CH679933A5 - - Google Patents

Download PDF

Info

Publication number
CH679933A5
CH679933A5 CH1652/89A CH165289A CH679933A5 CH 679933 A5 CH679933 A5 CH 679933A5 CH 1652/89 A CH1652/89 A CH 1652/89A CH 165289 A CH165289 A CH 165289A CH 679933 A5 CH679933 A5 CH 679933A5
Authority
CH
Switzerland
Prior art keywords
sep
virus
antigen
promoter
avipox
Prior art date
Application number
CH1652/89A
Other languages
German (de)
Inventor
Enzo Paoletti
Original Assignee
Health Research Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=27492413&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=CH679933(A5) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Health Research Inc filed Critical Health Research Inc
Publication of CH679933A5 publication Critical patent/CH679933A5/de

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • A61P31/22—Antivirals for DNA viruses for herpes viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16611—Simplexvirus, e.g. human herpesvirus 1, 2
    • C12N2710/16622—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/24011—Poxviridae
    • C12N2710/24041—Use of virus, viral particle or viral elements as a vector
    • C12N2710/24043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2730/00—Reverse transcribing DNA viruses
    • C12N2730/00011—Details
    • C12N2730/10011—Hepadnaviridae
    • C12N2730/10111—Orthohepadnavirus, e.g. hepatitis B virus
    • C12N2730/10122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16111—Influenzavirus A, i.e. influenza A virus
    • C12N2760/16122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/18011—Paramyxoviridae
    • C12N2760/18111—Avulavirus, e.g. Newcastle disease virus
    • C12N2760/18122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/20011—Rhabdoviridae
    • C12N2760/20111—Lyssavirus, e.g. rabies virus
    • C12N2760/20122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Virology (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • Oncology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Communicable Diseases (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Hematology (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

The present invention provides a method for inducing an immunological response in a vertebrate to a pathogen by inoculating the vertebrate with a synthetic recombinant avipox virus modified by the presence, in a non-essential region of the avipox genome, of DNA from any source which encodes for and expresses an antigen of the pathogen. The present invention further provides a synthetic recombinant avipox virus modified by the insertion therein of DNA from any source, and particularly from a non-avipox source, into a non-essential region of the avipox genome.

Description

       

  
 



  Die Erfindung betrifft ein rekombinantes Virus zur Expression eines Genprodukts in einem Vertebraten, welches Virus eine DNA enthält, die das Genprodukt ohne replikative Vermehrung des Virus in dem Vertebraten codiert und exprimiert. 



  Avipox oder Avipoxvirus ist eine Vögel infizierende, nahe verwandte Gattung von Pockenviren. Die Gattung Avipox schliesst die Arten Geflügelpocken, Kanarienpocken, Schneehuhnpocken, Taubenpocken, Wachtelpocken, Spatzenpocken, Starpocken und Truthahnpocken ein. Die Art Geflügelpocken infiziert Hühner. Sie darf nicht mit der menschlichen Erkrankung Windpocken verwechselt werden. Die Gattung Avipox hat viele gemeinsame Merkmale mit anderen Pockenviren und ist ein Mitglied derselben Unterfamilie, Pockenviren von Vertebraten, wie Vaccinia. Pockenviren, einschliesslich Vaccinia und Avipox, replizieren innerhalb eukaryotischer Wirtszellen. Diese Viren sind gekennzeichnet durch ihre Grösse, Komplexität und durch ihre Replikation im Cytoplasma.

  Allerdings gehören Vaccinia und Avipox zu verschiedenen Gattungen und sind in ihren jeweiligen Molekulargewichten, ihren antigenen Determinanten und in ihrer Wirtsspezifität verschieden; vgl. Intervirology, Bd. 17, Seiten 42-44, Fourth Report of the International Commitee on Taxonomy of Viruses (1982). 



  Avipoxviren infizieren nicht unter Vermehrung nicht-vogelartige Vertebraten, wie Säugetiere einschliesslich Menschen. Des weiteren vermehrt Avipoxvirus sich nicht, wenn man Säugetier- (einschliesslich Menschen-) Zellkulturen beimpft. In solchen Säugetier-Zellkulturen, die mit Avipox infiziert sind, sterben die Zellen wegen eines cytotoxischen Effekts ab, zeigen aber keine Hinweise auf eine virale Infektion unter Vermehrung. 



  Die Impfung eines nicht-vogelartigen Vertebraten wie z.B. eines Säugetiers mit lebenden Avipocken führt  zur  Bildung  einer  Läsion an  der  Impfstelle,  die  an  eine  Impfung  mit  Vac cinia  erinnert.  Es führt aber zu keiner produktiven viralen Infektion. Allerdings ist nun gefunden worden, dass ein auf diese Weise geimpftes Säugetier immunologisch auf das Avipoxvirus reagiert. Dies ist ein unerwartetes Ergebnis. 



  Impfstoffe, die aus abgetötetem Pathogen oder gereinigten antigenen Komponenten solcher Pathogene zusammengestellt sind, müssen in grösseren Mengen als Lebendvirus-Impfstoffe injiziert werden, um eine effektive Immunantwort hervorzurufen. Der Grund ist, dass Impfung mit Lebendvirus eine viel effizientere Methode der Impfung ist. Ein vergleichsweise kleines Inoculum kann eine effektive Immunantwort hervorrufen, weil das betreffende Antigen während der Replikation des Virus vermehrt wird. Aus medizinischer Sicht bieten Lebendvirusimpfstoffe eine effektivere und länger anhaltende Immunität als eine Impfung mit einem abgetöteten Pathogen oder gereinigten Antigenimpfstoff.

  Daher erfordern Impfstoffe, die aus abgetötetem Pathogen oder gereinigten antigenen Bestandteilen solcher Pathogene zusammengesetzt sind, eine Produktion von grösseren Mengen des Impfstoffmaterials, als es mit Lebendvirus gebraucht wird. 



  Aus der vorangegangenen Diskussion ist klar, dass es medizinische und wirtschaftliche Vorteile für den Gebrauch von Lebendvirus-Impfstoffen gibt. Ein solcher Lebendvirus-Impfstoff enthält Vacciniavirus. Es ist bekannt, dass dieses Virus benutzt werden kann, um mittels rekombinanten DNA-Methoden DNA zu inserieren, die genetische Sequenzen der Antigene von Säugetierpathogenen darstellt. 



  Daher wurden im Stand der Technik Verfahren entwickelt, die die Herstellung von rekombinanten Vacciniaviren durch die Insertion von DNA aus einer beliebigen Quelle (z.B. virale, prokaryotische, eukaryotische, synthetische) in eine nicht-essentielle Region des Vacciniagenoms erlauben, einschliesslich von DNA-Sequenzen, die für antigene Determinanten eines pathogenen Organismus codieren. Bestimmte rekombinante Vac ciniaviren, die mittels dieser Verfahren hergestellt wurden, wurden benutzt, um spezifische Immunität in Säugetieren auf eine Vielfalt von Säugetierpathogenen hervorzurufen, die in der US-A 4 603 112 beschrieben sind, auf deren Inhalt hier Bezug genommen wird. 



  Unverändertes Vacciniavirus hat eine lange Geschichte eines relativ sicheren und wirkungsvollen Gebrauchs zur Impfung gegen Pocken. Vor der Ausrottung der Pocken allerdings, als unmodifiziertes Vacciniavirus weithin verabreicht wurde, gab es ein geringes, aber reales Risiko von Komplikationen in Form einer generalisierten Vacciniainfektion, besonders bei Patienten, die an Ekzemen oder Immunsuppression litten. Eine weitere seltene, aber mögliche Komplikation, die aus der Impfung mit Vaccinia folgen kann, ist postvaczinale Encephalitis. Die meisten dieser Reaktionen ergaben sich bei der Impfung von Personen mit Hautkrankheiten, wie Ekzemen, oder mit einem geschwächten Immunsystem, oder von Individuen in Haushalten, in denen andere ein Ekzem oder eine geschwächte Immunantwort hatten. Vaccinia ist ein Lebendvirus und ist normalerweise harmlos für eine gesunde Person.

  Allerdings kann es zwischen Individuen mehrere Wochen lang nach der Impfung übertragen werden. Wenn eine Person mit einer Schwächung der normalen Immunantwort entweder durch Impfung oder durch Ansteckung durch eine frisch geimpfte Person infiziert wird, können die Folgen ernst sein. 



  Somit ist verständlich, dass ein Verfahren, welches in der Vorgehensweise die Vorteile von Lebendvirus-Impfung einschliesst, jedoch die vorher angesprochenen Probleme vermindert oder ausschliesst, ein höchst wünschenswerter Fortschritt über den gegenwärtigen Stand der Technik wäre. Dies ist heute um so mehr mit dem Vordringen der als "acquired immune deficiency syndrome" (AIDS) bekannten Krankheit von Bedeutung. Opfer dieser Erkrankung leiden an schwerer Immundysfunktion und können leicht durch eine normalerweise sichere Lebendviruspräparation getroffen werden, wenn sie ent weder direkt oder über den Kontakt mit einer Person, die kurz zuvor mit einem derartigen Lebendvirus-Impfstoff immunisiert worden ist, in Kontakt mit einem solchen Virus kommen. 



  Die Erfindung ist im Anspruch 1 definiert. Vorteilhafte Weiterbildungen der Erfindung ergeben sich aus den abhängigen Ansprüchen. 



   Diese Erfindung ermöglicht, einen Impfstoff zur Verfügung zu stellen, der in der Lage ist, Vertebraten gegen pathogene Organismen zu immunisieren, und der die Vorteile eines Lebendvirus-Impfstoffs hat und der wenige oder keine der Nachteile sowohl eines Lebendvirus-Impfstoffs als auch eines abgetöteten Virus-Impfstoffs hat, besonders, wenn er zum Immunisieren von nicht-vogelartigen Vertebraten verwendet wird. 



  Insbesondere ermöglicht diese Erfindung, synthetische rekombinante Avipoxviren zur Verwendung in solchen Impfstoffen zur Verfügung zu stellen. 



  Diese Erfindung ermöglicht, noch ein Verfahren zur Auslösung einer Immunantwort in vogelartigen und nicht-vogelartigen Vertebraten auf ein Antigen durch Impfung des Vertebraten mit einem synthetischen rekombinanten Avipoxvirus zur Verfügung zu stellen, das sich im Fall der nicht-vogelartigen Vertebraten, wie z.B. Säugetiere, nicht unter Vermehrung unter Produktion von infektiösem Virus repliziert. In diesem Fall begrenzt das Virus sich selbst und reduziert die Möglichkeit der Verbreitung auf nicht-geimpfte Wirte. 



  Des weiteren ermöglicht diese Erfindung ein Verfahren zur Auslösung einer Immunantwort in einem Vertebraten auf ein Antigen zur Verfügung zu stellen, wobei das Verfahren die Impfung des Vertebraten mit einem Impfstoff umfasst, der synthetisches rekombinantes, die antigenen Determinanten  eines Pathogens für den Vertebraten einschliessenden und exprimierenden Avipoxvirus enthält. 



  Ausserdem ermöglicht die Erfindung, ein Verfahren zur Expression eines Genprodukts in einem Vertebraten durch Impfung des Vertebraten mit einem rekombinanten Virus zur Verfügung zu stellen, der  das  Genprodukt  ohne  replikative  Vermehrung  des  Virus  in  dem  Vertebraten  codiert  und  exprimiert. 



  Schliesslich ermöglicht die Erfindung, ein Verfahren zur Auslösung einer Immunantwort in einem Vertebraten auf ein Antigen durch Impfung des Vertebraten mit einem rekombinanten, DNA enthaltenden Virus zur Verfügung zu stellen, das das Antigen ohne replikative Vermehrung des Virus in dem Vertebraten codiert und exprimiert. 



  In einer Hinsicht steht die Erfindung im Zusammenhang mit einem Verfahren zur Auslösung einer Immunantwort in einem Vertebraten auf ein Pathogen durch Impfung des Vertebraten mit einem syntetischen, rekombinanten Avipoxvirus. Dieser Virus ist modifiziert durch die Gegenwart - in einer nicht-essentiellen Region des Avipoxgenoms - von DNA aus einer beliebigen Quelle, welche ein Antigen des Pathogens codiert und exprimiert. 



  In einer weiteren Hinsicht steht die Erfindung im Zusammenhang mit einem Verfahren zur Expression eines Genprodukts oder zur Auslösung einer Immunantwort auf ein Antigen in einem Vertebraten mit einem rekombinanten, sich nicht replikativ in den Zellen des Vertebraten vermehrenden Virus, das aber das Genprodukt oder das Antigen in den Zellen des Vertebraten exprimiert. 



  In einer weiteren Hinsicht steht die Erfindung im Zusammenhang mit einem syntethischen, rekombinanten Avipoxvirus, das durch Insertion von DNA aus einer beliebigen Quelle, insbesondere aus einer  Nicht-Avipoxquelle, in einer nicht-essentiellen Region des Avipoxvirus-Genoms modifiziert ist. Synthetisch modifizierte Avipoxvirus-Rekombinanten, die exogene (d.h. Nicht-Avipox) Gene tragen, die ein Antigen codieren und exprimieren und die bei einem Vertebratenwirt eine Immunantwort auf das Antigen und deshalb auf das exogene Pathogen hervorrufen, werden besonders zur Impfung nicht-vogelartiger Vertebraten als neue Impfstoffe benutzt, die die Nachteile üblicher, abgetötete oder attenuierte lebende Organismen benutzende Impfstoffe vermeiden. 



  Es muss noch einmal bemerkt werden, dass Avipoxviren sich nur replikativ vermehren können in bzw. passagiert werden können durch Vogelarten oder Vogelzellinien. Die rekombinanten, aus Vogelwirtszellen gewonnenen Avipoxviren rufen eine Impfungsläsion ohne replikative Vermehrung des Avipoxvirus hervor, wenn man nicht-vogelartige Vertebraten, wie Säugetiere, in einer der Impfung von Säugetieren mit Vacciniavirus entsprechenden Weise impft. Trotz des Fehlens einer replikativen Vermehrung des Avipoxvirus in solch einem geimpften nicht-vogelartigen Vertebraten geschieht genügend Expression des Virus, so dass das geimpfte Tier immunologisch auf die antigenen Determinanten des rekombinanten Avipoxvirus und auch auf die antigenen Determinanten antwortet, für die die im Virus enthaltenen exogenen Gene codieren. 



  Bei Impfung einer Vogelart ruft ein solches synthetisches rekombinantes Avipoxvirus nicht nur eine Immunantwort auf die Antigene hervor, die auf der exogenen DNA aus einer beliebigen Quelle enthalten sein können, sondern führt auch zu replikativer Vermehrung des Virus in dem Wirt unter Auslösung einer erwarteten Immunantwort auf den Avipoxvektor per se. 



  Verschiedene Forscher haben vorgeschlagen, rekombinante Geflügelpocken speziell zum Gebrauch als Veterinär-Impfstoffe für den Schutz von Geflügelbeständen herzustellen; vgl.  Boyle und Coupar, J. Gen. Virol. Bd. 67 (1986), Seiten 1591-1600, und Binns et al., Isr. J. Vet. Med., Bd. 42 (1986), Seiten 124-127. Es sind aber weder Vorschläge noch tatsächliche Berichte zum Gebrauch von rekombinanten Avipoxviren zum Erzeugen einer spezifischen Immunität in Säugetieren bekanntgeworden. 



  Stickl und Mayr, Fortschr. Med. 97 (40) (1979), Seiten 1781-1788 beschreiben die Injektion von Avipox-, insbesondere Geflügelpockenviren in Menschen. Allerdings beziehen sich diese Untersuchungen nur auf den Gebrauch von gewöhnlichen Geflügelpocken, um die nicht-spezifische Immunität in Patienten zu verstärken, die an den Nebenwirkungen von Krebs-Chemotherapie leiden. Keine rekombinanten DNA-Techniken sind dabei angewendet. Es gibt keinen Hinweis über einen Avipoxvirus, in das für Antigene von Vertebratenpathogenen codierende DNA inseriert worden ist, oder über ein Verfahren zur Auslösung spezifischer Immunität in Vertebraten. Statt dessen hängt der Stand der Technik von einem allgemeinen und nicht-spezifischen stimulierenden Effekt auf den menschlichen Wirt ab. 



  Eine vollständigere Diskussion der Grundlagen der genetischen Rekombination hilft zum Verständnis, wie die modifizierten rekombinanten Viren der vorliegenden Erfindung hergestellt worden sind. 



   Genetische Rekombination ist allgemein der Austausch homologer Abschnitte von Desoxyribonucleinsäure (DNA) zwischen  zwei Strängen von DNA. (In bestimmten Viren kann Ribonucleinsäure [RNA] die DNA ersetzen). Homologe Abschnitte einer Nucleinsäure sind Abschnitte der Nucleinsäure (RNA oder DNA), die dieselbe Sequenz der Nucleotidbasen haben. 



  Genetische Rekombination kann natürlicherweise stattfinden während der Replikation oder der Erzeugung neuer viraler Genome innerhalb der infizierten Wirtszelle. Daher kann gene tische Rekombination zwischen viralen Genen während des viralen Replikationszyklus in einer mit zwei oder mehr verschiedenen Viren oder anderen genetischen Konstruktionen coinfizierten Wirtszelle stattfinden. Ein DNA-Abschnitt aus einem ersten Genom wird beim Aufbau des Abschnitts des Genoms eines zweiten, coinfizierenden Virus, in welchem die DNA homolog zu der aus dem ersten viralen Genom ist, ausgetauscht. 



  Allerdings kann Rekombination auch zwischen Abschnitten von DNA in verschiedenen, nicht vollkommen homologen Genomen stattfinden. Wenn solch ein Abschnitt aus einem ersten Genom mit einem Abschnitt eines anderen Genoms homolog ist (mit Ausnahme beispielsweise der Anwesenheit eines genetischen Markers oder eines Gens, das für eine antigene, in einen Abschnitt der homologen DNA inserierte Determinante codiert) kann immer Rekombination stattfinden. Die Produkte dieser Rekombination lassen sich dann durch die Anwesenheit jenes genetischen Markers oder Gens nachweisen. 



  Erfolgreiche Expression der als DNA eingeführten genetischen Sequenz des modifizierten infektiösen Virus erfordert zwei Bedingungen: 



  Erstens muss die Insertion in eine nicht-essentielle Region des Virus stattfinden, damit das modifizierte Virus lebensfähig bleibt. Weder für Geflügelpocken noch für andere Avipoxviren wurden bis jetzt nicht-essentielle Regionen analog zu den für Vacciniavirus beschriebenen, gezeigt. Entsprechend wurden für die vorliegende Erfindung nicht-essentielle Regionen von Geflügelpocken durch Spaltung des Geflügelpocken-Genoms in Fragmente, anschliessende Trennung der Fragmente nach Grösse und Insertion dieser Fragmente in Plasmidkonstrukte zur Vermehrung aufgefunden. Plasmide sind kleine, zirkuläre DNA-Moleküle, die als extrachromosomale Elemente in vielen Bakterien einschliesslich E. coli gefunden werden.

  Verfahren zur Insertion von DNA-Sequenzen, wie Genen für an tigene Determinanten oder andere genetische Marker in Plasmide sind dem Fachmann wohl bekannt und im einzelnen beschrieben in Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York (1982). Analog wurde bei der Insertion von genetischen Markern und/oder Antigene codierenden Genen in die clonierten Geflügelpockenfragmente vorgegangen. Die erfolgreich rekombinierten Fragmente (wie durch erfolgreiche Wiedergewinnung des genetischen Markers oder Antigens gezeigt wurde), waren diejenigen, die in eine nicht-essentielle Region des Geflügelpockenvirus inserierte DNA enthielten. 



  Die zweite Bedingung zur Expression inserierter DNA ist die Gegenwart eines Promotors in der korrekten Beziehung zu der inserierten DNA. Der Promotor muss so angeordnet sein, dass er vor der zu exprimierenden DNA-Sequenz liegt. Weil Avipoxviren nicht gut charakterisiert sind und Avipox-Promotoren bislang nicht identifiziert waren, sind bekannte Promotoren von anderen Pockenviren erfolgreich als Teil der vorliegenden Erfindung vor der zu exprimierenden DNA inseriert worden. Geflügelpocken-Promotoren können ebenso erfolgreich benutzt werden, um die Verfahren erfindungsgemäss auszuführen und die Produkte herzustellen. Erfindungsgemäss wurde gefunden, dass mit Geflügelpocken-Promotoren, Vaccinia-Promotoren und Entomopox-Promotoren Transkription in rekombinanten Pockenviren gestartet wird. 



  Boyle and Coupar, J. gen. Virol., Bd. 67 (1986), Seite 1591, vermuten, dass von Vaccinia-Promotoren "erwartet werden kann,  dass sie in (Geflügelpocken)-Virus arbeiten". Die Autoren lokalisierten und clonierten ein Geflügelpocken-TK-Gen (Boyle et al., Virology, Bd. 156 [1987], Seiten 355-365) und inserierten es in Vacciniavirus. Dieses TK-Gen wurde vermutlich wegen der Erkennung der Geflügelpocken-TK-Promotorsequenz durch Vaccinia-Polymerase exprimiert. Trotz ihrer Vermutung inserierten die Autoren allerdings weder einen beliebigen Vaccinia-Promotor in das Geflügelpockenvirus noch beobachte ten sie irgendeine Expression einer fremden, in dem Geflügelpocken-Genom vorhandenen DNA-Sequenz. Vor der vorliegenden Erfindung war nicht bekannt, dass Promotoren aus anderen Pockenviren, wie z.B. Vaccinia-Promotoren, tatsächlich die Expression eines Gens in einem Avipoxgenom ansteuern. 



  Es wurden besonders Geflügelpocken und Kanarienpockenviren als bevorzugte, mittels Rekombination durch Einbau exogener DNA modifizierte Avipoxarten benutzt. 



  Geflügelpocken ist eine Art von Avipox, die insbesondere Geflügel, nicht aber Säugetiere infiziert. Der als FP-5 bezeichnete Geflügelpockenstamm ist ein kommerzieller, aus Hühnerembryonen stammender Geflügelpockenvirus-Impfstamm, und von American Scientific Laboratories (Division of Schering Corp.), Madison, WI, United States Veterinary License No. 165, Serial No. 30 321, erhältlich. 



  Der hier als FP-1 bezeichnete Geflügelpockenstamm ist ein Duvette-Stamm, der zum Gebrauch als Impfstoff in Eintagsküken modifiziert ist. Der Stamm ist ein kommerzieller Geflügelpocken-Impfstamm, der als O DCEP 25/CEP67/ 2309 October 1980 bezeichnet und von Institute Merieux, Inc. erhältlich ist. 



  Kanarienpockenvirus ist eine andere Art von Avipoxvirus. Analog zu den Geflügelpocken infiziert Kanarienpockenvirus besonders Kanarienvögel, nicht jedoch Säugetiere. Der hier als CP bezeichnete Kanarienpockenstamm ist ein kommerzieller Kanarien-Impfstamm, der als LF2 CEP 524 241 075 bezeichnet und von Institute Merieux, Inc. erhältlich ist. 



  Die in diesen Avipoxviren durch genetische Rekombination eingefügten DNA-Sequenzen schliessen folgendes ein: Das lac Z-Gen prokaryotischen Ursprungs; das Toll wutglykoprotein (G)-Gen, das ein Antigen eines nicht-vogelartigen (spezifisch säugetierartigen) Pathogens codiert; das Truthahn-Influenzahämagglutinin-Gen, das für das Antigen eines von einem Avipoxvirus verschiedenen pathogenen Vogelvirus codiert; das gp51,30-Hüllgen des Rinderleukämievirus, einem Säugetiervirus; das Fusionsprotein-Gen des Newcastle Disease Virus (Texasstamm), einem Vogelvirus; das FeLV-Hüllgen des Katzenleukämievirus, einem Säugetiervirus, das RAV-1 env-Gen des Rous-assoziierten Virus, das eine Vogelvirus/Geflügelkrankheit ist; das Nucleoprotein (NP)-Gen des Hühner/Pennsylvania/1/83 Influenzavirus, einem Vogelvirus; das Matrixgen und Peplomergen des infektiösen Bronchitisvirus (Stamm Mass 41), einem Vogelvirus;

   und das Glykoprotein D-Gen (gD) des Herpes simplex Virus, einem Säugetiervirus. 



  Die Isolierung des lac Z-Gens ist beschrieben von Casadaban et al., Methods in Enzymology, Bd. 100 (1983), Seiten 293-308. Die Struktur des Tollwut G-Gens ist z.B. von Anilionis et al., Nature, Bd. 294 (1981), Seiten 275-278 beschrieben. Sein Einbau in Vaccinia und Expression in diesen Vektor werden von Kieny et al., Nature, Bd. 312 (1984), Seiten 163-166 diskutiert. Das Truthahn-Influenzahämagglutinin-Gen ist beschrieben von Kawaoka et al., Virology, Bd. 158 (1987), Seiten 218-227. Das Rinderleukämievirus gp51,30 env-Gen wurde beschrieben von Rice et al., Virology, Bd. 138 (1984), Seiten 82-93. Das Fusionsgen von Newcastle Disease Virus (Texasstamm) ist erhältlich vom Institute Merieux, Inc., als Plasmid pNDV 108. Das Katzenleukämievirus env-Gen wurde von Guilhot et al., Virology, Bd. 161 (1987), Seiten 252-258 be schrieben.

  Das Rous-assoziierte Virus Typ 1 ist erhältlich vom Institute Merieux, Inc., als zwei Clone penVRVIPT und mp19env (190). Hühnerinfluenza NP-Gen ist erhältlich von Yoshihiro Kawaoka vom St. Jude Children's Research Hospital als Plasmid pNP 33. Ein infektiöser Bronchitisvirus cDNA Clon des IBV Mass 41-Matrix-Gens und Peplomergens ist erhältlich vom Institute Merieux, Inc. als Plasmid pIBVM63. 



  Das Herpes simplex Virus gD-Gen ist beschrieben von Watson et al., Science, Bd. 218 (1982), Seiten 381-384. 



  Die rekombinanten Avipoxviren, die nachstehend näher beschrieben werden, schliessen einen von drei Vacciniapromotoren ein. Der Pi-Promotor aus dem Ava I H-Abschnitt von Vaccinia ist beschrieben von Wachsman et al., J. of Inf. Dis., Bd. 155 (1987), Seiten 1188-1197. Insbesondere ist dieser Promotor aus dem Ava I H(Xho I G)-Fragment aus dem L-varianten WR Vacciniastamm abgeleitet, in dem der Promotor die Transkription von rechts nach links steuert. Die Kartenposition des Promotors ist etwa 1,3 Kbp (Kilobasenpaare) vom linken Ende von Ava I H, etwa 12,5 Kbp vom linken Ende des Vacciniagenoms und etwa 8,5 Kbp links von der Hind III C/N  Verbindungsstelle. Der Promotor hat folgende Sequenz:
 
 (GGATCCC)-ACTGTAAAAATAGAAACTATAATCATATAATAGTGTAGGTTGGT-
 AGTAGGGTACTCGTGATTAATTTTATTGTTAAACTTG-(AATTC),
 
 wobei die Symbole in Klammern Linkersequenzen sind. 



  Der Hind III H-Promotor (auch "HH" und "H6") wurde durch Standardtranskriptions-Kartierungstechniken festgelegt. Er hat die Sequenz:
 
 ATTCTTTATTCTATACTTAAAAAATGAAAA
 TAAATACAAAGGTTCTTGAGGGTTGTGTTAAATTGAAAGCGAGAAATAATCATAAATT
 ATTTCATTATCGCGATATCCGT
 TAAGTTTGTATCGTAATG.
 



  Die Sequenz ist identisch mit der, die als 5 min seitig des offenenen Leserahmens H6 von Rosel et al., J. Virol., Bd. 60 (1986), Seiten 436-449, beschrieben ist. 



  Der 11K-Promotor ist von Wittek, J. Virol., Bd. 49 (1984), Seiten 371-378 und C. Bertholet et al., Proc. Natl. Acad. Sci. USA 82 (1985), Seiten 2096-2100, beschrieben. 



  Die rekombinanten Avipoxviren werden in an sich bekannter Weise in zwei Schritten zusammengebaut und analog zu jenen, die in dem vorstehend erwähnten US-Patent 4 603 112 zur Herstellung synthetischer Rekombinanten von Vacciniavirus beschrieben sind. 



  Zuerst wird die in das Virus zu inserierende DNA in ein E. coli Plasmid eingebaut, in das zu einem Abschnitt von nicht-essentieller DNA des Avipoxvirus homologe DNA eingebaut wurde. Getrennt davon ist die zu inserierende DNA-Gensequenz mit einem Promotor ligiert worden. Die Promotor-Gen-Verbindung wird danach in die Plasmidkonstruktion eingefügt, so dass die Promotor-Gen-Verbindung auf beiden Seiten von DNA flankiert ist, die homolog zu einem nicht-essentiellen Abschnitt von Avipox-DNA ist. Die daraus hervorgehende Plasmidkonstruktion wird danach durch Wachstum in E. coli  Bakterien vermehrt. (Plasmid-DNA wird benutzt, um exogenes genetisches Material zu tragen und zu vermehren; Diese Methodik ist bekannt. Beispielsweise sind diese Plasmidtechniken beschrieben von Clewell, J. Bacteriol., Bd. 110 [1972], Seiten 667-676.

  Die Techniken der Isolierung von amplifiziertem Plasmid aus dem E. coli-Wirt sind ebenfalls bekannt und beispielsweise von Clewell et al., in Proc. Natl. Acad. Sci. USA, Bd. 62 [1969], Seiten 1159-1166, beschrieben). 



  Das nach dem Wachstum in E. coli isolierte amplifizierte Plasmidmaterial wird nun für den zweiten Schritt benutzt. Dazu wird das die zu inserierende DNA-Gensequenz enthaltende Plasmid in eine Zellkultur (z.B. Hühnerembryofibroblasten) zusammen mit dem Avipoxvirus (wie z.B. Geflügelpockenstamm FP-1 oder FP-5) transfiziert. Rekombination zwischen homologer Geflügelpocken-DNA in dem Plasmid und dem viralen Genom führen zu einem Avipoxvirus, das durch die Gegenwart von Nicht-Geflügelpocken DNA-Sequenzen in einem nicht-essentiellen Abschnitt seines Genoms modifiziert ist. 



  Ein besseres Verständnis der Erfindung und ihrer zahlreichen Vorteile wird man aus den folgenden Beispielen haben, die zur Veranschaulichung gegeben werden. 


 Beispiel 1 
 


 Transiente Expressionsversuche zeigen die Erkennung von Vaccinia-Promotoren
 durch Geflügelpocken RNA-Transkriptionsfaktoren 
 



  Eine Anzahl von Plasmidkonstruktionen wurde hergestellt, die die codierende Sequenz für Hepatitis B Virus Oberflächenantigen (HBSAg) verbunden mit Vacciniavirus-Promotorensequenzen enthielten. Mit 50  mu g jedes Plasmids wurden CEF-Zellen (Hühnerembryofibroblasten) transfiziert, die mit 10 Plaque-bildenden Einheiten (pfu) Geflügelpockenvirus oder Vacciniavirus pro Zelle infiziert waren. Man liess die Infektion 24 Stunden weiterlaufen und lysierte dann die Zellen durch drei nachfolgende Zyklen von Einfrieren und Auftauen. 



  Die Menge von HBSAg in dem Lysat wurde unter Verwendung eines kommerziell erhältlichen AUSRIA II - <1><2><5>J Kit von Abbott Laboratories, Diagnostic Division, abgeschätzt. Die Gegenwart oder Abwesenheit von HBSAg ist als Verhältnis der Nettowerte (Probe minus Hintergrund) der unbekannten Probe zu dem negativen, vom Hersteller vorbestimmten Ausschlusswert ausgedrückt. Das führt zu einem P/N (Positiv/Negativ)-Verhältnis. Die Ergebnisse sind in Tabelle I zusammengefasst. 



  Es wurden drei verschiedene Vaccinia-Promotorsequenzen benutzt: Der früh in der Vacciniainfektion vor der DNA-Replikation erkannte Pi-Promotor; der 11K-Promotor, der spät in der Vacciniainfektion nach dem Einsetzen der DNA-Replikation erkannt wird; und der Hind III H (HH)-Promotor, der sowohl früh wie spät in der Vacciniainfektion erkannt wird. Diese Promotoren sind vorstehend beschrieben. 



   Die Daten zeigen, dass das in den Lysaten von infizierten Zellen produzierte HBSAg das Ergebnis der Erkennung von Vaccinia-Promotoren entweder durch Geflügelpocken- oder Vaccinia-Transkriptionsfaktoren ist. 
<tb><TABLE> Columns=4 
<tb>Title: Tabelle I 
<tb>Head Col 01 AL=L: Plasmid 
<tb>Head Col 02 AL=L: Virus 
<tb>Head Col 03 AL=L: Beschreibung 
<tb>Head Col 04 AL=L:

  P/N-Verhältnis 
<tb> <SEP>pMP 131piR2 <SEP>Geflügelpocken
Vaccinia <SEP>SAg mit Pi-Promotor
verbunden <SEP>1,8
9,1 
<tb> <SEP>pMPK 22.13S <SEP>Geflügelpocken
Vaccinia <SEP>SAg mit 11K-Promotor
verbunden <SEP>14
2 
<tb> <SEP>pPDK 22.5 <SEP>Geflügelpocken
Vaccinia <SEP>SAg mit 11K-Promotor
verbunden <SEP>92,6
5,6 
<tb> <SEP>pRW 668 <SEP>Geflügelpocken
Vaccinia <SEP>SAg mit HH-Promotor
verbunden <SEP>77
51,4 
<tb> <SEP>kein Plasmid <SEP>Geflügelpocken <SEP>1,1 
<tb> <SEP>kein Plasmid <SEP>Vaccinia <SEP>1,3 
<tb> <SEP>pMPK 22.13S <SEP>(kein Virus) <SEP>1,3 
<tb></TABLE> 


 Beispiel 2 
 


 Konstruktion eines das lac Z-Gen enthaltenden rekombinanten Geflügelopckenvirus vFP-1 
 



  Ein Fragment in einem nicht-essentiellen Abschnitt des Geflügelpockenvirus wurde wie folgt lokalisiert und isoliert. 



  Mit Nuclease Bal 31 wurde die einzelsträngige endständige Haarnadelstruktur von FP-5-DNA entfernt. Das Klenow (grosse) Fragment der DNA-Polymerase I wurde zur Bildung glatter Enden verwendet. Nach Entfernung der Haarnadelstruktur wurden  Fragmente hergestellt durch Verdau mit der Restriktionsendonuclease Bgl II. Dieser Verdau führt zu einer Reihe von FP-5-Fragmenten, die durch Agarosegelelektrophorese aufgetrennt wurden. 



  Ein stumpfendig 8.8 Kbp BglII-Fragment wurde isoliert und mit dem kommerziell erhältlichen Plasmid pUC 9 ligiert, das mit Bam HI und Sma I gespalten worden war. Das daraus hervorgehende Plasmid wurde pRW 698 genannt. 



  Um die Grösse des Geflügelpockenfragments zu verringern, wurde dieses Plasmid mit Hind III gespalten, wobei zwei weitere Fragmente erzeugt wurden. Ein 6.7 Kbp-Fragment wurde verworfen, und das übrigbleibende 4.7 Kbp-Fragment wurde mit  sich selbst ligiert, so dass sich ein neues, als pRW 699 bezeichnetes Plasmid, ergab. 



  Um ein am 11K-Promotor gestartetes lac Z-Gen in dieses Plasmid einzubauen, wurde pRW 699 mit Eco RV gespalten, das das Plasmid nur an einer Stelle spaltet. Das lac Z-Fragment unter der Kontrolle des 11K-Promotors wurde danach als stumpfendiges Pst I-Bam HI-Fragment inseriert und ergab ein neues Plasmid, das pRW 702 genannt wurde. Der lac Z-Clon stammt von pMC 1871, wie beschrieben von Casadaban et al., a.a.O. Der 11K-Promotor wurde an das achte Codon des lac Z-Gens mittels eines Bam HI-Linkers ligiert. 



  Mit Rekombinationstechniken, wie denjenigen, die für Vaccinia in der US-A 4 603 112 beschrieben sind, wurde das Plasmid pRW 702 mit dem Geflügelpockenvirus FP-5 rekombiniert, das auf CEF wuchs, wobei die folgenden Verfahren benutzt wurden, um vFP-1 herzustellen. 50  mu g pRW 702 DNA wurde in einem Endvolumen von 100  mu l mit 0,5  mu g von Gesamtgenom-Geflügelpocken-DNA gemischt. Dazu wurden gefügt: 10  mu l 2,5 molar CaCl2 und 110  mu l 2 x HEBS-Puffer (pH 7), der hergestellt wurde aus 
 
 40 mMol Hepes
 300 mMol NaCl
 1,4 mMol Na2HPO4
 10 mMol KCl
 12 mMol Dextrose.
 



  Nach 30 Minuten bei Raumtemperatur wurden 200  mu l einer Geflügelpockenvirussuspension (verdünnt auf 5 pfu/Zelle) hinzugefügt und die Mischung auf 60-mm-Schalen, die einen primären CEF Monolayer enthielten, geimpft. Ausserdem wurden 0,7 ml Eagles-Medium, das 2% fötales Kälberserum (FBS) enthielt, zur gleichen Zeit hinzugefügt. Die Platten wurden 2 Stunden bei  37 DEG C bebrütet, danach wurden weitere 3 ml Eagles-Medium mit 2% FBS zugesetzt und die Platten 3 Tage lang bebrütet. Die Zellen wurden lysiert durch drei folgende Zyklen von Einfrieren und Auftauen; die Virusnachkommenschaft wurde danach auf die Anwesenheit von Rekombinanten untersucht. 



  Ein Nachweis einer erfolgreichen Einfügung des 11K-Promotor-lac Z-Gens durch Rekombination in das Genom von Geflügelpocken FP-5 wurde dadurch geführt, dass auf Expression des lac Z-Gens getestet wurde. Das lac Z-Gen codiert das Enzym  beta -Galactosidase, das das chromogene Substrat 5-Brom-4-chlor-3-indolyl- beta -D-galactosidase (X-gal) spaltet und dabei ein blaues Indolylderivat freisetzt. Blaue Plaques wurden als positive Rekombinanten ausgewählt. 



  Ausserdem wurde die erfolgreiche Einführung von lac Z in das Genom von Geflügelpocken FP-5 und seine Expression bestätigt durch Immunpräzipitation des  beta -Galactosidaseproteins mittels kommerziell verfügbarer Antiseren und Standardverfahren, die vFP-1 infizierte CEF, BSC (Affennierenzellinie - ATCC CCL26), VERO (Affennierenzellinie - ATCC CCL81) und MRC-5 (diploide menschliche Lungenzellinie - ATCC CCL171) benutzen. 



  Weiter wurde die Expression der  beta -Galactosidase durch das rekombinante Virus vFP-1 in vivo bestätigt. Dazu wurden Kaninchen und Mäuse mit dem Virus geimpft. Der Anstieg in den Titern der gegen das  beta -Galactosidaseprotein gerichteten Antikörper in dem Serum der geimpften Tiere wurde gemessen. 



  Insbesondere wurde das rekombinante vFP-1 von Wirtszellverunreinigungen gereinigt und intradermal an zwei Stellen auf jeder Seite von zwei Kaninchen eingeimpft. Jedes Kaninchen erhielt insgesamt 10<8> pfu. 



  Den Tieren wurde in wöchentlichen Abständen Blut entnommen. Die Seren wurden für einen ELISA-Test benutzt, der eine kommerziell erhältliche Präparation von gereinigter  beta -Galactosidase als Antigenquelle benutzt. 



  Sowohl die mit dem rekombinanten vFP-1 geimpften Kaninchen als auch die Mäuse zeigten eine im ELISA-Test nachweisbare Immunantwort auf das  beta -Galactosidaseprotein. In beiden Arten  war die Antwort eine Woche nach der Impfung feststellbar. 


 Beispiel 3 
 


 Konstruktion des Tollwut G-Gen und lac Z enthaltenden rekombinanten
 Virus vFP-2 aus Geflügelpockenvirus FP-5 
 



  Ein 0,9 Kbp Pvu II-Fragment wurde aus FP-5 erhalten und mittels Standardverfahren zwischen die beiden Pvu II-Stellen in pUC 9 eingefügt. Die daraus hervorgehende Konstruktion, als pRW 688.2 bezeichnet, besitzt asymmetrisch in dem Pvu II-Fragment zwei etwa 30 bp voneinander entfernte Hinc II-Stellen und bildet daher einen langen und einen kurzen Arm des Fragments. 



   Unter Benutzung bekannter Techniken wurden zwischen diese Hinc II-Stellen Oligonucleotidadaptoren eingesetzt, um  Pst I- und Bam HI-Stellen einzuführen und auf diese Weise das Plasmid pRW 694 herzustellen. 



  Dieses Plasmid wurde nun mit Pst I und Bam HI gespalten und  das mit dem vorstehend beschriebenen 11K Vacciniapromotor verbundene lac Z-Gen eingefügt. Man erhielt das neue Plasmid pRW 700. 



  Zur Herstellung eines vom Pi-Promotor gesteuerten Tollwut G-Gens wurde die Bgl II-Stelle, die 5 min proximal zum Tollwutgen liegt (vgl. Kieny et al., a.a.O.), an den Enden glatt gemacht und an die aufgefüllte Eco RI-Stelle des vorstehend beschriebenen Pi-Promotors ligiert. 



  Diese Konstruktion wurde in die Pst I-Stelle von pRW 700 eingefügt und ergab das Plasmid pRW 735.1, das damit die fremde Gensequenz Pi-Tollwut G-11K-lac Z enthält. Dieses Insert ist so innerhalb des Plasmids angeordnet, dass der lange Pvu II-Hinc II-Arm der FP-5 Donorsequenz auf der 3 min -Seite des lac Z-Gens liegt. 



  Die so erzeugte fertige Konstruktion wurde mit Geflügelpockenvirus FP-5 durch Infektion/Transfektion von Hühnerembryofibroblasten (durch Verfahren wie vorstehend beschrieben)  rekombiniert. Man erhielt das rekombinante Geflügelpockenvirus vFP-2. Dieses rekombinante Virus wurde nach Anfärbung mit X-gal ausgewählt. 



  Die korrekte Insertion und Expression sowohl des lac Z-Marker-Gens wie des Tollwut G-Gens wurde mit einer Anzahl zusätzlicher, nachstehend beschriebener Verfahren, überprüft. 



  Ein Immunfluoreszenznachweis des Tollwutantigens durch spezifische Antikörper zeigte erfolgreich die Expression des Tollwutantigens auf der Oberfläche von vogelartigen und nicht-vogelartigen, mit vFP-2 Virus infizierten Zellen an. 



  Wie zuvor wurde die Expression des Tollwutantigens und der  beta -Galactosidase durch vogelartige und nicht-vogelartige, mit vFP-2 Virus infizierte Zellen durch das Immunpräzipitationsverfahren bestätigt. 



  Ein weiterer Nachweis, dass die Ausführungsform vFP-2 dieser Erfindung ein erfolgreiches rekombinantes Virus ist, das die Gene für Tollwut G und  beta -Galactosidase trägt, wurde durch Impfung von zwei Kaninchen mit vFP-2 Virus erreicht. Beide Kaninchen wurden intradermal mit 1 x 10<8> pfu vFP-2 pro Kaninchen beimpft. Beide Kaninchen entwickelten typische Pockenläsionen. Den Kaninchen wurde in wöchentlichen Abständen Blut entnommen; die Seren wurden durch ELISA getestet, um die Anwesenheit der für das Tollwutglykoprotein und das  beta -Galactosidaseprotein spezifischen Antikörper nachzuweisen. 



  Wie nachstehend in Tabelle II dargestellt, zeigte Kaninchen 205 nachweisbare Mengen von anti- beta -Galactosidase-Antikörper im ELISA-Test 1 Woche nach der Impfung. Diese Menge stieg nach 2 Wochen auf einen Titer von 1 in 4000, der 5 Wochen lang nach der Impfung aufrechterhalten wurde. Benutzte man einen Antigencapture ELISA-Test, zeigten Seren aus Kaninchen 205 nachweisbare Mengen von anti-Tollwut-Antikörpern zwischen 3 und 10 Wochen nach der Impfung. 
<tb><TABLE> Columns=2 
<tb>Title: Tabelle II
Antikörperproduktion durch Kaninchen 205 gegen Tollwutantigen und  beta -Galactosidase-Protein 
<tb>Head Col 01 AL=L: Zeit 
<tb>Head Col 02 AL=L:

  Antikörpertiter
(Kehrwert der Serumverdünnung) 
<tb> <SEP>Vorbluten anti- beta -Galactosidase <SEP>0 
<tb> <SEP>Woche 1 <SEP>500 
<tb> <SEP>Wochen 2-5 (jede) <SEP>4000 
<tb> <SEP>Woche 6 <SEP>500 
<tb> <SEP>Woche 9 <SEP>250 
<tb> <SEP>Vorbluten anti-Tollwut <SEP>0 
<tb> <SEP>Woche 3 <SEP>200 
<tb> <SEP>Woche 6 <SEP>200 
<tb> <SEP>Woche 10 <SEP>100 
<tb></TABLE> 


 Beispiel 4A 
 


 Konstruktion eines rekombinanten Virus vFP-3 mit einem Tollwut G-Gen 
 unter Promotorkontrolle aus Geflügelpockenvirus FP-1 
 



  Diese Ausführungsform zeigt, dass das Tollwut G-Gen vollständig auch durch andere Stämme von Geflügelpocken als FP-5, insbesondere durch einen anderen, als FP-1 bezeichneten Stamm von Geflügelpockenvirus exprimiert wird. 



  Wie in Beispiel 3 wurde ein 0,9 Kbp Pvu II-Fragment aus FP-1 unter der Annahme erhalten, dass, wie in FP-5, das Fragment einen nicht-essentiellen Abschnitt enthalten würde. 



  Dieses Fragment wurde zwischen die beiden Pvu II-Stellen von pUC 9 eingefügt und das Plasmid mit der Bezeichnung pRW 731.15R erzeugt. 



  Dieses Plasmid besitzt asymmetrisch innerhalb des Pvu II-Fragments zwei etwa 30 bp voneinander entfernte Hinc II-Stellen und bildet so einen langen und einen kurzen Arm dieses Fragments. 



  Ein kommerziell erhältlicher Pst I-Linker
 
 (5 min ) - CCTGCAGG - (3 min )
 
 wurde zwischen die beiden Hinc II-Stellen eingefügt und ergab das Plasmid pRW 741. 



  Ein von dem Promotor HH abhängiges Tollwut G-Gen wurde in dieses Plasmid in die Pst I-Stelle eingefügt und erzeugte das neue Plasmid pRW 742B. Durch Rekombination dieses Plasmids mit FP-1 nach Infektion/Transfektion von CEF-Zellen wurde das Virus vFP-3 erhalten. 



  Das ATG Translationsstartcodon des von dem HH-Promotor gesteuerten offenen Leserahmens wurde dem Startcodon des Tollwut G-Gens überlagert, indem ein die Eco RV-Stelle in dem HH-Promotor und die Hind III-Stelle in dem Tollwut G-Gen überlagerndes synthetisches Oligonucleotid benutzt wurde. Das 5 min -Ende dieses Tollwutgens unter dem HH-Promotor wurde in an sich bekannter Weise so modifiziert, dass es eine Pst I-Stelle enthielt. Die Konstruktion wurde danach mit der Pst I-Stelle von pRW 741 ligiert und ergab pRW 742B. Die Orientierung der Konstruktion in dem Plasmid ist die gleiche wie in dem vorher in Beispiel 3 diskutierten pRW 735.1. 



  Die Rekombination wurde gemäss Beispiel 2 ausgeführt. Die daraus hervorgehende Rekombinante wurde vFP-3 genannt. 



  Die Expression von Tollwutantigen sowohl in vogelartigen wie in nicht-vogelartigen, mit vFP-3 Virus infizierten Zellen wurde durch Immunpräzipitation und Immunfluoreszenztechniken (wie weiter oben beschrieben) bestätigt. 



  Ein weiterer Beweis, dass die Ausführungsform vFP-3 dieser Erfindung ein erfolgreiches rekombinantes, die Gene für Tollwut G exprimierendes Virus ist, wurde durch intradermale Impfung von Paaren von Kaninchen mit dem rekombinanten Virus erhalten. Zwei Kaninchen wurden intradermal geimpft mit je-  weils 1 x 10<8> pfu vFP-3. Beide Kaninchen entwickelten typische Pockenläsionen, die eine maximale Grösse 5 bis 6 Tage nach der Impfung erreichten. Den Kaninchen wurde in wöchentlichen Abständen Blut entnommen und die Seren durch ELISA getestet, um die Anwesenheit von für das Tollwutglykoprotein spezifischen Antikörpern nachzuweisen. 



   Ausserdem wurden 5 Ratten intradermal jeweils mit 5 x 10<7> pfu vFP-3 geimpft. Alle Tiere entwickelten Läsionen. 



  Sowohl die Kaninchen als auch die Ratten entwickelten nachweisbare Mengen von für Tollwut spezifischen Antikörpern innerhalb von 2 Wochen nach der Impfung. Zwei Kontrollkaninchen, die intradermal mit dem Ausgangs-FP-l-Virus geimpft waren, zeigten keine nachweisbaren Mengen an anti-Tollwut-Antikörpern. 



  Um die Möglichkeit auszuschliessen, dass die Antikörperantwort auf die Einführung von Tollwutantigen zurückzuführen ist, das zufällig von dem Impfvirus mitgetragen wurde oder in die Membran des rekombinanten Geflügelpockenvirus integriert war, statt auf, wie vorgeschlagen, de novo Synthese von Tollwutantigen durch das rekombinante Virus in dem Tier, wurde das vFP-3-Virus chemisch inaktiviert, und damit wurden Kaninchen geimpft. 



  Das gereinigte Virus wurde über Nacht bei 4 DEG C in Gegenwart von 0,001%  beta -Propiolacton inaktiviert und danach durch Zentrifugieren pelletiert. Das pelletierte Virus wurde in mit 10 mM Tris gepufferter Kochsalzlösung aufgenommen, ultraschallbehandelt und titriert, um sicherzustellen, dass kein infektiöses Virus übriggeblieben war. Zwei Ratten wurden intradermal mit inaktiviertem vFP-3 und zwei mit einer entsprechenden Menge von unbehandeltem rekombinantem Virus beimpft. Die Grösse der Läsionen wurde festgestellt. 



  Beide Kaninchen, die unbehandeltes vFP-3 erhalten hatten, entwickelten typische Pockenläsionen, die 5 Tage nach der Beimpfung als 4-5+ eingestuft wurden. Kaninchen, die mit inaktiviertem Virus beimpft waren, entwickelten ebenso Läsionen, doch diese wurden 5 Tage nach der Impfung als 2+ eingestuft. 



  Den Kaninchen wurde in wöchentlichen Abständen Blut entnommen und die Seren durch ELISA auf die Gegenwart von für Tollwut spezifischen Antikörpern und für Geflügelpocken spezifischen Antikörpern getestet. Die Ergebnisse sind in Tabelle III zusammengefasst. 
<tb><TABLE> Columns=9 
<tb>Title: Tabelle III 
<tb>Head Col 02 to 05 AL=L: Lebendes vFP-3 
<tb>Head Col 06 to 09 AL=L: Inaktiviertes vFP-3 
<tb>SubHead Col 01 AL=L>Kaninchen: 
<tb>SubHead Col 02 to 03 AL=L: No. 295 
<tb>SubHead Col 04 to 05 AL=L: No. 318 
<tb>SubHead Col 06 to 07 AL=L: No. 303 
<tb>SubHead Col 08 to 09 AL=L:

  No. 320 
<tb>SubHead Col 01 AL=L>Antikörper: 
<tb>SubHead Col 02 AL=L>Tollwut: 
<tb>SubHead Col 03 AL=L>FP: 
<tb>SubHead Col 04 AL=L>Tollwut: 
<tb>SubHead Col 05 AL=L>FP: 
<tb>SubHead Col 06 AL=L>Tollwut: 
<tb>SubHead Col 07 AL=L>FP: 
<tb>SubHead Col 08 AL=L>Tollwut: 
<tb>SubHead Col 09 AL=L>FP: 
<tb> <SEP>getestet:
Woche P.I 
<tb> <SEP>0 <SEP>0 <SEP>0 <SEP>0 <SEP>0 <SEP>0 <SEP>0 <SEP>0 <SEP>0 
<tb> <SEP>2 <SEP>250 <SEP>4000 <SEP>500 <SEP>4000 <SEP>0 <SEP>50 <SEP>0 <SEP>1000 
<tb> <SEP>3 <SEP>1000 <SEP>4000 <SEP>500 <SEP>4000 <SEP>0 <SEP>4000 <SEP>0 <SEP>2000 
<tb> <SEP>4 <SEP>1000 <SEP>4000 <SEP>2000 <SEP>4000 <SEP>0 <SEP>4000 <SEP>0 <SEP>2000 
<tb> <SEP>5 <SEP>4000 <SEP>4000 <SEP>2000 <SEP>4000 <SEP>0 <SEP>2000 <SEP>0 <SEP>4000 
<tb> <SEP>6 <SEP>4000 <SEP>4000 <SEP>4000 <SEP>4000 <SEP>0 <SEP>2000 <SEP>0 <SEP>2000 
<tb></TABLE> 



  In diesem Test wurde der Titer-Endwert (ausgedrückt als Kehrwert der Serumverdünnung) willkürlich als 0,2 gesetzt,  nachdem die Absorptionswerte aller Seren vor der "Belastungsinfektion" abgezogen waren. Die Kaninchen 295 und 318, die das lebende Virus erhalten hatten, entwickelten eine Immunantwort auf das Tollwutglykoprotein und auf Geflügelpockenvirusantigene. Die Kaninchen 303 und 320 entwickelten ebenfalls eine Immunantwort auf Geflügelpockenvirusantigene; der Titer war jedoch niedriger. Keines dieser Kaninchen entwickelte eine nachweisbare Antwort auf das Tollwutglykoprotein. 



  Dieser Befund bestätigt, dass die in dem Kaninchen hervorgerufene Immunantwort auf die de novo Expression des in dem rekombinanten Virus enthaltenden Tollwutglykoproteingens zurückzuführen ist und nicht eine Antwort auf irgendein zufällig in dem Impfvirus mitgetragenes Glykoprotein ist. 


 Beispiel 4B 
 


 Konstruktion des rekombinanten Virus vFP-5, das nichtangesteuerte Tollwut
 G-Gene enthält,  aus Geflügelpockenvirus FP-1 
 



  Die Expression eines fremden, durch Rekombination in das Geflügelpockengenom inserierten Gens, erfordert die Anwesenheit eines Promotors. Dies wurde gezeigt durch die Herstellung einer weiteren Rekombinante vFP-5, die mit vFP-3 mit Ausnahme der Weglassung des HH-Promotors identisch ist. Die Gegenwart des Tollwutgens in dieser Rekombinante wurde durch Nucleinsäurehybridisierung bestätigt. Kein Tollwutantigen wurde jedoch in mit dem Virus infizierten CEF-Zellkulturen festgestellt. 


 Beispiel 5 
 


 Versuche mit in vitro Passagieren zum Nachweis, ob-Geflügelpockenvirus
  in nicht-vogelartigen Zellen repliziert. 
 



  Ein Versuch wurde durchgeführt, bei dem drei Zellsysteme (eines vogelartig und zwei nicht-vogelartig) mit dem parentalen FP-1-Stamm oder mit rekombinanten vFP-3 beimpft wurden. Jeweils zwei Schalen mit CEF, MRC-5 oder VERO wurden mit FP-1 oder vFP-3 mit einer Eingangsmultiplizität von 10 pfu pro Zelle beimpft. 



  Nach 3 Tagen wurde jeweils eine Schale geerntet. Das Virus wurde durch drei aufeinanderfolgende Zyklen von Einfrieren  und Auftauen freigesetzt und auf einen frischen Monolayer derselben Zellinie wieder geimpft. Dieses wurde über sechs aufeinanderfolgende Passagen wiederholt; am Ende des Experiments wurden Proben jeder Passage auf Virusinfektiosität auf CEF-Monolayern titriert. Die Ergebnisse sind in Tabelle IVa zusammengefasst. Sie zeigen, dass eine Reihenpassage sowohl von FP-1 als auch vFP-3 in CEF-Zellen möglich ist, aber in keiner der beiden nicht-vogelartigen Zellinien. Infektiöses Virus konnte nicht in VERO- oder MRC-5-Zellen nach 3 oder 4 Passagen nachgewiesen werden. 



  Die zweite Schale wurde benutzt, um festzustellen, ob Virus, das nicht durch direkte Titration nachweisbar war, nach Amplifikation in permissiven CEF-Zellen nachgewiesen werden konnte. Nach 3 Tagen wurden Zellen aus der zweiten Schale durch Abschaben geerntet, ein Drittel dieser Zellen lysiert und auf einen frischen CEF-Monolayer geimpft. Wenn der volle cytopathische Effekt (CPE) erreicht war oder 7 Tage nach der Infektion, wurden die Zellen lysiert. Die Virusausbeute wurde titriert. Die Ergebnisse sind in Tabelle IVB zusammengefasst. Wurde Passage in CEF-Zellen benutzt, um ein etwa vorhandenes Virus zu vermehren, konnte kein Virus nach vier oder fünf Passagen nachgewiesen werden. 



   Versuche, eine permanent infizierte Zelle zu etablieren, schlugen fehl. 



  In einem weiteren Versuch, Hinweise einer andauernden viralen Expression in nicht-vogelartigen Zellen zu entdecken, wurden die vorstehend zur Virustiterbestimmung benutzten Proben in einem Standardimmunodottest eingesetzt, bei dem anti-Geflügelpocken-Antikörper und anti-Tollwut-Antikörper benutzt wurden, um die Anwesenheit des jeweiligen Antigens nachzuweisen.

  Die Ergebnisse dieser Tests bestätigen die Titrationsergebnisse. 
<tb><TABLE> Columns=7 
<tb>Title: Tabelle IVA
Passagierversuch 
<tb>Head Col 01 AL=L: Virus zur Beimpfung 
<tb>Head Col 02 to 04 AL=L: FP-1 
<tb>Head Col 05 to 07 AL=L: vFP-3 
<tb>SubHead Col 01 AL=L>Zelltyp: 
<tb>SubHead Col 02 AL=L>CEF: 
<tb>SubHead Col 03 AL=L>VERO: 
<tb>SubHead Col 04 AL=L>MRC-5: 
<tb>SubHead Col 05 AL=L>CEF: 
<tb>SubHead Col 06 AL=L>VERO: 
<tb>SubHead Col 07 AL=L>MRC-5: 
<tb> 
<tb>SubHead Col 01 to 07 AL=L:

  Passage 
<tb> <SEP>1 <SEP>6.6<a> <SEP>4.8 <SEP>4.9 <SEP>6.6 <SEP>5.4 <SEP>6.2 
<tb> <SEP>2 <SEP>6.7 <SEP>2.9 <SEP>3.7 <SEP>6.5 <SEP>4.2 <SEP>5.1 
<tb> <SEP>3 <SEP>6.4 <SEP>1.4 <SEP>1.0 <SEP>6.4 <SEP>1.7 <SEP>4.4 
<tb> <SEP>4 <SEP>6.1 <SEP>N.D<b> <SEP>N.D <SEP>6.2 <SEP>N.D <SEP>1.0 
<tb> <SEP>5 <SEP>6.4 <SEP>N.D <SEP>N.D <SEP>6.3 <SEP>N.D <SEP>N.D 
<tb> <SEP>6 <SEP>5.7 <SEP>N.D <SEP>N.D <SEP>5.9 <SEP>N.D <SEP>N.D 
<tb> 
 a - Virustiter in log10 pfu pro ml
b - nicht nachweisbar
  
<tb></TABLE> 
<tb><TABLE> Columns=7 
<tb>Title: Tabelle IVB
Vermehrungsversuch 
<tb>Head Col 01 AL=L: Virus zur Beimpfung 
<tb>Head Col 02 to 04 AL=L:

  FP-1 
<tb>Head Col 05 to 07 AL=L: vFP-3 
<tb>SubHead Col 01 AL=L>Zelltyp: 
<tb>SubHead Col 02 AL=L>CEF: 
<tb>SubHead Col 03 AL=L>VERO: 
<tb>SubHead Col 04 AL=L>MRC-5: 
<tb>SubHead Col 05 AL=L>CEF: 
<tb>SubHead Col 06 AL=L>VERO: 
<tb>SubHead Col 07 AL=L>MRC-5: 
<tb> 
<tb>SubHead Col 01 to 07 AL=L: Passage 
<tb> <SEP>1 <SEP>6.4<a> <SEP>6.2 <SEP>6.4 <SEP>6.5 <SEP>6.3 <SEP>6.4 
<tb> <SEP>2 <SEP>7.5 <SEP>6.3 <SEP>6.0 <SEP>6.5 <SEP>6.3 <SEP>5.5 
<tb> <SEP>3 <SEP>6.2 <SEP>6.7 <SEP>5.3 <SEP>5.9 <SEP>6.1 <SEP>6.3 
<tb> <SEP>4 <SEP>5.6 <SEP>4.6 <SEP>3.9 <SEP>5.7 <SEP>4.8 <SEP>5.8 
<tb> <SEP>5 <SEP>6.3 <SEP>4.1 <SEP>N.D <SEP>6.1 <SEP>4.7 <SEP>4.7 
<tb> <SEP>6 <SEP>6.2 <SEP>N.D<b> <SEP>N.D <SEP>6.2 <SEP>N.D <SEP>N.D 
<tb> 
 a - Virustiter in log10 pfu pro ml
b - nicht nachweisbar
  
<tb></TABLE> 


 Beispiel 6 
 


 Zusätzliche Rekombinanten von Geflügelpocken FP-1:

   vFP-6, vFP-7, vFP-8 und vFP-9 
 



  Die rekombinanten Viren vFP-6 und vFP-7 wurden nach folgenden Verfahren hergestellt. 



  Ein 5,5 Kbp Pvu II-Fragment von FP-1 wurde zwischen die beiden Pvu II-Stellen in pUC 9 eingefügt und ergab das Plasmid pRW 731.13. Dieses Plasmid wurde anschliessend an einer singulären Hinc II-Stelle gespalten und an den Enden stumpf gemachtes, vom HH-Promotor abhängiges Tollwut G-Gen eingefügt, was die Plasmide pRW 748A und B ergab, die die beiden entgegengesetzten Orientierungen des Inserts darstellen. Die Plasmide pRW 748A und B wurden dann getrennt benutzt, um CEF-Zellen zusammen mit FP-1 Virus zu infizieren und ergaben durch Rekombination vFP-6 bzw. vFP-7. Dieser Genort wird nun als Genort f7 bezeichnet. 



  Ein 10 Kbp Pvu II-Fragment von FP-1 wurde zwischen die beiden Pvu II-Stellen von pUC 9 eingefügt und ergab pRW 731.15. Dieses Plasmid wurde anschliessend an einer singulären Bam HI-Stelle-gespalten und anschliessend ein vom 11K-Promotor  abhängiges lac Z-Genfragment eingefügt, was pRW 749A und B erzeugte, die die entgegensetzten Orientierungen des Inserts darstellen. Rekombination dieser Donorplasmide mit FP-1 führte zu vFP-8 bzw. vFP-9. Dieser Genort wird nun als Genort f8 bezeichnet. 



  vFP-8 und vFP-9 exprimierten (wie mittels X-gal nachgewiesen) das lac Z-Gen. vFP-6 und vFP-7 exprimierten das Tollwut G-Gen, wie durch ein Tollwut-spezifisches Antiserum nachgewiesen wurde. 


 Beispiel 7 
 


 Immunisierung mit vFP-3 zum Schutz von Tieren gegen eine Belastungsinfektion 
 mit lebenden Tollwutviren 
 



  Gruppen von 20 weiblichen 4 bis 6 Wochen alten SPF-Mäusen wurden mit 50  mu l vFP-3 auf der Pfotenfläche mit Dosen im Bereich 0,7 bis 6,7 TCID50 pro Maus beimpft. (Die TCID50 oder tissue culture infectious dose ist diejenige Dosis, bei der 50% der Gewebekulturzellen einen cytopathischen Effekt erleiden). 14 Tage nach der Impfung wurden 10 Mäuse aus jeder Gruppe geopfert und Serumproben für RFFI-Tests gesammelt. Die übrigen 10 Mäuse wurden einer Belastungsinfektion durch Beimpfung mit 10 LD50 des Tollwutstamms CVS über den intracerebralen Weg ausgesetzt und die Überlebenden 14 Tage nach der Belastungsinfektion berechnet. 



  Die Ergebnisse sind in Tabelle VA zusammengefasst. 
<tb><TABLE> Columns=3 
<tb>Title: Tabelle VA 
<tb>Head Col 01 AL=L: Dosis vFP-3 
log10 TCID50 
<tb>Head Col 02 AL=L: Tollwutantikörper 
Titer log10
Verdünnung* 
<tb>Head Col 03 AL=L: Überlebensrate 
<tb> <SEP>6,7 <SEP>1,9 <SEP>8/10 
<tb> <SEP>4,7 <SEP>1,8 <SEP>0/10 
<tb> <SEP>2,7 <SEP>0,4 <SEP>0/10 
<tb> <SEP>0,7 <SEP>0,4 <SEP>0/10 
 * Gemessen als RFFI-(Rapid Fluorescent Focus Inhibition) Tests, Laboratory Techniques in Rabies, Third Ed., 354-357, WHO Genf.
  
<tb></TABLE> 



  Das Experiment wurde mit 12,5 LD50 des Tollwutvirus als Belastungsinfektion wiederholt. Die Ergebnisse sind in Tabelle VB zusammengefasst. 
<tb><TABLE> Columns=3 
<tb>Title: Tabelle VB 
<tb>Head Col 01 AL=L: Dosis vFP-3 
log10 TCID50 
<tb>Head Col 02 AL=L: Tollwutantikörper 
Titer log10
Verdünnung* 
<tb>Head Col 03 AL=L: Überlebensrate 
<tb> <SEP>6,7 <SEP>2,8 <SEP>5/10 
<tb> <SEP>4,7 <SEP>2,1 <SEP>2/10 
<tb> <SEP>2,7 <SEP>0,6 <SEP>0/8 
<tb> <SEP>0,7 <SEP>0,6 <SEP>0/8 
 * Siehe Tabelle VA
  
<tb></TABLE> 



  Zwei Hunde und zwei Katzen wurden mit einer einzigen subkutanen Impfung mit 8 log10 TCID50 des rekombinanten vFP-3 immunisiert. Zusätzlich wurden 2 Hunde und 4 Katzen von entsprechendem Alter und Gewicht als nicht-geimpfte Kontrollen gehalten. Allen Tieren wurde in wöchentlichen Abständen Blut entnommen. Am Tag 94 wurde jeder Hund einer Belastungsinfektion durch Beimpfung in den Schläfenmuskel mit zwei Dosen von 0,5 ml eines Speicheldrüsenhomogenats des NY-Stamms von Tollwutvirus (vom Institute Merieux, Inc. erhältlich) ausgesetzt. Die Gesamtdosis entsprach 10 000 Mäuse LD50 über einen intrazerebralen Weg. Die sechs Katzen wurden auf ähnliche Weise einer Belastungsinfektion durch Beimpfung in den Nackenmuskel mit zwei Dosen von 0,5 ml der gleichen Virussuspension ausgesetzt. Die Gesamtdosis pro Tier entsprach 40 000 Mäuse LD50 über einen intrazerebralen Weg.

   Die Tiere wurden täglich beobachtet. Alle nicht-geimpften Tiere starben am in der Tabelle VI angezeigten Tag an Tollwutsymptomen. Die geimpften Tiere überlebten die Belastungsinfektion und wurden 3 Wochen lang nach dem Tod des letzten Kontrolltieres beobachtet. Die Ergebnisse sind in Tabelle VI zusammengefasst. 
<tb><TABLE> Columns=9 
<tb>Title: Tabelle VI 
<tb>Head Col 01 to 02 AL=L: Überleben/Tier 
<tb>Head Col 03 AL=L: Impfung 
<tb>Head Col 04 to 08 AL=L: Titer nach Impfung am Tag 
<tb>Head Col 09 AL=L: Zeitpunkt des Todes 
<tb> 
<tb>SubHead Col 04 AL=L>0: 
<tb>SubHead Col 05 AL=L>14: 
<tb>SubHead Col 06 AL=L>21: 
<tb>SubHead Col 07 AL=L>28: 
<tb>SubHead Col 08 AL=L>94: 
<tb> <SEP>Katzen 
<tb>SubHead Col 02 AL=L>7015:

  <SEP>vFP-3<a> <SEP>0 <SEP>2.2<b> <SEP>2.4 <SEP>2.4 <SEP>1.5 <SEP>+ 
<tb> <SEP>7016 <SEP>vFP-3 <SEP>0 <SEP>1.7 <SEP>1.9 <SEP>2.0 <SEP>1.3 <SEP>+ 
<tb> <SEP>8271 <SEP>c<c> <SEP>0 <SEP>0 <SEP>0 <SEP>0 <SEP>0 <SEP>d/13<d> 
<tb> <SEP>T10 <SEP>c <SEP>0 <SEP>0 <SEP>0 <SEP>0 <SEP>0 <SEP>d/12 
<tb> <SEP>T41 <SEP>c <SEP>0 <SEP>0 <SEP>0 <SEP>0 <SEP>0 <SEP>d/13 
<tb> <SEP>T42 <SEP>c <SEP>0 <SEP>0 <SEP>0 <SEP>0 <SEP>0 <SEP>d/12 
<tb> <SEP>Hunde <SEP>426 <SEP>vFP-3 <SEP>0 <SEP>0.8 <SEP>1.0 <SEP>1.1 <SEP>1.2 <SEP>+ 
<tb> <SEP>427 <SEP>vFP-3 <SEP>0 <SEP>1.5 <SEP>2.3 <SEP>2.2 <SEP>1.9 <SEP>+ 
<tb> <SEP>55 <SEP>c <SEP>0 <SEP>0 <SEP>0 <SEP>0 <SEP>0 <SEP>d/15 
<tb> <SEP>8240 <SEP>c <SEP>0 <SEP>0 <SEP>0 <SEP>0 <SEP>0 <SEP>d/16 
<tb> 
 a - Die mit vFP-3 geimpften Katzen und Hunde erhielten 8 log10 TCID50 über den subkutanen Weg.
b - Titer ausgedrückt als log10 der höchsten Serumverdünnung,

   die eine Reduktion von mehr als 50% in der Anzahl der fluoreszierenden Vertiefungen in einem RFFI-Test ergibt.
c - Nicht-geimpfte Kontrolltiere.
d - Tier starb/Tag des Todes nach der Belastungsinfektion.
  
<tb></TABLE> 



  In weiteren Experimenten wurden die rekombinanten Viren vFP-2 und vFP-3 zur Beimpfung von Rindern über mehrere verschiedene Wege benutzt. 



  Geimpfte Tiere wurden auf anti-Tollwutantikörper an den Tagen 6, 14, 21, 28 und 35 getestet. Alle Tiere zeigen eine  serologische Antwort auf das Tollwutantigen. Dies ist in Tabelle VII A gezeigt. 
<tb><TABLE> Columns=8 
<tb>Title: Tabelle VIIA
Antikörpertiter in mit vFP-3 geimpften Säugetieren (Rinder) anti-Tollwut neutralisierende Antikörper
RFFI-Test log10 Verdünnung 
<tb>Head Col 01 AL=L: Rind Nr. 
<tb>Head Col 02 AL=L:

  Tag 
<tb>Head Col 03 AL=L: 0 
<tb>Head Col 04 AL=L: 6 
<tb>Head Col 05 AL=L: 14 
<tb>Head Col 06 AL=L: 21 
<tb>Head Col 07 AL=L: 28 
<tb>Head Col 08 AL=L: 35 
<tb> <SEP>7.3 log10 TCID50 
<tb> <SEP>1420 (intradermal) <SEP>negativ <SEP>0.6 <SEP>2 <SEP>1.7 <SEP>1.8 <SEP>1.7 
<tb> <SEP>8 log10 TCID50 
<tb> <SEP>1419 (subkutan) <SEP>negativ <SEP>1.6 <SEP>2.2 <SEP>2.1 <SEP>2.1 <SEP>1.9 
<tb> <SEP>8 log10 TCID50 
<tb> <SEP>1421 (intramuskulär) <SEP>negativ <SEP>0.9 <SEP>2.2 <SEP>2.2 <SEP>1.8 <SEP>1.7 
<tb> <SEP>7.3 log10 TCID50 
<tb> <SEP>1423 (intramuskulär) <SEP>negativ <SEP>0.9 <SEP>1.1+ <SEP>1+ <SEP>1+ <SEP>1.1+ 
<tb> 
 + nicht signifikant
  
<tb></TABLE> 



  Alle Rinder wurden am Tag 55 nach der Impfung wieder geimpft mit 8 log10 TCID50. Sie zeigten eine anamnetische Antwort auf das Tollwutantigen. In der Verstärkernachimpfung wurden alle Rinder subkutan geimpft ausser Nr. 1421, das wieder intramuskulär geimpft wurde. RFFI-Titer wurden bestimmt an den Tagen 55, 57, 63, 70, 77 und 86.

  Die Ergebnisse sind in Tabelle VIIB zusammengefasst. 
<tb><TABLE> Columns=8 
<tb>Title: Tabelle VIIB 
<tb>Head Col 01 AL=L: Rind Nr. 
<tb>Head Col 02 AL=L: Tag 
<tb>Head Col 03 AL=L: 55 
<tb>Head Col 04 AL=L: 57 
<tb>Head Col 05 AL=L: 63 
<tb>Head Col 06 AL=L: 70 
<tb>Head Col 07 AL=L: 77 
<tb>Head Col 08 AL=L: 86 
<tb> <SEP>1419 <SEP>1.7 <SEP>1.5 <SEP>2.9 <SEP>2.9 <SEP>2.6 <SEP>2.9 
<tb> <SEP>1420 <SEP>1.0 <SEP>0.5 <SEP>1.9 <SEP>2.3 <SEP>2.2 <SEP>2.0 
<tb> <SEP>1421 <SEP>1.3 <SEP>1.2 <SEP>2.9 <SEP>2.7 <SEP>2.5 <SEP>2.5 
<tb> <SEP>1423 <SEP>1.0 <SEP>0.7 <SEP>2.4 <SEP>2.5 <SEP>2.5 <SEP>2.2 
<tb></TABLE> 



  Alle Daten beziehen sich auf vFP-3 ausser bei Tier 1423, wo sie sich auf vFP-2 beziehen. 



  Rinder, Katzen und Kaninchen wurden auch intradermal mit bekannten Mengen von Geflügelpockenvirus geimpft. Wundschorf  wurde von den Tieren nach etwa 1 Woche gesammelt. Dieser wurde zermahlen, in physiologischer Kochsalzlösung suspendiert und zur Bestimmung der Virusmengen titriert. 



  Nur Restmengen an infektiösem Virus konnten nachgewiesen  werden. Dies zeigt, dass keine Infektion unter Vermehrung in vivo erfolgte. 


 Beispiel 8 
 


 Impfung von Hühnern mit vFP-3 
 



  Hühner wurden mit rekombinantem Geflügelpockenvirus vFP-3 geimpft, um die Expression von Fremd-DNA durch ein rekombinantes Geflügelpockenvirus in einem System zu zeigen, das eine replikative Vermehrung des Vektors gestattet. 



  Weisse Leghornhühner wurden intramuskulär mit 9 log10 TCID50 vFP-3 oder durch Flügeldurchstechen mit 3 log10 TCID50 vPP-3 geimpft. Blutproben wurden für einen RFFI-Test auf Tollwutantikörpertiter 21 Tage nach der Impfung entnommen. Titer am Tag 21 in geimpften Hühnern waren signifikant höher als Titer in den Kontrollen am Tag 21. Der Durchschnittstiter der  nicht-infizierten Kontrollen betrug 0,6, derjenige der intramuskulär geimpften Vögel 1,9, derjenige der Flügel-durchstochenen Vögel 1,2. 


 Beispiel 9 
 


 Truthahninfluenza H5 HA-Antigen exprimierende rekombinante Geflügelpocken vFP-11 
 



  Vogelarten können mit den rekombinanten Avipoxviren der Erfindung gegen Vogelpathogene immunisiert werden. 



  So wurde das nachstehend beschriebene neue Plasmid pRW 759, das sich vom Geflügelpockenvirus FP-1 ableitet und ein Hämagglutiningen (H5) von A/Truthahn/Irland/1378/83 (TYHA)  unter der Kontrolle des Hind III H-Promotors enthält, zur Transfektion von gleichzeitig mit dem Elternvirus FP-1 infizierten CEF-Zellen, benutzt. Rekombinantes Geflügelpockenvirus vFP-11 wurde durch die weiter vorstehend beschriebenen Verfahren erhalten. 



  Die Synthese eines Hämagglutininmoleküls in mit VFP-11 infizierten Zellen wurde durch Immunpräzipitation von über den Stoffwechsel radiomarkierten, infizierten Zellysaten unter Benutzung eines spezifischen anti-H5-Antikörpers und Standardverfahren bestätigt. Die spezifische Immunpräzipitation von Vorstufen-Hämagglutinin mit einem Molekulargewicht von ca. 63 kd (Kilodalton) und zwei Spaltprodukten mit einem Molekulargewicht von 44 und 23 kd wurde gezeigt. Keine derartigen Proteine wurden aus einem Lysat von nicht-infizierten CEF-Zellen oder von mit Elternvirus FP-1 infizierten Zellen ausgefällt. 



   Zum Nachweis, dass das in den mit dem rekombinanten Geflügelpocken vFP-11 infizierten Zellen produzierte HA-Molekül an  der Zelloberfläche exprimiert wurde, wurden Immunfluoreszenz-Untersuchungen durchgeführt. Mit dem rekombinanten Geflügelpockenvirus vFP-11 infizierte CEF-Zellen zeigten eine  starke Fluoreszenzfärbung an der Oberfläche. In mit dem Elternvirus FP-1 infizierten Zellen wurde keine Fluoreszenz gemessen. 



  Das Plasmid pRW 759 wurde wie folgt hergestellt:
 pRW 742B (vgl. Beispiel 4) wird durch teilweisen Verdau mit Pst I linearisiert und das Fragment nachgespalten mit Eco RV, um das Tollwut G-Gen zu entfernen, wobei der HH-Promotor an dem verbleibenden Fragment von etwa 3,4 Kbp bleibt. Nach Behandlung mit alkalischer Phosphatase wird ein synthetisches Oligonucleotid eingefügt, damit der HH-Promotor mit TYHA am ATG verbunden werden kann, was zu pRW 744 führt. 



  Dieses Plasmid wurde durch teilweisen Verdau mit Dra I linearisiert; das linearisierte Fragment wurde mit Sal I gespalten und das grössere Fragment wiedergewonnen und mit alkalischer Phosphatase behandelt. 



  Schliesslich wurde pRW 759 erzeugt durch Einfügen des isolierten Sal I-Dra I-Fragments hergestellt, das die codierende Sequenz von TYHA enthält, in den pRW 744 Vektor, wie von Kawaoka et al., Virology, Bd. 158 (1987), Seiten 218-227 gezeigt wurde. 


 Beispiel 10 
 


 Immunisierung mit vFP-11 zum Schutz von Vögeln gegen eine Belastungsinfektion 
 mit lebendem Influenzavirus 
 



  Zum Nachweis der immunogenen Wirkung von rekombinantem Geflügelpockenvirus vFP-11, wurden Impf- und Belastungsinfektion-Experimente in Hühnern und Truthühnern durchgeführt. 



  Spezifisch pathogenfreie (SPF) weisse Leghornhühner wurden im Alter von 2 Tagen und 5 Wochen durch Durchstechen der Flügelhaut mit einer Doppelnadel geimpft, wie sie für übliche Impfung von Hühnern mit Geflügelpockenvirus benutzt wird. 



  Etwa 2  mu l vFP-11 mit 6 x 10<5> pfu wurde jedem Vogel gegeben.     Den älteren Vögeln wurde vor der Impfung Blut entnommen, und allen Vögeln wurde vor der Belastungsinfektion und 2 Wochen später Blut entnommen. 



  Zu Vergleichszwecken wurde eine zweite Gruppe von Hühnern mit einem üblichen H5-Impfstoff beimpft, der aus einem inaktivierten H5N2-Stamm in einer Wasser-in-\l-Emulsion besteht. 



  Inaktiverter H5N2-Impfstoff wurde aus A/Mallard/NY/189/82 (H5N2) Influenzavirus gewonnen, das in 11 Tage alten befruchteten Hühnereiern gezogen war; die infizierte Allantoisflüssigkeit mit einem HA-Titer von 800/0,1 ml und einem infektiösen Titer von 10<8,5>/0,1 ml wurde mit 0,1% Propiolacton inaktiviert und in einer Wasser-in-\l-Emulsion, wie bei Stone et al., Avian Dis., Bd. 22 (1978) Seiten 666-674 und Brugh et al., Proc. Second Inter. Sym. on Avian Influenza (1986), Seiten 283-292 beschrieben, suspendiert. In 0,2 ml Volumen wurde der Impfstoff 2 Tage und 5 Wochen alten SPF weissen Leghornhühnern über den subkutanen Weg unter die Haut auf der Innenseite des Schenkelmuskels verabreicht. 



  Eine dritte und vierte Gruppe von Hühnern erhielt parenteral ursprüngliches Virus FP-1 bzw. keinen Impfstoff. 



  Hühner wurden einer Belastungsinfektion unterworfen mit ca. 10<3> LD50 des hochpathogenen A/Turkey/Ireland/1378/83 (H5N8) oder A/Chick/Penn/1370/83 (H5N2) Influenzavirus durch Verabreichung von 0,1 ml auf die Nasenlöcher jedes Vogels. Zwei Tage alte Vögel wurde einer Belastungsinfektion 6 Wochen nach der Impfung ausgesetzt und 5 Wochen alte Vögel wurden einer Belastungsinfektion 5 Wochen nach der Impfung ausgesetzt. Die Vögel wurden täglich auf Krankheitssymptome beobachtet, die sich durch Anschwellen und Cyanose des Gesichts und des Kammes und durch Blutungen an den Füssen (solche Vögel konnten häufig nicht stehen), Lähmung und Tod anzeigten. Die meisten Todesfälle geschahen zwischen 4 und 7 Tagen nach  der Infektion. 3 Tage nach der Infektion wurden Abstriche aus der Trachea und der Cloaca aus jedem lebenden Huhn auf Virus getestet durch Beimpfung von befruchteten Eiern.

  Die Hühner, die entweder mit Wildtyp oder rekombinantem Geflügelpockenvirus geimpft waren, entwickelten typische Läsionen am Flügelnetzgewebe. Einer Pustelbildung bis zum 3. Tag um jeden Nadelstich herum folgte eine zelluläre Infiltration mit Schorfbildung und Erholung nach 7 Tagen. Es wurden keine sekundären Läsionen gebildet, und es gab keinen Hinweis auf eine Verbreitung auf nicht-geimpfte Hühner, die in Kontakt kamen.

  Die Ergebnisse des Belastungsinfektions-Experiments sind in Tabelle VIII und die damit verbundenen serologischen Befunde in Tabelle IX zusammengefasst. 
<tb><TABLE> Columns=6 
<tb>Title: Tabelle VIII
Durch in Geflügelpocken exprimiertes H5 vermittelter Schutz von Hühnern 
<tb>Head Col 01 AL=L: Belastungsinfektion 
<tb>Head Col 02 AL=L: Impfstoff 
<tb>Head Col 03 AL=L: Alter der 
Hühner 
<tb>Head Col 04 AL=L: Schutz
Krank/Tot/Gesamt 
<tb>Head Col 05 to 06 AL=L:

  Virus 
<tb> 
<tb>SubHead Col 05 AL=L>Trachea: 
<tb>SubHead Col 06 AL=L>Cloaca: 
<tb> <SEP>Ty/Ireland (H5N8) <SEP>Geflügelpocken-H5 (vFP-11) <SEP>2 Tage <SEP>0/0/10 <SEP>0/10 <SEP>0/10 
<tb> <SEP>5 Wochen <SEP>0/0/5 <SEP>0/5 <SEP>0/5 
<tb> <SEP>inaktivierter H5N2 <SEP>2 Tage <SEP>0/0/9 <SEP>0/9 <SEP>0/9 
<tb> <SEP>5 Wochen <SEP>0/0/5 <SEP>0/5 <SEP>0/5 
<tb> <SEP>Geflügelpocken-
Kontrolle <SEP>2 Tage <SEP>10/9/10 <SEP>2/6 <SEP>3/6 
<tb> <SEP>5 Wochen <SEP>4/3/5 <SEP>0/5 <SEP>4/5 
<tb> <SEP>Kein <SEP>2 Tage <SEP>10/9/10 <SEP>2/7 <SEP>5/7 
<tb> <SEP>2 Tage* <SEP>2/1/2 <SEP>2/2 <SEP>2/2 
<tb> <SEP>5 Wochen <SEP>2/2/5 <SEP>0/5 <SEP>1/5 
<tb> <SEP>Ck/Penn (H5N2) <SEP>Geflügelpocken-H5 (vFP-11) <SEP>2 Tage <SEP>0/0/10 <SEP>8/10 <SEP>0/10 
<tb> <SEP>5 Wochen <SEP>0/0/6 <SEP>5/6 <SEP>2/6 
<tb> <SEP>inaktivierter H5N2 <SEP>2 Tage <SEP>0/0/8 <SEP>2/8 <SEP>0/8 
<tb> <SEP>5 Wochen <SEP>0/0/5 <SEP>3/5 

   <SEP>0/5 
<tb> <SEP>Geflügelpocken-
Kontrolle <SEP>2 Tage <SEP>10/1/10 <SEP>10/10 <SEP>10/10 
<tb> <SEP>5 Wochen <SEP>5/0/5 <SEP>5/5 <SEP>5/5 
<tb> <SEP>Kein <SEP>2 Tage <SEP>9/3/9 <SEP>9/9 <SEP>9/9 
<tb> <SEP>2 Tage* <SEP>2/2/2 <SEP>2/2 <SEP>2/2 
<tb> <SEP>5 Wochen <SEP>5/2/5 <SEP>5/5 <SEP>5/5 
<tb> <SEP>* Vier nicht geimpfte Vögel wurden zusammen mit der Geflügelpocken-H5-Gruppe von 10 Vögeln gehalten und aufgezogen, um die Ausbreitung von Geflügelpocken-H5 nachzuweisen. 
<tb></TABLE> 
<tb><TABLE> Columns=11 
<tb>Title: Tabelle IX
Durch Impfung mit vFP-11 oder einem inaktivierten Influenzavirusimpfstoff hervorgerufene Antikörperbildung 
<tb>Head Col 01 AL=L: Belastungs-
infektion 
<tb>Head Col 02 AL=L: Impfstoff 
<tb>Head Col 03 AL=L: Alter der Hühner 
<tb>Head Col 04 to 07 AL=L: HI Titer auf (a) 
<tb>Head Col 08 to 11 AL=L:

   Festsetzung der Infektiosität 
<tb>SubHead Col 04 to 05 AL=L: Ty/Ireland 
<tb>SubHead Col 06 to 07 AL=L: Ck/Penn 
<tb>SubHead Col 08 to 09 AL=L: Ty/Ireland 
<tb>SubHead Col 10 to 11 AL=L: Ck/Penn 
<tb>SubHead Col 04 AL=L>Post-1: 
<tb>SubHead Col 05 AL=L>Post-2: 
<tb>SubHead Col 06 AL=L>Post-1: 
<tb>SubHead Col 07 AL=L>Post-2: 
<tb>SubHead Col 08 AL=L>Post-1: 
<tb>SubHead Col 09 AL=L>Post-2: 
<tb>SubHead Col 10 AL=L>Post-1: 
<tb>SubHead Col 11 AL=L>Post-2:

   
<tb> <SEP>Ty/
Ireland (H5N8) <SEP>Geflügelpocken-H5 <SEP>2 Tage <SEP>15<(c)> <SEP>156 <SEP>&lt <SEP>65 <SEP>70 <SEP>2,500 
<tb> <SEP>5 Wochen <SEP>100 <SEP>480 <SEP>&lt <SEP>20 <SEP>160 <SEP>10,000 
<tb> <SEP>inaktiviertes H5N2 <SEP>2 Tage <SEP>30 <SEP>70 <SEP>30 <SEP>50 <SEP>65 <SEP>1,000 
<tb> <SEP>5 Wochen <SEP>350 <SEP>600 <SEP>180 <SEP>200 <SEP>240 <SEP>2,500 
<tb> <SEP>Geflügelpocken <SEP>2 Tage <SEP>&lt <SEP>160<(1)(b)> <SEP>&lt <SEP>20 <SEP>&lt <SEP>300<(1)> 
<tb> <SEP>Kontrolle <SEP>5 Wochen <SEP>&lt <SEP>1280<(2)> <SEP>&lt <SEP>60 <SEP>&lt <SEP>10,000<(2)> 
<tb> <SEP>kein <SEP>2 Tage <SEP>&lt <SEP>80<(1)> <SEP>&lt <SEP>20 <SEP>&lt <SEP>300<(1)> 
<tb> <SEP>5 Wochen <SEP>&lt <SEP>2000<(3)> <SEP>&lt <SEP>60 <SEP>&lt <SEP>70<(3)> 
<tb> <SEP>Ck/Penn <SEP>Geflügelpocken-H5 <SEP>2 Tage <SEP>15 <SEP>600 <SEP>&lt <SEP>90 <SEP>&lt <SEP>70 
<tb> <SEP>5 Wochen <SEP>80 <SEP>2500 <SEP>&lt 

   <SEP>300 <SEP>&lt <SEP>2,500 
<tb> <SEP>inaktiviertes H5N2 <SEP>2 Tage <SEP>60 <SEP>300 <SEP>20 <SEP>70 <SEP>10 <SEP>400 
<tb> <SEP>5 Wochen <SEP>300 <SEP>500 <SEP>100 <SEP>200 <SEP>150 <SEP>1,500 
<tb> <SEP>Geflügelpocken <SEP>2 Tage <SEP>&lt <SEP>60<(6)> <SEP>&lt <SEP>120 <SEP>&lt <SEP>40 
<tb> <SEP>Kontrolle <SEP>5 Wochen <SEP>&lt <SEP>90 <SEP>&lt <SEP>140 <SEP>&lt <SEP>40 
<tb> <SEP>kein <SEP>2 Tage <SEP>&lt <SEP>60<(6)> <SEP>&lt <SEP>160 <SEP>&lt <SEP>25 
<tb> <SEP>5 Wochen <SEP>&lt <SEP>160<(3)> <SEP>&lt <SEP>150 <SEP>&lt <SEP>70 
<tb> 
 (a) Den 5 Wochen alten Vögeln wurde vor der Impfung Blut entnommen, das in HI- und Neutralisationstests geprüft wurde; keiner enthielt nachweisbare Mengen an Antikörper; die Ergebnisse sind nicht gezeigt.

  Den 2 Tage alten Hühnern wurde 6 Wochen nach Impfung (Post-1) und den 5 Wochen alten Vögeln wurde 5 Wochen nach Impfung (Post-1) Blut entnommen; beiden Gruppen wurde 2 Wochen nach der Belastungsinfektion (Post-2) Blut entnommen. Die Zahlen stellen gemittelte Antikörpertiter aus der gleichen wie in Tabelle I beschriebenen Gruppe von Hühnern dar.
(b) Die Zahlen in Klammern geben an, wieviele die Belastungsinfektion überlebten:
&lt = weniger als 10.
(c) Hämagglutinationshemmungstests (HI) wurden in Mikrotiterplatten ausgeführt, wobei Rezeptor-zerstörende-Enzym-behandelte Seren verwendet wurden (4 HA-Einheiten von Ty/Ire-Virus, und 0,5% Hühnererythrocyten wie beschrieben bei Palmer et al., Immun. Series Nr. 6, 51-52, U.S. Dept. Health, Education and Welfare [1975]).

  Die Infektivitäts-Neutralisierungstests wurden ausgeführt, indem 10<3>EID50 von Ty/Ire-Virus mit Verdünnungen der Seren für 30 Minuten bei Raumtemperatur inkubiniert wurden, dem eine Impfung mit Aliquots in befruchtete Eier folgte. Viruswachstum wurde bestimmt durch Hämagglutinationstests nach Bebrütung der Eier für 2 Tage bei 33 DEG C.
  
<tb></TABLE> 



  Hühner, die mit dem rekombinanten Geflügelpocken-H5 (vFP-11) oder dem inaktivierten H5N2-Influenzaimpfstoff in Adjuvans     beimpft wurden, waren vor der Belastungsinfektion mit dem homologen Ty/Ire (H5N8) Influenzavirus und dem verwandten, aber unterscheidbaren Ck/Penn (H5N2)-Influenzavirus geschützt. Im Gegensatz dazu zeigte die Mehrheit der Vögel, die mit dem Ausgangs-FPV beimpft waren oder keinen Impfstoff erhalten hatten, klinische Anzeichen von hochpathogener Influenza einschliesslich eines Anschwellens und einer Cyanose  im Gesicht und Kamm, Blutungen an den Füssen und Lähmungen. Die Mehrheit dieser Vögel starb. Die geimpften Vögel schieden keine nachweisbaren Mengen von Ty/Ire, aber Ck/Penn aus. 



  Sowohl die inaktivierten als auch die rekombinanten Impfstoffe induzierten HI und neutralisierende Antikörper auf Ty/Ire, doch die Mengen an Antikörper, die von der Geflügelpocken-H5-Rekombinante vFP-11 vor der Belastungsinfektion induziert waren, hemmten nicht HA oder neutralisierten das heterologe Ck/Penn H5. Ungeachtet dessen waren die Hühner vor einer Belastungsinfektion sowohl mit Ty/Ire als auch mit Ck/Penn-Influenzaviren geschützt. 



  Durch Impfung mit vFP-11 induzierte Immunität gegen H5-Influenza dauerte mindestens 4 bis 6 Wochen und war kreuzreagierend. Zum Nachweis der Dauer und Spezifität der Antwort wurde eine Gruppe von 4 Wochen alten Hühnern in das Flügelnetzgewebe mit vFP-11 wie zuvor beschrieben geimpft und in monatlichen Abständen mit dem kreuzreagierenden Ck/Penn-Virus einer Belastungsinfektion ausgesetzt. Wiederum waren keine HI-Antikörper vor der Belastungsinfektion nachweisbar. Ungeachtet dessen waren die Vögel auch nach 4 Monaten geschützt. 



  Ausserdem induziert das durch vFP-11 exprimierte H5 eine schützende Immunantwort in Truthühnern. Weisse Outbread-Truthühner wurden im Alter von 2 Tagen und 4 Wochen durch Beimpfung am Flügelnetzwerk wie vorbeschrieben beimpft. Die  Ergebnisse sind in Tabelle X zusammengefasst. 
<tb><TABLE> Columns=9 
<tb>Title: Tabelle X
Durch in vFP-11 exprimiertem H5-HA vermittelter Schutz von Truthühnern 
<tb>Head Col 01 AL=L: Impfstoff 
<tb>Head Col 02 AL=L: Alter der 
Vögel 
<tb>Head Col 03 AL=L: Schutz
krank/tot/
gesamt 
<tb>Head Col 04 to 05 AL=L: Virusnachweis 
<tb>Head Col 06 to 07 AL=L: HI-Antikörper 
Ty/Ire 
<tb>Head Col 08 to 09 AL=L:

  Neutralisierende 
Antikörper log10 
zu Ty/Ire 
<tb>SubHead Col 04 AL=L>Trachea: 
<tb>SubHead Col 05 AL=L>Cloaca: 
<tb>SubHead Col 06 AL=L>Post-1: 
<tb>SubHead Col 07 AL=L>Post-2: 
<tb>SubHead Col 08 AL=L>Post-1: 
<tb>SubHead Col 09 AL=L>Post-2: 
<tb> <SEP>vFP-11 
Rekombinante <SEP>2 Tage <SEP>1/1/5 <SEP>5/5 <SEP>3/5 <SEP>&lt10 <SEP>160 <SEP>&lt1 <SEP>4.32 
<tb> <SEP>4 Wochen <SEP>2/1/6 <SEP>2/6 <SEP>0/6 <SEP>&lt10 <SEP>640 <SEP>1.05 <SEP>4.16 
<tb> <SEP>Kontakt <SEP>2 Tage <SEP>2/2/2 <SEP>2/2 <SEP>2/2 <SEP>&lt10 <SEP>tot <SEP>&lt1 <SEP>tot 
<tb> <SEP>Kontrollen <SEP>4 Wochen <SEP>2/2/2 <SEP>2/2 <SEP>2/2 <SEP>&lt10 <SEP>tot <SEP>&lt1 <SEP>tot 
<tb></TABLE> 



   In beiden Altersgruppen wurde eine signifikante Überlebensrate gegen eine Belastungsinfektion mit dem homologen Ty/Ire-Virus beobachtet. Nicht geimpfte Kontaktkontrollvögel wurden zusammen mit den geimpften Vögeln gehalten, um eine Verbreitung des rekombinanten Virus zu prüfen. Diese Vögel überlebten die Belastungsinfektion nicht. 


 Beispiel 11 
 


 Konstruktion der das Hühnerinfluenza-Nucleoprotein (NP)-Gen exprimierenden
 Geflügelpockenvirus FP-1-Rekombinante vFP-12 
 



  Das Plasmid pNP33 enthält einen cDNA-Clon des Influenzavirus Hühner/Pennsylvania/1/83 Nucleoproteingens (NP). Nur die 5 min - und 3 min -Enden des etwa 1,6 Kbp langen NP-Gens wurden sequenziert. NP wurde aus pNP 33 in mit Sma I verdautem pUC 9 überführt als ein stumpfendiges 5 min  Cla I-Xho I 3 min -Fragment, wobei die pUC 9-Eco RI-Stelle am 3 min -Ende war, wodurch pRW 714 erzeugt wurde. Das Translationsstartcodon (ATG) von NP enthält die folgende unterstrichene Aha II-Stelle: ATGGCGTC. Der vorher beschriebene Vaccinia H6-Promotor wurde mit NP mittels eines doppelsträngigen synthetischen Oligonucleotids verbunden. Das synthetische Oligonucleotid enthielt die H6-Sequenz von der Eco RV-Stelle bis zum ATG und bis zur NP codierenden Sequenz an der Aha II-Stelle.

  Das Oligonucleotid wurde mit Enden, die mit Bam HI und Eco RI kompatibel waren, zur Insertion in pUC 9 synthetisiert und führte zu pRW 755. Beginnend an dem mit Bam HI kompatiblen Ende, mit dem ATG unterstrichen, ist die Sequenz des doppelsträngigen synthetischen Oligonucleotids die folgende:
 
 GATCCGATATCCGTTAAGTTTGTATCGTAATGGCGTCG
 GCTATAGGCAATTCAAACATAGCATTACCGCAGCTTAA
 



  Das lineare Produkt eines teilweisen Verdaus von pRW 755 mit  Aha II wurde isoliert und nachgespalten mit Eco RI. Das pRW 755-Fragment, das einen einzigen Aha II-Schnitt am ATG enthielt und mit Eco RI nachgespalten war, wurde isoliert,  mit Phosphatase behandelt, und als Vektor für das Verdauungsprodukt von pRW 714 (siehe nachstehend) benutzt. 



  Das isolierte, lineare Produkt eines Partialverdaus mit Aha II von pRW 714 wurde mit Eco RI nachgespalten. Ein die codierende Sequenz für NP enthaltendes isoliertes Aha II-Eco RI Fragment von etwa 1,6 Kbp wurde in den pRW 755 Vektor eingesetzt und führte zu pRW 757. Der vollständige H6-Promotor wurde gebildet, indem die Sequenzen oberhalb (5 min ) der Eco RV-Stelle hinzugefügt wurden. Das Plasmid pRW 742B (beschrieben in Beispiel 4) hatte die H6-Sequenz unterhalb (3 min ) der Eco RV-Stelle mit den Sequenzen bis zu der Nde I Stelle in pUC 9 entfernt. Das mit Phosphatase behandelte Eco RV-Nde I Fragment von pRW 742B wurde als Vektor für das pRW 757-Fragment (siehe nachstehend) benutzt.

  Das isolierte lineare Produkt eines Partialverdaus von pRW 757 mit Eco RV wurde nach einer Spaltung mit Nde I wiedergewonnen; dieses Fragment enthält den H6-Promotor von der Eco RV-Stelle über NP bis zu der Nde I Stelle in pUC 9. Das pRW 757-Fragment wurde in den pRW 742B-Vektor inseriert und bildete pRW 758. Das Eco RI Fragment von pRW 758, das das vom H6-Promotor abhängige vollständige NP enthält, wurde mit dem Klenow-Fragment der DNA-Polymerase I an den Enden glattgemacht und in die Hinc II-Stelle von pRW 731.13 inseriert und ergab pRW 760. Die Hinc II StelIe von pRW 731.13 ist der FP-1-Genort, der in Beispiel 6 zur Konstruktion von vFP-6 und vFP-7 verwendet wurde. 



  Unter Benutzung von Geflügelpocken FP-1 als auffangendem Virus wurde das Plasmid pRW 760 für einen in vitro Rekombinationstest verwendet. Die Plaques der Nachkommenschaft wurden getestet und gereinigt mittels in situ Plaquehybridisierung. Expression des Gens wurde durch Immunpräzipitationsstudien unter Benutzung eines polyclonalen Ziegen-anti-NP-Antiserums  bestätigt. Die Grösse des Proteins, das insbesondere aus einem Lysat von mit vFP-12 infizierten CEF-Zellen präzipi tiert wurde, war etwa 55 kD, was innerhalb des veröffentlichten Bereichs von Influenzanucleoproteinen liegt. 


 Beispiel 12 
 


 Produktion einer Vogelinfluenza-Nucleoprotein (NP)- und Hämagglutinin (HA)-Gene
 exprimierenden Doppelrekombinante vFP-15 von Geflügelpockenvirus 
 



  Das Hämagglutinin (HA)-Gen aus A/Tyr/Ire/1378/83 wurde im Zusammenhang mit der Konstruktion von vFP-11 (Beispiel 9) beschrieben. Bei der Herstellung der Doppelrekombinante wurde das HA-Gen zuerst in den zuvor bei der Herstellung von vFP-8 unter Benutzung des Plasmids pRW 731.15 beschriebenen  Locus f8 gebracht. 



  Das zur Konstruktion von vFP-11 benutzte Plasmid war pRW 759. Das mit dem H6-Promotor verbundene Hämagglutiningen wurde aus diesem Plasmid durch einen partialen Verdau mit  Pst I entfernt. Dieses Fragment wurde dann an den Enden mit dem Klenow-Fragment der DNA Polymerase I glattgemacht, in die glattgemachte Bam HI-Stelle von pRW 731.15 inseriert und ergab so pRW 771. 



  Das Plasmid pRW 771 wurde dann in einem in vitro Rekombinationstest unter Benutzung von vFP-12 als auffangendem Virus eingesetzt. Das rekombinante Virus vFP-12 enthält das mit dem H6-Promotor verbundene Nucleoproteingen am Genort f7, wie er im Plasmid pRW 731.13 definiert ist. Rekombinante Plaques, die nun beide Insertionen enthielten, wurden ausgewählt und mittels in situ Hybridisierung und Oberflächenexpression des Hämagglutinins plaque-gereinigt, was durch einen Protein-A- beta -galactosidase-verbundenen Immuntest bestätigt wurde. Die Expression beider Gene wurde durch Immunpräzipitation aus mit dem doppelrekombinanten Virus vFP-15 infizierten Zellysaten nachgewiesen. 


 Beispiel 13 
 


 Konstruktion von rekombinanten Kanarienpockenviren 
 



  Das folgende Beispiel zeigt die Identifizierung von vier nicht-essentiellen Insertions-Loci in dem Kanarienpockengenom und die Konstruktion von vier rekombinanten Kanarienpockenviren vCP-16, vCP-17, vCP-19 und vCP-20. 



  Die Kanarienpocken-Rekombinante vCP-16 wurde wie folgt hergestellt. 



  Ein 3,4 Kbp Pvu II Fragment von Kanarienpocken-DNA wurde in pUC 9 cloniert und führte zu pRW 764.2. Es wurde eine singuläre Eco RI-Stelle gefunden, die asymmetrisch in dem Fragment mit einem kurzen Arm von 700 bp und einem langen Arm von 7,2 Kbp liegt. Das Plasmid wurde mit Eco RI verdaut und unter Verwendung von Klenow-Fragment der DNA-Polymerase I glattendig gemacht. Das glattendige H6/Tollwut G-Gen wurde danach mit dieser Stelle ligiert und zur Transformation von E. coli benutzt. Das daraus hervorgehende Plasmid pRW 775 wurde für einen in vitro Rekombinationstest benutzt. In einem Immunoscreen-Verfahren positive Nachkommenplaques wurden ausgewählt und plaque-gereinigt. Die daraus hervorgehende Rekombinante wurde als vCP-16 und der Insertions-Locus als C3 bezeichnet. 



   Das in der vorstehenden Konstruktion benutzte Plasmid pRW 764.2 enthielt ausserdem eine singuläre Bgl II-Stelle etwa 2,4 Kbp von der Eco RI-Stelle entfernt. Unter Benutzung der gleichen Clonierungsstrategie wurde das H6/Tollwut G Gen mit dem Plasmid pRW 764.2 an dieser Stelle ligiert und führte zu pRW 774. Dieses Plasmid wurde zur Konstruktion der Rekombinante vCP-17 mit dem als C4 bezeichneten Insertionslocus benutzt. 



  Das Plasmid pRW 764.5 enthält ein 850 bp Pvu II-Fragment von Kanarienpocken-DNA mit einer singulären Bgl II-Stelle, die asymmetrisch in dem Fragment 400 bp von einem Ende liegt. Unter Benutzung der wie vorher beschriebenen Clonierungsstrategie wurde das mit dem H6-Promotor verbundene Tollwut G-Gen an dieser Stelle inseriert und ergab das Plasmid pRW 777. Das damit hergestellte stabile rekombinante Virus wurde als vCP-19 und der Insertionslocus als C5 bezeichnet. 



  Plasmid pRW 764.7 enthält ein 1,2 Kbp Pvu II-Fragment mit einer singulären Bgl II-Stelle 300 Basen von einem Ende. Dieses Plasmid wurde mit Bgl II verdaut und mit dem Klenow-Fragment von DNA-Polymerase I an den Enden glattgemacht. Das an den Enden glattgemachte lac Z-Gen mit dem 11K-Promotor wurde eingefügt und führte zu Plasmid pRW 778. Das unter Benutzung dieses Plasmids hergestellte stabile rekombinante Virus wurde als VCP-20 und der Insertionslocus als C6 bezeichnet. 


 Beispiel 14 
 


 Konstruktion eines das Fusionsprotein von Newcastle Disease Virus exprimierenden rekombinanten 
 Geflügelpockenvirus vFP-29 
 



  Plasmid pNDV 108, der cDNA-Clon des Fusionsgens von NDV-Stamm Texas, besteht aus einem Hpa I cDNA-Fragment von etwa 3,3 Kbp, das sowohl die codierende Sequenz für das Fusionsprotein als auch zusätzliche, in die Sca I-Stelle von pBR 322 clonierte, codierende NDV-Sequenzen enthält. Schritte zur Herstellung des Insertionsplasmids sind nachstehend beschrieben. 


 (1) Herstellung von Plasmid pCE 11 
 



  Ein FPV-Insertionsvektor, pCE 11, wurde durch Einfügen von Polylinkern an der Hinc II-Stelle von pRW 731.13 hergestellt (bezeichnet als Locus f7). pRW 731.13 enthält ein 5,5 Kbp  Pvu II-Fragment von FP-1-DNA. Ein nicht-essentieller Locus wurde vorstehend definiert an der Hinc II-Stelle durch Konstruktion der in Beispiel 6 beschriebenen stabilen Rekombinante vFP-6. Die an der Hinc II-Stelle eingefügten Polylinker enthalten die folgenden Restriktionsenzym-Schnittstellen: Nru I, Eco RI, Sac I, Kpn I, Sma I, Bam HI, Xba I, Hinc II, Sal I, Acc I, Pst I, Sph I, Hind III und Hpa I. 


 (2) Herstellung von Plasmid pCE 19 
 



  Dieses Plasmid ist eine weitere Modifikation von pCE 11, in das das Vacciniavirus-Transkriptionstoppsignal ATTTTTNT (L. Yuen und B. Moss, J. Virology, Bd. 60 [1986], Seiten 320-323) (in diesem Fall ist N ein A) zwischen die Sac I- und Eco RI-Stellen von pCE 11 mit Verlust der Eco RI-Stelle eingefügt worden ist. 


 (3) Einfügung von codierenden NDV-Sequenzen 
 



  Ein über ein Gel gereinigtes 1,8 Kbp Bam HI-Fragment, das mit Ausnahme von 22 Nucleotiden vom 5 min -Ende des Fusionsproteingens alle Nucleotide enthielt, wurde in die Bam HI-Stelle von pUC 18 eingefügt und bildete pCE 13. Dieses Plasmid wurde mit Sal I verdaut, das in dem Vektor 12 Basen oberhalb des 5 min -Endes der codierenden Sequenz spaltet. Die Enden wurden mit dem Klenow-Fragment der DNA Polymerase I aufgefüllt und das Plasmid anschliessend mit Hind III verdaut, das 18 Basen oberhalb der Sal I-Stelle spaltet. Ein über ein Gel gereinigtes 146 bp Sma I - Hind III-Fragment, das den in den bevorzugten Ausführungsformen beschriebenen Vacciniavirus-H6-Promotor sowie auch Polylinkersequenzen an jedem Ende enthielt, wurde mit dem Vektor ligiert und in E. coli Zellen transformiert. Das daraus hervorgehende Plasmid wurde als pCE 16 bezeichnet. 



  Um das ATG Startcodon des NDV-Fusionproteingens mit dem 3 min -Ende des H6-Promotors in Ablesephase zu bringen und die in  pCE 16 vom NDV 5 min -Ende fehlenden 22 Nucleotide zu ersetzen, wurde ein komplementäres synthetisches Oligonucleotid mit Eco RV-und Kpn I-Stellen an den Enden entwickelt. Die Oligonucleotidsequenz war:
 
 5 min -ATC-CGT-TAA-GTT-TGT-ATC-GTA-ATG-GGC-TCC-
 AGA-TCT-TCT-ACC-AGG-ATC-CCG-GTA-C 3 min .
 



  Die Konstruktion pCE 16 wurde anschliessend mit Eco RV und  Kpn I verdaut. Die Eco RV-Stelle liegt in dem H6 Promotor 24 Basen oberhalb des Initiations-ATG. Die Kpn I-Stelle liegt in der codierenden NDV Sequenz 29 Basen unterhalb des ATG. 



  Die Oligonucleotide wurden miteinander hybridisiert, phosphoryliert und mit dem linearisierten Plasmid verbunden. Die daraus hervorgehende DNA wurde zur Transformation von E. coli Zellen benutzt. Dieses Plasmid wurde als pCE 18 bezeichnet. 



  Zur Insertion codierender NDV-Sequenzen in einen FPV Insertionsvektor wurde ein über ein Gel gereinigtes 1,9 Kbp Sma I-Hind III-Fragment von pCE 18 (wobei in der Polylinkerregion gespalten wird) mit einem 7,8 Kbp Sma I-Hind III-Fragment von pCE 19 (wie vorstehend beschrieben) ligiert. Das Transkriptionsstartsignal liegt 16 Basen unterhalb der Sma I-Stelle. Das daraus hervorgehende Plasmid wurde als pCE 20 bezeichnet. 



  Das Plasmid pCE 20 wurde in einem in vitro Rekombinationstest eingesetzt, wobei Geflügelpockenvirus FP-1 als auffangendes Virus benutzt wurde. Die daraus hervorgehende Nachkommenschaft wurde auf CEF-Monolayers plattiert und die Plaques wurden einem  beta -Galactosidase-Protein-A Immuntest unter Verwendung eines polyclonalen Hühner-anti-NDV-serums unterworfen. In der Färbung positive Plaques wurden ausgewählt und 4 Runden einer Plaquereinigung unterzogen, um eine homo gene Population zu erhalten. Die Rekombinante wurde vFP-29 genannt. 


 Beispiel 15 
 


 Konstruktion von Katzenleukämievirus-(FeLV) Hüll-(ENV)-Glykoprotein 
 exprimierenden Avipoxvirusrekombinanten 
 



  Das FeLV-env-Gen enthält die Sequenzen, welche das p70 + p15E Polyprotein codieren. Dieses Gen wurde zunächst in das Plasmid pSD467vC mit dem dem FeLV-env-Gen vorangestellten Vaccinia H6-Promotor eingefügt. Zuvor wurde das Plasmid pSD467vC durch die Einfügung eines 1802 bp Sal I/Hind III-Fragments, das das Vaccinia-Hämagglutinin (HA)-Gen enthält, in einen pUC 18 Vektor erhalten. Die Lage des HA-Gens wurde zuvor bestimmt (Shida, Virology, Bd. 150 [1988], Seiten 451-462). Die Mehrheit des das HA-Genprodukt codierenden offenen Leserahmens wurde deletiert (Nucleotid 443 bis Nucleotid 1311) und eine mutiple Clonierungsstelle, die Bgl II-, Sma I-, Pst I- und Eag I-Restriktionsendonucleasestellen enthielt, eingefügt.

   Das resultierende Plasmid pSD467vC enthält flankierende Arme aus Vaccinia von 442 bp aufwärts 5 min seitig von der mutiplen Clonierungsstelle und 491 bp 3 min seitig von diesen Restriktions-Schnittstellen. Diese flankierenden Arme ermöglichen es, dass in die multiple Clonierungsregion eingefügtes Material in die HA-Region des Kopenhagen-Stamms von Vaccinavirus rekombiniert werden kann. Die daraus hervorgehende rekombinante Nachkommenschaft ist HA-negativ. 



  Der H6-Promotor war synthetisiert worden durch das Aneinanderhängen von vier überlappenden Oligonucleotiden, die zusammen die vorstehend in den bevorzugten Ausführungsformen beschriebene vollständige Sequenz umfassten. Das daraus hervorgehende 132 bp-Fragment enthielt eine Bgl II-Restriktions-Schnittstelle am 5 min -Ende und eine Sma I-Stelle am 3 min -Ende. Dieses wurde in pSD467vC über die Bgl II-und Sma I-Restriktions-Schnittstellen eingefügt. Das daraus hervorge hende Plasmid wurde als pPT15 bezeichnet. Das FeLV-env-Gen wurde in die unmittelbar 3 min seitig von dem H6-Promotor liegende singuläre Pst I-Stelle von pPT15 inseriert. Das daraus hervorgehende Plasmid wurde als pFeLV1A bezeichnet. 



  Zur Konstruktion der FP-1 Rekombinante wurde die 2,4 Kbp H6/FeLV-env-Sequenz aus pFeLV1A durch Spaltung mit Bgl II und partielle Spaltung mit Pst I ausgeschnitten. Die Bgl II-Stelle liegt an der 5 min -Grenze der H6-Promotorsequenz. Die Pst I Stelle liegt 420 bp nach dem Terminationssignal der Translation für den offenen Leserahmen des Hüll-Glykoproteins. 



  Die 2,4 Kbp H6/FeLV-env-Sequenz wurde in mit Bam HI und Pst 15 I gespaltenen pCE 11 eingefügt. Der FP-1-Insertionsvektor, pCE 11, leitet sich ab von pRW 731.13 durch Einfügung einer multiplen Clonierungsstelle in die nicht-essentielle Hinc II-Stelle. Dieser Insertionsvektor gestattet die Herstellung von FP-1-Rekombinanten, die fremde Gene im Locus f7 des FP-1  Genoms enthalten. Das rekombinante FP-1/FeLV-Insertionsplasmid wurde als pFeLVFI bezeichnet. Diese Konstruktion bietet kein vollständiges ATG zur ATG-Substitution. 



  Um eine vollständige ATG:ATG-Konstruktion zu erreichen, wurde ein Nru I/Sst II-Fragment von etwa 1,4 Kbp aus dem Vacciniavirusinsertionsvektor pFeLV1C abgeleitet. Die Nru I-Stelle liegt innerhalb des H6-Promotors in einer Position von 24 bp oberhalb von dem ATG. Die Sst II-Stelle liegt 1,4 Kbp 3 min seitig des ATG und 1 Kbp 5 min seitig von dem Terminationssignal der Translation. Dieses Nru I/Sst II-Fragment wurde mit einem 9,9 Kbp-Fragment ligiert, das durch Verdau mit Sst II und partiellen Verdau mit Nru I erzeugt war. Dieses 9,9 Kbp-Fragment enthält die 5,5 Kbp der FP-1 flankierenden Arme, die pUC Vektorsequenzen, 1,4 Kbp an den dem 3 min -Ende des env-Gens entsprechenden Abschnitten der FeLV-Sequenz und die Sequenz ganz am 5 min -Ende des H6-Promotors (ca. 100 bp). Das daraus hervorgehende Plasmid wurde als pFeFLVF2  bezeichnet.

  Die ATG:ATG-Konstruktion wurde durch Nucleotidsequenzanalyse bestätigt. 



  Ein weiterer FP-1 Insertionsvektor, pFeLVF3, wurde aus pFeLVF2 durch Entfernen der dem wahrscheinlichen Immunsuppressionsbereich entsprechenden FeLV-env-Sequenzen abgeleitet (Cianciolo et al., Science, Bd. 230 [1985], Seiten 453-455) (Nucleotid 1548 bis 1628 der codierenden Sequenz). Dieses wurde erreicht durch Isolierung eines Sst II/Pst I-Fragments (Stellen sind oben beschrieben) von etwa 1 Kbp aus dem Vacciniavirus-Insertionsvektor pFeLV1D. Das Plasmid pFeLV1D ist ähnlich dem Plasmid pFeLV1C mit der Ausnahme, dass die dem Immunsuppressionsbereich entsprechenden env-Sequenzen (Nucleotid 1548 bis 1628) durch Oligonucleotid-gesteuerte Mutagenese (Mandecki, Proc. Natl. Acad. Sci. USA, Bd. 83 [1987], Seiten 7177-7181) entfernt worden waren.

  Das 1 Kbp Sst II/Pst I-Fragment ohne die Nucleotide 1548 bis 1628 wurde in ein 10,4 Kbp Sst II/Pst I-Fragment eingefügt, das das übrige aus pFeLVF2 abgeleitete H6:FeLV-env-Gen enthält. 



  Die Insertionsplasmide, pFeLVF2 und pFeLVF3, wurden für in vitro Rekombinationstests mit FP-1 als dem auffangenden Virus benutzt. Nachkommenschaft der Rekombination wurde auf CEF Monolayer plattiert und rekombinante Viren wurden durch Plaque-Hybridisierung auf CEF Monolayern ausgewählt. Mittels Hybridisierungsanalyse identifizierte rekombinante Nachkommenschaft wurde ausgewählt und 4 Runden einer Plaquereinigung unterworfen, um eine homogene Population zu erhalten. Eine FP-1-Rekombinante, die das vollständige FeLV-env-Gen enthielt, wurde als vFP-25 und eine FP-1-Rekombinante, die das vollständige Gen mit Ausnahme des Immunsuppressionsbereichs enthielt, als vFP-32 bezeichnet. Für beide Rekombinanten wurde durch Immunpräzipitation unter Benutzung eines polyclonalen Rinder-anti-FeLV polyclonalen Serums (Antibodies, Inc., Davis, Ca) gezeigt, dass sie das richtige Genprodukt exprimieren.

  Es ist von Bedeutung, dass diese FP- 1-Rekombinanten das fremde FeLV-env-Gen in der von Katzen stammenden CRFK-Zellinie (ATCC Nr. CCL94) exprimieren. 



  Zur Konstruktion von Kanarienpocken-(CP)-Rekombinanten, wurde ein H6:FeLV-env-Sequenzen enthaltendes 2,2 Kbp-Fragment aus pFeLVF2 durch Spaltung mit Sma I und Hpa I ausgeschnitten. Die Sma I-Stelle liegt an der 5 min -Grenze der H6-Promotorsequenz. Die Hpa I-Stelle liegt 180 bp 3 min seitig von dem Terminationssignal der Translation für den offenen Leserahmen des Hüll-Glykoproteins. 



  Die 2,2 Kbp H6:FeLV-env-Sequenz wurde in die nicht-essentielle Eco RI-Stelle des Insertionsplasmids pRW 764.2 eingesetzt, nachdem die Enden der Eco RI-Stelle glattgemacht waren. Dieser Insertionsvektor gestattet die Erzeugung von CP-Rekombinanten, die fremde Gene im Locus C4 des CP-Genoms enthalten. Das rekombinante CP-Insertionsplasmid wurde als pFeLVCP2 bezeichnet. Diese Konstruktion bietet eine perfekte ATG:ATG-Substitution. 



  Das Insertionsplasmid, pFeLVCP2, wurde in einem in vitro Rekombinationstest mit CP als dem auffangenden Virus eingesetzt. Nachkommenschaft der Rekombinante wurde auf CEF Monolayer plattiert und rekombinantes Virus mittels eines mit Protein-A-verbundenen  beta -Galactosidaseimmuntests unter Verwendung eines kommerziellen polyclonalen Rinder-anti-FeLV Serums (Antibodies, Inc., Davis, CA.) ausgewählt. In der Färbung positive Plaques wurden ausgewählt und 4 Runden einer Plaque-Reinigung unterzogen, um eine homogene Population zu erhalten. Eine Rekombinante, die das gesamte FeLV-env-Gen exprimiert, wurde als vCP-36 bezeichnet. 


 Beispiel 16 
 


 Konstruktion von Rous-assoziiertem Virus Typ 1-(RAV-1)-Hüll-(env)-Gen 
 exprimierendem rekombinantem Geflügelpockenvirus vFP-22 
 



   en  spezifische Präzipitation einer kleinen Menge von Vorläuferprotein mit einem Molekulargewicht von etwa 180 kD und von Spaltprodukten von 90 kD. 


 Beispiel 20 
 


 Konstruktion der Herpes simplex gD exprimierenden Geflügelpockenvirus-FP-1-Rekombinante vFP-30 
 



  Das Herpes simplex Virus (HSV) Typ 1 Glykoprotein D-Gen (gD) vom Stamm KOS wurde in die Bam HI-Stelle von pUC 9 als ein am 5 min -Bam HI-Ende mit Hpa II-NruI-Fragment, das mit dem am 3 min -Bam HI-Ende verknüpft wurde, cloniert; das 5 min -Ende liegt unmittelbar neben der Pst I-Stelle von pUC 9. Die 5 min -Sequenz von HSV gD, die mit dem Initiationscodon (ATG) der Translation beginnt, enthält die folgende unterstrichene Nco I Stelle:
 
 ATGGGGGGGGCTGCCGCCAGGTTGGGGGCCGTGATTTTGTTTGTCGTCATAGTGGGCCTCCATGG.
 



  Der vorstehend beschriebene Vaccinia H6-Promotor wurde an das HSV gD-Gen über ein synthetisches Oligonucleotid verknüpft. Das synthetische Oligonucleotid enthält den 3 min -Abschnitt des H6-Promotors von der Nru I-Stelle zum ATG und weiter zur codierenden Sequenz von gD bis zur Nco I-Stelle. Das Oligonucleotid wurde mit einem Pst I-kompatiblen Ende auf der 5 min -Seite synthetisiert. Der gD Clon in pUC 9 wurde mit Pst I und Nco I gespalten und die HSV-Sequenz am 5 min -Ende zum Austausch mit dem synthetischen Oligonucleotid entfernt, was zu pRW 787 führte. Die Sequenz des doppelsträngigen synthetischen Oligonucleotids ist:
 
 GTCGCGATATCCGTTAAGTTTGTATCGTAATGGGAGGTGCCGACGTCAGCGCTATAGGCAATTC-AAACATAGCATTACCCTCCACGGCCAGCTAGATTAGGTGCTGTTATTTTATTTGTAGTTA TAGTA-GGACTCGTCGATCTAATCCACGACAATAAAATAAACATCAATATCATCCTGAGGTAC
 



  Verdau von pRW 787 mit Nru I und Bam HI erzeugt ein Fragment von etwa 1,3 Kbp, das die 3 min -Seite des H6-Promotors von der  Nru I-Stelle durch die codierende Sequenz von HSV gD hindurch bis zur Bam HI-Stelle enthält. Der mit Nru I und Bam HI gespaltene Vektor pRW 760 wurde in Beispiel 11 beschrieben. Die Insertion eines 1,3 Kbp Fragments in den Vektor pRW 760 führte zu pRW 791. Der Vektor pRW 791 enthält das vollständige HSV gD Gen unter dem Vaccinia H6-Promotor in der nicht-essentiellen Hinc II-Stelle in FP-l in pRW 731.13 (Locus f7). 



  Rekombination des Spenderplasmids pRW 791 mit FP-1 führte zu vFP-30. Oberflächenexpression des Glykoproteins wurde in rekombinanten Plaques nachgewiesen unter Verwendung von mit  beta -Galactosidase verknüpftem Protein A und für HSV-1 spezifischen Seren. 


 Beispiel 21 
 


 Verwendunq von Entomopockenpromotoren zur Regulation der Expression von Fremdgenen 
 in Pockenvirenvektoren 
 


 (a) Hintergrund 
 



  Pockenviren von Insekten (Entomopocken) werden gegenwärtig in der Unterfamilie Entomopoxvirinae eingeordnet, die weiter unterteilt wird in drei Gattungen (A, B und C), die Entomopockenviren entsprechen, die aus den Insektenordnungen Coleoptera, Lepidoptera bzw. Orthoptera isoliert wurden. Entomopockenviren haben in der Natur einen engen Wirtsbereich, und es ist nicht bekannt, dass sie in irgendeiner Vertebratenart replizieren. 



  Das in den vorliegenden Untersuchungen benutzte Virus wurde ursprünglich aus infizierten Larven von Amsacta moorei (Lepidoptera: arctildae) aus Indien isoliert; vgl. Roberts und Granados, J. Invertebr. Pathol. Bd. 12, (1968), Seiten 141-143. Das Virus, bezeichnet als AmEPV, ist die Leitart für Genus B. 



  Wildtyp AmEPV wurde von Dr. R. Granados (Boyce Thomson Institute, Cornell University) als infektiöse Hämolymphe von infizierten Estigmene acrea-Larven erhalten. Es wurde gefunden, dass das Virus in der Invertebraten-Zellinie IPLB-LD652Y repliziert, die aus Ovariumgeweben von Lymantria dispar (Schwammspinner) (beschrieben bei Goodwin et al., In Vitro Bd. 14 [1978] Seiten 485-494) gewonnen wurde. Diese Zellen wurden bei 28 DEG C in IPL-528-Medium gezogen, das mit 4% fötalem Kälber- und 4% Hühnerserum supplementiert war. 



  Das Wildtyp-Virus wurde auf Plaques auf LD652Y-Zellen geprüft und ein Plaque, als V1 bezeichnet, wurde für weitere Experimente ausgewählt. Dieses Isolat ruft zahlreiche Einschlusskörperchen (OBs) im Cytoplasma der infizierten Zellen gegen Ende des Infektionszyklus hervor. 


 (b) Promotorindentifizierung 
 



  Die Identifizierung und Kartierung eines AmEPV-Promotors wurde wie folgt erreicht. Gesamt-RNA aus infizierten LD652Y-Zellen (48 Stunden nach der Infektion; späte Phase) wurde isoliert und benutzt, um mit 32P-markierte erste Strang-cDNA zu erzeugen. Die cDNA wurde dann benutzt, um "Blots" zu prüfen, die Restriktionsverdaus von AmEPV-Genom enthielten. Dieser Southern Blot führte zur Aufdeckung eines starken Signals auf einem 2,6 kb Cla I-Fragment, was anzeigte, dass dieses Fragment ein stark exprimiertes Gen codierte. Das Fragment wurde in einen Plasmidvektor cloniert und seine DNA-Sequenz bestimmt. 



  Analyse der Sequenzdaten ergab einen offenen Leserahmen, der in der Lage war, ein 42 kD Polypeptid zu codieren. In vitro Translation der Gesamt-RNA zum Zeitpunkt 48 Stunden nach der Infektion und Auftrennung der Produkte über SDS-PAGE führte zu einem Polypeptid von ca. 42 kD. 


 (c) Konstruktion eines rekombinanten Vacciniavirus mit der Expression eines Fremdgens unter der Kontrolle des Entomopockenvirus-Promotors. 
 



  Um zu bestimmen, ob ein Entomopockenvirus-Promotor in einem Vertebraten-Pockenvirussystem funktionieren würde, wurde das folgende Plasmid konstruiert: ein Oligonucleotid wurde chemisch synthetisiert, das 107 Basen von der 5 min -Seite des Translationsstartsignals des 42K Gens (nachfolgend als AmEPV 42K-Promotor bezeichnet) enthielt und von einer Bgl II-Stelle am 5 min -Ende und am 3 min -Ende von den ersten 14 Basen der codierenden, an einer Eco RI-Stelle aufhörenden Region von Hepatitis B-Virus pre-S2 flankiert ist. Die AmEPV 42K-Promotorsequenz ist im folgenden beschrieben:
 
 TCAAAAAAATATAAATGATTCACCATC
 TGATAGAAAAAAAATTTATTGGGAAGA
 ATATGATAATATTTTGGGATTTCAAA
 ATTGAAAATATATAATTACAATATAAAATG
 



  Der AmEPV 42K-Promotor wurde mit dem Hepatitis B-Virus-Oberflächenantigen (HBVsAG) wie folgt ligiert. Ein das Hepatitis B-Virus-Oberflächenantigen und den codierenden Bereich von pre-S2 (Typ ayw wie beschrieben bei Galibert et al., Nature Bd. 281 [1979], Seiten 646-650) enthaltendes pUC-Plasmid wurde erzeugt, das von den Vacciniavirusarmen in der nichtessentiellen Region des Vacciniavirusgenoms, das das Hämagglutinin-(HA)-Molekül codiert (HA-Arme beschrieben in Beispiel 15; HA-Region beschrieben von Shida, Virology Bd. 150 [1986], Seiten 451-462) flankiert war. Das vorstehend beschriebene Oligonucleotid wurde in dieses Plasmid eingefügt, indem die singuläre Eco RI-Stelle in den HBVsAg codierenden Bereich und die singuläre Bgl II-Stelle in dem HA-Vacciniaarm benutzt wurde. Das daraus hervorgehende rekombinante Vacciniavirus wurde als vP 547 bezeichnet. 



   Die Expression der codierenden HBVsAg-Sequenz unter der Kontrolle des Entomopocken 42K-Promotors wurde mit einem Immu noassay nachgewiesen. Entsprechende Kulturen der Säugetierzellinie BSC-40 wurden mit Ausgangsvacciniavirus oder der Rekombinante vP 547 infiziert. 24 Stunden nach Infektion wurden die Zellen lysiert und das Lysat in Reihenverdünnungen auf eine Nitrocellulosemembran aufgebracht. Die Membran wurde zuerst mit einem Ziegen-anti-HBV-Serum und anschliessend mit <1><2><5>J-Protein A inkubiert. Nach dem Waschen wurde ein Röntgenfilm mit der Membran belichtet. Positive Signale wurden in mit vP 547 infizierten Kulturen, jedoch nicht in mit Elternvirus infizierten Kulturen gefunden, was eine Erkennung des AmEPV 42K-Promotors durch Vacciniavirus in Säugetierzellen andeutet. 



  Die vorstehenden Ergebnisse wurden bestätigt durch Verwendung eines Ausria-Assays (vgl. Beispiel 1 für Details), um HBVsAg in infizierten Säugetierzellen nachzuweisen. Vacciniavirusrekombinanten, die entweder das HBVsAg-Gen an AmEPV42K oder an den Vacciniavirus H6-Promotor gekoppelt hatten, wurden verwendet, um BSC-40 Zellen zu infizieren; das Ausmass der Expression von sAg wurde in einem Ausria-Test ermittelt.

  Wie in Tabelle XII dargestellt, zeigen die Daten, dass die Menge an Expression von HBVsAg bei Verwendung des 42K-Promotors signifikant war. 
<tb><TABLE> Columns=3 
<tb>Title: Tabelle XII
Expression von HBVsAg in rekombinantem Vacciniavirus 
<tb>Head Col 01 AL=L: Rekombinantes Virus 
<tb>Head Col 02 AL=L: Promotor 
<tb>Head Col 03 AL=L: Ausria P/N-Verhältnis 
<tb> <SEP>vP-410 <SEP>Kontrolle <SEP>1,0 
<tb> <SEP>vP-481 <SEP>H6 <SEP>24,3 
<tb> <SEP>vP-547 <SEP>42K <SEP>44,9 
<tb></TABLE> 



  Weitere Experimente wurden durchgeführt, um die zeitabhängige Natur der Regulation des AmEPV 42K Promotors in einem Vertebraten-Pockenvirussystem zu bestätigen. Gleichartige Kulturen von BSC-40 Zellen wurden mit vP 547 in Gegenwart  oder Abwesenheit von 40  mu g/ml Cytosin Arabinosid, einem deshalb die späte virale Transkription blockierenden Inhibitor der DNA-Replikation infiziert. Die Mengen der Expression wurden in einem Ausria-Test 24 Stunden nach Infektion überprüft. Die Ergebnisse zeigen, dass der 42K Promotor als ein früher Promotor in einem Vacciniavirus-Replikationssystem erkannt wurde. 



  Die Verwendung des AmEPV 42K-Promotors zur Expression von Fremdgenen in einem Säugetiersystem ist ersichtlich verschieden von der Verwendung des Autographa californica NPV Polyhedrin-Promotors zur Genexpression in Invertebraten-Systemen (Luckow und Summers, Biotechnology, Bd. 6 [1988], Seiten 47-55). Der Polyhedrinpromotor wird nicht durch den Transkriptionsapparat in Säugetierzellen erkannt (Tjla et al., Virology, Bd. 125 [1983], Seiten 107-117). Die Verwendung des AmEPV 42K-Promotors in Säugetierzellen zeigt erstmals, dass ein Insektenviruspromotor zur Expression von fremden Genen in einem nicht-insektenviralen Vektor in Nicht-Invertebratenzellen benutzt worden ist. 



  Um festzustellen, ob Avipoxviren ebenfalls den 42K-Entomopockenpromotor erkennen würden, wurde das folgende Experiment durchgeführt. Identische Kulturen von CEF-Zellen wurde mit 10 pfu pro Zelle entweder von Geflügelpockenvirus, Kanarienpockenvirus oder Vacciniavirus geimpft und gleichzeitig mit 25  mu g eines der folgenden Plasmide transfiziert: 1) Plasmid 42K.17, das die HBV pre-S2 + sAg codierende Sequenz mit dem 42K-Promotor verknüpft enthielt oder 2) Plasmid pMP15.spsP, das die identische HBVsAg codierende Sequenz mit dem Vacciniavirus H6-Promotor verknüpft enthält. Nach 24 Stunden wurden die Zellen gefroren und lysiert und die Lysate unter Verwendung eines Ausria-Tests (siehe Beispiel 1) auf die Gegenwart von HBVsAg überprüft. 



  Die in Tabelle XIII gezeigten Ergebnisse sollten in einem qualitativen Sinn betrachtet werden. Sie deuten an, dass der  Transkriptionsapparat sowohl von Geflügelpockenvirus als auch von Kanarienpockenvirus in der Lage ist, den 42K-Promotor zu erkennen und die Transkription der damit verbundenen codierenden HBVsAg-Sequenz gestattet.

  Obwohl die Mengen an Expression niedriger sind als die mit dem Vacciniavirus H6-Promotor, liegen die Mengen deutlich über den Hintergrundmengen, die man mit den negativen Kontrollen erhält. 
<tb><TABLE> Columns=3 
<tb>Title: Tabelle XIII
Erkennung des 42K Entomopockenviruspromotors durch Avipoxviren 
<tb>Head Col 01 AL=L: Virus 
<tb>Head Col 02 AL=L: Promotor 
<tb>Head Col 03 AL=L: Verhältnis P/N 
<tb> <SEP>Geflügelpocken <SEP>42K <SEP>39,1 
<tb> <SEP>H6 <SEP>356,8 
<tb> <SEP>Kanarienpocken <SEP>42K <SEP>90,2 
<tb> <SEP>H6 <SEP>222,2 
<tb> <SEP>Vaccinia <SEP>42K <SEP>369,4 
<tb> <SEP>H6 <SEP>366,9 
<tb> <SEP>Kein <SEP>42K <SEP>7,8 
<tb> <SEP>Kein <SEP>H6 <SEP>7,2 
<tb> <SEP>Vaccinia <SEP>- <SEP>7,2 
<tb></TABLE> 


 Beispiel 22 
 


 Immunisierung mit VCP-16 zum Schutz von Mäusen gegen eine Belastungsinfektion 
 mit lebendem Tollwutvirus 
 



  Gruppen von 20 vier bis sechs Wochen alten Mäusen wurden in der Pfotenfläche mit 50 bis 100  mu l einer Reihe von Verdünnungen von einer der beiden folgenden Rekombinanten beimpft: (a) vFP-6 - der in Beispiel 6 beschriebenen Geflügelpocken-Tollwutrekombinante - und (b) vCP-16 - der in Beispiel 13 beschriebenen - Kanarienpocken-Tollwut-Rekombinante. 



  Nach 14 Tagen wurden 10 Mäuse aus jeder Gruppe geopfert und das Serum gesammelt. Der anti-Tollwuttiter in dem Serum wurde mit dem in Beispiel 7 beschriebenen RFFI-Test berechnet. Die verbleibenden 10 Mäuse aus jeder Gruppe wurden einer Belastungsinfektion durch intrazerebrale Impfung mit dem CVS-Stamm von Tollwutvirus, das in Beispiel 7 benutzt wurde, ausgesetzt. Jede Maus erhielt 30  mu l, was 16 Maus-LD50 entsprach. Nach 28 Tagen wurde die Zahl der überlebenden Mäuse bestimmt und die schützende Dosis 50 (PD50) berechnet. Die Ergebnisse sind in Tabelle XIV zusammengefasst. 



  Der bei mit vFP-6 geimpften Mäusen gefundene Schutzgrad bestätigte das in Beispiel 7 diskutierte Ergebnis der Impfung mit rekombinanten Geflügelpockenviren vFP-3. Der mit der Impfung mit vCP-16 erreichte Schutzgrad ist beträchtlich höher. Auf der Basis des berechneten PD50 ist die Kanarienpocken-Tollwut-Rekombinante 100mal wirksamer beim Schutz gegen eine Belastungsinfektion mit Tollwut als die Geflügelpocken-Tollwut-Rekombinante. 
<tb><TABLE> Columns=6 
<tb>Title: Tabelle XIV
Die durch zwei Avipox-Tollwut-Rekombinanten erzielte schützende Immunität gegen eine Belastungsinfektion mit Tollwutvirus 
<tb>Head Col 01 to 03 AL=L: Geflügelpocken vFP-6 
<tb>Head Col 04 to 06 AL=L:

   Kanarienpocken vCP-16 
<tb>SubHead Col 01 AL=L>Impfdosis: 
<tb>SubHead Col 02 AL=L>RFFI-Titer: 
<tb>SubHead Col 03 AL=L>Überlebensrate: 
<tb>SubHead Col 04 AL=L>Impfdosis: 
<tb>SubHead Col 05 AL=L>RFFI-Titer: 
<tb>SubHead Col 06 AL=L>Überlebensrate: 
<tb> <SEP>7.5<a> <SEP>2.3<b> <SEP>7/10 <SEP>6.5 <SEP>2.5 <SEP>10/10 
<tb> <SEP>5.5 <SEP>1.8 <SEP>5/10 <SEP>4.5 <SEP>1.9 <SEP>8/10 
<tb> <SEP>3.5 <SEP>0.7 <SEP>0/10 <SEP>2.5 <SEP>1.1 <SEP>1/10 
<tb> <SEP>1.5 <SEP>0.6 <SEP>0/10 <SEP>0.5 <SEP>0.4 <SEP>0/10 
<tb> <SEP>1 PD50 = 6.17 <SEP>1 PD50 = 4.18 
<tb> 
 a  Virus-Titer, ausgedrückt als log10 TCID50
b RFFI-Titer, ausgedrückt als log10 der höchsten Serumverdünnung,

   die eine Reduktion um mehr als 50% in der Anzahl der fluoreszierenden Vertiefungen in einem RFFI-Test ergibt.
  
<tb></TABLE> 


 Beispiel 23 
 


 Verwendung von Geflügelpockenpromotorelementen zur Expression von Fremdgenen 
 


 I. Identifizierung des ein 25.8 Kilodalton (kD) Genprodukt codierenden Geflügelpockengens 
 



  Sichtbarmachen von in mit Geflügelpocken (FP-1) infizierten CEF-Lysaten vorhandenen Proteintypen mittels Coomassie Brilliantblau-Anfärbung von SDS-Polyacrylamidgelen zeigte einen  reichlich vorhandenen Typ mit einem offenbaren Molekulargewicht von 25,8 kD. Dieses Protein fehlte in nicht-infizierten Zellysaten. Puls-Experimente unter Verwendung von <3><5>S-Methionin zur Radiomarkierung synthetisierter Proteine zu bestimmten Zeiten nach der Infektion zeigten wiederum die grosse Menge an FP-1-induziertem Protein und zeigten, dass es 6 bis 54 Stunden nach Infektion synthetisiert wird. An seinem Spitzenwert macht dieses FP-1 25,8 kD Protein ca. 5 bis 10% des in dem Zellysat vorhandenen Gesamtproteins aus. 



  Die grosse Menge an durch FP-1 induziertem 25,8 kD Protein legte nahe, dass das dieses Genprodukt codierende Gen von einem starken FP-1 Promotorelement reguliert wird. Um dieses Promotorelement zur nachfolgenden Verwendung bei der Expression von Fremdgenen in Pockenvirenrekombinanten zu lokalisieren, wurde eine Polysomen-Präparation aus mit FP-1 infizierten CEF-Zellen 54 Stunden nach Infektion gewonnen. RNA aus dieser Polysomenpräparation wurde isoliert und führte dann, wenn man sie zur Programmierung eines Kaninchenreticulocyten-in vitro-Translationssystem benutzte, vorwiegend zur Bildung von 25,8.8 kD FP-1 Protein. 



  Die Polysomen-RNA wurde ausserdem als Matrize zur cDNA-Synthese des ersten Strangs unter Verwendung eines Oligo(dT)12-18 als Primer benutzt. Der erste Strang der cDNA wurde als eine Hybridisierungssonde in einer Southern-Blot-Analyse mit genomischen Verdaus von FP-1 benutzt. Ergebnisse aus diesen Hybridisierungsanalysen legten nahe, dass das für das 25,8 kD Protein codierende Gen in einem 10.5 Kbp Hind III-Fragment enthalten war. Dieses genomische Hind III-Fragment wurde anschliessend isoliert und mit einem kommerziellen Vektor, pBS (Stratagene, La Jolla, CA.), cloniert und der Clon als pFP23k-1 bezeichnet. Weitere Hybridisierungsanalysen unter Verwendung des ersten Strangs der cDNA als Sonde gegen Verdaus von pFP23k-1 führten zur Lokalisierung des 25.8 kD Gens auf einem 3.2 Kbp Eco RV-Sub-Fragment. 



  Dieses Fragment wurde in pBS subcloniert und als pFP23k-2 bezeichnet. 



  Etwa 2.4 Kbp dieses FP-1 Eco RV-Fragments wurden mit der Sanger-Didesoxy-Kettenabbruchsmethode (Sanger et al., Proc. Natl. Acad. Sci. USA, Bd. 74 [1977], Seiten 5463-5467) sequenziert. Die Analyse der Sequenz ergibt einen offenen Leserahmen (ORF), der ein Genprodukt mit einem Molekulargewicht von 25.8 kD codiert. In vitro run-off-Transkription dieses ORF durch Polymerase des Bakteriophagen T7 (Stratagene, La Jolla, CA.) in einem pBS Vektor erzeugt eine RNA-Art, die bei Benutzung zur Programmierung eines Kaninchenreticulocyten in vitro-Translationssystems (Promega Biotec, Madison, WI) eine Polypeptidart mit einem offenbaren Molekulargewicht von 25.8 kD ergibt. Dieses Polypeptid wandert auf einem SDS-Polyacrylamidgel gemeinsam mit dem reich vorhandenen 25.8 kD Protein, das in mit FP-1 infizierten CEFs beobachtet wird.

  Diese Ergebnisse legen nahe, dass es sich um das codierende Gen für das durch FP-1 induzierte, reich vorhandene 25.8 kD Genprodukt handelt. 


 II. Verwendung von Upstream-Promotorelementen des FP-1 25.8 kD Gens zur Expression des 
 Katzenleukämievirus (FeLV) env-Gens in FP-1 und Vacciniarekombinanten. 
 



  Ein den regulatorischen Bereich des FP-1 25.8 kD Gens enthaltendes 270 bp Eco RV/Eco RI-Fragment (FP25.8K Promotor) und 21 bp der codierenden Sequenz des 25.8 kD Gens wurden aus pFP23k-2 isoliert. Nachstehend wird die Nucleotidsequenz der FP 25.8K Promotorregion vorgestellt, die benutzt wurde, um pFeLV25.8F1 und pFeLV25.81A zu erzeugen. Diese 270 Nucleotide lange Sequenz stellt 249 Nucleotide des 5 min -Bereichs vor dem Initiationscodon (ATG) für das 25.8 kD Genprodukt und die ersten 21 bp der codierenden Sequenz zur Verfügung.
 
 5 min -GATATCCCCATCTCTCCAGAACAGCAGCATAGTGTTAGGACAATCATCTAATGCAATATCATA
 TATGAATCTCACTCCGATAGGATACTTACCACAGCTATTATACCTTAATGTATGTTCTATATATTTAAAAACAGAAACAAACGGCTATAAGTTTATATGATGTCTATATTATAGTGAGTATATTATAAGTAT GCGGGAATATCTTTGATTTAACAGCGTACGATTCGTGATAAGTAAATATAGGCAATGGATAGCATAAATGAATTC-3 min 
 



  Dieses Fragment wurde an den Enden glattgemacht und dann in einen mit Sma I verdauten, FeLV env-Sequenzen enthaltenden FP-1 Insertionsvektor (pFeLVF1; siehe Beispiel 15) eingefügt. Dieser Insertionsvektor ermöglichte Rekombination mit dem f7 Locus des FP-1 Genom. Die Einfügung der FP25.8K Promotor upstream-Sequenzen auf der 5 min -Seite des FeLV env-Gens und die richtige Orientierung wurde durch Sequenzanalyse bestätigt. Diese Insertion stellt kein perfektes ATG für die ATG-Substitution zur Verfügung, da das von dem 25.8 kD Gen bereitgestellte ATG sich nicht im Leseraster des FeLV env ATG befindet und daher kein Fusionsprotein gebildet wird. Das FP-1 Insertionsplasmid, das den FP25.8 kD Promotor oberhalb des FeLV env Gens enthielt, wurde als pFeLV25.8F1 bezeichnet. 



  Eine ähnliche Konstruktion wurde hergestellt unter Verwendung des das FeLV Gen enthaltenden Vacciniavirus-Insertionsvektors pFeLV1A (siehe Beispiel 15). Der H6-Promotor wurde aus pFeLV1A ausgeschnitten durch Verdau mit Bgl II und Sma I. Nachdem die Bgl II-Restriktionsstelle am Ende glattgemacht war, wurde das den FP25.8K Promotor enthaltende, am Ende glattgemachte 270 bp Eco RV/Eco RI-Fragment neben dem 5 min -Ende des FeLV env-Gens bestätigt. Diese Konstruktion wurde durch Sequenzanalyse überprüft. Auch in dieser Rekombinante gibt es kein perfektes ATG für ATG Substitution, da das ATG und das 25.8 kD Gen nicht im Leseraster mit dem ATG des FeLV-Gens ist.

   Der die 25.8KD Gen upstream-Region neben dem 5 min -Ende des FeLV-Gens enthaltende Vaccinia-Insertionsvektor (Kopenhagen-Stamm) wurde als pFeLV25.81A bezeichnet.  Die Insertionsplasmide pFeLV25.8F1 und pFeLV25.81A wurden zur in vitro Rekombination mit FP-1 (pFeLV25.8F1) und dem Kopenhagen-Stamm des Vacciniavirus (pFeLV25.81A) als den auffangenden Viren benutzt. Die Nachkommenschaft der Rekombination wurde auf passende Zellmonolayer plattiert und rekombinante Viren wurden nach einen Immuntest mit mit  beta -Galactosidase verbundenem Protein A und einem Rinder-anti-FeLV-Serum (Antibodies, Inc., Davis, CA.) ausgewählt. Vorläufige Ergebnisse legen nahe, dass der FP25.8K Promotor die Expression von Fremdgenen in Pockenviren-Rekombinanten steuern kann. 


 Beispiel 24 
 


 Sicherheit und Wirksamkeit von vFP-6 und vCP-16 bei Geflügel 
 



  Mit den beiden Avipoxrekombinanten vFP-6 und vCP-16 (beschrieben in den Beispielen 6 und 13) wurden 18 Tage alte Hühnerembryonen, Eintagsküken und 28 Tage alte Küken beimpft und die Reaktion der Vögel nach drei Kriterien ausgewertet: 1) Effekt der Impfung auf das Ausschlüpfen, Impfreaktionen und Sterblichkeit 2) die von dem Tollwutglykoprotein hervorgerufene Immunantwort und 3) die von den Geflügelpockenantigenen hervorgerufene Immunantwort. Die Experimente wurden wie folgt durchgeführt. 


 A. Sicherheitstests. 
 



  Gruppen von zwanzig 18 Tage alten Embryonen wurden in die Allantoishöhle mit 3,0 oder 4,0 log10 TCI500 entweder von vFP-6 oder vCP-16 beimpft. Nach dem Ausschlüpfen wurden die Küken 14 Tage beobachtet, danach wurde ihnen einzeln Blut entnommen und die Seren gesammelt. Die beiden Rekombinanten, mit denen die Hühnerembryonen beimpft wurden, hatten keinen Effekt auf die Ausschlüpfrate der Eier und die Küken blieben gesund während der 14tägigen Beobachtungsphase. 



  Gruppen von zehn SPF-Eintagsküken wurden mit 3,0 log10TCID50 einer jeden der Rekombinanten intramuskulär geimpft. Die Küken wurden 28 Tage lang beobachtet und Serumproben 14 und 28 Tage nach der Impfung gesammelt. Mit keiner der beiden Rekombinanten wurde eine Impfreaktion an der Impfstelle beobachtet und die Küken blieben gesund während der 28 Tage der Beobachtungsphase. 



  Gruppen von zehn 28 Tage alten Küken wurden mit einem der  beiden rekombinanten Viren beimpft, wobei sie entweder 3,0 log10 TCID50 intramuskulär oder 3,0 log10TCID50 über die Hautroute (Geflügelnetzwerk) erhielten. Die Küken wurden 28 Tage lang beobachtet und Serumproben 14 und 28 Tage nach der Impfung gesammelt. Bei keiner der beiden Rekombinanten wurde eine Reaktion auf die intramuskuläre Impfung beobachtet. Impfung in die Haut führte zu einer sehr kleinen Impfreaktion auf Geflügelpocken mit Läsionen, die in der Grösse heterogen waren. Kanarienpockenimpfung führte zur Ausbildung einer normalen Läsion auf der Haut an der Impfstelle. Alle Läsionen waren bis zum Ende des Experiments zurückgegangen. 


 B. Immunantwort. 
 



  Der in Beispiel 7 beschriebene RFFI-Test wurde benutzt, um die Mengen an Antikörper gegen das Tollwutglykoprotein festzustellen. Für jede Gruppe wurden die Ergebnisse als der geometrisch gemittelte Titer der individuellen Seren ausgedrückt, die auf Internationale Einheiten (IU) entsprechend einem Standardserum umgerechnet wurden, das 23,4 IU enthielt. Der kleinste positive Wert wurde als ein IU festgelegt und benutzt, um die Prozentzahl positiver Vögel zu bestimmen. Antikörper gegen Avipoxviren wurden mit einer ELISA-Methode unter Verwendung eines Geflügelpockenvirusstamms als Antigen getestet. Jede Serumprobe wurde 1/20 und 1/80 verdünnt. Eine Standardkurve wurde unter Verwendung der positiven und negativen Seren aufgestellt. Der kleinste positive Wert wurde berechnet, indem das Mittel der verschie denen Werte der negativen Seren mit zweifacher Standardabweichung hinzugefügt wurde. 



  Die Ergebnisse der serologischen Beobachtungen werden in Tabelle XV für vFP-6 und Tabelle XVI für vCP-16 gezeigt. 



  Eine begrenzte Antikörperbildung sowohl auf Tollwut wie auf Geflügelpockenantigene wurde beobachtet bei Embryonen, die entweder mit vFP-6 oder vCP-16 beimpft waren. Der Geflügelpockenvektor rief eine Antikörperbildung auf beide Antigene in einer grösseren Anzahl von Vögeln hervor als der Kanarienpockenvektor, doch die Antwort war immer noch heterogen. 



  Mit vFP-6 beimpfte Eintagsküken zeigten eine gute Antikörperbildung, wobei alle Küken auf Tollwut und Geflügelpockenantigene seropositiv 28 Tage nach der Impfung waren. Die Antwort auf die Impfung mit vCP-16 war sehr viel niedriger, wobei 40% der Küken seropositiv für Tollwutglykoprotein nach 28 Tagen und 10% seropositiv für Avipoxantigene waren. 



  Mit vFP-6 intramuskulär geimpfte, 28 Tage alte Küken zeigten 100% Serokonversion auf beide Antigene 14 Tage nach der Impfung. Obwohl die Mehrzahl der Küken ebenso Serokonversion nach Impfung in die Haut zeigte, waren die erreichten Titer sowohl für Tollwut- wie für Avipoxantigene viel niedriger. Wie zuvor zeigten mit vCP-16 sowohl über den intramuskulären als auch den kutanen Weg geimpfte Küken eine uneinheitliche Antwort mit einem Maximalwert von 70% Serokonversion auf Tollwut über intramuskuläre Beimpfung. Der niedrige Wert einer Serokonversion für Avipoxantigene nach Impfung mit Kanarienpocken könnte den Grad der serologischen Verwandtschaft zwischen den Viren widerspiegeln. 



  Die Ergebnisse zeigen, dass sowohl vFP-6 wie vCP-16 sicher für die Impfung von Hühnern in einem weiten Altersbereich sind. Der Geflügelpockenvektor vFP-6 scheint effizienter bei der Auslösung einer Immunantwort in Hühnern zu sein. Für die  beiden rekombinanten Avipoxviren Geflügelpocken und Kanarienpocken wurde aber signifikant gezeigt, dass sie für eine Impfung in ovum nützlich sind. 
<tb><TABLE> Columns=7 
<tb>Title: Tabelle XV
Immunantwort gegen Geflügelpocken/Tollwut-Glykoprotein (vFP-6) bei Hühnern verschiedenen Alters 
<tb>Head Col 01 AL=L: Positive Gruppen 
<tb>Head Col 02 AL=L: Dosis
(TCID50) 
<tb>Head Col 03 AL=L: Zeit nach Impfung
(Tage) 
<tb>Head Col 04 to 07 AL=L: Antikörper 
<tb>SubHead Col 04 to 05 AL=L: Tollwut Glykoprotein 
<tb>SubHead Col 06 to 07 AL=L:

   Geflügelpocken 
<tb>SubHead Col 04 AL=L> DIAMETER  IU Titer: 
<tb>SubHead Col 05 AL=L>% Vögel/1IU: 
<tb>SubHead Col 06 AL=L> DIAMETER: 
<tb>SubHead Col 07 AL=L>Elisa OD %: 
<tb> <SEP>Embryonen <SEP>10<3> <SEP>3 + 14 <SEP>0.28 <SEP>15 <SEP>0.125 <SEP>54 
<tb> <SEP>18 Tage alt <SEP>10<4> <SEP>3 + 14 <SEP>0.87 <SEP>30 <SEP>0.129 <SEP>46 
<tb> <SEP>Eintagsküken, i.m. <SEP>10<3> <SEP>14
28 <SEP>1.8
4.2 <SEP>90
100 <SEP>0.109
0.234 <SEP>70
100 
<tb> <SEP>28 Tage alte Küken, i.m.

  <SEP>10<3> <SEP>14
28 <SEP>3.7
2.7 <SEP>100
100 <SEP>0.317
0.378 <SEP>100
100 
<tb> <SEP>28 Tage alte Küken,
Durchstechung <SEP>10<3> <SEP>14
28 <SEP>1.6
0.54 <SEP>100
90 <SEP>0.191
0.161 <SEP>100
80 
<tb></TABLE> 
<tb><TABLE> Columns=7 
<tb>Title: Tabelle XVI
Immunantwort gegen Kanarienvogelpocken/Tollwut-Glykoprotein (vCP-16) von Hühnern bei verschiedenem Alter 
<tb>Head Col 01 AL=L: Positive Gruppen 
<tb>Head Col 02 AL=L: Dosis
(TCID50) 
<tb>Head Col 03 AL=L: Zeit nach Impfung
(Tage) 
<tb>Head Col 04 to 07 AL=L: Antikörper 
<tb>SubHead Col 04 to 05 AL=L: Tollwut Glykoprotein 
<tb>SubHead Col 06 to 07 AL=L:

  Kanarienpocken 
<tb>SubHead Col 04 AL=L> DIAMETER  IU Titer: 
<tb>SubHead Col 05 AL=L>% Vögel/1IU: 
<tb>SubHead Col 06 AL=L> DIAMETER: 
<tb>SubHead Col 07 AL=L>Elisa OD%: 
<tb> <SEP>Embryonen <SEP>10<3> <SEP>3 + 14 <SEP>0.14 <SEP>0 <SEP>0.068 <SEP>25 
<tb> <SEP>18 Tage alt <SEP>10<4> <SEP>3 + 14 <SEP>0.19 <SEP>8 <SEP>0.059 <SEP>25 
<tb> <SEP>Eintagsküken, i.m. <SEP>10<3> <SEP>14
28 <SEP>0.18
0.21 <SEP>10
40 <SEP>0.027
0.059 <SEP>0
10 
<tb> <SEP>28 Tage alte Küken, i.m. <SEP>10<3> <SEP>14
28 <SEP>0.61
0.24 <SEP>70
30 <SEP>0.093
0.087 <SEP>60
30 
<tb> <SEP>28 Tage alte Küken,
Durchstechung <SEP>10<3> <SEP>14
28 <SEP>0.34
0.11 <SEP>40
10 <SEP>0.071
0.061 <SEP>30
10 
<tb></TABLE> 


 Beispiel 25 
 


 Sicherheit und immunogene Wirkung einer Impfung von Ferkeln mit vFP-6 
 



  Zwei Gruppen von drei Ferkeln wurden mit der Rekombinante vFP-6 beimpft über einen der beiden Wege: 
 
   a) drei Tiere erhielten 8,1 log10TCID50 durch eine intramuskuläre Impfung; und 
   b) drei Tiere erhielten die gleiche Dosis durch orale Impfung. 
 



  Allen Tieren wurde in wöchentlichen Abständen Blut entnommen und alle Tiere erhielten eine Auffrischimpfung der gleichen Dosis über den gleichen Weg am Tag 35. Die Ferkel wurden täglich auf klinische Symptome beobachtet. Die Seren wurden auf anti-Geflügelpocken-Antikörper mit einem ELISA-Test und einen Serumneutralisationstest geprüft. Tollwutantikörper wurden in einem RFFI-Test bestimmt. 



  Alle Ferkel blieben bei guter Gesundheit und keine Läsionen wurden nach der Impfung beobachtet. Die Temperaturkurven waren normal, wobei kein Unterschied zwischen geimpften und nicht geimpften Tieren zutage trat. Sowohl die über den intramuskulären als auch oralen Weg geimpften Ferkel entwickelten eine Antikörperbildung auf Geflügelpockenantigene, wie durch ELISA- und Serumneutralisation bestimmt wurde. Eine zweite Antwort war offenkundig nach der Auffrischimpfung. (Ergebnisse nicht gezeigt). Alle Ferkel entwickelten ausserdem eine Immunantwort auf Tollwutglykoprotein, wie in einem RFFI-Test bestimmt, und ein Auffrischeffekt war bei beiden Wegen offenkundig. Diese Ergebnisse sind in Tabelle XVII zusammengefasst. 



  Die Ergebnisse zeigen an, dass die Impfung mit Geflügelpocken/Tollwutrekombinanten unschädlich für Ferkel ist und dass die Rekombinante in der Lage ist, eine signifikante Im munantwort auf das Tollwutglykoprotein nach oraler oder intramuskulärer Impfung hervorzurufen. 
<tb><TABLE> Columns=8 
<tb>Title: Tabelle XVII
Gegen Tollwutglykoprotein erzeugte Antikörper in mit vFP-6 geimpften Ferkeln 
<tb>Head Col 01 AL=L: Impfweg 
<tb>Head Col 02 AL=L: Tier Nr. 
<tb>Head Col 03 to 06 AL=L: Tollwut-Antikörper nach Tagen 
<tb>Head Col 07 to 08 AL=L: (RFFI-Titer) 
<tb>SubHead Col 03 AL=L>14: 
<tb>SubHead Col 04 AL=L>21: 
<tb>SubHead Col 05 AL=L>28: 
<tb>SubHead Col 06 AL=L>35<b>: 
<tb>SubHead Col 07 AL=L>42: 
<tb>SubHead Col 08 AL=L>49: 
<tb> <SEP>I.M.

   <SEP>984 <SEP>2.4<a> <SEP>2.2 <SEP>2.1 <SEP>2.2 <SEP>3 <SEP>3 
<tb> <SEP>985 <SEP>2.5 <SEP>2.7 <SEP>2.6 <SEP>2.4 <SEP>3 <SEP>3 
<tb> <SEP>986 <SEP>2.2 <SEP>2.0 <SEP>2.1 <SEP>2.3 <SEP>3 <SEP>3 
<tb> <SEP>Oral <SEP>987 <SEP>3 <SEP>2 <SEP>2.1 <SEP>2 <SEP>3 <SEP>3 
<tb> <SEP>988 <SEP>2.9 <SEP>2.4 <SEP>2.2 <SEP>2.4 <SEP>2.7 <SEP>2.5 
<tb> <SEP>989 <SEP>2.8 <SEP>2 <SEP>1.7 <SEP>1.8 <SEP>2.4 <SEP>2.5 
<tb> 
 a Titer ausgedrückt als log10 der höchsten Serumverdünnung, die eine Reduktion um mehr als 50% in der Anzahl der fluoreszierenden Näpfchen in einem RFFI-Test ergibt.
b Tiere erhielten eine zweite Impfung am Tag 35.
  
<tb></TABLE> 



  
 



  The invention relates to a recombinant virus for expressing a gene product in a vertebrate, which virus contains a DNA which codes and expresses the gene product in the vertebrate without replicative replication of the virus.



  Avipox or Avipoxvirus is a bird-infecting, closely related genus of smallpox viruses. The genus Avipox includes the species poultry pox, canary pox, ptarmigan pox, pigeon pox, quail pox, sparrow pox, starpox and turkey pox. Chicken pox infects chickens. It should not be confused with the human disease chickenpox. The genus Avipox has many features in common with other smallpox viruses and is a member of the same subfamily, poxviruses from vertebrates such as vaccinia. Smallpox viruses, including vaccinia and avipox, replicate within eukaryotic host cells. These viruses are characterized by their size, complexity and by their replication in the cytoplasm.

  However, vaccinia and avipox belong to different genera and are different in their respective molecular weights, their antigenic determinants and their host specificity; see. Intervirology, vol. 17, pages 42-44, Fourth Report of the International Committee on Taxonomy of Viruses (1982).



  Avipox viruses do not infect multiply non-bird-like vertebrates like mammals including humans. Furthermore, avipox virus does not multiply when inoculating mammalian (including human) cell cultures. In such mammalian cell cultures infected with Avipox, the cells die because of a cytotoxic effect, but show no evidence of viral infection with proliferation.



  Vaccination of a non-bird vertebrate such as of a mammal with live avipox leads to the formation of a lesion at the vaccination site that is reminiscent of vaccination with Vac cinia. However, it does not lead to a productive viral infection. However, it has now been found that a mammal vaccinated in this way reacts immunologically to the avipox virus. This is an unexpected result.



  Vaccines composed of killed pathogen or purified antigenic components of such pathogens must be injected in larger quantities than live virus vaccines in order to elicit an effective immune response. The reason is that live virus vaccination is a much more efficient method of vaccination. A comparatively small inoculum can produce an effective immune response because the antigen in question is increased during the replication of the virus. From a medical point of view, live virus vaccines offer more effective and longer-lasting immunity than vaccination with a killed pathogen or purified antigen vaccine.

  Therefore, vaccines composed of killed pathogen or purified antigenic components of such pathogens require production of larger amounts of the vaccine material than is needed with the live virus.



  From the previous discussion, it is clear that there are medical and economic benefits to using live virus vaccines. Such a live virus vaccine contains vaccinia virus. It is known that this virus can be used to use recombinant DNA methods to insert DNA which is the genetic sequence of antigens from mammalian pathogens.



  Therefore, methods have been developed in the prior art which allow the production of recombinant vaccinia viruses by inserting DNA from any source (eg viral, prokaryotic, eukaryotic, synthetic) into a non-essential region of the vaccinia genome, including DNA sequences, which code for antigenic determinants of a pathogenic organism. Certain recombinant Vac ciniaviruses produced by these methods have been used to elicit specific immunity in mammals to a variety of mammalian pathogens described in US-A 4,603,112, the contents of which are incorporated herein by reference.



  Unchanged vaccinia virus has a long history of relatively safe and effective use for smallpox vaccination. However, prior to the eradication of smallpox, when unmodified vaccinia virus was widely administered, there was a small but real risk of complications in the form of generalized vaccinia infection, especially in patients who had eczema or immunosuppression. Another rare but possible complication that can result from vaccination with vaccinia is post-vaccinal encephalitis. Most of these reactions have occurred when vaccinating people with skin disorders such as eczema or with a weakened immune system, or individuals in households where others have had eczema or a weakened immune response. Vaccinia is a live virus and is usually harmless to a healthy person.

  However, it can be transmitted between individuals for several weeks after vaccination. If a person with a weakened immune response is infected either by vaccination or by infection from a freshly vaccinated person, the consequences can be serious.



  Thus, it is understandable that a method which incorporates the benefits of live virus vaccination in the course of the procedure but which reduces or eliminates the problems discussed above would be a highly desirable advance over the current state of the art. This is all the more important today with the advancement of the disease known as "acquired immune deficiency syndrome" (AIDS). Victims of this condition suffer from severe immune dysfunction and can be easily affected by a normally safe live virus preparation when in contact with such a virus, either directly or through contact with a person who has recently been immunized with such a live virus vaccine come.



  The invention is defined in claim 1. Advantageous developments of the invention result from the dependent claims.



   This invention enables a vaccine to be provided which is capable of immunizing vertebrates against pathogenic organisms and which has the advantages of a live virus vaccine and which has little or none of the disadvantages of both a live virus vaccine and a killed virus Vaccine, especially when used to immunize non-bird vertebrates.



  In particular, this invention enables synthetic recombinant avipox viruses to be used for such vaccines.



  This invention makes it possible to provide a method for eliciting an immune response in bird-like and non-bird-like vertebrates to an antigen by vaccinating the vertebrate with a synthetic recombinant avipox virus, which in the case of non-bird-like vertebrates, e.g. Mammals, not replicated under replication with production of infectious virus. In this case, the virus limits itself and reduces the possibility of spreading to non-vaccinated hosts.



  Furthermore, this invention enables a method of eliciting an immune response in a vertebrate to an antigen to be provided, the method comprising vaccinating the vertebrate with a vaccine comprising synthetic recombinant avipox virus including and expressing the antigenic determinants of a pathogen for the vertebrate contains.



  The invention also makes it possible to provide a method for expressing a gene product in a vertebrate by vaccinating the vertebrate with a recombinant virus which encodes and expresses the gene product without replicative propagation of the virus in the vertebrate.



  Finally, the invention makes it possible to provide a method for eliciting an immune response in a vertebrate to an antigen by vaccinating the vertebrate with a recombinant DNA-containing virus which encodes and expresses the antigen without replicative replication of the virus in the vertebrate.



  In one respect, the invention is related to a method of eliciting an immune response in a vertebrate to a pathogen by vaccinating the vertebrate with a synthetic, recombinant avipox virus. This virus is modified by the presence, in a non-essential region of the avipox genome, of DNA from any source which encodes and expresses an antigen of the pathogen.



  In a further aspect, the invention relates to a method for expressing a gene product or for triggering an immune response to an antigen in a vertebrate with a recombinant virus which does not replicate replicatively in the cells of the vertebrate, but which, however, the gene product or the antigen in expressed in the cells of the vertebrate.



  In a further aspect, the invention is related to a synthetic, recombinant avipox virus modified by inserting DNA from any source, particularly from a non-avipox source, into a non-essential region of the avipox virus genome. Synthetically modified avipox virus recombinants that carry exogenous (ie non-avipox) genes that encode and express an antigen and that elicit an immune response to the antigen and therefore to the exogenous pathogen in a vertebrate host, are particularly useful for vaccinating non-bird-like vertebrates used new vaccines that avoid the disadvantages of conventional vaccines that use killed or attenuated living organisms.



  It must be noted once again that avipox viruses can only replicate replicatively in or can be passaged through bird species or bird cell lines. The recombinant avipox viruses derived from avian host cells cause a vaccination lesion without replicative multiplication of the avipox virus when non-avian vertebrates, such as mammals, are vaccinated in a manner corresponding to vaccination of mammals with vaccinia virus. Despite the lack of replicative replication of the avipox virus in such a vaccinated non-bird-like vertebrate, enough expression of the virus occurs that the vaccinated animal responds immunologically to the antigenic determinants of the recombinant avipox virus and also to the antigenic determinants for which the exogenous ones contained in the virus Encode genes.



  When vaccinating a bird species, such a synthetic recombinant avipox virus not only elicits an immune response to the antigens that may be contained on the exogenous DNA from any source, but also leads to replicative replication of the virus in the host, triggering an expected immune response to the Avipox vector per se.



  Various researchers have proposed to make recombinant poultry pox specifically for use as veterinary vaccines for the protection of poultry populations; see. Boyle and Coupar, J. Gen. Virol. Vol. 67 (1986), pages 1591-1600, and Binns et al., Isr. J. Vet. Med., Vol. 42 (1986), pages 124-127. However, no proposals or actual reports on the use of recombinant avipox viruses to generate specific immunity in mammals have been known.



  Stickl and Mayr, progress. Med. 97 (40) (1979), pages 1781-1788 describe the injection of Avipox, in particular fowlpox, viruses into humans. However, these studies only relate to the use of common poultry pox to increase non-specific immunity in patients suffering from the side effects of cancer chemotherapy. No recombinant DNA techniques are used. There is no evidence of an avipox virus in which DNA coding for antigens of vertebrate pathogens has been inserted, or of a method for inducing specific immunity in vertebrates. Instead, the prior art depends on a general and non-specific stimulating effect on the human host.



  A more complete discussion of the basics of genetic recombination helps to understand how the modified recombinant viruses of the present invention were made.



   Genetic recombination is generally the exchange of homologous sections of deoxyribonucleic acid (DNA) between two strands of DNA. (In certain viruses, ribonucleic acid [RNA] can replace DNA). Homologous sections of a nucleic acid are sections of the nucleic acid (RNA or DNA) that have the same sequence of the nucleotide bases.



  Genetic recombination can occur naturally during replication or the creation of new viral genomes within the infected host cell. Therefore, genetic recombination between viral genes can occur during the viral replication cycle in a host cell coinfected with two or more different viruses or other genetic constructions. A section of DNA from a first genome is exchanged during the construction of the section of the genome of a second, coinfecting virus in which the DNA is homologous to that from the first viral genome.



  However, recombination can also take place between sections of DNA in different, not completely homologous genomes. If such a section from a first genome is homologous to a section of another genome (except for example the presence of a genetic marker or a gene coding for an antigenic determinant inserted into a section of the homologous DNA) recombination can always take place. The products of this recombination can then be detected by the presence of that genetic marker or gene.



  Successful expression of the modified infectious virus genetic sequence introduced as DNA requires two conditions:



  First, the insertion into a non-essential region of the virus must take place for the modified virus to remain viable. Neither the essential regions analogous to those described for vaccinia virus have been shown for poultry pox nor for other avipox viruses. Accordingly, non-essential regions of fowlpox were found for the present invention by splitting the fowlpox genome into fragments, then separating the fragments according to size and inserting these fragments into plasmid constructs for propagation. Plasmids are small, circular DNA molecules that are found as extrachromosomal elements in many bacteria, including E. coli.

  Methods for inserting DNA sequences such as genes for antigenic determinants or other genetic markers in plasmids are well known to those skilled in the art and are described in detail in Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York ( 1982). The same procedure was followed when inserting genetic markers and / or genes coding for antigens into the cloned poultry pox fragments. The successfully recombined fragments (as demonstrated by successful recovery of the genetic marker or antigen) were those that contained DNA inserted into a non-essential region of the chickenpox virus.



  The second condition for expression of inserted DNA is the presence of a promoter in the correct relationship to the inserted DNA. The promoter must be arranged so that it is in front of the DNA sequence to be expressed. Because avipox viruses are not well characterized and avipox promoters have so far not been identified, known promoters from other pox viruses have been successfully inserted as part of the present invention in front of the DNA to be expressed. Fowlpox promoters can also be used successfully to carry out the methods of the invention and to manufacture the products. It was found according to the invention that transcription in recombinant smallpox viruses is started with poultry pox promoters, vaccinia promoters and entomopox promoters.



  Boyle and Coupar, J. Gen. Virol., Vol. 67 (1986), page 1591, suspect that vaccinia promoters "can be expected to work in (chickenpox) virus". The authors localized and cloned a fowlpox TK gene (Boyle et al., Virology, vol. 156 [1987], pages 355-365) and inserted it into vaccinia virus. This TK gene was probably expressed because of the recognition of the fowlpox TK promoter sequence by vaccinia polymerase. Despite their presumption, however, the authors did not insert any vaccinia promoter into the fowlpox virus, nor did they observe any expression of a foreign DNA sequence present in the fowlpox genome. Prior to the present invention, it was not known that promoters from other smallpox viruses, e.g. Vaccinia promoters, actually target the expression of a gene in an avipox genome.



  Fowlpox and canarypox viruses were particularly used as the preferred avipox species modified by recombination by incorporating exogenous DNA.



  Chickenpox is a type of Avipox that infects poultry in particular, but not mammals. The poultry pox strain, designated FP-5, is a commercial poultry pox virus vaccine strain derived from chicken embryos and is available from American Scientific Laboratories (Division of Schering Corp.), Madison, WI, United States Veterinary License No. 165, serial no. 30 321, available.



  The fowlpox strain referred to here as FP-1 is a Duvette strain modified for use as a vaccine in day-old chicks. The strain is a commercial fowlpox vaccine strain, designated O DCEP 25 / CEP67 / 2309 October 1980, and is available from Institute Merieux, Inc.



  Canarypox virus is another type of avipox virus. Similar to the chickenpox, canarypox virus particularly infects canaries, but not mammals. The canarypox strain referred to herein as CP is a commercial canary vaccine strain designated LF2 CEP 524 241 075 and is available from Institute Merieux, Inc.



  The DNA sequences inserted into these avipox viruses by genetic recombination include the following: the lac Z gene of prokaryotic origin; the rabies glycoprotein (G) gene, which encodes an antigen of a non-bird-like (specifically mammalian) pathogen; the turkey influenza hemagglutinin gene, which encodes the antigen of a pathogenic avian virus other than an avipox virus; the gp51,30 envelope gene of bovine leukemia virus, a mammalian virus; the fusion protein gene of the Newcastle Disease Virus (Texas strain), an avian virus; the FeLV envelope gene of feline leukemia virus, a mammalian virus, the RAV-1 env gene of the Rous-associated virus, which is an avian / poultry disease; the chicken / Pennsylvania / 1/83 influenza virus, an avian virus nucleoprotein (NP) gene; the matrix gene and peplomer gene of the infectious bronchitis virus (strain Mass 41), an avian virus;

   and the glycoprotein D gene (gD) of the herpes simplex virus, a mammalian virus.



  The isolation of the lac Z gene is described by Casadaban et al., Methods in Enzymology, Vol. 100 (1983), pages 293-308. The structure of the rabies G gene is e.g. by Anilionis et al., Nature, Vol. 294 (1981), pages 275-278. Its incorporation into vaccinia and expression in this vector are discussed by Kieny et al., Nature, Vol. 312 (1984), pages 163-166. The turkey influenza hemagglutinin gene is described by Kawaoka et al., Virology, Vol. 158 (1987), pages 218-227. The bovine leukemia virus gp51.30 env gene has been described by Rice et al., Virology, vol. 138 (1984), pages 82-93. The Newcastle Disease Virus (Texas strain) fusion gene is available from Institute Merieux, Inc., as plasmid pNDV 108. The feline leukemia virus env gene was described by Guilhot et al., Virology, Vol. 161 (1987), pp. 252-258 .

  The Rous-associated virus type 1 is available from Institute Merieux, Inc. as two clones penVRVIPT and mp19env (190). Chicken influenza NP gene is available from Yoshihiro Kawaoka of St. Jude Children's Research Hospital as plasmid pNP 33. An infectious bronchitis virus cDNA clone of the IBV Mass 41 matrix gene and peplomer gene is available from the Institute Merieux, Inc. as plasmid pIBVM63.



  The herpes simplex virus gD gene is described by Watson et al., Science, Vol. 218 (1982), pages 381-384.



  The recombinant avipox viruses, which are described in more detail below, include one of three vaccinia promoters. The Pi promoter from the Ava I H section of Vaccinia is described by Wachsman et al., J. of Inf. Dis., Vol. 155 (1987), pages 1188-1197. In particular, this promoter is derived from the Ava I H (Xho I G) fragment from the L-variant WR vaccinia strain, in which the promoter controls the transcription from right to left. The promoter card position is approximately 1.3 Kbp (kilobase pairs) from the left end of Ava I H, approximately 12.5 Kbp from the left end of the vaccinia genome, and approximately 8.5 Kbp to the left of the Hind III C / N junction. The promoter has the following sequence:
 
 (GGATCCC) -ACTGTAAAAATAGAAACTATAATCATATAATAGTGTAGGTTGGT-
 AGTAGGGTACTCGTGATTAATTTTATTGTTAAACTTG- (AATTC),
 
 where the symbols in brackets are linker sequences.



  The Hind III H promoter (also "HH" and "H6") was determined by standard transcription mapping techniques. He has the sequence:
 
 ATTCTTTATTCTATACTTAAAAAATGAAAA
 TAAATACAAAGGTTCTTGAGGGTTGTGTTAAATTGAAAGCGAGAAATAATCATAAATT
 ATTTCATTATCGCGATATCCGT
 TAAGTTTGTATCGTAATG.
 



  The sequence is identical to that described as 5 minutes from the open reading frame H6 by Rosel et al., J. Virol., Vol. 60 (1986), pages 436-449.



  The 11K promoter is described by Wittek, J. Virol., Vol. 49 (1984), pages 371-378 and C. Bertholet et al., Proc. Natl. Acad. Sci. USA 82 (1985), pages 2096-2100.



  The recombinant avipox viruses are assembled in a manner known per se in two steps and analogous to those described in the above-mentioned US Pat. No. 4,603,112 for the production of synthetic recombinants of vaccinia virus.



  First, the DNA to be inserted into the virus is inserted into an E. coli plasmid, into which DNA homologous to a section of non-essential DNA of the avipox virus has been inserted. Separately, the DNA gene sequence to be inserted has been ligated to a promoter. The promoter-gene compound is then inserted into the plasmid construction so that the promoter-gene compound is flanked on both sides by DNA that is homologous to a non-essential portion of Avipox DNA. The resulting plasmid construction is then multiplied by growth in E. coli bacteria. (Plasmid DNA is used to carry and propagate exogenous genetic material; this methodology is known. For example, these plasmid techniques are described by Clewell, J. Bacteriol., Vol. 110 [1972], pages 667-676.

  The techniques for isolating amplified plasmid from the E. coli host are also known and are described, for example, by Clewell et al. In Proc. Natl. Acad. Sci. USA, Vol. 62 [1969], pages 1159-1166).



  The amplified plasmid material isolated after growth in E. coli is now used for the second step. For this purpose, the plasmid containing the DNA gene sequence to be inserted is transfected into a cell culture (e.g. chicken embryo fibroblasts) together with the avipox virus (such as e.g. avian pox strain FP-1 or FP-5). Recombination between homologous fowlpox DNA in the plasmid and the viral genome results in an avipox virus that is modified by the presence of non-fowlpox DNA sequences in a non-essential portion of its genome.



  A better understanding of the invention and its numerous advantages will be had from the following examples, which are given by way of illustration.


 example 1
 


 Transient expression experiments show the recognition of vaccinia promoters
 by fowlpox RNA transcription factors
 



  A number of plasmid constructions were constructed that contained the coding sequence for hepatitis B virus surface antigen (HBSAg) linked to vaccinia virus promoter sequences. CEF (chicken embryo fibroblast) cells infected with 10 plaque-forming units (pfu) of fowlpox virus or vaccinia virus per cell were transfected with 50 µg of each plasmid. The infection was allowed to continue for 24 hours and then the cells were lysed through three subsequent cycles of freezing and thawing.



  The amount of HBSAg in the lysate was determined using a commercially available AUSRIA II - <1> <2> <5> J Kit from Abbott Laboratories, Diagnostic Division. The presence or absence of HBSAg is expressed as the ratio of the net values (sample minus background) of the unknown sample to the negative exclusion value predetermined by the manufacturer. This leads to a P / N (positive / negative) ratio. The results are summarized in Table I.



  Three different vaccinia promoter sequences were used: the pi promoter recognized early in vaccinia infection before DNA replication; the 11K promoter recognized late in vaccinia infection after the onset of DNA replication; and the Hind III H (HH) promoter, which is recognized both early and late in vaccinia infection. These promoters are described above.



   The data show that the HBSAg produced in the lysates from infected cells is the result of recognition of vaccinia promoters by either fowlpox or vaccinia transcription factors.
 <tb> <TABLE> Columns = 4
 <tb> Title: Table I
 <tb> Head Col 01 AL = L: plasmid
 <tb> Head Col 02 AL = L: Virus
 <tb> Head Col 03 AL = L: description
 <tb> Head Col 04 AL = L:

  P / N ratio
 <tb> <SEP> pMP 131piR2 <SEP> chickenpox
Vaccinia <SEP> SAg with Pi promoter
connected <SEP> 1.8
9.1
 <tb> <SEP> pMPK 22.13S <SEP> chickenpox
Vaccinia <SEP> SAg with 11K promoter
connected <SEP> 14
2nd
 <tb> <SEP> pPDK 22.5 <SEP> chickenpox
Vaccinia <SEP> SAg with 11K promoter
connected <SEP> 92.6
5.6
 <tb> <SEP> pRW 668 <SEP> chickenpox
Vaccinia <SEP> SAg with HH promoter
connected <SEP> 77
51.4
 <tb> <SEP> no plasmid <SEP> chickenpox <SEP> 1.1
 <tb> <SEP> no plasmid <SEP> Vaccinia <SEP> 1.3
 <tb> <SEP> pMPK 22.13S <SEP> (no virus) <SEP> 1.3
 <tb> </TABLE>


 Example 2
 


 Construction of a recombinant poultry opvirus vFP-1 containing the lac Z gene
 



  A fragment in a non-essential portion of the poxpox virus was located and isolated as follows.



  The single-stranded terminal hairpin structure of FP-5-DNA was removed with Nuclease Bal 31. The Klenow (large) fragment of DNA polymerase I was used to form blunt ends. After removal of the hairpin structure, fragments were prepared by digestion with the restriction endonuclease Bgl II. This digestion leads to a series of FP-5 fragments, which were separated by agarose gel electrophoresis.



  A blunt-ended 8.8 Kbp BglII fragment was isolated and ligated with the commercially available plasmid pUC 9, which had been digested with Bam HI and Sma I. The resulting plasmid was named pRW 698.



  To reduce the size of the fowlpox fragment, this plasmid was digested with Hind III, generating two more fragments. A 6.7 Kbp fragment was discarded and the remaining 4.7 Kbp fragment was ligated to itself to give a new plasmid, called pRW 699.



  In order to insert a lac Z gene started at the 11K promoter into this plasmid, pRW 699 was cleaved with Eco RV, which cleaves the plasmid only at one point. The lac Z fragment under the control of the 11K promoter was then inserted as a blunt-ended Pst I-Bam HI fragment and resulted in a new plasmid called pRW 702. The lac Z clone is from pMC 1871, as described by Casadaban et al., Supra. The 11K promoter was ligated to the eighth codon of the lac Z gene using a Bam HI linker.



  With recombination techniques, such as those described for vaccinia in US-A 4,603,112, the plasmid pRW 702 was recombined with the fowlpox virus FP-5, which grew on CEF, using the following methods to produce vFP-1 . 50 µg of pRW 702 DNA was mixed in a final volume of 100 µl with 0.5 µg of whole genome fowlpox DNA. The following were added: 10 μl 2.5 molar CaCl2 and 110 μl 2 × HEBS buffer (pH 7), which was prepared from
 
 40 mmol Hepes
 300 mmol NaCl
 1.4 mmol Na2HPO4
 10 mmol KCl
 12 mmoles of dextrose.
 



  After 30 minutes at room temperature, 200 µl of a chickenpox virus suspension (diluted to 5 pfu / cell) was added and the mixture was inoculated onto 60 mm dishes containing a primary CEF monolayer. In addition, 0.7 ml of Eagles medium containing 2% fetal calf serum (FBS) was added at the same time. The plates were incubated for 2 hours at 37 ° C., then a further 3 ml of Eagles medium with 2% FBS were added and the plates were incubated for 3 days. The cells were lysed by three subsequent cycles of freezing and thawing; the virus progeny was then examined for the presence of recombinants.



  Evidence of successful insertion of the 11K promoter lac Z gene by recombination into the genome of fowlpox FP-5 was made by testing for expression of the lac Z gene. The lac Z gene encodes the enzyme beta-galactosidase, which cleaves the chromogenic substrate 5-bromo-4-chloro-3-indolyl-beta-D-galactosidase (X-gal) and thereby releases a blue indolyl derivative. Blue plaques were selected as positive recombinants.



  In addition, the successful introduction of lac Z into the genome of fowlpox FP-5 and its expression was confirmed by immunoprecipitation of the beta-galactosidase protein using commercially available antisera and standard methods that infected CEF, BSF (monkey kidney cell line - ATCC CCL26), VERF ( Use monkey kidney cell line - ATCC CCL81) and MRC-5 (diploid human lung cell line - ATCC CCL171).



  The expression of the beta-galactosidase by the recombinant virus vFP-1 was confirmed in vivo. Rabbits and mice were vaccinated with the virus. The increase in the titers of the antibodies directed against the beta-galactosidase protein in the serum of the vaccinated animals was measured.



  In particular, the recombinant vFP-1 was cleaned of host cell contaminants and inoculated intradermally at two sites on each side by two rabbits. Each rabbit received 10 in total <8> pfu.



  Blood was drawn from the animals at weekly intervals. The sera were used for an ELISA test using a commercially available preparation of purified beta-galactosidase as the source of the antigen.



  Both the rabbits vaccinated with the recombinant vFP-1 and the mice showed an immune response to the beta-galactosidase protein which was detectable in the ELISA test. In both types, the response was found one week after vaccination.


 Example 3
 


 Construction of the rabies G gene and lac Z-containing recombinant
 Virus vFP-2 from fowlpox virus FP-5
 



  A 0.9 Kbp Pvu II fragment was obtained from FP-5 and inserted between the two Pvu II sites in pUC 9 using standard procedures. The resulting construction, designated pRW 688.2, has two Hinc II sites approximately 30 bp apart asymmetrically in the Pvu II fragment and therefore forms a long and a short arm of the fragment.



   Using known techniques, oligonucleotide adapters were inserted between these Hinc II sites to insert Pst I and Bam HI sites to produce plasmid pRW 694.



  This plasmid was now digested with Pst I and Bam HI and the lac Z gene linked to the 11K vaccinia promoter described above was inserted. The new plasmid pRW 700 was obtained.



  To produce a rabies G gene controlled by the Pi promoter, the Bgl II site, which is 5 minutes proximal to the rabies gene (see Kieny et al., Loc. Cit.), Was smoothed at the ends and at the filled-in Eco RI site of the Pi promoter described above.



  This construction was inserted into the Pst I site of pRW 700 and gave the plasmid pRW 735.1, which thus contains the foreign gene sequence pi-rabies G-11K-lac Z. This insert is arranged within the plasmid such that the long Pvu II-Hinc II arm of the FP-5 donor sequence lies on the 3 min side of the lac Z gene.



  The final construction so created was recombined with fowlpox virus FP-5 by infection / transfection of chicken embryo fibroblasts (by methods as described above). The recombinant fowlpox virus vFP-2 was obtained. This recombinant virus was selected after staining with X-gal.



  The correct insertion and expression of both the lac Z marker gene and the rabies G gene was checked using a number of additional methods described below.



  Immunofluorescence detection of the rabies antigen by specific antibodies successfully indicated the expression of the rabies antigen on the surface of bird-like and non-bird-like cells infected with vFP-2 virus.



  As before, expression of rabies antigen and beta-galactosidase by bird-like and non-bird-like cells infected with vFP-2 virus was confirmed by the immunoprecipitation method.



  Further evidence that the vFP-2 embodiment of this invention is a successful recombinant virus carrying the rabies G and beta-galactosidase genes was achieved by vaccinating two rabbits with vFP-2 virus. Both rabbits were treated with 1 x 10 intradermally <8> inoculated vFP-2 per rabbit. Both rabbits developed typical pox lesions. Blood was drawn from the rabbits at weekly intervals; the sera were tested by ELISA to detect the presence of the antibodies specific for rabies glycoprotein and beta-galactosidase protein.



  As shown in Table II below, rabbits showed 205 detectable levels of anti-beta-galactosidase antibody in the ELISA test 1 week after vaccination. This amount increased after 2 weeks to a titer of 1 in 4000, which was maintained for 5 weeks after vaccination. Using an antigen capture ELISA, rabbit sera showed 205 detectable levels of anti-rabies antibodies between 3 and 10 weeks after vaccination.
 <tb> <TABLE> Columns = 2
 <tb> Title: Table II
Antibody production by rabbit 205 against rabies antigen and beta-galactosidase protein
 <tb> Head Col 01 AL = L: time
 <tb> Head Col 02 AL = L:

  Antibody titer
(Reciprocal of serum dilution)
 <tb> <SEP> pre-bleeding anti-beta-galactosidase <SEP> 0
 <tb> <SEP> week 1 <SEP> 500
 <tb> <SEP> weeks 2-5 (each) <SEP> 4000
 <tb> <SEP> week 6 <SEP> 500
 <tb> <SEP> week 9 <SEP> 250
 <tb> <SEP> pre-bleeding anti-rabies <SEP> 0
 <tb> <SEP> week 3 <SEP> 200
 <tb> <SEP> week 6 <SEP> 200
 <tb> <SEP> week 10 <SEP> 100
 <tb> </TABLE>


 Example 4A
 


 Construction of a recombinant virus vFP-3 with a rabies G gene
 under promoter control from fowlpox virus FP-1
 



  This embodiment shows that the rabies G gene is also completely expressed by strains of fowlpox other than FP-5, in particular by a different strain of fowlpox virus called FP-1.



  As in Example 3, a 0.9 Kbp Pvu II fragment was obtained from FP-1 on the assumption that, as in FP-5, the fragment would contain a non-essential portion.



  This fragment was inserted between the two Pvu II sites of pUC 9 and the plasmid named pRW 731.15R was generated.



  This plasmid has two asymmetric Hinc II sites approximately 30 bp apart within the Pvu II fragment and thus forms a long and a short arm of this fragment.



  A commercially available Pst I linker
 
 (5 min) - CCTGCAGG - (3 min)
 
 was inserted between the two Hinc II sites and gave the plasmid pRW 741.



  A rabies G gene dependent on the HH promoter was inserted into this plasmid at the Pst I site and generated the new plasmid pRW 742B. The virus vFP-3 was obtained by recombination of this plasmid with FP-1 after infection / transfection of CEF cells.



  The ATG translation start codon of the open reading frame controlled by the HH promoter was superimposed on the start codon of the rabies G gene using a synthetic oligonucleotide overlaying the Eco RV site in the HH promoter and the Hind III site in the rabies G gene has been. The 5 min end of this rabies gene under the HH promoter was modified in a manner known per se so that it contained a Pst I site. The construction was then ligated to the Pst I site of pRW 741 to give pRW 742B. The orientation of the construction in the plasmid is the same as in pRW 735.1 previously discussed in Example 3.



  The recombination was carried out according to Example 2. The resulting recombinant was named vFP-3.



  The expression of rabies antigen in both bird-like and non-bird-like cells infected with vFP-3 virus was confirmed by immunoprecipitation and immunofluorescence techniques (as described above).



  Further evidence that the vFP-3 embodiment of this invention is a successful recombinant virus expressing the genes for rabies G was obtained by intradermally vaccinating pairs of rabbits with the recombinant virus. Two rabbits were vaccinated intradermally with 1 x 10 each <8> pfu vFP-3. Both rabbits developed typical pox lesions that reached a maximum size 5 to 6 days after vaccination. Blood was drawn from the rabbits at weekly intervals and the sera tested by ELISA to detect the presence of antibodies specific for rabies glycoprotein.



   In addition, 5 rats were given 5 x 10 intradermally <7> pfu vFP-3 vaccinated. All animals developed lesions.



  Both rabbits and rats developed detectable levels of rabies specific antibodies within 2 weeks of vaccination. Two control rabbits vaccinated intradermally with the parent FP-1 virus showed no detectable levels of anti-rabies antibodies.



  In order to rule out the possibility that the antibody response is due to the introduction of rabies antigen, which was coincidentally carried by the vaccine virus or was integrated into the membrane of the recombinant fowlpox virus, instead of, as suggested, de novo synthesis of rabies antigen by the recombinant virus in the Animal, the vFP-3 virus was chemically inactivated, and rabbits were vaccinated with it.



  The purified virus was inactivated at 4 ° C. overnight in the presence of 0.001% beta-propiolactone and then pelleted by centrifugation. The pelleted virus was taken up in 10 mM Tris buffered saline, sonicated and titrated to ensure that no infectious virus was left. Two rats were inoculated intradermally with inactivated vFP-3 and two with an appropriate amount of untreated recombinant virus. The size of the lesions was determined.



  Both rabbits that received untreated vFP-3 developed typical pox lesions that were rated 4-5 + 5 days after inoculation. Rabbits vaccinated with inactivated virus also developed lesions, but these were classified as 2+ 5 days after vaccination.



  Blood was drawn from the rabbits at weekly intervals and the sera were tested by ELISA for the presence of antibodies specific for rabies and antibodies specific for fowlpox. The results are summarized in Table III.
 <tb> <TABLE> Columns = 9
 <tb> Title: Table III
 <tb> Head Col 02 to 05 AL = L: Living vFP-3
 <tb> Head Col 06 to 09 AL = L: Inactivated vFP-3
 <tb> SubHead Col 01 AL = L> Rabbit:
 <tb> SubHead Col 02 to 03 AL = L: No. 295
 <tb> SubHead Col 04 to 05 AL = L: No. 318
 <tb> SubHead Col 06 to 07 AL = L: No. 303
 <tb> SubHead Col 08 to 09 AL = L:

  No. 320
 <tb> SubHead Col 01 AL = L> Antibodies:
 <tb> SubHead Col 02 AL = L> Rabies:
 <tb> SubHead Col 03 AL = L> FP:
 <tb> SubHead Col 04 AL = L> Rabies:
 <tb> SubHead Col 05 AL = L> FP:
 <tb> SubHead Col 06 AL = L> Rabies:
 <tb> SubHead Col 07 AL = L> FP:
 <tb> SubHead Col 08 AL = L> Rabies:
 <tb> SubHead Col 09 AL = L> FP:
 <tb> <SEP> tested:
Week P.I.
 <tb> <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 0
 <tb> <SEP> 2 <SEP> 250 <SEP> 4000 <SEP> 500 <SEP> 4000 <SEP> 0 <SEP> 50 <SEP> 0 <SEP> 1000
 <tb> <SEP> 3 <SEP> 1000 <SEP> 4000 <SEP> 500 <SEP> 4000 <SEP> 0 <SEP> 4000 <SEP> 0 <SEP> 2000
 <tb> <SEP> 4 <SEP> 1000 <SEP> 4000 <SEP> 2000 <SEP> 4000 <SEP> 0 <SEP> 4000 <SEP> 0 <SEP> 2000
 <tb> <SEP> 5 <SEP> 4000 <SEP> 4000 <SEP> 2000 <SEP> 4000 <SEP> 0 <SEP> 2000 <SEP> 0 <SEP> 4000
 <tb> <SEP> 6 <SEP> 4000 <SEP> 4000 <SEP> 4000 <SEP> 4000 <SEP> 0 <SEP> 2000 <SEP> 0 <SEP> 2000
 <tb> </TABLE>



  In this test, the final titer value (expressed as the reciprocal of the serum dilution) was arbitrarily set to 0.2 after the absorption values of all sera had been subtracted before the "stress infection". Rabbits 295 and 318, which had received the live virus, developed an immune response to rabies glycoprotein and to poxpox virus antigens. Rabbits 303 and 320 also developed an immune response to chickenpox virus antigens; however, the titer was lower. None of these rabbits developed a detectable response to the rabies glycoprotein.



  This finding confirms that the immune response elicited in the rabbit is due to the de novo expression of the rabies glycoprotein gene contained in the recombinant virus and is not a response to any glycoprotein accidentally carried in the vaccine virus.


 Example 4B
 


 Construction of the recombinant virus vFP-5, the uncontrolled rabies
 Contains G genes from fowlpox virus FP-1
 



  The expression of a foreign gene inserted into the fowlpox genome by recombination requires the presence of a promoter. This has been demonstrated by producing another recombinant vFP-5 that is identical to vFP-3 except for the omission of the HH promoter. The presence of rabies gene in this recombinant was confirmed by nucleic acid hybridization. However, no rabies antigen was found in CEF cell cultures infected with the virus.


 Example 5
 


 Experiments with in vitro passengers to detect whether poultry pox virus
  replicated in non-bird-like cells.
 



  An experiment was carried out in which three cell systems (one bird-like and two non-bird-like) were inoculated with the parental FP-1 strain or with recombinant vFP-3. Two dishes with CEF, MRC-5 or VERO were inoculated with FP-1 or vFP-3 with an input multiplicity of 10 pfu per cell.



  After 3 days, one bowl was harvested. The virus was released by three consecutive freeze and thaw cycles and re-vaccinated on a fresh monolayer of the same cell line. This was repeated over six consecutive passages; at the end of the experiment, samples of each passage were titrated for viral infectivity on CEF monolayers. The results are summarized in Table IVa. They show that series passage of both FP-1 and vFP-3 is possible in CEF cells, but in neither of the two non-bird-like cell lines. Infectious virus could not be detected in VERO or MRC-5 cells after 3 or 4 passages.



  The second dish was used to determine if virus that was not detectable by direct titration could be detected after amplification in permissive CEF cells. After 3 days, cells from the second dish were harvested by scraping, a third of these cells were lysed and vaccinated on a fresh CEF monolayer. When the full cytopathic effect (CPE) was achieved or 7 days after infection, the cells were lysed. The virus yield was titrated. The results are summarized in Table IVB. If passage in CEF cells was used to multiply any virus present, no virus could be detected after four or five passages.



   Attempts to establish a permanently infected cell failed.



  In a further attempt to discover evidence of sustained viral expression in non-avian cells, the samples used above for virus titer determination were used in a standard immunodotest using anti-fowlpox and anti-rabies antibodies to detect the presence of the to detect the respective antigen.

  The results of these tests confirm the titration results.
 <tb> <TABLE> Columns = 7
 <tb> Title: Table IVA
Passenger attempt
 <tb> Head Col 01 AL = L: virus for inoculation
 <tb> Head Col 02 to 04 AL = L: FP-1
 <tb> Head Col 05 to 07 AL = L: vFP-3
 <tb> SubHead Col 01 AL = L> cell type:
 <tb> SubHead Col 02 AL = L> CEF:
 <tb> SubHead Col 03 AL = L> VERO:
 <tb> SubHead Col 04 AL = L> MRC-5:
 <tb> SubHead Col 05 AL = L> CEF:
 <tb> SubHead Col 06 AL = L> VERO:
 <tb> SubHead Col 07 AL = L> MRC-5:
 <tb>
 <tb> SubHead Col 01 to 07 AL = L:

  passage
 <tb> <SEP> 1 <SEP> 6.6 <a> <SEP> 4.8 <SEP> 4.9 <SEP> 6.6 <SEP> 5.4 <SEP> 6.2
 <tb> <SEP> 2 <SEP> 6.7 <SEP> 2.9 <SEP> 3.7 <SEP> 6.5 <SEP> 4.2 <SEP> 5.1
 <tb> <SEP> 3 <SEP> 6.4 <SEP> 1.4 <SEP> 1.0 <SEP> 6.4 <SEP> 1.7 <SEP> 4.4
 <tb> <SEP> 4 <SEP> 6.1 <SEP> N.D <b> <SEP> N.D <SEP> 6.2 <SEP> N.D <SEP> 1.0
 <tb> <SEP> 5 <SEP> 6.4 <SEP> N.D <SEP> N.D <SEP> 6.3 <SEP> N.D <SEP> N.D
 <tb> <SEP> 6 <SEP> 5.7 <SEP> N.D <SEP> N.D <SEP> 5.9 <SEP> N.D <SEP> N.D
 <tb>
 a - Virus titer in log10 pfu per ml
b - undetectable
  
 <tb> </TABLE>
 <tb> <TABLE> Columns = 7
 <tb> Title: Table IVB
Propagation attempt
 <tb> Head Col 01 AL = L: virus for inoculation
 <tb> Head Col 02 to 04 AL = L:

  FP-1
 <tb> Head Col 05 to 07 AL = L: vFP-3
 <tb> SubHead Col 01 AL = L> cell type:
 <tb> SubHead Col 02 AL = L> CEF:
 <tb> SubHead Col 03 AL = L> VERO:
 <tb> SubHead Col 04 AL = L> MRC-5:
 <tb> SubHead Col 05 AL = L> CEF:
 <tb> SubHead Col 06 AL = L> VERO:
 <tb> SubHead Col 07 AL = L> MRC-5:
 <tb>
 <tb> SubHead Col 01 to 07 AL = L: passage
 <tb> <SEP> 1 <SEP> 6.4 <a> <SEP> 6.2 <SEP> 6.4 <SEP> 6.5 <SEP> 6.3 <SEP> 6.4
 <tb> <SEP> 2 <SEP> 7.5 <SEP> 6.3 <SEP> 6.0 <SEP> 6.5 <SEP> 6.3 <SEP> 5.5
 <tb> <SEP> 3 <SEP> 6.2 <SEP> 6.7 <SEP> 5.3 <SEP> 5.9 <SEP> 6.1 <SEP> 6.3
 <tb> <SEP> 4 <SEP> 5.6 <SEP> 4.6 <SEP> 3.9 <SEP> 5.7 <SEP> 4.8 <SEP> 5.8
 <tb> <SEP> 5 <SEP> 6.3 <SEP> 4.1 <SEP> N.D <SEP> 6.1 <SEP> 4.7 <SEP> 4.7
 <tb> <SEP> 6 <SEP> 6.2 <SEP> N.D <b> <SEP> N.D <SEP> 6.2 <SEP> N.D <SEP> N.D
 <tb>
 a - Virus titer in log10 pfu per ml
b - undetectable
  
 <tb> </TABLE>


 Example 6
 


 Additional fowlpox recombinants FP-1:

   vFP-6, vFP-7, vFP-8 and vFP-9
 



  The recombinant viruses vFP-6 and vFP-7 were produced by the following methods.



  A 5.5 Kbp Pvu II fragment of FP-1 was inserted between the two Pvu II sites in pUC 9 and gave the plasmid pRW 731.13. This plasmid was then cleaved at a unique Hinc II site and blunt-ended rabies G gene dependent on the HH promoter inserted at the ends, resulting in plasmids pRW 748A and B, which represent the two opposite orientations of the insert. The plasmids pRW 748A and B were then used separately to infect CEF cells together with FP-1 virus and gave vFP-6 and vFP-7, respectively, by recombination. This locus is now referred to as locus f7.



  A 10 Kbp Pvu II fragment of FP-1 was inserted between the two Pvu II sites of pUC 9, giving pRW 731.15. This plasmid was then cleaved at a singular Bam HI site and then a lac Z gene fragment dependent on the 11K promoter was inserted, which produced pRW 749A and B, which represent the opposite orientations of the insert. Recombination of these donor plasmids with FP-1 led to vFP-8 or vFP-9. This locus is now referred to as locus f8.



  vFP-8 and vFP-9 expressed (as demonstrated by X-gal) the lac Z gene. vFP-6 and vFP-7 expressed the rabies G gene, as demonstrated by a rabies-specific antiserum.


 Example 7
 


 Immunization with vFP-3 to protect animals against a stress infection
 with live rabies viruses
 



  Groups of 20 female 4 to 6 week old SPF mice were inoculated with 50 μl vFP-3 on the paw area with doses in the range 0.7 to 6.7 TCID50 per mouse. (The TCID50 or tissue culture infectious dose is the dose at which 50% of the tissue culture cells experience a cytopathic effect). 14 days after vaccination, 10 mice from each group were sacrificed and serum samples collected for RFFI tests. The remaining 10 mice were exposed to a stress infection by inoculation with 10 LD50 of the rabies strain CVS via the intracerebral route and the survivors were calculated 14 days after the strain infection.



  The results are summarized in Table VA.
 <tb> <TABLE> Columns = 3
 <tb> Title: Table VA
 <tb> Head Col 01 AL = L: dose of vFP-3
log10 TCID50
 <tb> Head Col 02 AL = L: rabies antibody
Titer log10
Dilution*
 <tb> Head Col 03 AL = L: survival rate
 <tb> <SEP> 6.7 <SEP> 1.9 <SEP> 8/10
 <tb> <SEP> 4.7 <SEP> 1.8 <SEP> 0/10
 <tb> <SEP> 2.7 <SEP> 0.4 <SEP> 0/10
 <tb> <SEP> 0.7 <SEP> 0.4 <SEP> 0/10
 * Measured as RFFI (Rapid Fluorescent Focus Inhibition) tests, Laboratory Techniques in Rabies, Third Ed., 354-357, WHO Geneva.
  
 <tb> </TABLE>



  The experiment was repeated with 12.5 LD50 of the rabies virus as a stress infection. The results are summarized in Table VB.
 <tb> <TABLE> Columns = 3
 <tb> Title: Table VB
 <tb> Head Col 01 AL = L: dose of vFP-3
log10 TCID50
 <tb> Head Col 02 AL = L: rabies antibody
Titer log10
Dilution*
 <tb> Head Col 03 AL = L: survival rate
 <tb> <SEP> 6.7 <SEP> 2.8 <SEP> 5/10
 <tb> <SEP> 4.7 <SEP> 2.1 <SEP> 2/10
 <tb> <SEP> 2.7 <SEP> 0.6 <SEP> 0/8
 <tb> <SEP> 0.7 <SEP> 0.6 <SEP> 0/8
 * See table VA
  
 <tb> </TABLE>



  Two dogs and two cats were immunized with a single subcutaneous vaccination with 8 log10 TCID50 of the recombinant vFP-3. In addition, 2 dogs and 4 cats of appropriate age and weight were kept as non-vaccinated controls. Blood was drawn from all animals at weekly intervals. On day 94, each dog was subjected to a strain infection by inoculation in the temporal muscle with two doses of 0.5 ml of NY salivary homogenate from rabies virus (available from Institute Merieux, Inc.). The total dose corresponded to 10,000 LD50 mice via an intracerebral route. The six cats were similarly exposed to a strain infection by inoculation into the neck muscle with two doses of 0.5 ml of the same virus suspension. The total dose per animal corresponded to 40,000 LD50 mice via an intracerebral route.

   The animals were observed daily. All non-vaccinated animals died of rabies symptoms on the day shown in Table VI. The vaccinated animals survived the stress infection and were observed for 3 weeks after the death of the last control animal. The results are summarized in Table VI.
 <tb> <TABLE> Columns = 9
 <tb> Title: Table VI
 <tb> Head Col 01 to 02 AL = L: survival / animal
 <tb> Head Col 03 AL = L: vaccination
 <tb> Head Col 04 to 08 AL = L: titer after vaccination on the day
 <tb> Head Col 09 AL = L: time of death
 <tb>
 <tb> SubHead Col 04 AL = L> 0:
 <tb> SubHead Col 05 AL = L> 14:
 <tb> SubHead Col 06 AL = L> 21:
 <tb> SubHead Col 07 AL = L> 28:
 <tb> SubHead Col 08 AL = L> 94:
 <tb> <SEP> cats
 <tb> SubHead Col 02 AL = L> 7015:

   <SEP> vFP-3 <a> <SEP> 0 <SEP> 2.2 <b> <SEP> 2.4 <SEP> 2.4 <SEP> 1.5 <SEP> +
 <tb> <SEP> 7016 <SEP> vFP-3 <SEP> 0 <SEP> 1.7 <SEP> 1.9 <SEP> 2.0 <SEP> 1.3 <SEP> +
 <tb> <SEP> 8271 <SEP> c <c> <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> d / 13 <d>
 <tb> <SEP> T10 <SEP> c <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> d / 12
 <tb> <SEP> T41 <SEP> c <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> d / 13
 <tb> <SEP> T42 <SEP> c <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> d / 12
 <tb> <SEP> dogs <SEP> 426 <SEP> vFP-3 <SEP> 0 <SEP> 0.8 <SEP> 1.0 <SEP> 1.1 <SEP> 1.2 <SEP> +
 <tb> <SEP> 427 <SEP> vFP-3 <SEP> 0 <SEP> 1.5 <SEP> 2.3 <SEP> 2.2 <SEP> 1.9 <SEP> +
 <tb> <SEP> 55 <SEP> c <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> d / 15
 <tb> <SEP> 8240 <SEP> c <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> 0 <SEP> d / 16
 <tb>
 a - The cats and dogs vaccinated with vFP-3 received 8 log10 TCID50 via the subcutaneous route.
b - titer expressed as log10 of the highest serum dilution,

   which results in a reduction of more than 50% in the number of fluorescent wells in an RFFI test.
c - Non-vaccinated control animals.
d - animal died / day of death after exposure infection.
  
 <tb> </TABLE>



  In further experiments, the recombinant viruses vFP-2 and vFP-3 were used to inoculate cattle in several different ways.



  Vaccinated animals were tested for anti-rabies antibodies on days 6, 14, 21, 28 and 35. All animals show a serological response to the rabies antigen. This is shown in Table VII A.
 <tb> <TABLE> Columns = 8
 <tb> Title: Table VIIA
Antibody titers in vFP-3 vaccinated mammals (cattle) anti-rabies neutralizing antibodies
RFFI test log10 dilution
 <tb> Head Col 01 AL = L: beef no.
 <tb> Head Col 02 AL = L:

  Day
 <tb> Head Col 03 AL = L: 0
 <tb> Head Col 04 AL = L: 6
 <tb> Head Col 05 AL = L: 14
 <tb> Head Col 06 AL = L: 21
 <tb> Head Col 07 AL = L: 28
 <tb> Head Col 08 AL = L: 35
 <tb> <SEP> 7.3 log10 TCID50
 <tb> <SEP> 1420 (intradermal) <SEP> negative <SEP> 0.6 <SEP> 2 <SEP> 1.7 <SEP> 1.8 <SEP> 1.7
 <tb> <SEP> 8 log10 TCID50
 <tb> <SEP> 1419 (subcutaneous) <SEP> negative <SEP> 1.6 <SEP> 2.2 <SEP> 2.1 <SEP> 2.1 <SEP> 1.9
 <tb> <SEP> 8 log10 TCID50
 <tb> <SEP> 1421 (intramuscular) <SEP> negative <SEP> 0.9 <SEP> 2.2 <SEP> 2.2 <SEP> 1.8 <SEP> 1.7
 <tb> <SEP> 7.3 log10 TCID50
 <tb> <SEP> 1423 (intramuscular) <SEP> negative <SEP> 0.9 <SEP> 1.1+ <SEP> 1+ <SEP> 1+ <SEP> 1.1+
 <tb>
 + not significant
  
 <tb> </TABLE>



  All cattle were re-vaccinated with 8 log10 TCID50 on day 55 after vaccination. They showed a history response to the rabies antigen. In the booster vaccination, all cattle were vaccinated subcutaneously except No. 1421, which was vaccinated again intramuscularly. RFFI titers were determined on days 55, 57, 63, 70, 77 and 86.

  The results are summarized in Table VIIB.
 <tb> <TABLE> Columns = 8
 <tb> Title: Table VIIB
 <tb> Head Col 01 AL = L: beef no.
 <tb> Head Col 02 AL = L: day
 <tb> Head Col 03 AL = L: 55
 <tb> Head Col 04 AL = L: 57
 <tb> Head Col 05 AL = L: 63
 <tb> Head Col 06 AL = L: 70
 <tb> Head Col 07 AL = L: 77
 <tb> Head Col 08 AL = L: 86
 <tb> <SEP> 1419 <SEP> 1.7 <SEP> 1.5 <SEP> 2.9 <SEP> 2.9 <SEP> 2.6 <SEP> 2.9
 <tb> <SEP> 1420 <SEP> 1.0 <SEP> 0.5 <SEP> 1.9 <SEP> 2.3 <SEP> 2.2 <SEP> 2.0
 <tb> <SEP> 1421 <SEP> 1.3 <SEP> 1.2 <SEP> 2.9 <SEP> 2.7 <SEP> 2.5 <SEP> 2.5
 <tb> <SEP> 1423 <SEP> 1.0 <SEP> 0.7 <SEP> 2.4 <SEP> 2.5 <SEP> 2.5 <SEP> 2.2
 <tb> </TABLE>



  All data refer to vFP-3 except for Tier 1423, where they refer to vFP-2.



  Cattle, cats and rabbits were also vaccinated intradermally with known amounts of chickenpox virus. Scab was collected from the animals after about 1 week. This was ground, suspended in physiological saline and titrated to determine the virus amounts.



  Only residual amounts of infectious virus could be detected. This shows that there was no proliferation infection in vivo.


 Example 8
 


 Vaccination of chickens with vFP-3
 



  Chickens were vaccinated with recombinant fowlpox virus vFP-3 to demonstrate the expression of foreign DNA by a recombinant fowlpox virus in a system that allowed the vector to replicate.



  White Leghorn chickens were vaccinated intramuscularly with 9 log10 TCID50 vFP-3 or by wing piercing with 3 log10 TCID50 vPP-3. Blood samples were taken for an RFFI test for rabies antibody titers 21 days after vaccination. Day 21 titers in vaccinated chickens were significantly higher than titers in day 21 controls. The mean titre of the non-infected controls was 0.6, that of the intramuscularly vaccinated birds 1.9, that of the wing-pierced birds 1.2.


 Example 9
 


 Recombinant fowlpox vFP-11 expressing turkey influenza H5 HA antigen
 



  Bird species can be immunized against avian pathogens with the recombinant avipox viruses of the invention.



  Thus, the new plasmid pRW 759 described below, which is derived from the fowlpox virus FP-1 and contains a hemagglutin gene (H5) from A / Turkey / Ireland / 1378/83 (TYHA) under the control of the Hind III H promoter, became a transfection of CEF cells infected simultaneously with the parent virus FP-1. Recombinant fowlpox virus vFP-11 was obtained by the methods described above.



  The synthesis of a hemagglutinin molecule in VFP-11 infected cells was confirmed by immunoprecipitation of metabolically labeled infected cell lysates using a specific anti-H5 antibody and standard procedures. The specific immunoprecipitation of precursor hemagglutinin with a molecular weight of approx. 63 kd (kilodalton) and two cleavage products with a molecular weight of 44 and 23 kd was shown. No such proteins were precipitated from a lysate from uninfected CEF cells or from parental virus FP-1 infected cells.



   Immunofluorescence studies were carried out to demonstrate that the HA molecule produced in the cells infected with the recombinant smallpox vFP-11 was expressed at the cell surface. CEF cells infected with the recombinant fowlpox virus vFP-11 showed a strong fluorescence staining on the surface. No fluorescence was measured in cells infected with the parent virus FP-1.



  The plasmid pRW 759 was prepared as follows:
 pRW 742B (see Example 4) is linearized by partial digestion with Pst I and the fragment is subsequently cleaved with Eco RV to remove the rabies G gene, the HH promoter remaining on the remaining fragment of about 3.4 Kbp. After treatment with alkaline phosphatase, a synthetic oligonucleotide is inserted so that the HH promoter can be linked to TYHA at the ATG, resulting in pRW 744.



  This plasmid was linearized by partial digestion with Dra I; the linearized fragment was digested with Sal I and the larger fragment recovered and treated with alkaline phosphatase.



  Finally, pRW 759 was generated by inserting the isolated Sal I-Dra I fragment containing the coding sequence of TYHA into the pRW 744 vector as described by Kawaoka et al., Virology, Vol. 158 (1987), pages 218 -227 was shown.


 Example 10
 


 Immunization with vFP-11 to protect birds against a stress infection
 with living influenza virus
 



  In order to demonstrate the immunogenic effect of recombinant fowlpox virus vFP-11, vaccination and stress infection experiments were carried out in chickens and turkeys.



  Specifically pathogen-free (SPF) white leghorn chickens were vaccinated at the age of 2 days and 5 weeks by piercing the wing skin with a double needle as used for the usual vaccination of chickens with the chickenpox virus.



  About 2 ml vFP-11 with 6 x 10 <5> pfu was given to every bird. Blood was drawn from the older birds before vaccination and blood was drawn from all birds before the challenge infection and 2 weeks later.



  For comparison purposes, a second group of chickens was inoculated with a standard H5 vaccine consisting of an inactivated strain of H5N2 in a water-in-1 emulsion.



  Inactivated H5N2 vaccine was obtained from A / Mallard / NY / 189/82 (H5N2) influenza virus grown in 11-day-old fertilized chicken eggs; the infected allantoic fluid with an HA titer of 800 / 0.1 ml and an infectious titer of 10 <8.5> / 0.1 ml was inactivated with 0.1% propiolactone and in a water-in-1 emulsion as described in Stone et al., Avian Dis., Vol. 22 (1978) pages 666- 674 and Brugh et al., Proc. Second Inter. Sym. on Avian Influenza (1986), pages 283-292. In 0.2 ml volume, the vaccine was administered to 2-day and 5-week-old SPF white chickens via the subcutaneous route under the skin on the inside of the thigh muscle.



  A third and fourth group of chickens received parenterally original FP-1 virus or no vaccine.



  Chickens were subjected to a stress infection at around 10 <3> LD50 of the highly pathogenic A / Turkey / Ireland / 1378/83 (H5N8) or A / Chick / Penn / 1370/83 (H5N2) influenza virus by administering 0.1 ml to each bird's nostrils. Birds two days old were exposed to a stress infection 6 weeks after vaccination and birds 5 weeks old were exposed to a stress infection 5 weeks after vaccination. The birds were observed daily for symptoms of the symptoms, which showed swelling and cyanosis of the face and crest and bleeding on the feet (such birds often could not stand), paralysis and death. Most deaths occurred between 4 and 7 days after infection. Three days after infection, smears from the trachea and cloaca from each live chicken were tested for virus by inoculating fertilized eggs.

  The chickens, vaccinated with either wild-type or recombinant fowlpox virus, developed typical lesions on the wing mesh. A pustule up to the 3rd day around each needle stick was followed by a cellular infiltration with scab formation and recovery after 7 days. No secondary lesions were formed and there was no evidence of spread to non-vaccinated chickens that came into contact.

  The results of the stress infection experiment are summarized in Table VIII and the associated serological findings in Table IX.
 <tb> <TABLE> Columns = 6
 <tb> Title: Table VIII
Protection of chickens mediated by H5 expressed in chickenpox
 <tb> Head Col 01 AL = L: stress infection
 <tb> Head Col 02 AL = L: vaccine
 <tb> Head Col 03 AL = L: Age of the
Chicken
 <tb> Head Col 04 AL = L: protection
Sick / dead / total
 <tb> Head Col 05 to 06 AL = L:

  virus
 <tb>
 <tb> SubHead Col 05 AL = L> Trachea:
 <tb> SubHead Col 06 AL = L> Cloaca:
 <tb> <SEP> Ty / Ireland (H5N8) <SEP> Chickenpox H5 (vFP-11) <SEP> 2 days <SEP> 0/0/10 <SEP> 0/10 <SEP> 0/10
 <tb> <SEP> 5 weeks <SEP> 0/0/5 <SEP> 0/5 <SEP> 0/5
 <tb> <SEP> inactivated H5N2 <SEP> 2 days <SEP> 0/0/9 <SEP> 0/9 <SEP> 0/9
 <tb> <SEP> 5 weeks <SEP> 0/0/5 <SEP> 0/5 <SEP> 0/5
 <tb> <SEP> chickenpox
control <SEP> 2 days <SEP> 10/9/10 <SEP> 2/6 <SEP> 3/6
 <tb> <SEP> 5 weeks <SEP> 4/3/5 <SEP> 0/5 <SEP> 4/5
 <tb> <SEP> None <SEP> 2 days <SEP> 10/9/10 <SEP> 2/7 <SEP> 5/7
 <tb> <SEP> 2 days * <SEP> 2/1/2 <SEP> 2/2 <SEP> 2/2
 <tb> <SEP> 5 weeks <SEP> 2/2/5 <SEP> 0/5 <SEP> 1/5
 <tb> <SEP> Ck / Penn (H5N2) <SEP> Chickenpox H5 (vFP-11) <SEP> 2 days <SEP> 0/0/10 <SEP> 8/10 <SEP> 0/10
 <tb> <SEP> 5 weeks <SEP> 0/0/6 <SEP> 5/6 <SEP> 2/6
 <tb> <SEP> inactivated H5N2 <SEP> 2 days <SEP> 0/0/8 <SEP> 2/8 <SEP> 0/8
 <tb> <SEP> 5 weeks <SEP> 0/0/5 <SEP> 3/5

    <SEP> 0/5
 <tb> <SEP> chickenpox
control <SEP> 2 days <SEP> 10/1/10 <SEP> 10/10 <SEP> 10/10
 <tb> <SEP> 5 weeks <SEP> 5/0/5 <SEP> 5/5 <SEP> 5/5
 <tb> <SEP> None <SEP> 2 days <SEP> 9/3/9 <SEP> 9/9 <SEP> 9/9
 <tb> <SEP> 2 days * <SEP> 2/2/2 <SEP> 2/2 <SEP> 2/2
 <tb> <SEP> 5 weeks <SEP> 5/2/5 <SEP> 5/5 <SEP> 5/5
 <tb> <SEP> * Four unvaccinated birds were kept and raised with the fowlpox H5 group of 10 birds to demonstrate the spread of fowlpox H5.
 <tb> </TABLE>
 <tb> <TABLE> Columns = 11
 <tb> Title: Table IX
Antibody formation caused by vaccination with vFP-11 or an inactivated influenza virus vaccine
 <tb> Head Col 01 AL = L: load
infection
 <tb> Head Col 02 AL = L: vaccine
 <tb> Head Col 03 AL = L: age of the chickens
 <tb> Head Col 04 to 07 AL = L: HI titer on (a)
 <tb> Head Col 08 to 11 AL = L:

   Fixing infectivity
 <tb> SubHead Col 04 to 05 AL = L: Ty / Ireland
 <tb> SubHead Col 06 to 07 AL = L: Ck / Penn
 <tb> SubHead Col 08 to 09 AL = L: Ty / Ireland
 <tb> SubHead Col 10 to 11 AL = L: Ck / Penn
 <tb> SubHead Col 04 AL = L> Post-1:
 <tb> SubHead Col 05 AL = L> Post-2:
 <tb> SubHead Col 06 AL = L> Post-1:
 <tb> SubHead Col 07 AL = L> Post-2:
 <tb> SubHead Col 08 AL = L> Post-1:
 <tb> SubHead Col 09 AL = L> Post-2:
 <tb> SubHead Col 10 AL = L> Post-1:
 <tb> SubHead Col 11 AL = L> Post-2:

   
 <tb> <SEP> Ty /
Ireland (H5N8) <SEP> Chickenpox H5 <SEP> 2 days <SEP> 15 <(c)> <SEP> 156 <SEP> & lt <SEP> 65 <SEP> 70 <SEP> 2,500
 <tb> <SEP> 5 weeks <SEP> 100 <SEP> 480 <SEP> & lt <SEP> 20 <SEP> 160 <SEP> 10,000
 <tb> <SEP> inactivated H5N2 <SEP> 2 days <SEP> 30 <SEP> 70 <SEP> 30 <SEP> 50 <SEP> 65 <SEP> 1,000
 <tb> <SEP> 5 weeks <SEP> 350 <SEP> 600 <SEP> 180 <SEP> 200 <SEP> 240 <SEP> 2,500
 <tb> <SEP> chickenpox <SEP> 2 days <SEP> & lt <SEP> 160 <(1) (b)> <SEP> & lt <SEP> 20 <SEP> & lt <SEP> 300 <(1)>
 <tb> <SEP> control <SEP> 5 weeks <SEP> & lt <SEP> 1280 <(2)> <SEP> & lt <SEP> 60 <SEP> & lt <SEP> 10,000 <(2)>
 <tb> <SEP> no <SEP> 2 days <SEP> & lt <SEP> 80 <(1)> <SEP> & lt <SEP> 20 <SEP> & lt <SEP> 300 <(1)>
 <tb> <SEP> 5 weeks <SEP> & lt <SEP> 2000 <(3)> <SEP> & lt <SEP> 60 <SEP> & lt <SEP> 70 <(3)>
 <tb> <SEP> Ck / Penn <SEP> Chickenpox H5 <SEP> 2 days <SEP> 15 <SEP> 600 <SEP> & lt <SEP> 90 <SEP> & lt <SEP> 70
 <tb> <SEP> 5 weeks <SEP> 80 <SEP> 2500 <SEP> & lt

    <SEP> 300 <SEP> & lt <SEP> 2,500
 <tb> <SEP> inactivated H5N2 <SEP> 2 days <SEP> 60 <SEP> 300 <SEP> 20 <SEP> 70 <SEP> 10 <SEP> 400
 <tb> <SEP> 5 weeks <SEP> 300 <SEP> 500 <SEP> 100 <SEP> 200 <SEP> 150 <SEP> 1,500
 <tb> <SEP> chickenpox <SEP> 2 days <SEP> & lt <SEP> 60 <(6)> <SEP> & lt <SEP> 120 <SEP> & lt <SEP> 40
 <tb> <SEP> control <SEP> 5 weeks <SEP> & lt <SEP> 90 <SEP> & lt <SEP> 140 <SEP> & lt <SEP> 40
 <tb> <SEP> no <SEP> 2 days <SEP> & lt <SEP> 60 <(6)> <SEP> & lt <SEP> 160 <SEP> & lt <SEP> 25
 <tb> <SEP> 5 weeks <SEP> & lt <SEP> 160 <(3)> <SEP> & lt <SEP> 150 <SEP> & lt <SEP> 70
 <tb>
 (a) Blood was drawn from the 5 week old birds prior to vaccination and tested in HI and neutralization tests; none contained detectable levels of antibody; the results are not shown.

  Blood was drawn from the 2 day old chickens 6 weeks after vaccination (Post-1) and the 5 week old birds 5 weeks after vaccination (Post-1); Blood was drawn from both groups 2 weeks after the stress infection (post-2). The numbers represent mean antibody titers from the same group of chickens as described in Table I.
(b) The numbers in parentheses indicate how many survived the stress infection:
& lt = less than 10.
(c) Hemagglutination inhibition (HI) tests were carried out in microtiter plates using receptor-destroying enzyme-treated sera (4 HA units of Ty / Ire virus, and 0.5% chicken erythrocytes as described in Palmer et al., Immun Series No. 6, 51-52, US Dept. Health, Education and Welfare [1975]).

  The infectivity neutralization tests were carried out by 10 <3> EID50 from Ty / Ire virus were incubated with dilutions of the sera for 30 minutes at room temperature, followed by vaccination with aliquots into fertilized eggs. Virus growth was determined by hemagglutination tests after incubation of the eggs for 2 days at 33 ° C.
  
 <tb> </TABLE>



  Chickens inoculated with the recombinant chickenpox H5 (vFP-11) or the inactivated H5N2 influenza vaccine in adjuvant were prior to the challenge infection with the homologous Ty / Ire (H5N8) influenza virus and the related but distinguishable Ck / Penn (H5N2 ) -Influenza virus protected. In contrast, the majority of birds vaccinated with the initial FPV or without a vaccine showed clinical signs of highly pathogenic influenza including swelling and cyanosis of the face and crest, bleeding from the feet and paralysis. The majority of these birds died. The vaccinated birds excreted no detectable amounts of Ty / Irish, but Ck / Penn.



  Both the inactivated and recombinant vaccines induced HI and neutralizing antibodies to Ty / Ire, but the levels of antibodies induced by the chickenpox H5 recombinant vFP-11 prior to the stress infection did not inhibit HA or neutralized the heterologous Ck / Penn H5. Regardless, the chickens were protected from exposure infection with both Ty / Ire and Ck / Penn influenza viruses.



  Immunity to H5 influenza induced by vaccination with vFP-11 lasted at least 4 to 6 weeks and was cross-reactive. To demonstrate the duration and specificity of the response, a group of 4 week old chickens were vaccinated with vFP-11 in the wing mesh as described previously and exposed to the cross-reacting Ck / Penn virus at monthly intervals. Again, no HI antibodies were detectable before the stress infection. Regardless, the birds were protected even after 4 months.



  In addition, the H5 expressed by vFP-11 induces a protective immune response in turkeys. White outbread turkeys were inoculated at 2 days and 4 weeks by inoculation on the wing network as described above. The results are summarized in Table X.
 <tb> <TABLE> Columns = 9
 <tb> Title: Table X
Protection of turkeys mediated by H5-HA expressed in vFP-11
 <tb> Head Col 01 AL = L: vaccine
 <tb> Head Col 02 AL = L: Age of the
Birds
 <tb> Head Col 03 AL = L: protection
sick / dead /
total
 <tb> Head Col 04 to 05 AL = L: virus detection
 <tb> Head Col 06 to 07 AL = L: HI antibody
Ty / Irish
 <tb> Head Col 08 to 09 AL = L:

  Neutralizing
Antibody log10
to Ty / Ire
 <tb> SubHead Col 04 AL = L> Trachea:
 <tb> SubHead Col 05 AL = L> Cloaca:
 <tb> SubHead Col 06 AL = L> Post-1:
 <tb> SubHead Col 07 AL = L> Post-2:
 <tb> SubHead Col 08 AL = L> Post-1:
 <tb> SubHead Col 09 AL = L> Post-2:
 <tb> <SEP> vFP-11
Recombinant <SEP> 2 days <SEP> 1/1/5 <SEP> 5/5 <SEP> 3/5 <SEP> & lt10 <SEP> 160 <SEP> & lt1 <SEP> 4.32
 <tb> <SEP> 4 weeks <SEP> 2/1/6 <SEP> 2/6 <SEP> 0/6 <SEP> & lt10 <SEP> 640 <SEP> 1.05 <SEP> 4.16
 <tb> <SEP> contact <SEP> 2 days <SEP> 2/2/2 <SEP> 2/2 <SEP> 2/2 <SEP> & lt10 <SEP> dead <SEP> & lt1 <SEP> dead
 <tb> <SEP> controls <SEP> 4 weeks <SEP> 2/2/2 <SEP> 2/2 <SEP> 2/2 <SEP> & lt10 <SEP> dead <SEP> & lt1 <SEP> dead
 <tb> </TABLE>



   A significant survival rate against stress infection with the homologous Ty / Ire virus was observed in both age groups. Non-vaccinated contact control birds were kept with the vaccinated birds to test for the spread of the recombinant virus. These birds did not survive the stress infection.


 Example 11
 


 Construction of the chicken influenza nucleoprotein (NP) gene expressing
 Chickenpox virus FP-1 recombinant vFP-12
 



  The plasmid pNP33 contains a cDNA clone of the influenza virus chicken / Pennsylvania / 1/83 nucleoprotein gene (NP). Only the 5 min and 3 min ends of the approximately 1.6 kbp NP gene were sequenced. NP was transferred from pNP 33 into pUC 9 digested with Sma I as a blunt-ended 5 min Cla I-Xho I 3 min fragment, with the pUC 9 Eco RI site at the 3 min end, producing pRW 714. NP's translation start codon (ATG) contains the following underlined Aha II site: ATGGCGTC. The Vaccinia H6 promoter previously described was linked to NP using a double stranded synthetic oligonucleotide. The synthetic oligonucleotide contained the H6 sequence from the Eco RV site to the ATG and to the NP coding sequence at the Aha II site.

  The oligonucleotide was synthesized with ends compatible with Bam HI and Eco RI for insertion into pUC 9 and led to pRW 755. Starting at the end compatible with Bam HI with the ATG underlined, the sequence of the double-stranded synthetic oligonucleotide is that the following:
 
 GATCCGATATCCGTTAAGTTTGTATCGTAATGGCGTCG
 GCTATAGGCAATTCAAACATAGCATTACCGCAGCTTAA
 



  The linear product of a partial digestion of pRW 755 with Aha II was isolated and subsequently cleaved with Eco RI. The pRW 755 fragment, which contained a single Aha II cut on the ATG and was cleaved with Eco RI, was isolated, treated with phosphatase and used as a vector for the digest of pRW 714 (see below).



  The isolated, linear product of a partial digest with Aha II from pRW 714 was cleaved with Eco RI. An isolated Aha II-Eco RI fragment of about 1.6 Kbp containing the coding sequence for NP was inserted into the pRW 755 vector and led to pRW 757. The complete H6 promoter was formed by the sequences above (5 min) the Eco RV site were added. The plasmid pRW 742B (described in Example 4) had removed the H6 sequence below (3 min) the Eco RV site with the sequences up to the Nde I site in pUC 9. The phosphatase treated Eco RV-Nde I fragment of pRW 742B was used as a vector for the pRW 757 fragment (see below).

  The isolated linear product of a partial digest of pRW 757 with Eco RV was recovered after cleavage with Nde I; this fragment contains the H6 promoter from the Eco RV site via NP to the Nde I site in pUC 9. The pRW 757 fragment was inserted into the pRW 742B vector and formed pRW 758. The Eco RI fragment from pRW 758 , which contains the complete NP dependent on the H6 promoter, was blunt-ended with the Klenow fragment of DNA polymerase I and inserted into the Hinc II site of pRW 731.13 to give pRW 760. The Hinc II site of pRW 731.13 is the FP-1 locus used in Example 6 to construct vFP-6 and vFP-7.



  Using fowlpox FP-1 as the catching virus, the plasmid pRW 760 was used for an in vitro recombination test. The progeny plaques were tested and cleaned using in situ plaque hybridization. Expression of the gene was confirmed by immunoprecipitation studies using a goat anti-NP polyclonal antiserum. The size of the protein, which was particularly precipitated from a lysate of CEF cells infected with vFP-12, was about 55 kD, which is within the published range of influenza nucleoproteins.


 Example 12
 


 Production of a bird fluenza nucleoprotein (NP) and hemagglutinin (HA) genes
 expressing double recombinant vFP-15 from fowlpox virus
 



  The hemagglutinin (HA) gene from A / Tyr / Ire / 1378/83 has been described in connection with the construction of vFP-11 (Example 9). When producing the double recombinant, the HA gene was first brought into the locus f8 previously described in the production of vFP-8 using the plasmid pRW 731.15.



  The plasmid used to construct vFP-11 was pRW 759. The hemagglutin gene linked to the H6 promoter was removed from this plasmid by partial digestion with Pst I. This fragment was then blunt-ended with the Klenow fragment of DNA polymerase I, inserted into the blended Bam HI site of pRW 731.15, to give pRW 771.



  The plasmid pRW 771 was then used in an in vitro recombination test using vFP-12 as the collecting virus. The recombinant virus vFP-12 contains the nucleoprotein gene connected to the H6 promoter at the f7 locus as defined in the plasmid pRW 731.13. Recombinant plaques, which now contained both insertions, were selected and plaque-purified by in situ hybridization and surface expression of the hemagglutinin, which was confirmed by a protein A-beta-galactosidase-linked immunoassay. The expression of both genes was detected by immunoprecipitation from cell lysates infected with the double recombinant virus vFP-15.


 Example 13
 


 Construction of recombinant canarypox viruses
 



  The following example shows the identification of four non-essential insertion loci in the canarypox genome and the construction of four recombinant canarypox viruses vCP-16, vCP-17, vCP-19 and vCP-20.



  Canarypox recombinant vCP-16 was prepared as follows.



  A 3.4 Kbp Pvu II fragment of canarypox DNA was cloned into pUC 9 and resulted in pRW 764.2. A unique Eco RI site was found to be asymmetric in the fragment with a short arm of 700 bp and a long arm of 7.2 Kbp. The plasmid was digested with Eco RI and blunt-ended using Klenow fragment of DNA polymerase I. The smooth-ended H6 / rabies G gene was then ligated to this site and used to transform E. coli. The resulting plasmid pRW 775 was used for an in vitro recombination test. Progeny plaque positive in an immunoscreen method were selected and plaque-cleaned. The resulting recombinant was named vCP-16 and the insertion locus C3.



   The plasmid pRW 764.2 used in the above construction also contained a singular Bgl II site about 2.4 Kbp from the Eco RI site. Using the same cloning strategy, the H6 / rabies G gene was ligated to the plasmid pRW 764.2 at this point and resulted in pRW 774. This plasmid was used to construct the recombinant vCP-17 with the insertion locus designated C4.



  The plasmid pRW 764.5 contains an 850 bp Pvu II fragment of canarypox DNA with a unique Bgl II site which is asymmetrically located in the 400 bp fragment from one end. Using the cloning strategy as previously described, the rabies G gene linked to the H6 promoter was inserted at this point and yielded the plasmid pRW 777. The stable recombinant virus thus produced was designated as vCP-19 and the insertion locus as C5.



  Plasmid pRW 764.7 contains a 1.2 Kbp Pvu II fragment with a unique Bgl II site 300 bases from one end. This plasmid was digested with Bgl II and flattened with the Klenow fragment of DNA polymerase I. The end-laced lac Z gene with the 11K promoter was inserted and resulted in plasmid pRW 778. The stable recombinant virus produced using this plasmid was named VCP-20 and the insertion locus as C6.


 Example 14
 


 Construction of a recombinant expressing the Newcastle Disease Virus fusion protein
 Chickenpox virus vFP-29
 



  Plasmid pNDV 108, the cDNA clone of the NDV strain Texas fusion gene, consists of an Hpa I cDNA fragment of approximately 3.3 Kbp, which contains both the coding sequence for the fusion protein and additional into the Sca I site of pBR 322 contains cloned coding NDV sequences. Steps to prepare the insertion plasmid are described below.


 (1) Preparation of plasmid pCE 11
 



  An FPV insertion vector, pCE 11, was created by inserting polylinkers at the Hinc II site of pRW 731.13 (designated locus f7). pRW 731.13 contains a 5.5 Kbp Pvu II fragment of FP-1 DNA. A non-essential locus was defined above at the Hinc II site by constructing the stable recombinant vFP-6 described in Example 6. The polylinkers inserted at the Hinc II site contain the following restriction enzyme sites: Nru I, Eco RI, Sac I, Kpn I, Sma I, Bam HI, Xba I, Hinc II, Sal I, Acc I, Pst I, Sph I, Hind III and Hpa I.


 (2) Preparation of plasmid pCE 19
 



  This plasmid is a further modification of pCE 11 in which the vaccinia virus transcription stop signal ATTTTTNT (L. Yuen and B. Moss, J. Virology, Vol. 60 [1986], pages 320-323) (in this case, N is an A) ) was inserted between the Sac I and Eco RI sites of pCE 11 with loss of the Eco RI site.


 (3) Insertion of coding NDV sequences
 



  A gel-purified 1.8 Kbp Bam HI fragment containing all of the nucleotides except for 22 nucleotides from the 5 min end of the fusion protein gene was inserted into the Bam HI site of pUC 18 and formed pCE 13. This plasmid was digested with Sal I, which cleaves 12 bases above the 5 min end of the coding sequence in the vector. The ends were filled in with the Klenow fragment of DNA polymerase I and the plasmid was then digested with Hind III, which cleaves 18 bases above the Sal I site. A gel-purified 146 bp Sma I - Hind III fragment containing the vaccinia virus H6 promoter described in the preferred embodiments as well as polylinker sequences at each end was ligated to the vector and transformed into E. coli cells. The resulting plasmid was named pCE 16.



  In order to bring the ATG start codon of the NDV fusion protein gene with the 3 min end of the H6 promoter into the reading phase and to replace the 22 nucleotides missing from the NDV 5 min end in pCE 16, a complementary synthetic oligonucleotide with Eco RV and Kpn I-places developed at the ends. The oligonucleotide sequence was:
 
 5 min -ATC-CGT-TAA-GTT-TGT-ATC-GTA-ATG-GGC-TCC-
 AGA-TCT-TCT-ACC-AGG-ATC-CCG-GTA-C 3 min.
 



  The construction pCE 16 was then digested with Eco RV and Kpn I. The Eco RV site is 24 bases above the initiation ATG in the H6 promoter. The Kpn I site is 29 bases below the ATG in the coding NDV sequence.



  The oligonucleotides were hybridized, phosphorylated and linked to the linearized plasmid. The resulting DNA was used to transform E. coli cells. This plasmid was named pCE 18.



  To insert coding NDV sequences into an FPV insertion vector, a gel-purified 1.9 Kbp Sma I-Hind III fragment of pCE 18 (which is cleaved in the polylinker region) was cut with a 7.8 Kbp Sma I-Hind III Fragment of pCE 19 ligated (as described above). The transcription start signal is 16 bases below the Sma I site. The resulting plasmid was named pCE 20.



  The plasmid pCE 20 was used in an in vitro recombination test, using fowlpox virus FP-1 as the catching virus. The resulting progeny was plated on CEF monolayers and the plaques were subjected to a beta-galactosidase protein A immunoassay using a chicken polyclonal anti-NDV serum. Plaques positive in staining were selected and plaque cleaning was performed for 4 rounds to obtain a homogeneous population. The recombinant was named vFP-29.


 Example 15
 


 Construction of feline leukemia virus (FeLV) envelope (ENV) glycoprotein
 expressing avipox virus recombinants
 



  The FeLV env gene contains the sequences encoding the p70 + p15E polyprotein. This gene was first inserted into the plasmid pSD467vC with the vaccinia H6 promoter preceding the FeLV env gene. The plasmid pSD467vC was previously obtained by inserting a 1802 bp Sal I / Hind III fragment containing the vaccinia hemagglutinin (HA) gene into a pUC 18 vector. The location of the HA gene was previously determined (Shida, Virology, Vol. 150 [1988], pages 451-462). The majority of the open reading frame encoding the HA gene product was deleted (nucleotide 443 to nucleotide 1311) and a multiple cloning site containing Bgl II, Sma I, Pst I and Eag I restriction endonuclease sites was inserted.

   The resulting plasmid pSD467vC contains flanking vaccinia arms from 442 bp up 5 min from the mutiple cloning site and 491 bp 3 min from these restriction sites. These flanking arms allow material inserted into the multiple cloning region to be recombined into the HA region of the Copenhagen strain of vaccinia virus. The resulting recombinant progeny is HA negative.



  The H6 promoter had been synthesized by the attachment of four overlapping oligonucleotides, which together comprised the complete sequence described above in the preferred embodiments. The resulting 132 bp fragment contained a Bgl II restriction site at the 5 min end and an Sma I site at the 3 min end. This was inserted into pSD467vC via the Bgl II and Sma I restriction sites. The resulting plasmid was named pPT15. The FeLV env gene was inserted into the unique Pst I site of pPT15 immediately 3 min to the side of the H6 promoter. The resulting plasmid was named pFeLV1A.



  To construct the FP-1 recombinant, the 2.4 Kbp H6 / FeLV env sequence was cut out of pFeLV1A by cleavage with Bgl II and partial cleavage with Pst I. The Bgl II site is at the 5 min limit of the H6 promoter sequence. The Pst I site is 420 bp after the termination signal of translation for the open reading frame of the envelope glycoprotein.



  The 2.4 Kbp H6 / FeLV env sequence was inserted into pCE 11 digested with Bam HI and Pst 15 I. The FP-1 insertion vector, pCE 11, is derived from pRW 731.13 by inserting a multiple cloning site into the non-essential Hinc II site. This insertion vector allows the production of FP-1 recombinants which contain foreign genes in the f7 locus of the FP-1 genome. The recombinant FP-1 / FeLV insertion plasmid was named pFeLVFI. This construction does not offer a complete ATG for ATG substitution.



  In order to achieve complete ATG: ATG construction, a Nru I / Sst II fragment of approximately 1.4 kbp was derived from the vaccinia virus insertion vector pFeLV1C. The Nru I site is within the H6 promoter at a position 24 bp above the ATG. The Sst II site is 1.4 Kbp 3 min on the ATG side and 1 Kbp 5 min on the translation termination signal. This Nru I / Sst II fragment was ligated to a 9.9 Kbp fragment generated by digestion with Sst II and partial digestion with Nru I. This 9.9 Kbp fragment contains the 5.5 Kbp of the FP-1 flanking arms, the pUC vector sequences, 1.4 Kbp at the sections of the FeLV sequence corresponding to the 3 min end of the env gene and the sequence at the very end 5 min end of the H6 promoter (approx. 100 bp). The resulting plasmid was named pFeFLVF2.

  The ATG: ATG construction was confirmed by nucleotide sequence analysis.



  Another FP-1 insertion vector, pFeLVF3, was derived from pFeLVF2 by removing the FeLV env sequences corresponding to the likely immunosuppression region (Cianciolo et al., Science, Vol. 230 [1985], pages 453-455) (nucleotide 1548 to 1628 the coding sequence). This was achieved by isolating a Sst II / Pst I fragment (sites described above) of about 1 Kbp from the vaccinia virus insertion vector pFeLV1D. The plasmid pFeLV1D is similar to the plasmid pFeLV1C with the exception that the env sequences corresponding to the immunosuppression region (nucleotides 1548 to 1628) are controlled by oligonucleotide-controlled mutagenesis (Mandecki, Proc. Natl. Acad. Sci. USA, vol. 83 [1987] , Pages 7177-7181) had been removed.

  The 1 Kbp Sst II / Pst I fragment without nucleotides 1548 to 1628 was inserted into a 10.4 Kbp Sst II / Pst I fragment containing the rest of the H6: FeLV env gene derived from pFeLVF2.



  The insertion plasmids, pFeLVF2 and pFeLVF3, were used for in vitro recombination tests with FP-1 as the collecting virus. Progeny of the recombination was plated on CEF monolayers and recombinant viruses were selected by plaque hybridization on CEF monolayers. Recombinant progeny identified by hybridization analysis was selected and subjected to 4 rounds of plaque cleaning to obtain a homogeneous population. An FP-1 recombinant containing the full FeLV env gene was named vFP-25 and an FP-1 recombinant containing the complete gene except for the immunosuppression region was named vFP-32. Both recombinants were shown to express the correct gene product by immunoprecipitation using bovine polyclonal anti-FeLV polyclonal serum (Antibodies, Inc., Davis, Ca).

  It is important that these FP-1 recombinants express the foreign FeLV env gene in the cat-derived CRFK cell line (ATCC No. CCL94).



  To construct canarypox (CP) recombinants, a 2.2 Kbp fragment containing H6: FeLV env sequences was excised from pFeLVF2 by cleavage with Sma I and Hpa I. The Sma I site is at the 5 min limit of the H6 promoter sequence. The Hpa I site is 180 bp 3 min from the translation termination signal for the open reading frame of the envelope glycoprotein.



  The 2.2 Kbp H6: FeLV env sequence was inserted into the non-essential Eco RI site of the insertion plasmid pRW 764.2 after the ends of the Eco RI site were smoothed. This insertion vector allows the generation of CP recombinants that contain foreign genes in the C4 locus of the CP genome. The recombinant CP insertion plasmid was named pFeLVCP2. This construction offers a perfect ATG: ATG substitution.



  The insertion plasmid, pFeLVCP2, was used in an in vitro recombination test with CP as the catching virus. Progeny of the recombinant was plated on CEF monolayer and recombinant virus selected by protein A-linked beta-galactosidase immunoassay using a commercial polyclonal bovine anti-FeLV serum (Antibodies, Inc., Davis, CA.). Plaques positive in staining were selected and plaque cleaning was performed for 4 rounds to obtain a homogeneous population. A recombinant that expresses the entire FeLV env gene was named vCP-36.


 Example 16
 


 Construction of Rous-associated virus type 1 (RAV-1) envelope (env) gene
 expressing recombinant fowlpox virus vFP-22
 



   Specific precipitation of a small amount of precursor protein with a molecular weight of approximately 180 kD and of cleavage products of 90 kD.


 Example 20
 


 Construction of the herpes simplex gD expressing fowlpox virus FP-1 recombinant vFP-30
 



  The herpes simplex virus (HSV) type 1 glycoprotein D gene (gD) from the KOS strain was inserted into the Bam HI site of pUC 9 as an at the 5 min -Bam HI end with Hpa II-NruI fragment which was associated with the was linked at the 3 min -Bam HI end, cloned; the 5 min end is immediately adjacent to the Pst I site of pUC 9. The 5 min sequence of HSV gD, which begins with the initiation codon (ATG) of translation, contains the following underlined Nco I site:
 
 ATGGGGGGGGCTGCCGCCAGGTTGGGGGCCGTGATTTTGTTTGTCGTCATAGTGGGCCTCCATGG.
 



  The Vaccinia H6 promoter described above was linked to the HSV gD gene via a synthetic oligonucleotide. The synthetic oligonucleotide contains the 3 min section of the H6 promoter from the Nru I site to the ATG and further to the coding sequence from gD to the Nco I site. The oligonucleotide was synthesized with a Pst I compatible end on the 5 min side. The gD clone in pUC 9 was digested with Pst I and Nco I and the HSV sequence was removed at the 5 min end for exchange with the synthetic oligonucleotide, resulting in pRW 787. The sequence of the double-stranded synthetic oligonucleotide is:
 
 GTCGCGATATCCGTTAAGTTTGTATCGTAATGGGAGGTGCCGACGTCAGCGCTATAGGCAATTC-AAACATAGCATTACCCTCCACGGCCAGCTAGATTAGGTGCTGTTATTTTATTTGTAGTTA TAGTA-GGACTCGTCACGATGTAATCCTACGATGTAATCCACACCAT
 



  Digestion of pRW 787 with Nru I and Bam HI produces a fragment of approximately 1.3 Kbp that extends the 3 min side of the H6 promoter from the Nru I site through the coding sequence from HSV gD to the Bam HI site contains. The vector pRW 760 digested with Nru I and Bam HI was described in Example 11. The insertion of a 1.3 Kbp fragment into the vector pRW 760 resulted in pRW 791. The vector pRW 791 contains the complete HSV gD gene under the vaccinia H6 promoter in the non-essential Hinc II site in FP-1 in pRW 731.13 (Locus f7).



  Recombination of the donor plasmid pRW 791 with FP-1 led to vFP-30. Surface expression of the glycoprotein was detected in recombinant plaques using protein A linked to beta-galactosidase and sera specific for HSV-1.


 Example 21
 


 Use of entomopox promoters to regulate the expression of foreign genes
 in smallpox virus vectors
 


 (a) Background
 



  Smallpox viruses from insects (entomopox) are currently classified in the subfamily Entomopoxvirinae, which is further divided into three genera (A, B and C), which correspond to entomopoxviruses isolated from the insect orders Coleoptera, Lepidoptera and Orthoptera, respectively. Entomopox viruses have a narrow host range in nature and are not known to replicate in any vertebrate species.



  The virus used in the present studies was originally isolated from infected larvae of Amsacta moorei (Lepidoptera: arctildae) from India; see. Roberts and Granados, J. Invertebr. Pathol. Vol. 12, (1968), pages 141-143. The virus, known as AmEPV, is the leading species for genus B.



  Wild-type AmEPV was developed by Dr. R. Granados (Boyce Thomson Institute, Cornell University) obtained as an infectious hemolymph from infected Estigmene acrea larvae. The virus was found to replicate in the invertebrate cell line IPLB-LD652Y, which was obtained from ovarian tissues from Lymantria dispar (sponge spinner) (described by Goodwin et al., In Vitro Vol. 14 [1978] pages 485-494). These cells were grown at 28 ° C in IPL-528 medium supplemented with 4% fetal calf and 4% chicken serum.



  The wild-type virus was checked for plaques on LD652Y cells and a plaque, designated V1, was selected for further experiments. This isolate causes numerous inclusion bodies (OBs) in the cytoplasm of the infected cells towards the end of the infection cycle.


 (b) promoter identification
 



  The identification and mapping of an AmEPV promoter was accomplished as follows. Total RNA from infected LD652Y cells (48 hours post infection; late phase) was isolated and used to generate first strand cDNA labeled with 32P. The cDNA was then used to screen "blots" containing restriction digests from the AmEPV genome. This Southern blot revealed a strong signal on a 2.6 kb Cla I fragment, indicating that this fragment encoded a highly expressed gene. The fragment was cloned into a plasmid vector and its DNA sequence determined.



  Analysis of the sequence data revealed an open reading frame that was able to encode a 42 kD polypeptide. In vitro translation of the total RNA at 48 hours after infection and separation of the products via SDS-PAGE resulted in a polypeptide of approximately 42 kD.


 (c) Construction of a recombinant vaccinia virus with the expression of a foreign gene under the control of the entomopox virus promoter.
 



  To determine whether an entomopoxvirus promoter would work in a vertebrate poxvirus system, the following plasmid was constructed: an oligonucleotide was chemically synthesized that contains 107 bases from the 5 min side of the translation start signal of the 42K gene (hereinafter AmEPV 42K promoter designated) contained and is flanked by a Bgl II site at the 5 min end and at the 3 min end of the first 14 bases of the coding region which stops at an Eco RI site of hepatitis B virus pre-S2. The AmEPV 42K promoter sequence is described below:
 
 TCAAAAAAATATAAATGATTCACCATC
 TGATAGAAAAAAAATTTATTGGGAAGA
 ATATGATAATATTTTGGGATTTCAAA
 ATTGAAAATATATAATTACAATATAAAATG
 



  The AmEPV 42K promoter was ligated to the hepatitis B virus surface antigen (HBVsAG) as follows. A pUC plasmid containing the hepatitis B virus surface antigen and the coding region of pre-S2 (type ayw as described by Galibert et al., Nature Vol. 281 [1979], pages 646-650) was generated Vaccinia virus arms flanked in the non-essential region of the vaccinia virus genome encoding the hemagglutinin (HA) molecule (HA arms described in Example 15; HA region described by Shida, Virology Vol. 150 [1986], pages 451-462). The oligonucleotide described above was inserted into this plasmid using the unique Eco RI site in the HBVsAg coding region and the unique Bgl II site in the HA vaccine arm. The resulting recombinant vaccinia virus was named vP 547.



   The expression of the coding HBVsAg sequence under the control of the entomopocken 42K promoter was detected with an immunoassay. Corresponding cultures of the BSC-40 mammalian cell line were infected with starting vaccinia virus or the recombinant vP 547. 24 hours after infection, the cells were lysed and the lysate was applied in serial dilutions to a nitrocellulose membrane. The membrane was first treated with a goat anti-HBV serum and then with <1> <2> <5> J-Protein A incubated. After washing, an X-ray film was exposed to the membrane. Positive signals were found in cultures infected with vP 547 but not in cultures infected with parent virus, which indicates recognition of the AmEPV 42K promoter by vaccinia virus in mammalian cells.



  The above results were confirmed using an Ausria assay (see Example 1 for details) to detect HBVsAg in infected mammalian cells. Vaccinia virus recombinants that had either the HBVsAg gene linked to AmEPV42K or the vaccinia virus H6 promoter were used to infect BSC-40 cells; the extent of expression of sAg was determined in an Ausria test.

  As shown in Table XII, the data show that the amount of HBVsAg expression was significant using the 42K promoter.
 <tb> <TABLE> Columns = 3
 <tb> Title: Table XII
Expression of HBVsAg in recombinant vaccinia virus
 <tb> Head Col 01 AL = L: recombinant virus
 <tb> Head Col 02 AL = L: promoter
 <tb> Head Col 03 AL = L: Ausria P / N ratio
 <tb> <SEP> vP-410 <SEP> control <SEP> 1.0
 <tb> <SEP> vP-481 <SEP> H6 <SEP> 24.3
 <tb> <SEP> vP-547 <SEP> 42K <SEP> 44.9
 <tb> </TABLE>



  Further experiments were carried out to confirm the time-dependent nature of the regulation of the AmEPV 42K promoter in a vertebrate poxvirus system. Similar cultures of BSC-40 cells were infected with vP 547 in the presence or absence of 40 μg / ml cytosine arabinoside, an inhibitor of DNA replication which therefore blocks late viral transcription. The levels of expression were checked in an Ausria test 24 hours after infection. The results show that the 42K promoter was recognized as an early promoter in a vaccinia virus replication system.



  The use of the AmEPV 42K promoter for the expression of foreign genes in a mammalian system is evidently different from the use of the Autographa californica NPV polyhedrin promoter for gene expression in invertebrate systems (Luckow and Summers, Biotechnology, Vol. 6 [1988], pages 47- 55). The polyhedrin promoter is not recognized by the transcription apparatus in mammalian cells (Tjla et al., Virology, vol. 125 [1983], pages 107-117). The use of the AmEPV 42K promoter in mammalian cells shows for the first time that an insect virus promoter has been used to express foreign genes in a non-insect viral vector in non-invertebrate cells.



  The following experiment was carried out to determine whether avipox viruses would also recognize the 42K entomopox promoter. Identical cultures of CEF cells were inoculated with 10 pfu per cell from either poultry pox virus, canary pox virus or vaccinia virus and at the same time transfected with 25 mu g of one of the following plasmids: 1) Plasmid 42K.17, which contains the HBV pre-S2 + sAg coding sequence linked to the 42K promoter or 2) plasmid pMP15.spsP, which contains the identical HBVsAg coding sequence linked to the vaccinia virus H6 promoter. After 24 hours the cells were frozen and lysed and the lysates were checked for the presence of HBVsAg using an Ausria test (see Example 1).



  The results shown in Table XIII should be viewed in a qualitative sense. They indicate that the transcription apparatus of both poultrypox virus and canarypox virus is able to recognize the 42K promoter and allows the transcription of the coding HBVsAg sequence associated therewith.

  Although the levels of expression are lower than those with the vaccinia virus H6 promoter, the levels are well above the background levels obtained with the negative controls.
 <tb> <TABLE> Columns = 3
 <tb> Title: Table XIII
Detection of the 42K entomopox virus promoter by avipox viruses
 <tb> Head Col 01 AL = L: Virus
 <tb> Head Col 02 AL = L: promoter
 <tb> Head Col 03 AL = L: ratio P / N
 <tb> <SEP> chickenpox <SEP> 42K <SEP> 39.1
 <tb> <SEP> H6 <SEP> 356.8
 <tb> <SEP> canary pox <SEP> 42K <SEP> 90.2
 <tb> <SEP> H6 <SEP> 222.2
 <tb> <SEP> Vaccinia <SEP> 42K <SEP> 369.4
 <tb> <SEP> H6 <SEP> 366.9
 <tb> <SEP> None <SEP> 42K <SEP> 7.8
 <tb> <SEP> None <SEP> H6 <SEP> 7.2
 <tb> <SEP> Vaccinia <SEP> - <SEP> 7.2
 <tb> </TABLE>


 Example 22
 


 Immunization with VCP-16 to protect mice against a stress infection
 with live rabies virus
 



  Groups of 20 four to six week old mice were inoculated in the paw area with 50 to 100 μl of a series of dilutions from one of the following two recombinants: (a) vFP-6 - the fowlpox rabies recombinant described in Example 6 - and (b ) vCP-16 - the canarypox rabies recombinant described in Example 13.



  After 14 days, 10 mice from each group were sacrificed and the serum collected. The anti-rabies titer in the serum was calculated using the RFFI test described in Example 7. The remaining 10 mice from each group were challenged by intracerebral vaccination with the rabies virus CVS strain used in Example 7. Each mouse received 30 μl, which corresponded to 16 mouse LD50. After 28 days, the number of surviving mice was determined and the protective dose 50 (PD50) was calculated. The results are summarized in Table XIV.



  The degree of protection found in mice vaccinated with vFP-6 confirmed the result of vaccination with recombinant fowlpox virus vFP-3 discussed in Example 7. The level of protection achieved with vaccination with vCP-16 is considerably higher. Based on the calculated PD50, the canarypox rabies recombinant is 100 times more effective in protecting against a rabies infection than the poultry pox rabies recombinant.
 <tb> <TABLE> Columns = 6
 <tb> Title: Table XIV
The protective immunity achieved by two Avipox rabies recombinants against a strain infection with rabies virus
 <tb> Head Col 01 to 03 AL = L: Chickenpox vFP-6
 <tb> Head Col 04 to 06 AL = L:

   Canary pox vCP-16
 <tb> SubHead Col 01 AL = L> Vaccine dose:
 <tb> SubHead Col 02 AL = L> RFFI titer:
 <tb> SubHead Col 03 AL = L> survival rate:
 <tb> SubHead Col 04 AL = L> Vaccine dose:
 <tb> SubHead Col 05 AL = L> RFFI titer:
 <tb> SubHead Col 06 AL = L> survival rate:
 <tb> <SEP> 7.5 <a> <SEP> 2.3 <b> <SEP> 7/10 <SEP> 6.5 <SEP> 2.5 <SEP> 10/10
 <tb> <SEP> 5.5 <SEP> 1.8 <SEP> 5/10 <SEP> 4.5 <SEP> 1.9 <SEP> 8/10
 <tb> <SEP> 3.5 <SEP> 0.7 <SEP> 0/10 <SEP> 2.5 <SEP> 1.1 <SEP> 1/10
 <tb> <SEP> 1.5 <SEP> 0.6 <SEP> 0/10 <SEP> 0.5 <SEP> 0.4 <SEP> 0/10
 <tb> <SEP> 1 PD50 = 6.17 <SEP> 1 PD50 = 4.18
 <tb>
 a virus titer expressed as log10 TCID50
b RFFI titer, expressed as log10 of the highest serum dilution,

   which results in a reduction of more than 50% in the number of fluorescent wells in an RFFI test.
  
 <tb> </TABLE>


 Example 23
 


 Use of fowlpox promoter elements for the expression of foreign genes
 


 I. Identification of the poultry pox gene encoding a 25.8 kilodalton (kD) gene product
 



  Visibility of protein types present in CEF lysates infected with fowlpox (FP-1) by means of Coomassie brilliant blue staining of SDS-polyacrylamide gels showed an abundant type with an apparent molecular weight of 25.8 kD. This protein was absent in uninfected cell lysates. Pulse experiments using <3> <5> S-methionine for radiolabeling synthesized proteins at certain times after infection again showed the large amount of FP-1-induced protein and showed that it is synthesized 6 to 54 hours after infection. At its peak, this FP-1 25.8 kD protein makes up approximately 5 to 10% of the total protein present in the cell lysate.



  The large amount of 25.8 kD protein induced by FP-1 suggested that the gene encoding this gene product is regulated by a strong FP-1 promoter element. In order to localize this promoter element for subsequent use in the expression of foreign genes in smallpox virus recombinants, a polysome preparation was obtained from CEF cells infected with FP-1 54 hours after infection. RNA from this polysome preparation was isolated and, when used to program a rabbit reticulocyte in vitro translation system, resulted primarily in the production of 25.8.8 kD FP-1 protein.



  The polysome RNA was also used as a template for first strand cDNA synthesis using an oligo (dT) 12-18 as a primer. The first strand of the cDNA was used as a hybridization probe in a Southern blot analysis with FP-1 genomic digests. Results from these hybridization analyzes suggested that the gene coding for the 25.8 kD protein was contained in a 10.5 Kbp Hind III fragment. This Hind III genomic fragment was then isolated and cloned with a commercial vector, pBS (Stratagene, La Jolla, CA.) and the clone was designated pFP23k-1. Further hybridization analyzes using the first strand of the cDNA as a probe against digestion of pFP23k-1 led to the localization of the 25.8 kD gene on a 3.2 Kbp Eco RV sub-fragment.



  This fragment was subcloned into pBS and designated pFP23k-2.



  About 2.4 kbp of this FP-1 Eco RV fragment were sequenced using the Sanger dideoxy chain termination method (Sanger et al., Proc. Natl. Acad. Sci. USA, Vol. 74 [1977], pages 5463-5467). Analysis of the sequence reveals an open reading frame (ORF) that encodes a gene product with a molecular weight of 25.8 kD. In vitro run-off transcription of this ORF by polymerase of bacteriophage T7 (Stratagene, La Jolla, CA.) in a pBS vector generates an RNA type which, when used to program a rabbit reticulocyte in vitro translation system (Promega Biotec, Madison, WI) results in a type of polypeptide with an apparent molecular weight of 25.8 kD. This polypeptide migrates on an SDS-polyacrylamide gel together with the abundant 25.8 kD protein observed in CEFs infected with FP-1.

  These results suggest that it is the coding gene for the rich, 25.8 kD gene product induced by FP-1.


 II. Use of upstream promoter elements of the FP-1 25.8 kD gene for expression of the
 Feline leukemia virus (FeLV) env gene in FP-1 and vaccinia recombinants.
 



  A 270 bp Eco RV / Eco RI fragment (FP25.8K promoter) containing the regulatory region of the FP-1 25.8 kD gene and 21 bp of the coding sequence of the 25.8 kD gene were isolated from pFP23k-2. The following is the nucleotide sequence of the FP 25.8K promoter region that was used to generate pFeLV25.8F1 and pFeLV25.81A. This 270 nucleotide long sequence provides 249 nucleotides of the 5 min region in front of the initiation codon (ATG) for the 25.8 kD gene product and the first 21 bp of the coding sequence.
 
 5 min -GATATCCCCATCTCTCCAGAACAGCAGCATAGTGTTAGGACAATCATCTAATGCAATATCATA
 TATGAATCTCACTCCGATAGGATACTTACCACAGCTATTATACCTTAATGTATGTTCTATATATTTAAAAACAGAAACAAACGGCTATAAGTTTATATGATGTCTATATTATAGTGAGTATATTATAAGTAT GCGGGAATATCTTTGATTTAACAGCGTAGGATTAAATATGATTTAACAGCGTAGGATTCAATAT
 



  This fragment was flattened at the ends and then inserted into an FP-1 insertion vector (pFeLVF1; see Example 15) digested with Sma I and containing FeLV env sequences. This insertion vector allowed recombination with the f7 locus of the FP-1 genome. The insertion of the FP25.8K promoter upstream sequences on the 5 min side of the FeLV env gene and the correct orientation was confirmed by sequence analysis. This insertion does not provide a perfect ATG for the ATG substitution, since the ATG provided by the 25.8 kD gene is not in the reading frame of the FeLV env ATG and therefore no fusion protein is formed. The FP-1 insertion plasmid, which contained the FP25.8 kD promoter above the FeLV env gene, was named pFeLV25.8F1.



  A similar construction was made using the vaccinia virus insertion vector pFeLV1A containing the FeLV gene (see Example 15). The H6 promoter was excised from pFeLV1A by digestion with Bgl II and Sma I. After the Bgl II restriction site was blunted at the end, the 270 bp Eco RV / Eco RI fragment containing the FP25.8K promoter was blended alongside the 5 min end of the FeLV env gene confirmed. This construction was checked by sequence analysis. In this recombinant, too, there is no perfect ATG for ATG substitution, since the ATG and the 25.8 kD gene are not in reading frame with the ATG of the FeLV gene.

   The vaccinia insertion vector (Copenhagen strain) containing the 25.8KD gene upstream region next to the 5 min end of the FeLV gene was designated pFeLV25.81A. The insertion plasmids pFeLV25.8F1 and pFeLV25.81A were used for in vitro recombination with FP-1 (pFeLV25.8F1) and the Copenhagen strain of the vaccinia virus (pFeLV25.81A) as the catching virus. The progeny of the recombination was plated on suitable cell monolayers and recombinant viruses were selected after an immunoassay with protein A linked to beta-galactosidase and a bovine anti-FeLV serum (Antibodies, Inc., Davis, CA.). Preliminary results suggest that the FP25.8K promoter can control the expression of foreign genes in smallpox virus recombinants.


 Example 24
 


 Safety and effectiveness of vFP-6 and vCP-16 in poultry
 



  The two Avipox recombinants vFP-6 and vCP-16 (described in Examples 6 and 13) were used to inoculate 18-day-old chicken embryos, day-old chicks and 28-day-old chicks and the response of the birds was evaluated according to three criteria: 1) Effect of the vaccination on the Hatching, vaccination reactions and mortality 2) the immune response caused by the rabies glycoprotein and 3) the immune response caused by the fowlpox antigens. The experiments were carried out as follows.


 A. Security tests.
 



  Groups of twenty 18 day old embryos were inoculated into the Allantoic Cave with either 3.0 or 4.0 log10 TCI500 from either vFP-6 or vCP-16. After hatching, the chicks were observed for 14 days, after which blood was taken individually and the sera were collected. The two recombinants used to inoculate the chicken embryos had no effect on the egg hatching rate and the chicks remained healthy during the 14-day observation period.



  Groups of ten SPF day-old chicks were vaccinated intramuscularly with 3.0 log10TCID50 of each of the recombinants. The chicks were observed for 28 days and serum samples were collected 14 and 28 days after vaccination. No vaccination reaction was observed at the vaccination site with either recombinant and the chicks remained healthy during the 28 days of the observation period.



  Groups of ten 28-day-old chicks were inoculated with one of the two recombinant viruses, receiving either 3.0 log10 TCID50 intramuscularly or 3.0 log10TCID50 via the skin route (poultry network). The chicks were observed for 28 days and serum samples were collected 14 and 28 days after vaccination. No response to intramuscular vaccination was observed in either recombinant. Vaccination into the skin resulted in a very small vaccination reaction to chickenpox with lesions that were heterogeneous in size. Canarypox vaccination resulted in the formation of a normal lesion on the skin at the vaccination site. All lesions had decreased by the end of the experiment.


 B. Immune response.
 



  The RFFI test described in Example 7 was used to determine the levels of antibody to the rabies glycoprotein. For each group, the results were expressed as the geometrically averaged titer of the individual sera converted to International Units (IU) according to a standard serum containing 23.4 IU. The smallest positive value was set as an IU and used to determine the percentage of positive birds. Antibodies against avipox viruses were tested by an ELISA method using a poultrypox virus strain as an antigen. Each serum sample was diluted 1/20 and 1/80. A standard curve was drawn up using the positive and negative sera. The smallest positive value was calculated by adding the mean of the different values of the negative sera with twice the standard deviation.



  The results of the serological observations are shown in Table XV for vFP-6 and Table XVI for vCP-16.



  Limited antibody formation on both rabies and fowlpox antigens was observed in embryos inoculated with either vFP-6 or vCP-16. The fowlpox vector raised antibodies to both antigens in a larger number of birds than the canarypox vector, but the response was still heterogeneous.



  Day-old chicks inoculated with vFP-6 showed good antibody formation, with all chicks seropositive for rabies and fowlpox antigens 28 days after vaccination. The response to vaccination with vCP-16 was much lower, with 40% of the chicks seropositive for rabies glycoprotein after 28 days and 10% seropositive for avipoxantigens.



  28 day old chicks vaccinated intramuscularly with vFP-6 showed 100% seroconversion to both antigens 14 days after vaccination. Although the majority of chicks also showed seroconversion after inoculation into the skin, the titers achieved were much lower for both rabies and avipox antigens. As before, vCP-16 vaccinated chicks vaccinated both intramuscularly and cutaneously gave a non-uniform response with a maximum of 70% seroconversion to rabies via intramuscular inoculation. The low level of seroconversion for avipoxantigens after vaccination with canarypox could reflect the level of serological relationship between the viruses.



  The results show that both vFP-6 and vCP-16 are safe for vaccinating chickens in a wide range of ages. The chickenpox vector vFP-6 appears to be more efficient in triggering an immune response in chickens. However, the two recombinant avipox viruses, chickenpox and canary pox, were shown to be significantly useful for vaccination in ovum.
 <tb> <TABLE> Columns = 7
 <tb> Title: Table XV
Immune response to chickenpox / rabies glycoprotein (vFP-6) in chickens of various ages
 <tb> Head Col 01 AL = L: Positive groups
 <tb> Head Col 02 AL = L: dose
(TCID50)
 <tb> Head Col 03 AL = L: time after vaccination
(Days)
 <tb> Head Col 04 to 07 AL = L: Antibody
 <tb> SubHead Col 04 to 05 AL = L: rabies glycoprotein
 <tb> SubHead Col 06 to 07 AL = L:

   Chickenpox
 <tb> SubHead Col 04 AL = L> DIAMETER IU Titer:
 <tb> SubHead Col 05 AL = L>% birds / 1IU:
 <tb> SubHead Col 06 AL = L> DIAMETER:
 <tb> SubHead Col 07 AL = L> Elisa OD%:
 <tb> <SEP> embryos <SEP> 10 <3> <SEP> 3 + 14 <SEP> 0.28 <SEP> 15 <SEP> 0.125 <SEP> 54
 <tb> <SEP> 18 days old <SEP> 10 <4> <SEP> 3 + 14 <SEP> 0.87 <SEP> 30 <SEP> 0.129 <SEP> 46
 <tb> <SEP> day-old chick, i.m. <SEP> 10 <3> <SEP> 14
28 <SEP> 1.8
4.2 <SEP> 90
100 <SEP> 0.109
0.234 <SEP> 70
100
 <tb> <SEP> 28 day old chick, i.m.

   <SEP> 10 <3> <SEP> 14
28 <SEP> 3.7
2.7 <SEP> 100
100 <SEP> 0.317
0.378 <SEP> 100
100
 <tb> <SEP> 28 day old chicks,
Puncture <SEP> 10 <3> <SEP> 14
28 <SEP> 1.6
0.54 <SEP> 100
90 <SEP> 0.191
0.161 <SEP> 100
80
 <tb> </TABLE>
 <tb> <TABLE> Columns = 7
 <tb> Title: Table XVI
Immune response to canary pox / rabies glycoprotein (vCP-16) from chickens at various ages
 <tb> Head Col 01 AL = L: Positive groups
 <tb> Head Col 02 AL = L: dose
(TCID50)
 <tb> Head Col 03 AL = L: time after vaccination
(Days)
 <tb> Head Col 04 to 07 AL = L: Antibody
 <tb> SubHead Col 04 to 05 AL = L: rabies glycoprotein
 <tb> SubHead Col 06 to 07 AL = L:

  Canary pox
 <tb> SubHead Col 04 AL = L> DIAMETER IU Titer:
 <tb> SubHead Col 05 AL = L>% birds / 1IU:
 <tb> SubHead Col 06 AL = L> DIAMETER:
 <tb> SubHead Col 07 AL = L> Elisa OD%:
 <tb> <SEP> embryos <SEP> 10 <3> <SEP> 3 + 14 <SEP> 0.14 <SEP> 0 <SEP> 0.068 <SEP> 25
 <tb> <SEP> 18 days old <SEP> 10 <4> <SEP> 3 + 14 <SEP> 0.19 <SEP> 8 <SEP> 0.059 <SEP> 25
 <tb> <SEP> day-old chick, i.m. <SEP> 10 <3> <SEP> 14
28 <SEP> 0.18
0.21 <SEP> 10
40 <SEP> 0.027
0.059 <SEP> 0
10th
 <tb> <SEP> 28 day old chick, i.m. <SEP> 10 <3> <SEP> 14
28 <SEP> 0.61
0.24 <SEP> 70
30th <SEP> 0.093
0.087 <SEP> 60
30th
 <tb> <SEP> 28 day old chicks,
Puncture <SEP> 10 <3> <SEP> 14
28 <SEP> 0.34
0.11 <SEP> 40
10th <SEP> 0.071
0.061 <SEP> 30
10th
 <tb> </TABLE>


 Example 25
 


 Safety and immunogenic effects of vaccination of piglets with vFP-6
 



  Two groups of three piglets were inoculated with the recombinant vFP-6 in one of two ways:
 
   a) three animals received 8.1 log10TCID50 by intramuscular vaccination; and
   b) three animals received the same dose by oral vaccination.
 



  Blood was drawn from all animals at weekly intervals and all animals received a booster dose of the same dose by the same route on day 35. The piglets were observed daily for clinical symptoms. The sera were checked for anti-fowlpox antibody with an ELISA test and a serum neutralization test. Rabies antibodies were determined in an RFFI test.



  All piglets remained in good health and no lesions were observed after vaccination. The temperature curves were normal with no difference between vaccinated and non-vaccinated animals. Both piglets vaccinated via the intramuscular and oral route developed antibody formation on poultry pox antigens as determined by ELISA and serum neutralization. A second answer was evident after the booster shot. (Results not shown). All piglets also developed an immune response to rabies glycoprotein, as determined in an RFFI test, and a refreshing effect was evident in both routes. These results are summarized in Table XVII.



  The results indicate that vaccination with poultry pox / rabies recombinants is harmless to piglets and that the recombinant is able to elicit a significant immune response to rabies glycoprotein after oral or intramuscular vaccination.
 <tb> <TABLE> Columns = 8
 <tb> Title: Table XVII
Antibodies raised against rabies glycoprotein in piglets vaccinated with vFP-6
 <tb> Head Col 01 AL = L: vaccination route
 <tb> Head Col 02 AL = L: Tier No.
 <tb> Head Col 03 to 06 AL = L: rabies antibody after days
 <tb> Head Col 07 to 08 AL = L: (RFFI titer)
 <tb> SubHead Col 03 AL = L> 14:
 <tb> SubHead Col 04 AL = L> 21:
 <tb> SubHead Col 05 AL = L> 28:
 <tb> SubHead Col 06 AL = L> 35 <b>:
 <tb> SubHead Col 07 AL = L> 42:
 <tb> SubHead Col 08 AL = L> 49:
 <tb> <SEP> I.M.

    <SEP> 984 <SEP> 2.4 <a> <SEP> 2.2 <SEP> 2.1 <SEP> 2.2 <SEP> 3 <SEP> 3
 <tb> <SEP> 985 <SEP> 2.5 <SEP> 2.7 <SEP> 2.6 <SEP> 2.4 <SEP> 3 <SEP> 3
 <tb> <SEP> 986 <SEP> 2.2 <SEP> 2.0 <SEP> 2.1 <SEP> 2.3 <SEP> 3 <SEP> 3
 <tb> <SEP> Oral <SEP> 987 <SEP> 3 <SEP> 2 <SEP> 2.1 <SEP> 2 <SEP> 3 <SEP> 3
 <tb> <SEP> 988 <SEP> 2.9 <SEP> 2.4 <SEP> 2.2 <SEP> 2.4 <SEP> 2.7 <SEP> 2.5
 <tb> <SEP> 989 <SEP> 2.8 <SEP> 2 <SEP> 1.7 <SEP> 1.8 <SEP> 2.4 <SEP> 2.5
 <tb>
 a Titer expressed as log10 of the highest serum dilution, which results in a reduction of more than 50% in the number of fluorescent cells in an RFFI test.
b Animals received a second vaccination on day 35.
  
 <tb> </TABLE>

Claims (31)

1. Rekombinantes Virus zur Expression eines Genprodukts in einem Vertebraten, welches Virus eine DNA enthält, die das Genprodukt ohne replikative Vermehrung des Virus in dem Vertebraten codiert und exprimiert.       1. Recombinant virus for expressing a gene product in a vertebrate, which virus contains a DNA which encodes and expresses the gene product without replicative propagation of the virus in the vertebrate. 2. Virus nach Anspruch 1, welches ein Pockenvirus ist. 2. Virus according to claim 1, which is a pox virus. 3. Virus nach Anspruch 2, welches ein Avipoxvirus ist. 3. Virus according to claim 2, which is an avipox virus. 4. Virus nach Anspruch 3, welches ein Geflügelpockenvirus oder ein Kanarienvogelpockenvirus ist. 4. Virus according to claim 3, which is a fowlpox virus or a canary poxvirus. 5. Virus nach Anspruch 1, bei dem das Genprodukt ein Antigen ist. 5. The virus of claim 1, wherein the gene product is an antigen. 6. Virus nach Anspruch 5, bei dem das Antigen eine Immunantwort bei einem Vertebraten auslöst. 6. Virus according to claim 5, wherein the antigen triggers an immune response in a vertebrate. 7. Virus nach Anspruch 5 oder 6, welches ein Pockenvirus ist. 7. Virus according to claim 5 or 6, which is a pox virus. 8. Virus nach Anspruch 7, welches ein Avipoxvirus ist. 8. The virus of claim 7, which is an avipox virus. 9. Virus nach Anspruch 8, welches ein Geflügelpockenvirus oder ein Kanarienvogelpockenvirus ist. 9. Virus according to claim 8, which is a fowlpox virus or a canary poxvirus. 10. 10th Virus nach Anspruch 6, bei dem das Antigen eine Immunantwort auf ein Vertebratenpathogen bei einem Vertebraten auslöst. The virus of claim 6, wherein the antigen elicits an immune response to a vertebrate pathogen in a vertebrate. 11. Virus nach Anspruch 10, welches ein Pockenvirus ist. 11. The virus of claim 10, which is a pox virus. 12. Virus nach Anspruch 11, welches ein Avipoxvirus ist. 12. The virus of claim 11, which is an avipox virus. 13. Virus nach Anspruch 12, welches ein Geflügelpockenvirus oder ein Kanarienvogelpockenvirus ist. 13. Virus according to claim 12, which is a fowlpox virus or a canary poxvirus. 14. Virus nach Anspruch 10, bei dem der Vertebrat ein Säugetier und das Vertebratenpathogen ein Säugetierpathogen ist. 14. The virus of claim 10, wherein the vertebrate is a mammal and the vertebrate pathogen is a mammalian pathogen. 15. Virus nach Anspruch 14, bei dem das Antigen ein Tollwut G-Antigen, gp51,30-Hüllantigen des Rinderleukämievirus, FeLV-Hüllantigen des Katzenleukämievirus oder Glykoprotein D-Antigen des Herpes simplex Virus ist. 15. The virus of claim 14, wherein the antigen is rabies G antigen, gp51,30 envelope antigen from bovine leukemia virus, FeLV envelope antigen from cat leukemia virus or glycoprotein D antigen from herpes simplex virus. 16. Virus nach Anspruch 14 oder 15, bei dem die Säugetiere Hunde, Katzen, Mäuse, Kaninchen, Rinder, Schafe oder Schweine sind. 16. The virus of claim 14 or 15, wherein the mammals are dogs, cats, mice, rabbits, cattle, sheep or pigs. 17. 17th Virus nach Anspruch 1, dadurch gekennzeichnet, dass es ein rekombinantes Avipoxvirus ist, das eine DNA aus einer Nicht-Avipox-Quelle in einem nicht-essentiellen Bereich des Genoms des Avipoxvirus enthält. Virus according to claim 1, characterized in that it is a recombinant avipox virus containing a DNA from a non-avipox source in a non-essential region of the genome of the avipox virus. 18. Virus nach Anspruch 17, das ausserdem einen Nicht-Avipoxpromotor zur Expression der DNA enthält. 18. Virus according to claim 17, which also contains a non-avipox promoter for expression of the DNA. 19. Virus nach Anspruch 18, bei dem der Nicht-Avipoxpromotor ein Vacciniapromotor ist. 19. The virus of claim 18, wherein the non-avipox promoter is a vaccinia promoter. 20. Virus nach Anspruch 19, bei dem der Vacciniapromotor der HH-, 11K- oder Pi-Promotor ist. 20. The virus of claim 19, wherein the vaccinia promoter is the HH, 11K or Pi promoter. 21. Virus nach Anspruch 18, bei dem der Nicht-Avipoxpromotor ein Entomopoxpromotor ist. 21. The virus of claim 18, wherein the non-avipox promoter is an entomopox promoter. 22. Virus nach Anspruch 17, das ausserdem einen Avipoxpromotor zur Expression der DNA enthält. 22. Virus according to claim 17, which also contains an avipox promoter for expressing the DNA. 23. Virus nach Anspruch 17, bei dem die DNA ein Antigen ei nes Säugerpathogens codiert. 23. The virus of claim 17, wherein the DNA encodes an antigen of a mammalian pathogen. 24. 24th Virus nach Anspruch 23, bei dem das Antigen ein Tollwutantigen, Tollwut G-Antigen, gp51,30-Hüllantigen des Rinderleukämievirus, FeLV-Hüllantigen des Katzenleukämievirus oder Glykoprotein D-Antigen des Herpes simplex Virus ist. The virus of claim 23, wherein the antigen is rabies antigen, rabies G antigen, gp51,30 envelope antigen from bovine leukemia virus, FeLV envelope antigen from cat leukemia virus or glycoprotein D antigen from herpes simplex virus. 25. Virus nach Anspruch 17, bei dem die DNA ein Antigen eines Vogelpathogens codiert. 25. The virus of claim 17, wherein the DNA encodes an antigen of a bird pathogen. 26. Virus nach Anspruch 25, bei dem das Antigen ein Vogelinfluenza-Hemagglutininantigen, Fusionsproteinantigen von Newcastle Disease Virus, RAV-1-Hüllantigen des Rous assoziierten Virus, Nucleoproteinantigen des Vogelinfluenzavirus, Matrixantigen des infektiösen Bronchitisvirus oder Peplomerantigen des infektiösen Bronchitisvirus ist. 26. The virus of claim 25, wherein the antigen is an avian influenza hemagglutinin antigen, fusion protein antigen from Newcastle Disease Virus, RAV-1 envelope antigen from Rous associated virus, nucleoprotein antigen from avian influenza virus, matrix antigen from infectious bronchitis virus or peplomer antigen from infectious bronchitis. 27. Virus nach Anspruch 17, welches ein Geflügelpockenvirus ist. 27. The virus of claim 17, which is a fowlpox virus. 28. Virus nach Anspruch 17, welches ein Kanarienvogelpockenvirus ist. 28. The virus of claim 17, which is a canarypox virus. 29. 29. Virus nach Anspruch 1, dadurch gekennzeichnet, dass es ein rekombinantes Pockenvirus ist, das eine DNA aus einer beliebigen Quelle und einen Entomopoxpromotor zur Expression der DNA enthält.  Virus according to claim 1, characterized in that it is a recombinant pox virus containing a DNA from any source and an entomopox promoter for the expression of the DNA. 30. Virus nach Anspruch 29, welches ein Avipoxvirus ist. 30. The virus of claim 29, which is an avipox virus. 31. Virus nach Anspruch 29, welches ein Vacciniavirus ist. 31. The virus of claim 29, which is a vaccinia virus.  
CH1652/89A 1987-08-28 1988-08-24 CH679933A5 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US9071187A 1987-08-28 1987-08-28
US11033587A 1987-10-20 1987-10-20
US18605488A 1988-04-25 1988-04-25
US23439088A 1988-08-23 1988-08-23

Publications (1)

Publication Number Publication Date
CH679933A5 true CH679933A5 (en) 1992-05-15

Family

ID=27492413

Family Applications (2)

Application Number Title Priority Date Filing Date
CH1444/91A CH679934A5 (en) 1987-08-28 1988-08-24
CH1652/89A CH679933A5 (en) 1987-08-28 1988-08-24

Family Applications Before (1)

Application Number Title Priority Date Filing Date
CH1444/91A CH679934A5 (en) 1987-08-28 1988-08-24

Country Status (17)

Country Link
JP (3) JP3348156B2 (en)
KR (1) KR970011149B1 (en)
AR (1) AR241939A1 (en)
AT (1) AT408549B (en)
AU (2) AU2427588A (en)
BE (1) BE1002134A5 (en)
CH (2) CH679934A5 (en)
DE (4) DE10399032I1 (en)
DK (1) DK175904B1 (en)
FR (1) FR2621487B1 (en)
GB (1) GB2217718B (en)
IL (1) IL87581A0 (en)
IT (1) IT1229484B (en)
LU (2) LU90951I2 (en)
NL (4) NL195051C (en)
NZ (1) NZ225970A (en)
WO (1) WO1989003429A1 (en)

Families Citing this family (116)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5338683A (en) * 1981-12-24 1994-08-16 Health Research Incorporated Vaccinia virus containing DNA sequences encoding herpesvirus glycoproteins
US5505941A (en) * 1981-12-24 1996-04-09 Health Research, Inc. Recombinant avipox virus and method to induce an immune response
US7045313B1 (en) 1982-11-30 2006-05-16 The United States Of America As Represented By The Department Of Health And Human Services Recombinant vaccinia virus containing a chimeric gene having foreign DNA flanked by vaccinia regulatory DNA
DE10399032I1 (en) * 1987-08-28 2004-01-29 Health Research Inc Recombinant viruses.
US5286639A (en) * 1987-09-16 1994-02-15 Nippon Zeon Co., Ltd. Recombinant avipoxvirus
DE3813093A1 (en) * 1988-04-19 1989-11-09 Immuno Ag RECOMBINANT PLASMIDE, METHOD FOR PRODUCING A RECOMBINANT AVIPOX VIRUS, RECOMBINANT AVIPOX VIRUS, AND USE THEREOF
US5631154A (en) * 1988-06-10 1997-05-20 Therion Biologics, Incorporated Self assembled, defective, non-self-propagating lentivirus particles
EP0353851B1 (en) * 1988-06-24 1994-01-19 Btg International Limited Fowlpox virus non-essential regions
US5093258A (en) * 1988-08-26 1992-03-03 Therion Biologics Corporation Recombinant fowlpox virus and recombination vector
CA2001001A1 (en) * 1988-10-21 1990-04-21 Matthew M. Binns Fowlpox virus promoter
US6248333B1 (en) 1990-04-04 2001-06-19 Health Research Inc. Isolated nucleic acid sequence of equine herpesvirus type 1 glycoprotein D (EHV-1 gD)
US5204243A (en) * 1990-02-14 1993-04-20 Health Research Incorporated Recombinant poxvirus internal cores
US5514375A (en) * 1990-08-15 1996-05-07 Virogenetics Corporation Flavivirus recombinant poxvirus vaccine
MY109299A (en) * 1990-08-15 1996-12-31 Virogenetics Corp Recombinant pox virus encoding flaviviral structural proteins
FR2668064B1 (en) * 1990-10-23 1994-12-16 Transgene Sa PHARMACEUTICAL COMPOSITION FOR THE TREATMENT OR PREVENTION OF MALIGNANT TUMOR.
US5759841A (en) * 1990-11-20 1998-06-02 Virogenetics Corporation Immunological composition of measles virus utilizing recombinant poxvirus
US6309647B1 (en) 1999-07-15 2001-10-30 Aventis Pasteur Poxvirus—canine dispemper virus (CDV) or measles virus recombinants and compositions and methods employing the recombinants
US5756102A (en) * 1990-11-20 1998-05-26 Virogenetics Corporation Poxvirus-canine distemper virus (CDV) recombinants and compositions and methods employing the recombinants
IE68404B1 (en) * 1990-11-20 1996-06-12 Virogenetics Corp Measles virus recombinant poxvirus vaccine
AU672359B2 (en) * 1991-03-07 1996-10-03 Virogenetics Corporation Genetically engineered vaccine strain
US5503834A (en) * 1990-11-20 1996-04-02 Virogenetics Corporation Measles virus recombinant poxvirus vaccine
US5338679A (en) * 1991-01-08 1994-08-16 Her Majesty The Queen In Right Of Canada, As Represented By National Research Council Canada And Forestry Canada Vertebrate poxvoris expression vector under the control of entomopoxvirus spheroidin gene promoter
US5863542A (en) * 1991-03-07 1999-01-26 Virogenetics Corporation Recombinant attenuated ALVAC canaryopox virus containing heterologous HIV or SIV inserts
US5756101A (en) * 1991-07-01 1998-05-26 Pasteur Merieux Serums Et Vaccins Malaria recombinant poxvirus
US5766598A (en) * 1991-03-07 1998-06-16 Virogenetics Corporation Recombinant attenuated ALVAC canarypoxvirus expression vectors containing heterologous DNA segments encoding lentiviral gene products
US5766597A (en) * 1991-03-07 1998-06-16 Virogenetics Corporation Malaria recombinant poxviruses
EP0575544A4 (en) * 1991-03-20 1997-05-21 Virogenetics Corp Malaria recombinant poxvirus vaccine
ATE241696T1 (en) * 1991-06-14 2003-06-15 Virogenetics Corp RECOMBINANT HIV-SPECIFIC VACCINE FROM POXVIRU
WO1993003145A1 (en) * 1991-07-26 1993-02-18 Virogenetics Corporation Infectious bursal disease virus recombinant poxvirus vaccine
ES2212795T3 (en) * 1991-08-26 2004-08-01 Baxter Healthcare S.A. VIRUSES OF THE VIRUELA DE LAS AVES DE RECOMBINANTE CORRAL.
US5443831A (en) * 1991-10-29 1995-08-22 University Of Delaware Gene encoding glycoprotein B of Infectious Laryngotracheitis Virus
US6328975B1 (en) 1992-01-13 2001-12-11 Syntro Corporation Recombinant swinepox virus
US6033904A (en) * 1992-01-13 2000-03-07 Syntro Corporation Recombinant swinepox virus
US6497882B1 (en) 1992-01-13 2002-12-24 Syntro Corporation Recombinant swinepox virus
US5869312A (en) * 1992-01-13 1999-02-09 Syntro Corporation Recombinant swinepox virus
US6251403B1 (en) 1992-01-13 2001-06-26 Syntro Corporation Recombinant swinepox virus
US6127163A (en) * 1992-01-13 2000-10-03 Syntro Corporation Recombinant swinepox virus
DK0623172T3 (en) * 1992-01-13 2005-04-25 Virogenetics Corp Recombinant Marek's disease virus poxvirus vaccine
EP0662139A1 (en) * 1992-09-21 1995-07-12 Chiron Corporation Recombinant retroviral vector against felv and/or fiv
US6136318A (en) * 1993-02-26 2000-10-24 Cochran; Mark D. Recombinant fowlpox viruses and uses thereof
US5925358A (en) * 1993-02-26 1999-07-20 Syntro Corporation Recombinant fowlpox viruses and uses thereof
AU727278B2 (en) * 1993-02-26 2000-12-07 Syntro Corporation Recombinant fowlpox viruses and uses thereof II
WO1994019015A1 (en) * 1993-02-26 1994-09-01 Syntro Corporation Recombinant fowlpox viruses and uses thereof
US5496731A (en) * 1993-03-25 1996-03-05 Xu; Hong-Ji Broad-spectrum tumor suppressor genes, gene products and methods for tumor suppressor gene therapy
US5843742A (en) * 1994-12-16 1998-12-01 Avigen Incorporated Adeno-associated derived vector systems for gene delivery and integration into target cells
EP0753581A1 (en) 1995-07-10 1997-01-15 Immuno Ag Improved recombinant eukaryotic cytoplasmic viruses, method for their production and their use as vaccines
US5858373A (en) * 1995-12-01 1999-01-12 Virogenetics Corporation Recombinant poxvirus-feline infectious peritionitis virus, compositions thereof and methods for making and using them
CA2261989C (en) 1996-07-25 2008-09-30 Therion Biologics Corporation Recombinant pox virus for immunization against tumor-associated antigens
US6106825A (en) * 1997-05-07 2000-08-22 University Of Florida Entomopoxvirus-vertebrate gene delivery vector and method
AU3910097A (en) * 1997-08-05 1999-03-01 Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The Live recombinant vaccine comprising inefficiently or non-replicating vir us
US6248582B1 (en) * 1997-10-08 2001-06-19 Imran Khan Gene deleted recombinant FeLV proviral DNA for production of vaccines against FeLV
JPH11165762A (en) 1997-12-01 1999-06-22 Lintec Corp Cover tape for carrying chip body and sealing structure
US20020147143A1 (en) 1998-03-18 2002-10-10 Corixa Corporation Compositions and methods for the therapy and diagnosis of lung cancer
US20030235557A1 (en) 1998-09-30 2003-12-25 Corixa Corporation Compositions and methods for WT1 specific immunotherapy
US6221349B1 (en) 1998-10-20 2001-04-24 Avigen, Inc. Adeno-associated vectors for expression of factor VIII by target cells
US6200560B1 (en) 1998-10-20 2001-03-13 Avigen, Inc. Adeno-associated virus vectors for expression of factor VIII by target cells
US7935805B1 (en) 1998-12-31 2011-05-03 Novartis Vaccines & Diagnostics, Inc Polynucleotides encoding antigenic HIV Type C polypeptides, polypeptides and uses thereof
AU2221600A (en) 1998-12-31 2000-07-31 Chiron Corporation Improved expression of hiv polypeptides and production of virus-like particles
EP1194449B1 (en) 1999-06-28 2010-09-22 Oklahoma Medical Research Foundation Inhibitors of memapsin 2 and use thereof
DK1265915T3 (en) 2000-02-23 2011-02-14 Glaxosmithkline Biolog Sa New connections
AR029540A1 (en) 2000-06-28 2003-07-02 Corixa Corp COMPOSITIONS AND METHODS FOR THE DIAGNOSIS AND THERAPY OF CA NCER DE PULMoN
WO2002080982A2 (en) 2001-01-12 2002-10-17 Chiron Corporation Nucleic acid mucosal immunization
JP4037273B2 (en) * 2001-03-08 2008-01-23 インターベツト・インターナシヨナル・ベー・ベー Repolipox based vector vaccine
JP4499311B2 (en) * 2001-04-27 2010-07-07 シャープ株式会社 Broadcast receiving terminal
EP1988097A1 (en) 2001-05-09 2008-11-05 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
US20030198621A1 (en) 2001-07-05 2003-10-23 Megede Jan Zur Polynucleotides encoding antigenic HIV type B and/or type C polypeptides, polypeptides and uses thereof
JP5033303B2 (en) 2001-07-05 2012-09-26 ノバルティス バクシンズ アンド ダイアグノスティックス，インコーポレーテッド Polynucleotides encoding polypeptides with antigenic type C HIV, polypeptides and uses thereof
EP1581119B1 (en) 2001-12-17 2013-01-30 Corixa Corporation Compositions and methods for the therapy and diagnosis of inflammatory bowel disease
CN101863930A (en) 2003-01-06 2010-10-20 科里克萨有限公司 Certain aminoalkyl glucosaminide phosphate compounds and their purposes
US7960522B2 (en) 2003-01-06 2011-06-14 Corixa Corporation Certain aminoalkyl glucosaminide phosphate compounds and their use
US20070073048A1 (en) 2003-05-15 2007-03-29 Ying Lian Hiv polynucleotides and polypeptides derived from botswana mj4
US7261882B2 (en) 2003-06-23 2007-08-28 Reagents Of The University Of Colorado Methods for treating neuropathic pain by administering IL-10 polypeptides
BRPI0515516B1 (en) 2004-09-22 2017-08-08 Glaxosmithkline Biologicals S.A. IMMUNOGENIC COMPOSITION, VACCINE, METHOD OF MANUFACTURING A VACCINE, AND USE OF IMMUNOGENIC COMPOSITION.
WO2007081447A2 (en) 2005-11-22 2007-07-19 Novartis Vaccines And Diagnostics, Inc. Norovirus and sapovirus antigens
CA2636424A1 (en) 2006-01-09 2007-10-25 The Regents Of The University Of California Immunostimulatory combinations of tnfrsf, tlr, nlr, rhr, purinergic receptor, and cytokine receptor agonists for vaccines and tumor immunotherapy
WO2007106560A2 (en) 2006-03-14 2007-09-20 Oregon Health & Science University Methods for detecting a mycobacterium tuberculosis infection
EP2444410A3 (en) 2007-02-28 2012-08-08 The Govt. Of U.S.A. As Represented By The Secretary Of The Department Of Health And Human Services Brachyury polypeptides and methods for use
US9593340B2 (en) 2007-10-15 2017-03-14 Admedus Vaccines Pty Ltd. Expression system for modulating an immune response
US8691502B2 (en) 2008-10-31 2014-04-08 Tremrx, Inc. T-cell vaccination with viral vectors via mechanical epidermal disruption
WO2010078556A1 (en) 2009-01-05 2010-07-08 Epitogenesis Inc. Adjuvant compositions and methods of use
US8664183B2 (en) 2009-02-27 2014-03-04 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services SPANX-B polypeptides and their use
CN102834106A (en) 2009-11-20 2012-12-19 俄勒冈健康科学大学 Methods for producing an immune response to tuberculosis
US20130052221A1 (en) 2010-02-26 2013-02-28 The Govt. of the U.S, as represented by The Sec. of The Dept. of Health and Human Services Dna-protein vaccination protocols
US9795658B2 (en) 2010-04-20 2017-10-24 Admedus Vaccines Pty Ltd Expression system for modulating an immune response
WO2012106281A2 (en) 2011-01-31 2012-08-09 The General Hospital Corporation Multimodal trail molecules and uses in cellular therapies
WO2012151272A2 (en) 2011-05-02 2012-11-08 Tremrx, Inc. T-cell vaccination with viral vectors via mechanical epidermal disruption
MX2013013627A (en) 2011-06-21 2014-04-25 Oncofactor Corp Compositions and methods for the therapy and diagnosis of cancer.
JP6499446B2 (en) 2011-06-24 2019-04-10 エピットジェネシス・インコーポレーテッド Pharmaceutical composition containing a combination of a selective carrier, vitamin, tannin and flavonoid as an antigen-specific immune modulator
WO2013082106A1 (en) 2011-12-02 2013-06-06 The General Hospital Corporation Differentiation into brown adipocytes
WO2014035474A1 (en) 2012-08-30 2014-03-06 The General Hospital Corporation Compositions and methods for treating cancer
US20150224181A1 (en) 2012-09-14 2015-08-13 The United States Of America As Represented By The Secretary Department Of Health And Human Se Brachyury protein, non-poxvirus non-yeast vectors encoding brachyury protein, and their use
WO2014043535A1 (en) 2012-09-14 2014-03-20 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Compositions for the treatment of cancer
EP2986310B1 (en) 2013-04-17 2020-08-05 Genzyme Corporation Compositions for treating and preventing macular degeneration
EP3848045A1 (en) 2013-05-21 2021-07-14 President and Fellows of Harvard College Engineered heme-binding compositions and uses thereof
CA2930693A1 (en) 2013-11-15 2015-05-21 The Board Of Trustees Of The Leland Stanford Junior Unversity Methods of treating heart failure with agonists of hypocretin receptor 2
WO2015120309A1 (en) 2014-02-06 2015-08-13 Genzyme Corporation Compositions and methods for treating and preventing macular degeneration
WO2016044707A1 (en) 2014-09-18 2016-03-24 Cedars-Sinai Medical Center Compositions and methods for treating fibrosis
WO2016154010A1 (en) 2015-03-20 2016-09-29 Makidon Paul Immunogenic compositions for use in vaccination against bordetella
US20180112006A1 (en) 2015-04-17 2018-04-26 The General Hospital Corporation Agents, systems and methods for treating cancer
WO2016172479A1 (en) 2015-04-22 2016-10-27 Cedars-Sinai Medical Center Enterically delivered bitter oligopeptides for the treatment for type 2 diabetes
EP4276106A3 (en) 2015-05-13 2024-01-24 The United States of America as represented by the Secretary of the Department of Health and Human Services Methods and compositions for inducing an immune response using conserved element constructs
WO2016196366A1 (en) 2015-05-29 2016-12-08 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Extension of replicative lifespan in diseases of premature aging using p53 isoforms
EP3313863B1 (en) 2015-06-29 2020-12-23 The Board of Trustees of the Leland Stanford Junior University Degron fusion constructs and methods for controlling protein production
JP7110108B2 (en) 2015-12-09 2022-08-01 ジンガン メディスン（オーストラリア） プロプライアタリー リミティド Therapeutic immunomodulatory compositions
WO2018018082A1 (en) 2016-07-26 2018-02-01 The Australian National University Immunostimulatory compositions and uses therefor
US10917454B1 (en) 2019-08-01 2021-02-09 Rohde & Schwarz Gmbh & Co. Kg System and method for ATC voice quality assurance
EP4419684A1 (en) 2021-10-21 2024-08-28 The J. David Gladstone Institutes, A Testamentary Trust Established under The Will of J. David Gladstone Retroelement-generated transcription factor decoys
WO2023077147A2 (en) 2021-11-01 2023-05-04 Pellis Therapeutics, Inc. T-cell vaccines for patients with reduced humoral immunity
CA3237482A1 (en) 2021-11-03 2023-05-11 The J. David Gladstone Institutes, A Testamentary Trust Established Under The Will Of J. David Gladstone Precise genome editing using retrons
WO2023141602A2 (en) 2022-01-21 2023-07-27 Renagade Therapeutics Management Inc. Engineered retrons and methods of use
WO2023183589A1 (en) 2022-03-25 2023-09-28 The J. David Gladstone Institutes, A Testamentary Trust Established Under The Will Of J. David Gladstone Rt-dna fidelity and retron genome editing
WO2023183627A1 (en) 2022-03-25 2023-09-28 The J. David Gladstone Institutes, A Testamentary Trust Established Under The Will Of J. David Gladstone Production of reverse transcribed dna (rt-dna) using a retron reverse transcriptase from exogenous rna
WO2023183588A1 (en) 2022-03-25 2023-09-28 The J. David Gladstone Institutes, A Testamentary Trust Established Under The Will Of J. David Gladstone Methods of assessing engineered retron activity, and uses thereof
WO2024020346A2 (en) 2022-07-18 2024-01-25 Renagade Therapeutics Management Inc. Gene editing components, systems, and methods of use
WO2024044673A1 (en) 2022-08-24 2024-02-29 The J. David Gladstone Institutes, A Testamentary Trust Established Under The Will Of J. David Gladstone Dual cut retron editors for genomic insertions and deletions
WO2024044723A1 (en) 2022-08-25 2024-02-29 Renagade Therapeutics Management Inc. Engineered retrons and methods of use

Family Cites Families (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK489481A (en) * 1980-11-10 1982-05-11 Searle & Co PLASMID VECTOR AND METHOD OF PRODUCING THEREOF
US4603112A (en) * 1981-12-24 1986-07-29 Health Research, Incorporated Modified vaccinia virus
AU570940B2 (en) * 1982-11-30 1988-03-31 United States of America, as represented by the Secretary, U.S. Department of Commerce, The Process for producing poxvirus recombinants for expression offoreign genes
FR2563434B1 (en) * 1984-04-25 1986-07-25 Transgene Sa Rabies vaccine and process for its preparation
WO1986000528A1 (en) * 1984-07-05 1986-01-30 Genex Corporation Cloned gene and method for making and using the same
DD235669A1 (en) * 1985-03-26 1986-05-14 Akad Wissenschaften Ddr METHOD FOR PRODUCING A BLV-CODED HUEL PROTEIN
EP0218625B1 (en) * 1985-03-29 1995-04-05 Btg International Limited Infectious bronchitis virus spike protein
AU6170486A (en) * 1985-08-23 1987-02-26 Advanced Genetics Research Institute Defective viral vaccines
AU607399B2 (en) * 1985-09-09 1991-03-07 Cetus Corporation Infectious recombinant virus vaccine for feline leukemia
NZ217645A (en) * 1985-09-25 1991-11-26 Oncogen Recombinant viruses expressing lav/htlv-iii related epitopes and vaccine formulations
AU602875B2 (en) * 1985-12-18 1990-11-01 British Technology Group Limited Newcastle disease virus gene clones
WO1988002022A1 (en) * 1986-09-22 1988-03-24 Commonwealth Scientific And Industrial Research Or Recombinant poxviruses
AU8075787A (en) * 1986-09-22 1988-04-07 Australian National University, The Recombinant poxviruses
EP0261940A3 (en) * 1986-09-23 1989-07-05 Applied Biotechnology, Inc. Pseudorabies vaccines and dna vectors for recombination with pox viruses
EP0284416B1 (en) * 1987-03-27 1995-02-22 Nippon Zeon Co., Ltd. Recombinant avipoxyvirus
DE10399032I1 (en) * 1987-08-28 2004-01-29 Health Research Inc Recombinant viruses.
GB8724885D0 (en) * 1987-10-23 1987-11-25 Binns M M Fowlpox virus promotors
FR2632863B2 (en) * 1987-10-29 1990-08-31 Transgene Sa RECOMBINANT FOWLPOX VIRUS AND VACCINES DERIVED FROM SUCH VIRUSES
EP0353851B1 (en) * 1988-06-24 1994-01-19 Btg International Limited Fowlpox virus non-essential regions
WO1990010693A1 (en) * 1989-03-08 1990-09-20 Health Research, Inc. Recombinant poxvirus host selection system
JP3895366B2 (en) * 1990-09-25 2007-03-22 キャンタブ ファーマシューティカルズ リサーチ リミティド Virus vaccine

Also Published As

Publication number Publication date
NL300130I1 (en) 2003-09-01
IT8821772A0 (en) 1988-08-29
AR241939A1 (en) 1993-01-29
JPH02500879A (en) 1990-03-29
DK203689D0 (en) 1989-04-27
NL8820679A (en) 1989-07-03
KR970011149B1 (en) 1997-07-07
NL195051C (en) 2003-07-01
WO1989003429A1 (en) 1989-04-20
GB8908921D0 (en) 1989-08-02
LU91039I2 (en) 2003-11-05
FR2621487B1 (en) 1991-10-18
AU690210B2 (en) 1998-04-23
DE3890874C2 (en) 2003-03-13
NL300138I1 (en) 2004-02-02
KR890701757A (en) 1989-12-21
DE10399032I1 (en) 2004-01-29
GB2217718A (en) 1989-11-01
NZ225970A (en) 1991-01-29
JP3348156B2 (en) 2002-11-20
AU1628895A (en) 1995-08-17
DE10399031I1 (en) 2004-01-29
AT408549B (en) 2001-12-27
JP3826055B2 (en) 2006-09-27
DE10299049I1 (en) 2004-07-01
NL300138I2 (en) 2004-03-01
JP2002348255A (en) 2002-12-04
DK175904B1 (en) 2005-06-06
IL87581A0 (en) 1989-01-31
DE3890874C5 (en) 2005-10-20
ATA900788A (en) 1995-05-15
FR2621487A1 (en) 1989-04-14
LU90951I2 (en) 2003-01-15
JP2002186494A (en) 2002-07-02
IT1229484B (en) 1991-09-03
NL300130I2 (en) 2005-11-01
GB2217718B (en) 1992-05-20
CH679934A5 (en) 1992-05-15
AU2427588A (en) 1989-05-02
BE1002134A5 (en) 1990-07-24
NL300139I1 (en) 2004-02-02
DK203689A (en) 1989-06-27

Similar Documents

Publication Publication Date Title
AT408549B (en) VIRUS-CONTAINING VACCINE, RECOMBINANT VIRUS AND METHOD FOR EXPRESSING A GENE PRODUCT
US5174993A (en) Recombinant avipox virus and immunological use thereof
US5505941A (en) Recombinant avipox virus and method to induce an immune response
DE4090565C2 (en) Recombinant herpesvirus poxvirus vaccine
AT400955B (en) RECOMBINANT SMALL VIRUS HOST SELECTION SYSTEM
DE69532068T2 (en) Recombinant live bird vaccine using a turkey herpes virus vector
DE69535359T2 (en) RECOMBINANT HERPESVIRUS FROM TAILS AND ITS USES
DE3850019T2 (en) Recombinant avipox virus.
DE69533305T2 (en) Live recombinant bird vaccine based on a bird herpes virus, against Gumborok disease
DE68920610T2 (en) Recombinant Marek&#39;s disease and vaccine virus.
DE69735594T2 (en) RECOMBINANT PORK VIRUS
DE4192786B4 (en) Measles virus recombinant poxvirus vaccine
DE69627526T2 (en) RECOMBINANT POX VIRUS OF THE INFECTIOUS PERITONITIS OF THE CAT, ITS COMPOSITIONS AND METHODS FOR THE PRODUCTION AND USE
DE69435081T2 (en) RECOMBINANT ADENOVIRUS VECTOR FOR POULTRY
DE3752182T2 (en) WEAKENED HERPESVIRUS, HERPESVIREN, CONTAINING A FOREIGN DNA ENCODING AMINO ACID SEQUENCES, AND VACCINATES THAT CONTAIN THEM
Smith et al. Development and trial of a bovine herpesvirus 1‐thymidine kinase deletion virus as a vaccine
WO2007115385A2 (en) Transfer plasmidic vector and recombinant canarypox virus
AU761321B2 (en) Recombinant viruses, vaccines containing them and in vitro cell cultures thereof
DK175980B1 (en) Antigen expression in vertebrates using recombinant virus - contg. specific DNA and incapable of replication, esp. avipox, useful as safe, live vaccines
CA1341403C (en) Recombinant a vipox virus
AU725985B2 (en) Recombinant virus
CA2084064A1 (en) Recombinant pigeon pox virus vaccine
DK176068B1 (en) Antigen expression in vertebrates using recombinant virus - contg. specific DNA and incapable of replication, esp. avipox, useful as safe, live vaccines
DK176165B1 (en) Antigen expression in vertebrates using recombinant virus - contg. specific DNA and incapable of replication, esp. avipox, useful as safe, live vaccines
DD297997A5 (en) PROTEINS, VACCINE AND NUCLEIC ACIDS

Legal Events

Date Code Title Description
SPCF Supplementary protection certificate filed

Free format text: PRODUCT NAME: VIRUS CANARYPOX VCP NR. 1529 UND 1533; REGISTRATION NUMBER/DATE: IVI 1674 01.03.2007

Filing date: 20070822

PL Patent ceased
SPCG Supplementary protection certificate granted

Free format text: PRODUCT NAME: VIRUS CANARYPOX VCP1529 INFLUENZA A/EQUI-2/KENTUCKY/94 (H3N8) UND VIRUS CANARYPOX VCP1533 INFLUENZA A/EQUI-2/NEWMARKET/2/93 (H3N8); REGISTRATION NUMBER/DATE: IVI 1674 01.03.2007

Spc suppl protection certif: C679933/01

Filing date: 20070822

Extension date: 20130823

SPCL Supplementary protection certificate deletion

Spc suppl protection certif: C679933/01