US5047336A - DNA sequences, recombinant DNA molecules and processes for producing mullerian inhibiting substance-like polypeptides - Google Patents

DNA sequences, recombinant DNA molecules and processes for producing mullerian inhibiting substance-like polypeptides Download PDF

Info

Publication number
US5047336A
US5047336A US06/792,880 US79288085A US5047336A US 5047336 A US5047336 A US 5047336A US 79288085 A US79288085 A US 79288085A US 5047336 A US5047336 A US 5047336A
Authority
US
United States
Prior art keywords
mis
cells
sequences
recombinant dna
dna molecule
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
US06/792,880
Other languages
English (en)
Inventor
Richard L. Cate
Patricia K. Donahoe
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
General Hospital Corp
Biogen Inc
Original Assignee
General Hospital Corp
Biogen Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by General Hospital Corp, Biogen Inc filed Critical General Hospital Corp
Priority to US06/792,880 priority Critical patent/US5047336A/en
Assigned to GENERAL HOSPITAL CORPORATION THE, A CORP OF MASSACHUSETTS reassignment GENERAL HOSPITAL CORPORATION THE, A CORP OF MASSACHUSETTS ASSIGNMENT OF ASSIGNORS INTEREST. Assignors: DONAHOE, PATRICIA K.
Assigned to BIOGEN N.V. reassignment BIOGEN N.V. ASSIGNMENT OF ASSIGNORS INTEREST. Assignors: CATE, RICHARD L., DONAHOE, PATRICIA K.
Priority to AU64521/86A priority patent/AU606584B2/en
Priority to ZA868251A priority patent/ZA868251B/xx
Priority to DE3650266T priority patent/DE3650266T2/de
Priority to CA000521767A priority patent/CA1307753C/en
Priority to DK517986A priority patent/DK517986A/da
Priority to EP86308400A priority patent/EP0221761B1/en
Priority to AT86308400T priority patent/ATE119915T1/de
Priority to HU864535A priority patent/HUT43627A/hu
Priority to IL80451A priority patent/IL80451A0/xx
Priority to KR860009203A priority patent/KR870004143A/ko
Priority to PT83655A priority patent/PT83655B/pt
Priority to JP61257126A priority patent/JPH0720431B2/ja
Priority to JP89502264A priority patent/JPH03503524A/ja
Priority to AU30557/89A priority patent/AU622891B2/en
Priority to PCT/US1989/000239 priority patent/WO1989006695A1/en
Priority to US08/080,140 priority patent/US5359033A/en
Priority to EP19890902436 priority patent/EP0437427A4/en
Assigned to BIOGEN, INC., A CORP. OF DE reassignment BIOGEN, INC., A CORP. OF DE CHANGE OF NAME (SEE DOCUMENT FOR DETAILS). EFFECTIVE JUNE 30, 1988 (DELAWARE) Assignors: BIOGEN N.V., A CORP. OF THE NETHERLANDS
Assigned to BIOGEN, INC., A MA CORP. reassignment BIOGEN, INC., A MA CORP. MERGER (SEE DOCUMENT FOR DETAILS). JUNE 30, 1988 MASSACHUESETTS Assignors: BIOGEN MASSACHUSETTS, INC., A MA CORP. (CHANGED TO), BIOGEN, INC., A DE CORP. (MERGED INTO)
Publication of US5047336A publication Critical patent/US5047336A/en
Application granted granted Critical
Priority to US07/957,061 priority patent/US5427780A/en
Priority to JP5178268A priority patent/JP2541761B2/ja
Assigned to NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT reassignment NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT EXECUTIVE ORDER 9424, CONFIRMATORY LICENSE Assignors: GENERAL HOSPITAL CORPORATION DBA MASS
Anticipated expiration legal-status Critical
Assigned to NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT reassignment NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: MASSACHUSETTS GENERAL HOSPITAL
Expired - Fee Related legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents

Definitions

  • This invention relates to DNA sequences, recombinant DNA molecules and processes for producing Mullerian Inhibiting Substance (MIS)-like polypeptides. More particularly, the invention relates to DNA sequences and recombinant DNA molecules that are characterized in that they code for at least one MIS-like polypeptide. Accordingly, hosts transformed with these sequences may be employed in the processes of this invention to produce the MIS-like polypeptides of this invention. These polypeptides possess antitumor activity and are useful in the treatment of cancer, especially cancer of the female genital tract (e.g., ovarian cancer).
  • MIS Mullerian Inhibiting Substance
  • testicular factors by the male gonad shortly after differentiation was first postulated to be necessary for normal male reproductive development following the fetal rabbit castration experiments of Jost (C. R. Soc. Biol., 140, 463-64 (1946) and C. R. Soc. Biol., 141, 135-36 (1947)).
  • One factor, testosterone was shown to be responsible for differentiation of the epididymis, vas deferens, and seminal vesicles from the Wolffian ducts.
  • Virilization of the male was not complete, however, unless a second, nonsteroidal, factor was present to stimulate regression of the Mullerian ducts, the anlagen of the female reproductive system.
  • MIS Mullerian Inhibiting Substance
  • bovine MIS was further enhanced when sequential ion exchange chromatography was coupled with sequential lectin affinity chromatography (Budzik et al., Cell 21, 909-15 (1980); U.S. Pat. No. 4,404,188; and U.S. Pat. No. 4,510,131).
  • the results of Budzik et al. suggested that bovine MIS was a large molecular weight glycoprotein and provided semipurified MIS fractions that were used to prepare anti-MIS monoclonal antibodies (Mudgett-Hunter et al., J. Immunol., 128, 1327-33 (1982); Shima et al., Hybridoma, 3, 201-14 (1984); and U.S. Pat. No.
  • Lectin-affinity-purified bovine MIS fractionated by gel filtration under native conditions exhibited a single peak at approximately 200,000 daltons, although on denaturing polyacrylamide gels, this fraction contained multiple components suggesting a multiple subunit structure (Budzik et al., Cell, 21, 909-15 (1980)).
  • Matrix Gel Green A was used to achieve greater than 2000-fold purification of bovine MIS with a concomitant 60% recovery of starting activity. This was achieved by stabilizing MIS activity with the dialyzable protecting agents 2-mercaptoethanol, EDTA, and Nonidet-P40 (NP40). Analysis of the 2000-fold-purified MIS fraction by SDS-polyacrylamide gel electrophoresis indicated that only one component, migrating at 140,000 daltons was sensitive to reduction, although a number of other moieties were detected.
  • bovine MIS is a dimer of disulfide-linked subunits with a total molecular weight of 124,000 daltons (Picard et al., Mol. Cell. Endocrinol., 12, 17-30 (1978)).
  • MIS of greater purity and in large amounts is urgently needed for oncological studies because the present methods of treating cancers of the female genital tract are not adequate.
  • Cancers of the female genital tract represent approximately 9 percent of all cahcers in humans.
  • physicians use surgery and radiation when genital tract cancers are detected in early stages (for example, ovarian carcinoma Stage I-IIa). Although these methods of treatment are effective, they render the patients sterile.
  • Chemotherapy is used in advanced cases (Stage III-IV) when patients are classified as inoperable.
  • chemotherapeutic agents cisplatinum, adriamycin and cytoxan are the most commonly used. These drugs have proven to be most effective when combined in cisplatinum containing regimens and used on a long-term basis. Each of these drugs is considered to be highly toxic and their use requires intermittent hospitalization of the patients.
  • MIS as a natural biological regressor, is expected to have less side effects because of its specificity.
  • Other potential uses of MIS include the treatment of tumors with high levels of epithelial growth factor (EGF) receptors (Hutson et al., Science, 223, 586-89 (1984)), such as those from the head and neck, lung, epithelial lining of the digestive tract, cornea and skin.
  • EGF epithelial growth factor
  • MIS may inhibit germ cell meiosis since the substance has been localized to the granulosa cell of the Graffian follicle.
  • MIS may inhibit germ cell meiosis since the substance has been localized to the granulosa cell of the Graffian follicle.
  • their use as a contraceptive agent is being explored.
  • human MIS is preferred to MIS of animal origin.
  • Human MIS is even more difficult to obtain because human tissue in sufficient quantities is not available; thus, the only way to produce human MIS is through recombinant DNA technology. Accordingly, the isolation of the human gene for MIS was of paramount importance.
  • the present invention addresses the foregoing problems by providing DNA sequences coding for at least one MIS-like polypeptide, recombinant DNA molecules comprising such sequences, hosts comprising such sequences and processes for producing such polypeptides in hosts transformed with those DNA sequences, and in higher purity than heretofore available.
  • the DNA sequences of this invention are selected from the group consisting of
  • DNA sequences (a) the DNA sequences ##STR1## (b) DNA sequences which hybridize to the aforementioned DNA sequences and which code on expression for a human MIS-like polypeptide or a bovine MIS-like polypeptide and preferably have a substantial degree of homology (more preferably, at least about 70% homology and most preferably at least about 80% of homology) to the aforementioned DNA sequences; and
  • the DNA sequences, recombinant DNA molecules, hosts and processes of this invention enable the production of MIS-like polypeptides for use in the treatment of ovarian cancer and other susceptible cancers.
  • polypeptides selected from the group consisting of ##STR2## the amino acid sequence of mature bovine MIS protein
  • MIS-like polypeptides related thereto an anti-cancer pharmaceutical composition
  • an anti-cancer pharmaceutical composition comprising one of the foregoing polypeptides and a pharmaceutically acceptable carrier and methods of using such compositions in treating susceptible cancers, especially cancers of the female genital tract (e.g., ovarian cancer).
  • FIG. 1 depicts the amino acid sequences obtained from sequence analysis of tryptic peptides of bovine MIS. Only two of the 23 sequences obtained are shown.
  • FIG. 2 shows the sixteen pools of chemically synthesized oligonucleotide DNA probes that were used to isolate the bovine cDNA clone.
  • FIG. 3 displays the nucleotide sequence of the bovine gene which includes the full length cDNA sequence and the promoter region.
  • FIG. 4 depicts the construction of plasmid pBG311.bmis which may be used to express the bovine DNA sequence of the invention.
  • FIG. 5 depicts the human genomic clone chmis33 and compares it with the bovine cDNA clone pS21.
  • the solid blocks are exons which contain the protein coding regions.
  • FIG. 6 displays the nucleotide sequence of the human gene in cosmid clone chmis33.
  • the protein sequence is indicated below the DNA sequence. It is interrupted in four places by introns.
  • FIG. 7 depicts the construction of plasmids pBG311.hmis and pBG312.hmis that may be used to express the human DNA sequence of the invention.
  • Nucleotide--A monomeric unit of DNA or RNA consisting of a sugar moiety (pentose), a phosphate, and a nitrogenous heterocyclic base.
  • the base is linked to the sugar moiety via the glycosidic carbon (1' carbon of the pentose) and that combination of base and sugar is called a nucleoside.
  • the base characterizes the nucleotide.
  • the four DNA bases are adenine ("A”), guanine (“G”), cytosine ("C”), and thymine (“T”).
  • the four RNA bases are A, G, C, and uracil ("U”).
  • Codon--A DNA sequence of three nucleotides which encodes through mRNA an amino acid, a translation start signal or a translation termination signal.
  • a triplet the nucleotide triplets
  • TTA, TTG, CTT, CTC, CTA and CTG encode for the amino acid leucine ("Leu")
  • TAG, TAA and TGA are translation stop signals
  • ATG is a translation start signal.
  • Reading Frame The grouping of codons during the translation of mRNA into amino acid sequences. During translation the proper reading frame must be maintained.
  • the DNA sequence GCTGGTTGTAAG may be expressed in three reading frames or phases, each of which affords a different amino acid sequence:
  • Gene--A DNA sequence which encodes through its template or messenger RNA (“mRNA”) a sequence of amino acids characteristic of a specific polypeptide.
  • mRNA messenger RNA
  • the vector can be a plasmid or a phage.
  • the vector can be a plasmid, a phage or a cosmid.
  • Exon--Portions of the gene which after transcription are maintained in the mRNA following splicing of the precursor RNA.
  • Plasmid--A nonchromosomal double-stranded DNA sequence comprising an intact "replicon" such that the plasmid is replicated in a host cell.
  • the characteristics of that organism may be changed or transformed as a result of the DNA of the plasmid.
  • a plasmid carrying the gene for tetracycline resistance TERT R
  • TERT R tetracycline resistance
  • Phage or Bacteriophage--Bacterial virus many of which consist of DNA sequences encapsidated in a protein envelope or coat ("capsid").
  • Cosmid--A plasmid containing the cohesive end (“cos") site of bacteriophage ⁇ may, because of the presence of the cos site, be packaged into ⁇ coat protein and used to infect an appropriate host. Because of their capacity for large fragments of foreign DNA, cosmids are useful as cloning vehicles.
  • Cloning Vehicle--A plasmid, phage DNA, cosmid or other DNA sequence which is able to replicate in a host cell, characterized by one or a small number of endonuclease recognition sites at which such DNA sequences may be cut in a determinable fashion without attendant loss of an essential biological function of the DNA, e.g., replication, production of coat proteins or loss of promoter or binding sites, and which contain a marker suitable for use in the identification of transformed cells, e.g., tetracycline resistance or ampicillin resistance.
  • a cloning vehicle is often called a vector.
  • Cloning The process of obtaining a population of organisms or DNA sequences derived from one such organism or sequence by asexual reproduction.
  • Recombinant DNA Molecule or Hybrid DNA--A molecule consisting of segments of DNA from different genomes which have been joined end-to-end outside of living cells and able to be maintained in living cells.
  • the gene can be linked to a eukaryotic promoter such as that for the SV40 early region coupled to the gene encoding dihydrofolate reductase and selectively amplified in Chinese hamster ovary cells to produce a cell line containing many copies of actively transcribed eukaryotic genes.
  • a eukaryotic promoter such as that for the SV40 early region coupled to the gene encoding dihydrofolate reductase and selectively amplified in Chinese hamster ovary cells to produce a cell line containing many copies of actively transcribed eukaryotic genes.
  • MIS-Like Polvpeptide--A polypeptide displaying a biological or immunological activity of an MIS protein shall be understood to mean that the MIS-like polypeptide has a cross section of biological activity which is substantially similar to that of a natural MIS protein (e.g., it is able to stimulate regression of the Mullerian ducts or is cytotoxic to one or more types of ovarian tumor cells, for example, the cell line HOC-21, and preferably, it both stimulates regression of the Mullerian ducts and is cytotoxic to one or more types of ovarian tumor cells) .
  • an MIS-like polypeptide may include amino acids in addition to those of a native MIS protein or it may not include all of the amino acids of native MIS protein. For example, it may include an N-terminal methionine. Also, this polypeptide may be a mature protein or an immature protein or a protein derived from an immature protein (for example, a protein wherein only a portion of the signal sequence has been cleaved).
  • MIS-like polypeptides derived therefrom shall be understood to mean not only a claimed MIS-polypeptide (e.g., bovine MIS or human MIS) but also various related polypeptides of the types described in this paragraph.
  • the present invention relates to DNA sequences and recombinant DNA molecules coding for MIS polypeptides and processes for the production of those polypeptides.
  • bovine MIS protein In our isolation and cloning of a DNA sequence of this invention, we adopted a selection strategy based upon bovine MIS protein. Accordingly, we purified a bovine MIS protein from bovine testes and determined the amino acid sequence of various fragments of that protein. Based on those protein sequences, we then synthesized several antisense oligonucleotide DNA probes corresponding to those regions of purified bovine protein which had minimal nucleotide degeneracy. We then used these probes to screen a bovine cDNA library comprising E.coli cells containing bovine testis cDNA sequences inserted into a phage cloning vector.
  • oligonucleotide probes For screening, we hybridized the oligonucleotide probes to the bovine cDNA library utilizing a plaque hybridization screening assay and we selected clones hybridizing to a number of our probes. After isolating and subcloning the selected bovine cDNA inserts into plasmids, we determined their nucleotide sequences and compared them to our amino acid sequences from peptides of purified bovine MIS protein. As a result of this comparison, we found that the nucleotide sequences of all clones isolated coded for amino acid sequences of bovine MIS protein.
  • the cDNA sequences or genomic DNA sequences of this invention can be operatively-linked to expression control sequences and used in various mammalian or other eukaryotic or prokaryotic host cells to produce the MIS-like polypeptides coded for by them.
  • the cDNA sequences or genomic DNA sequences of the invention are useful as probes to screen human cDNA libraries for other sequences coding for MIS-like polypeptides.
  • the human genomic DNA sequence described above, has several introns. DNA sequences and recombinant DNA molecules wherein one or more or all of these introns are deleted are also considered to be within the scope of the present invention.
  • the bovine and human MIS-like polypeptides (and preferably the human MIS-like polypeptides) of this invention are useful as anti-cancer drugs.
  • such compositions may comprise an anti-cancer effective amount of MIS-like polypeptide of this invention and a pharmaceutically acceptable carrier.
  • Such therapies generally comprise a method of treating patients in a pharmaceutically acceptable manner with those compositions.
  • the pharmaceutical compositions of the present invention may be formulated and administered using methods similar to those used for other pharmaceutically important polypeptides (e.g., alpha-interferon).
  • the polypeptides may be stored in lyophilized form, reconstituted with sterile water just prior to administration, and administered intravenously.
  • the pharmaceutical formulations of the present invention will be administered in dosages and modes of administration similar to those that have been used for MIS protein as disclosed in U.S. Pat. No. 4,510,131, the disclosure of which is hereby incorporated herein by reference.
  • useful cloning or expression vehicles may consist of segments of chromosomal, non-chromosomal and synthetic DNA sequences, such as various known derivatives of SV40 and known bacterial plasmids, e.g., plasmids from E.coli including col El, pCRl, pBR322, pMB9 and their derivatives, wider host range plasmids, e.g., RP4, phage DNAs, e.g., the numerous derivatives of phage ⁇ , e.g., NM 989, and other DNA phages, e.g., M13 and filamentous single-stranded DNA phages and vectors derived from combinations of plasmids and phage DNAs such as plasmids which have been modified to employ phage DNA or other expression control sequence
  • the preferred expression vector is ⁇ gt10 and the preferred host is E.coli BNN102.
  • the preferred expression vectors are pBG311 and pBG312 in Chinese hamster ovary (CHO) cells.
  • each specific cloning or expression vehicle various sites may be selected for insertion of the MIS-like polypeptide DNA sequences of this invention. These sites are usually designated by the restriction endonuclease which cuts them and are well recognized by those of skill in the art. Various methods for inserting DNA sequences into these sites to form recombinant DNA molecules are also well known. These include, for example, dG-dC or dA-dT tailing, direct ligation, synthetic linkers, exonuclease and polymerase-linked repair reactions followed by ligation, or extension of the DNA strand with DNA polymerase and an appropriate single-stranded template followed by ligation. It is, of course, to be understood that a cloning or expression vehicle useful in this invention need not have a restriction endonuclease site for insertion of the chosen DNA fragment. Instead, the vehicle could be joined to the fragment by alternative means.
  • expression control sequences may also be chosen to effect the expression of the DNA sequences of this invention.
  • These expression control sequences include, for example, the lac system, the ⁇ -lactamase system, the trp system, the tac system, the trc system, the major operator and promoter regions of phage ⁇ , the control regions of fd coat protein, the promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, the promoters of acid phosphatase, e.g., Pho5, the promoters of the yeast ⁇ -mating factors, promoters for mammalian cells such as the SV40 early promoter, adenovirus late promoter and metallothionine promoter, and other sequences known to control the expression of genes of prokaryotic or eukaryotic cells or their viruses and various combinations thereof.
  • it is additionally possible to amplify the expression units by linking the gene to that for dihydrofolate reductase and applying a selection
  • these DNA sequences are operatively-linked to one or more of the above-described expression control sequences in the expression vector.
  • Such operative linking which may be effected before or after the chosen MIS-like polypeptide DNA sequence is inserted into a cloning vehicle, enables the expression control sequences to control and promote the expression of the DNA sequence.
  • the vector or expression vehicle, and in particular the sites chosen therein for insertion of the selected DNA fragment and the expression control sequence employed in this invention is determined by a variety of factors, e.g., number of sites susceptible to a particular restriction enzyme, size of the protein to be expressed, expression characteristics such as the location of start and stop codons relative to the vector sequences, and other factors recognized by those of skill in the art.
  • the choice of a vector, expression control sequence, and insertion site for a particular MIS-like polypeptide sequence is determined by a balance of these factors, not all selections being equally effective for a given case.
  • DNA sequences coding for the MIS-like polypeptides of this invention that are inserted at the selected site of a cloning or expression vehicle may include nucleotides which are not part of the actual gene coding for the MIS-like polypeptide or may include only a fragment of the entire gene for that polypeptide. It is only required that whatever DNA sequence is employed, a transformed host will produce a MIS-like polypeptide.
  • the MIS-like polypeptide-related DNA sequences of this invention may be fused in the same reading frame in an expression vector of this invention to at least a portion of a DNA sequence coding for at least one eukaryotic or prokaryotic carrier protein or a DNA sequence coding for at least one eukaryotic or prokaryotic signal sequence, or combinations thereof.
  • Such constructions may aid in expression of the desired MIS-like polypeptide-related DNA sequence, improve purification or permit secretion, and preferably maturation, of the MIS-like polypeptide from the host cell.
  • the MIS-like polypeptide-related DNA sequence may alternatively include an ATG start codon, alone or together with other codons, fused directly to the sequence encoding the first amino acid of a mature native MIS-like polypeptide.
  • Such constructions enable the production of, for example, a methionyl or other peptidyl-MIS like polypeptide, that is part of this invention.
  • This N-terminal methionine or peptide may either then be cleaved intra- or extra-cellularly by a variety of known processes or the MIS-like polypeptide with the methionine or peptide attached may be used, uncleaved, in the pharmaceutical compositions and methods of this invention.
  • the cloning vehicle or expression vector containing the MIS-like polypeptide coding sequences of this invention is employed in accordance with this invention to transform an appropriate host so as to permit that host to express the MIS-like polypeptides for which the DNA sequence codes.
  • Useful cloning or expression hosts may include strains of E.coli, such as E.coli C600, E.coli ED8767, E.coli DHl, E.coli LE392, E.coli HB 101, E.coli X1776, E.coli X2282, E.coli MRCI, E.coli BNN102, E.coli JM83, E.coli JA221, and strains of Pseudomonas, Bacillus, and Streptomyces, yeasts and other fungi, animal hosts, such as CHO cells, COS cells or mouse cells, other animal (including human) hosts, plant cells in culture or other hosts.
  • E.coli such as E.coli C600, E.coli ED8767, E.coli DHl, E.coli LE392, E.coli HB 101, E.coli X1776, E.coli X2282, E.coli MRCI, E.coli BNN102, E.coli JM83, E.coli JA221, and strains of Pse
  • the selection of an appropriate host is also controlled by a number of factors recognized by the art. These include, for example, compatibility with the chosen vector, toxicity of proteins encoded by the hybrid plasmid, susceptibility of the desired protein to proteolytic degradation by host cell enzymes, contamination or binding of the protein to be expressed by host cell proteins difficult to remove during purification, ease of recovery of the desired protein, expression characteristics, bio-safety and cost. A balance of these factors must be struck with the understanding that not all host vector combinations may be equally effective for either the cloning or expression of a particular recombinant DNA molecule.
  • the MIS-like polypeptides may include polypeptides in the form of fused proteins (e.g., linked to a prokaryotic, eukaryotic or combination N-terminal segment to direct excretion, improve stability, improve purification or improve possible cleavage of the N-terminal segment), in the form of a precursor of MIS-like polypeptides (e.g., starting with all or parts of a MIS-like polypeptide signal sequence or other eukaryotic or prokaryotic signal sequences), in the form of a mature MIS-like polypeptide, or in the form of an fmet-MIS-like polypeptide.
  • fused proteins e.g., linked to a prokaryotic, eukaryotic or combination N-terminal segment to direct excretion, improve stability, improve purification or improve possible cleavage of the N-terminal segment
  • a precursor of MIS-like polypeptides e.g., starting with all or parts of a MIS-like poly
  • One particularly useful form of a polypeptide in accordance with this invention, or at least a precursor thereof, is a mature MIS-like polypeptide with an easily cleaved amino acid or series of amino acids attached to the amino terminus.
  • Such construction allows synthesis of the polypeptide in an appropriate host, where a start signal that may not be present in the mature polypeptide is needed, and then cleavage in vivo or in vitro of the extra amino acids to produce mature MIS-like polypeptides.
  • the polypeptides may also be glycosylated, like native MIS protein, unglycosylated, or have a glycosylation pattern different than that of native MIS protein. Such glycosylation will result from the choice of host cell or post-expression treatment chosen for the particular inhibitor.
  • the polypeptides of the invention also include MIS-like polypeptides that are coded for on expression by DNA sequences characterized by different codons for some or all of the codons of the present DNA sequences. These substituted codons may code for amino acids identical to those coded for by the codons replaced but result in higher yield of the polypeptide. Alternatively, the replacement of one or a combination of codons leading to amino acid replacement or to a longer or shorter MIS-like polypeptide may alter its properties in a useful way (e.g., increase the stability, increase the solubility or increase the therapeutic activity).
  • bovine MIS protein from newborn bovine testis by the procedure of Budzik et al. (Cell, 34, 307-314 (1983)). After eluting it from the Matrix Gel Green A column with 0.5M NaCl, we concentrated the bovine MIS fraction (Green-3) and dialyzed against PBS and 0.01% Nonidet-P40 and stored at -70°.
  • MIS Green-3 fraction
  • the two pools of the probes derived from sequences in the tryptic fragments T105-106 and T81 of FIG. 1, were 17-mers with 256 fold degeneracy or 20-mers with 512 fold degeneracy respectively.
  • Double Strand Synthesis 1 We resuspended the cDNA in H 2 O and we set up duplicate second strand reactions each containing 4 ⁇ g cDNA. Each 400 ⁇ l reaction contained 0.02M Tris-HCl pH 7.5, 0.1M KCl, 0.005M MgCl 2 , 0.5mM dATP+100 ⁇ Ci ⁇ -dATP 32 (3000 Ci/mmol, New England Nuclear), 1 mM dCTP, 1 mM dGTP, 1 mM dTTP, 100 u DNA Pol 1 Klenow Fraction (Boehringer Mannheim), and 4 U RNase H (P. L. Biochem).
  • a unique oligomer linker formed by annealing linker 27, a 22-mer with the sequence 5' AATTGAGCT CGA GCG CGG CCG C to 5' phosphorylated linker 28, an 8-mer with the sequence 5' GCG GCC GCG CTC GAG CTC 3'.
  • the annealed linker contained a phosphorylated blunt end for ligation to blunt end cDNA and a nonphosphorylated 5' protruding sequence (AATT) for ligation to EcoRl digested ⁇ gt10.
  • the linker contained recognition sequences for the following restriction enzymes: Alul, Aval, Ban2, Bsp12, Fnu4H, FnuD2, Ha13, Hgi Al, Hhal, HinPl, Notl, Sstl, Xhol, Xma3.
  • oligonucleotide probe 16 was prehybridized and hybridized the filters to oligonucleotide probe 16 in 0.2% polyvinyl-pyrrolidone, 0.2% ficoll (MW 400,000), 0.2% bovine serum albumin, 0.05M Tris-HCl (pH 7.5), lM sodium chloride, 0.1% sodium pyrophosphate, 1% SDS, 10% dextran sulfate (MW 500,000) and 100 ⁇ g/ml tRNA.
  • the first 16 or 17 amino acids of this leader appear to constitute a signal sequence, which enables the protein to be secreted (deduced from Von Heijne analysis, Eur. J. Biochem., 133, 17-21 (1983)).
  • the remaining 7 or 8 amino acids are subsequently cleaved off to generate the mature protein. (It is not clear whether this cleavage is necessary to activate the protein.)
  • a promoter sequence TATA is located upstream from the initiating methionine (34 bp) suggesting that the 5' untranslated region is very short. We confirmed this by the following primer extension experiment which showed that RNA initiation occurs about 10 nucleotides upstream of the initiating ATG.
  • An anti-sense kinased oligomer (5'-A*GTCCCAGGCTTGCTGAAAGATGAGTGCCC 3') was hybridized to poly A + RNA from bovine testes and extended with reverse transcriptase.
  • the primer extension product was sized on a sequencing gel at 166-167 nucleotides. This placed the 5' end of the mRNA 10 or 11 nucleotides upstream from the initiating ATG. This analysis proved that we had isolated the entire gene for bovine MIS which encodes for a 58 Kd protein.
  • the DNA sequence is shown in FIG. 3a. The first 100 bp contain the promoter and 5' untranslated region. This is followed by 1875 bp that encode the bovine MIS protein and 81 bp of 3' untranslated sequence.
  • FIG. 5 shows the general structure of the human gene
  • FIG. 6a-k shows the nucleotide sequence.
  • the first 100 bp contain the human promoter and the 5' untranslated region. This is followed by 2622 bp that contain the five protein coding regions, which are indicated below the DNA sequence. The last 112 bp are the 3' untranslated region.
  • ⁇ HT4 partial clone
  • the human gene in these vectors may be expressed in COS cells and CHO cells.
  • the pBG311 vector uses the SV40 early promoter to drive expression, while the pBG312 vector uses the major late adenovirus-2 promoter.
  • RNA isolated from COS cells 48 hrs after transfection with pBG312.hmis by Northern and Sl analysis. The Sl analysis clearly demonstrated that the human MIS gene was being transcribed and that the RNA was being spliced.
  • E.coli strain JA221 harboring plasmid pBG312.hmis has been deposited with In Vitro International Inc. depository as Deposit No. IVI 10089.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Endocrinology (AREA)
  • Toxicology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Veterinary Medicine (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Physics & Mathematics (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Saccharide Compounds (AREA)
  • Medicines Containing Plant Substances (AREA)
US06/792,880 1985-10-30 1985-10-30 DNA sequences, recombinant DNA molecules and processes for producing mullerian inhibiting substance-like polypeptides Expired - Fee Related US5047336A (en)

Priority Applications (20)

Application Number Priority Date Filing Date Title
US06/792,880 US5047336A (en) 1985-10-30 1985-10-30 DNA sequences, recombinant DNA molecules and processes for producing mullerian inhibiting substance-like polypeptides
AU64521/86A AU606584B2 (en) 1985-10-30 1986-10-29 DNA sequences, recombinant DNA molecules and processes for producing mullerian inhibiting substance-like polypeptides
ZA868251A ZA868251B (en) 1985-10-30 1986-10-29 Dna sequences,recombinant dna molecules and processes for producing mullerian inhibiting substance-like polypeptides
DE3650266T DE3650266T2 (de) 1985-10-30 1986-10-29 DNS-Sequenzen, rekombinante DNS-Moleküle und Verfahren zur Herstellung von "mullerian inhibiting substance"-ähnlichen Polypeptiden.
CA000521767A CA1307753C (en) 1985-10-30 1986-10-29 Dna sequences, recombinant dna molecules and processes for producing mullerian inhibiting substance-like polypeptides
DK517986A DK517986A (da) 1985-10-30 1986-10-29 Dna-sekvenser, rekombinant-dna-molekyler og fremgangsmaade til fremstilling af mueller-inhiberende stof-lignende polypeptider
EP86308400A EP0221761B1 (en) 1985-10-30 1986-10-29 DNA sequences, recombinant DNA molecules and processes for producing mullerian inhibiting substance-like polypeptides
AT86308400T ATE119915T1 (de) 1985-10-30 1986-10-29 Dns-sequenzen, rekombinante dns-moleküle und verfahren zur herstellung von ''mullerian inhibiting substance''-ähnlichen polypeptiden.
HU864535A HUT43627A (en) 1985-10-30 1986-10-29 Dns sequences, recombinant dns molekules, and process for producing mis-like polypeptides
JP61257126A JPH0720431B2 (ja) 1985-10-30 1986-10-30 ミュレル管抑制物質の活性を示すポリペプチドをコードするｄｎａ，組換ｄｎａおよび形質転換宿主
PT83655A PT83655B (en) 1985-10-30 1986-10-30 Dna sequences recombinant dna molecules and processes for producing mullerian inhibiting substance-like polypeptides
KR860009203A KR870004143A (ko) 1985-10-30 1986-10-30 Dna서열, 재조합 dna분자 및 뮬레리안억제 물질류 폴리펩티드의 생산 방법
IL80451A IL80451A0 (en) 1985-10-30 1986-10-30 Dna sequences,recombinant dna molecules,processes for producing mis-like polypeptides and pharmaceutical containing said peptides
JP89502264A JPH03503524A (ja) 1985-10-30 1989-01-25 ミュレル管阻害物質様ポリペプチドの開裂二量体
AU30557/89A AU622891B2 (en) 1985-10-30 1989-01-25 Cleaved dimers of mullerian inhibiting substance-like polypeptides
PCT/US1989/000239 WO1989006695A1 (en) 1985-10-30 1989-01-25 Cleaved dimers of mullerian inhibiting substance-like polypeptides
US08/080,140 US5359033A (en) 1985-10-30 1989-01-25 Cleaved dimers of mullerian inhibiting substance-like polypeptides
EP19890902436 EP0437427A4 (en) 1985-10-30 1989-01-25 Cleaved dimers of mullerian inhibiting substance-like polypeptides
US07/957,061 US5427780A (en) 1985-10-30 1992-10-05 Composition comprising Mullerian inhibiting substance-like polypeptides
JP5178268A JP2541761B2 (ja) 1985-10-30 1993-07-19 ミュレル管抑制物質様ポリペプチドおよびその製造方法

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
US06/792,880 US5047336A (en) 1985-10-30 1985-10-30 DNA sequences, recombinant DNA molecules and processes for producing mullerian inhibiting substance-like polypeptides

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US92387986A Continuation-In-Part 1985-10-30 1986-10-28

Publications (1)

Publication Number Publication Date
US5047336A true US5047336A (en) 1991-09-10

Family

ID=25158349

Family Applications (1)

Application Number Title Priority Date Filing Date
US06/792,880 Expired - Fee Related US5047336A (en) 1985-10-30 1985-10-30 DNA sequences, recombinant DNA molecules and processes for producing mullerian inhibiting substance-like polypeptides

Country Status (13)

Country Link
US (1) US5047336A (ja)
EP (1) EP0221761B1 (ja)
JP (2) JPH0720431B2 (ja)
KR (1) KR870004143A (ja)
AT (1) ATE119915T1 (ja)
AU (1) AU606584B2 (ja)
CA (1) CA1307753C (ja)
DE (1) DE3650266T2 (ja)
DK (1) DK517986A (ja)
HU (1) HUT43627A (ja)
IL (1) IL80451A0 (ja)
PT (1) PT83655B (ja)
ZA (1) ZA868251B (ja)

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0221761A2 (en) * 1985-10-30 1987-05-13 Biogen, Inc. DNA sequences, recombinant DNA molecules and processes for producing mullerian inhibiting substance-like polypeptides
WO1992004444A1 (en) * 1990-09-12 1992-03-19 Zymogenetics, Inc. Methods for producing acyloxyacyl hydrolase
US5310880A (en) * 1991-04-12 1994-05-10 The General Hospital Corporation Purification of Mullerian inhibiting substance
US5354665A (en) * 1988-08-26 1994-10-11 Biogen, Inc. Recombinant DNA processes for producing PI-linked lymphocyte function associated antigen-3
US5427780A (en) * 1985-10-30 1995-06-27 Biogen, Inc. Composition comprising Mullerian inhibiting substance-like polypeptides
US5538892A (en) * 1992-03-18 1996-07-23 The General Hospital Corporation Nucleic acids encoding a TGF-β type 1 receptor
US5661126A (en) * 1989-01-19 1997-08-26 The General Hospital Corporation Use of mullerian inhibiting substance for treating certain tumors and for modulating class I major histocompatibility antigen expression
US6692738B2 (en) 2000-01-27 2004-02-17 The General Hospital Corporation Delivery of therapeutic biologicals from implantable tissue matrices
US20040136987A1 (en) * 1991-10-07 2004-07-15 Biogen, Inc., A Massachusetts Corporation Methods of treating skin conditions using inhibitors of the CD2/LFA-3 interaction
US20040151693A1 (en) * 2002-08-23 2004-08-05 The General Hospital Corporation Use of mullerian inhibiting substance and interferon for treating tumors
US20040265305A1 (en) * 2001-07-24 2004-12-30 Vaishnaw Akshay K. Method for treating or preventing sclerotic disorders using cd-2 binding agents
US20050171016A1 (en) * 1999-03-31 2005-08-04 The General Hospital Corporation, A Massachusetts Corporation Thrombospondin-2 and uses thereof
US20060216294A1 (en) * 2005-03-24 2006-09-28 Mclennan Ian S Method of modulation
US20060233796A1 (en) * 1998-08-31 2006-10-19 Biogen Idec Ma Inc., A Massachusetts Corporation Method of modulating memory effector T-cells and compositions
US20070172478A1 (en) * 2004-02-06 2007-07-26 Astellas Us Llc Methods of treating skin disorders
US20080020383A1 (en) * 2004-05-04 2008-01-24 Genaissance Pharmaceuticals, Inc. Haplotype Markers And Methods Of Using The Same To Determine Response To Treatment
US20080019960A1 (en) * 2004-05-07 2008-01-24 Astellas Us Llc Methods of Treating Viral Disorders
US20090304675A1 (en) * 2005-10-26 2009-12-10 Otago Innovation Limited C/-Td Scott & Co. Method of modulation of mullerian inhibitory substance (mis) receptor for the treatment of neurodegenerative diseases
WO2013190443A1 (en) 2012-06-18 2013-12-27 Signorile Pietro Giulio Anti-mullerian hormone

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0437427A4 (en) * 1985-10-30 1992-07-01 Biogen, Inc. Cleaved dimers of mullerian inhibiting substance-like polypeptides
US5349058A (en) * 1990-02-06 1994-09-20 E. R. Squibb & Sons, Inc. Nucleic acid encoding human mevalonate kinase
WO2001019387A1 (en) * 1999-09-14 2001-03-22 The General Hospital Corporation Use of mullerian inhibiting substance for treating excess androgen states
JP2005525081A (ja) * 2001-06-05 2005-08-25 カレン ケイ． オオイシ 植物からの生物活性ミュラー管抑制物質を含むＴＧＦ−βタンパク質の遺伝子発現および産生法
US20060162026A1 (en) * 2004-12-23 2006-07-20 Karen Oishi Expressing TGF-beta proteins in plant plastids
WO2008116161A2 (en) * 2007-03-22 2008-09-25 The General Hospital Corporation Pyrazoloanthrone and derivatives thereof for the treatment of cancer expressing 'mullerian inhibiting substance' type ii receptor (misrii) and of excess androgen states
US9289492B2 (en) 2007-07-17 2016-03-22 The General Hospital Corporation Collecting ovarian cancer stem cells from ovarian cancer cells
KR20160029731A (ko) * 2013-03-12 2016-03-15 더 제너럴 하스피탈 코포레이션 변형된 뮐러관 억제 물질(mis) 단백질 및 질환 치료를 위한 그 용도
RU2616273C1 (ru) * 2016-04-21 2017-04-13 Федеральное государственное унитарное предприятие "Государственный научно-исследовательский институт особо чистых биопрепаратов" Федерального медико-биологического агентства Синтетическая ДНК, кодирующая антимюллеров гормон человека, содержащий ее экспрессионный вектор pTVK4pu/MISOPT и штамм клеток яичников китайского хомячка CHO-MIS - продуцент рекомбинантного антимюллерового гормона человека

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4404188A (en) * 1981-07-29 1983-09-13 Massachusetts General Hospital Purified Mullerian Inhibiting Substance and method of purification
US4442205A (en) * 1981-09-22 1984-04-10 The United States Of America As Represented By The Department Of Health And Human Services Simian virus recombinant that directs the synthesis of hepatitis B surface antigen
US4487833A (en) * 1982-03-01 1984-12-11 The General Hospital Corporation Method of preparing hybridomas and of purifying immunogenic materials
US4510131A (en) * 1981-07-29 1985-04-09 The General Hospital Corporation Purified Mullerian Inhibiting Substance and method of use
US4740587A (en) * 1985-07-18 1988-04-26 The Salk Institute For Biological Studies Inhibin and method of purifying same

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5047336A (en) * 1985-10-30 1991-09-10 Biogen, Inc. DNA sequences, recombinant DNA molecules and processes for producing mullerian inhibiting substance-like polypeptides

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4404188A (en) * 1981-07-29 1983-09-13 Massachusetts General Hospital Purified Mullerian Inhibiting Substance and method of purification
US4510131A (en) * 1981-07-29 1985-04-09 The General Hospital Corporation Purified Mullerian Inhibiting Substance and method of use
US4442205A (en) * 1981-09-22 1984-04-10 The United States Of America As Represented By The Department Of Health And Human Services Simian virus recombinant that directs the synthesis of hepatitis B surface antigen
US4487833A (en) * 1982-03-01 1984-12-11 The General Hospital Corporation Method of preparing hybridomas and of purifying immunogenic materials
US4740587A (en) * 1985-07-18 1988-04-26 The Salk Institute For Biological Studies Inhibin and method of purifying same

Non-Patent Citations (82)

* Cited by examiner, † Cited by third party
Title
A. Fuller, Jr. et al., "Mullerian Inhibiting Substance Inhibition of a Human Endometrial Carcinoma Cell Line Xenografted in Nude Mice", Gynecologic Oncology, 17, 124-132 (1984) [Fuller et al. II].
A. Fuller, Jr. et al., "Mullerian Inhibiting Substance Inhibits Colony Growth of a Human Ovarian Carcinoma Cell Line", J. Clin. Endocr. Met., 54, 1051-1055 (1982) [Fuller et al. I].
A. Fuller, Jr. et al., "Mullerian Inhibiting Substance Reduction of Colony Growth of Human Gynecologic Cancers in a Stem Cell Assay", Gynecologic Oncology, 22, 135-148 (1985) [Fuller et al. III].
A. Fuller, Jr. et al., Mullerian Inhibiting Substance Inhibition of a Human Endometrial Carcinoma Cell Line Xenografted in Nude Mice , Gynecologic Oncology, 17, 124 132 (1984) Fuller et al. II . *
A. Fuller, Jr. et al., Mullerian Inhibiting Substance Inhibits Colony Growth of a Human Ovarian Carcinoma Cell Line , J. Clin. Endocr. Met., 54, 1051 1055 (1982) Fuller et al. I . *
A. Fuller, Jr. et al., Mullerian Inhibiting Substance Reduction of Colony Growth of Human Gynecologic Cancers in a Stem Cell Assay , Gynecologic Oncology, 22, 135 148 (1985) Fuller et al. III . *
B. Vigier et al., "A Monoclonal Antibody Against Bovine Anti-Mullerian Hormone", Endocrinology, 110, 131-137 (1982) [Vigier et al. I].
B. Vigier et al., "Production of Anti-Mullerian Hormone: Another Homology Between Sertoli and Granulosa Cells", Endocrinology, 114, 1315-1320 (1984) [Vigier et al. II].
B. Vigier et al., A Monoclonal Antibody Against Bovine Anti Mullerian Hormone , Endocrinology, 110, 131 137 (1982) Vigier et al. I . *
B. Vigier et al., Production of Anti Mullerian Hormone: Another Homology Between Sertoli and Granulosa Cells , Endocrinology, 114, 1315 1320 (1984) Vigier et al. II . *
Chemical Week, Jan. 30, 1985, p. 69. *
D. MacLaughlin et al., "Specific Estradiol Binding in Embryonic Mullerian Ducts: A Potential Modulator of Regression in the Male and Female Chick", Endocrinology, 113, 141-145 (1983).
D. MacLaughlin et al., Specific Estradiol Binding in Embryonic Mullerian Ducts: A Potential Modulator of Regression in the Male and Female Chick , Endocrinology, 113, 141 145 (1983). *
D. Swann et al., "Extraction of Mullerian Inhibiting Substance from Newborn Calf Testis", Developmental Biology, 69, 73-84 (1979).
D. Swann et al., Extraction of Mullerian Inhibiting Substance from Newborn Calf Testis , Developmental Biology, 69, 73 84 (1979). *
G. Budzik et al., "A Possible Purification of Mullerian Inhibiting Substance and a Model for Its Mechanism of Action", Developmental Mechanisms: Normal and Abnormal, 171, 207-223 (1985) [Budzik et al. II].
G. Budzik et al., "Enhanced Purification of Mullerian Inhibiting Substance by Lectin Affinity Chromatography", Cell, 21, 909-915 (1980) [Budzik et al. I].
G. Budzik et al., A Possible Purification of Mullerian Inhibiting Substance and a Model for Its Mechanism of Action , Developmental Mechanisms: Normal and Abnormal, 171, 207 223 (1985) Budzik et al. II . *
G. Budzik et al., Cell, 34, 307 314 (1983). *
G. Budzik et al., Cell, 34, 307-314 (1983).
G. Budzik et al., Enhanced Purification of Mullerian Inhibiting Substance by Lectin Affinity Chromatography , Cell, 21, 909 915 (1980) Budzik et al. I . *
H. Ikawa et al., "Cyclic Adenosine 3',5'-Monophosphate Modulation of Mullerian Duct Regression", Endocrinology, 114, 1686-1691 (1984) [Ikawa et al. II].
H. Ikawa et al., Cyclic Adenosine 3 ,5 Monophosphate Modulation of Mullerian Duct Regression , Endocrinology, 114, 1686 1691 (1984) Ikawa et al. II . *
H. Iwaka et al., "Steroid Enhancement of Mullerian Duct Regression", J. Pediatric Surgery, 17, 453-458 (1982) [Ikawa et al. I].
H. Iwaka et al., Steroid Enhancement of Mullerian Duct Regression , J. Pediatric Surgery, 17, 453 458 (1982) Ikawa et al. I . *
H. Shima et al., "Production of Monoclonal Antibodies for Affinity Purification of Bovine Mullerian Inhibiting Substance Activity", Hybridoma, 3, 201-214 (1984).
H. Shima et al., Production of Monoclonal Antibodies for Affinity Purification of Bovine Mullerian Inhibiting Substance Activity , Hybridoma, 3, 201 214 (1984). *
J Y Picard et al., Biosynthesis of Labelled Anti Mullerian Hormone by Fetal Testes: Evidence for the Glycoprotein Nature of the Hormone and for its Disulfide Bonded Structure , Molecular and Cellular Endocrinology, 12, 17 30, (1978) Picard et al. II . *
J Y Picard et al., Purification of Testicular AntiMullerian Hormone Allowing Direct Visualization of the Pure Glycoprotein and Determination of Yield and Purification Factor , Molecular and Cellular Endocrinology, 34, pp. 23 29 (1984) Picard et al., III . *
J Y. Picard et al., Anti Mullerian Hormone: Estimation of Molecular Weight by Gel Filtration , Biomedicine, 25, 147 150 (1976) Picard et al. I . *
J. Hutson et al., "Phosphorylation Events During Mullerian Duct Regression", Science, 223, 586-589, (1984) [Hutson et al., II].
J. Hutson et al., "Steroid Modulation of Mullerian Duct Regression in the Chick Embryo", General and Comparative Endocrinology, 57, 88-102 (1985) [Hutson et al. III].
J. Hutson et al., "The Ontogeny of Mullerian Inhibiting Substance in the Gonads of the Chicken", J. Pediatric Surgery, 16, 822-827 (1981) [Hutson et al. I].
J. Hutson et al., Phosphorylation Events During Mullerian Duct Regression , Science, 223, 586 589, (1984) Hutson et al., II . *
J. Hutson et al., Steroid Modulation of Mullerian Duct Regression in the Chick Embryo , General and Comparative Endocrinology, 57, 88 102 (1985) Hutson et al. III . *
J. Hutson et al., The Ontogeny of Mullerian Inhibiting Substance in the Gonads of the Chicken , J. Pediatric Surgery, 16, 822 827 (1981) Hutson et al. I . *
Jaye et al. (1983), Nucleic Acids Res. 11: 2335 45. *
Jaye et al. (1983), Nucleic Acids Res. 11: 2335-45.
J-Y Picard et al., "Biosynthesis of Labelled Anti-Mullerian Hormone by Fetal Testes: Evidence for the Glycoprotein Nature of the Hormone and for its Disulfide-Bonded Structure", Molecular and Cellular Endocrinology, 12, 17-30, (1978) [Picard et al. II].
J-Y Picard et al., "Purification of Testicular AntiMullerian Hormone Allowing Direct Visualization of the Pure Glycoprotein and Determination of Yield and Purification Factor", Molecular and Cellular Endocrinology, 34, pp. 23-29 (1984) [Picard et al., III].
J-Y. Picard et al., "Anti-Mullerian Hormone: Estimation of Molecular Weight by Gel Filtration", Biomedicine, 25, 147-150 (1976) [Picard et al. I].
M. Fallat et al., "Androgen Stimulation of Nucelotide Pyrophosphatase During Mullerian Duct Regression", Endocrinology, 144, 1592-1598 (1984) [Fallat et al. II].
M. Fallat et al., "The Role of Nucleotide Pyrophosphatase in Mullerian Duct Regression", Developmental Biology, 100, 358-364 (1983) [Fallat et al. I].
M. Fallat et al., Androgen Stimulation of Nucelotide Pyrophosphatase During Mullerian Duct Regression , Endocrinology, 144, 1592 1598 (1984) Fallat et al. II . *
M. Fallat et al., The Role of Nucleotide Pyrophosphatase in Mullerian Duct Regression , Developmental Biology, 100, 358 364 (1983) Fallat et al. I . *
M. G. Blanchard et al., "Source of the Anti-Mullerian Hormone Synthesized by the Fetal Testis: Mullerian-Inhibiting Activity of Fetal Bovine Sertoli Cells in Tissue Culture", Pediat. Res., 8, 968-971 (1974).
M. G. Blanchard et al., Source of the Anti Mullerian Hormone Synthesized by the Fetal Testis: Mullerian Inhibiting Activity of Fetal Bovine Sertoli Cells in Tissue Culture , Pediat. Res., 8, 968 971 (1974). *
M. Hayashi et al., "Immunocytochemical Localization of Mullerian Inhibiting Substance in the Rough Endoplasmic Reticulum and Golgi Apparatus in Sertoli Cells of the Neonatal Calf Testis Using a Monoclonal Antibody", Journal of Histochemistry and Cytochemistry, 32, 649-654 (1984).
M. Hayashi et al., Immunocytochemical Localization of Mullerian Inhibiting Substance in the Rough Endoplasmic Reticulum and Golgi Apparatus in Sertoli Cells of the Neonatal Calf Testis Using a Monoclonal Antibody , Journal of Histochemistry and Cytochemistry, 32, 649 654 (1984). *
M. Mudgett Hunter et al., Monoclonal Antibody to Mullerian Inhibiting Substance , Journal of Immunology, 128, 1327 1333 (1982). *
M. Mudgett-Hunter et al., "Monoclonal Antibody to Mullerian Inhibiting Substance", Journal of Immunology, 128, 1327-1333 (1982).
N. Josso et al., "Mullerian-Inhibiting Activity of Calf Fetal Testes: Relationship to Testosterone and Protein Synthesis", Biology of Reproduction, 13, 163-167 (1975).
N. Josso et al., Mullerian Inhibiting Activity of Calf Fetal Testes: Relationship to Testosterone and Protein Synthesis , Biology of Reproduction, 13, 163 167 (1975). *
N. Josso, "In Vitro Synthesis of Mullerian-Inhibiting Hormone by Seminiferous Tubules Isolated from the Calf Fetal Testis", Endocrinology, 93, 829-834 (1973) [Josso II].
N. Josso, "Permeability of Membranes to the Mullerian-Inhibiting Substance Synthesized by the Human Fetal Testis in Vitro: A Clue to its Biochemical Nature", J. Clin. Endocr., 34, 265-270 (1972) [Josso I].
N. Josso, In Vitro Synthesis of Mullerian Inhibiting Hormone by Seminiferous Tubules Isolated from the Calf Fetal Testis , Endocrinology, 93, 829 834 (1973) Josso II . *
N. Josso, Permeability of Membranes to the Mullerian Inhibiting Substance Synthesized by the Human Fetal Testis in Vitro: A Clue to its Biochemical Nature , J. Clin. Endocr., 34, 265 270 (1972) Josso I . *
P. Donahoe et al., "Mechanism of Action of Mullerian Inhibiting Substance", Ann. Rev. Physiol., 46, 53-65 (1984), [Donahoe et al. VIII].
P. Donahoe et al., "Molecular Dissection of Mullerian Duct Regression", The Role of Extracellular Matrix in Development, 573-595 (1984) [Donahoe et al. IX].
P. Donahoe et al., "Mullerian Duct Regression In The Embryo Correlated with Cytotoxic Activity Against Human Ovarian Cancer", Science, 205, 913-915 (1979) [Donahoe et al. IV].
P. Donahoe et al., "Mullerian Inhibiting Substance Activity in Bovine Fetal, Newborn and Prepubertal Testes", Biology of Reproduction, 16, 238-243 (1977) [Donahoe et al. II].
P. Donahoe et al., "Mullerian Inhibiting Substance in Human Testes After Birth", Journal of Pediatric Surgery, 12, 323-330 (1977) [Donahoe et al. III].
P. Donahoe et al., "Mullerian Inhibiting Substance Inhibits Growth of a Human Ovarian Cancer In Nude Mice", Ann. Surg., 194, 472-480 (1981), [Donahoe et al. V].
P. Donahoe et al., "Mullerian-Inhibiting Substance: An Update", Recent Progress in Hormone Research, 38, 279-330 (1982), [Donahoe et al. VII].
P. Donahoe et al., "The Biochemistry and Biology of Mullerian Inhibiting Substance", Pediatric Andrology, 37-46, 1981 [Donahoe et al. VI].
P. Donahoe et al., "The Production of Mullerian Inhibiting Substance by the Fetal, Neonatal and Adult Rat", Biology of Reproduction, 15, 329-334 (1976) [Donahoe et al. I].
P. Donahoe et al., Ann. Rev. Physiol., 46, 53 65 (1984). *
P. Donahoe et al., Ann. Rev. Physiol., 46, 53-65 (1984).
P. Donahoe et al., Mechanism of Action of Mullerian Inhibiting Substance , Ann. Rev. Physiol., 46, 53 65 (1984), Donahoe et al. VIII . *
P. Donahoe et al., Molecular Dissection of Mullerian Duct Regression , The Role of Extracellular Matrix in Development, 573 595 (1984) Donahoe et al. IX . *
P. Donahoe et al., Mullerian Duct Regression In The Embryo Correlated with Cytotoxic Activity Against Human Ovarian Cancer , Science, 205, 913 915 (1979) Donahoe et al. IV . *
P. Donahoe et al., Mullerian Inhibiting Substance Activity in Bovine Fetal, Newborn and Prepubertal Testes , Biology of Reproduction, 16, 238 243 (1977) Donahoe et al. II . *
P. Donahoe et al., Mullerian Inhibiting Substance in Human Testes After Birth , Journal of Pediatric Surgery, 12, 323 330 (1977) Donahoe et al. III . *
P. Donahoe et al., Mullerian Inhibiting Substance Inhibits Growth of a Human Ovarian Cancer In Nude Mice , Ann. Surg., 194, 472 480 (1981), Donahoe et al. V . *
P. Donahoe et al., Mullerian Inhibiting Substance: An Update , Recent Progress in Hormone Research, 38, 279 330 (1982), Donahoe et al. VII . *
P. Donahoe et al., Recent Progress in Hormone Research, 38, 279 330 (1982). *
P. Donahoe et al., Recent Progress in Hormone Research, 38, 279-330 (1982).
P. Donahoe et al., The Biochemistry and Biology of Mullerian Inhibiting Substance , Pediatric Andrology, 37 46, 1981 Donahoe et al. VI . *
P. Donahoe et al., The Production of Mullerian Inhibiting Substance by the Fetal, Neonatal and Adult Rat , Biology of Reproduction, 15, 329 334 (1976) Donahoe et al. I . *
SCRIP, No. 976, p. 22, Feb. 25, 1985. *
Z. Rosenwaks et al., "In Vitro Inhibition of Endometrial Cancer Growth by a Neonatal Rat Testicular Secretory Product", J. Clin. Endocr. Met., 52, 817-819 (1981).
Z. Rosenwaks et al., In Vitro Inhibition of Endometrial Cancer Growth by a Neonatal Rat Testicular Secretory Product , J. Clin. Endocr. Met., 52, 817 819 (1981). *

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0221761B1 (en) * 1985-10-30 1995-03-15 Biogen, Inc. DNA sequences, recombinant DNA molecules and processes for producing mullerian inhibiting substance-like polypeptides
US5427780A (en) * 1985-10-30 1995-06-27 Biogen, Inc. Composition comprising Mullerian inhibiting substance-like polypeptides
EP0221761A2 (en) * 1985-10-30 1987-05-13 Biogen, Inc. DNA sequences, recombinant DNA molecules and processes for producing mullerian inhibiting substance-like polypeptides
US5354665A (en) * 1988-08-26 1994-10-11 Biogen, Inc. Recombinant DNA processes for producing PI-linked lymphocyte function associated antigen-3
US5661126A (en) * 1989-01-19 1997-08-26 The General Hospital Corporation Use of mullerian inhibiting substance for treating certain tumors and for modulating class I major histocompatibility antigen expression
WO1992004444A1 (en) * 1990-09-12 1992-03-19 Zymogenetics, Inc. Methods for producing acyloxyacyl hydrolase
US5281520A (en) * 1990-09-12 1994-01-25 Zymogenetics, Inc. Method for producing acyloxyacyl hydrolase
US5310880A (en) * 1991-04-12 1994-05-10 The General Hospital Corporation Purification of Mullerian inhibiting substance
US20040136987A1 (en) * 1991-10-07 2004-07-15 Biogen, Inc., A Massachusetts Corporation Methods of treating skin conditions using inhibitors of the CD2/LFA-3 interaction
US7323171B2 (en) 1991-10-07 2008-01-29 Astellas Us Llc Methods of treating skin conditions using inhibitors of the CD2/LFA-3 interaction
US5538892A (en) * 1992-03-18 1996-07-23 The General Hospital Corporation Nucleic acids encoding a TGF-β type 1 receptor
US5547854A (en) * 1992-03-18 1996-08-20 The General Hospital Corporation DNA encoding a receptor for Mullerian inhibitory substance, misr1, and corresponding vectors, cells, probes, and recombinant methods
US20060233796A1 (en) * 1998-08-31 2006-10-19 Biogen Idec Ma Inc., A Massachusetts Corporation Method of modulating memory effector T-cells and compositions
US20050171016A1 (en) * 1999-03-31 2005-08-04 The General Hospital Corporation, A Massachusetts Corporation Thrombospondin-2 and uses thereof
US7078032B2 (en) 2000-01-27 2006-07-18 The General Hospital Corporation Delivery of therapeutic biologicals from implantable tissue matrices
US20040086497A1 (en) * 2000-01-27 2004-05-06 Maclaughlin David T. Delivery of therapeutic biologicals from implantable tissue matrices
US6692738B2 (en) 2000-01-27 2004-02-17 The General Hospital Corporation Delivery of therapeutic biologicals from implantable tissue matrices
US20040265305A1 (en) * 2001-07-24 2004-12-30 Vaishnaw Akshay K. Method for treating or preventing sclerotic disorders using cd-2 binding agents
US7858095B2 (en) 2001-07-24 2010-12-28 Astellas Us Llc Method for treating or preventing sclerotic disorders using CD-2 binding agents
US20040151693A1 (en) * 2002-08-23 2004-08-05 The General Hospital Corporation Use of mullerian inhibiting substance and interferon for treating tumors
US20070172478A1 (en) * 2004-02-06 2007-07-26 Astellas Us Llc Methods of treating skin disorders
US20080020383A1 (en) * 2004-05-04 2008-01-24 Genaissance Pharmaceuticals, Inc. Haplotype Markers And Methods Of Using The Same To Determine Response To Treatment
US20080019960A1 (en) * 2004-05-07 2008-01-24 Astellas Us Llc Methods of Treating Viral Disorders
US7662921B2 (en) 2004-05-07 2010-02-16 Astellas Us Llc Methods of treating viral disorders
US20060216294A1 (en) * 2005-03-24 2006-09-28 Mclennan Ian S Method of modulation
US20090304675A1 (en) * 2005-10-26 2009-12-10 Otago Innovation Limited C/-Td Scott & Co. Method of modulation of mullerian inhibitory substance (mis) receptor for the treatment of neurodegenerative diseases
WO2013190443A1 (en) 2012-06-18 2013-12-27 Signorile Pietro Giulio Anti-mullerian hormone

Also Published As

Publication number Publication date
PT83655A (en) 1986-11-01
KR870004143A (ko) 1987-05-07
JPH06133793A (ja) 1994-05-17
DE3650266T2 (de) 1995-08-31
HUT43627A (en) 1987-11-30
DK517986A (da) 1987-05-01
CA1307753C (en) 1992-09-22
ZA868251B (en) 1988-09-28
JP2541761B2 (ja) 1996-10-09
EP0221761A2 (en) 1987-05-13
PT83655B (en) 1988-11-29
IL80451A0 (en) 1987-01-30
ATE119915T1 (de) 1995-04-15
DE3650266D1 (de) 1995-04-20
EP0221761B1 (en) 1995-03-15
JPS62190084A (ja) 1987-08-20
JPH0720431B2 (ja) 1995-03-08
AU6452186A (en) 1987-05-07
AU606584B2 (en) 1991-02-14
DK517986D0 (da) 1986-10-29
EP0221761A3 (en) 1988-10-12

Similar Documents

Publication Publication Date Title
US5047336A (en) DNA sequences, recombinant DNA molecules and processes for producing mullerian inhibiting substance-like polypeptides
US5767251A (en) Recombinant heterodimeric human fertility hormones, and methods, cells, and vectors and DNA for the production thereof
JP2740417B2 (ja) ヒト神経成長因子の遺伝子組換えによる調製法
US5639640A (en) DNA encoding the beta subunit of human follide stimulating hormone and expression vectors and cells containing same
EP0211894B1 (en) Fsh
US5443825A (en) Human leukemia inhibitory factor
EP0235205B1 (en) Peptide analogues of mammalian insulin-like growth factor-1
EP0043980B1 (en) Mature human leukocyte interferon a, process for its microbial preparation, intermediates therefor and compositions containing it.
AU638402B2 (en) Analogs of fibroblast growth factor
Van Obberghen-Schilling et al. Complementary deoxyribonucleic acid cloning of bovine transforming growth factor-β1
JPH04503812A (ja) メラニン濃縮ホルモンおよびそれを用いた処置法
Wempe et al. Characterization by cDNA cloning of the mRNA of a new growth factor from bovine seminal plasma: acidic seminal fluid protein
US5185431A (en) Recombinant natural killer cell activator
EP0323722A1 (en) Compositions and method for recombinant production of crotalidus venom fibrolase
US5026639A (en) Method to improve mRNA translation and use thereof for production of platelet factor-4
US5187075A (en) Cloning and expression of a variant gene of platelet factor 4 and compositions thereof to modulate immune responses
US5427780A (en) Composition comprising Mullerian inhibiting substance-like polypeptides
US6277822B1 (en) Family of peptides known as xenoxins
EP0511816B1 (en) Neurotrophic peptide derivative
US6280968B1 (en) Human PEC-60-like protein and DNA encoding the same
JPH09295945A (ja) 成熟型骨誘導因子の製造方法
US20030004098A1 (en) Leukaemia inhibitory factor

Legal Events

Date Code Title Description
AS Assignment

Owner name: BIOGEN N.V., 25 PIETERMAAI, WILLEMSTAD, CURACAO, N

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST.;ASSIGNORS:CATE, RICHARD L.;DONAHOE, PATRICIA K.;REEL/FRAME:004504/0852

Effective date: 19851212

Owner name: GENERAL HOSPITAL CORPORATION THE, FRUIT STREET, BO

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST.;ASSIGNOR:DONAHOE, PATRICIA K.;REEL/FRAME:004504/0853

Effective date: 19851212

Owner name: BIOGEN N.V.,NETHERLANDS ANTILLES

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:CATE, RICHARD L.;DONAHOE, PATRICIA K.;REEL/FRAME:004504/0852

Effective date: 19851212

AS Assignment

Owner name: BIOGEN, INC., A MA CORP.

Free format text: MERGER;ASSIGNORS:BIOGEN, INC., A DE CORP. (MERGED INTO);BIOGEN MASSACHUSETTS, INC., A MA CORP. (CHANGED TO);REEL/FRAME:005138/0422

Effective date: 19880930

Owner name: BIOGEN, INC., A CORP. OF DE

Free format text: CHANGE OF NAME;ASSIGNOR:BIOGEN N.V., A CORP. OF THE NETHERLANDS;REEL/FRAME:005138/0384

Effective date: 19880616

REMI Maintenance fee reminder mailed
FPAY Fee payment

Year of fee payment: 4

SULP Surcharge for late payment
LAPS Lapse for failure to pay maintenance fees
FP Lapsed due to failure to pay maintenance fee

Effective date: 19950913

FPAY Fee payment

Year of fee payment: 8

FPAY Fee payment

Year of fee payment: 12

AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF

Free format text: EXECUTIVE ORDER 9424, CONFIRMATORY LICENSE;ASSIGNOR:GENERAL HOSPITAL CORPORATION DBA MASS;REEL/FRAME:021345/0276

Effective date: 19870306

AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:MASSACHUSETTS GENERAL HOSPITAL;REEL/FRAME:024770/0067

Effective date: 19870306

STCH Information on status: patent discontinuation

Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362