the response of the birds was evaluated by three criteria: 1) effects of vaccination on hatching ability, vaccination reactions and mortality 2) induced immune response to the rabies glycoprotein, and 3) induced immune response to poultry pox antigens. The experiments performed are described below.

A. Securities testing. Groups of twenty 18-day-old fetuses were inoculated into the allantoic cavity with 3.0 or 4.0 log-10 TCID50 of either vFP-6 or vCP-16. After hatching, the chickens were observed for 14 days, at which time they each received blood and sera were collected. The two recombinants inoculated into the chicken embryos had no effect on the hatching ability of the eggs, and the chicks remained healthy during the 14-day observation period.

72 I

DK 175904 B1 I

Groups of 10 SPF 1 day old chickens were given intramuscular administration I

inoculated with 3.0 logio TCID 50 of each of the recombinants. The chickens became you

observed for 28 days and serum samples collected 14 and 28 days after in- I

inoculate. No vaccination reaction was seen at the inoculation site with no-I

5 of the recombinants and the chicks remained healthy for 28 days I

long observation period. IN

Groups of ten 28-day-old chickens were inoculated with each of the recombinations

binary viruses, receiving either 3.0 logs of TCID 50 by intramuscular injection

10 or 3.0 logio TCID 50 by cutaneous administration (wing membrane). Chickens I

was observed for 28 days and serum samples collected 14 and 28 days after rno-I

kulering. No reaction was seen after intramuscular inoculation with any I

of the recombinants. Cutaneous inoculation resulted in a very small vaccine

reaction to poultry pox with heterogeneous size lesions. IN

Canary pox inoculation led to the formation of a normal cutaneous lesion on the inoculum

kuleringsstedet. All lesions were in decline at the end of the trial. IN

B. Immune Response. The RFFI test described in Example 7 was used for I

assessment of antibody levels against the rabies glycoprotein. For each group I

20, the results were expressed with the geometric mean titer of the individual I

serum converted to International Units (IU) according to a standard serum that I

contained 23.4 IU. The minimum positivity level was set to one IU and became I

used to determine% positive birds. Antibodies to the avipox viruses were I

tested by an ELISA method using the poultry pox virus strain as an I

25 antigen. Each serum sample was diluted 1/20 and 1/80. An I was constructed

standard curve using positive and negative sera. Minimum I

the positivity level was calculated with the mean of the different value I

are of the negative sera added with two standard deviations. IN

The results of serological studies are shown in Table XV for vFP-6 and ta-I

call XVI for vCP-16. IN

DK 175904 B1 73

A limited serologic response was observed for both rabies and poultry pox antigens with fetuses inoculated with either vFP-6 or vCP-16. The poultry epox vector induced a serological response to both anti-5 genes in a greater number of birds than was the case for canary epox, but the response was still heterogeneous.

1 day old chickens inoculated with vFP-6 had a good serological response, with all birds seropositive to rabies and poultry pox antigens 10 28 days after inoculation. The response to inoculation with vCP-16 was much lower, with 40% of birds seropositive to rabies glycoprotein on day 28 and 10% seropositive to avipox antigens.

! 28 day old chickens inoculated intramuscularly with vFP-6 showed 100% in 15 seroconversion for both antigens 14 days after inoculation. Although the majority of birds also seroconverted after cutaneous inoculation, the titers obtained were lower for both rabies and avipox antigens. As before, chickens, inoculated by both intramuscular and subcutaneous route with vCP-16, exhibited a varying response with a maximum of 70% seroconversion against 20 rabies by intramuscular inoculation. The low seroconversion level of avipox antigens after canary pox inoculation possibly reflects the degree of serological kinship between the viruses.

The results indicate that both vFP-6 and vCP-16 are safe to inoculate in chickens of different ages. The poultry epox vector vFP-6 seems more efficient for inf; inducing an immune response in chickens. However, it is significant that both! recombinant avipox viruses, poultry pox and canary epoxis. have been shown to be useful for immunization in ovum.

DK 175904 B1 I

Q) I

>

jh

w vP

O VO> O os θ 'O' O 'θ' ^ H

Ω. o 'o' o 'O O O O o'

X. o CD O O O O O O

O S 'lO IV- T- T- T- t- CO

£ i § I

«£ i I

s ΰ I

Φ ® in o o ti- rv. g T- ^ I

- * ^ CNOJ oco T-pr σ> E? 50 P 1- T- 1- CN ro.

, ο 2 o * o "o * o" o '° o ~ ° I

i_ i— tu ω

D 3 = _ H

CO 2

^ i ^ I

-) £ c C Φ

- <(φ O)> 5 v? > 5's I

^ o OO O 'O' O 'o' vo CO O ^ o'o'S'OOOOS '

n * «" pinOOOOOOO

Q. 9 "S 't— COO) T-r-T-T-CD

> 1 I

CO) I

ω ιο JH I

o You are

> ^ I

5 8 K -55 I

S Qj ^ 5 co -4- I

CD 7 PCNI'-COCMI'-f'-CO10

<® Έ Ο * °° - T- * CO csi T- * o 'I

H s I

CO

L_

^ I

Ο σ>

Q! _ · - I

§ "I

b t-i a) f ® 3 «- T-

«= 5 o ® + + ^ ° o ^ oo -« tco I

> t0 I— .— CO CO 1- CM T- CM 1- CN

Ω I

(A I

c

° ^ (rt .. 8 I

a) .12 Q

* - (Λ == I

Y Ο Ο · ί μ n m

«Ο lL ο Ο O O O

σ ο Ο Μ

C

3 Ε - Ε - φ −ε φ t φ

Ε ml ΕI Ε I

Φ 3 Φ 3 Φ Η Ο) t _Χ Ο) .X Ο)

Φ Φ ® σ> 3 Φ Φ 3 Φ Φ I

q_ 0) Ο) 3> c Ο) Φ) c Ο) Φ) I

ο ι-to c o c c φ ^ croc y · ti) 73 = ro ro = -ora = ό ro

ζ Ooo >> ^ t: >> co? >> C03 I

(5 ILT- ^ r.E ΪΝΟ I

m o in o m I

x- t- CM CN H

DK 175904 B1 <0> <0

O vflvP Vp vPsP vPvP

U 0 ^ 0 ^ .o 0 ^ 0 ^ 0 ^ 0 ^

X «LO LO o ^ O OO OO

O o '· CM N Or- COCO CO r- Q.

0> -2 Q

2 <0 O.

10 ro ro

0) '✓S

g ED

OJ COO) SOI CO r- T- T- cn 2 co lo cm lo o co h- co £ 12 oooo oo oo> ♦ - L- 2 o 'o' o 'o' o 'o' o "o"

- CD

* - 5 =

<1) Oh

σ I I 3 1 <s or co

CO 'm3 -sP vg v °> P

T— ^ 2 wO vO 0s * 0s * 0s · 0s * 0s

• * J5. ο σ ^ ο ^ ΟΟ OO OO

CL C S 'O CO τ- h- CO τ- ^ & W o Γ 1-

i 9 »S

η «T

> o -92 3 5c S -Q - ^ o ro o «io« S Cl) ir ^ UJ - 32 05 CO -r- t- 1 5 σ! 2 T- i- t -__ CN CO CN CO Ί- <ch 2 o 'o "o' o 'o' o 'o' o 'I- .32 2 lo O) Ο 1— c Q CD · £ = ^ sh | 5" ro 1-2 ^ + +' i co - ^ - 00 co

-X .b 00 CO τ- C \ l T- CN t- CM

• ro

Q

CO

c o ^

Cl «S

5β w O.

Φ O - / "'l Ο λ - <i · co r> co

-X '-'μΙΟΟΟ Ο O

σ ^ o o c

E

E _ro -c ro t: ω

E o J1 E j $ E

ro "^ 3 to 3 to 05 CO) O) <D 2. ® S 3 0) 0) ¾ 0) 0) o. 0) 0) O) z; c Ο) σ> ^ □) σ>« _ o 2. ro r σι tc to tc <oc §- T3 ΐ ro ro = Ό ro ^ Ό ro ^ o co> * oo -a co "3 CD u_ -c- ^ cn.E ϊ (μ o

to 0 10 0 LO

t— t— CM CM

DK 175904 B1 I

76 I

Example 25 - Security and immunogenicity of vFP-6 inoculation in I

smallorise I

Two groups of three piglets were inoculated with the recombinant vFP-6 at I

5 one of two routes of administration:

a) three animals received 8.1 log ™ TCID50 by intramuscular inoculation, and I

b) three animals received the same dose by oral inoculation. IN

All animals received blood at weekly intervals and received booster I

10 inoculation of the same dose by the same route of administration on day 35. I

The piglets were observed daily for clinical signs. Sera was tested for I

anti-poultry pox antibodies by an ELISA assay and a serum I

neutralization testing. Rabies antibodies were tested by an RFFI-I

testing. IN

15 I

All piglets remained healthy and no lesions were observed after inoculation

kulering. Temperature curves were normal without any apparent difference

between inoculated and uninoculated animals. IN

20 Pigs inoculated by intramuscular as well as oral route of administration

direct a serological response to poultry pox antigens as measured by ELISA and I

Serum-neutralization. A secondary response was evident after the booster I

inoculation (results not shown). All piglets also developed an im

monologic response to rabies glycoprotein as measured by an RFFI-I

25 testing, and a booster effect is evident in both routes of administration. IN

These results are shown in Table XVII. IN

The results indicate that inoculation of a poultry pox / rabies recombinant is I

harmless in weaners and that the recombinant is capable of generating a sign i- I

30 immune response to the rabies glycoprotein by oral or intramuscular I

inoculation. IN

DK 175904 B1 77

TABLE XVII

Rabies Glvcoprotein Antibody Formed in Small Theory Inoculated with vFP-6 5

Intramuscular 985 2.5 2.7 2.6 2.4 3 3 10 986 2.2 2.0 2.1 2.3 3 3 987 3 2 2.1 2 3 3

Oral 988 2.9 2.4 2.2 2.4 2.7 2.5 989 2.8 2 1.7 1.8 2.4 2.5 15 a Titer expressed as log10 of highest serum dilution yielding over 50 % reduction in the number of fluorescent wells in an RFFI test. b The animals received the second inoculation on day 35.

20

Claims (9)

A recombinant avipox virus, characterized in that it contains DNA I5 from a non-avipox source encoding an antigen of a vertebrate pathogen and is ligated to a promoter for expression of the DNA, wherein said DNA and H promoter is inserted into a non-essential region of the avipox genome. IN The virus of claim 1, wherein said promoter is a vaccinia promoter, an entomopox promoter or an avipox promoter. IN The virus according to claim 1, wherein said DNA encodes an antigen of a mammalian pathogen, in particular an antigen selected from rabies antigen, rabies G anti-I gene, gp51.30 coat antigen from bovine leukemia virus, FeLV envelope antigen from I cat leukemia virus and glycoprotein D antigen from herpes simplex virus. IN The virus of claim 1, wherein said DNA encodes an antigen selected for 15 from avian influenza hemagglutinin antigen, a fusion protein antigen of Newcastle disease virus, a RAV-1 envelope antigen of Rous-associated virus, and nucleoprotein antigen. of avian influenza virus, a matrix antigen of the infectious branchitis virus and peplomer antigen of the infectious bronchitis virus. IN The virus according to any one of claims 1-4 for use in the manufacture of a medicament for vertebrates. IN Use of a virus according to any one of claims 1-4 in the manufacture of a medicament for treating mammals for an infection with a mammalian pathogen. H Use according to claim 6 wherein the mammalian pathogen is selected from rabies virus, bovine leukemia virus, cat leukemia virus and herpes simplex virus. In DK 175904 B1 Use of a virus according to any one of claims 1-4 in the manufacture of a medicament for treating birds for an infection with a bird pathogen. Use according to claim 8 wherein the bird pathogen is selected from avian influenza virus, Newcastle disease virus, Rous-associated virus and infectious bronchitis virus *