JP2002348255A - Immunization method by use of recombinant avipoxvirus - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a vaccine used for non-aves-vertebrate without having defects shown by virus live vaccine or virus sterilized vaccine. SOLUTION: The method is made by inducing immune response to pathogenic bodies, such as hydrophobia, feline leukemia, bovine leukemia, herpesvirus in the vertebrata animals by inoculating to vertebrate animals (except birds and mammals), synthetic recombinant Avipoxvirus which is modified with existence of optionally originated DNA which is coding and manifesting antigen of pathogenic body in non-essential region of Avipoxvirus.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001] This application is a CIP application of US Patent Application No. 186,054, filed April 25, 1988, which is further incorporated by reference into US Patent Application No. 110,335, filed October 20, 1987. CIP application, which is also a US Patent Application No. 0, filed August 28, 1987.
No. 90,711 CIP application.

[0002] The present invention relates to a method for inducing an immune response in vertebrates, including non-avian vertebrates, using synthetic recombinant avipoxviruses. More specifically,
The present invention relates to immunological response to vertebrate pathogens in vertebrates, particularly mammals, by inoculating the vertebrates with a synthetic recombinant avipoxvirus containing DNA encoding and expressing the determinants of the vertebrate pathogen. And vaccines comprising such modified avipoxviruses. The invention further relates to modified avipoxviruses, methods for their production and use, DNA sequences produced or involved in the production of modified avipoxviruses, and methods for producing such sequences.

A background of the invention avipox, namely avipox virus is a genus of the poxvirus and closely related to the infection in poultry. The avipox genus includes fowl pox, canary pox, junco pox, pigeon pox (p
egon pox), quail pox (quail)
pox), sparrow pox
x), sterling pox
x), and turkey pox
Seeds included. Fowlpox species infect chickens and should not be confused with a human disease called chickenpox. The avipox genus has many features in common with other poxviruses and belongs to the same subfamily as avipox as a poxvirus that uses vertebrates as hosts. Poxviruses, including vaccinia and avipox, replicate in eukaryotic cells of the host. These viruses are characterized by their large size, complexity, and replication at sites in the cytoplasm. However, vaccinia and avipox are different genera, and the International Committee on Virus Classification (International Committee)
e on Taxonomy of Viruses)
4th Report, Intervirology 17
Vol. 42-44 (1982), each differs in molecular weight, antigenic determinant, and host species.

[0004] Avipoxviruses do not multiply infect non-avian vertebrates, such as mammals, including humans. Furthermore, avipox does not grow when inoculated into cultured cells of mammals (including humans). In cultured mammalian cells inoculated with avipox, cells die due to cytotoxic effects,
There is no evidence of a productive transmission of the virus.

[0005] When a non-avian vertebrate such as a mammal is inoculated with live avipox, a lesion similar to that inoculated with vaccinia is formed in the inoculated portion. However, no productive infection of the virus occurs. Nevertheless, it has now been found that mammals inoculated in this way respond immunologically to the avipoxvirus. This is an unexpected result.

[0006] Vaccines consisting of killed pathogens or purified antigenic components of such pathogens must be injected in larger amounts than live virus vaccines to elicit an effective immune response. This is because live virus inoculation is a much more efficient vaccination method. Even relatively small inoculations can elicit an effective immune response because the antigen in question is amplified during viral replication. From a medical perspective, live virus vaccines are more effective than inoculating killed pathogens or purified antigen vaccines,
Moreover, it provides longer lasting immunity. Therefore,
Vaccines consisting of killed pathogens or purified antigenic components of such pathogens require the production of larger quantities of vaccine material than for live viruses.

As is clear from what has already been described,
The use of live virus vaccines has medical and economic benefits. One of such live vaccines is a vaccine consisting of vaccinia virus. This virus is known in the prior art to be one of the viruses useful for inserting DNA representing the gene sequence of an antigen of a mammalian pathogen using recombinant DNA techniques.

Accordingly, DNA of any origin (eg, virus, prokaryote, eukaryote, synthetic) containing DNA sequences encoding antigenic determinants of a pathogenic organism is inserted into a non-essential region of the vaccinia genome. Thereby, methods by which recombinant vaccinia virus can be produced have been developed in the prior art. Certain recombinant vaccinia viruses produced by these methods have been used to elicit specific immunity in mammals against various mammalian pathogens. All of these are described in U.S. Pat.
No. 3,112, which is incorporated herein by reference.

[0009] Unmodified vaccinia virus has a long history of being used as a relatively safe and effective vaccine for smallpox vaccination. However, prior to eradication of smallpox, when unmodified vaccinia virus was widely administered, there was a modest risk of actual complications in the form of a systemic vaccinia infection, especially eczema or immune Risk was associated with those suffering from suppression. A rare complication of vaccinia vaccination is, rarely, post-vaccination encephalitis. Most of these reactions are due to skin diseases such as eczema, or immune system deficiency,
Or due to vaccination of those whose family members had eczema or immune dysfunction. Vaccinia is a live virus and is usually harmless to healthy individuals. But,
It is transmitted between individuals for several weeks after inoculation. Serious consequences can occur if a person with a compromised normal immune response is infected by inoculation or by contagious transmission from a recently vaccinated person.

[0010] Thus, it can be seen that a method which alleviates or eliminates the above-mentioned problems while having the advantages of live virus inoculation in the art has desirable advantages over the state of the art. This is extremely important now that a disease known as acquired immunodeficiency syndrome (AIDS) has developed. The victim of the disease has significant immunodeficiency and is transmitted by direct contact with a live virus that is safe for others, or by contact with a person recently vaccinated with a live virus preparation. Easily injured by such virus preparations.

OBJECTS OF THE INVENTION It is an object of the present invention to provide a vaccine capable of immunizing vertebrates against pathogenic organisms, while having the advantages of live virus vaccines, in particular for immunizing non-avian vertebrates. It is to provide a vaccine which, when used, has little or no disadvantages of live viral vaccines as already listed, or of dead viral vaccines.

Another object of the present invention is to provide a synthetic recombinant avipoxvirus used for such a vaccine.

[0013] The present invention further relates to a synthetic set of birds and non-avian vertebrates which, in the case of non-avian vertebrates, such as mammals, cannot reproduce multiply with the production of the infected virus in the animal. It is an object of the present invention to provide a method for inducing an immune response by inoculating a vertebrate with a recombinant avipoxvirus. When inoculated into non-avian vertebrates, such as mammals, such viruses self-limiting and reduce the likelihood of spreading to non-vaccinated hosts.

The present invention further provides a method of eliciting an immune response to an antigen in a vertebrate, comprising the step of providing a vaccine containing a synthetic recombinant avipoxvirus containing and expressing an antigenic determinant of a pathogen to the vertebrate. It is an object to provide a method comprising inoculating a bacterium.

Also, by inoculating a vertebrate with a recombinant virus which encodes the gene product and contains DNA which expresses the gene product without the product replicating in the vertebrate, It is also an object of the present invention to provide a method for expressing a gene product.

Furthermore, by inoculating a vertebrate with a recombinant virus containing DNA encoding the antigen and expressing the antigen without the virus replicatively replicating in the vertebrate, an immune response to the antigen is vertebrate inoculated. It is also an object of the present invention to provide a method for inducing an animal.

DESCRIPTION OF THE INVENTION One embodiment of the present invention provides a synthetic recombinant avipox virus modified by the presence of DNA of any origin that encodes and expresses the antigen of the pathogen in a non-essential region of the avipox genome. The present invention relates to a method of inducing an immune response against said pathogen in a vertebrate by inoculating the vertebrate.

In another embodiment, the present invention provides for the expression of a gene product in a vertebrate using a recombinant virus that does not replicate productively in a vertebrate cell but expresses the gene product or antigen in such a cell. Or inducing a vertebrate to elicit an immune response to the antigen.

In another embodiment, the present invention relates to a synthetic avipoxvirus modified by inserting DNA of any origin, especially non-avipox origin, into a non-essential region of the avipox genome.

An artificially modified avipoxvirus recombinant having a foreign (ie, non-avipox) gene encoding and expressing an antigen can elicit the development of a vertebrate host immune response to said antigen, resulting in a foreign While eliciting the development of an immune response to the pathogen, such recombinants inoculate in the present invention the disadvantages of conventional vaccines using dead or attenuated living organisms, especially to non-avian vertebrates. Used to create new vaccines without them.

It should also be mentioned here that avipoxviruses can only be reproduced and replicated in birds or avian cell lines only.
Recombinant avipox virus from avian host cells, when inoculated into non-avian vertebrates such as mammals in a manner similar to inoculation of mammals with vaccinia virus, causes lesions upon inoculation, but productive replication of avipox virus Does not happen. Although avipoxviruses do not replicate productively in such inoculated non-avian vertebrates, the expression of the virus occurs well, and the inoculated animals are infected with this recombinant avipoxvirus. It responds immunologically to antigenic determinants and to antigenic determinants encoded by foreign genes of the virus.

Upon inoculation in birds, such a synthetic recombinant avipoxvirus not only elicits an immune response against the antigen encoded by foreign DNA of any origin present therein, but also reproduces the virus in the host. Causes replication to provoke the expected immunological response to the avipox vector itself.

Several researchers have proposed to produce recombinant foulpox, specifically a virus for use as an animal vaccine to protect poultry. Boyle and Coupa
r), J. et al. Gen. Virol. 67 , 1591
-1600 (1986) and Binns et al.
Isr. J. Vet. Med. 42 , 124-1
27 (1986). There has been no suggestion or use of a recombinant avipoxvirus as a method of inducing specific immunity in mammals.

Stickl and Meyer
(Mayer) in Fortschr. Med.97
(40) In 1781-1788 (1979), Abipo
Fowlpox virus in humans
An injection is described. However, these studies
Non-specificity in patients with sequelae of cancer chemotherapy
Use normal foulpox to enhance heterosexual immunity
It is only about using No recombinant DNA technology
Not used. Encodes vertebrate pathogen antigens
Inserting DNA into avipox can also affect spinal motion.
There is no suggestion about how to induce specific immunity in
Not. Instead, this prior art is a general
Based on targeted and non-specific tonic effects.

A more thorough study based on genetic recombination will help to understand how the modified recombinant viruses of the present invention are made.

Gene recombination generally involves exchanging the homologous portion of deoxyribonucleic acid (DNA) between two DNA helices. (In some viruses, ribonucleic acid (RN
A) can replace DNA. ) The homologous portion of a nucleic acid is a nucleic acid having the same nucleotide base sequence (R
NA or DNA).

Genetic recombination may occur spontaneously during the replication or production of a novel viral genome in infected host cells. Thus, genetic recombination between viral genes can also occur during a viral replication cycle that occurs in a host cell simultaneously infected with two or more different viruses or other genetic constructs. The DNA portion of the first genome is used interchangeably in assembling a co-infected second viral genome portion having DNA homologous to the first viral genomic DNA.

However, recombination can also occur between portions of DNA in different genomes that are not completely homologous. For example, such a portion may be derived from a first genome homologous to a portion of the genome, except that a gene encoding a genetic marker or antigenic determinant has been inserted into a homologous DNA portion within the first genome. In any case, recombination can occur and the products of the recombination can be detected by the presence of the genetic marker or antigenic determinant.

In order for the inserted DNA gene sequence to be successfully expressed by the modified infectious virus, two conditions are required.

First of all, in order for the modified virus to remain viable, the insertion must be in a non-essential region of said virus. Neither foulpox nor avipoxviruses have previously been suggested to have regions similar to the non-essential regions described for vaccinia virus. Thus, non-essential regions of the foulpox of the present invention were discovered by cutting the foulpox genome into fragments, separating the fragments by size and inserting them into a plasmid construct to amplify these fragments (plasmid Is a small cyclic DN found as an extrachromosomal element in many bacteria, including E. coli.
A molecule. Methods for inserting a DNA sequence, such as an antigenic determinant gene or other genetic marker, into a plasmid include:
Well known in the art, Maniatis
Et al., Molecular Cloning : A Lab
laboratory Manual , Cold Spring Harbor Laboratory (Cold Spring Harbor Laboratory)
Harbor Laboratory) New York [1982]). Next, the gene encoding the genetic marker and / or the antigen was inserted into the cloned foulpox fragment. Certain successfully recombined fragments can be demonstrated by good recovery of genetic markers or antigens, such fragments being those comprising DNA inserted into non-essential regions of the foulpox genome.

[0031] The second condition for the expression of the inserted DNA is the presence of a promoter that is appropriately associated with the inserted DNA. The promoter must be located upstream of the DNA sequence to be expressed. Because the properties of avipoxviruses have not been fully elucidated, and the avipox promoter has not been previously identified in the art, some of the present invention provides DNA encoding a known promoter of another poxvirus. Insert effectively upstream. Foulpox promoters have also been successfully used to practice the methods of the invention and to make the products of the invention. According to the present invention, it has been found that the foulpox promoter, vaccinia promoter and entmopox promoter promote transcription of recombinant poxvirus.

Boyle and Cou
par) is described in Gen. Viro1. 67 , 15
91 (1986), published a speculation that the vaccinia promoter is "predicted to act on the (foulpox) virus." The authors located and cloned the Fowlpox TK gene (Boile et al., Virology 156 , 355).
-365 [1987]) and inserted into vaccinia virus. The TK gene was expressed, presumably because of the recognition of the foulpox TK promoter sequence by the function of vaccinia polymerase. But, despite their speculation,
The authors did not insert the vaccinia promoter into the foulpox virus and did not observe the expression of foreign DNA sequences in the foulpox genome. It was not known before the present invention that promoters from other poxviruses, such as the vaccinia promoter, actually promote gene transcription in the avipox genome.

A preferred embodiment of the described fowlpox and canary pox virus, was used particularly preferred avipox species to be modified by the incorporation recombinant foreign DNA of the present invention.

Fowlpox is a type of avipox that infects chickens in particular, but does not infect mammals. The foulpox strain, referred to herein as FP-5, was obtained from American Scientific Labs (American Scientific La.).
Boratories) (Schering (Scher)
ing Corp. ), Madison
ison), Wyoming, USA Veterinary License Number 16
5, a commercial fowlpox virus vaccine strain derived from chicken embryo, available from serial number 30321.

The foulpox strain, referred to herein as FP-1, is a modified Duvette strain for use in the vaccine of 1 day old chickens.
This strain is a commercially available foulpox virus vaccine strain called ODCEP25 / CEP67 / 2309 Oktober 1980, and is available from the Institute Maryx, Inc.
c. ).

[0036] Canary pox is a species of avipox. Like fowlpox, canarypox specifically infects canary but does not infect mammals. The Canarypox strain, referred to herein as CP, is a commercially available Canarypox vaccine strain, referred to as LF2 CEP524 241075, available from the Institute Merix.

The DNA gene sequences inserted into these Apipoxviruses by the genetic recombination of the present invention include the LacZ gene derived from prokaryotes, the rabies glycoprotein which is one of the antigens of non-avian (particularly mammalian) pathogens.
(G) gene, Turkey influenza hemagglutinin gene which is an antigen of a pathogenic avian virus other than avipox virus, gp51,30 envelope gene of bovine leukemia virus which is one of mammalian viruses, and Newcastle which is one of avian viruses Fusion protein gene of the disease virus (Texas strain), FeLV envelope gene of feline leukemia virus which is a mammalian virus, RAV-1 env gene of Rouss-associated virus which is avian virus / poultry disease, chicken / chicken which is avian virus Pennsylvania (Cicken / Pen
nsylvania) / 1/83 influenza virus nucleoprotein (NP) gene, avian virus infectious bronchitis virus (Mass 41 strain) matrix gene and peplomer gene, mammalian virus herpes simplex virus glycoprotein D gene ( gD).

The isolation of the Lac Z gene was carried out by Casadaban et al. In Methods ins.
Enzymology 100 , 293-308 (19
83). The structure of the rabies G gene is described, for example, in Anilionis et al., Natu.
re 294 , 275-278 (1981).

Integration into vaccinia and expression in this vector is described in Kiney et al., Nature.
312 , 163-166 (1984). The Turkish influenza hemagglutinin gene was obtained from Kawaoka et al., Virology.
158 , 218-227 (1987). Bovine leukemia virus gp51,30 env
The gene was obtained from Rice et al., Virology.
138 , 82-93 (1984). The fusion gene of Newcastle disease virus (Texas strain)
The institution as plasmid pNDV108
Available from Merix. The feline leukemia virus env gene is derived from Guilhot et al.
irology 161 , 252-258 (1987)
It is described in. Louth-associated virus type 1 has two clones, pen VRVIPT and mp19env (19
0) is available from the Institute Merricks. The chicken influenza NP gene was designated as plasmid pNP33 by St. Jude Children's Research Hospital.
arch Hospita 1) from Yoshihiro Kawakawa. An infectious bronchitis virus cDNA clone of the IBV Mass41 matrix gene and the peplomer gene is available from the Institute Merix as plasmid pIBVM63. The herpes simplex virus gD gene has been described by Watson et al., Science 218 , 381-384 (1982).
It is described in.

The recombinant avipoxvirus described in more detail below incorporates one of the three vaccinia promoters. The Pi promoter from the vaccinia Ava I H region is waxman (Wachsm
an) et al. of Inf. Dis. 155 ,
1188-1197 (1987). More specifically, this promoter is derived from the Ava IH (Xho IG) fragment of the L mutant WR vaccinia strain,
In this, the promoter directs transcription from right to left. The position of this promoter on the map is Ava I
1.3 Kbp (kilobase pair) from the left end of H,
It is approximately 12.5 Kbp from the left end of the vaccinia genome, about 8.5 Kbp at the Hind III C / N junction. The sequence of this promoter is

Embedded image And the symbol in parentheses in the above sequence is a linker sequence.

The Hind III H promoter (also referred to herein as "HH" and "H6") was revealed by standard transcription mapping techniques. It has the following sequence:

[0042]

Embedded image This sequence is described in Rosel et al. Vir
o1. 60, 436-449 (1986) as the sequence described upstream of the reading frame.

The 11K promoter is Witec (Wi
ttek), J.A. Virol. 49 , 371-378
(1984) and Vertholet,
C) et al., Proc. Natl. Acad. Sc
i. USA 82, 2096-2100 (1985).

The recombinant avipoxviruses of the present invention can be prepared in two steps in a manner similar to that disclosed in the aforementioned US Pat. No. 4,603,112 for making recombinant avipoxvirus recombinants known in the art. Produced.

First, the DNA gene sequence to be inserted into the virus is inserted into an E. coli plasmid construct into which DNA homologous to a nonessential region of the avipox virus has been inserted. Separately, the DNA gene sequence to be inserted is linked to a promoter. The promoter-gene conjugate is then placed in a plasmid construct and flanked on both ends by DNA homologous to non-essential regions of avipox DNA. The resulting plasmid construct is propagated in E. coli and amplified. (Plasmid DNA is used to carry and amplify foreign genetic material, and this method is well known in the art. For example, for these plasmid technologies, Clewell et al., J. Bac.
terol. 110, 667-676 (1972). Techniques for isolating amplification plasmids from host E. coli are also well known in the art, and are described, for example, in Klewell et al., Proc. Natl. Acad. Sc
i. USA 62, 1159-1166 (1969). )

The amplified plasmid material isolated after growth in E. coli is then used in a second step. That is, the DNA to be inserted
The plasmid containing the gene sequence is transfected together with an avipox virus (such as Fowlpox strains FP-1 or FP-5) into cultured cells such as, for example, chicken embryo fibroblasts (CEF). Recombination between the homologous foulpox DNA in the plasmid and the viral genome results in an avipoxvirus that has been modified by the presence of non-foulpox DNA sequences in a non-essential region of this genome.

The invention and many of its advantages will be better understood with the following illustrative examples.

Example 1 Foulpox RNA Transcription Factor
Transients suggest vaccinia promoter recognition by offspring
Bound to prepare several plasmid structure containing the hepatitis B virus surface antigen (HBsAg) encoding sequence in the assay vaccinia virus promoter sequences of expression. 50 μg of each plasmid was transfected into CEF cells infected with 10 pfu per cell of fowlpox virus or vaccinia virus. Infection 2
The mixture was allowed to proceed for 4 hours, and then thawed and thawed three times continuously for thawing.

The amount of HBsAg in this lysate was determined by Abbott Laboratories (Abbott Laboratory).
ies) Diagnostic Department (Diagnostic Div)
AUSRI (AUSRI)
A) Evaluation was performed using the II- ^125I kit. HBsAg
Is shown as the ratio of the net count (sample value minus background value) of the unknown sample to the negative cutoff value preset by the manufacturer. This is shown as the P / N (positive / negative) ratio. The results are shown in Table I.

Three different vaccinia promoter sequences,
That is, the Pi promoter found at the early stage of vaccinia infection before DNA replication, the 11K promoter found at the late stage of vaccinia infection after the initiation of DNA replication, and the Hind III H (H
H) promoter. These promoters have already been described herein.

The above data suggest that HBsAg produced in the lysate of infected cells is the result of recognition of the vaccinia promoter by fowlpox or vaccinia transcription factors.

[0052]

[Table 1]

Example 2 LAC Z Gene-Containing Recombinant File
Preparation of Owlpoxvirus vFP-1 A fragment within the nonessential region of Fowlpoxvirus was identified and isolated as follows.

Using nuclease Bal31, FP-
The hairpin loop at the single-stranded end of 5 DNA was removed. D
Blunt ends were generated using the Klenow (large) fragment of NA polymerase. After removing the loop, Bgl
The fragment was prepared by restriction enzyme digestion with II. This digestion produced a series of FP-5 fragments, which were separated by agarose gel electrophoresis.

A fragment containing the 8.8 Kbp Bgl II blunt end was isolated and ligated with the commercially available plasmid pUC9 which had been cut with Bam HI and Sma I. The resulting plasmid was named pRW698.

To reduce the size of the foulpox fragment, this plasmid was cut with HindIII to generate two more fragments. The 6.7 Kbp fragment was discarded, and the other 4.7 Kbp fragment was ligated to prepare a new plasmid pRW699.

To incorporate the LacZ gene whose transcription is promoted by the 11K promoter into this plasmid, pRW
699 was cut with EcoRV. This EcoRV cuts the plasmid at only one place. This insertion site was named F3. L promoted by this 11K promoter
ac Z segment is blunt-end Pst IB
am HI fragment and the new plasmid pRW7
02 was produced. This Lac Z clone is derived from pMC1871 as described by Casadaban et al. In the cited reference. The 11K promoter is linked to Lac Z by a Bam HI linker.
Linked to the 8th codon of the gene.

Using the recombinant technique for vaccinia described in US Pat. No. 4,603,112, this pRW702
The plasmid was then recombined into fowlpox virus FP-5 grown on chicken embryo fibroblasts (CEF). At this time, the following operation was used to produce vFP-1. 50 μg of pRW702 DNA was mixed with 0.5 μg of whole genome foulpox DNA, and the final volume was 10 μg.
0 μl was used. 10 μl of 2.5MCaCl ₂ and 4
0 mM Hepes, 300 mM NaCl, 1.4 m
2 × HEBS buffer (pH 7) prepared from M Na ₂ HPO ₄ , 10 mM KCl, 12 mM dextrose
110 μl was added to this. After 30 minutes at room temperature, 200 μl of Fowlpox virus pool diluted to 5 pfu / cell was added. This mixture was then inoculated onto a 60 mm dish containing the primary CEF monolayer. At this time, 0.7 ml of Eagle's medium containing 2% fetal bovine serum (FBS) was also added. After incubating the plate at 37 ° C. for 2 hours, 3 ml of Eagle's medium containing 2% FBS was added and the plate was incubated for 3 days. After the cells were lysed by three consecutive freeze-thaw cycles, the neoplastic virus particles were assayed in the presence of the recombinant.

La promoted by 11K promoter
Evidence of successful insertion due to recombination of the cZ gene into the foulpox FP-5 genome was found in La
Obtained by testing the expression of the cZ gene. L
The ac Z gene encodes the enzyme β-galactosidase, which is a chromogen, 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-ga
1) is cleaved to release the blue indolyl derivative. Blue plaque was selected as a positive recombinant.

The successful insertion of Lac Z into the foulpox FP-5 genome and its successful expression was determined by vFP-1 infected CE.
F, BSC (monkey kidney cell line-ATCC CCL26),
VERO (monkey kidney cell line-ATCC CCL 81),
And MRC-5 (human diploid lung cell line-ATCC CC)
L 171) and β-reaction with commercially available antiserum.
It was also confirmed by immunoprecipitation of galactosidase.

Expression of β-galactosidase by the recombinant virus vFP-1 was further determined by inoculating rabbits and mice with the virus and inoculating animal titers of antibodies raised against β-galactosidase protein in the sera of the inoculated animals. Was also confirmed in vivo by measuring its rise and its goodness.

In particular, the recombinant vFP-1 was purified from infected host cells and injected intradermally at two sites on each side of two rabbits. Each rabbit was inoculated with a total of 10 ⁸ pfu.

Animals were bled every other week, and the serum was detected by an ELISA assay using a commercially available purified β-galactosidase preparation as an antigen.

It was detected by ELISA that both rabbits and mice inoculated with the recombinant vFP-1 produced an immune response to the β-galactosidase protein. This response was detectable in both species one week after inoculation.

Example 3 Fowlpox virus FP
-5 containing rabies G gene and LACZ
Construction of Irus vFP-2 A 0.9 Kbp Pvu II fragment was obtained from FP-5 and inserted between the two Pvu II sites of pUC9 by standard techniques. The resulting structure pRW688.2 is Hinc II
Pvu II at two sites, approximately 30 bp apart
Asymmetrically within the fragment, thereby forming a long arm and a short arm from the fragment.

The oligonucleotide adapter was replaced with Pst
Plasmid pRW694 was created by inserting between these HincII sites using known techniques for introducing I and BamHI sites. These insertion sites were designated as F1.

Next, this plasmid was replaced with Pst I and Ba
The plasmid was cut with mHI, and the LacZ gene having the ligated 11K vaccinia promoter described above was inserted to prepare a new plasmid pRW700.

To create the rabies G gene transcriptionally promoted by the Pi promoter, a BglII site adjacent to the 5 'end of the rabies G gene (Kieny et al.
The above cited reference) was blunt-ended and ligated to the previously described Eco RI site that buried the single-stranded portion of the Pi promoter.

This construct was inserted into the PstI site of pRW700, into which the foreign gene sequence Pi-rabies Gl was inserted.
The pRW735.1 plasmid with 1K-LacZ was made. This insertion is compatible with the Pvu of the FP-5 donor sequence.
The II-Hinc II long arm is positioned in the plasmid such that it is 3 'to the Lac Z gene.

The resulting final construct was recombined with fowlpox virus FP-5 by infecting / transfecting chick embryo fibroblasts by the recombinant fowlpox virus vFP-2 production method described above. This recombinant virus was selected by X-gal staining.

It was confirmed by the following various additional methods that both the Lac Z gene and the rabies G gene were properly inserted and expressed.

Determination of the location of the rabies antigen by immunofluorescence using a specific antibody indicated that the rabies virus was well expressed on the surface of avian or non-avian cells infected with the vFP-2 virus. .

As already mentioned, rabies antigen and β-antibodies by avian or non-avian cells infected with the vFP-2 virus.
Galactosidase expression was confirmed by immunoprecipitation.

Another evidence that the vFP-2 embodiment of the present invention is a successful example of a recombinant virus carrying the rabies G gene and the β-galactosidase gene is that two rabbits were inoculated with the vFP-2 virus. It was obtained by doing. 1 for 2 rabbits
× 10 ⁸ pfu of vFP-2 was inoculated intradermally. Blood is collected from rabbits every other week and serum is tested by ELISA,
The presence of specific antibodies to rabies glycoprotein and β-galactosidase protein was detected.

As shown in Table II below, rabbit 205
1 week after inoculation, anti-β-galactosidase antibody was shown in an amount detectable by ELISA test. This increased to a titer of 1/4000 at 2 weeks and persisted until 5 weeks after inoculation. Using the antigen capture ELISA assay, the serum of rabbit 205 showed detectable amounts of anti-rabies antibodies from 3 to 10 weeks after inoculation.

[0076]

[Table 2]

Example 4A Fowlpox virus F
Rabies G gene containing recombination promoted from P-1
Production of virus vFP-3 This example demonstrates that the rabies G gene is completely expressed by a fowlpox strain other than FP-5, in particular, another strain of foulpox virus called FP-1. .

As in Example 3, this fragment was obtained from FP-1 under the assumption that the 0.9 Kbp Pvu II fragment contained a non-essential region as in FP-5.

This fragment was inserted into the two PvuII sites of pUC9 to prepare a plasmid named pRW731.15R.

This plasmid has two Hinc II sites at asymmetric positions about 30 bp apart in the Pvu II fragment, thereby forming the long and short arms of the fragment.

A commercially available Pst linker, (5 ')-CCT
GCAGG- (3 ') was inserted into the two Hinc II sites to create plasmid pRW741.

The rabies G gene transcriptionally promoted by the HH promoter was inserted into this plasmid at the Pst I site,
A new plasmid pRW742B was created. By recombining this plasmid with FP-1 by infection / transfection of CEF cells, the virus vFP
-3 was obtained.

The ATG translation initiation codon of the open reading frame transcriptionally promoted by the HH promoter was ligated to the rabies G gene using a synthetic oligonucleotide linking the Eco RV site in the HH promoter and the Hind III site in the rabies G gene. Over the start codon of The 5 'end of the rabies G gene whose transcription is promoted by the HH promoter is modified using a known technique,
After inclusion of one I site, this construct was transformed into pRW74
Ligation to 1 Pst I site to create pRW742B. The position of this construct in this plasmid is
This is the same as that in pRW735.1 already described in Example 3.

The recombination was performed as described in Example 2. The resulting recombinant is called vFP-3.

The expression of rabies antigen by both avian and non-avian cells infected with the vFP-3 virus was confirmed by the immunoprecipitation method and the immunofluorescence method described above.

Another proof that the embodiment of the vFP-3 of the present invention is a successful example of a recombinant virus expressing the rabies G gene is that the recombinant virus was expressed in rabbit 2
Obtained by intradermal inoculation of the animals. Two rabbits were inoculated intradermally with 1 × 10 ⁸ pfu of vFP-3 per animal. Both of these rabbits developed a typical pox lesion, which reached its maximum 5-6 days after inoculation. Rabbits were bled weekly and serum was tested by ELISA to detect the presence of antibodies specific for the rabies glycoprotein.

Each of 5 rats received 5 × vFP-3.
10 ⁷ pfu was intradermally inoculated. Lesions remained in all animals.

Both rabbits and rats produced detectable levels of rabies-specific antibodies by two weeks after inoculation. Two control rabbits inoculated intradermally with the parental FP-1 virus showed no detectable levels of anti-rabies antibodies. This antibody response was not induced by de novo synthesis by the recombinant virus of rabies antigen in the animals used in the experiments, but rather by accident, depending on whether it was brought in with the inoculated virus or incorporated into the recombinant fowlpox virus membrane. The vFP-3 virus was chemically inactivated and rabbits were inoculated to rule out any possible rabies antigen introduced.

The purified virus was incubated at 4 ° C. overnight at 0.001%
Was inactivated in the presence of β-propiolactone, and then pelletized by centrifugation. The pelleted virus was collected in 10 mM Tris buffer, sonicated and titered to ensure that no infectious virus remained. Two rabbits were inoculated intradermally with inactivated vFP-3, and two other rabbits were intradermally inoculated with the same amount of untreated recombinant. The size of the lesion was monitored.

Both rabbits receiving untreated vFP-3
Five days after inoculation, typical lesions of 4-5 + grade occurred. Rabbits inoculated with the inactivated virus also developed lesions,
These were 2+ grade 5 days after inoculation.

Rabbits are bled every other week and serum is
Tested in SA to determine the presence of rabies specific antibody and foulpox specific antibody. The results are shown in Table III below.

[0092]

[Table 3]

In this test, the titer endpoint (shown as the reciprocal of the serum dilution) was arbitrarily determined to be 0.2 after subtracting the serum absorption before antigen administration. Rabbits 295 and 3
18 were both administered live virus and generated an immune response to rabies glycoprotein and fowlpox virus antigens. Rabbits 303 and 320 also produced an immune response to the fowlpox virus antigen, but their titers were low. Neither of the rabbits produced a detectable response to the rabies glycoprotein.

This finding suggests that the immune response generated in the rabbit is due to the de novo expression of the rabies glycoprotein gene carried by the recombinant virus and is not a response to the glycoprotein accidentally brought into the inoculated virus. You.

Example 4B Fowlpox virus F
Recombinant rabies G gene-containing recombinant gene lacking transcription ability from P-1
Production of Ils vFP-5 Expression of a foreign gene inserted into the foulpox genome by recombination requires the presence of a promoter. VFP-3 except lacking the HH promoter
The same recombinant vFP-5 was prepared to demonstrate this. The presence of the rabies gene in this recombinant was confirmed by nucleic acid hybridization. However, no rabies antigen was detected in the CEF cell medium infected with this virus.

Example 5 Fowlpox virus
In vitro to determine whether to replicate in avian cells
FP-1 against three cell lines: one passage bird and two non-birds
The experiment was performed by inoculating the parent strain or the recombinant vFP-3. C
FP-1 or vFP-3 was added to two dishes each of EF, MRC-5, and VERO at 10 pfu / cell.
At a multiplicity of inoculation.

Three days later, cells were harvested from one dish for each. After freezing and thawing were repeated three times successively to release the virus, a fresh monolayer of the same cell line was re-inoculated. This was passaged six times in succession, and at the end of the experiment the specimens at each passage were titered to determine the viral infectivity on the CEF monolayer.

The results are shown in Table IVA. From this result, C
It was suggested that continuous passage of both FP-1 and vFP-3 was possible in EF cells, but not in any of the two non-avian cell lines. The infectious virus is in VERO or MCR-5 cells.
Not detectable after 3 or 4 passages.

A second dish was used to determine if undetectable virus could be detected in permissive CEF cells after amplification by direct titration.

Three days later, the cells in the second dish were scraped and harvested, and one third of the cells were lysed and inoculated onto a fresh CEF monolayer. When the cytopathic effect (CPE) was maximal or 7 days after inoculation, the cells were lysed and the virus yield was titrated. The results are shown in Table IVB. When all of the virus present was amplified using passage in CEF cells, the virus was undetectable after 4 or 5 passages.

Attempts to establish constantly infected cells have failed.

[0102] Further, an attempt was made to detect evidence of continuous virus expression in non-avian cells. Specimens used for the above virus titer assay were used for standard immunodot assays. In this assay, anti-foulpox antibodies and anti-rabies antibodies were used to detect the presence of each antigen. The results of these assays confirmed the results of the titer test.

[0103]

[Table 4]

[0104]

[Table 5]

Example 6 Another foul pox FP-1
Recombinants: vFP-6, vFP-7, vFP-8 and vFP
FP-9 recombinant viruses vFP-6 and vFP-7 were produced by the following operations.

A 5.5 Kbp Pvu II fragment of FP-1 was inserted between the two Pvu II sites of pUC9 to create plasmid PRW731.13. This plasmid was then cut at its unique Hinc II site, and the blunt-ended rabies G gene carrying the HH-promoter was inserted into plasmids pRW748A and pRW7.
48B was produced. These plasmids show that the orientation of the insertion is opposite. Plasmid pRW
748A and B were then used separately and transfected into CEF cells along with the FP-1 virus to produce vFP-6 and vFP-7, respectively, by recombination.
This locus was named locus f7.

The 10 Kbp Pvu-II fragment of FP-1 was inserted between the two Pvu II sites of pUC9 and pRW73 was inserted.
1.15 was made. This plasmid is then used as the only Ba
After cutting at the mHI site, a Lac Z gene fragment having the 11K promoter was inserted, and pRW749A and pRW749B, in which the insertion directions were reversed, were prepared. These donor plasmids were recombined with FP-1 to yield vFP-8 and vFP-9, respectively. This locus
I named 8.

VFP-8 and vFP-9 are X-gal
Expressed the Lac Z gene detected by E. coli. vF
P-6 and vFP-7 expressed the rabies G gene detected by rabies specific antiserum.

Example 7 Attacks with Raw Rabies Virus
Groups of 20 female SPF mice (4-6 weeks old) immunized with vFP-3 to protect animals from 0.7 to 6.7 TCID ₅₀ per mouse.
The toes were inoculated with 50 μl of vFP-3 at doses in the range (TCID ₅₀ , or tissue culture infectious dose, is the amount at which 50% of the tissue culture cells undergo a cytopathic effect). On day 14 after inoculation, 10 mice of each group were sacrificed, and serum samples were
Collected for FFI assay assays. For the remaining 10 mice, after rabies CVS strain were challenged by inoculation in an amount of 10 LD ₅₀ in cerebral and counted the number of surviving at 14 days.

The results are shown in Table VA below.

[0111]

[Table 6]

[0112] The present experiment was repeated attack in the rabies virus in the amount of 12.5LD _50. The results are shown in Table VB below.

[0113]

[Table 7]

Recombinant vFP was used for two dogs and two cats.
The immunization was carried out by once intravenously inoculating 8 times the amount of 1 log ₁₀ TCID ₅₀ of -3. Further, two dogs and four cats having the same age and weight were used as a non-vaccinated control group. Blood was collected from all animals every other week. On day 94, each dog was challenged by inoculating the temporal muscle twice with 0.5 ml of the salivary gland homogenate of the rabies virus NY strain obtained from the Institute Merix. The total dose was equivalent to 10,000 times the mouse LD ₅₀ by cerebral route. Six cats were similarly challenged by inoculating the neck muscle twice with 0.5 ml of the virus suspension. The total dose per cats corresponded to 40,000 times the mouse LD ₅₀ for cerebral pathways. Animals were observed daily. All non-vaccinated animals died on the days indicated in Table VI with rabies symptoms. Vaccinated animals survived the challenge and were observed up to 3 weeks after the last one of the control animals had died. The results are shown in the table below.
See VI.

[0115]

[Table 8]

Furthermore, the recombinant viruses vFP-2 and vF-2
Experiments were performed in which cattle were inoculated with P-3 by several different routes.

The inoculated animals were treated with antirabies antibody at 6, 1
Tested on days 4, 21, 28 and 35. Table VIIA below
As shown, all animals showed a serological response to rabies antigen.

[0118]

[Table 9]

All the cattle were inoculated on day 55 after the inoculation.
Eight times the amount of ₁₀ TCID ₅₀ was vaccinated again, and showed a previous response to the rabies antigen. All cows except for No. 1421 were boosted by re-vaccination. 14
Cow 21 was again inoculated intramuscularly. RFFI titers were measured after 55, 57, 63, 70, 77 and 86 days.

The results are shown in Table VIIB.

[0121]

[Table 10]

All data are vFP-3, except that the data of the animal No. 1423 is based on vFP-2.

Cows, cats and rabbits were also inoculated intradermally with known amounts of fowlpox virus, and scabs were collected from the animals about one week later. After crushing, the cells were suspended in physiological saline and assayed for titer to measure the amount of virus.

Only the remaining amount of infectious virus could be recovered. This suggests that no productive infection occurs in vivo.

Example 8 : Chicken contact with vFP-3
Species of recombinant foulpox virus vFP-3 is inoculated into chickens and foreign DNA by the recombinant foulpox virus in a system that allows productive replication of this vector
Was expressed.

For white leghorn chickens, vFP-
3 from muscles 9 volumes of _log 10 TCID _50, or the Vfp-3 was inoculated by penetrating the wing 3 volumes of _1og 10 TClD _50. Blood samples collected and vaccination 2
One day later, rabies antibody titers were determined by the RFFI test. Day 21 titers of the inoculated chickens were much higher than day 21 titers of the control group. That is, the mean titer of the uninfected control group was 0.6, while the mean of the chickens inoculated intramuscularly was 1.9, and the mean of the chickens inoculated through was 1.2.

Example 9 Turkey Influenza H5
Recombinant foulpox vFP-1 expressing HA antigen
It can be immunized birds against avian pathogens using recombinant avipox virus of one invention.

Therefore, A / Turkey / Ireland / 137 whose transcription is promoted by the HindIII promoter
CEF co-infected with parental virus FP-1 using a novel plasmid pRW759 (described below) derived from foulpox virus FP-1 containing the hemagglutinin gene (H5) of 8/83 (TYHA) Cells were transfected. Recombinant fowlpox virus vFP-11 was obtained by the techniques already described herein.

The synthesis of hemagglutinin molecules by vFP-11 infected cells was performed using specific anti-H5 antibodies and standard techniques.
Confirmation was made by immunoprecipitation from lysates of infected cells that were radiolabeled by metabolism. Specific immunoprecipitation of a hemagglutinin precursor with a molecular weight of about 63 Kd (kilodalton) and two degradation products with molecular weights of 44 Kd and 23 Kd were revealed. No such protein precipitated from lysates of uninfected CEF cells or cells infected with parental virus FP-1.

Immunofluorescence studies were performed to determine that the HA molecule produced in cells infected with the recombinant foulpox vFP-11 is expressed on the cell surface. CEF cells infected with the recombinant fowlpox virus vFP-11 were strongly fluorescently stained on the surface. No fluorescence was detected in cells infected with the parent virus FP-1.

[0131] Plasmid pRW759 was prepared as follows. pRW742B (see Example 4) was replaced with Pst I
The fragment was made linear by partial digestion with Eco RV.
Again to remove the rabies G gene, about 3.4 Kbp
The HH promoter was left on the remaining fragment. This is treated with alkaline phosphatase, and this HH
A synthetic oligonucleotide was inserted to bind the promoter and TYHA to prepare pRW744.

This plasmid was partially digested with Dra I to make it linear, the linear fragment was cut with Sal I, and the larger fragment was again isolated and treated with alkaline phosphatase.

[0133] Finally, Kawaoka et al.
158 , 218-227 (1987), pRW759 was made by inserting the isolated TYHA SalI-DraI coding sequence into the pRW744 vector.

Example 10 Live Influenza Virus
By vFP-11 to protect birds from attack by attack
To examine the immunogenicity of the immune recombinant foul pox virus vFP-11, it was carried out vaccination and challenge experiments in chickens and turkeys.

For a sterile white leghorn, 2 days old and 5 days old
Commercial fowlpox virus in poultry at week of age
Double needle (doubl) used for vaccination
needed) to perform vaccination by puncture of the wing net
Was. 6 × 10 vFP-11 ⁵About 2 μl containing pfu
Was administered to each chicken. Older chickens get vaccine
Blood is collected before seeding and all chickens are pre-challenge.
Blood was drawn two and two weeks later.

For comparison, another group of chickens was prepared using a conventional H-water-in-oil emulsion of the inactivated H5N2 strain.
Five vaccines were given.

The inactivated H5N2 vaccine was used for A / malard (Ma11ar) grown in chick eggs of 11-day-old embryos.
d) Prepared from / NY / 189/82 (H5N2).
HA titer 800 / 0.1 ml and infectious titer 10 ^8.5 /
0.1 ml of infected chorioallantoic fluid was inactivated with 0.1% propiolactone, and Stone et al., Avia
n Dis. , 22 , 666-674 (1978) and Brug et al., Proc. Second
Inter. Sym. on AvianInfl
uenza, 283-292 (1986). A 0.2 ml volume of the vaccine was administered by intravenous route to the skin inside the thigh muscle of 2 day old, 5 week old SPF white leghorn chickens.

The chickens in groups 3 and 4 received either the parent virus FP-1 or no vaccine.

0.1 ml was administered to each nostril of each chicken, and the highly pathogenic A / turkey / Ireland / 137
8/83 (H5N8) or A / Chick /
A pen (Pen) / 1370/83 ( H5N2) influenza virus was attacking the chicken in about 10 ³ times the amount of _{LD 50.} Two-day-old chickens attacked 6 weeks after vaccination, and 5 week-old chickens attacked 5 weeks after vaccination. The chickens were observed daily for signs of illness, paralysis and death, as indicated by facial and swelling swelling and cyanosis, as well as foot bleeding (these chickens often failed to stand). Most of the deaths occurred 4-7 days after infection. On day 3 post-infection, samples were taken from the trachea and total cloaca of each surviving chicken by linear derivation and inoculated into embryonated eggs for virus screening.
Chickens inoculated with wild-type or recombinant fowlpox virus developed typical lesions in the wing network. A pustule was formed at the site where the needle was stabbed by day 3 and cell infiltration continued with scab formation and recovered by day 7. No secondary foci were formed and there was no evidence of transmission to non-vaccinated contacted chickens. The results of the challenge experiment are shown in Table VIII and the relevant serological findings are shown in Table IX.

[0140]

[Table 11]

[0141]

[Table 12]

The foulpox-H5 recombinant (vFP
-11) or chickens vaccinated with inactivated H5N2 influenza vaccine in adjuvant have homologous Ty / Ir
Protected from attack by e (H5N8) influenza virus and a related but distinctly different Ck / Penne (H5N2) influenza virus. In contrast, the majority of chickens vaccinated with parental FPV or not receiving any vaccine show clinical symptoms of highly pathogenic influenza, facial and swelling swelling and cyanosis, Hemorrhage and paralysis were included. Most of these chickens died. Vaccinated chickens did not show detectable amounts of Ty / Ire, but were detectable in the case of Ck / Penne.

Both inactivated and recombinant vaccines are H
Induced neutralizing antibodies for I and Ty / Ire, but did not inhibit HA at the level of antibodies induced by foulpox-H5 recombinant vFP-11 prior to challenge, and did not inhibit heterologous Ck /
Penn H5 was not neutralized. Nevertheless, chickens were protected from challenge by both Ty / Ire and Ck / Penne influenza viruses.

Immunity to H5 influenza induced by vFP-11 vaccination lasted for at least 4 to 6 weeks and was cross-reactive. To further investigate the persistence and specificity of this response, a group of 4-week-old chickens was inoculated with wing networks with vFP-11 as previously described, and then cross-reactive Ck / Penn every month. Attacked with a virus. In addition, no HI antibody could be detected before the challenge. Nevertheless, the chickens were protected for more than four months.

H5 expressed by vFP-11 also elicits a protective immune response in turkeys. Outbred white turkeys were vaccinated at 2 days and 4 weeks of age by wing net inoculation as described above. The results are shown in Table X.

[0146]

[Table 13] Significant survival was seen in both age groups against challenge with the homologous Ty / Ire virus. Non-vaccinated contact turkeys were kept with vaccinated turkeys and tested for transmission of the recombinant virus. These turkeys did not survive the attack.

Example 11 Chicken Influenza Nucleus
Fowlpox FP-1 expressing protein (NP) gene
Construction of Recombinant vFP-12 Plasmid pNP33 contains a cDNA clone of the influenza virus chicken / Pennsylvania / 1/83 nucleoprotein gene (NP). About 1.6
Only the 5 'and 3' ends of the Kbp NP gene were determined. NP to blunt-end 5 'Cla I-Xho
As an I 3 'fragment, the fragment was transferred from pNP33 to pUC9 which had been digested with SmaI.
Ligated to the EcoRI site of UC9, the pR
W714 was produced. NP translation initiation codon (ATG)
Had an Aha II site underlined as follows: AT GGCGTC . Vaccinia H6 already mentioned
A promoter was linked to this NP with a double-stranded synthetic oligonucleotide. This synthetic oligonucleotide is Ec
o Contains the H6 sequence from the RV site to its ATG and enters the NP coding sequence at the AhaII site. This oligonucleotide had a Bam HI end and Eco RI
It has been synthesized to be compatible with both ends.
Insertion into UC9 created pRW755. Bam H
The sequence of the double-stranded synthetic oligonucleotide starting from the I-compatible end (ATG underlined) was: GATCCGATATCCGTTAAGTTTGTATCGTA ATG GCGTCG GCTATAGGCAATTCAAACATAGCATTACCGCAGCTTAA.

The linear partial digestion product of pRW755 with AhaII was isolated and cut with EcoRI. The ATG site contains one AhaII cleavage site and
The pRW755 fragment re-cut with RI was isolated and treated with phosphatase, and then used as a vector for the following pRW714 digestion product.

The AhaII linear partial digestion product of pRW714 was recut with EcoRI. An about 1.6 Kbp AhaII-EcoRI isolated fragment containing the NP coding sequence was inserted into the pRW755 vector described above to generate pRW757. The complete H6 promoter was formed by adding a sequence upstream (3 'side) of the Eco RV site. Plasmid pRW742B (described in Example 4)
Eco cleaved with Nde I site of UC9 '
It had the H6 sequence downstream (3 'side) of the RV site. p
The RW742B Eco RV-NdeI fragment was treated with phosphatase and used as a vector for the following pRW757 fragment.

After isolating the linear EcoRV digestion product of pRW757, it was digested with NdeI and isolated again. This pRW757 fragment was inserted into the pRW742B vector and
RW758 was formed. The EcoRI fragment of pRW758 contained all NPs driven by the H6 promoter and was blunt-ended with the Klenow fragment of DNA polymerase I, and then inserted into the pRW731.13 HincII site to create pRW760. pRW731.3 Hin
The cII site is the FP-1 locus used in Example 6 to create vFP-6 and vFP-7.

The plasmid pRW760 was used in an in vitro recombination test, using Fowlpox FP-1 as the rescue virus. Progeny plaques were assayed and plaques purified using in situ plaque hybridization. Gene expression was confirmed by immunoprecipitation experiments using goat polyclonal anti-NP antiserum. The size of this protein, which specifically precipitated from lysates of CEF cells infected with vFP-12, was approximately 55 KD, and was within the reported nucleoprotein of influenza virus.

Example 12 Evian Influenza Nucleus
Expresses protein (NP) and hemagglutinin (HA) genes
Fowlpox virus double recombinant vFP-15
For the hemagglutinin (HA) gene from A / Tyr / Ire / 1378/83, vFP-11 (Example 9)
Has already been described. In making the double recombinant, the HA gene was first inserted into plasmid pRW731.15.
And the locus f8 defined at the time of the production of vFP-8.
Moved to

The plasmid used for construction of vFP-11 was pRW759. The hemagglutinin gene linked to the H6 promoter was transferred from this plasmid by Pst I partial digestion. This fragment is then plant-ended with the Klenow fragment of DNA polymerase I,
pRW731.15 was inserted into the BamHI site of the blunt end to create pRW771.

The plasmid pRW771 was then used in an in vitro recombination test using vFP-12 as a rescue virus. The vFP-12 recombinant virus contains a nucleoprotein gene linked to the H6 promoter at locus f7 as defined in plasmid pRW731.13. Recombinant plaques having both inserts were selected, plaques were purified by in situ hybridization, and the surface expression of hemagglutinin was confirmed by protein A-β-galactosidase binding immunoassay. Expression of both genes was confirmed by immunoprecipitation from double recombinant virus vFP-15 and infected cell lysate.

Example 13 Recombinant Canary Poxui
In the following examples, confirmation of four non-essential insertion loci of the canarypox genome and four recombinant canarypox viruses
CP-16, vCP-17, vCP-19 and vCP-
20 will be described.

The recombinant canarypox vCP-16 was prepared as follows.

The 3.4 Kbp Pvu II canarypox DNA fragment was cloned into pUC9 and
Yielded 4.2. Only one Eco RI site was found asymmetrically in this fragment, resulting in a short arm of 700 bp and a long arm of 2.7 Kbp. This plasmid is called Eco RI
And blunt-ended using the Klenow fragment of DNA polymerase I. H of brand end
The 6 / rabies G gene was then ligated to this site and used to transform E. coli. The resulting plasmid pRW775 was used for an in vitro recombination test. Progeny plaques positive in the immunoscreen were selected and plaques were purified. The resulting recombinant was used as vCP-
No. 16 and the insertion site was named C3.

The plasmid pRW76 used for the above construction was prepared.
4.2 is approximately 2.4 Kbp from the Eco RI site
It contained a unique Bgl II site apart. Using the same cloning strategy, the H6 / rabies G gene was ligated at this site to plasmid pRW764.2 and pRW7
74 were produced. Using this plasmid, a recombinant vCP-17 having an insertion site named C4 was prepared.

Plasmid pRW764.5 has a 850 bp Pvu II fragment of canarypox DNA,
Only B asymmetric within a 400 bp fragment from one end
It has a glII site. Using the same method as the cloning method described above, the rabies G gene linked to the H6 promoter was inserted into this site to prepare pRW777. The produced stable recombinant virus was named vCP-19, and the insertion locus was named C5.

Plasmid pRW764.7 contains a 1.2 Kbp PvuII fragment with a unique BglII site 300 bases away from one end. This plasmid was digested with BglII and blunt-ended with the Klenow fragment of DNA polymerase I. LacZ Promoted Transcription by 11K Promoter at Blunt End
The gene was inserted to create plasmid pRW778.
The stable recombinant virus produced using this plasmid was named vCP-20, and the insertion site was named C6.

Example 14 Newcastle Disease Virus
Expressing foulpox virus recombinant vFP-29
Preparation Plasmid pNDV108 of a cDNA clone of the fusion gene of NDV Texas strain of about 3.3 Kbp H
It consists of a paI cDNA fragment and contains a sequence encoding the fusion protein and another sequence encoding NDV cloned into the ScaI site of pBR322. The following describes the steps for preparing the inserted plasmid.

(1) Preparation of plasmid pCE11 The FPV insertion vector pCE11 was constructed using pRW731.1.
3 by inserting a polylinker into the Hinc II site (designated locus f7). pRW731.13
Contains a 5.5 Kbp Pvu II fragment of FP-1 DNA. Non-essential loci were defined at the HincII site in the generation of the stable recombinant vFP-6, already described in Example 6. The polylinker inserted into the Hinc II site has the following restriction enzyme sites. That is, Nru I, Ec
o RI, Sac I, Kpn I, Sma I, Bam
HI, Xba I, Hinc II, Sal I, Acc
I, Pst I, Sph I, Hind III and Hpa
I.

(2) Preparation of plasmid pCE19 This plasmid is a further modified version of pCE11, and is a vaccinia virus transcription termination signal ATTTTTNT.
(L. Yuen and B. Moss
s); Virol. 60 , 320-323 [198
6]) (where N is A) is the Sac of pCE11
Inserted between the I and Eco RI sites,
The co RI site has disappeared.

(3) Insertion of NDV coding sequence B purified on a 1.8 Kbp gel containing all but 22 nucleotides at the 5 'end of the fusion protein gene
The am HI fragment was inserted into the Bam HI site of pUC18 to form pCE13. This plasmid was digested with SalI which cuts the vector at 12 bases upstream of the 5 'end of the coding sequence. The ends were filled in with the Klenow fragment and the plasmid was further digested with HindIII, which cuts 18 bases upstream of the SalI site. The 146 base Sma I- gel containing the vaccinia virus H6 promoter and polylinker sequences at both ends and gel purified as previously described in the preferred embodiment.
A Hind III fragment was ligated into this vector and transformed into E. coli cells. The resulting plasmid was named pCE16.

Initiation ATG of NDV fusion protein gene
To align the codon at the 3 'end of the H6 promoter and to complement pCE16 with the 22 nucleotides missing from the 5' end of NDV, a complementary synthetic oligonucleotide was designed terminating at the Eco RV and Kpn I sites. . This oligonucleotide sequence was 5'ATC-CGT-TAA-GTT-TGT-ATC-GTA-ATG-GGC-TCC-AGA-TCT-TCT-ACC-AGG-ATC-CCG-GTA-C3 '.

The produced pCE16 was digested with EcoRV and KpnI. An Eco RV site occurs 24 bases upstream of the starting ATG in the H6 promoter. Kpn
The I site occurs 29 bases downstream of the ATG within the NDV coding sequence.

The oligonucleotide was annealed, phosphorylated and ligated to the linear plasmid described above. The resulting DNA was used to transform E. coli cells. This plasmid was designated as pCE18.

To insert this NDV coding sequence into the FPV insertion vector, a 1.9 Kbp SmaI-H purified on a gel of pCE18 (cut at the polylinker region) was used.
The indIII fragment was converted to the 7.8 Kbp of pCE19 described
It was ligated to the SmaI-HindIII fragment. The transcription termination signal occurs at 16 bases downstream of the SmaI site. The resulting plasmid was named pCE20.

Plasmid pCE20 was used in an in vitro recombination test using fowlpox virus FP-1 as a rescue virus. The resulting progeny was applied to a CEF monolayer, and the plaques were subjected to β-galactosidase-linked protein A immunoscreen using polyclonal anti-NDV chicken serum. After selecting positively stained plaques and purifying the plaques four times, a single population was obtained.
This recombinant was designated as vFP-29.

Example 15 Feline leukemia virus (FeL)
V) Avis expressing envelope (env) glycoprotein
Preparation FeLV env gene pox viruses contain sequences encoding p70 + p15E polyprotein. First, the FeLV gene was inserted into the plasmid pSD467vC with the vaccinia H6 promoter juxtaposed on the 5 'side of this gene. Plasmid pSD467vC contains a 1802 bp Sal containing the vaccinia hemagglutinin (HA) gene.
The I / HindIII fragment was derived by first inserting it into the pUC18 vector. The location of the HA gene has already been elucidated (Shida,
Virology 150 , 451-462, [198
8]). The majority of the open reading frame encoding the HA gene product is missing (nucleotide 443 to nucleotide 1311), and Bgl II, Sma I, Pst I and E
A multiple cloning site containing a gaI restriction enzyme site was inserted. The resulting pSD467vC plasmid is
It contains the vaccinia flanking arm 442 bp upstream of the multiple cloning site and 491 bp downstream of these restriction sites. These flanking arms can insert the genetic material into the multiple cloning site and recombine into the HA site of the vaccinia virus strain Copenhagen. The resulting recombinant progeny was HA negative.

The H6 promoter was synthesized by annealing four overlapping oligonucleotides consisting of the complete sequence already described in the preferred embodiment. The resulting fragment consisting of 132 bases has B
It had a glII restriction site and a SmaI site at the 3 'end. This was inserted into pSD467vC via BglII and SmaI restriction sites. The resulting plasmid was named pPT15. This FeS site is the only Pst I site in pPT15 just downstream of the H6 promoter.
The LV env gene was inserted. The resulting plasmid was named pFeLVIA.

For production of FP-1 recombinant, 2.4K
The bp H6 / FeLV env sequence was cut from pFeLVIA by BglII digestion and partial PstI digestion.

The Bgl II site is at the 5 'boundary of the H6 promoter sequence. The Pst I site is 420 bp downstream of the translation termination signal in the envelope glycoprotein reading frame.

This 2.4 Kbp H6 / FeLV en
The v sequence was inserted into BamHI and PstI digested pCE11. The FP-1 insertion vector pCE11 was derived from pRW731.13 by inserting a multiple cloning site into a non-essential Hinc II site. This insertion vector can produce an FP-1 recombinant carrying the foreign gene at locus f7 of the FP-1 genome. Recombinant FP-1 / Fe
The LV insertion plasmid was designated herein as pFeLVFI. This construct does not give a complete ATG for ATG substitution.

Complete ATG: To make the ATG construct, one Nru I / SstII fragment of about 1.4 Kbp was derived from the vaccinia virus insertion vector pFeLVIC. The Nru I site occurs in the H6 promoter 24 bp upstream from the ATG. The Sst II site is AT
It is located 1.4 Kbp downstream from G and 1 Kbp upstream from the translation termination signal. This Nru I / Sst II fragment was
9.9 Kb prepared by tII digestion and NruI partial digestion
Ligation to the p fragment. This 9.9 Kbp fragment contains 5.5 kbp of the FP-1 flanking arm, pUC vector sequence, en
It contains a 1.4 Kbp FeLV sequence, which corresponds to the downstream part of the v gene, and most of the sequence 5 'to the H6 promoter (about 100 bp). The resulting plasmid was named pFeFLVF2. This ATG for ATG construction was confirmed by nucleotide sequence analysis.

Another FP-1 insertion vector pFe
LVF3 is located in the putative immunosuppressive region (Ciansiolo (Cia
nciolo) et al., Science 230 , 453-
455 [1985]) (nucleotide 15 of the coding sequence).
Derived from pFeLVF2 by removing the FeLV env sequence corresponding to 48 to 1628). This is an approximately 1 Kbp SstII / PstI fragment.
(Sites described above) with the vaccinia virus insertion vector pFe
Completed by isolation from LVID. This plasmid pFeLVlD was similar to pFeLVlG, except that the env sequence corresponding to the immunosuppressive region (nucleotides 1548 to 1628) was deleted by oligonucleotide mutagenesis.
(Mandecki, Proc. Nat
l. Acad. Sci. USA, 83 , 7177-71
81 [1987]). Nucleotides 1548 to 162
1 Kbp Sst II / Pst lacking up to 8
The I fragment was converted from the remaining H6: F derived from pFeLVF2.
10.4 Kbp Ss containing eLV env gene
Inserted into the tII / PstI fragment.

The insert plasmids pFeLVF2 and pFeL
VF3 was used for an in vitro recombination test of the rescue virus FP-1. The progeny of this recombinant was spread on a CEF monolayer and the recombinant virus was selected by plaque hybridization on the CEF monolayer. Recombinant progeny identified by hybrid analysis were selected and plaque purification was performed four times to obtain a homogeneous population. F carrying all FeLV env genes
The P-1 recombinant was designated as vFP-25, and the FP-1 recombinant containing all the genes deficient in the immunosuppressive region was called vFP-25.
It was named P-32. The two recombinants were both bovine anti-FeLV polyclonal sera (Antibodies, Inc.), Davis (Da
vis), California) showed that it expressed the appropriate gene product.
These FP-1 recombinants were used in the CRFK cell line (ATCC
It is also important to express the exogenous FeLV env gene in (# CCL94), this cell line being of cat origin.

For the preparation of canarypox (CP) recombinants, the 2.2 Kbp fragment containing the H6: FeLV env sequence was cut from pFeLVF2 by digestion with SmaI and HpaI. This SmaI site is at the 5 'boundary of the H6 promoter sequence. Hpa
The I site is located 180 bp downstream of the translation termination signal in the envelope glycoprotein reading frame.

The 2.2 Kbp H6 / FeLV env sequence was inserted into the non-essential Eco plasmid of the insert plasmid pRW764.2.
Insertion into the RI site followed by blunt end Eco RI site. This insertion vector gives rise to a CP recombinant carrying the foreign gene in locus C4 of the CP genome. This recombinant CP insertion plasmid is now called pFeLVCP2
It was named. This construct has a complete A for ATG substitution.
Provide one TG.

The insertion plasmid pFeLVCP2 was used in an in vitro recombination test using CP as the rescue virus. After applying the progeny of this recombinant to a CEF monolayer,
Recombinant viruses were selected by β-galactosidase-conjugated protein A immunoscreening using bovine anti-FeLV commercially available polyclonal serum (Antibodies, Davis, CA). After staining positive plaques were selected and plaques were purified four times, a homogeneous population was obtained. The recombinant expressing the complete FeLV env gene was named vCP-36.

Example 16 Rous-related virus type 1
(RAV-1) expresses the envelope (env) gene
Of fowlpox virus recombinant vFP-22
Clone of the RAV-1 envelope gene manufactured by penvRV
1PT encodes a 1.1 Kb coding sequence cloned as a Kpn I-Sac I fragment in M13mp18.
p RAV-1 env DNA. This fragment had the 5 'end as it was, but lacked a part of the 3' sequence, and was used in the following procedures. Eco-derived 1.1 Kbp gel-purified penvRVI
The RI-PstI fragment was ligated with EcoRI and Ps of pUC9.
Insertion at the t I site created pRW756. This plasmid was digested with Kpn I and Hind III and cut at 59 bases upstream of ATG in the vector. The 146 base pair K containing the vaccinia H6 promoter already described
The pn I-Hind III fragment was inserted and the plasmid pC
E6 was produced.

To confirm that the starting ATG of the RAV env gene was adjacent to the 3 'end of the H6 promoter lacking the foreign sequence, the Eco RV and B
Two complementary synthetic oligonucleotides were made at the anII site. The oligonucleotide sequence was ATC-CGT-TAA-GTT-TGT-ATC-GTA-ATG-AGG-CGA-GCC-3 '.

Plasmid pCE6 was digested with Ban II which cuts 7 bases downstream of ATG in the sequence encoding Eco RV and RAV env which cuts 24 bases upstream of ATG in the H6 promoter. This DNA fragment was ligated and used for transformation of E. coli cells. The resulting plasmid, pCE7, provided the H6 promoter and the correct 5 'sequence for final construction.

Clone mp19env (190) was found by restriction enzyme mapping to contain the entire RAV-1 env gene. Mp1 containing all genes
1.9 Kbp Kpn I-Sa of 9env (190)
The cI fragment was inserted into the KpnI and SacI sites of pUC18 to form pCE3. This plasmid is called RA
It was digested with HpaI, which cuts 132 bases downstream of the starting ATG in the sequence encoding V-1, and SacI, which cuts at the 3 'end of this gene. The previously described FPV insertion vector pCE11 was digested with SmaI and SacI, and this plasmid was cut with a polylinker region. pCE3
Ligated with pCE11 using the HpaI-Sac fragment of
E14 was produced.

Plasmid pCE7 was then replaced with Xho I and H
digested with ind III, H6 promoter and correct 5 '
A 332 base pair fragment containing the sequence was generated. Plasmid pCE14 is digested with HindIII which cuts at the polylinker region of this vector and XhoI which cuts at the coding sequence.
Digested. This DNA was obtained from HindII obtained from pCE7.
Ligation with the I-XhoI fragment formed pCE15, the final RAV-1 envelope gene construct.

[0186] This plasmid was transformed into Fowlpox FP.
-1 was used for an in vitro recombination test using the rescuing virus. Recombinant progeny were applied to CEF monolayer and anti-RAV-1
Plaques were screened in a β-galactosidase-linked protein A immunoassay using polyclonal serum. After selecting positive staining plaques, the plaques were purified four times to obtain a single population. VFP
-22. From the immunoprecipitation experiment using the vFP-22-infected CEF lysate, the apparent molecular weights of 76.5 Kd and 30 K corresponding to two gene products of the envelope gene were determined.
It was shown that the two proteins having d were specifically precipitated. No precursor gene products were found.

Preliminary studies have elicited an immune response to this RAV-1 envelope gene product in chickens inoculated with vFP-22.

Example 17 Bovine leukemia virus (BL
V) the gp51,30 envelope (env) gene
Preparation of avipoxvirus recombinant to be expressed (1) Preparation of pBLVF1 and pBLVF2 Plasmids pBLVF1 and pBLVF2 are gp of BLV
Contains the 51,30 env gene. In both plasmids, the BLV env gene contains vaccinia virus H6.
It is under the transcriptional control of a promoter and is cloned between fowlpox adjacent arms (locus f7). The nucleotide sequences of the two plasmids are identical except for codons 268 and 269. (PBLVF1 encodes a protein containing the amino acids Arg-Ser at these two positions, while pBLVF2 encodes a protein containing the amino acids Gln-Thr.)

[0189] pBLVF1 and pBLVF2 were prepared in the following procedure. Plasmid pNS97-1 contains all BLV e
This is a plasmid containing the nv gene.
It was cut with mHI and partially cut with MstII. gp
A 2.3 Kbp fragment containing all 51,30 genes was isolated on an agarose gel and the sticky end was replaced with E. coli DN.
Filled with A polymerase I (Klenow fragment).
A Pst I linker was ligated to the end of the fragment and digested with Pst I before the Pst I site of pTP15 (Example 1).
5). This places the BLV gene adjacent to vaccinia promoter H6. (PTP
15 contains the vaccinia H6 promoter cloned at a non-essential locus in the vaccinia genome. )

The plasmid is then cut with Eco RV and partially cut with Ava II. The 5.2 Kbp fragment was isolated and the oligonucleotide 5'-ATCCGTTAAG
TTTGTATCGTAATGCCCAAAGAACG
ACG-3 'and 5'-GACCGTCGTTCTTTTG
GGCATTACGATACAAACTTAACGGA
This plasmid was recircularized using T-3 '. This removes unnecessary bases between the BLV gene and the H6 promoter.

The resulting plasmid was digested with Pst I and partially digested with Bgl II, and the 1.7 Kbp fragment containing the BLV gene whose transcription was promoted by the promoter H6 was ligated with the fowlpox virus insertion vector pCE described above.
It was cloned using locus f7 at 11 BamHI-PstI sites. Thus, B having the H6 promoter
The LV gene is located between the foulpox adjacent arms.
This plasmid was designated as pBLVF1.

Using the same procedure, pBLVF2 was prepared, except that the BLV gene having the H6 promoter was
Before cloning into 11, an in vitro mutagenesis operation was further performed. This mutation was introduced by the following procedure.
Plasmid pNS97-1 was cut with XmaI and Stu
Partially cut with I. The 5.2 Kbp fragment was isolated and the oligonucleotide 5'-CCGGGTCAGACAAAC
TCCCGTCGCAGCCCTGACCTTAGG-
3 'and 5'-CCTAAGGTCAGGGCTGCGA
This plasmid was recyclized using CGGGAGTTTGTTCTGAC-3 '. By this, codon 2
The nucleotide sequence of 68 and 269 changes from CGC-AGT to CAA-ACT.

(2) Preparation of recombinant viruses The plasmids pBLVF1 and pBLVF2 were replaced with FP-
1 was used in an in vitro recombination test using the virus as a rescue virus. Recombinant progeny were selected for in situ plaque hybridization, and once the population was determined to be pure by this criterion, plaques were screened in a β-galactosidase protein A immunoassay using a BLVgp-specific monoclonal antibody preparation. Plasmid pBLV
Recombinant vF made from F1 and pBLVF2 respectively
Both P23 and vFP24 showed positive staining by immunoscreen, suggesting that an immunologically recognizable glycoprotein was expressed on the infected cell surface.

The plasmids pBLVK4 and pBLVK6
Contains the aforementioned BLV envgp51,30 gene and BLV gp51,30 cleavage minus gene, respectively. Both genes have been cloned into the unique Eco RI site (locus C3) of pRW764.2 (described in Example 13 for pRW764.2) and are under transcriptional control of the vaccinia H6 promoter.

This plasmid was derived by the following procedure. Restriction enzyme Hind to pBLVF1 and pBLVF2
Cut at III. Oligonucleotide BKL 1 (AG
CTTGAATTCA) was cloned into this site and
An EcoRI site is created 3 'of the LV gene. Since there is also an Eco RI site on the 5 'side of this BLV gene, these plasmids (pBLVK1 and pBLVK
2) was cut with Eco RI, and the fragment containing the BLV gene whose transcription was promoted by the H6 promoter was ligated with pRW76.
It was cloned into the 4.2 Eco RI site. The resulting plasmids were named pBLVK4 and pBLVK6, respectively. These plasmids were used in an in vitro recombination test using Canarypox as a rescue virus. Recombinants were selected and purified based on the expression on the surface of the glycoprotein detected by the immunoassay. Recombinants from plasmids pBLVK4 and pBLVK6 were named vCP27 and vCP28, respectively.

Fowlpox recombinants vFP23 and vFP23
Sheep and cattle were inoculated with FP24 by various routes. Animals were inoculated twice, the second 45 days after the first. Serum samples were given 5 weeks after the first vaccination and 2 weeks after the second vaccination.
Collected after a week. Antibodies to gp51 are competitive ELI
As determined by the SA test, titers were expressed as the reciprocal of the serum dilution that inhibited competition by 50%. The results are shown in Table XI.

None of the species tested showed a detectable immune response after the first inoculation. Both sheep and cattle showed significant antibody elevation after the second vaccination.

[0198]

[Table 14]

Example 18 Infectious bronchitis virus Ma
foul pot expressing ss41 matrix gene
Plasmid pIBVB63, which is used to construct the recombinant virus vox-FP-1 transgenic vFP-26, has the infectious bronchitis virus (IBV) cD
Contains NA clones. 8 Kbp of pIBVB63
The Eco RI fragment contains a matrix gene having a pepromer gene upstream (5 'side), and has an Eco RV site further upstream. Plasmid pRW715
Is an Eco that binds the two Pvu II sites of pUC9.
Has an RI linker. 8 from pIBVM63
The EcoRI fragment of Kbp was replaced with the EcoRI of pRW715.
Into the site to create pRW763. Plasmid p
A plasmid pRW776 deficient in the 5 'Eco RI site of RW763 was prepared, and the only Eco RI site downstream (3' side) of this matrix gene was left. The isolated Eco RI partially digested linear product of pRW763 was recut with Eco RV. The largest fragment was isolated, blunt-ended with the Klenow fragment of DNA polymerase I, and self-ligated to produce pRW776. The construct pRW776 has the entire IBV peplomer gene and the entire matrix gene, followed by a unique Eco RI site.

The sequence of only the 5 'and 3' ends of the matrix gene of about 0.9 Kbp was determined. 5 'of matrix gene starting at translation initiation codon (ATG)
The sequence contains an Rsa I site underlined below. ATGTCCAACGAGACAAAT
TGTAC .

The previously described H6 promoter was linked to this matrix gene with a synthetic oligonucleotide. This synthetic oligonucleotide is derived from the Eco RV site through the AT
Contains the H6 sequence up to G, the first Rsa I
Inserted into the matrix coding sequence via the site. This oligonucleotide is B-like so that it can be inserted into pUC9.
am HI and Eco RI end
W772 was produced. The Eco RI end is 3 'of the Rsa I site. Starting from the Bam HI compatible end, the sequence of this double-stranded synthetic oligonucleotide (ATG is underlined) is

Embedded image It is.

The Rsa I partially digested linear product of pRW772 was isolated and recut with Eco RI. This Rsa
The pRW772 fragment having the site cut once at the I site and recut with Eco RI was treated with phosphatase, and the following p
It was used as a vector for the RW776 digestion product.

The linear Rsa I of isolated pRW776
The partial digestion product was cut again with Eco RI. Eco
The RI site is just beyond the 3 'end of the matrix gene. About 0.8 Kbp of Ras containing the matrix-encoding sequence from the RsaI site described above
The I-Eco RI isolated fragment was inserted into the pRW772 vector described above to generate pRW783. The complete H6 promoter was formed by adding a sequence 5 'of the Eco RV site. The 5 'end of the H6 promoter was blunt-ended and inserted into the SalI site of pUC9 to create an EcoRI site, which was a HinfI site. The 5' of this H6 promoter was Hind of pUC9.
III site. The HindIII-Eco RV fragment containing the 5'H6 promoter was inserted into pRW783 Hi
Insertion between the ndIII and EcoRV sites, pRW78
No. 6 was produced. The pRW786 Eco RI fragment was H6
It contains a complete matrix gene with a promoter, is blunt-ended with the Klenow fragment of DNA polymerase I, is inserted into the Bam HI site of the blunt end of pRW731.15 (locus f8) and pRW78
9 was produced. This pRW731.15 Bam HI
The site was FP-1 used in the preparation of vFP-8 in Example 6.
It is a seat.

The plasmid pRW789 was used for preparing vFP-26. Recombinant plaques were selected and treated with in situ plaque hybridization.

In a preliminary study, chickens inoculated with vFP-26 elicited an immune response to the IBV matrix protein.

Example 19 Infectious bronchitis virus (I
BV) Fowlpox virus expressing peplomer
Preparation of FP-1 recombinant vFP-31 cD of infectious bronchitis virus (IBV) Mass41
NA clone pIBVM63 and its subclone pRW
776 has already been described for the preparation of vFP-26 in Example 18. Subclone pRW776 is 4Kb
It contains the pIBV peplomer gene and is followed by a matrix gene with a unique Eco RI site at the 3 'end. Only the sequences at the 5 'and 3' ends of the IBV hepromer gene of about 4 Kbp have been determined. It is separated into two genes at a unique XbaI site. 5 'of the peplomer gene beginning with the translation initiation codon (ATG)
The ends have an Rsa I site underlined below. AGTTTGGTAACACCCTTTTTT
ACTAGTGACTCTTTTGGTGT GTAC .

The previously described H6 promoter was linked to the ぺ promer gene with a synthetic oligonucleotide. This synthetic oligonucleotide contained the H6 promoter sequence from the Nru I site to the ATG, and was inserted into the pepromer coding sequence via its first Rsa I site. This oligonucleotide was synthesized at the ends compatible with Bam HI and Eco RI for insertion into pUC9 to produce pRW768. The Eco RI end is 3 'of the Rsa I site. The sequence of the double-stranded synthetic oligonucleotide starting at the Bam HI compatible end (ATG is underlined)

Embedded image It is. The isolated linear RsaI partial digest of pRW768 was re-cut with EcoRI. Rs above
The pRW768 fragment containing the site cut at the aI site and recut with EcoRI was isolated, treated with phosphatase, and used as a vector for the following pRW776 digestion product.

The linear Rsa of the isolated pRW776
The partial digestion product was cut again with Eco RI. R above
After cutting once at the saI site, a 5 Kbp pRW776 fragment containing up to the EcoRI site was isolated. This fragment contains the IBV sequence from the above-mentioned peplomer RsaI site to the EcoRI site at the 3 'end of the matrix gene. This pRW776 fragment was ligated to the above-mentioned pRW768.
This was inserted into a vector to generate pRW788. This matrix gene was transferred to the Xba I site described above. 4K
bp of pRW788 Nru I-Bam HI blunt-end fragment to pRW760 Nru I-Bam HI
By inserting into a blunt-end vector, 5 ′
The H6 promoter was added to the Nru I site and pRW7
90 were produced. The vector pRW760 is described in Example 11, and is simply a vaccinia influenza nucleoprotein that is transcriptionally driven by the H6 promoter adjacent to the non-essential FP-1 locus f7. This pRW
The 760 vector was created by removing the 3'H6 sequence from the NruI site to the BamHI at the end of the nucleoprotein. pRW790 is pRW731.13
IBV peplomer bearing the H6 promoter in the Hinc II site. Replace the donor plasmid pRW790 with FP
-1 to generate vFP-31. vFP-3
An immunoprecipitation experiment was performed using a CEF lysate prepared from one infected cell, and it was shown that a small amount of a precursor protein having a molecular weight of about 180 Kd and a small amount of a degradation product of 90 Kd were specifically precipitated.

Example 20 Herpes Simplex Virus gD
Expressed foulpox virus FP-1 recombinant vF
Preparation of P-30 Herpes simplex virus (HSV) type 1 strain KOS glycoprotein D gene (gD) was inserted into the BamHI site of pUC9.
It was cloned as a fragment from 5'BamHI-ligated HpaII to 3'BamHI-ligated NruI. The 5 'end is adjacent to the pUC9 Pst I site. The 5 'sequence of HSVgD beginning with the translation initiation codon (ATG) contains an Nco I site underlined below.

[0210]

Embedded image

The previously described vaccinia H6 promoter was ligated to the HSVgD gene with a synthetic oligonucleotide. It contains the 3 'portion of the H6 promoter from Nru I to ATG and further to the Nco I site of the gD coding sequence. This oligonucleotide was synthesized to have a Pst I compatible 5 'end. The gD clone of pUC9 was cut with PstI and NcoI, the 5′HSV sequence was removed, and replaced with a synthetic oligonucleotide to yield pRW787. The sequence of this double-stranded synthetic oligonucleotide is

Embedded image It is. Digestion of pRW787 with Nru I and Bam HI results in an approximately 1.3 Kbp fragment containing the 3'H6 promoter from the Nru I site through the HSVgD coding sequence to the Bam HI site. This pRW760
The cutting of the vector with NruI and BamHI was described in Example 11. This 1.3 Kbp fragment is p
It was inserted into the RW760 vector to produce pRW791.
This pRW791 vector contains the HSVgD gene, which is transcriptionally promoted by the complete vaccinia promoter, at the non-essential FP-1 HincII site (locus f7) of pRW731.13.

The donor plasmid pRW791 was replaced with FP-1.
And vFP-30 was obtained. Glycoprotein surface expression was detected in protein A-β-galactosidase linked immunoassays and in recombinant plaques using HSV-1 specific sera.

Example 21 In Poxvirus Vector
For regulation of foreign gene expression in rice
Use of promoters (a) Background insect poxviruses are currently in the subfamily Entomopoxvirinae (Entomopoxvirin).
ae) and beetles (Celeoptet)
a), Lepidoptera, Orthoptera (O
rthoptera), three genera respectively corresponding to entomopoxviruses isolated from insects belonging to the order
(A, B, C). It is known that entmopoxviruses originally have a narrow host range and do not replicate in any vertebrates.

[0214] The entmopox virus used in this study was an infected Amsakta moray (A) originally from India.
msacta moorei (Lepidoptera: arctildae) larvae (Roberts and Granados (Gr.)
anados), J.M. Invertebr. Pat
ho1. 12 , 141-143 [1968]). This virus is named AmEPV and is a species of the genus B.

The wild-type AmEPV was transformed into R. Granados (Gr
anados) Dr. Boyce Thompson Institute
Tute), Cornell University
erythrocytes) and obtained as infected haemolymph from larvae of infected Estigmene acrea . This virus is an invertebrate cell line derived from the ovarian tissue of Lymantria disper ( Gypsy moth), IP
It was found to replicate in LB-LD652Y (Goodwill et al., In Vitro).
14 , 485-494 [1978]). This cell is
IPL supplemented with 4% fetal calf serum and 4% chicken serum
Grow at -28 ° C in -528 medium.

The wild-type virus was plaque assayed on LD652Y cells and one plaque, designated V1, was selected for the following experiments. This isolate has numerous inclusion bodies (occ) in the cytoplasm of infected cells late in the infection cycle.
luision bodies (OBs).

(B) Identification of Promoter The identification and mapping of the AmEPV promoter were completed as follows. Total RNA of recently infected LD652Y cells (48 h post-infection) was isolated and the first c labeled with ³² P
Used to make DNA strands. This cDNA was converted to Am
It was used as a probe in a blot containing restriction digests of EPV. A strong signal was detected on the 2.6 Kb ClaI fragment in this Southern blot, indicating that this fragment encodes a strongly expressed gene. This fragment was cloned into a plasmid vector and its DNA sequence was determined.

Analysis of the sequence data revealed an open reading frame capable of encoding a 42 Kd polypeptide. In vitro translation of total RNA 48 hours post-infection and separation of products by SDS-PAGE,
One polypeptide of about 42 Kd was identified.

(C) Entmopox promoter system
Recombinant vaccinia expressing foreign gene under control
For making entomopox promoter virus examine whether function in vertebrate poxviruses system was prepared following plasmids. 4 adjacent to the Bg1 II site at the 5 'end
2K gene translation initiation signal (hereinafter referred to as AmEPV42K
107 bases on the 5 'side of the promoter and Eco
Oligonucleotides containing the first 14 bases at the 3 'end of the coding region of hepatitis B virus pre-S2 terminating at the RI site were chemically synthesized. Below is this AmEPV4
Describes the 2K promoter sequence.

[0220]

Embedded image

This AmEPV42K promoter was ligated with the hepatitis B virus surface antigen (HBVsA
g). The vaccinia virus arm in a non-essential region of the vaccinia virus genome encoding the hemagglutinin (HA) molecule (the HA arm is described in Example 15; the HA region is described by Virology as Shida).
150 , 451-462 [1986]), the pre-S2 coding region (type ayw is described by Galibert et al., Nature).
281 , 646-650 [1979]) and a pUC plasmid containing the hepatitis B virus surface antigen. The aforementioned oligonucleotide was inserted into this plasmid using a unique Eco RI site in the coding region of HBVsAg and a unique Bgl II site in the HA vaccinia arm. The obtained recombinant vaccinia virus was transferred to vP54
No. 7.

The expression of the coding sequence of the inserted HBVsAg under the control of the Entmopox 42K promoter was
Confirmed using immunoassay. Mammalian cell line BS
Equivalent cultures of C-40 were infected with parental vaccinia virus or recombinant vP547. The cells were lysed 24 hours after infection, and the lysate was serially diluted and mounted on a nitrocellulose membrane. First the membrane was incubated with goat anti-HBV serum, and ^then incubated with ^{1 25} I Protein A. After washing, the film was exposed to an X-ray film.
A positive signal was detected in the vP547 infected culture,
It was not detected in parental virus-infected cultures, suggesting that the Vaccinia virus in mammalian cells recognizes the AmEPV42K promoter.

The above results demonstrate that HBV in infected mammalian cells
Confirmation was made using the Ausria assay for detecting sAg (see Example 1 for details). AmEPV
BSC-40 cells were infected with HBsAg-containing vaccinia virus recombinants conjugated to the 42K or vaccinia virus H6 promoter, and sAg expression levels were assayed in an Austria test. As shown in Table XII, 4
The data show that the HBsAg expression level using the 2K promoter is significant.

[0224]

[Table 15]

In addition, experiments were performed to confirm the temporal properties of the AmEPV42K promoter regulation in a vertebrate poxvirus environment. Equivalent cultures of BSC-40 cells were infected with vP547 in the presence or absence of 40 μg / ml cytosine arabinoside, which inhibits late viral transcription and thereby inhibits DNA replication. Expression levels at 24 hours post-infection were assayed in the Ausria test. These results suggested that the 42K promoter was recognized as an early promoter in the vaccinia virus replication system.

Expression of foreign genes in mammalian systems
Use of the mEPV42K promoter has been shown to improve gene expression in invertebrate systems by Autographa californica.
a ) Using the NPV polyhedrin promoter (Luckow and Summer)
s), Biotechnology 6 , 47-55.
It should be noted that this is clearly different from [1988]). The polyhedrin promoter is not recognized by the transcription machinery in mammalian cells (Tjla)
Virology 125 , 107-117 [198
3]). The use of the AmEPV42K promoter in mammalian cells is the first example where an insect virus promoter has been used to express foreign genes in non-insect viral vectors in non-invertebrate cells.

The following experiment was performed to determine whether avipoxviruses similarly recognize the 42K entmopox promoter. For the same culture of CEF cells, plasmids fowlpox virus per cell 10 pfu, Canary pox virus, or vaccinia virus was inoculated, containing simultaneously 1) HBV play _S 2 + sAg coding sequence linked to the 42K promoter 42K. 17 or 2) HBVs linked to the previously described vaccinia virus H6 promoter
Plasmid containing the coding sequence of Ag pMP15. s
Transformation was performed with 25 g of either plasmid of psP.
Twenty-four hours later, the culture was frozen to lyse the cells and the presence of HBVsAg in the lysate was analyzed using the Ausria test.

The results shown in Table XIII should be examined quantitatively. As a result, both the foulpox and canarypox transcription mechanisms can recognize the 42K promoter,
And it is suggested that it allows transcription of the linked HBVsAg coding sequence. Expression level is vaccinia virus H
6 lower than that obtained with the promoter, but well above background levels obtained with the negative control.

[0229]

[Table 16]

Example 22 Against Raw Rabies Virus Attack
Immunization with VCP-16 to protect mice in the footpad hoof of a group of 20 4-6 week old mice with two recombinant (a) vFP-6 (Fowlpox rabies described in Example 6) (B), and 50 to 100 μl of a predetermined volume of a dilution of either of the recombinant) and (b) vCP-16 (the canarypox rabies recombinant described in Example 13).

On the 14th, 10 mice were sacrificed from each group and serum was collected. Serum anti-rabies titers were calculated using the RFFI test described in Example 7. The rabies virus CV used in Example 7 was used for the remaining 10 mice in each group.
The S strain was challenged by inoculation into the brain. Each mouse has a mouse L
The 30μl corresponding to 16 times the D ₅₀ was administered. 28
The surviving mice were examined on the day and the 50% protective dose (PD ₅₀ ) was calculated. The results are shown in Table XIV.

The protection level of the mice determined from the vFP-6 inoculation confirms the results shown in the inoculation of the foulpox recombinant vFP-3 studied in Example 7. The level of protection provided by vCP-16 inoculation is quite high. When used as a reference to calculate PD _{5 0,} in the defense against rabies attack, people than the foul pox rabies recombinant Canary Po try rabies recombinant is 100 times more effective.

[0233]

[Table 17]

Example 23 : Filer for foreign gene expression
Use of the Ulpox promoter element 25.8 kilodalton (KD) gene product
Identification of foulpox gene to be stained SDS polyacrylamide gel was stained with Coomassie blue to stain the protein species present in the foulpox (FP-1) infected CEF lysate, resulting in a major apparent molecular weight of 25.8 KD. Molecular species were revealed. This protein was not present in uninfected cell lysates. Proteins synthesized at a specific time after infection
^From pulse experiments of radiolabeling with ³⁵ S-methionine,
The FP-1 induced protein was shown to be abundant and suggested that this protein was synthesized from 6 to 54 hours post-infection. At peak level, this F
The protein of P-1 25.8KD accounts for approximately 5% to 10% of the total protein present in the cell lysate.

The large amount of FP-1 induced 25.8 KD protein suggested that the gene encoding this gene product was controlled by a strong FP-1 promoter element. Polysomal preparations were obtained from FP-1-infected CEF cells 54 hours after infection to determine the location of this promoter element for use in expressing foreign genes in poxvirus recombinants. RNA was isolated from this polysomal preparation and produced a predominantly 25.8 KD FP-1 protein when used in the rabbit reticulocyte in vitro translation system.

This polysomal RNA was ligated to oligo (dT)
12-18 was used as a template for the initial cDNA strand synthesis using primers. This first cDNA strand is
It was used as a hybridization probe in Southern blot analysis of the P-1 genomic digest. From the results of the hybridization analysis, it was found that the gene encoding the 25.8 KD protein was 10.5 Kbp Hind II.
It was suggested that it was contained in the I fragment. Next, this genomic Hind III fragment was isolated and the commercially available vector pBS
(Stratagene, La Jolla, CA) and the clone was named pFP23K-1. pFP23
Hybridization analysis using the first cDNA strand as a probe of the digest of K-1 gave 25.8K.
The D protein gene was found to be located on a 3.2 Kbp Eco RV small fragment. This fragment was cloned in pBS and named pFP23K-2.

About 2.4 Kbp of this FP-1 Eco
The nucleotide sequence of the RV fragment was determined by the Sanger dideoxy chain terminator method (Sanger et al., Pro.
c. Natl. Acad. USA, 74 , 5463
-5467 [1977]). Sequence analysis revealed an open reading frame (ORF) encoding a gene product with a molecular weight of 25.8 KD. This ORF is pB
In vitro run-off transcription with bacteriophage T7 polymerase in the S vector results in a rabbit reticulocyte in vitro translation system (Promega Biotech (Prom Biotech).
ega Biotec), Madison (Madiso)
n), when used in Wisconsin) Apparent molecular weight 2
An RNA species producing a 5.8 KD polypeptide species was obtained. This polypeptide has the same mobility on a SDS-polyacrylamide gel as the abundant 25.8 KD protein observed in FP-1 infected CEFs lysates. These results suggest that this is the gene encoding the abundant 25.8KD gene product induced by FP-1.

II. For FP-1 and vaccinia recombinants
The feline leukemia virus (FeLV) env gene
Upstream of FP-1 25.8KD gene for expression
Use of promoter element FP-1 25.8 KD gene regulatory region (FP 25.
270 bp Eco RV / Ec containing 21 bp of the 25.8 KD gene coding sequence.
o The RI fragment was isolated from pFP23K-2. PFe
The nucleotide sequence of the FP 25.8K promoter region used to induce LV 25.8F1 and pFeLV 25.81A is shown below. This 270 nucleotide sequence represents 249 nucleotides upstream of the start codon (ATG) of the 25.8KD gene product and the first 21 bp of the coding sequence.

[0239]

Embedded image

Using this fragment as a blunt end, FeLV
It was inserted into a SmaI digested FP-1 insertion vector containing the env sequence (pFeLVF1: see Example 15). This insertion vector allowed recombination at the f7 locus of the FP-1 genome. This upstream sequence of the FP 25.8K promoter was inserted at the 5 'side of the FeLV env gene, and it was confirmed by sequence analysis that they had the correct orientation. This insertion does not confer a full ATG for the ATG substitution, but the ATG provided by the 25.8KD gene does not alter this FeLV env AT
Since it is outside the frame of G, no fusion protein is formed. F
An FP-1 insertion plasmid containing the FP25.8KD promoter upstream of the eLV env gene was pFeLV
It was named 25.8F1.

Vaccinia virus insertion vector pFeL
V1A has the FeLV gene (see Example 15), and a similar construct was prepared using this vector.
This H6 promoter was cleaved from pFeLVIA by digestion with Bgl II and Sma I. After blunt-ending the Bgl II restriction site, the blunt-ended Eco RV / Ec containing the FP25.8K promoter was used.
o An RI fragment (270 bases) was inserted adjacent to the 5 'side of the FeLV env gene. This structure was confirmed by sequence analysis. This recombinant also has no complete ATG for ATG substitution, but the ATG of the 25.8 KD gene is not in frame with the ATG of the FeLV gene. The vaccinia (Copenhagen strain) insertion vector has a 25.8 KD gene upstream region adjacent to the 5 'side of the FeLV gene and was named pFeLV25.81A.

This insertion plasmid pFeLV25.8F
1 and pFeLV25.81A were used for in vitro recombination with FP-1 (pFeLV25.8F1) as a rescue virus and vaccinia virus strain Copenhagen (pFeLV25.81A). After application of the recombinant progeny to the appropriate cell monolayer, the recombinant virus was treated with β-galactosidase-linked protein A immunoscreen and bovine anti-FeL.
Selected by V serum (Antibodies, Davis, CA). From preliminary results, this FP2
It was suggested that the 5.8K promoter could control the expression of foreign genes in poxvirus recombinants.

Example 24 : vFP-6 in poultry
Safety and Efficacy of vCP-16 Two Avipox Recombinants vFP-6 and vCP-16
(Described in Examples 6 and 13) were inoculated into 18-day-old chick embryos, 1-day-old and 28-day-old chickens, and the response of these chickens was evaluated on three criteria: 1) hatchability, response to vaccine And the effect of the vaccine on mortality, 2) the immune response elicited by the rabies glycoprotein, and 3) the immune response elicited by the fowlpox antigen. The experiments performed are described below.

A. Safety test 18 days old 20 animals were set as one group, and these serosal cavities were 3.0 or 4.0 of log ₁₀ TCID ₅₀ of either vFP-6 or vCP-16.
Double doses were inoculated. After hatching, the chickens were observed for 14 days, and serum was collected. The two recombinants inoculated into the chicken embryo had no effect on egg hatchability and the chicken remained healthy during the 14 day observation period.

A group consisting of 10 1-day-old SPF chickens was intramuscularly injected with log ₁₀ T of any of the above recombinants.
3.0 times the amount of CID ₅₀ was inoculated. The chickens were observed for 28 days, and serum samples were collected on days 14 and 28 after inoculation. None of the recombinants showed any vaccine response at the inoculation site, and the chickens were healthy during the 28-day observation period.

A group of 10 28-day-old chickens was inoculated with any of the recombinant viruses. The dose is
Either 3.0 log ₁₀ TCID _{50 for} the muscle route or 3.0 log ₁₀ TCID _{50 for the} skin (wing mesh) route. The chickens were observed for 28 days, and serum samples were collected on days 14 and 28 after inoculation. No reaction was observed when any recombinant was intramuscularly injected. Falpox produced a very small vaccine response upon skin inoculation, but the lesion size was different. Canarypox inoculation resulted in normal skin lesions at the site of inoculation. All lesions had regressed by the end of the experiment.

B. Immunization Reaction R described in Example 7
Antibody levels against rabies glycoprotein were evaluated using the FFI test. The results of each group were calculated based on the standard serum containing 23.4 IU, and the geometric mean of the titer of each serum was calculated based on International Units (IU).
And expressed as The minimum positive level was defined as 1 IU and used to determine the percentage of positive chickens. Antibodies to avipoxviruses were tested by ELISA using a fowlpox virus strain as an antigen. Each serum sample was diluted 1:20 and 1:80. A standard curve was drawn using positive and negative sera. The minimum positive level was calculated as the mean of various values of negative serum plus two standard deviations.

The serological results are shown in Table XV for vFP-6 and Table XVI for vCP-16.

In embryos inoculated with either vFP-6 or vCP-16, a limited serologic response to rabies or fowlpox antigens was observed. The foulpox vector elicited a serological response to both antigens in more chickens than canarypox, but this response was also variable.

Chickens inoculated with vFP-6 at 1 day of age showed good serologic response, and all chickens were seropositive for rabies antigen and fowlpox antigen by 28 days after inoculation. Response to vCP-16 inoculation was much lower, at day 28 40% of chickens were seropositive for rabies glycoprotein and 10% of chickens were seropositive for avipox antigen.

Chickens inoculated with vFP-6 via the muscular route at 28 days of age had 100% seroconversion to both antigens by 14 days after inoculation. Most of the chickens also seroconverted after skin inoculation, but the titers obtained for both rabies and avipox antigens were low. As already mentioned, chickens inoculated with vCP-16 by both the muscle and cutaneous routes showed various responses, with up to 70% seroconversion for intramuscularly challenged rabies. Low levels of seroconversion to avipox antigen after canarypox inoculation may reflect the degree of serological closeness between the viruses.

From the above results, it was found that vFP-6 and vCP-
Both of these suggest that it is safe to inoculate chickens of a certain age range. The foulpox vector vFP-6 appears to be more effective in raising an immune response in chickens. It is important, however, that recombinants of both the avipox viruses fowlpox and canarypox are effective for immunization in eggs.

[0253]

[Table 18]

[0254]

[Table 19]

Example 25 Piglets are Inoculated with vFP-6
Safety and immunogenicity Two groups of three piglets per group were inoculated with recombinant vFP-6 by one of two administration routes.

A) 8.1 liters of 3 piglets injected intramuscularly
og ₁₀ TCID ₅₀ was administered and b) 3 piglets were given the same dose by oral inoculation.

After blood was collected from all animals at weekly intervals, booster inoculation was performed on day 35 by the same route and the same dose. The piglets were observed daily for clinical signs. Serum was tested for anti-foulpox antibodies by ELISA and serum neutralization tests. Rabies antibody to RFFI
Assayed in the test.

All the piglets remained in good health, and no foci were found after inoculation. The temperature curves were normal and there was no difference between vaccinated and non-vaccinated animals.

As determined by ELISA and serum neutralization, both piglets vaccinated by the intramuscular and oral routes elicited a serological response to the foulpox antigen. After the second inoculation, the secondary reaction was pronounced (results not shown). As measured by the RFFI test, all piglets develop an immunological response to the rabies glycoprotein,
The additional effect of both routes is significant. These results are tabulated.
Shown in XVII.

The results show that inoculation of the foulpox / rabies recombinant is harmless in piglets and that this recombinant elicits a significant immune response to rabies glycoprotein by oral or intramuscular inoculation. It is suggested that can be.

[0261]

[Table 20]

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61P 31/12 171 A61P 31/12 171 31/22 31/22 // A61K 35/76 A61K 35/76 C12N 15/09 ZNA C12N 15/00 ZNAA (31) Priority claim number 234,390 (32) Priority date August 23, 1988 (August 23, 1988) (33) Priority claim country United States (US) F Term (reference) 4B024 AA01 CA03 DA02 EA02 GA11 HA20 4C084 AA13 ZB27 ZB33 ZC61 4C085 AA03 BA64 BA67 BA75 BA78 CC08 DD62 GG03 GG04 GG05 GG08 4C087 AA01 AA02 BC83 CA12 MA52 MA65 MA66 ZB27 ZB32 ZB33

Claims (8)

[Claims] 1. A method for eliciting an immune response in a non-avian vertebrate (excluding mammals), comprising the steps of: providing a non-essential region of an avipox virus genome with a foreign DNA encoding an antigen of a pathogen to said animal; A promoter for expression, and inoculating the animal with a recombinant avipoxvirus that does not replicate productively in the animal. 2. The method of claim 1, wherein said avipoxvirus is selected from the group consisting of fowlpoxvirus and canarypoxvirus. Wherein the inoculation, subcutaneous, intradermal, intramuscular injection, performed orally or In'obamu (inovum), Method according to claim 1 or 2. 4. The antigen is selected from the group consisting of rabies antigen, rabies G antigen, bovine leukemia virus gp51, 30 envelope antigen, feline leukemia virus FeLV envelope antigen, and herpes simplex virus glycoprotein D antigen. A method according to any one of claims 1 to 3. 5. The promoter according to claim 5, wherein the promoter is Pi vaccinia promoter, HindIII (HH and H6) vaccinia promoter, 11K vaccinia promoter, 25.
8KD FP-1 foulpox promoter and A
The method according to any one of claims 1 to 4, wherein the method is selected from the group consisting of the mEPV 42K entmopox promoter. 6. The method according to any one of claims 1 to 5, wherein the recombinant avipoxvirus is a foulpoxvirus strain 5 in which the foreign DNA and promoter are inserted at locus F1 or locus F3. . 7. The method according to any one of claims 1 to 5, wherein the recombinant avipoxvirus is foulpoxvirus strain 1 in which the foreign DNA and promoter are inserted at locus F7 or locus F8. . 8. The recombinant avipox virus, wherein the foreign DNA and the promoter are located at locus C3, locus C4, locus C.
The method according to any one of claims 1 to 5, which is a canarypox virus inserted at 5 or locus C6.