JP3348156B2 - Recombinant Avipox virus - Google Patents

Description

DETAILED DESCRIPTION OF THE INVENTION This application is filed with U.S. Patent Application No. 186,05 filed April 25, 1988.
No. 4 CIP application, which was further filed October 2, 1987
CIP application of U.S. Patent Application No. 110,335 filed on day 0,
This further applies to U.S. Patent Application No. 090, filed August 28, 1987.
No. 711 CIP application.

The present invention relates to a synthetic recombinant avipox virus (avipox).
virus) to elicit an immune response in vertebrates, including non-avian vertebrates. More particularly, the present invention relates to the use of vertebrates, particularly mammals, by inoculating vertebrates with a synthetic recombinant avipoxvirus containing DNA encoding and expressing an antigenic determinant of a vertebrate pathogen. Methods for eliciting an immunological response to a pathogen, and vaccines comprising such modified avipoxviruses. The invention further relates to modified avipoxviruses, methods for their production and use, DNA sequences produced or involved in the production of modified avipoxviruses, and methods for producing such sequences.

BACKGROUND OF THE INVENTION Avipox, or avipoxvirus, is a genus closely related to poxviruses that infect poultry. The avipox genus includes fowl pox, canary pox, junco pox
x), pigeon pox, quail pox, sparrow pox
x), starling pox, and turkey pox species. Fowlpox species infect chickens and should not be confused with a human disease called chickenpox. The avipox genus has many features in common with other poxviruses, and belongs to the same subfamily as vaccinia as a poxvirus that uses vertebrates as hosts. Poxviruses, including vaccinia and avipox, replicate in eukaryotic cells of the host.
These viruses are characterized by their large size, complexity, and replication at sites in the cytoplasm. However, vaccinia and avipox are different genera, and the International Committee on Virus Classification (International Comm.
4th report of Ittee on Taxonomy of Viruses, Intervirology, vol. 17, p. 42-44 (1
982), each has a different molecular weight, antigenic determinant, and host species.

Avipoxviruses do not cause productive infections in non-avian vertebrates, such as mammals, including humans. Furthermore, avipox does not grow when inoculated into cultured cells of mammals (including humans). In cultured mammalian cells inoculated with avipox, cells die due to cytotoxic effects, but there is no evidence of a productive infection of the virus.

When non-avian vertebrates such as mammals are inoculated with live avipox, foci similar to vaccinia inoculation are formed in the inoculated area. However, no productive infection of the virus occurs. Nevertheless, it has now been found that mammals inoculated in this way respond immunologically to the avipoxvirus. This is an unexpected result.

Vaccines consisting of killed pathogens or purified antigenic components of such pathogens must be injected in larger quantities than live viral vaccines to elicit an effective immune response. This is because live virus inoculation is a much more efficient vaccination method. Even relatively small inoculations can elicit an effective immune response because the antigen in question is amplified during viral replication. From a medical point of view, live viral vaccines are more effective than inoculating killed pathogens or purified antigen vaccines, and confer longer lasting immunity. Therefore, vaccines consisting of killed pathogens or purified antigenic components of such pathogens require the production of larger quantities of vaccine material than for live viruses.

As is evident from what has already been mentioned, the use of live virus vaccines has medical and economic advantages. As one of such live virus vaccines,
Vaccines consisting of vaccinia virus are mentioned. It is known in the prior art that this virus is one of the viruses useful for inserting DNA representing the gene sequence of an antigen of a mammalian pathogen using a recombinant DNA method.

Thus, by inserting DNA of any origin (eg, virus, prokaryote, eukaryote, synthetic) into a non-essential region of the vaccinia genome, containing DNA sequences encoding antigenic determinants of the pathogenic organism, Methods capable of producing recombinant vaccinia virus have been developed in the prior art. Certain recombinant vaccinia viruses produced by these methods have been used to elicit specific immunity in mammals against various mammalian pathogens, all of which are described in U.S. Patent No. 4,603,112; It is cited herein.

Unmodified vaccinia virus has a long history of being used as a relatively safe and effective vaccine for smallpox. However, prior to eradication of smallpox, when unmodified vaccinia virus was widely administered, there was a modest risk of actual complications in the form of a systemic vaccinia infection, especially eczema or immune Risk was associated with those suffering from suppression. A rare complication of vaccinia vaccination is, rarely, post-vaccination encephalitis. Most of these reactions were due to vaccination of skin diseases such as eczema, or those with immune system dysfunction, or those whose families had eczema or immune dysfunction. Vaccinia is a live virus and is usually harmless to healthy individuals. However, it is transmitted between individuals for several weeks after inoculation. Serious consequences can occur if a person with a compromised normal immune response is infected by inoculation or by contagious transmission from a recently vaccinated person.

Thus, it can be seen that methods which reduce or eliminate the problems already mentioned while having the advantages of live virus inoculation in the art have desirable advantages over the state of the art. This is extremely important now that a disease known as acquired immunodeficiency syndrome (AIDS) has developed. The victim of the disease has a severe immunodeficiency and is transmitted by direct contact with a live virus that is safe for others, or by contact with a person who has recently been vaccinated with a live virus preparation. Easily injured by such virus preparations.

OBJECTS OF THE INVENTION An object of the present invention is to provide a vaccine capable of immunizing vertebrates against pathogenic organisms, while having the advantages of live virus vaccines, especially when used to immunize non-avian vertebrates. The aim is to provide a vaccine that has little or no disadvantages of live virus vaccines and dead virus vaccines as already listed.

The present invention further aims at providing a synthetic recombinant avipoxvirus for use in such a vaccine.

The invention further relates to avian and non-avian vertebrates,
In the case of non-avian vertebrates, such as mammals, the immune response is induced by inoculating the vertebrate with a synthetic recombinant avipoxvirus that is unable to replicate productively with the production of the infected virus in the animal. It is intended to provide a method of inducing. When inoculated into non-avian vertebrates, such as mammals, such viruses self-limiting and reduce the likelihood of spreading to non-vaccinated hosts.

The present invention further provides a method of eliciting an immune response to an antigen in a vertebrate, wherein the vertebrate is vaccinated with a vaccine containing a synthetic recombinant avipoxvirus containing and expressing an antigenic determinant of a pathogen to the vertebrate. It is intended to provide a method including:

Also, by inoculating a vertebrate with a recombinant virus that encodes the gene product and that contains DNA that expresses the gene product without the virus replicatively replicating in the vertebrate, the gene product is transformed in the vertebrate. It is also an object of the present invention to provide a method for expression.

In addition, vertebrates elicit an immune response to the antigen by inoculating the vertebrate with a recombinant virus that encodes the antigen and contains DNA that expresses the antigen without the virus replicating in the vertebrate. It is also an object of the present invention to provide a method for causing this to occur.

DESCRIPTION OF THE INVENTION One embodiment of the present invention provides a vertebrate with a synthetic recombinant avipoxvirus modified by the presence of DNA of any origin that encodes and expresses the antigen of the pathogen in a non-essential region of the avipox genome. The present invention relates to a method of inducing an immune response against said pathogen in a vertebrate animal by inoculation.

In another aspect, the invention relates to a method of expressing a gene product in a vertebrate using a recombinant virus that does not replicate productively in a vertebrate cell but expresses the gene product or antigen in such a cell. The present invention relates to a method of eliciting an immune response in an animal against an antigen.

In another embodiment, the present invention relates to synthetic avipoxviruses modified by inserting DNA of any origin, particularly non-avipox origin, into a non-essential region of the avipox genome.

Artificially modified avipoxvirus recombinants having a foreign (ie, non-avipox) gene encoding and expressing the antigen will elicit the development of a vertebrate host immune response to the antigen, thereby providing immunity to the foreign pathogen Although it induces the development of a response, such recombinants have the disadvantages of conventional vaccines using live or attenuated live organisms in the present invention, especially when used in inoculation of non-avian vertebrates. Used to create new vaccines without.

It must also be mentioned here that avipoxviruses can only replicate productively in birds or avian cell lines and can be passaged. Recombinant avipox virus from avian host cells, when inoculated into non-avian vertebrates such as mammals in a manner similar to inoculation of mammals with vaccinia virus, causes lesions due to inoculation, but productive replication of avipoxvirus Does not happen. Although avipoxviruses do not replicate productively in such inoculated non-avian vertebrates, the expression of the virus occurs well, and the inoculated animals are infected with this recombinant avipoxvirus. It responds immunologically to antigenic determinants and to antigenic determinants encoded by foreign genes of the virus.

Upon inoculation in birds, such a synthetic recombinant avipoxvirus not only elicits an immune response against the antigen encoded by foreign DNA of any origin present therein, but also causes a productive replication of the virus in the host. Elicit the expected immunological response to the avipox vector itself.

Several investigators have proposed to make recombinant falpox, specifically a virus, for use as an animal vaccine to protect poultry. Boyle and Coupar, Journal of Genetic Viology (J.Gen.Virol.), 67 ,
1591-1600 (1986) and Binns et al., Israel Journal of Veterinary Medicine (Is
rJVet. Med.) 42 , 124-127 (1986). The use of recombinant avipoxviruses as a method of eliciting specific immunity in mammals has never been paraphrased or reported in practice.

Stickl and Mayer are from Fortschritter der Medizin (Fortschr.Med)
97 (40), 1781-1788 (1979) describe the injection of avipox, in particular fowlpox virus, into humans. However, these studies only relate to using conventional foulpox to enhance nonspecific immunity in patients with sequelae of cancer chemotherapy. No recombinant DNA technology is used. There is no suggestion for inserting DNA encoding vertebrate pathogen antigens into avipox, nor for inducing specific immunity in vertebrates. Instead, this prior art is based on the general and non-specific tonic effects of the human host.

A more thorough study based on genetic recombination will help to understand how the modified recombinant viruses of the present invention are made.

Genetic recombination generally involves exchanging the homologous portion of deoxyribonucleic acid (DNA) between two DNA helices. (In some viruses, ribonucleic acid (RNA) can replace DNA.) A homologous portion of a nucleic acid is a portion of a nucleic acid (RNA or DNA) having the same sequence of nucleotide bases.

Genetic recombination may occur spontaneously during the replication or production of the novel viral genome in the infected host cell.
Thus, genetic recombination between viral genes can also occur during a viral replication cycle that occurs in a host cell simultaneously infected with two or more different viruses or other genetic constructs. The DNA portion of the first genome is used interchangeably in assembling a co-infected second viral genome portion having DNA homologous to the first viral genomic DNA.

However, recombination can also occur between portions of DNA in different genomes that are not completely homologous. For example, such a portion may be derived from a first genome that is homologous to one portion of another genome, but with a homology within the first genome.
Recombination can also occur when a gene encoding a genetic marker or antigenic determinant is inserted into the DNA portion, and the product of the recombination can be detected by the presence of the genetic marker or antigenic determinant.

Two conditions are required for the inserted DNA gene sequence to be successfully expressed by the modified infectious virus.

First, in order for the modified virus to remain viable, the insertion must be within a non-essential region of the virus. Neither foulpox nor avipoxviruses have previously been suggested to have regions similar to the non-essential regions described for vaccinia virus. Thus, the non-essential regions of the foulpox of the present invention were discovered by cutting the foulpox genome into fragments, separating the fragments by size and inserting them into a plasmid construct to amplify these fragments (plasmid A small circular DNA molecule found as an extrachromosomal element in many bacteria, including E. coli, such as antigenic determinant genes or other genetic markers.
Methods for inserting DNA sequences into plasmids are well known in the art, and are described in Maniatis et al., Molecular Cloning: Experimental Manual (A).
Laboratory Manual), Cold Spring Harbor Laboratory
New York [1982]). Next, the gene encoding the genetic marker and / or the antigen was inserted into the cloned foulpox fragment. Certain successfully recombined fragments can be demonstrated by good recovery of genetic markers or antigens, such fragments being fragments consisting of DNA inserted into non-essential regions of the foulpox genome.

The second condition for expression of the inserted DNA is the presence of a promoter in proper relationship with the inserted DNA.
The promoter must be located upstream of the DNA sequence to be expressed. Because the properties of avipoxviruses have not been fully elucidated, and avipox promoters have not been identified in the art so far, some of the present invention are directed upstream of DNA that expresses known promoters of other poxviruses. To insert effectively. Foulpox promoters have also been successfully used to practice the methods of the invention and to make the products of the invention. According to the present invention, it has been found that the foulpox promoter, vaccinia promoter and entmopox promoter promote transcription of recombinant poxvirus.

Boyle and Coupar are the Journal of Genetic Virols (J.Gen.Virol.)
67 , 1591 (1986) published the speculation that the vaccinia promoter "is predicted to act on the (foulpox) virus." The authors confirmed the location of the foulpox TK gene and cloned it (Boile (Bo
yle) et al., Virology 156 , 355-365 [198
7]) and inserted it into vaccinia virus. The TK gene was expressed, presumably because of the recognition of the foulpox TK promoter sequence by the function of vaccinia polymerase. However, despite their speculation, the authors did not insert the vaccinia promoter into the fowlpox virus and did not observe the expression of foreign DNA sequences in the foulpox genome. It was not known before the present invention that promoters from other poxviruses, such as the vaccinia promoter, actually promote gene transcription in the avipox genome.

DESCRIPTION OF THE PREFERRED EMBODIMENTS The foulpox and canarypox viruses are
It has been specifically used as a preferred avipox species that incorporates the foreign DNA of the present invention and is modified by recombination.

Fowlpox is a type of avipox that infects chickens in particular, but does not infect mammals. The foulpox strain, referred to herein as FP-5, was obtained from American Scientific Laboratories (American).
an Scientific Laboratories)
ring Corp.), Madison, Wyoming, US Veterinary License # 165, Serial # 30321,
Is a commercial fowlpox virus vaccine strain derived from chick embryos, which is available from E.I.

The foulpox strain, referred to herein as FP-1, is a modified Duvette strain for use in day 1 chicken vaccines. This strain is O DCEP25 /
A commercially available foulpox virus vaccine strain called CEP67 / 2309 Oktober 1980, available from the Institute Merieux, Inc.

Canary pox is a species of avipox.
Like fowlpox, canarypox specifically infects canary but does not infect mammals. The Canarypox strain, referred to herein as CP, is LF2 CEP524 2
A commercial canarypox vaccine strain called 4 10 75, available from the Institute Merricks.

The DNA gene sequences inserted into these avipoxviruses by the genetic recombination of the present invention include a Lac Z gene derived from a prokaryote, a rabies glycoprotein (G) gene which is an antigen of a non-avian (particularly, a mammalian) pathogen. , The turkey influenza hemagglutinin gene, an antigen of pathogenic avian viruses other than avipoxvirus, the gp51,30 envelope gene of bovine leukemia virus, one of mammalian viruses, and the Newcastle disease virus, one of avian viruses (Texas (Texas strain), the feline envelope gene of the feline leukemia virus, a mammalian virus, the RAV-1 env gene of the rous-related virus, avian virus / poultry disease, and the chicken / pennsylvania bird virus (Chicken / Pennsy
lvania) / 1/83 influenza virus nucleoprotein (NP) gene, avian virus infectious bronchitis virus (Mass 41 strain) matrix gene and peplomer gene, mammalian virus herpes simplex virus glycoprotein D gene ( gD) is included.

The Lac Z gene was isolated from Casadaban.
Laga Method in E (Methods in E
nzymology) 100 , 293-308 (1983). The structure of the rabies G gene is described, for example, by Anilionis.
nis) et al., Nature 294 , 275-278 (1981).
Is disclosed.

Integration into vaccinia and expression in this vector is described in Kiney et al., Nature 312 ,
163-166 (1984). Turkey influenza hemagglutinin gene is Kawaoka
a) et al., Virology 158 , 218-227 (1987).
Has been stated. Bovine leukemia virus gp51,30
The env gene was obtained from Rice et al.
y) 138 , 82-93 (1984). The fusion gene for Newcastle disease virus (Texas strain) is available from the Institute Merix as plasmid pNDV108. Feline leukemia virus env gene
Guilhot et al. For Virology 16
1 , 252-258 (1987). Louth-associated virus type 1 contains two clones, pen VRVIPT and mp19env (19
0) is available from the Institute Merricks. The chicken influenza NP gene was converted as a plasmid pNP33 into St. Jude Children's Research Hospital (S
t.Jude Children's Research Hospital)
Available from Kawaoka (Yoshihiro Kawaoka). IBV M
The infectious bronchitis virus cDNA clones of the ass41 matrix gene and the pepromer gene were cloned into plasmid pIBV
Available as M63 from the Institute Merix. The herpes simplex virus gD gene has been described by Watson et al. In Science 218 , 381-384.
(1982).

The recombinant avipoxvirus described in more detail below incorporates one of the three vaccinia promoters. Wachman et al., J. of Inf. Dis. 155 , Pi promoter from the vaccinia Ava IH region
1188-1197 (1987). More specifically, the promoter is the L mutant WR vaccinia strain Ava I
H (Xho IG) fragment, in which the promoter directs right-to-left transcription. The position of this promoter on the map is approximately 1.3 Kbp (kilobase pair) from the left end of Ava IH and approximately 12.5 kbp from the left end of the vaccinia genome.
Kbp, about 8.5 Kbp at the Hind III C / N junction. The sequence of this promoter is And the symbol in parentheses in the above sequence is a linker sequence.

The Hind III H promoter (also referred to herein as "HH" and "H6") was revealed by standard transcription mapping methods. It has the following sequence:

This sequence is identical to that described by Rosel et al., J. Virol. 60, 436-449 (1986) as the sequence upstream of the open reading frame.

The 11K promoter is described in Wittek, Journal of Virology (J. Virol.) 49 , 371-378 (19).
84) and Bertholet, C., et al., Procedurals of National Academy of Sciences USA (Proc. Natl. Acad. Sci. USA) 82, 2096-210.
0 (1985).

The recombinant avipoxviruses of the present invention were made in two steps similar to the method disclosed in the aforementioned US Patent No. 4,603,112 for making synthetic vaccinia virus recombinants known in the art.

First, the DNA gene sequence to be inserted into the virus is inserted into an E. coli plasmid construct into which DNA homologous to a non-essential region of the avipox virus has been inserted. Separately, the DNA gene sequence to be inserted is linked to a promoter. The promoter-gene conjugate is then placed in a plasmid construct, flanked on both ends by DNA homologous to non-essential regions of avipox DNA. The resulting plasmid construct is propagated in E. coli and amplified. (Plasmid DNA is used to carry and amplify foreign genetic material, and this method is well known in the art. For example, for these plasmid technologies, see Clewel
l) Journal of Bacteriology (J. Bacteri)
ol.) 110, 667-676 (1972). Techniques for isolating amplification plasmids from host E. coli are also well known in the art and are described, for example, by Clewell et al. In Proceedings of National Academy of Sciences USA 62, 1159-1166 (1969). ing. The amplified plasmid material isolated after growth in E. coli is then used in the second step. That is, a plasmid containing the DNA gene sequence to be inserted is transfected together with an avipox virus (such as fowlpox strain FP-1 or FP-5) into cultured cells such as chicken embryo fibroblasts (CEF). Recombination between the homologous foulpox DNA in the plasmid and the viral genome results in an avipoxvirus that has been modified by the presence of non-fowlpox DNA sequences in non-essential regions of this genome.

The invention and many of its advantages will be better understood with the following illustrative examples.

Example 1 Assay for Transient Expression Suggesting Recognition of Vaccinia Promoter by Fowlpox RNA Transcription Factor Several Plasmid Structures Containing Sequences Coding for Vaccinia Virus Promoter Sequence and Encoding Hepatitis B Virus Surface Antigen (HBSAg) The body was made. 50 μg of each plasmid was used to infect CEF infected with 10 pfu of fowlpox virus or vaccinia virus per cell.
Cells were transfected. The infection was allowed to proceed for 24 hours, and then thawed and thawed three times in succession.

The amount of HBSAg in this lysate was determined by Abbott Laboratories' Diagnostic Department.
AUSRIA II commercially available from Pivision)
^-Evaluated using the ¹²⁵ I kit. The presence or absence of HBSAg is shown as the ratio of the net count of the unknown sample (sample value minus the background value) to the negative cutoff value preset by the manufacturer. This is shown as the P / N (positive / negative) ratio.
The results are shown in Table I.

Three different vaccinia promoter sequences: DN
APi promoter seen early in vaccinia infection before replication, 11K seen late in vaccinia infection after DNA replication starts
The promoter, the Hind III H (HH) promoter found both early and late in vaccinia infection, was used. These promoters have already been described herein.

From the above data, HB produced in the lysate of infected cells
It is suggested that SAg is the result of recognition of the vaccinia promoter by foulpox or vaccinia transcription factors.

Example 2 Preparation of LAC Z Gene-Containing Recombinant Fowlpox Virus vFP-1 One fragment in a non-essential region of a fowlpox virus was isolated by identifying its position as follows.

The hairpin loop at the single-stranded end of FP-5 DNA was removed using nuclease Bal31. Blunt ends were generated using the Klenow (large) fragment of DNA polymerase. After removing the loop, the fragment was prepared by restriction enzyme digestion with Bgl II. By this digestion, a series of FP-5
Fragments were formed, which were separated by agarose gel electrophoresis.

A fragment containing the 8.8 Kbp Bgl II blunt end was isolated, and a commercially available plasmid pU cut with Bam HI and Sma I was used.
Connected to C9. The resulting plasmid was named pRW698.

To reduce the size of the foulpox fragment, this plasmid was cut with HindIII to generate two more fragments. The 6.7 Kbp fragment was discarded, and the other 4.7 Kbp fragment was ligated to prepare a new plasmid pRW699.

L which is promoted by 11K promoter
pRW699 was cut with EcoR V to incorporate the ac Z gene. This EcoR V cleaves the plasmid at only one place. This insert was named F3. This 11K promoter promotes transcriptional Lac Z segment into blunt-ended P
Inserted as a stI-BamHI fragment, the new plasmid pRW70
2 was produced. This Lac Z clone was designated pMC18 as described by Casadaban et al.
It is derived from 71. The 11K promoter was linked to the eighth codon of the Lac Z gene by a Bam HI linker.

Using the vaccinia recombination technique described in U.S. Pat. No. 4,603,112, this pRW702 plasmid was then recombined into falpopoxvirus FP-5 grown on chicken embryo fibroblasts (CEF). At this time, the following operation was used to prepare vFP-1. Mix 50 μg of pRW702 DNA with 0.5 μg of whole genome foulpox DNA and bring the final volume to 100
μ. 10 μM of 2.5 M CaCl ₂ and 40 mM Hepes, 30
110 μm of ₂ × HEBS buffer (pH 7) prepared from 0 mM NaCl, 1.4 mM Na ₂ HPO ₄ , 10 mM KCl, 12 mM dextrose was added thereto. After 30 minutes at room temperature, 200 μl of Fowlpox virus pool diluted to 5 pfu / cell
After the addition of the mixture, the mixture was 60 mm containing the primary CEF monolayer.
Inoculated on the dish. At this time, 2% fetal bovine serum (FB
0.7 m of an Eagles medium containing S) was also added. After incubating the plate at 37 ° C for 2 hours, 2%
3 m of Eagle's medium containing FBS was added and the plate was incubated for 3 days. After the cells were lysed by three consecutive freeze-thaw cycles, the neoplastic virus particles were assayed in the presence of the recombinant.

Evidence of successful insertion by recombination of the Lac Z gene, which is transcriptionally driven by the 11K promoter, into the Fowlpox FP-5 genome was obtained by examining the expression of the Lac Z gene. The Lac Z gene encodes the enzyme β-galactosidase, which is a chromogen, 5-bromo-4-chloro-3-indolyl-β-D-.
Cleavage galactoside (X-gal) releases the blue indolyl derivative. Blue plaque was selected as a positive recombinant.

Successful insertion of Lac Z into the foulpox FP-5 genome and its expression were confirmed by vFP-1 infected CEF, BSC (monkey kidney cell line-ATCC CCL26), VERO (monkey kidney cell line-ATCC CCL8).
1) and MRC-5 (human diploid lung cell line-ATCC CCL 17
It was also confirmed by the standard method using 1) and immunoprecipitation of β-galactosidase with a commercially available antiserum.

Expression of β-galactosidase by the recombinant virus vFP-1 was further demonstrated by inoculating rabbits and mice with this virus and increasing the titer of antibodies raised against β-galactosidase protein in inoculated animal sera after inoculation. It was also confirmed in vivo by measurement and its goodness.

In particular, the recombinant vFP-1 was purified from infected host cells and injected intradermally at two sites on each side of two rabbits. They were inoculated with 10 ⁸ pfu in total in each rabbit.

Animals were bled every other week, and the serum was detected by an ELISA assay using a commercially available purified β-galactosidase preparation as an antigen.

Both rabbits and mice inoculated with this recombinant vFP-1 were detected by ELISA to have produced an immune response to β-galactosidase protein. This response was detectable in both species one week after inoculation.

Example 3 Preparation of a Rabies G Gene and LAC Z-Containing Recombinant Virus vFP-2 from Fowlpox Virus FP-5 A 0.9 Kbp Pvu II fragment was obtained from FP-5 and the two Pvu II parts of pUC9 were obtained by standard procedures. Inserted in between. Generated structure
pRW688.2 has two Hinc II sites, approximately 30 bp apart, asymmetrically within the Pvu II fragment, thereby forming a long arm and a short arm from this fragment.

Oligonucleotide adapters were used with Pst I and Bam HI
Using known techniques for introducing sites, these Hi
Insertion between the nc II sites created plasmid pRW694.
These insertion sites were named F1.

Next, this plasmid was cut with Pst I and Bam HI, and Lac Z having the linked 11K vaccinia promoter described above was used.
The gene was inserted to create a new plasmid pRW700.

To generate the rabies G gene whose transcription is promoted by the Pi promoter, Bgl close to the 5 'end of the rabies G gene was used.
The II site (Kieny et al., Supra) was blunt-ended and ligated to the previously described Eco RI site that buried the single-stranded portion of the Pi promoter.

This construct was inserted into the PstI site of pRW700 and contained therein the foreign gene sequence Pi-Rabies G11K-LacZ.
One plasmid was prepared. This insertion is positioned in the plasmid such that the Pvu II-Hinc II long arm of the FP-5 donor sequence is 3 'to the Lac Z gene.

The resulting final construct was recombined with fowlpoxvirus FP-5 by infecting / transfecting chick embryo fibroblasts by the recombinant foulpoxvirus vFP-2 production method described above. This recombinant virus was selected by X-gal staining.

Various addition methods described below confirmed that both the Lac Z gene and the rabies G gene were properly inserted and expressed.

Determination of the position of the rabies antigen by immunofluorescence using a specific antibody indicated that the rabies virus was well expressed on the surface of avian or non-avian cells infected with the vFP-2 virus.

As described above, the expression of rabies antigen and β-galactosidase by avian or non-avian cells infected with the vFP-2 virus was confirmed by immunoprecipitation.

Another evidence that the vFP-2 embodiment of the invention is a successful example of a recombinant virus carrying the rabies G gene and the β-galactosidase gene is by inoculating two rabbits with the vFP-2 virus. Obtained. 1 × 10 ⁸ pfu of vFP per rabbit for two rabbits
-2 was inoculated intradermally. Rabbits are bled every other week and serum is tested by ELISA for rabies glycoprotein and β-
The presence of a specific antibody for the galactosidase protein was detected.

As shown in Table II below, rabbit 205 exhibited anti-β-galactosidase antibody in a detectable amount in an ELISA test one week after inoculation. This increased to a titer of 1/4000 in the second week and persisted for up to 5 weeks after inoculation. Antigen capture ELISA
Using the assay, the serum of rabbit 205 showed detectable amounts of anti-rabies antibody from 3 to 10 weeks after inoculation.

Example 4A Transcriptionally Enhanced Recombinant Virus Containing Rabies G Gene vFP- from Fowlpox Virus FP-1
Production of 3 This example demonstrates that the rabies G gene is completely expressed by a foulpox strain other than FP-5, in particular, another strain of foulpox virus called FP-1.

As in Example 3, 0.9 Kbp as in FP-5
This fragment was obtained from FP-1 under the assumption that the Pvu II fragment contained a non-essential region.

This fragment was inserted into the two Pvu II sites of pUC9, resulting in pRW73
A plasmid named 1.15R was prepared.

This plasmid has two Hinc II sites at asymmetric positions about 30 bP apart within the Pvu II fragment,
Form the long and short arms of this fragment.

Commercially available Pst linker, (5 ')-CCTGCAGG- (3')
Was inserted into two Hinc II sites to create plasmid pRW741.

The rabies G gene whose transcription is promoted by the HH promoter
Inserted into this plasmid at the tI site, the new plasmid pRW
742B was produced. The virus vFP-3 was obtained by recombination of this plasmid with FP-1 by infection / transfection of CEF cells.

The ATG translation initiation codon of the open reading frame that is promoted by the HH promoter is replaced with EcoR V in the HH promoter.
It was overlaid on the start codon of the rabies G gene using a synthetic oligonucleotide linking the site to the Hind III site in the rabies G gene. After modifying the 5 'end of the rabies G gene transcription-promoted by the HH promoter using a known technique to contain one Pst I site, this structure was ligated to the Pst I site of pRW741 to prepare pRW742B. did. The position of this construct in this plasmid is the same as in pRW735.1 already described in Example 3.

Recombination was performed as described in Example 2. The resulting recombinant is called vFP-3.

The expression of the rabies antigen by both avian and non-avian cells infected with the vFP-3 virus was confirmed by the immunoprecipitation method and the immunofluorescence method described above.

Further evidence that the embodiment for vFP-3 of the present invention is a successful example of a recombinant virus expressing the rabies G gene was obtained by intradermally inoculating two rabbits with the recombinant virus. 1 rabbit per rabbit
It was inoculated intradermally in the × 10 ⁸ pfu of vFP-3. Both of these rabbits developed a typical pox lesion, which reached its maximum 5-6 days after inoculation. Rabbits were bled weekly and serum was tested by ELISA to detect the presence of antibodies specific for the rabies glycoprotein.

Each of 5 rats was inoculated intradermally with 5 × 10 ⁷ pfu of vFP-3. Lesions remained in all animals.

Both rabbits and rats produced detectable levels of rabies-specific antibodies by two weeks after inoculation. Parent FP-
Two control rabbits intradermally inoculated with one virus did not show any detectable levels of anti-rabies antibodies. This antibody response was not induced by de novo synthesis by the recombinant virus of rabies antigen in the animals used in the experiments, but rather by accident, depending on whether it was brought in with the inoculated virus or incorporated into the recombinant fowlpox virus membrane. The vFP-3 virus was chemically inactivated and rabbits were inoculated to rule out any possible rabies antigen transfer.

The purified virus was inactivated overnight at 4 ° C. in the presence of 0.001% β-propiolactone, and then pelleted by centrifugation. The pelleted virus was collected in 10 mM Tris buffer, sonicated, and assayed for titer to ensure that no infectious virus remained. Two rabbits were inoculated intradermally with inactivated vFP-3, and two other rabbits were intradermally inoculated with the same amount of untreated recombinant. The size of the lesion was monitored.

Both rabbits receiving untreated vFP-3 produced typical lesions of grade 4-5 + 5 days after inoculation. Rabbits inoculated with the inactivated virus also developed lesions, but these were 2+ grade 5 days after inoculation.

Rabbits are bled every other week, serum is tested by ELISA,
The presence of rabies specific antibodies and foulpox specific antibodies was examined. The results are shown in Table III below.

In this test, the titer endpoint (shown as the reciprocal of the serum dilution) was arbitrarily set to 0.2 after subtracting the serum absorption before antigen administration. Rabbits 295 and 318 were both administered the live virus and generated an immune response to rabies glycoprotein and fowlpoxvirus antigens. Rabbit
303 and 320 also produced an immune response to the fowlpox virus antigen, but at a lower titer. Neither of the rabbits produced a detectable response to the rabies glycoprotein.

This finding suggests that the immune response generated in the rabbit is due to the de novo expression of the rabies glycoprotein gene carried by the recombinant virus and is not a response to the glycoprotein accidentally brought into the inoculated virus.

Example 4B Preparation of Recombinant Rabies G Gene-Containing Virus vFP-5 Without Transcriptional Capability from Fowlpox Virus FP-1 Expression of a foreign gene inserted into the foulpox genome by recombination requires the presence of a promoter It is. This was demonstrated by generating a recombinant vFP-5 identical to vFP-3 except that it lacked the HH promoter.
The presence of the rabies gene in this recombinant was confirmed by nucleic acid hybridization. However, no rabies antigen was detected in the CEF cell medium infected with this virus.

Example 5 In Vitro Passage Experiment to Determine Whether Fowlpox Virus Replicates in Non-Avian Cells FP-1 was tested against three cell lines, one avian and two non-avian
The experiment was performed by inoculating the parent strain or the recombinant vFP-3. CEF,
FP-1 or v on each of two plates of MRC-5 and VERO
FP-3 was inoculated at a multiplicity of inoculation of 10 pfu per cell.

Three days later, cells were harvested from one dish for each. After freezing and thawing were repeated three times successively to release the virus, a fresh monolayer of the same cell line was re-inoculated. This was passaged six times in succession, and at the end of the experiment, the specimens at each passage were titered to determine the virus infectivity on the CEF monolayer.

The results are shown in Table IVA. From these results, it was found that FP
It was suggested that continuous passage of both -1 and vFP-3 was possible, but not in either of the two non-avian cell lines. Infectious virus
Not detectable after 3 or 4 passages in VERO or MCR-5 cells.

The second dish was used to determine if undetectable virus could be detected in permissive CEF cells after amplification by direct titration.

Three days later, the cells in the second dish were scraped and harvested, and one third of the cells were lysed and inoculated onto a fresh CEF monolayer.
When the cytopathic effect (CPE) was maximal or 7 days after inoculation, the cells were lysed and the virus yield was titrated. The results are shown in Table IVB. After amplification of all of the virus present using passage in CEF cells, the virus was undetectable after 4 or 5 passages.

Attempts to establish constantly infected cells have failed.

In addition, an attempt was made to detect evidence of continuous virus expression in non-avian cells, but the samples used for virus titer assays described above were used in a standard immunodot assay. In this assay, anti-foulpox antibodies and anti-rabies antibodies were used to detect the presence of each antigen. The results of these assays confirmed the results of the titer test.

Example 6 Other foulpox FP-1 recombinants: vFP-
6, vFP-7, vFP-8 and vFP-9 Recombinant viruses vFP-6 and vFP-7 were produced by the following operations.

The 5.5 kbp Pvu II fragment of FP-1 was inserted between the two Pvu II sites of pUC9 to create plasmid PRW731.13. This plasmid was then cut at its unique Hinc II site and the blunt-ended rabies G gene containing the HH-promoter inserted to insert plasmids pRW748A and pRW74.
8B was produced. These plasmids show that the orientation of the insertion is opposite. Plasmids pRW748A and B were then separately used to transfect CEF cells with the FP-1 virus, and
vFP-6 and vFP-7 were prepared. This locus was named locus f7.

A 10 Kbp Pvu-II fragment of FP-1 was inserted between the two Pvu II sites of pUC9 to create pRW731.15. This plasmid was then cut at the unique Bam HI site, and then the Lac Z gene fragment with the 11K promoter was inserted, creating pRW749A and pRW749B with the insertion directions reversed. These donor plasmids were recombined with FP-1, resulting in vFP-8 and vFP-8, respectively.
FP-9 was obtained. This locus was named locus f8.

vFP-8 and vFP-9 are the L detected by X-gal.
The ac Z gene was expressed. vFP-6 and vFP-7 expressed the rabies G gene detected by rabies specific antiserum.

Example 7 Immunization with vFP-3 to protect animals from live rabies virus challenge Groups of 20 female SPF mice (4-6 weeks old)
Toes were inoculated with vFP-3 50μ at doses ranging from 0.7 to 6.7 TCID ₅₀ per mouse (TCID _50, or tissue culture infectious dose, is the amount at which 50% of the tissue culture cells undergo a cytopathic effect. ). On day 14 after inoculation, 10 mice of each group were sacrificed,
Serum samples were collected for the RFFI test assay. 10 remaining
To mice, rabies CVS strain cerebral, after attack inoculated in an amount of 10 LD _50, was counted, the number of surviving at 14 days.

 The results are shown in Table VA below.

This experiment was repeated with a challenge with 12.5 LD ₅₀ of rabies virus. The results are shown in Table VB below.

Log ₁₀ T of recombinant vFP-3 for two dogs and two cats
Eight times the amount of CID ₅₀ was intravenously inoculated once and immunized. Furthermore, two dogs and four cats of the same age and weight were used as a non-vaccinated control group. Blood was collected from all animals every other week. 94
On the day, each dog was challenged by inoculating the temporal muscle twice with 0.5 m of the salivary gland homogenate of the rabies virus NY strain obtained from the Institute Merix. The total dose was equivalent to 10,000 times the mouse LD ₅₀ by cerebral route. Six cats were similarly challenged by inoculating the neck muscle twice with 0.5 m of the virus suspension. The total dose per cats corresponded to 40,000 times the mouse LD ₅₀ for cerebral pathways. Animals were observed daily. All non-vaccinated animals died on the days indicated in Table VI with rabies symptoms.
Vaccinated animals survived the challenge and were observed up to 3 weeks after the last one of the control animals had died.
The results are shown in Table VI below.

In addition, experiments were performed in which cows were inoculated with recombinant viruses vFP-2 and vFP-3 by several different routes.

Anti-rabies antibody was administered to inoculated animals on 6, 14, 21, 28 and
Tested on day 35. As shown in Table VIIA below, all animals showed a serological response to rabies antigen.

All cattle were re-inoculated with 8 times the log ₁₀ TCID ₅₀ on day 55 after inoculation and showed a pre-existing response to this rabies antigen. All cattle except for No. 1421 were boosted by re-vaccination. Cattle # 1421 was again inoculated intramuscularly. RFFI titers were measured after 55, 57, 63, 70, 77 and 86 days. The results are shown in Table VIIB.

All data are vFP-3, except that the data for the 1423 animal is based on vFP-2.

Bovines, cats and rabbits were also inoculated intradermally with known amounts of fowlpox virus, and scabs were collected from animals approximately one week later. After crushing, the cells were suspended in physiological saline and assayed for titer to measure the amount of virus.

Only the remaining amount of infectious virus could be recovered. This suggests that no productive infection occurs in vivo.

Example 8 Chicken Inoculation with vFP-3 Chickens were inoculated with recombinant fowlpox virus vFP-3 to demonstrate the expression of foreign DNA by the recombinant fowlpox virus in a system that permits productive replication of this vector.

VFP-3 to log ₁₀ TCID for white leghorn chickens
9 times the amount of ₅₀ from muscle or vFP-3 from log ₁₀ TCID ₅₀
It was inoculated by penetrating the wing with a double volume. Blood samples were collected and rabies antibody titers were determined by RFFI test 21 days after vaccination. Day 21 titers of the inoculated chickens were much higher than day 21 titers of the control group. That is, the mean titer of the uninfected control group was 0.6, the mean of the chickens inoculated intramuscularly was 1.9, and the mean of the chickens penetrated and inoculated was 1.2.

Example 9 Recombinant fowlpox vFP-11 expressing Turkey influenza H5 HA antigen The recombinant avipoxvirus of the present invention can be used to immunize birds against avian pathogens.

Therefore, a novel plasmid pRW759 from fowlpox virus FP-1 containing the hemagglutinin gene (H5) of A / turkey / Ireland / 1378/83 (TYHA) that is transcriptionally promoted by the Hind III H promoter (described below) )
CEF simultaneously infected with parent virus FP-1
Cells were transfected. Recombinant fowlpox virus vFP-11 was obtained by the techniques already described herein.

The synthesis of hemagglutinin molecules by vFP-11 infected cells is
Confirmation was performed by immunoprecipitation from lysates of infected cells metabolically radiolabeled using specific anti-H5 antibodies and standard procedures. Specific immunoprecipitation of a hemagglutinin precursor with a molecular weight of about 63 Kd (kilodalton) and two degradation products with molecular weights of 44 Kd and 23 Kd were revealed. Uninfected CEF cells or parent virus FP
No such protein was precipitated from the lysate of -1 infected cells.

Immunofluorescence studies were performed to determine that HA molecules produced in cells infected with recombinant fowlpox vFP-11 are expressed on the cell surface. The surface of CEF cells infected with the recombinant fowlpox virus vFP-11 was strongly fluorescently stained. No fluorescence was detected in cells infected with the parent virus FP-1.

Plasmid pRW759 was produced as follows. pRW7
42B (see Example 4) was linearized by partial digestion with PstI, and this fragment was recut with EcoR V to remove the rabies G gene, leaving the HH promoter on the remaining fragment of about 3.4 Kbp.
This was treated with alkaline phosphatase, and a synthetic oligonucleotide was inserted into ATG to bind this HH promoter to TYHA, to produce pRW744.

This plasmid was partially digested with Dra I to make it linear.
This linear fragment was cut with Sal I and the larger fragment was again isolated and treated with alkaline phosphatase.

Finally, Kawaoka et al. Reported on virology, 158 , 218-227 (1
987), the isolated TYHA Sal I-
PRW759 was made by inserting the Dra I coding sequence into the pRW744 vector.

Example 10 Immunization with vFP-11 to protect birds from live influenza virus challenge To examine the immunogenicity of recombinant fowlpox virus vFP-11, vaccination and challenge experiments were performed on chickens and turkeys.

Sterile white leghorns were vaccinated at 2 days and 5 weeks of age with wing net puncture with a double needle used to commercially vaccinate poultry with fowlpox virus. vFP-11 is 6 × 10 ⁵
About 2μ containing pfu was administered to each chicken. Older chickens were bled before vaccination, and all chickens were bled before challenge and 2 weeks later.

For comparison, another group of chickens was vaccinated with a conventional H5 vaccine consisting of an inactivated H5N2 strain of a water-in-oil emulsion.

Inactivated H5N2 vaccine was prepared from A / Mallard / NY / 189/82 (H5N2) grown in 11 day old chick eggs. HA titer 800 / 0.1m and infection titer 10 ^{8.5 /} 0.1m
Infected chorioallantoic acid was inactivated with 0.1% propiolactone, and Stone et al., Avian Dis, 22 , 666-674 (1978) and Burg (B)
rugh et al., Proc.Second Inter.Sym.on Avian Influenz
a), 283-292 (1986), suspended in a water-in-oil emulsion. A 0.2 m volume of the vaccine was administered by intravenous route to the skin inside the thigh muscle of 2 day old, 5 week old SPF white leghorn chickens.

For the chickens in groups 3 and 4, the parent virus FP-1 was used.
, Or no vaccine.

0.1 m into each nostril of each chicken
The A / Turkey / Ireland / 1378/83 (H5N8) or A / tick (Chick) / pen (Pen) / 1370/83 ( H5N2) influenza virus was attacked by the chicken in about 10 ³ times the amount of LD _50. Two-day-old chickens attacked 6 weeks after vaccination, and 5 week-old chickens attacked 5 weeks after vaccination. The chickens were observed daily for signs of illness, paralysis and death, as indicated by facial and swelling swelling and cyanosis, as well as foot bleeding (these chickens often failed to stand). Most of the deaths occurred 4-7 days after infection. Three days after infection, samples were taken from the trachea and total cloaca of each surviving chicken with a cotton swab and inoculated into embryonated eggs for virus screening. Chickens inoculated with wild-type or recombinant fowlpox virus developed typical lesions in the wing network.
A pustule formed at the site where the needle was stabbed by day 3 and cell infiltration continued with scab formation and recovered by day 7. No secondary foci were formed and there was no evidence of transmission to non-vaccinated contacted chickens. The results of the challenge experiment are shown in Table VIII and the relevant serological findings are shown in Table IX.
Shown in

Chickens vaccinated with foulpox-H5 recombinant (vFP-11) or inactivated H5N2 influenza vaccine in adjuvant have homologous Ty / Ire (H5N8) influenza virus and related but distinctly different Ck / Pen
n (H5N2) Protected against influenza virus attack. In contrast, the majority of chickens vaccinated with parental FPV or not receiving any vaccine showed clinical symptoms of highly pathogenic influenza, including facial and swelling swelling and cyanosis, Bleeding and paralysis were included. Most of these chickens died. Vaccinated chickens did not show detectable amounts of Ty / Ire, but were detectable with Ck / Penn.

HI and Ty for both inactivated and recombinant vaccines
/ Ire induced neutralizing antibodies, but the level of antibodies induced by foulpox-H5 recombinant vFP-11 prior to challenge was HA
And did not neutralize heterologous Ck / Penn H5. Nevertheless, chickens were protected from attack by both Ty / Ire and Ck / Penn influenza viruses.

Immunity against H5 influenza induced by vFP-11 vaccination lasts at least 4 to 6 weeks,
And it was cross-reactive. To further examine the persistence and specificity of this response, a group of 4-week-old chickens was inoculated with wing networks with vFP-11 as previously described, and cross-reactive Ck / Penn Attacked with a virus. Also, no HI antibody could be detected before the challenge. Nevertheless, the chickens were protected for more than four months.

H5 expressed by vFP-11 also elicits a protective immune response in turkeys. Outbred white turkey
At 4 weeks of age, they were vaccinated by wing net inoculation as previously described. The results are shown in Table X.

Significant survival was seen in both age groups against challenge with the homologous Ty / Ire virus. Non-vaccinated contact turkeys were housed together with the vaccinated turkeys and tested for transmission of house virus. These turkeys did not survive the attack.

Example 11 Chicken influenza nucleoprotein (NP)
Construction of Gene Expression Foulpox FP-1 Recombinant vFP-12 Plasmid pNP33 is a plasmid for the influenza virus chicken / Pennsylvania / 1/83 nuclear protein gene (NP).
Contains DNA clones. Only the 5 'and 3' ends of the approximately 1.6 Kbp NP gene were determined. NP was used as a blunt-ended 5 'Cla I-Xho I 3' fragment from pNP33 to S
The resulting fragment was transferred to pUC9 that had been digested with maI, and the 3 'end of the fragment was ligated to the EcoRI site of pUC9 to prepare pRW714. The translation initiation codon (ATG) of the NP had an AhaII site underlined as follows: AT GGCGTC .
The previously described vaccinia H6 promoter was linked to this NP with a double-stranded synthetic oligonucleotide. This synthetic oligonucleotide contains the H6 sequence from the Eco RV site to its ATG and enters the NP coding sequence at the Aha II site.
This oligonucleotide was synthesized so as to be compatible with both the BamH I terminus and the EcoR I terminus, and inserted into pUC9 to produce pRW755. Starting from the Bam HI compatible end, the sequence of the duplex oligonucleotide (ATG is underlined) is: Met.

Isolate the linear partial digestion product of pRW755 by Aha II,
Cut with Eco RI. A pRW755 fragment containing one AhaII cleavage site at the ATG site and recut with EcoRI was isolated, treated with phosphatase, and used as a vector for the following pRW714 digestion product.

The Aha II linear partial digest of pRW714 was recut with Eco RI. An approximately 1.6 Kbp AhaII-EcoRI isolated fragment containing the NP coding sequence was inserted into the pRW755 vector described above to generate pRW757. The complete H6 promoter was formed by adding a sequence upstream (3 'side) of the Eco RV site. Plasmid pRW742B (described in Example 4) contains the Nde I of pUC9 '.
Downstream (3 'side) of Eco RV site cleaved with site
H6 sequence. The pRW742B Eco RV-Nde I fragment was treated with phosphatase and used as a vector for the following pRW757 fragment. After isolating the linear Eco RV digestion product of pRW757, it was digested with NdeI and isolated again. This pRW757 fragment was inserted into the pRW742B vector to form pRW758. pRW758
Eco RI fragment contains all NPs driven by the H6 promoter, DNA
After blunt-end with Klenow fragment of polymerase I, it was inserted into pRW731.13 HincII site to create pRW760. The pRW731.3 Hinc II site was identified in Example 6 as vFP-
6 and FP-1 locus used for production of vFP-7.

Using Fowlpox FP-1 as a rescue virus,
Plasmid pRW760 was used in the in vitro recombination test.
Progeny plaques were assayed and plaques were purified using in situ plaque hybridization. Gene expression was confirmed by immunoprecipitation experiments using goat polyclonal anti-NP antiserum. The size of this protein, which specifically precipitated from the lysate of CEF cells infected with vFP-12, was approximately
55 KD, within the reported influenza virus nucleoprotein.

Example 12 Evian influenza nucleoprotein (NP)
Production of Fowlpox Virus Double Recombinant vFP-15 Expressing Hemagglutinin (HA) Gene and Hemagglutinin (HA) Gene from A / Tyr / Ire / 1378/83 ).
In generating the double recombinant, the HA gene was first transferred using the plasmid pRW731.15 to locus f8 as defined in the generation of vFP-8.

The plasmid used for construction of vFP-11 was pRW759. Hemagglutinin gene linked to H6 promoter,
Transferred from this plasmid by Pst I partial digestion. This fragment was then blunt-ended with the Klenow fragment of DNA polymerase I to create a Bam of pRW731.15 blunt end.
Insertion into the HI site created pRW771.

Plasmid pRW771 was then used as a rescue virus for vFP-1
2 was used in an in vitro recombination test. The vFP-12 recombinant virus contains a nucleoprotein gene linked to the H6 promoter at locus f7 as defined in plasmid pRW731.13. Recombinant plaques having both inserts were selected, plaques were purified by in situ hybridization, and the surface expression of hemagglutinin was confirmed by protein A-β-galactosidase binding immunoassay. Expression of both genes was confirmed by immunoprecipitation from double recombinant virus vFP-15 and infected cell lysate.

Example 13 Production of Recombinant Canarypox Virus In the following example, confirmation of four non-essential insertion loci of the canarypox genome and recombinant canarypoxvirus 4
The production of the species vCP-16, vCP-17, vCP-19 and vCP-20 is shown.

Recombinant canarypox vCP-16 was prepared as follows.

A 3.4 Kbp Pvu II canarypox DNA fragment was cloned into pUC9, resulting in pRW764.2. Only one Eco RI site was found asymmetrically in this fragment, and the short arm 700bp,
The long arm resulted in 2.7 Kbp. This plasmid was digested with Eco RI and blunt-ended with the Klenow fragment of DNA polymerase I. The blunt-end H6 / rabies G gene was then ligated into this site and used to transform E. coli. The resulting plasmid pRW775 was used for an in vitro recombination test. Progeny plaques positive in the immunoscreen were selected and plaques were purified. The resulting recombinant was named vCP-16 and the insertion locus was named C3.

The plasmid pRW764.2 used for the above preparation was
It contained a unique Bgl II site approximately 2.4 Kbp away from the RI site. Using the same cloning strategy, the H6 / rabies G gene was ligated at this site to plasmid pRW764.2 and pR76
W774 was made. Using this plasmid, a recombinant vCP-17 having an insertion site named C4 was prepared.

Plasmid pRW764.5 is 850 bp of canarypox DNA
And a unique Bgl II site that is asymmetric within a 400 bp fragment from one end. Using the same method as the cloning method described above, the rabies G gene linked to the H6 promoter was inserted into this site to produce pRW777. The produced stable recombinant virus was named vCP-19, and the insertion locus was named C5.

Plasmid pRW764.7 contains a 1.2 Kbp Pvu II fragment with a unique Bgl II site 300 bases away from one end. This plasmid was digested with BglII and blunt-ended with the Klenow fragment of DNA polymerase I. Lac Z is transcriptionally promoted by the 11K promoter at the blunt end
The gene was inserted to create plasmid pRW778. The stable recombinant virus produced using this plasmid was
It was named 0 and the insertion locus was named C6.

Example 14 Generation of Fowlpox Virus Recombinant vFP-29 Expressing Newcastle Disease Virus Plasmid pNDV108 is a fusion gene of the NDV Texas strain.
A cDNA clone consisting of an approximately 3.3 Kbp Hpa I cDNA fragment, a sequence encoding the fusion protein and Sca I of pBR322.
Contains another sequence encoding NDV to be cloned into the site. The following describes the steps for preparing the inserted plasmid.

(1) Preparation of plasmid pCE11 The FPV insertion vector pCE11 was prepared by inserting a polylinker into the Hinc II site of pRW731.13 (locus f7
Named). pRW731.13 contains a 5.5 Kbp Pvu II fragment of FP-1 DNA. Non-essential loci were defined at the Hinc II site in the generation of the stable recombinant vFP-6, already described in Example 6.
The polylinker inserted into the Hinc II site has the following restriction enzyme sites. That is, Nru I, Eco RI, Sac I, K
pn I, Sma I, Bam HI, Xba I, Hinc II, Sal I, Acc
I, Pst I, Sph I, Hind III and Hpa I.

(2) Preparation of plasmid pCE19 This plasmid was obtained by further modifying pCE11.
The vaccinia virus transcription termination signal ATTTTTNT (L. Yuen and B. Moss, Journal of Virology, 60 , 320-323 [1986]), where N is A, is the Sac I of pCE11. And the Eco RI site has been inserted, resulting in the disappearance of the Eco RI site.

(3) Insertion of NDV coding sequence Bam HI purified on a 1.8 Kbp gel containing all but 22 nucleotides at the 5 'end of the fusion protein gene
The fragment was inserted into the BamHI site of pUC18 to form pCE13. This plasmid is inserted upstream of the 5 'end of the coding sequence.
It was digested with Sal I which cuts the vector at 12 bases. Fill in the ends with the Klenow fragment and Hind II, which cuts this plasmid further 18 bases upstream of the Sal I site.
Digested with I. The 146 base Sma I gel containing the vaccinia virus H6 promoter and polylinker sequences at both ends and gel purified as previously described in the preferred embodiment.
-The HindIII fragment was ligated into the vector and transformed into E. coli cells. The resulting plasmid was named pCE16.

To align the start ATG codon of the NDV fusion protein gene at the 3 'end of the H6 promoter and to complement pCE16 with the 22 nucleotides missing from the 5' end of the NDV, a complementary synthetic oligonucleotide was added to the Eco RV and Kpn I sites. Was designed to be the terminal. This oligonucleotide sequence is Met.

The produced pCE16 was then digested with Eco RV and KpnI. Eco
The RV site occurs 24 bases upstream of the starting ATG within the H6 promoter. The Kpn I site is located within the NDV coding sequence at 2
Occurs 9 bases downstream.

The oligonucleotide was annealed, phosphorylated and ligated to the linear plasmid as described above. The resulting DNA was used to transform E. coli cells. This plasmid is called pC
Named E18.

In order to insert this NDV coding sequence into the FPV insertion vector, a 1.9 Kbp Sma I-Hind III fragment purified on a gel of pCE18 (cut at the polylinker region) was used.
It was ligated to the Sma I-Hind III fragment. The transcription termination signal is Sma
It occurs 16 bases downstream of the I site. The resulting plasmid is called pC
Named E20.

Plasmid pCE20 was replaced with Fowlpox virus FP-
1 was used in an in vitro recombination test using the virus as a rescue virus. The resulting progeny were spread on a CEF monolayer and the plaques were stained with β-polyclonal anti-NDV chicken serum.
The samples were subjected to galactosidase-linked protein A immunoscreen. After selecting positively stained plaques and purifying the plaques four times, a single population was obtained.
Named 9

Example 15 Generation of Avipoxvirus Expressing Feline Leukemia Virus (FeLV) Envelope (env) Glycoprotein The FeLV env gene contains a sequence encoding the p70 + P15E polyprotein. The FeLV gene was first inserted into the plasmid pSD467vC with the vaccinia H6 promoter juxtaposed 5 'to this gene. Plasmid pSD467vC
1802 bp containing the vaccinia hemagglutinin (HA) gene
The Sal I / Hind III fragment was first inserted into the pUC18 vector. The location of the HA gene has already been elucidated (Shida, virology 15 ).
0 , 451-462, [1988]). The majority of the open reading frame encoding the HA gene product is missing (nucleotide 443 to nucleotide 1311), and Bgl II, Sma I, Pst I, and Eg
A multiple cloning site containing an aI restriction enzyme site was inserted. The resulting pSD467vC plasmid contains a vaccinia flanking arm 442 bp upstream of the multiple cloning site and 491 bp downstream of these restriction sites. These flanking arms can insert the genetic material into the multiple cloning site and recombine into the HA site of the vaccinia virus strain Copenhagen. The obtained recombinant progeny was HA negative.

The H6 promoter was synthesized by annealing four overlapping oligonucleotides consisting of the complete sequence described in the preferred embodiment. 132 obtained
The base fragment had a Bgl II restriction site at the 5 'end and a Sma I site at the 3' end. Bgl II and Sma I
This was inserted into pSD467vC via a restriction site. The resulting plasmid was named pPT15. This FeLV env gene was inserted into the unique PstI site of pPT15 just downstream of the H6 promoter. The resulting plasmid was named pFeLV1A.

For production of FP-1 recombinant, 2.4 Kbp of H6 / FeLV env
The sequence was cut from pFeLV1A by Bgl II digestion and Pst I partial digestion.

The Bgl II site is at the 5 'boundary of the H6 promoter sequence.
The Pst I site is 420 bp downstream of the translation termination signal in the envelope glycoprotein reading frame.

This 2.4 Kbp H6 / FeLV env sequence was inserted into BamHI and PstI digested pCE11. The FP-1 insertion vector pCE11 was derived from pRW731.13 by inserting a multiple cloning site into a non-essential Hinc II site. This insertion vector is called FP
FP-1 recombinant carrying the foreign gene can be produced at locus f7 of the -1 genome. The recombinant FP-1 / FeLV insertion plasmid was named here pFeLVFI. This construct does not give a complete ATG for ATG substitution.

Complete ATG: About 1.4 Kbp of Nru I / Sst
One vaccinia virus insertion vector pFeLV1C
Derived from The Nru I site is located 24 bp upstream from ATG.
Occurs in the H6 promoter. Sst II site is 1.4 Kb from ATG
It is located p downstream and 1 Kbp upstream of the translation termination signal. This Nru I
/ Sst II fragment was generated by Sst II digestion and Nru I partial digestion
Ligation to the 9.9 Kbp fragment. This 9.9 Kbp fragment contains the 5.5 Kbp FP-1 adjacent arm which is the pUC vector sequence, the 1.4 Kbp FeLV sequence corresponding to the downstream part of the env gene, and most of the sequence 5 'to the H6 promoter (about 100 bp). are doing.
The resulting plasmid was named pFeFLVF2. This ATG for ATG construction was confirmed by nucleotide sequence analysis.

Another FP-1 insertion vector, pFeLVF3, contains a FeLV env corresponding to a putative immunosuppressive region (Cianciolo et al., Science 230 , 453-455 [1985]) (nucleotides 1548 to 1628 of the coding sequence). Derived from pFeLVF2 by removing the sequence. This was accomplished by isolating an approximately 1 Kbp SstII / PstI fragment (site described above) from the vaccinia virus insertion vector pFeLV1D. This plasmid pFeLV1D corresponds to the immunosuppressive region (nucleotides 1548 to 1628).
v Similar to pFeLV1C except that the sequence was deleted by oligonucleotide mutagenesis (Mandecki, Proceedings of National Academy of Sciences US
A, 83 , 7177-7181 [1987]). Nucleotides 1548-1
The 1 Kbp Sst II / Pst I fragment missing up to 628 was
1 containing the remaining H6: FeLV env gene derived from LVF2
It was inserted into a 0.4 Kbp Sst II / Pst I fragment.

Insertion plasmids pFeLVF2 and pFeLVF3 contain the rescuing virus FP
-1 was used for the in vitro recombination test. The progeny of this recombinant was spread on a CEF monolayer and the recombinant virus was selected by plaque hybridization on the CEF monolayer. Recombinant progeny identified by hybrid analysis were selected and plaque purification was performed four times to obtain a homogeneous population. The FP-1 recombinant carrying the entire FeLV env gene was named vFP-25, and the FP-1 recombinant containing the entire gene lacking the immunosuppressive region was called vFP-25.
It was named -32. The two recombinants were both bovine anti-Fe
LV polyclonal serum (Antibodi
es, Inc.), Davis, California)
Immunoprecipitation with, indicated that it expressed the appropriate gene product. These FP-1 recombinants were
It is also important to express the exogenous FeLV env gene in a cell line (ATCC # CCL94), which is of cat origin.

For the preparation of canarypox (CP) recombinants, the 2.2 Kbp fragment containing the H6: FeLV env sequence was ligated with Sma I and Hp
Dissociated from pFeLVF2 by aI digestion. This Sma I site is at the 5 'boundary of the H6 promoter sequence. The Hpa I site is located 180 bp downstream of the translation termination signal in the envelope glycoprotein reading frame.

2.2 Kbp H6 / FeLV env sequence insert plasmid pRW764.2
At the non-essential Eco RI site, followed by blunt end of the Eco RI site. This insertion vector is the locus of the CP genome.
Produce a CP recombinant carrying a foreign gene in C4.
This recombinant CP insertion plasmid was named here pFeLVCP2. This construct provides one complete ATG for ATG substitution.

The insertion plasmid pFeLVCP2 was used for an in vitro recombination test using CP as the rescue virus. After applying the progeny of this recombinant to a CEF monolayer, β-galactosidase-conjugated protein A using bovine anti-FeLV commercially available polyclonal serum (Antibodies, Davis, CA)
Recombinant viruses were selected by the immunoscreen method. After staining positive plaques were selected and plaques were purified four times, a homogeneous population was obtained. The recombinant expressing the complete FeLV env gene was named vCP-36.

Example 16 Preparation of Fowlpox Virus Recombinant vFP-22 Expressing the Rouss-Associated Virus Type 1 (RAV-1) Envelope (env) Gene The clone penvRV1PT of the RAV-1 envelope gene was
Contains 1.1 Kbp of RAV-1 env DNA encoding the sequence cloned as a KpnI-SacI fragment in M13mp8. Although this fragment had the 5 'end as it was, it lacked a part of the 3' sequence, and was used in the following procedures. Eco RI-P derived from 1.1 kbp gel-purified penvRVI
The stI fragment was inserted into the EcoRI and PstI sites of pUC9, resulting in pRW7
56 were produced. This plasmid was digested with Kpn I and Hind III and cut at 59 bases upstream of ATG in the vector. The 146 base pair KpnI-HindIII fragment containing the vaccinia H6 promoter described above was inserted to create plasmid pCE6.

To confirm that the starting ATG of the RAV env gene was adjacent to the 3 'end of the H6 promoter lacking foreign sequences, two complementary synthetic oligonucleotides were made at the terminal Eco RV and Ban II sites. . This oligonucleotide sequence Met.

Plasmid pCE6 was digested with Eco RV, which cuts 24 bases upstream of ATG in the H6 promoter, and Ban II, which cuts 7 bases downstream of ATG in the sequence encoding RAV env. This D
The NA fragment was ligated and used for transformation of E. coli cells. The resulting plasmid, pCE7, provided the H6 promoter and the correct 5 'sequence for final construction.

Clone mp19env (190) was found by restriction enzyme mapping to contain the entire RAV-1 env gene. 1.9 Kbp Kpn I-Sac of mp19env (190) containing all genes
The I fragment was inserted into the KpnI and SacI sites of pUC18 to form pCE3. This plasmid was digested with HpaI, which cuts 132 bases downstream of the starting ATG in the sequence encoding RAV-1, and SacI, which cuts at the 3 'end of the gene. The previously described FPV insertion vector pCE11 was digested with SmaI and SacI, and this plasmid was cut with a polylinker region. Hpa for pCE3
The I-Sac fragment was ligated with pCE11 to create pCE14.

Plasmid pCE7 was then digested with Xho I and Hind III and H6
A 332 base pair fragment containing the promoter and the correct 5 'sequence was generated. Plasmid pCE14 was digested with HindIII which cuts at the polylinker region of this vector and XhoI which cuts at the coding sequence. Hind III obtained from this DNA by pCE7
Ligation with the -XhoI fragment formed pCE15, the final RAV-1 envelope gene construct.

This plasmid was used for an in vitro recombination test using Fowlpox FP-1 as a rescue virus. Recombinant progeny were spread on CEF monolayers and plaques were screened in a β-galactosidase-linked protein A immunoassay using anti-RAV-1 polyclonal serum. After selecting positive staining plaques, the plaques were purified four times to obtain a single population. The recombinant produced was named vFP-22. vFP−
22 Apparent molecular weights corresponding to two gene products of the envelope gene from immunoprecipitation experiments using the infected CEF lysate
It was shown that two proteins having 76.5Kd and 30Kd were specifically precipitated. No precursor gene products were found.

Preliminary studies have elicited an immune response to this RAV-1 envelope gene product in chickens inoculated with vFP-22.

Example 17 Preparation of Recombinant Avipoxvirus Expressing Bovine Leukemia Virus (BLV) gp51,30 Envelope (env) Gene (1) Preparation of pBLVF1 and pBLVF2 Plasmids pBLVF1 and pBLVF2 contain gp51,30env genes of BLV I do. In both plasmids, the BLV env gene is under transcriptional control of the vaccinia virus H6 promoter and is cloned between fowlpox adjacent arms (locus f7). The nucleotide sequences of the two plasmids are identical except for codons 268 and 269. (PBLVF1 encodes the amino acid Arg-Ser containing protein at these two positions,
On the other hand, pBLVF2 encodes a protein containing the amino acid Gln-Thr. PBLVF1 and pBLVF2 were prepared by the following procedure. Plasmid
pNS97-1 is a plasmid containing the entire BLV env gene, which was cut with Bam HI and partially cut with Mst II. A 2.3 Kbp fragment containing the entire gp51,30 gene was isolated on an agarose gel and the sticky end was filled in with E. coli DNA polymerase I (Klenow fragment). PST
After ligating the I linker to the end of the fragment and digesting with Pst I,
It was ligated to the PstI site of pTP15 (Example 15). This places the BLV gene adjacent to the vaccinia promoter H6. (PTP15 contains the vaccinia H6 promoter cloned at a non-essential locus in the vaccinia genome.) This plasmid is then cut with Eco RV and partially cut with Ava II. The 5.2 Kbp fragment was isolated and the oligonucleotide 5'-ATCCGTTAAGTTTGTATCGTAATGCCCAAAGAACGACG-3 '
And 5'-GACCGTCGTTCTTTGGGCATTACGATACAAACTTAACGGAT
This plasmid was recircularized using -3 '. This removes unnecessary bases between the BLV gene and the H6 promoter.

The resulting plasmid was cut with Pst I, partially cut with Bgl II, and a 1.7 Kbp fragment containing the BLV gene whose transcription was promoted by the promoter H6 was replaced with the Bam HI-Pst I site of the previously described foulpox virus insertion vector pCE11. Was cloned using the locus f7. This places the BLV gene with the H6 promoter between fowlpox adjacent arms. This plasmid was named pBLVF1.

PBLVF2 was prepared using the same procedure, but an in vitro mutagenesis procedure was further performed before cloning the BLV gene with the H6 promoter into pCE11. This mutation was introduced by the following procedure. Plasmid pNS97-1 was replaced with XmaI
And partially cut with StuI. Isolating the 5.2 Kbp fragment,
Oligonucleotide 5'-CCGGGTCAGACAAACTCCCGTCGCAG
CCCTGACCTTAGG-3 'and 5'-CCTAAGGTCAGGGCTGCGACGGG
This plasmid was re-cyclized using AGTTTGTCTGAC-3 '. This changes the nucleotide sequence at codons 268 and 269 from CGC-AGT to CAA-ACT.

(2) Preparation of recombinant viruses The plasmids pBLVF1 and pBLVF2 were used in an in vitro recombination test using FP-1 as a rescue virus. Recombinant progeny were selected for in situ plaque hybridization, and if the population was determined to be pure by this criterion, the plaques were converted to ββ using a BLVgp-specific monoclonal antibody preparation.
Screened by galactosidase protein A immunoassay. Both recombinants vFP23 and vFP24, made from plasmids pBLVF1 and pBLVF2, respectively, stained positive on immunoscreens, indicating that immunologically recognizable glycoproteins were expressed on the infected cell surface. Was.

Plasmids pBLVK4 and pBLVK6 are, respectively,
It contains the env gp51,30 gene and the BLV gp51,30 cleavage minus gene. Both genes are the only Eco of pRW764.2
It has been cloned into the RI site (locus C3) (for pRW764.2, described in Example 13) and is under the transcriptional control of the vaccinia H6 promoter.

This plasmid was derived by the following procedure. pBLVF1 and
pBLVF2 was cut with the restriction enzyme HindIII. Oligonucleotide BKL1 (AGCTTGAATTCA) is cloned into this site to create an Eco RI site 3 'of the BLV gene. this
Since there is also an Eco RI site on the 5 'side of the BLV gene, these plasmids (pBLVK1 and pBLVK2) were cut with Eco RI and
A fragment containing the BLV gene whose transcription was promoted by the 6 promoter was cloned into the EcoRI site of pRW764.2. The resulting plasmids were named pBLVK4 and pBLVK6, respectively.
These plasmids were used in an in vitro recombination test using Canarypox as a rescue virus. Recombinants were selected and purified based on the expression on the surface of the glycoprotein detected by the immunoassay. Plasmid pBLV
Recombinants from K4 and pBLVK6, respectively, were named vCP27 and vCP28.

Sheep and cattle were inoculated with fowlpox recombinants vFP23 and vFP24 by various routes. Inoculate the animal twice,
The second was 45 days after the first. Serum samples were collected 5 weeks after the first inoculation and 2 weeks after the second inoculation. Antibodies to gp51 were measured in a competitive ELISA test and the titer was 50
It was expressed as the reciprocal of the serum dilution that inhibited%. Table XI results
It was shown to.

None of the species tested showed a detectable immune response after the first inoculation. Both sheep and cattle showed significant antibody elevation after the second vaccination.

Example 18 Preparation of Fowlpox Virus FP-1 Recombinant vFP-26 Expressing Infectious Bronchitis Virus Mass 41 Matrix Gene Plasmid pIBVB63 contains an infectious bronchitis virus (IBV) cDNA clone of the matrix gene of the Mass41 strain I do. The 8 Kbp Eco RI fragment of pIBVB63 was ligated to the upstream (5 '
Side) contains a matrix gene having a pepromer gene, and further upstream there is an Eco RV site. Plasmid pRW715 contains an Eco R that binds the two Pvu II sites of pUC9.
It has an I linker. 8 Kbp Eco RI from pIBVM63
The fragment was inserted into the pRW715Eco RI site to generate pRW763. A plasmid pRW776 lacking the 5 'Eco RI site of the plasmid pRW763 was prepared, and the unique Eco RI site downstream (3' side) of this matrix gene was left. The isolated Eco RI partially digested linear product of pRW763 was cut again with Eco RV. The largest fragment was isolated and DNA polymerase I
Was blunt-ended with Klenow fragment and self-ligated to produce pRW776. The construct pRW776 contains the entire IBV pepromer gene and the entire matrix gene, followed by a unique Eco RI site.

The sequence of only the 5 'and 3' ends of the matrix gene of about 0.9 Kbp had been determined. The 5 'sequence of the matrix gene beginning with the translation initiation codon (ATG) contains an Rsa I site underlined below. ATGTCCAACGA
GACAAATT GTAC . The previously described H6 promoter was linked to this matrix gene with a synthetic oligonucleotide. This synthetic oligonucleotide is located between the Eco RV site and the ATG.
It contains the H6 sequence and was inserted into the matrix coding sequence via the first Rsa I site. This oligonucleotide was synthesized to have Bam HI and Eco RI ends so that it could be inserted into pUC9, and pRW772 was prepared. The Eco RI end is 3 'of the Rsa I site. Starting from the Bam HI compatible end. The sequence of this double-stranded synthetic oligonucleotide (ATG is underlined) It is.

The Rsa I partially digested linear product of pRW772 was isolated and Eco RI
Was cut again. The pRW772 fragment having the site cut once at the RsaI site and recut with EcoRI was treated with phosphatase and used as a vector for the following pRW776 digestion product.

The isolated linear Rsa I digest of pRW776 was digested with Eco RI
Was cut again. The Eco RI site is just beyond the 3 'end of the matrix gene. About 0.8K containing the sequence encoding the matrix from the Rsa I site above
The bp Ras I-Eco RI isolated fragment was inserted into the pRW772 vector described above to generate pRW783. The complete H6 promoter is
It was formed by adding a sequence 5 'of the Eco RV site. The 5 'end of the H6 promoter is blunt-ended and inserted into the SalI site of pUC9 to create an EcoRI site.
5 'of this H6 promoter was pUC9
Hind III site. The Hind III-Eco RV fragment containing the 5'H6 promoter was ligated with pRW783 Hind III and Eco R
It was inserted between the V sites to generate pRW786. pRW786 Eco R
The I fragment contains the complete matrix gene with the H6 promoter and is blunt-ended with the Klenow fragment of DNA polymerase I and inserted into the blunt-end Bam HI site (locus f8) of pRW731.15 to create pRW789. . This pRW731.15 Bam HI site was identified in Example 6 as vFP-8
This is the FP-1 locus used for the preparation of

Plasmid pRW789 was used for construction of vFP-26. Recombinant plaques were selected and treated with in situ plaque hybridization.

In a preliminary study, chickens inoculated with vFP-26 were IBV
An immune response to the matrix protein was elicited.

Example 19 Fowlpox virus FP-1 recombinant vFP expressing infectious bronchitis virus (IBV) peplomer
Preparation of -31 cDNA clone pIBVM63 of infectious bronchitis virus (IBV) Mass41 and its subclone pRW776 have already been described for the preparation of vFP-26 in Example 18. Subclone pRW776 contains a 4 Kbp IBV peplomer gene followed by a matrix gene with a unique Eco RI site at the 3 'end. Only the sequences at the 5 'and 3' ends of the approximately 4 Kbp IBV hepromer gene have been determined. Separated into two genes at a unique Xba I site. The 5 'end of the peplomer gene beginning with the translation initiation codon (ATG)
It has the Rsa I site underlined below. ATG
TTGGTAACACCTCTTTTACTAGTGACTCTTTTGTGT GTAC . The previously described H6 promoter was linked to the pepromer gene with a synthetic oligonucleotide. This synthetic oligonucleotide contained the H6 promoter sequence from the Nru I site to the ATG and was inserted into the pepromer coding sequence via its first Rsa I site. This oligonucleotide was synthesized with ends compatible with Bam HI and Eco RI for insertion into pUC9 to produce pRW768. Eco RI terminal is Rsa
3 'of the I site. The sequence of the double stranded synthetic oligonucleotide starting at the Bam HI compatible end (ATG is underlined) It is. The isolated linear Rsa I partial digest of pRW768 was re-cut with Eco RI. The pRW768 fragment containing the site cut at the above RsaI site and recut with EcoRI was isolated, treated with phosphatase, and used as a vector for the following pRW776 digestion product.

The isolated linear Rsa I partial digest of pRW776 was digested with Eco R
I cut again. Cut once at the above Rsa I site and Eco R
A 5 Kbp pRW776 fragment containing up to the I site was isolated. This fragment contains the IBV sequence from the above-described pepomer Rsa I site to the Eco RI site at the 3 'end of the matrix gene. This pRW776 fragment was inserted into the above-described pRW768 vector to prepare pRW788. This matrix gene was transferred to the XbaI site described above. The 5'H6 promoter was added to the NruI site by inserting the 4 Kbp pRW788 NruI-BamHI blunt-end fragment into the pRW760 NruI-BamHI blunt-end vector, creating pRW790. The vector pRW760 is described in Example 11 and is simply a vaccinia influenza nucleoprotein that is transcriptionally driven by the H6 promoter adjacent to the non-essential FP-1 locus f7. This pRW760 vector was made by removing the 3'H6 sequence from the Nru I site to the Bam HI end of the nucleoprotein. pRW790 is an IBV peplomer bearing the H6 promoter in the pRW731.13 Hinc II site. The donor plasmid pRW790 was recombined with FP-1 to generate vFP-31. An immunoprecipitation experiment was performed using a CEF lysate prepared from vFP-31 infected cells, and it was shown that a small amount of a precursor protein having a molecular weight of about 180 Kd and a small amount of a degradation product of 90 Kd were specifically precipitated. Was.

Example 20 Preparation of Fowlpoxvirus FP-1 Recombinant vFP-30 Expressing Herpes Simplex Virus gD Herpes Simplex Virus (HSV) Type 1 KOS Glycoprotein D
The gene (gD) was ligated to the Bam HI site of pUC9 at 5 'Bam HI
It was cloned as a fragment from HpaII to 3'BamHI-ligated NruI. The 5 'end is adjacent to the pUC9 Pst I site. The 5 'sequence of HSVgD beginning with the translation initiation codon (ATG) contains an Nco I site underlined below.

The previously described vaccinia H6 promoter was linked to the HSVgD gene with a synthetic oligonucleotide. It contains the 3 'portion of the H6 promoter from Nru I to ATG and further to the Nco I site of the gD coding sequence. This oligonucleotide was synthesized to have a Pst I compatible 5 'end. g of pUC9
The D clone was cut with Pst I and Nco I, the 5'HSV sequence was removed and replaced with a synthetic oligonucleotide to give pRW787. The sequence of this double-stranded synthetic oligonucleotide is When pRW787 is digested with Nru I and Bam HI, HSV from Nru I site
An approximately 1.3 Kbp fragment containing the 3'H6 promoter through the gD coding sequence to the Bam HI site is created. The cutting of this pRW760 vector with Nru I and Bam HI was described in Example 11. This 1.3 Kbp fragment was inserted into the pRW760 vector to produce pRW791. This pRW791 vector contains pRW73
The non-essential FP-1 Hinc II site at 1.13 (locus f7) contains the HSVgD gene that is transcriptionally promoted by the complete vaccinia promoter.

The donor plasmid pRW791 was recombined with FP-1 and vFP-3
Got 0. Glycoprotein surface expression is determined by protein A-β
-Detected in recombinant plaques using galactosidase-linked immunoassay and HSV-1 specific serum.

Example 21 Use of Entomopox Promoter to Control Expression of Foreign Gene in Poxvirus Vector (a) Background Insect poxviruses (poxviruses) are currently in the Enmopox subfamily (Entomo-
poxvirinae) and beetles (Celeoptet)
a), lepidoptera (Lipidoptera), and three genera (A, B, C) corresponding to entmopoxviruses isolated from insects belonging to the order of Orthoptera, respectively. It is known that entmopoxviruses originally have a narrow host range and do not replicate in any vertebrates.

The entmopox virus used in this study was an originally infected Indian Amsacta moor
ei) (Lepidoptera: arctildae) isolated from larvae (Roberts and Granados, Journal of Inverte Pathology (J. Invertebr. Pathol.) 12 , 141 −
143 [1968]). This virus is named AmEPV and is a species of the genus B.

Dr. R. Granados (Boyce Thompson Institute)
Institute), Cornell University
From the infected Estigmene acrea (Estigmene ac
rea). The virus is Lymantria disper
Invertebrate cell line derived from ovarian tissue
Replicated in IPLB-LD652Y (Goodwill et al., In Vitro 14 , 485-4).
94 [1978]). The cells were transformed with 4% fetal calf serum and 4%
The cells were grown at 28 ° C. in IPL-528 medium supplemented with chicken serum.

Plaque assay of wild-type virus in LD652Y cells,
One plaque, designated V1, was selected for the following experiments. This isolate has a number of occlusion bodies (OBs) in the cytoplasm of infected cells late in the infection cycle.
To produce

(B) Promoter identification The identification and mapping of the AmEPV promoter were completed as follows. Total RNA from recently infected LD652Y cells (48 h post-infection) was isolated and used to generate the first ³² P-labeled cDNA strand. This cD
NA was used as a probe in a blot containing a restriction digest of AmEPV. A strong signal was detected on the 2.6 Kb Cla I fragment in this Southern blot, indicating that this fragment encodes a strongly expressed gene. This fragment was cloned into a plasmid vector and its DNA sequence was determined.

Analysis of the sequence data revealed an open reading frame capable of encoding a 42 Kd polypeptide. In vitro translation of total RNA 48 hours post-infection and isolation of the product by SDS-PAGE revealed one polypeptide of about 42 Kd.

(C) Preparation of recombinant vaccinia virus expressing foreign gene under control of entmopox promoter In order to examine whether or not the entmopox promoter functions in a vertebrate poxvirus system, the following plasmids were prepared. 42K adjacent to the Bgl II site at the 5 'end
An oligonucleotide containing 107 bases 5 'of the gene translation initiation signal (hereinafter referred to as the AmEPV42K promoter) and the first 14 bases at the 3' end of the hepatitis B virus pre-S2 coding region terminating at an EcoRI site was ligated. Synthesized chemically. The AmEPV42K promoter sequence is described below.

This AmEPV42K promoter was ligated to the hepatitis B virus surface antigen (HBVsAg) as follows. The vaccinia virus arm in a non-essential region of the vaccinia virus genome encoding the hemagglutinin (HA) molecule (the HA arm is described in Example 15; the HA region is described by Shida Virology, 150 , 451-462 [1986]. ], Adjacent to the pre-S2 coding region (type ayw is Galibert)
Nature, 281 , 646-650 [197
9]) and a pUC plasmid containing the hepatitis B virus surface antigen was prepared. The oligonucleotides described above can be used in HBVs
A unique Eco RI site in the coding region of Ag and a unique Bgl II site in the HA vaccinia arm were used to insert into this plasmid. The obtained recombinant vaccinia virus was named vP547.

The expression of the coding sequence of the inserted HBVsAg under the control of the Enmopox 42K promoter was confirmed using an immunoassay. Equivalent cultures of the mammalian cell line BSC-40 were infected with parental vaccinia virus or recombinant vP547.
Cells were lysed 24 hours after infection, and the lysate was serially diluted and mounted on a nitrocellulose membrane. The membrane was first incubated with goat anti-HBV serum and then with ¹²⁵ I protein A. After washing, the film was exposed to an X-ray film. Positive signals were detected in cultures infected with vP547 but not in cultures infected with the parental virus, suggesting that the Vaccinia virus in mammalian cells recognizes the AmEPV42K promoter.

The above results were confirmed using an Auslia assay for detecting HBVsAg in infected mammalian cells (see Example 1 for details). Infect BSC-40 cells with HBsAg-containing vaccinia virus recombinant conjugated to the AmEPV42K or vaccinia virus H6 promoter, sAg
Expression levels were assayed in the Ausria test. As shown in Table XII, the data indicate that the HBsAg expression level using the 42K promoter is remarkable.

Furthermore, Am in a vertebrate poxvirus environment
An experiment was performed to confirm the temporal properties of EPV42K promoter regulation. Equivalent cultures of BSC-40 cells were infected with vP547 in the presence or absence of 40 μg / m cytosine arabinoside, which inhibits late virus transcription and thereby DNA replication. Expression levels at 24 hours post-infection were assayed in the Ausria test. These results suggested that this 42K promoter was recognized as an early promoter in the vaccinia virus replication system.

Use of the AmEPV42K promoter for expression of foreign genes in mammalian systems has been demonstrated to enhance gene expression in invertebrate systems by using Autographa californica.
alitornica) Using the NPV polyhedrin promoter (Luckow and Summers, Biotechnology 6 , 47-55 [198
It should be noted that this is clearly different from [8]). The polyhedrin promoter is not recognized by the transcription machinery in mammalian cells (Tjla, virology,
125 , 107-117 [1983]). AmEPV42 in mammalian cells
The use of the K promoter is the first example where an insect virus promoter was used to express foreign genes in non-insect viral vectors in non-invertebrate cells.

To determine whether avipox viruses similarly recognize the 42K entomopox promoter, the following experiment was performed. For the same culture of CEF cells, fowlpox virus per cell 10 pfu, Canary pox virus, or vaccinia virus was inoculated, HBV play S ₂ linked to simultaneously 1) 42K promoter
Plasmid 42K.17 containing the + sAg coding sequence, or 2) plasmid pMP15. Containing the coding sequence of HBVsAg linked to the vaccinia virus H6 promoter previously described.
Transformation was performed with 25 g of either plasmid of spsP. Twenty-four hours later, the culture was frozen to lyse the cells and the presence of HBVsAg in the lysates was analyzed using the Austrian test.

The results shown in Table XIII should be considered quantitatively. As a result, the transcription mechanisms of both foulpox and canarypox can recognize the 42K promoter, and
It is suggested that it allows transcription of the BVsAg coding sequence. Expression levels are lower than those obtained with the vaccinia virus H6 promoter, but well above background levels obtained with the negative control.

Example 22 Immunization with VCP-16 to Protect Mice Against Live Rabies Virus Challenge Two recombinant (a) vFP-6 (Example) in the footpad of a group of 20 4-6 week old mice A predetermined amount of a dilution of 50 to 100 μ of either the foul pox rabies recombinant described in No. 6 or (b) vCP-16 (the canary pox rabies recombinant described in Example 13) was inoculated.

On the 14th, 10 mice were sacrificed from each group and serum was collected.
Serum anti-rabies titers were calculated using the RFFI test described in Example 7. The remaining 10 mice in each group were challenged with the rabies virus CVS strain used in Example 7 by intracerebral inoculation. Each mouse is equivalent to 16 times the mouse L _D50 30.mu.
Was administered. On day 28, surviving mice were examined and a 50% protective dose (PD ₅₀ ) was calculated. The results are shown in Table XIV.

The protection level of mice found from vFP-6 inoculation was:
Fowlpox recombinant vFP-3 studied in Example 7
This confirms the results shown in the inoculation. vCP-16
The level of protection provided by vaccination is quite high. When the calculated PD ₅₀ as a reference, in the protection against rabies attack, than fowlpox rabies recombinants towards Canary pox rabies recombinant is 100 times more effective.

Example 23 Use of a Fowlpox Promoter Element for Foreign Gene Expression I. Identification of a Fowlpox Gene Encoding a 25.8 Kilodalton (KD) Gene Product SDS polyacrylamide gels were stained with Coomassie blue to produce Fowlpox (FP) -1) Staining of the protein species present in the infected CEF lysate revealed the major molecular species with an apparent molecular weight of 25.8 KD. This protein was not present in uninfected cell lysates. Pulse experiments in which proteins synthesized at specific times after infection are radiolabeled with ³⁵ S-methionine show that the FP-1 induced protein is abundant, and that this protein is from 6 hours to 54 hours after infection. Was suggested to be synthesized. At peak level, this FP-1 25.8 KD protein accounts for approximately 5% of the total protein present in the cell lysate.
Accounts for up to 10%.

The gene encoding this gene product has a strong FP-1
It was suggested that it was controlled by a promoter element. Polysomal preparations were obtained from FP-1-infected CEF cells 54 hours post-infection to determine the location of this promoter element for use in expressing foreign genes in poxvirus recombinants. RNA was isolated from this polysomal preparation and produced mainly 25.8 KD of the FP-1 protein when used in an in vitro translation system for rabbit reticulocytes.

This polysomal RNA was used as a template for the first cDNA strand synthesis using oligo (dT) 12-18 as a primer. This first cDNA strand was used as a hybridization probe in Southern blot analysis of the FP-1 genomic digest. From the results of these hybridization analyses,
The gene encoding the 25.8KD protein is 10.5 Kbp Hi
It was suggested that it was contained in the ndIII fragment. Next, the genomic Hind III fragment was isolated and the commercially available vector pBS (Stratagene), La Jolla (La Jolla) was used.
a), California) and clone this clone into pFP23
It was named K-1. Hybridization analysis using the first cDNA strand as a probe of the digest of pFP23K-1 revealed that the 25.8 KD protein gene was located on a 3.2 Kbp Eco RV small fragment. This fragment was cloned in pBS and named pFP23K-2.

The nucleotide sequence of this FP-1 Eco RV fragment of about 2.4 Kbp is determined by Sanger's dideoxy chain terminator method (Sanger et al., Proceedings of National Academy of Sciences USA, 74 , 5463-546).
7 [1977]). Analysis of the sequence revealed a molecular weight of 25.8K
An open reading frame (ORF) encoding the gene product of D was revealed. In vitro run-off transcription of this ORF with bacteriophage T7 polymerase in a pBS vector yields a rabbit reticulocyte in vitro translation system (Promega Biotec, Madison
n), Wisconsin) Apparent molecular weight 25.
An RNA species producing an 8 KD polypeptide species was obtained. This polypeptide was purified on a SDS-polyacrylamide gel by F
It has the same mobility as the abundant 25.8 KD protein observed in the P-1 infected CEFs lysate. These results suggest that this is the gene encoding the FP-1 induced abundant 25.8KD gene product.

II. FP-1 and FP-1 for expressing feline leukemia virus (FeLV) env gene in vaccinia recombinants
Use of upstream promoter element of 25.8KD gene FP-1 270b containing 25.8KD gene regulatory region (FP 25.8K promoter) and 21 bp 25.8KD gene coding sequence
The p Eco RV / Eco RI fragment was isolated from pFP23K-2. pFe
FP 2 used to induce LV 25.8F1 and pFeLV 25.81A
The nucleotide sequence of the 5.8K promoter region is shown below. This 270 nucleotide sequence represents 249 nucleotides upstream of the start codon (ATG) of the 25.8KD gene product and the first 21 bp of the coding sequence.

Using this fragment as the blunt end, a SmaI digested FP-1 insertion vector containing the FeLV env sequence (pFeLVF1: Example 15)
Reference). This insertion vector allowed recombination at the f7 locus of the FP-1 genome. This upstream sequence of the FP 25.8K promoter was inserted 5 'to the FeLV env gene, and it was confirmed by sequence analysis that they had the correct orientation. This insertion does not confer full ATG on ATG substitution, but does not confer ATG provided by the 25.8 KD gene.
Is outside the frame of this FeLV env ATG, so no fusion protein is formed. An FP-1 insertion plasmid containing the FP25.8KD promoter upstream of the FeLV env gene was inserted into pFeLV25.8F1
It was named.

The vaccinia virus insertion vector pFeLV1A has the FeLV gene (see Example 15), and a similar construct was prepared using this vector. This H6 promoter
It was cut from pFeLV1A by digestion with Bgl II and Sma I. Bgl
After blunt-ending the II restriction site, a blunt-ended Eco RV / Eco RI fragment (270 bases) containing the FP25.8K promoter was inserted adjacent to the 5 ′ side of the FeLV env gene. This structure was confirmed by sequence analysis. This recombinant also has no complete ATG for ATG replacement, but 25.8
The ATG of the KD gene is not in the frame with the ATG of the FeLV gene.
The vaccinia (Copenhagen strain) insertion vector has a 25.8 KD gene upstream region adjacent to the 5 'side of the FeLV gene and was named pFeLV25.81A.

The inserted plasmids pFeLV25.8F1 and pFeLV25.81A were used for in vitro recombination with FP-1 (pFeLV25.8F1) as a rescue virus and vaccinia virus strain Copenhagen (pFeLV25.81A). After applying the recombinant progeny to the appropriate cell monolayer, the recombinant virus was selected with β-galactosidase-linked protein A immunoscreen and bovine anti-FeLV serum (Antibodies, Davis, CA). Preliminary results suggested that this FP25.8K promoter could regulate the expression of foreign genes in poxvirus recombinants.

Example 24 Safety and Efficacy of vFP-6 and vCP-16 in Poultry Two avipox recombinants, vFP-6 and vCP-16 (described in Examples 6 and 13) were transformed into 18-day-old chicken embryos, One-day and 28-day-old chickens are inoculated and the response of these chickens to three criteria: 1) the effect of the vaccine on hatchability, response to the vaccine and mortality, 2)
The evaluation was based on the immune response induced by the rabies glycoprotein and 3) the immune response induced by the foulpox antigen. The experiments performed are described below.

A. Safety test A group consisting of 20 18-day-old animals and having a log ₁₀ TCID ₅₀ of either vFP-6 or vCP-16 of 3.0
Or 4.0 times volume was inoculated. After hatching, the chickens were observed for 14 days, and serum was collected. The two recombinants inoculated into the chicken embryo had no effect on the hatchability of the eggs, and the chicken remained healthy during the 14-day observation period.

A group consisting of 10 1-day-old SPF chickens was inoculated intramuscularly with 3.0 times the log ₁₀ TCID ₅₀ of any of the above recombinants. The chickens were observed for 28 days, and serum samples were collected on days 14 and 28 after inoculation. None of the recombinants showed any vaccine response at the inoculation site, and the chickens were healthy during the 28-day observation period.

Groups of 10 28-day-old chickens were inoculated with any of the recombinant viruses. Dosage is 3.0 log by muscle route
₁₀ TCID ₅₀ or skin was either 3.0 log ₁₀ TCID ₅₀ by (blade network) pathway. The chickens were observed for 28 days and 14 days after inoculation.
Serum samples were collected on day 28. No reaction was observed when any recombinant was intramuscularly injected. Although skin inoculation caused Fowlpox to have a very small vaccine response,
Lesions differed in size. Canarypox inoculation resulted in normal skin lesions at the site of inoculation. All lesions had regressed by the end of the experiment.

B. Immune Response Using the RFFI test described above in Example 7,
Antibody levels against rabies glycoprotein were evaluated. The results of each group were calculated based on the standard serum containing 23.4 IU, and the geometric mean titer of each serum was calculated using the International Units (I
U). Determine the minimum positive level as 1 IU,
Used to determine the percentage of positive chickens. Antibodies to avipoxviruses were tested by ELISA using a fowlpox virus strain as an antigen. Each serum sample was diluted 1:20 and 1:80. A standard curve was drawn using positive and negative sera. The minimum positive level was calculated as the mean of various values of negative serum plus two standard deviations.

The serologic results are shown in Table XV for vFP-6 and vCP
-16 is shown in Table XVI.

Limited serologic response to rabies or fowlpox antigens was observed in embryos inoculated with either vFP-6 or vCP-16. The foulpox vector elicited a serological response to both antigens in more chickens than canarypox, but this response was also variable.

Chickens inoculated with vFP-6 at 1 day of age showed good serologic response, and all chickens were seropositive for rabies antigen and fowlpox antigen by 28 days after inoculation. Response to vCP-16 inoculation was much lower, 2
On day 8, 40% of chickens were seropositive for rabies glycoprotein and 10% of chickens were seropositive for avipox antigen.

At 28 days of age, chickens inoculated with vFP-6 via the muscle route
By 14 days after inoculation, 100% seroconversion had been performed for both antigens. Most of the chickens also seroconverted after skin inoculation, but the titers obtained for both rabies and avipox antigens were low. As already mentioned, vCP-16 in both muscle and skin routes
The chickens vaccinated with ATP showed different responses, with up to 70% seroconversion to intramuscular rabies. Low levels of seroconversion to avipox antigen after canarypox inoculation may reflect the degree of serological closeness between the viruses.

The above results suggested that both vFP-6 and vCP-16 are safe to inoculate in a certain age range of chickens. The foulpox vector vFP-6 appears to be more effective in raising an immune response in chickens. It is important, however, that recombinants of both the avipox viruses fowlpox and canarypox are effective for immunization in eggs.

Example 25 Safety and Immunogenicity of Inoculating Piglets with vFP-6 Recombinant vFP-6 was inoculated by one of two administration routes to two groups of three piglets per group.

a) Three piglets received 8.1 log ₁₀ TCID ₅₀ by intramuscular inoculation, and b) three piglets received the same amount by oral inoculation.

Blood was collected from all animals at weekly intervals and boosted on day 35 by the same route and dose. The piglets were observed daily for clinical signs. Serum was tested for anti-foulpox antibodies by ELISA and serum neutralization tests. Rabies antibodies were assayed in the RFFI test.

All piglets remained in good health and no lesions were seen after inoculation. The temperature curves were normal and there was no difference between vaccinated and non-vaccinated animals.

Both piglets vaccinated by the intramuscular and oral routes elicited a serological response to the foulpox antigen, as determined by ELISA and serum neutralization. After the second inoculation, the secondary reaction was pronounced (results not shown). All piglets develop an immunological response to the rabies glycoprotein as measured by the RFFI test, and the additional effects of both pathways are significant. The results are shown in Table XVII.

The results show that inoculation of the foulpox / rabies recombinant is harmless in piglets and that this recombinant can elicit a significant immune response to rabies glycoprotein by oral or intramuscular inoculation. It is suggested.

────────────────────────────────────────────────── ─── Continued on the front page (51) Int.Cl. ⁷ Identification code FI C12N 7/00 C12P 21/00 C C12P 21/00 C12R 1:92 (C12N 15/09 ZNA C12N 15/00 ZNAA C12R 1:92 (31) Priority claim number 186,054 (32) Priority date April 25, 1988 (1988. 4.25) (33) Priority claim country United States (US) (31) Priority claim number 234, 390 (32) Priority date Aug. 23, 1988 (August 23, 1988) (33) Priority country United States (US) (56) References JP-A-58-129771 (JP, A) 1-168279 (JP, A) JP-T-60-500518 (JP, A) JP-T-61-502586 (JP, A) International Publication 86/105806 (WO, A1) Virology, Vol. 160, No. 1, (1987), p. 203-209 Avian Diseases, Vol. 30, No. 1, P. 24-27 Virology, Vol. 156, pp. 355-365 (March 1987)

Claims (8)

(57) [Claims] 1. A method for inducing an immune response in a mammal other than a human, comprising a foreign DNA encoding an antigen of a pathogen to the mammal in a non-essential region of the avipox virus genome and a promoter for expressing the DNA. And inoculating the mammal with a recombinant avipoxvirus that does not replicate productively in the mammal. 2. The method of claim 1, wherein said avipoxvirus is selected from the group consisting of fowlpoxvirus and canarypoxvirus. 3. The method according to claim 1, wherein the inoculation is performed subcutaneously, intradermally, intramuscularly, orally or in ovum. 4. The rabies antigen, rabies G antigen,
The method according to any one of claims 1 to 3, wherein the method is selected from the group consisting of bovine leukemia virus gp51, 30 envelope antigen, feline leukemia virus FeLV envelope antigen, and herpes simplex virus glycoprotein D antigen. 5. The promoter according to claim 1, wherein the promoter is selected from the group consisting of a Pi vaccinia promoter, a Hind III (HH and H6) vaccinia promoter, an 11K vaccinia promoter, a 25.8KD FP-1 foulpox promoter and an AmEPV 42K entmopox promoter. Item 1
The method according to any one of claims 4 to 4. 6. The recombinant avipox virus is fowlpox virus strain 5, wherein the foreign DNA and promoter are inserted at locus F1 or locus F3.
6. The method according to claim 5. 7. The recombinant avipox virus is fowlpox virus strain 1 in which the foreign DNA and promoter are inserted at locus F7 or locus F8.
6. The method according to claim 5. 8. The recombinant avipox virus, wherein the foreign DNA and the promoter are located at locus C3, locus C4, locus C5 or locus C6.
The method according to any one of claims 1 to 5, which is a canarypox virus inserted into the virus.