US20230072639A1 - New major facilitator superfamily (mfs) protein (bad) in hmo production - Google Patents

New major facilitator superfamily (mfs) protein (bad) in hmo production Download PDF

Info

Publication number
US20230072639A1
US20230072639A1 US17/759,267 US202117759267A US2023072639A1 US 20230072639 A1 US20230072639 A1 US 20230072639A1 US 202117759267 A US202117759267 A US 202117759267A US 2023072639 A1 US2023072639 A1 US 2023072639A1
Authority
US
United States
Prior art keywords
hmos
genetically modified
nucleic acid
modified cell
pglpf
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
US17/759,267
Other languages
English (en)
Inventor
Margit Pedersen
Isotta D'ARRIGO
Katrine Bych KAMPMANN
Manos PAPADAKIS
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Glycom AS
Original Assignee
Glycom A/S
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Glycom A/S filed Critical Glycom A/S
Publication of US20230072639A1 publication Critical patent/US20230072639A1/en
Pending legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10Cells modified by introduction of foreign genetic material
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/20Reducing nutritive value; Dietetic products with reduced nutritive value
    • A23L33/21Addition of substantially indigestible substances, e.g. dietary fibres
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/40Complete food formulations for specific consumer groups or specific purposes, e.g. infant formula
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/12Antidiarrhoeals
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00Preparation of compounds containing saccharide radicals
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00Preparation of compounds containing saccharide radicals
    • C12P19/02Monosaccharides
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01SRADIO DIRECTION-FINDING; RADIO NAVIGATION; DETERMINING DISTANCE OR VELOCITY BY USE OF RADIO WAVES; LOCATING OR PRESENCE-DETECTING BY USE OF THE REFLECTION OR RERADIATION OF RADIO WAVES; ANALOGOUS ARRANGEMENTS USING OTHER WAVES
    • G01S5/00Position-fixing by co-ordinating two or more direction or position line determinations; Position-fixing by co-ordinating two or more distance determinations
    • G01S5/02Position-fixing by co-ordinating two or more direction or position line determinations; Position-fixing by co-ordinating two or more distance determinations using radio waves
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to the field of recombinant production of biological molecules in genetically modified cells. More particularly, it relates to a method for recombinant production of human milk oligosaccharides (HMO) using a genetically modified cell expressing a protein of the major facilitator superfamily (MFS), the protein expressed being Bad.
  • HMO human milk oligosaccharides
  • MFS major facilitator superfamily
  • Human milk represents a complex mixture of carbohydrates, fats, proteins, vitamins, minerals and trace elements.
  • the by far most predominant fraction is represented by carbohydrates, which can be further divided into lactose and more complex oligosaccharides (Human milk oligosaccharides, HMO).
  • lactose is used as an energy source
  • the complex oligosaccharides are not metabolized by the infant.
  • the fraction of complex oligosaccharides accounts for up to 1/10 of the total carbohydrate fraction and consists of probably more than 150 different oligosaccharides.
  • the occurrence and concentration of these complex oligosaccharides are specific to humans and thus cannot be found in large quantities in the milk of other mammals, like for example domesticated dairy animals.
  • HMOs have become of great interest in the last decade, due to the discovery of their important functionality in human development. Besides their prebiotic properties, HMOs have been linked to additional positive effects, which expands their field of application (Kunz C. et al., (2014) Food Oligosaccharides: Production, Analysis and Bioactivity, 1st Edition, p 5-20, Eds. Moreno J. and Luz Sanz M., John Wiley & Sons, Ltd). The health benefits of HMOs have enabled their approval for use in foods, such as infant formulas and foods, and for consumer health products.
  • HMOs Due to the limited availability of HMOs, an effective commercial, i.e., large scale production is highly desirable. Chemical routes to some HMOs have been developed. However, production of HMOs by chemical synthesis, enzymatic synthesis or fermentation has proved to be challenging. The manufacturing of large-scale quantities as well as qualities, required for food and medical applications, through chemical synthesis, has yet to be provided. Furthermore, chemical synthetic routes to HMOs involve several noxious chemicals, which impose a contamination risk to the final product.
  • Fermentation based processes have been developed for several HMOs such as 2′-fucosyllactose, 3-fucosyllactose, lacto-N-tetraose, lacto-N-neotetraose, 3′-sialyllactose and 6′-sialyllactose.
  • Fermentation based processes typically utilize genetically modified bacterial strains, such as recombinant Escherichia coli ( E. coli ).
  • Biotechnological production, such as a fermentation process, of HMOs is a valuable, cost-efficient and large-scale approach to HMO manufacturing. It relies on genetically modified bacteria constructed so as to express the glycosyltransferases needed for synthesis of the desired oligosaccharides and takes advantage of the bacteria's innate pool of nucleotide sugars as HMO precursors.
  • HMO-producing bacterial cells may be genetically modified to increase the limited intracellular pool of nucleotide sugars in the bacteria (WO2012112777), to improve activity of enzymes involved in the HMO production (WO2016040531), or to facilitate the secretion of synthesized HMOs into the extracellular media (WO2010142305, WO2017042382).
  • expression of genes of interest in recombinant cells may be regulated by using particular promoters or other gene expression regulators, like e.g. what has recently been described in WO2019123324.
  • WO2010142305 and WO2017042382 have an advantage in that it allows to reduce the metabolic burden inflicted on the producing cell by high levels of recombinant gene expression, e.g., using methods of WO2012112777, WO2016040531 or WO2019123324.
  • This approach attracts growing attention in recombinant HMO-producing cells engineering, e.g., recently there have been described several new sugar transporter genes encoding proteins and fermentation processes that can facilitate efflux of a recombinantly produced 2′-fucosyllactose (2′-FL), the most abundant HMO of human milk (WO2018077892, US201900323053, US201900323052).
  • the present disclosure shows that overexpression in HMO producing strains of the heterologous gene bad, which encodes the Bad protein from the Major facilitator superfamily (MFS), increases the amount of HMO produced by the cells.
  • MFS Major facilitator superfamily
  • the present invention thus relates to a genetically modified cell capable of producing one or more Human Milk Oligosaccharides (HMOs), wherein said genetically modified cell comprises a heterologous nucleic acid sequence encoding a major facilitator superfamily
  • HMOs Human Milk Oligosaccharides
  • MFS polypeptide shown in SEQ ID NO: 1, or a functional homologue thereof which amino acid sequence is more than 80% identical to SEQ ID NO: 1, such as at least 90, such as at least 95%, such as at least 99% identical to SEQ ID NO: 1.
  • the genetically modified cell according to the present invention can further comprise a nucleic acid sequence comprising a regulatory element for the regulation of the expression of the heterologous nucleic acid sequence.
  • Said regulatory element in one aspect regulates the expression of the MFS polypeptide shown in SEQ ID NO: 1, or a functional homologue thereof which amino acid sequence is more than 80% identical to SEQ ID NO: 1.
  • the amino acid sequence identified herein as SEQ ID NO: 1 is the amino acid sequence that is 100% identical to the amino acid sequence having the GenBank accession ID WP_017489914.1.
  • the MFS transporter protein having the amino acid sequence of SEQ ID NO: 1 is identified herein as “Bad protein” or “Bad transporter” or “Bad”, interchangeably;
  • a nucleic acid sequence encoding Bad protein is identified herein as SEQ ID NO: 2 “Bad coding nucleic acid/DNA” or “bad gene” or “bad”.
  • the present invention shows that use of HMO producing recombinant cells that express Bad protein results in very distinct improvements of the HMO manufacturing process related both to fermentation and purification of the HMOs.
  • the disclosed herein recombinant cells and methods for HMO production provide both higher yields of total produced HMOs, lower by-product formation or by-product-to-product ratio, lower biomass formation per fermentation and facilitated recovery of the HMOs during downstream processing of the fermentation broth.
  • HMOs that consist of either tri or tetra units of monosaccharides, i.e. HMOs that are trisaccharides and tetrasaccharides, e.
  • a genetically modified cell according to the present invention typically further comprises a nucleic acid sequence comprising a regulatory element.
  • the regulatory element can regulate the expression of the nucleic acid encoding a polypeptide of the Major facilitator superfamily (MFS), and can be selected from the group consisting of PglpF and PglpF_SD4.
  • MFS Major facilitator superfamily
  • the invention also relates to a nucleic acid construct comprising a nucleic acid sequence(s) encoding a polypeptide of the Major facilitator superfamily (MFS), wherein the nucleic acid sequence encoding the Major facilitator superfamily (MFS) polypeptide has at least 70% sequence identity to SEQ ID NO: 2, such as at least 80%, such as at least 85%, such as at least 95%, such as at least 99%, as well as to a genetically modified cell comprising the nucleic acid construct, which is Escherichia coli.
  • MFS Major facilitator superfamily
  • the nucleic acid construct comprising a nucleic acid sequence(s) encoding a polypeptide of the Major facilitator superfamily (MFS), wherein the nucleic acid sequence is at least 70% identical to SEQ ID NO: 2.
  • MFS Major facilitator superfamily
  • the invention also provides a method for the biosynthetic production of one or more Human Milk Oligosaccharides (HMOs), the method comprising the steps of:
  • the invention also relates to the use of a genetically modified cell or a nucleic acid construct comprising a heterologous nucleic acid sequence encoding a Major facilitator superfamily (MFS) polypeptide, said nucleic acid sequence having at least 70% sequence identity to SEQ ID NO: 2, for the biosynthetic production of one or more Human Milk Oligosaccharides (HMOs).
  • MFS Major facilitator superfamily
  • the corresponding one or more HMOs are produced in high yields, while by-product and biomass formation is reduced. This facilitates recovery of the HMOs during downstream processes, e.g. the overall recovery and purification procedure may comprise less steps and overall time of purification may be shortened.
  • FIG. 1 shows the relative 3-FL production of modified E. coli strain (Strain 1) with and without the expression of the Bad MFS transporter protein with SEQ ID NO: 1, Strain 2 and Strain 1, respectively. Data is obtained from a deep-well feed batch assay.
  • FIG. 2 shows the relative distribution of 3-FL inside and outside the cells in modified E. coli strain (Strain 1) with and without the expression of the Bad MFS transporter protein with SEQ ID NO: 1, Strain 2 and Strain 1, respectively. Data is obtained from a deep-well feed batch assay.
  • FIG. 3 shows the relative 2′-FL production of modified E. coli strain (Strain 3) with and without the expression of the Bad MFS transporter protein with SEQ ID NO: 1, Strain 4 and Strain 3, respectively. Data is obtained from a deep-well feed batch assay.
  • FIG. 4 shows relative distribution of 2′-FL inside and outside the cells in modified E. coli strain (Strain 3) with and without the expression of the Bad MFS transporter protein with SEQ ID NO: 1, Strain 4 and 5, versus Strain 3, respectively. Data is obtained from a deep-well feed batch assay.
  • FIG. 5 shows the percentage (%) relative LNnT concentrations in total samples for seven strains that express GlcNacT and Gal4T genes and a heterologous transporter gene, yberC0001_9420, bad, fred, marc, vag, nec, or yabM, correspondingly.
  • the strain MP3672 expresses the glycosyltransferase genes and no transporter genes;
  • FIG. 6 shows the percentage (%) relative LNnT concentrations in the supernatant of cells expressing vag or yabM.
  • the present invention in general relates to a genetically modified cell for efficient production of oligosaccharides and use of said genetically modified cell in a method of producing the oligosaccharides.
  • the present invention relates to a genetically modified cell enabled to synthesize an oligosaccharide, preferably a heterologous oligosaccharide, in particular a human milk oligosaccharide (HMO).
  • HMO human milk oligosaccharide
  • a genetically modified cell of the invention is modified to express a set of recombinant nucleic acids that are necessary for synthesis of one or more HMOs by the cells (which enable the host cell to synthesize one or more HMOs), such as genes encoding one or more enzymes with glycosyltransferase activity as described below.
  • the oligosaccharide producing recombinant cell of the invention is further modified to comprise a heterologous recombinant nucleic acid sequence, preferably, a DNA sequence, encoding a putative MFS (major facilitator superfamily) transporter protein, originating from the bacterium Rouxiella badensis.
  • the invention relates to a genetically modified cell optimized for the production of one or more particular oligosaccharides, in particular one or more particular HMOs, comprising a recombinant nucleic acid encoding a Bad protein.
  • a nucleic acid sequence encoding a Bad protein having the nucleic acid sequence of SEQ ID NO: 2 is herein identified as “Bad coding nucleic acid/DNA” or “bad gene” or “bad”.
  • the MFS transporter protein identified herein as “Bad protein” or “Bad transporter” or “Bad”, interchangeably, has the amino acid sequence of SEQ ID NO: 1;
  • the amino acid sequence identified herein as SEQ ID NO: 1 is an amino acid sequence that has 100% identity with the amino acid sequence having the GenBank accession ID WP_017489914.1.
  • one aspect of the invention relates to a genetically modified cell capable of producing one or more Human Milk Oligosaccharides (HMOs), wherein said genetically modified cell comprises a heterologous nucleic acid sequence encoding a polypeptide capable of sugar transportation, said nucleic acid sequence having at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably at least 95% and even more preferably at least 99% sequence identity to SEQ ID NO: 2.
  • HMOs Human Milk Oligosaccharides
  • the invention relates to a genetically modified cell optimized for the production of one or more particular oligosaccharides, in particular one or more particular HMOs, comprising a recombinant nucleic acid encoding a protein having at least 80%, such as at least 90% sequence identity, preferably at least 95%, more preferably at least 97%, more preferably at least 98%, and even more preferably at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 1.
  • one aspect of the invention relates to a genetically modified cell capable of producing one or more Human Milk Oligosaccharides (HMOs), wherein said genetically modified cell comprises a heterologous nucleic acid sequence encoding a polypeptide capable of sugar transportation, said nucleic acid sequence having at least 70%, more preferably at least 75%, more preferably at least 80% more preferably at least 90% and even more preferably at least 95%, such as 99% sequence identity to SEQ ID NO: 2.
  • HMOs Human Milk Oligosaccharides
  • another aspect of the invention relates to a genetically modified cell capable of producing one or more HMOs, wherein said cell comprises a recombinant nucleic acid encoding a protein of SEQ ID NO: 1, or a functional homologue thereof which amino acid sequence is at least 80% identical, preferably at least 90%, more preferably at least 95%, more preferably at least 97%, more preferably at least 99% identical to SEQ ID NO: 1.
  • a functional homolog in the present context is meant a protein that has an amino acid sequence that is at least 80%, such as 90%-99.9% identical to SEQ ID NO: 1 and has a function that is beneficial to achieve at least one advantageous effect of the invention, e.g. an increase of the total HMO production or of a selection of HMO by the genetically modified cell, facilitate recovery of the produced HMO(s), HMO production efficiency and/or viability of an HMO producing cell.
  • MFS Major Facilitator Superfamily
  • MFS transporter means in the present context a protein that facilitates transport of an oligosaccharide, preferably, an HMO, through the cell membrane, preferably transport of an HMO/oligosaccharide synthesized by the genetically modified cell from the cell cytosol to the cell medium, preferably an HMO/oligosaccharide comprising three or four sugar units, e.g. 2′-FL, 3-FL, LNT-2, LNT, LNnT, 3′-SL or 6′-SL. Additionally, or alternatively, the MFS transporter may also facilitate efflux of molecules that are not considered HMO or oligosaccharides according to the present invention, such as lactose, glucose, cell metabolites or toxins.
  • sequence identity of [a certain] %” in the context of two or more nucleic acid or amino acid sequences means that the two or more sequences have nucleotides or amino acid residues in common in the given percent when compared and aligned for maximum correspondence over a comparison window or designated sequences of nucleic acids or amino acids (i.e. the sequences have at least 90 percent (%) identity).
  • Percent identity of nucleic acid or amino acid sequences can be measured using a BLAST 2.0 sequence comparison algorithm with default parameters, or by manual alignment and visual inspection (see e.g. http://www.ncbi.nlm.nih.gov/BLAST/).
  • BLAST 2.2.20+ is used to determine percent sequence identity for the nucleic acids and proteins of the invention. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/).
  • sequence alignment algorithms are CLUSTAL Omega (http://www.ebi.ac.uk/Tools/msa/clustalo/), EMBOSS Needle (http://www.ebi.ac.uk/Tools/psa/emboss_needle/), MAFFT (http://mafft.cbrc.jp/alignment/server/) or MUSCLE (http://www.ebi.ac.uk/Tools/msa/muscle/).
  • oligosaccharide means a saccharide polymer containing a number of monosaccharide units.
  • preferred oligosaccharides are saccharide polymers consisting of three or four monosaccharide units, i.e. trisaccharides or tetrasaccharides.
  • Preferable oligosaccharides of the invention are human milk oligosaccharides (HMOs).
  • human milk oligosaccharide or “HMO” in the present context means a complex carbohydrate found in human breast milk (for reference, see Urashima et al.: Milk Oligosaccharides. Nova Science Publisher (2011); or Chen, Adv. Carbohydr. Chem. Biochem. 72, 113 (2015)).
  • the HMOs have a core structure comprising a lactose unit at the reducing end that can be elongated by one or more ⁇ -N-acetyl-lactosaminyl and/or one or more ⁇ -lacto-N-biosyl units, and this core structure can be substituted by an ⁇ -L-fucopyranosyl and/or an ⁇ -N-acetyl-neuraminyl (sialyl) moiety.
  • the non-acidic (or neutral) HMOs are devoid of a sialyl residue, and the acidic HMOs have at least one sialyl residue in their structure.
  • the non-acidic (or neutral) HMOs can be fucosylated or non-fucosylated.
  • neutral non-fucosylated HMOs include lacto-N-triose 2 (LNT-2) lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), lacto-N-neohexaose (LNnH), para-lacto-N-neohexaose (pLNnH), para-lacto-N-hexaose (pLNH) and lacto-N-hexaose (LNH).
  • neutral fucosylated HMOs examples include 2′-fucosyllactose (2′-FL), lacto-N-fucopentaose I (LNFP-I), lacto-N-difucohexaose I (LNDFH-I), 3-fucosyllactose (3-FL), difucosyllactose (DFL), lacto-N-fucopentaose II (LNFP-II), lacto-N-fucopentaose III (LNFP-III), lacto-N-difucohexaose III (LNDFH-III), fucosyl-lacto-N-hexaose II (FLNH-II), lacto-N-fucopentaose V (LNFP-V), lacto-N-difucohexaose II (LNDFH-II), fucosyl-lacto-N-hexaose I (FLNH-
  • acidic HMOs examples include 3′-sialyllactose (3′-SL), 6′-sialyllactose (6′-SL), 3-fucosyl-3′-sialyllactose (FSL), 3′-O-sialyllacto-N-tetraose a (LST a), fucosyl-LST a (FLST a), 6′-O-sialyllacto-N-tetraose b (LST b), fucosyl-LST b (FLST b), 6′-O-sialyllacto-N-neotetraose (LST c), fucosyl-LST c (FLST c), 3′-O-sialyllacto-N-neotetraose (LST d), fucosyl-LST d (FLST d), sialyl-lacto-N-hexaose (SL
  • tri-HMOs and tetra-HMOs may be a preferred, e.g. trisaccharides 2′-FL, 3-FL, LNT-2, 3′-SL, 6′-SL, and tetrasaccharides DFL, LNT, LNnT, FSL.
  • tri-HMOs are preferred, in particular trisaccharides selected from 2′-FL and 3-FL, and tetrasaccharides selected from DFL and LNT.
  • 2′-Fucosyllactose (2′-FL or 2′O-fucosyllactose) is a trisaccharide, more precisely, fucosylated, neutral trisaccharide composed of L-fucose, D-galactose, and D-glucose units (Fuc ⁇ 1-2Gal ⁇ 1-4Glc). It is the most prevalent human milk oligosaccharide (HMO) naturally present in human breast milk, making up about 30% of all of HMOs. In a genetically modified cell or in an enzymatic reaction, 2′-FL is produced primarily by an ⁇ -1,2-fucosyltransferase enzymatic reaction with lactose and a fucosyl doner.
  • HMO human milk oligosaccharide
  • 3-Fucosyllactose is a trisaccharide, more precisely, fucosylated, neutral trisaccharide composed of D-galactose, L-fucose, and D-glucose (Gal ⁇ 1-4(Fuc ⁇ 1-3)Glc). It is naturally present in human milk.
  • 3-FL is produced primarily by an ⁇ -1,3-fucosyltransferase or ⁇ -1,3/4-fucosyltransferase enzymatic reaction with lactose and a fucosyl doner.
  • Lacto-N-tetraose is a tetrasaccharide, more precisely, a neutral tetrasaccharide composed of galactose, N-acetylglucosamine, galactose, and glucose (GlcNAc ⁇ 1-3Gal ⁇ 1-4Glc). It is naturally present in human milk.
  • Difucosyllactose (DFL or 2′,3-di-O-fucosyllactose) is an oligosaccharide, more precisely, focusylated neutral tetrasaccharide composed of L-fucose, D-galactose, L-fucose, and D-glucose (Fuc ⁇ 1-2Gal ⁇ 1-4(Fuc ⁇ 1-3)Glc). It is naturally present in human milk.
  • DFL is produced primarily by an ⁇ -1,2-fucosyltransferase, ⁇ -1,3-fucosyltransferase and/or ⁇ -1,3/4-fucosyltransferase enzymatic reaction with lactose and two fucosyl doners.
  • the recombinant cell of the invention comprises at least one recombinant nucleic acid which encodes a functional enzyme with glycosyltransferase activity.
  • the galactosyltransferase gene may be integrated into the genome (by chromosomal integration) of the genetically modified cell, or alternatively, it may be comprised in a plasmid DNA and expressed as plasmid-borne. If two or more glycosyltransferases are needed for the production of an HMO, e.g.
  • two or more recombinant nucleic acids encoding different enzymes with glycosyltransferase activity may be integrated in the genome and/or expressed from a plasmid, e.g. a ⁇ -1,3-N-acetylglucosaminyltransferase (a first recombinant nucleic acid encoding a first glycosyltransferase) in combination with a ⁇ -1,3-galactosyltransferase (a second recombinant nucleic acid encoding a second glycosyltransferase) for the production of LNT, where the first and second recombinant nucleic acid can independently from each other be integrated chromosomally or on a plasmid.
  • a plasmid e.g. a ⁇ -1,3-N-acetylglucosaminyltransferase (a first recombinant nucleic acid encoding
  • both the first and second recombinant nucleic acids are stably integrated into the chromosome of the production cell; in another embodiment at least one of the first and second glycosyltransferase is plasmid-borne.
  • a protein/enzyme with glycosyltransferase activity may be selected in different embodiments from enzymes having the activity of ⁇ -1,2-fucosyltransferase, ⁇ -1,3-fucosyltransferase, ⁇ -1,3/4-fucosyltransferase, ⁇ -1,4-fucosyltransferase ⁇ -2,3-sialyltransferase, ⁇ -2,6-sialyltransferase, acetylglucosaminyltransferase, ⁇ -1,6-N-acetylglucosaminyltransferase, ⁇ -1,3-galactos
  • the production of 2′-FL requires that the modified cell expresses an active ⁇ -1,2-fucosyltransferase enzyme; for the production of 3-FL the modified cell needs expression of an active ⁇ -1,3-fucosyltransferase enzyme; for the production of LNT the modified cell need to express at least two glycosyltransferases, a ⁇ -1,3-N-acetylglucosaminyltransferase and a ⁇ -1,3-galactosyltransferase; for the production of 6′-SL the modified cell has to express an active ⁇ -2,6-sialyltransferase enzyme and a pathway for CMP-sialic acid synthesis; for the production of 3′-SL the modified cell has to express an active ⁇ -2,3-sialyltransferase enzyme and a pathway for CMP-sialic acid synthesis.
  • An aspect of the present invention is the provision of a nucleic acid construct comprising a heterologous nucleic acid sequence(s) encoding a polypeptide capable of sugar transportation which is a major facilitator superfamily (MFS) polypeptide as shown in SEQ ID NO: 1, or a functional homologue thereof which amino acid sequence is at least 80% identical to SEQ ID NO: 1, wherein the nucleic acid sequence encoding the sugar transportation polypeptide has at least 70% sequence identity to SEQ ID NO: 2.
  • MFS major facilitator superfamily
  • heterologous nucleic acid sequence “recombinant gene/nucleic acid/DNA encoding” or “coding nucleic acid sequence” is meant an artificial nucleic acid sequence (i.e. produced in vitro using standard laboratory methods for making nucleic acid sequences) that comprises a set of consecutive, non-overlapping triplets (codons) which is transcribed into mRNA and translated into a polypeptide whened under the control of the appropriate control sequences, i.e. promoter.
  • the boundaries of the coding sequence are generally determined by a ribosome binding site located just upstream of the open reading frame at the 5′end of the mRNA, a transcriptional start codon (AUG, GUG or UUG), and a translational stop codon (UAA, UGA or UAG).
  • a coding sequence can include, but is not limited to, genomic DNA, cDNA, synthetic, and recombinant nucleic acid sequences.
  • nucleic acid includes RNA, DNA and cDNA molecules. It is understood that, as a result of the degeneracy of the genetic code, a multitude of nucleotide sequences encoding a given protein may be produced.
  • nucleic acid is used interchangeably with the term “polynucleotide”.
  • oligonucleotide is a short chain nucleic acid molecule.
  • Primer is an oligonucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a nucleic acid strand is induced, (i.e., in the presence of nucleotides and an inducing agent such as
  • the primer is preferably single stranded for maximum efficiency in amplification but may alternatively be double stranded. If double stranded, the primer is first treated to separate its strands before being used to prepare extension products.
  • the primer is a deoxyribonucleotide sequence.
  • the primer must be sufficiently long to prime the synthesis of extension products in the presence of the inducing agent. The exact lengths of the primers will depend on many factors, including temperature, source of primer and the use of the method.
  • the recombinant nucleic sequence of the invention may be a coding DNA sequence, e.g. a gene, or non-coding DNA sequence, e.g. a regulatory DNA, such as a promoter sequence.
  • a recombinant cell comprising recombinant DNA sequences encoding enzymes necessary for the production of one or more HMOs and a DNA sequence encoding Bad transporter.
  • the invention relates to a nucleic acid construct comprising a coding nucleic sequence, i.e. recombinant DNA sequence of a gene of interest, e.g.
  • a glycosyltransferase gene or the bad gene and a non-coding DNA sequence, e.g. a promoter DNA sequence, e.g. a recombinant promoter sequence derived from the promoter of lac operon or an glp operon, or a promoter sequence derived from another genomic promoter DNA sequence, or a synthetic promoter sequence, wherein the coding and promoter sequences are operably linked.
  • a promoter DNA sequence e.g. a recombinant promoter sequence derived from the promoter of lac operon or an glp operon, or a promoter sequence derived from another genomic promoter DNA sequence, or a synthetic promoter sequence, wherein the coding and promoter sequences are operably linked.
  • operably linked refers to a functional relationship between two or more nucleic acid (e.g., DNA) segments. Typically, it refers to the functional relationship of a transcriptional regulatory sequence to a transcribed sequence.
  • a promoter sequence is operably linked to a coding sequence if it stimulates or modulates the transcription of the coding sequence in an appropriate host cell or other expression system.
  • promoter transcriptional regulatory sequences that are operably linked to a transcribed sequence are physically contiguous to the transcribed sequence, i.e., they are cis-acting.
  • the nucleic acid construct of the invention may be a part of the vector DNA, in another embodiment the construct it is an expression cassette/cartridge that is integrated in the genome of a host cell.
  • nucleic acid construct means an artificially constructed segment of nucleic acid, in particular a DNA segment, which is intended to be ‘transplanted’ into a target cell, e.g. a bacterial cell, to modify expression of a gene of the genome or express a gene/coding DNA sequence which may be included in the construct.
  • the nucleic acid construct contains a recombinant DNA sequence comprising two or more recombinant DNA sequences: essentially, a non-coding DNA sequence comprising a promoter DNA sequence and a coding DNA sequence encoding a gene of interest, e.g. Bad protein, a glycosyltransferase, of another gene useful for production of an HMO in a host cell.
  • the construct comprises further non-coding DNA sequences that either regulate transcription or translation of the coding DNA of the construct, e.g. a DNA sequence facilitating ribosome binding to the transcript, a leading DNA sequence that stabilize the transcript.
  • Integration of the recombinant nucleic acid of interest comprised in the construct (expression cassette) into the bacterial genome can be achieved by conventional methods, e.g. by using linear cartridges that contain flanking sequences homologous to a specific site on the chromosome, as described for the attTn7-site (Waddell C. S. and Craig N. L., Genes Dev. (1988) February; 2(2):137-49.); methods for genomic integration of nucleic acid sequences in which recombination is mediated by the Red recombinase function of the phage ⁇ or the RecE/RecT recombinase function of the Rac prophage (Murphy, J Bacteriol.
  • a single copy of the expression cassette comprising a gene of interest may be sufficient to secure production of a desired HMO and achieve the desired effects according to the invention. Accordingly, in some preferred embodiments, the invention relates to a recombinant HMO producing cell that comprises one, two or three copies of a gene of interest integrated in the genomic DNA of the cell. In some embodiments the single copy of the gene is preferred.
  • recombinant coding nucleic acid sequence of the nucleic acid construct of the invention is heterologous with respect to the promoter, which means that in the equivale native coding sequence in the genome of species of origin is transcribed under control of another promoter sequence (i.e. not the promoter sequence of the construct).
  • the coding DNA may be either heterologous (i.e. derived from another biological species or genus), such as e.g. the DNA sequence encoding Bad protein expressed in Escherichia coli host cells, or homologous (i.e. derived from the host cell), such as e.g. genes of the colonic acid operon, the wca genes.
  • the construct of the invention comprising a gene related to biosynthetic production of an HMO, a promoter DNA sequence, and other regulatory sequences, such as a ribosomal binding site sequence (e.g. Shine-Dalgarno sequence), expressed in the genetically modified cell enables production of the HMO at the level of at least 0.03 g/OD (optical density) of 1 liter of the fermentation media comprising a suspension of genetically modified cell s, e.g., at the level of around 0.05 g/l/OD to around 0.5 g/l/OD.
  • a ribosomal binding site sequence e.g. Shine-Dalgarno sequence
  • the later level of HMO production is regarded as “sufficient” and the genetically modified cell capable of producing this level of a desired HMO is regarded as “suitable genetically modified cell”, i.e. the cell can be further modified to express the HMO transporter protein, e.g. Bad, to achieve at least one effect described herein that is advantageous for the HMO production.
  • suitable genetically modified cell i.e. the cell can be further modified to express the HMO transporter protein, e.g. Bad, to achieve at least one effect described herein that is advantageous for the HMO production.
  • the genetically modified cell or the nucleic acid construct of the present invention comprises a nucleic acid sequence such as a heterologous gene encoding a putative MFS (major facilitator superfamily) transporter protein.
  • a MFS transporter of particular interest in the present invention is Bad protein.
  • a nucleic acid construct of the present invention therefore contains a nucleic acid sequence having at least 70% sequence identity to the gene, bad, SEQ ID NO: 2.
  • the nucleic acid sequence contained in the genetically modified cell or in nucleic acid construct encodes for a protein of SEQ ID NO: 1, or a functional homologue thereof which amino acid sequence is at least 80%, such as at least 85%, 90%, 95% or 99% identical to SEQ ID NO: 1.
  • a functional homologue of the protein of SEQ ID NO: 1 may be obtained by mutagenesis.
  • the functional homologue should have a remaining functionality of at least 50%, such as 60%, 70%, 80%, 90% or 100% compared to the functionality of amino acid sequence of SEQ ID NO: 1.
  • the functional homologue can have a higher functionality compared to the functionality of amino acid sequence of SEQ ID NO: 1.
  • the functional homologue of SEQ ID NO: 1, should be able to enhance HMO production of the genetically modified cell according to the invention.
  • a “genetically modified cell” as used herein is understood as a cell which has been transformed or transfected, by a heterologous polynucleotide sequence.
  • the terms a “genetically modified cell” and “a host cell” are used interchangeably.
  • a “genetically modified cell” or “genetically modified cell” is in the present context understood as a host cell which has been transformed or transfected by an exogenous polynucleotide sequence.
  • the genetically modified cell is preferably a prokaryotic cell.
  • Appropriate microbial cells that may function as a host cell include yeast cells, bacterial cells, archaebacterial cells, algae cells, and fungal cells.
  • the genetically modified cell may be e.g. a bacterial or yeast cell. In one preferred embodiment, the genetically modified cell is a bacterial cell.
  • the bacterial host cells there are, in principle, no limitations; they may be eubacteria (gram-positive or gram-negative) or archaebacteria, as long as they allow genetic manipulation for insertion of a gene of interest and can be cultivated on a manufacturing scale.
  • the host cell has the property to allow cultivation to high cell densities.
  • Non-limiting examples of bacterial host cells that are suitable for recombinant industrial production of an HMO(s) according to the invention could be Erwinia herbicola ( Pantoea agglomerans ), Citrobacter freundii, Pantoea citrea, Pectobacterium carotovorum, or Xanthomonas campestris.
  • Bacteria of the genus Bacillus may also be used, including Bacillus subtilis, Bacillus licheniformis, Bacillus coagulans, Bacillus thermophilus, Bacillus laterosporus, Bacillus megaterium, Bacillus mycoides, Bacillus pumilus, Bacillus lentus, Bacillus cereus, and Bacillus circulans.
  • bacteria of the genera Lactobacillus and Lactococcus may be modified using the methods of this invention, including but not limited to Lactobacillus acidophilus, Lactobacillus salivarius, Lactobacillus plantarum, Lactobacillus helveticus, Lactobacillus delbrueckii, Lactobacillus rhamnosus, Lactobacillus bulgaricus, Lactobacillus crispatus, Lactobacillus gasseri, Lactobacillus casei, Lactobacillus reuteri, Lactobacillus jensenii, and Lactococcus lactis.
  • Lactobacillus acidophilus Lactobacillus salivarius
  • Lactobacillus plantarum Lactobacillus helveticus
  • Lactobacillus delbrueckii Lactobacillus rhamnosus
  • Lactobacillus bulgaricus Lactobacillus crispatus
  • Lactobacillus gasseri Lactobacillus
  • Streptococcus thermophiles and Proprionibacterium freudenreichii are also suitable bacterial species for the invention described herein. Also included as part of this invention are strains, modified as described here, from the genera Enterococcus (e.g., Enterococcus faecium and Enterococcus thermophiles ), Bifidobacterium (e.g., Bifidobacterium longum, Bifidobacterium infantis, and Bifidobacterium bifidum ), Sporolactobacillus spp., Micromomospora spp., Micrococcus spp., Rhodococcus spp., and Pseudomonas (e.g., Pseudomonas fluorescens and Pseudomonas aeruginosa ).
  • Enterococcus e.g., Enterococcus faecium and Enterococc
  • Bacteria comprising the characteristics described herein are cultured in the presence of lactose, and an oligosaccharide, such as an HMO, produced by the cell is retrieved, either from the bacterium itself or from a culture supernatant of the bacterium.
  • the genetically modified cell of the invention is an Escherichia coli cell.
  • the host cell is a yeast cell e.g. Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, Kluveromyces lactis, Kluveromyces marxianus, etc.
  • Genetically modified cells of the invention can be provided using standard methods of the art e.g. those described in the manuals by Sambrook et al., Wilson & Walker, “Maniatise et al., and Ausubel et al.
  • a host suitable for the HMO production may comprise an endogenous ⁇ -galactosidase gene or an exogenous ⁇ -galactosidase gene, e.g. E. coli comprises an endogenous lacZ gene (e.g., GenBank Accession Number V00296 (GI:41901)).
  • an HMO-producing host cell is genetically manipulated to either comprise any ⁇ -galactosidase gene or to comprise the gene that is inactivated.
  • the gene may be inactivated by a complete or partial deletion of the corresponding nucleic acid sequence from the bacterial genome, or the gene sequence is mutated in the way that it is transcribed, or, if transcribed, the transcript is not translated or if translated to a protein (i.e. ⁇ -galactosidase), the protein does not have the corresponding enzymatic activity.
  • the HMO-producing bacterium accumulates an increased intracellular lactose pool which is beneficial for the production of HMOs.
  • the engineered cell e.g. bacterium
  • sialic acid catabolic pathway is meant a sequence of reactions, usually controlled and catalyzed by enzymes, which results in the degradation of sialic acid.
  • An exemplary sialic acid catabolic pathway described herein is the E. coli pathway.
  • sialic acid (Neu5Ac; N-acetylneuraminic acid) is degraded by the enzymes NanA (N-acetylneuraminic acid lyase) and NanK (N-acetylmannosamine kinase) and NanE (N-acetylmannosamine-6-phosphate epimerase), all encoded from the nanATEK-yhcH operon, and repressed by NanR (http://ecocyc.org/ECOLI).
  • NanA N-acetylneuraminic acid lyase
  • NanK N-acetylmannosamine kinase
  • NanE N-acetylmannosamine-6-phosphate epimerase
  • nanA N-acetylneuraminate lyase
  • nanK N-acetylmannosamine kinase
  • nanE N-acetylmannosamine-6-phosphate epimerase, GI: 947745, incorporated herein by reference
  • the nanT (N-acetylneuraminate transporter) gene is also inactivated or mutated.
  • nanA is mutated.
  • nanA and nanK are mutated, while nanE remains functional.
  • nanA and nanE are mutated, while nanK has not been mutated, inactivated or deleted.
  • a mutation is one or more changes in the nucleic acid sequence coding the gene product of nanA, nanK, nanE, and/or nanT.
  • the mutation may be 1, 2, up to 5, up to 10, up to 25, up to 50 or up to 100 changes in the nucleic acid sequence.
  • the nanA, nanK, nanE, and/or nanT genes are mutated by a null mutation. Null mutations as described herein encompass amino acid substitutions, additions, deletions, or insertions, which either cause a loss of function of the enzyme (i.e. reduced or no activity) or loss of the enzyme (i.e. no gene product).
  • mutated is meant that the coding region is removed completely or in part such that no (functional) gene product is produced.
  • inactivated is meant that the coding sequence has been altered such that the resulting gene product is functionally inactive or encodes for a gene product with less than 100%, e.g. 90%, 80%, 70%, 60%, 50%, 40%, 30% or 20% of the activity of the native, naturally occurring, endogenous gene product.
  • a “not mutated” gene or protein does not differ from a native, naturally-occurring, or endogenous coding sequence by 1, 2, up to 5, up to 10, up to 20, up to 50, up to 100, up to 200 or up to 500 or more codons, or to the corresponding encoded amino acid sequence.
  • the bacterium may also comprise a sialic acid synthetic capability.
  • the bacterium comprises a sialic acid synthetic capability through provision of an exogenous UDP-GlcNAc 2-epimerase (e.g., neuC of Campylobacter jejuni (GenBank AAK91727.1) or equivalent (e.g. (GenBank CAR04561.1), a Neu5Ac synthase (e.g., neuB of C. jejuni (GenBank AAK91726.1) or equivalent, (e.g.
  • Flavobacterium limnosediminis sialic acid synthase GenBank WP_023580510.1
  • a CMP-Neu5Ac synthetase e.g., neuA of C. jejuni (GenBank AAK91728.1) or equivalent, (e.g. Vibrio brasiliensis CMP-sialic acid synthase, GenBank WP_006881452.1).
  • N-acetylglucosamine-containing HMOs such as Lacto-N-triose 2 (LNT-2), Lacto-N-tetraose (LNT), Lacto-N-neotetraose (LNnT), Lacto-N-fucopentaose I (LNFP-I), Lacto-N-fucopentaose II (LNFP-II), Lacto-N-fucopentaose III (LNFP-III), Lacto-N-fucopentaose V (LNFP-V), Lacto-N-difucohexaose I (LDFH-I), Lacto-N-difucohexaose II (LDFH-II), and Lacto-N-neodifucohexaose II (LNDFH-III), as described above, and it is modified to comprise an exogenous UDP-GlcNAc:G
  • This exogenous UDP-GlcNAc:Gal ⁇ / ⁇ -R ⁇ -3-N-acetylglucosaminyltransferase gene may be obtained from any one of a number of sources, e.g., the IgtA gene described from N. meningitides (Genbank protein Accession AAF42258.1) or N. gonorrhoeae (Genbank protein Accession ACF31229.1).
  • an additional exogenous glycosyltransferase gene may be co-expressed in the bacterium comprising an exogenous UDP-GlcNAc:Gal ⁇ / ⁇ -R ⁇ -3-N-acetylglucosaminyltransferase.
  • a ⁇ -1,4-galactosyltransferase gene is co-expressed with the UDP-GlcNAc:Gal ⁇ / ⁇ -R ⁇ -3-N-acetylglucosaminyltransferase gene.
  • This exogenous ⁇ -1,4-galactosyltransferase gene can be obtained from any one of a number of sources, e.g., the one described from N. meningitidis, the lgtB gene (Genbank protein Accession AAF42257.1), or from H. pylori, the HP0826/galT gene (Genbank protein Accession NP_207619.1).
  • the additional exogenous glycosyltransferase gene co-expressed in the bacterium comprising an exogenous UDP-GlcNAc:Gal ⁇ / ⁇ -R ⁇ -3-N-acetylglucosaminyltransferase gene is a P-I,3-galactosyltransferase gene, e.g., that described from E. coli 055:H7, the wbgO gene (Genbank protein Accession WP_000582563.1), or from H.
  • a N-acetylglucosaminyltransferase gene and/or a galactosyltransferase gene can also be operably linked to a Pglp and be expressed from the corresponding genome-integrated cassette.
  • the gene that is genome integrated is a gene encoding for a galactosyltransferase, e.g. HP0826 gene encoding for the GaIT enzyme from H. pylori (Genbank protein Accession NP_207619.1); in another embodiment, the gene that is genome integrated is a gene encoding a ⁇ -1,3-N-acetylglucosaminyltransferase, e.g.
  • the second gene i.e. a gene encoding a ⁇ -1,3-N-acetylglucosaminyltransferase or galactosyltransferase, correspondingly, may either be expressed from a genome-integrated or plasmid borne cassette.
  • the second gene may optionally be expressed either under the control of a glp promoter or under the control of any other promoter suitable for the expression system, e.g. Plac.
  • HMO producing host cells typically comprise a functional lacY and a dysfunctional lacZ gene.
  • the HMOs produced by recombinant cells of the invention may be purified using a suitable procedure available in the art (e.g. such as described in WO2015188834, WO2017182965 or WO2017152918).
  • Sugar transportation relates to the transport of a sugar, such as, but not limited to, an oligosaccharide, and in relation to the invention, influx and/or efflux transport of one/or more HMOs, from the cytoplasm or periplasm of a genetically modified cell to the production media and/or from the production media to the cytoplasm or periplasm of a genetically modified cell.
  • a polypeptide expressed in the genetically modified cell capable of transporting HMOs from the cytoplasm or periplasm to the production medium and/or from the production media to the cytoplasm or periplasm of a genetically modified cell is a polypeptide capable of sugar transportation.
  • sugar transportation can mean efflux and/or influx transportation of sugar, such as, but not limited to, an oligosaccharide.
  • the polypeptide capable of sugar transportation is a polypeptide belonging to the Major Facilitator Superfamily (MFS).
  • MFS Major Facilitator Superfamily
  • the polypeptide has at least 80%, such as at least 90%, such as at least 95%, such as at least 99%, sequence identity with SEQ ID NO:1 or it is a functional variant thereof as described herein.
  • SEQ ID NO:1 is the amino acid sequence of the Bad protein.
  • the genetically modified cell or the nucleic acid construct of the present invention comprises a nucleic acid sequence such as a heterologous gene encoding a Bad protein.
  • Said nucleic acid sequence has at least 70% sequence identity to the bad gene as shown in SEQ ID No: 2, such as at least 75%, 80%, 85%, 90% or 99% A identity.
  • the nucleic acid sequence construct encodes a protein of SEQ ID NO: 1, or a functional homologue thereof which amino acid sequence is at least 80%, such as at least 90% identical to SEQ ID NO: 1.
  • a functional homologue of the protein of SEQ ID NO: 1 may be obtained by mutagenesis.
  • the functional homologue should have a remaining functionality of at least 50%, such as 60%, 70%, 80%, 90% or 100% compared to the functionality of amino acid sequence of SEQ ID NO: 1.
  • the functional homologue can have a higher functionality compared to the functionality of amino acid sequence of SEQ ID NO: 1.
  • the functional homologue of SEQ ID NO: 1, should be able to enhance HMO production of the genetically modified cell according to the invention.
  • the genetically modified cell or the nucleic acid construct may contain one or more nucleic acid sequences encoding the polypeptide capable of sugar transportation. More often, the genetically modified cell or the nucleic acid construct of the invention, encodes a single copy of a polypeptide capable of sugar transportation.
  • a single copy of the expression cassette comprising a gene of interest may be sufficient to secure production of a desired HMO and achieve the desired effects according to the invention.
  • the invention relates to a recombinant HMO producing cell that comprises one, two or three copies of a gene or genes of interest integrated in the genomic DNA of the cell.
  • the single copy of the gene or genes is/are preferred.
  • the genetically modified cell or the nucleic acid construct may also contain one or more regulatory elements for the regulation of the expression of a nucleic acid sequence encoding the sugar transportation polypeptide and wherein said nucleic acid sequence has at least 70% sequence identity with SEQ ID NO: 2.
  • the genetically modified cell or the nucleic acid construct may further comprise a nucleic acid sequence comprising a regulatory element for the regulation of the expression of the nucleic acid sequence having at least 70% sequence identity to SEQ ID NO: 2.
  • the nucleic acid sequence of the regulatory region may be heterologous or homologous.
  • a “regulatory element” or “promoter” or “promoter region” or “promoter element” is a nucleic acid sequence that is recognized and bound by a DNA dependent RNA polymerase during initiation of transcription.
  • the promoter together with other transcriptional and translational regulatory nucleic acid sequences (also termed “control sequences”) is necessary to express a given gene or group of genes (an operon).
  • control sequences also termed “control sequences”
  • the transcriptional and translational regulatory sequences include, but are not limited to, promoter sequences, ribosomal binding sites, transcriptional start and stop sequences, translational start and stop sequences, and enhancer or activator sequences.
  • the “transcription start site” means the first nucleotide to be transcribed and is designated +1.
  • Nucleotides downstream of the start site are numbered +2, +3, +4 etc., and nucleotides in the 5′ opposite (upstream) direction are numbered ⁇ 1, ⁇ 2, ⁇ 3 etc.
  • the promoter of the construct can derive from a promoter region of any gene encoded in the genome of a species.
  • a promoter region of the genomic DNA of E. coli Preferably, any promoter that is able to bind to an RNA polymerase and initiate transcription is suitable for practicing the invention.
  • any promoter can be used to control transcription of the recombinant gene, such as the MFS transporter or the glycosyltransferases of the invention.
  • promoter sequence A is promoting the expression of the MFS transporter
  • another promoter sequence B or identical promoter sequence A is promoting the expression of the glycosyltransferase.
  • the construct may comprise further regulatory sequences, e.g. a leading DNA sequence, such as a DNA sequence derived from 5′-untranslated region (5′UTR) of a glp gene of E. coli, a sequence for ribosomal binding.
  • a leading DNA sequence such as a DNA sequence derived from 5′-untranslated region (5′UTR) of a glp gene of E. coli, a sequence for ribosomal binding. Examples of the later sequences are described in WO2019123324 (incorporated herein by reference) and are illustrated in non-limiting working examples herein.
  • one or more regulatory elements may be inserted into to the DNA construct encoding the bad gene according to SEQ ID NO: 2 and/or into to the DNA construct encoding one or more glycosyltransferases, according to the invention.
  • one or more copies of the bad gene according to SEQ ID NO: 2 may be inserted into the DNA construct, according to the invention.
  • the bad gene according to SEQ ID NO: 2 may be inserted into one or more identical or non-identical DNA constructs, according to the invention.
  • the regulatory element for the regulation of the expression of a recombinant gene included in the construct of the invention is glpFKX operon promoter, PglpF.
  • the promoter is lac operon promoter, Plac.
  • the regulatory element is PglpF_SD4, which are modified version of the PglpF sequence comprising a modified ribosomal binding site sequence downstream of the promoter sequence.
  • any promoter enabling transcription and/or regulation of the level of transcription, of one or more recombinant nucleic acids that encode one or more polypeptides according to the invention are suitable for practicing the invention.
  • promoters for the expression of a heterologous gene according to the present invention are selected from table 2.
  • the preferred regulatory elements present in a genetically modified cell or in a nucleic acid construct of the present invention is selected from the group consisting of PgatY_70UTR, PglpF, PglpF_SD1, PglpF_SD10, PglpF_SD2, PglpF_SD3, PglpF_SD4, PglpF_SD5, PglpF_SD6, PglpF_SD7, PglpF_SD8, PglpF_SD9, Plac_16UTR, Plac, PmglB_70UTR and PmglB_70UTR_SD4.
  • Especially preferred regulatory elements present in a genetically modified cell or in a nucleic acid construct of the present invention is selected from the group consisting of PglpF and PglpF_SD4.
  • promoters may be either necessary or beneficial for achieving an optimal level of biosynthetic production of one or more HMOs in the genetically modified cell and allowing to achieve the desired effects according to the invention.
  • a promoter sequence, of this invention enables transcription and/or regulates the expression of a polypeptide capable of sugar transportation and/or the glycosyltransferases of the invention, resulting in optimized biosynthesis and transport of HMOs or HMO precursors and/or degradation of by-products of the HMO production.
  • a nucleic acid construct is comprised in the genetically modified cell, that encodes at least one gene related to biosynthetic production of one or more HMOs, a promoter DNA sequence, and other regulatory sequences, such as a ribosomal binding site sequence (e.g. Shine-Dalgarno sequence).
  • a ribosomal binding site sequence e.g. Shine-Dalgarno sequence.
  • the expression, of the gene or genes related to the biosynthetic production of HMOs enables the production of one or more HMOs at level of 0.03 g/l/OD (optical density) from 1 liter of fermentation media comprising a suspension of the genetically modified cell s.
  • the HMO level could be approx. 0.05 g/l/OD to approx. 0.5 g/l/OD, such as at least 0.25-0.3 g/L/OD.
  • the level of HMO production is regarded as “sufficient” and the genetically modified cell capable of producing this level of a desired HMO or mixture of HMOs is regarded as the suitable genetically modified cell for carrying out the invention.
  • the “suitable genetically modified cell ” can be further modified, as described above, to express the sugar polypeptide capable of sugar transportation of the MFS family, e.g. bad, to achieve an, in one way or another, advantageous HMO production, such as but not limited to, a higher HMO level pr biosynthetic production, a higher level of purity in the biosynthetic production, a faster production time and/or a more efficient biosynthetic production of HMOs.
  • a second aspect of the invention related to a method for the production of one or more HMOs, the method comprising the steps of:
  • the term “culturing” (or “cultivating” or “cultivation”, also termed “fermentation”) relates to the propagation of bacterial expression cells in a controlled bioreactor according to methods known in the industry.
  • the HMO-producing bacteria as described herein are cultivated according to the procedures known in the art in the presence of a suitable carbon source, e.g. glucose, glycerol, lactose, etc., and the produced HMO is harvested from the cultivation media and the microbial biomass formed during the cultivation process. Thereafter, the HMOs are purified according to the procedures known in the art, e.g. such as described in WO2015188834, WO2017182965 or WO2017152918, and the purified HMOs are used as nutraceuticals, pharmaceuticals, or for any other purpose, e.g. for research.
  • a suitable carbon source e.g. glucose, glycerol, lactose, etc.
  • the purified HMOs are used as nutraceuticals, pharmaceuticals, or for any other purpose, e.g. for research.
  • Manufacturing of HMOs is typically accomplished by performing cultivation in larger volumes.
  • the term “manufacturing” and “manufacturing scale” in the meaning of the invention defines a fermentation with a minimum volume of 5 L culture broth.
  • a “manufacturing scale” process is defined by being capable of processing large volumes of a preparation containing the product of interest and yielding amounts of the protein of interest that meet, e.g. in the case of a therapeutic compound or composition, the demands for clinical trials as well as for market supply.
  • a manufacturing scale method is characterized by the use of the technical system of a bioreactor (fermenter) which is equipped with devices for agitation, aeration, nutrient feeding, monitoring and control of process parameters (pH, temperature, dissolved oxygen tension, back pressure, etc.).
  • a bioreactor which is equipped with devices for agitation, aeration, nutrient feeding, monitoring and control of process parameters (pH, temperature, dissolved oxygen tension, back pressure, etc.).
  • process parameters pH, temperature, dissolved oxygen tension, back pressure, etc.
  • the culture medium may be semi-defined, i.e. containing complex media compounds (e.g. yeast extract, soy peptone, casamino acids, etc.), or it may be chemically defined, without any complex compounds.
  • complex media compounds e.g. yeast extract, soy peptone, casamino acids, etc.
  • one or more HMOs is meant that an HMO production cell may be able to produce a single HMO structure (a first HMO) or multiple HMO structures (a second, a third, etc. HMO).
  • a genetically modified cell that produces a single HMO
  • a genetically modified cell producing multiple HMO structures may be preferred.
  • Non-limiting examples for genetically modified cell s producing single HMO structures are 2′-FL, 3-FL, 3′-SL, 6′-SL or LNT-2 producing cells.
  • Non-limiting examples of genetically modified cells capable of producing multiple HMO structures can be DFL, FSL, LNT LNnT, LNFP I, LNFP II, LNFP III, LNFP IV, LNFP V, pLNnH, pLNH2 producing cells.
  • the present invention relates to genetically modified cells producing one or more of the single HMO structures which are selected from the group consisting of 2′-FL, 3-FL and DFL producing cells.
  • slaughtering in the context in the invention relates to collecting the produced HMO(s) following the termination of fermentation.
  • it may include collecting the HMO(s) included in both the biomass (i.e. the genetically modified cell s) and cultivation media, i.e. before/without separation of the fermentation broth from the biomass.
  • the produced HMOs may be collected separately from the biomass and fermentation broth, i.e. after/following the separation of biomass from cultivation media (i.e. fermentation broth).
  • the separation of cells from the medium can be carried out with any of the methods well known to the skilled person in the art, such as any suitable type of centrifugation or filtration.
  • the separation of cells from the medium can follow immediately after harvesting the fermentation broth or be carried out at a later stage after storing the fermentation broth at appropriate conditions.
  • Recovery of the produced HMO(s) from the remaining biomass (or total fermentation) include extraction thereof from the biomass (the production cells). It can be done by any suitable methods of the art, e.g. by sonication, boiling, homogenization, enzymatic lysis using lysozyme, or freezing and grinding.
  • HMO(s) are available for further processing and purification. Purification of HMOs produced by fermentation can be done using a suitable procedure described in WO2016095924, WO2015188834, WO2017152918, WO2017182965, US20190119314 (all incorporated by reference).
  • a genetically modified cell may produce several HMOs, wherein one HMO is the “product” HMO and some/all the other HMOs are “by-product” HMOs.
  • by-product HMOs are either the major HMO precursors or products of further modification of the major HMO.
  • Cells and methods for HMO production described herein allow for controlled production of an HMO product with a defined HMO profile, e.g. in one embodiment, the produced HMO mixture wherein the product HMO is a dominating HMO compared to the other HMOs (i.e.
  • the cell producing the same HMO mixture may be tuned to produce one or more by-product HMOs in higher amount than product HMO.
  • the product HMO often a significant amount of DFL, the by-product HMO, is produced.
  • the level of DFL in the 2′-FL product can be significantly reduced.
  • the invention provides both a decreased ratio of by-product to product and an increased overall yield of the product (and/or HMOs in total). This, less by-product formation in relation to product formation facilitates an elevated product production and increases efficiency of both the production and product recovery process, providing superior manufacturing procedure of HMOs.
  • different genetically modified cells producing 2′-FL, 3-FL, DFL and/or LNT, as the product or by-product HMO may be selected.
  • the product is 3-FL.
  • the product is 2′-FL and by-product is DFL.
  • the product is LNT-2, and by-products are LNT and LNFP I.
  • Preferred HMO products of the invention as described are 2′-FL and 3-FL.
  • the present invention also related to the use of a host cell as described herein for use in the production of one or more Human Milk Oligosaccharides (HMOs).
  • HMOs Human Milk Oligosaccharides
  • the invention relates to the use of a host cell as described herein for the production of a specific HMO, wherein the host cell is selected with the aim of generating a majority of one specific HMO, preferably selected from 2′-FL and 3-FL.
  • E. coli strains were propagated in Basal Minimal medium containing 0.2% glucose (in Luria-Bertani (LB) medium containing 0.2% glucose in experiment 3) at 37° C. with agitation. Agar plates were incubated at 37° C. overnight.
  • Basal Minimal medium had the following composition: NaOH (1 g/L), KOH (2.5 g/L), KH 2 PO 4 (7 g/L), NH 4 H 2 PO 4 (7 g/L), Citric acid (0.5 g/l), Trace mineral solution (5 mL/L).
  • the trace mineral stock solution contained: ZnSO 4 *7H 20 0.82 g/L, Citric acid 20 g/L, MnSO 4 *H 2 O 0.98 g/L, FeSO 4 *7H 2 O 3.925 g/L, CuSO 4 *5H 2 O 0.2 g/L.
  • the pH of the Basal Minimal Medium was adjusted to 7.0 with 5 N NaOH and autoclaved. Before inoculation, the Basal Minimal medium was supplied with 1 mM MgSO 4 , 4 pg/mL thiamine, 0.5% of a given carbon source (glycerol (Carbosynth)).
  • E. coli was inoculated from LB plates in 5 mL LB containing 0.2% glucose at 37° C. with shaking until OD600 ⁇ 0.4. 2 mL culture was harvested by centrifugation for 25 seconds at 13.000 g. The supernatant was removed, and the cell pellet resuspended in 600 ⁇ L cold TB solutions (10 mM PIPES, 15 mM CaCl2, 250 mM KCl). The cells were incubated on ice for 20 minutes followed by pelleting for 15 seconds at 13.000 g. The supernatant was removed, and the cell pellet resuspended in 100 ⁇ L cold TB solution.
  • Transformation of plasmids were done using 100 ⁇ L competent cells and 1 to 10 ng plasmid DNA. Cells and DNA were incubated on ice for 20 minutes before heat shocking at 42° C. for 45 seconds. After 2 min incubation on ice 400 ⁇ L SOC (20 g/L tryptone, 5 g/L Yeast extract, 0.5 g/L NaCl, 0.186 g/L KCl, 10 mM MgCl2, 10 mM MgSO4 and 20 mM glucose) was added and the cell culture was incubated at 37° C. with shaking for 1 hour before plating on selective plates.
  • SOC 20 g/L tryptone, 5 g/L Yeast extract, 0.5 g/L NaCl, 0.186 g/L KCl, 10 mM MgCl2, 10 mM MgSO4 and 20 mM glucose
  • Plasmid were transformed into TOP10 chemical competent cells at conditions recommended by the supplier (ThermoFisher Scientific).
  • Plasmid DNA from E. coli was isolated using the QIAprep Spin Miniprep kit (Qiagen). Chromosomal DNA from E. coli was isolated using the QIAmp DNA Mini Kit (Qiagen). PCR products were purified using the QIAquick PCR Purification Kit (Qiagen). DreamTaq PCR Master Mix (Thermofisher), Phusion U hot start PCR master mix (Thermofisher), USER Enzym (New England Biolab) were used as recommended by the supplier. Primers were supplied by Eurofins Genomics, Germany. PCR fragments and plasmids were sequenced by Eurofins Genomics. Colony PCR was done using DreamTaq PCR Master Mix in a T100TM Thermal Cycler (Bio-Rad).
  • heterologous proteins expressed in the genetically modified HMO producing cells of this invention is described in table 4, the promoter elements which was used in the below exemplifications of the invention is described in table 5, and the oligos used for amplification of plasmid backbones, promoter, elements, and bad is described in table 6.
  • SEQ Name ID NO Oligonucleotide Sequence 5′-3′ Description O40 8 ATTAACCCUCCAGGCATCAAATAAAACGAAA Backbone.for GGC O79 9 ATTTGCGCAUCACCAATCAAATTCACGCGGC Backbone.rev C O261 10 ATGCGCAAAUGCGGCACGCCTTGCAGATTA PglpF.for CG O262 11 AGCTGTTUCCTCCTTGGTTAATGTTTGTTGT PglpF.rev ATGCG O459 12 AGCTGTTUCCTAGTTGGTTAATGTTTGTTGT PglpF_SD4 ATGCG KABY729 13 AAACAGCUATGAGCAGCCGTCGTCTGAGC bad.for KABY730 14 AGGGTTAAUTTACACGTTTAACACGGGTC bad.rev ATCAG O48 15 CCCAGCGAGACCTGACCGCAGAAC galK.for
  • Plasmid backbones containing two I-SceI endonuclease sites, separated by two DNA fragments appropriated for homologous recombination into the E. coli genome and a T1 transcriptional terminator sequence were synthesized.
  • the gal operon (required for homologous recombination in galK), and a T1 transcriptional terminator sequence was synthesized (GeneScript).
  • Standard techniques well-known in the field of molecular biology were used for designing of primers and amplification of specific DNA sequences of the Escherichia coli K-12 DH1 chromosomal DNA.
  • Such standard techniques, vectors, and elements can be found, for example, in: Ausubel et al. (eds.), Current Protocols in Molecular Biology (1995) (John Wiley & Sons); Sambrook, Fritsch, & Maniatis (eds.), Molecular Cloning (1989) (Cold Spring Harbor Laboratory Press, NY); Berger & Kimmel, Methods in Enzymology 152: Guide to Molecular Cloning Techniques (1987) (Academic Press); Bukhari et al. (eds.).
  • Chromosomal DNA obtained from E. coli DH1 was used to amplify a 300 bp DNA fragment containing the promoter PglpF using oligos O261 and O262, or PglpF_SD4 using oligos O261 and O459,
  • a 1.182 bp DNA fragment containing a codon optimized version of the bad gene, SEQ ID NO: 2, originating from Rouxiella badensis was synthesized by Genescript (Table 5).
  • the bad gene was amplified using oligos KABY729, SEQ ID NO: 13 and KABY730, SEQ ID NO: 14.
  • PCR fragments (plasmid backbones, promoter containing elements and the bad gene) were purified, and plasmid backbones, promoter elements (PglpF and PglpF_SD4), and a bad containing DNA fragment were assembled.
  • the plasmids were cloned by standard USER cloning. Cloning in any appropriated plasmid could be done using any standard DNA cloning techniques.
  • the plasmids were transformed into TOP10 cells and selected on LB plates containing 100 ⁇ g/mL ampicillin (or any appropriated antibiotic) and 0.2% glucose.
  • the constructed plasmids were purified and the promoter sequence and the 5′end of the bad gene was verified by DNA sequencing (MWG Eurofins Genomics). In this way, a genetic cassette containing any promoter of interest linked to the bad gene was constructed.
  • the bacterial strain used, MDO was constructed from Escherichia coli K-12 DH1.
  • the E. coli K-12 DH1 genotype is: F ⁇ , ⁇ , gyrA96, recA1, relA1, endA1, thi-1, hsdR17, supE44.
  • the E. coli K-12 DH1 genotype is: F ⁇ , ⁇ , gyrA96, recA1, relA1, endA1, thi-1, hsdR17, supE44.
  • coli K-12 DH1 genotype MDO has the following modifications: lacZ: deletion of 1.5 kbp, lacA: deletion of 0.5 kbp, nanKETA: deletion of 3.3 kbp, melA: deletion of 0.9 kbp, wcaJ: deletion of 0.5 kbp, mdoH: deletion of 0.5 kbp, and insertion of Plac promoter upstream of the gmd gene.
  • Insertion of an expression cassette containing a promoter linked to the bad gene and to a T1 transcriptional terminator sequence in the chromosomal DNA of E. coli K-12 DH1 MDO was performed by Gene Gorging essentially as described by Herring et al. (Herring, C. D., Glasner, J. D. and Blattner, F. R. (2003). Gene (311). 153-163). Briefly, the donor plasmid and the helper plasmid were co-transformed into MDO and selected on LB plates containing 0.2% glucose, ampicillin (100 ⁇ g/mL) or kanamycin (50 mg/mL) and chloramphenicol (20 ⁇ g/mL).
  • a single colony was inoculated in 1 mL LB containing chloramphenicol (20 ⁇ g/mL) and 10 ⁇ L of 20% L-arabinose and incubated at 37° C. with shaking for 7 to 8 hours.
  • For integration in the galK loci of E. coli cells were then plated on M9-DOG plates and incubated at 37° C. for 48 hours.
  • Single colonies formed on MM-DOG plates were re-streaked on LB plates containing 0.2% glucose and incubated for 24 hours at 37° C.
  • the deep well assay was performed as originally described to Lv et al (Bioprocess Biosyst Eng (2016) 39:1737-1747) and optimized for the purposes of the current invention.
  • strains disclosed in the examples were screened in 24 deep well plates using a 4-day protocol. During the first 24 hours, shaker culture cells were grown at 34° C. with 700 rpm shaking, to high densities while in the next 48 hours cells were transferred to a medium that allowed induction of gene expression and product formation. Specifically, during day 1 fresh inoculums were prepared using a basal minimal medium supplemented with magnesium sulphate, thiamine and glucose.
  • the supernatants were analysed by HPLC.
  • the cell lysate prepared by boiling was pelleted by centrifugation for 10 minutes at 4.700 rpm.
  • the HMO concentration in the supernatant was determined by HPLC or HPAC methods.
  • the Escherichia coli K-12 (DH1) MDO) strain can be manipulated to express heterologous genes of interest.
  • Strain 1 is a 3-FL producing strain overexpressing the ⁇ 1,3-fucosyltransferase gene, futA, and the colonic acid genes (gmd-wcaG-wcaH-wcaI-manC-manB). Insertion of an expression cassette containing a promoter element (PglpF) linked to bad in a single copy into the Strain 1 background resulted in Strain 2.
  • PglpF promoter element linked to bad in a single copy into the Strain 1 background resulted in Strain 2.
  • Results from deep-well assays showed that expression of the bad gene using PglpF increase the 3-FL production by 1.4-fold (40% increase in the total 3-FL production (fig.1). Expression of the bad gene does not affect the supernatant-to-pellet distribution of 3-FL (fig.2).
  • the Escherichia coli K-12 (DH1) MDO) strain can be manipulated to express heterologous genes of interest.
  • Strain 3 is a 2′-FL producing strain overexpressing the ⁇ 1,2-fucosyltransferase gene, futC, and the colonic acid genes (gmd-wcaG-wcaH-wcaI-manC-manB).
  • Insertion of an expression cassette containing a promoter element (PglpF_SD4) linked to bad in a single copy into the Strain 3 background resulted in Strain 4.
  • Results from deep-well assays showed that expression of the bad gene using PglpF_SD4 increase the 2′-FL production by 1.7-fold (70% increase in the total 2′-FL production (fig.3)). Expression of the bad gene improves the product distribution by decreasing the intracellular 2′-FL concentration and increasing the product outside the cells (fig.4).
  • Chromosomal insertion of a single-copy promoter-bad construct in a 2′-FL or 3-FL production strain increased the total production of HMO significantly. Chromosomal expression of bad in a 2′-FL production strain decreased the amount of HMO inside the cells (pellet fraction).
  • Example 3 The Vag Transporter is a Novel LNT-2-Core Transporter with High Selectivity for LNnT
  • helper and donor plasmids used for strain construction Plasmid Relevant genotype Marker gene pACBSR Para-I-Scel-A Red, p15A ori, cam* cam pUC57 pMB1, bla bla pUC57:gal pUC57::galTK′/ T1-galKM′ bla
  • DNA sequences of heterologous genes coding for transporters or glycosyltransferases of interest were codon optimized and synthesized by GenScript.
  • the genes of interest encoding for the transporter proteins as shown in Table 4 were amplified by PCR using appropriated primers covering the start codon, ATG, and the stop codon, TAA, of the gene (Table 3).
  • To construct donor plasmids with any heterologous gene of interest standard USER cloning was employed to combine the purified PCR fragments of the relevant plasmid backbone, promoter element and gene of interest. Cloning in an appropriated plasmid could be done using any standard DNA cloning technique.
  • the DNA was transformed into TOP10 cells and selected on LB plates containing 100 ⁇ g/mL ampicillin (or 50 mg/mL kanamycin depending on the backbone applied) and 0.2% glucose.
  • the constructed plasmids were purified, and the promoter sequence and the 5′end of the gene of interest were verified by DNA sequencing (MWG Eurofins Genomics).
  • the bacterial strain used, MDO was constructed from Escherichia coli K-12 DH1.
  • the E. coli K-12 DH1 genotype is: F ⁇ , ⁇ ⁇ , gyrA96, recA1, relA1, endA1, thi-1, hsdR17, supE44.
  • the E. coli K-12 DH1 genotype is: F ⁇ , ⁇ ⁇ , gyrA96, recA1, relA1, endA1, thi-1, hsdR17, supE44.
  • coli K-12 DH1 genotype MDO has the following modifications: lacZ: deletion of 1.5 kbp, lacA: deletion of 0.5 kbp, nanKETA: deletion of 3.3 kbp, melA: deletion of 0.9 kbp, wcaJ: deletion of 0.5 kbp, mdoH: deletion of 0.5 kbp, and insertion of Plac promoter upstream of the gmd gene.
  • Insertion of an expression cassette containing a promoter linked to the vag gene and to a T1 transcriptional terminator sequence was performed by Gene Gorging essentially as described by Herring et al (Herring, C. D., Glasner, J. D. and Blattner, F. R. (2003). Gene (311). 153-163), and example of helper and donor plasmids used to construct strains presented in the present application are provided in Table 6. Briefly, the donor plasmid and the helper plasmid were co-transformed into MDO and selected on LB plates containing 0.2% glucose, ampicillin (100 ⁇ g/mL) or kanamycin (50 mg/mL) and chloramphenicol (20 ⁇ g/mL).
  • a single colony was inoculated in 1 mL LB containing chloramphenicol (20 ⁇ g/mL) and 10 ⁇ L of 20% L-arabinose and incubated at 37° C. with shaking for 7 to 8 hours.
  • For integration in the galK loci of E. coli cells were then plated on M9-DOG plates and incubated at 37° C. for 48 hours.
  • Single colonies formed on MM-DOG plates were re-streaked on LB plates containing 0.2% glucose and incubated for 24 hours at 37° C.
  • BLAST 2.1.2 Basic Local Alignment Search Tool
  • NCBI database http://www.ncbi.nlm.nih.gov
  • heterologous MFS transporters In the present invention, we tested the ability of selected heterologous MFS transporters to export LNnT out of the host cell using a reference strain, namely MP3672.
  • the strain has one PglpF-driven copy of each heterologous glycosyltransferase that is required for product formation.
  • Plac-driven expression of most transporter genes either has no significant effect or diminish LNnT production (down to 45%).
  • introduction of the vag gene in the genetic background of the strain MP3672 results in a marked increase in LNnT titer ( FIG. 5 ).
  • the YabM transporter seems to be ineffective in relation to LNnT transport, which is clearly reflected by the product concentrations detected in the extracellular fraction of the corresponding host cell cultures ( FIG. 6 ).
  • extracellular LNnT concentrations were much higher for the strain MP3994 (vag-expressing cells) than for the strains MP4362 (yabM-expressing cells) and MP3672 (reference cells expressing no heterologous transporter) ( FIG. 6 ).
  • Vag transporter is an efficient transporter for LNnT.
  • This conclusion derives from both the results of a screening procedure of the seven transporter genes genomically expressed in the same reference strain, under the same culture conditions and control of the same promoter, Plac, and analysis of the transporter protein sequences, that revealed that transporter proteins with relatively high homology to Vag, such as YabM and Marc (75% and 71%), do not export LNnT at all, or , if export, the efficiency is very low.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Mycology (AREA)
  • Polymers & Plastics (AREA)
  • Food Science & Technology (AREA)
  • Nutrition Science (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Remote Sensing (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pediatric Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • Radar, Positioning & Navigation (AREA)
  • General Physics & Mathematics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Selective Calling Equipment (AREA)
US17/759,267 2020-01-23 2021-01-22 New major facilitator superfamily (mfs) protein (bad) in hmo production Pending US20230072639A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
DKPA202000087 2020-01-23
DKPA202000087 2020-01-23
PCT/EP2021/051476 WO2021148618A1 (en) 2020-01-23 2021-01-22 New major facilitator superfamily (mfs) protein (bad) in hmo production

Publications (1)

Publication Number Publication Date
US20230072639A1 true US20230072639A1 (en) 2023-03-09

Family

ID=74494875

Family Applications (2)

Application Number Title Priority Date Filing Date
US17/759,267 Pending US20230072639A1 (en) 2020-01-23 2021-01-22 New major facilitator superfamily (mfs) protein (bad) in hmo production
US17/759,261 Active 2042-01-27 US12351806B2 (en) 2020-01-23 2021-01-22 HMO production

Family Applications After (1)

Application Number Title Priority Date Filing Date
US17/759,261 Active 2042-01-27 US12351806B2 (en) 2020-01-23 2021-01-22 HMO production

Country Status (7)

Country Link
US (2) US20230072639A1 (https=)
EP (2) EP4093877A1 (https=)
JP (1) JP2023511523A (https=)
CN (2) CN115003814A (https=)
AU (2) AU2021209395A1 (https=)
BR (1) BR112022014423A2 (https=)
WO (3) WO2021148618A1 (https=)

Families Citing this family (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK180952B1 (en) * 2020-12-22 2022-08-10 Glycom As A dfl-producing strain
BR112023014557A2 (pt) 2021-01-22 2023-10-17 Glycom As Nova proteína (fred) da superfamília de facilitadores principais (mfs) na produção de hmos sialiado
DK181242B1 (en) * 2021-05-17 2023-05-30 Dsm Ip Assets Bv GENETICALLY ENGINEERED CELLS COMPRISING A RECOMBINANT NUCLEIC ACID SEQUNCE ENCODING AN α-1,2-FUCOSYLTRANSFERASE CAPABLE OF PRODUCING LNFP-I, NUCLEIC ACID SEQUENCES ENCODING SAME AND METHODS FOR USE OF SAME
DK181497B1 (en) 2021-05-17 2024-03-12 Dsm Ip Assets Bv ENHANCING FORMATION OF THE HMOS LNT AND/OR LNnT BY MODIFYING LACTOSE IMPORT IN THE CELL
DK181991B1 (en) 2021-11-11 2025-05-15 Dsm Ip Assets Bv Combined fermentation process for producing one or more human milk oligosaccharide(s) (hmo(s)) in escherichia coli
US20260028634A1 (en) 2022-03-02 2026-01-29 Dsm Ip Assets B.V. New sialyltransferases for in vivo synthesis of 3'sl and 6'sl
DK181319B1 (en) 2022-03-02 2023-08-10 Dsm Ip Assets Bv Genetically engineered cells and methods comprising use of a sialyltransferase for in vivo synthesis of 3’sl
DK181683B1 (en) 2022-03-02 2024-09-20 Dsm Ip Assets Bv Cells exprssing new sialyltransferases for in vivo synthesis of lst-a, methods using same and constructs encoding said sialyltransferases
US20250290078A1 (en) 2022-04-29 2025-09-18 Dsm Ip Assets B.V. Hmo producing microorganism with increased robustness towards glucose gradients
WO2023235555A1 (en) * 2022-06-02 2023-12-07 Bee-Io Honey Technologies Ltd. Cultured buffalo milk production methods, systems, compositions and uses thereof
DK181765B1 (en) 2022-07-15 2024-12-04 Dsm Ip Assets Bv Cells expressing new fucosyltransferases for in vivo synthesis of lnfp-iii, and methods and uses of same
EP4577061A1 (en) 2022-08-25 2025-07-02 DSM IP Assets B.V. Hybrid method for producing complex hmos
WO2024110667A1 (en) 2022-11-25 2024-05-30 Dsm Ip Assets B.V. Two-strain system for producing oligosaccharides
CN120677242A (zh) 2023-02-24 2025-09-19 帝斯曼知识产权资产管理有限公司 用于体内合成人乳寡糖的产物特异性转运蛋白
DK181822B1 (en) 2023-06-07 2025-01-30 Dsm Ip Assets Bv Genetically engineered strains with reduced byproduct formation and methods and uses of same
DK182227B1 (en) 2023-10-17 2025-12-18 Dsm Ip Assets Bv Genetically engineered cells comprising new fucosyltransferases for in vivo synthesis of complex fucosylated human milk oligosaccharides mixtures comprising lnfp-vi, methods using the same, and uses of new fucosyltransferases thereof.
DK202430472A1 (en) 2024-08-19 2026-02-24 Dsm Ip Assets Bv Alpha-1,2 fucosyltransferase mutants with increased alpha 1,3-fucosyltransferase activity

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180305724A1 (en) * 2015-09-12 2018-10-25 Jennewein Biotechnologie Gmbh Production of human milk oligosaccharides in microbial hosts with engineered import / export

Family Cites Families (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7363028B2 (en) 2003-11-04 2008-04-22 Universal Electronics, Inc. System and method for controlling device location determination
DK2440661T3 (en) 2009-06-08 2018-03-12 Jennewein Biotechnologie Gmbh HMO synthesis
EP2675899A4 (en) 2011-02-16 2014-09-10 Glycosyn LLC BIOSYNTHESIS OF HUMAN MILK OLIGOSACCHARIDES IN MANIPULATED BACTERIA
EP2760875A4 (en) * 2011-09-30 2015-08-26 Glycom As SYNTHESIS OF HMO NUCLEAR STRUCTURES
EP3461890B1 (en) * 2014-03-31 2025-09-24 Chr. Hansen HMO GmbH Total fermentation of oligosaccharides
DE202015009782U1 (de) 2014-06-11 2020-02-10 Glycom A/S Trennung von 2'-O-Fucosyllactose aus Fermentationsbrühe
EP3191499A4 (en) 2014-09-09 2018-06-06 Glycosyn LLC Alpha (1,3) fucosyltransferases for use in the production of fucosylated oligosaccharides
US10676770B2 (en) 2014-12-16 2020-06-09 Glycom A/S Separation of 2′-FL from a fermentation broth
DE202017007249U1 (de) 2016-03-07 2020-04-23 Glycom A/S Abtrennung von Oligosacchariden aus der Fermentationsbrühe
EP4674526A3 (en) 2016-04-19 2026-04-01 Glycom A/S Separation of oligosaccharides from fermentation broth
ES2856749T3 (es) 2016-10-29 2021-09-28 Chr Hansen Hmo Gmbh Proceso para la producción de oligosacáridos fucosilados
EP3635429A1 (en) 2017-05-04 2020-04-15 Eaton Intelligent Power Limited Multi-dimensional location of an object using multiple electrical devices
US11608504B2 (en) 2017-12-21 2023-03-21 Glycom A/S Nucleic acid construct for in vitro and in vivo gene expression
US20190323052A1 (en) 2018-04-23 2019-10-24 Dupont Nutrition Biosciences Aps Increasing export of 2? fucosyllactose from microbial cells through the expression of a heterologous nucleic acid
WO2019209241A1 (en) * 2018-04-23 2019-10-31 Dupont Nutrition Biosciences Aps Increasing export of 2' fucosyllactose from microbial cells through the expression of a heterologous nucleic acid
US20190323053A1 (en) 2018-04-23 2019-10-24 Dupont Nutrition Biosciences Aps Increasing activity of 2? fucosyllactose transporters endogenous to microbial cells
EP3569713A1 (en) * 2018-05-16 2019-11-20 Jennewein Biotechnologie GmbH Use of glycosidases in the production of oligosaccharides
CN109609422A (zh) * 2018-11-20 2019-04-12 安徽天凯生物科技有限公司 一种可以产2’-岩藻基乳糖菌株的构建方法
US10519475B1 (en) 2018-11-21 2019-12-31 Amyris, Inc. Biosynthesis of compounds in yeast

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180305724A1 (en) * 2015-09-12 2018-10-25 Jennewein Biotechnologie Gmbh Production of human milk oligosaccharides in microbial hosts with engineered import / export

Also Published As

Publication number Publication date
WO2021148618A1 (en) 2021-07-29
AU2021211904A1 (en) 2022-07-14
CN115003812A (zh) 2022-09-02
US20230046359A1 (en) 2023-02-16
WO2021148620A1 (en) 2021-07-29
US12351806B2 (en) 2025-07-08
EP4093877A1 (en) 2022-11-30
BR112022014423A2 (pt) 2022-09-27
EP4093878A1 (en) 2022-11-30
WO2021148618A9 (en) 2021-11-18
WO2021148611A1 (en) 2021-07-29
JP2023511523A (ja) 2023-03-20
CN115003814A (zh) 2022-09-02
AU2021209395A1 (en) 2022-07-14

Similar Documents

Publication Publication Date Title
US12351806B2 (en) HMO production
US12428657B2 (en) HMO production
US20230193335A1 (en) Hmo production
US20230109661A1 (en) Hmo production
US20240102063A1 (en) New major facilitator superfamily (mfs) protein (fred) in production of sialylated hmos
US20240043891A1 (en) A dfl-producing strain
US20230109937A1 (en) New major facilitator superfamily (mfs) protein (fred) in hmo production
EA046005B1 (ru) НОВЫЙ БЕЛОК СУПЕРСЕМЕЙСТВА ОСНОВНЫХ ПЕРЕНОСЧИКОВ (MFS) (Fred) В ПРОИЗВОДСТВЕ ОГМ
EA046260B1 (ru) Получение огм
EA046241B1 (ru) Получение огм
EA046248B1 (ru) Получение огм
CN116802302A (zh) 唾液酸化hmo生产中的新主要易化子超家族(mfs)蛋白(fred)

Legal Events

Date Code Title Description
STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION COUNTED, NOT YET MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED