US20210269828A1 - Vectors for gene delivery that persist within cells - Google Patents

Vectors for gene delivery that persist within cells Download PDF

Info

Publication number
US20210269828A1
US20210269828A1 US17/253,929 US201917253929A US2021269828A1 US 20210269828 A1 US20210269828 A1 US 20210269828A1 US 201917253929 A US201917253929 A US 201917253929A US 2021269828 A1 US2021269828 A1 US 2021269828A1
Authority
US
United States
Prior art keywords
dna
cell
itr
dna vector
vector
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
US17/253,929
Other languages
English (en)
Inventor
Richard Jude Samulski
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Asklepios Biopharmaceutical Inc
Original Assignee
Asklepios Biopharmaceutical Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Asklepios Biopharmaceutical Inc filed Critical Asklepios Biopharmaceutical Inc
Priority to US17/253,929 priority Critical patent/US20210269828A1/en
Publication of US20210269828A1 publication Critical patent/US20210269828A1/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14151—Methods of production or purification of viral material
    • C12N2750/14152—Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles

Definitions

  • the present invention relates to the field of vectors and methods for the cell-free production, introduction and expression of nucleic acid sequences into mammalian cells, such as for gene therapy.
  • Viral based protocols have been developed, in which a viral vector is employed to introduce exogenous DNA into a cell that can subsequently integrate the introduced DNA into the target cell's genome or remain episomally.
  • Viral based vectors finding use include retroviral vectors, e.g., Moloney murine leukemia viral based vectors, adenovirus derived vectors, adeno-associated virus (AAV) derived vectors, HSV derived vectors, Sindbis derived vectors, etc.
  • AAV vectors e.g., Moloney murine leukemia viral based vectors, adenovirus derived vectors, adeno-associated virus (AAV) derived vectors, HSV derived vectors, Sindbis derived vectors, etc.
  • AAV vectors e.g., Moloney murine leukemia viral based vectors, adenovirus derived vectors, adeno-associated virus (AAV) derived vectors, HSV derived vectors,
  • a typical method for production of AAV vectors is using cells such as insect cells, e.g., SF-9, or mammalian cells, that express AAV rep (rep is required to initiate replication of the AAV), and cap (cap is needed for the production of AAV) genes for the formation of virions, and introducing into these cells a plasmid with AAV inverted terminal repeats (ITRs) flanking a cassette containing a promoter operably linked to a gene of interest.
  • ITRs AAV inverted terminal repeats
  • An additional plasmid with viral helper genes for example derived from adenovirus or herpes simplex virus, is also needed to replicate and obtain the packaged AAV capsids used for transduction.
  • helper virus e.g., adenovirus
  • the use of viral proteins can elicit an unwanted immune response.
  • aspects of the invention relate to an in vitro cell-free environment to generate vectors for gene delivery without the need of a helper virus.
  • This cell-free synthesis is easier and safer to use for vector production.
  • the vectors described herein can also be produced within cells, e.g. bacterial, mammalian, or insect cells.
  • aspects of the invention also relate to a methods and vector constructs for introducing a nucleic acid construct into a target cell for sustained expression.
  • the method comprises administering to the target cell a covalently closed linear non-viral DNA construct comprising at least one DD-ITR comprising i) an inverted terminal repeat having an A, A′, B, B′, C, C′ and D region; ii) a D′ region; iii) wherein the D and D′ region are complementary palindromic sequences, and wherein D and D′ are positioned adjacent the A and A′ region.
  • the regions correspond to a parvoviral ITR, e.g.
  • the ITR corresponds to a parvoviral ITR that is a wild type ITR, a mutant ITR, or a synthetic ITR.
  • the DNA vector construct further comprises complementary strands of the nucleic acid construct comprising a cassette containing a promoter operably linked to a predetermined DNA sequence that can anneal into expressible dsDNA, wherein the DNA construct forms linear DNA with covalently closed hairpin ends, and wherein the DNA construct can express the predetermined DNA sequence in the target cell.
  • the covalently closed non-viral linear DNA construct comprises at least two DD-ITRs, e.g. as illustrated in FIG. 1 .
  • the DNA vector for delivery of a predetermined nucleic acid sequence (e.g. heterologous gene) into a target cell for sustained expression.
  • the DNA vector is a covalently closed non-viral linear DNA vector for delivery of predetermined nucleic acid into a target cell for sustained expression that comprises a) at least one DD-ITR comprising: i) an inverted terminal repeat having an A, A′, B, B′, C, C′ and D region; ii) a D′ region; iii) wherein the D and D′ region are complementary palindromic sequences, and wherein D and D′ are positioned adjacent the A and A′ region; b) complementary strands of the nucleic acid construct comprising a predetermined DNA sequence that can anneal into expressible dsDNA; c) wherein the DNA vector construct forms linear DNA with covalently closed hairpin ends; and d) wherein the DNA vector construct can express the predetermined DNA sequence in the target cell.
  • the regions correspond to a parvoviral ITR, e.g. the AAV A, A′, B, B′, C, C′ and D regions.
  • the ITR correspond to a wild type ITR, a mutant ITR, or a synthetic ITR.
  • the DNA vector construct further comprises complementary strands of the nucleic acid construct comprising a cassette containing a promoter operably linked to a predetermined DNA sequence that can anneal into expressible dsDNA, wherein the DNA construct forms linear DNA with covalently closed hairpin ends, and wherein the DNA construct can express the predetermined DNA sequence in the target cell.
  • the vector comprises at least two DD-ITRs that flank the nucleic acid in the context of covalently closed non-viral linear DNA that expresses a predetermined heterologous transgene, e.g. a protein or nucleic acid.
  • a predetermined heterologous transgene e.g. a protein or nucleic acid.
  • the vector is substantially complimentary DNA having covalently closed hairpin ends.
  • the D regions are about 20 nt in length.
  • the D and D′ region may have substitution, insertion, and/or deletions that retains at least 5 nucleic acids of the region.
  • the retained nucleic acids may comprise the nicking site and/or junction of the A and A′ region and the D and D′ regions.
  • aspects of the invention further relate to a DNA vector for delivery of a predetermined nucleic acid sequence into a target cell for sustained expression.
  • the vector comprises two DD-ITRs each comprising i) an inverted terminal repeat having an A, A′, B, B′, C, C′ and D region;
  • the vector further comprises the predetermined nucleic acid sequence.
  • the two DD-ITRs flank the nucleic acid in the context of covalently closed non-viral DNA, e.g. mini-circle DNA, wherein a majority of the vector is non-bacterial sequences.
  • aspects of the invention relate to a method for introducing a nucleic acid into a target cell for sustained expression comprising administering to the target cell a covalently closed non-viral DNA construct.
  • the DNA construct comprises at least one ITR sequence selected from the group consisting of the ITR's shown in FIG. 5 , complementary strands of the nucleic acid construct, wherein the nucleic acid construct comprises a predetermined DNA sequence, wherein the complementary strands can anneal into expressible dsDNA; and wherein the DNA construct forms linear DNA with hairpin covalently closed ends.
  • Further aspects of the invention relate to use of the covalently closed non-viral linear DNA (sometimes closed linear DNA) to produce recombinant viral particles comprising construct DNA.
  • DD-ITRs e.g., see FIG. 1
  • parvovirus viral capsid proteins e.g., a dependovirus such as AAV, necessary to form a virion (viral particle) that can encapsidate the ITRs and the intervening DNA sequence.
  • the DD-ITRs resolve and replication is initiated from the self-primed ITR in the presence of Rep to produce vector genomes that can be packaged.
  • the intervening DNA sequence contains a transgene sequence such as a therapeutic gene sequence.
  • the particular Rep protein that nicks, e.g., an AAV ITR is typically from the same serotype (for example, AAV2 ITR with AAV2Rep78) although any serotypes can be used as long as they retain at least 25% . . . 35% . . . 50% . . . 65% . . . 75% . . . 85% . . . 90% . . . 95% . . . 98% . .
  • the initial non-viral closed linear DNA construct used as a rAAV vector template for example can have a Rep nick defective ITR or a hairpin sequence. See for example, U.S. Pat. Nos.
  • the template is approximately 1 ⁇ 2 size template and one of the DD-ITRs is a Rep-nick incompetent ITR.
  • the nick defective ITR, or hairpin sequence is placed between to two Rep-nick competent DD-ITRs and the nick defective ITR, or hairpin sequence is further in between the sense and anti-sense sequences of the transgene. In either case, after replication of the template the sense and anti-sense sequences are on a single strand of DNA in between ITRs and this vector genome can be packaged.
  • the host cell can already be expressing the Rep and viral capsid proteins or one can co-transfect the cells at the same or about the same time by standard means. Any of the known cell-types used in the art can be used in this process. For example, one can use mammalian cells, or insect cells such as baculovirus.
  • compositions comprising the vectors described herein are also provided.
  • the ITR sequence is flanked on either side by complementary sequences D and D′.
  • the D regions contain a nicking site.
  • the D regions are at least 5 nucleotides in length.
  • the D regions are about 20 nt in length.
  • the D region corresponds to a parvovirus D region of a parvovirus ITR.
  • the parvovirus is a dependovirus.
  • the dependovirus is AAV.
  • the predetermined DNA/nucleic acid sequence is operably linked to a promoter.
  • the ITR is acting as a promoter.
  • the DD-ITR drives expression of the predetermined DNA/nucleic acid sequence.
  • the D and D′ region has a substitution, insertion, and/or deletion that retains at least 5 nucleic acids of the region.
  • the retained nucleic acids comprise the nicking site and/or junction of the A and A′ region and the D and D′ regions.
  • the predetermined DNA sequence/nucleic acid sequence encodes a protein, a protein fragment, a peptide, or a functional RNA.
  • the functional RNA is selected from the group consisting of micro RNA, RNAi, shRNA, and guide RNA for Crisper Cas 9 recombination.
  • the spacers are at least 5 nucleotides.
  • the spacers are at least 20 nucleotides.
  • the spacers are at least 25 nucleotides.
  • At least one DD-ITR is generated from an AAV ITR, a parvovirus ITR, or a synthetic ITR.
  • the DNA construct comprises two or more DD-ITRs.
  • the D regions are from different stereotypes than the ITR.
  • multiple DD-ITRs are present and one or more of the DD-ITRs are derived from a different viral serotype than the other(s).
  • the DNA construct further comprises a partial protelomerase binding site and wherein the covalently closed ends are formed by protelomerase enzyme activity in vitro.
  • the DNA construct persists within the target cell and results in sustained expression of the predetermined sequence (e.g., as a result of either replication or recombination).
  • the DNA construct can be converted into a concatemeric structure in the cell.
  • the sustained expression of the predetermined DNA sequence in the target cell is for a period of time at least at least 2-5 weeks, at least 1-12 months, at least 1-10 years.
  • the concatemeric structure persists in the target cell and results in sustained expression of the predetermined sequence (e.g., as a result of either replication or recombination).
  • the concatemeric structure persists in the target cell extra-chromosomally.
  • the concatemeric structure integrates into the target cell chromosome.
  • the nucleic acid is a therapeutic nucleic acid.
  • the target cell is in vitro.
  • the construct is administered to the target cell ex vivo.
  • the target cell is selected from the group consisting of a neural cell, lung cell, retinal cell, epithelial cell, smooth muscle cell, skeletal muscle cell cardiac muscle cell, pancreatic cell, hepatic cell, kidney cell, myocardial cell, bone cell, spleen cell, keratinocyte, fibroblast, endothelial cell, prostate cell, germ cell, progenitor cell, stem cell, cancer cell, and tumor cell.
  • Another aspect of the invention relates to a cell or population thereof, produced by the methods described herein.
  • parvovirus encompasses the family Parvoviridae, including autonomously-replicating parvoviruses and dependoviruses.
  • the autonomous parvoviruses include members of the genera Parvovirus, Erythrovirus, Densovirus, Iteravirus, and Contravirus.
  • Exemplary autonomous parvoviruses include, but are not limited to, minute virus of mouse, bovine parvovirus, canine parvovirus, chicken parvovirus, feline panlcukopenia virus, feline parvovirus, goose parvovirus, HI parvovirus, muscovy duck parvovirus, snake parvovirus, and B19 virus.
  • Other autonomous parvoviruses are known to those skilled in the art. See, e.g., FIELDS et al. VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers).
  • the genus Dependovirus contains the adeno-associated viruses (AAV), including but not limited to, AAV type 1, AAV type 2, AAV type 3 (including types 3A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, AAV type 12, AAV type 13, avian AAV, bovine AAV, canine AAV, goat AAV, snake AAV, equine AAV, and ovine AAV. See, e.g., FIGS. 8-19 ; FIELDS et al. VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers).
  • AAV adeno-associated viruses
  • AAV adeno-associated virus
  • AAV includes but is not limited to, AAV type 1, AAV type 2, AAV type 3 (including types 3A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, AAV type 12, AAV type 13, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, goat AAV, shrimp AAV, and any other AAV now known or later discovered. See, e.g., FIELDS et al. VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers). A number of relatively new AAV serotypes and clades have been identified (See, e.g., Gao et al. (2004) J. Virol. 78:6381; Moris et al. (2004) Virol. 33-:375).
  • inverted terminal repeat includes any viral terminal repeat or synthetic sequence that forms a hairpin structure and functions as an inverted terminal repeat (i.e., mediates the desired functions such as replication, integration and/or provirus rescue, and the like).
  • the ITR can be an AAV ITR or a non-AAV ITR.
  • a non-AAV ITR sequence such as those of other parvoviruses (e.g., canine parvovirus, bovine parvovirus, mouse parvovirus, porcine parvovirus, human parvovirus B-19) or the SV40 hairpin that serves as the origin of SV40 replication can be used as an ITR, which can further be modified by truncation, substitution, deletion, insertion and/or addition.
  • the ITR can be partially or completely synthetic, such as shown in FIG. 5 , and described in U.S. Pat. No. 9,169,494, the contents of which are incorporated herein by reference in their entirety.
  • the ITR is 145 nucleotides.
  • the terminal 125 nucleotides form a palindromic double stranded T-shaped hairpin structure.
  • the A-A′ palindrome forms the stem, and the two smaller palindromes B-B′ and C-C′ form the cross-arms of the T.
  • the other 20 nucleotides in the D sequence remain single stranded.
  • the DD-ITR has the ability to provide information in cis for replication of the DNA construct.
  • a DD-ITR has an inverted palindromic sequence with flanking D and D′ elements, e.g. a (+) strand 5′ to 3′ sequence of 5′-DABB′CC′A′D′-3′ and a ( ⁇ ) strand complimentary to the (+) strand that has a 5′ to 3′ sequence of 5′-DACC′BB′A′D′-3′ that can form a Holiday structure, e.g. as illustrated in FIG. 1 .
  • the DD-ITR may have deletions in its components (e.g. A-C), while still retaining the D and D′ element.
  • the ITR comprises deletions while still retaining the ability to form a Holliday structure and retaining two copies of the D element (D and D′).
  • the DD-ITR may be generated from a native AAV ITR or from a synthetic ITR.
  • the deletion is in the B region element.
  • the deletion is in the C region element.
  • the entire B and/or C element is deleted, and e.g. replaced with a single hairpin element.
  • An “AAV inverted terminal repeat” or “AAV ITR” may be from any AAV, including but not limited to serotypes 1, 2, 3a, 3b, 4, 5, 6, 7, 8, 9, 10, 11, or 13, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, goat AAV, shrimp AAV, or any other AAV now known or later discovered (see, e.g., Table 1).
  • An AAV ITR need not have the native terminal repeat sequence (e.g., a native AAV ITR sequence may be altered by insertion, deletion, truncation and/or missense mutations), as long as the terminal repeat mediates the desired functions, e.g., replication, or, integration.
  • synthetic ITR refers to a non-naturally occurring ITR that differs in nucleotide sequence from wild-type ITRs, e.g., the AAV serotype 2 ITR (ITR2) sequence due to one or more deletions, additions, substitutions, or any combination thereof.
  • the difference between the synthetic and wild-type ITR (e.g., ITR2) sequences may be as little as a single nucleotide change, e.g., a change in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 60, 70, 80, 90, or 100 or more nucleotides or any range therein.
  • the difference between, the synthetic and wild-type ITR (e.g., ITR2) sequences may be no more than about 100, 90, 80, 70, 60, 50, 45, 40, 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide or any range therein.
  • the D regions are derived from different serotypes than the A, B and C regions.
  • a “promoter” is a nucleotide sequence which initiates and regulates transcription of a polynucleotide. Promoters can include inducible promoters (where expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), repressible promoters (where expression of a polynucleotide sequence operably linked to the promoter is repressed by an analyte, cofactor, regulatory protein, etc.), and constitutive promoters. It is intended that the term “promoter” or “control element” includes full-length promoter regions and functional (e.g., controls transcription or translation) segments of these regions.
  • a protelomerase target sequence is any DNA sequence whose presence in a DNA template allows for its conversion into a closed linear DNA by the enzymatic activity of protelomerase.
  • the protelomerase target sequence is required for the cleavage and religation of double stranded DNA by protelomerase to form covalently closed linear DNA.
  • a protelomerase target sequence comprises any perfect palindromic sequence i.e any double-stranded DNA sequence having two-fold rotational symmetry, also described herein as a perfect inverted repeat.
  • the protelomerase target sequences from various mesophilic bacteriophages, and a bacterial plasmid all share the common feature of comprising a perfect inverted repeat.
  • the length of the perfect inverted repeat differs depending on the specific organism. In Borrelia burgdorferi , the perfect inverted repeat is 14 base pairs in length. In various mesophilic bacteriophages, the perfect inverted repeat is 22 base pairs or greater in length.
  • the central perfect inverted palindrome is flanked by inverted repeat sequences, i.e forming part of a larger imperfect inverted palindrome.
  • strand displacement is used herein to describe the ability of a DNA polymerase to displace complementary strands on encountering a region of double stranded DNA during DNA synthesis.
  • contacting in connection with delivery of a nucleic acid (e.g., a template, DNA) to a host system (e.g, cell free or cellular) refers broadly to placing the nucleic acid (e.g., DNA template or plasmid template) into a host system such that it is present in the host system. Less broadly, contacting refers to any appropriate means of placing the template or plasmid template in a host system described herein. Contacting can be by such means that the template is appropriately transported into the interior of the cell such that, e.g., circular nucleic acid is produced by the host cell machinery. Such contacting may involve, for example transformation, transfection, electroporation, or lipofection.
  • FIG. 1 is an illustration of the generation of an embodiment of the covalently closed linear DNA vector construct of the invention through the activity of protelomerase.
  • Protelomerase binds to the protelomerase binding sites, cleaves and ligates the two strands to generate covalently closed ends, leaving a partial protelomerase binding site at the ligated portion.
  • the partial protelomerase binding sites flank two DD-ITRs that flank a predetermined sequence (e.g. a transgene the encodes a protein or nucleic acid sequence).
  • the vector is a covalently closed linear double stranded vector having hairpin ends in its natural state (annealed) and is capable of expressing transgene in a target cell.
  • the vector If the vector is fully denatured it would form a single stranded covalently closed circle having complimentary transgene sequences on one contiguous covalently closed single strand of DNA; upon renaturing the complimentary sequences would re-anneal. This is in contrast to a covalently closed circular double stranded DNA molecule that can express a transgene, e.g. plasmid DNA, where the complimentary sequences for expression of the transgene are on separate single stranded covalently closed molecules when denatured.
  • a transgene e.g. plasmid DNA
  • FIG. 2 is an illustration of the recombination of one embodiment of the DNA vector construct of the invention that can occur in vivo, resulting in concatemeric structures that persist within cells resulting in sustained gene expression.
  • FIG. 3 is an illustration of an embodiment of the DNA vector construct of the invention showing the DD-ITR resolution in vivo in the absence of an AAV Rep protein to generate structures that can either ligate in vivo after resolution or self-replicate in vivo, e.g. forming monomers and concatemeric structures, thereby resulting in sustained gene expression.
  • FIG. 5 lists chimeric ITRs for use in the instant invention.
  • FIG. 6 is an illustration of the cloning of PCR-amplified and EcoRI cut double-D into EcoRI site of plasmid pGEM-3′Z.
  • FIG. 7 is a schematic of preparation of viral particles.
  • FIG. 8 shows protelomerase target site telRL.
  • the DNA of phage N15 after infection consists of a circular DNA, which contains the telomere resolution site telRL. This site is a palindrome with telR and telL as right and left arms. Arrows indicate the inverted repeats (28 bp each) and dots interruptions in the palindrome.
  • the central 22-bp palindrome telO is required for recognition and cleavage by the protelomerase, TelN. It cleaves the DNA within telO and joins the resulting ends to form two covalently closed hairpins at either end.
  • the 28-bp sequences telR and telL designate also the ends of the linear N15 prophage DNA (“doggybone”).
  • FIGS. 9A-9C show results expected from expression of EGFP from mini lc-DNA.
  • FIG. 9A In plasmid pDD3 (left), two telRL sites flank the transcriptional unit for EGFP. The reaction of pDD3 with protelomerase results in two linear closed linear DNA fragments, the EGFP-expressing mini lc-DNA (right), and the vector backbone (not shown). Two MunI recognition sites within the protelomerase target sites are used to generate the mini lo-DNA of the same size as a control. ( FIG. 9A ) In plasmid pDD3 (left), two telRL sites flank the transcriptional unit for EGFP. The reaction of pDD3 with protelomerase results in two linear closed linear DNA fragments, the EGFP-expressing mini lc-DNA (right), and the vector backbone (not shown). Two MunI recognition sites within the protelomerase target sites are used to generate the mini lo-DNA of the same size as a control. ( FIG.
  • HEK293 cells will be transiently transfected with DNA (0.7 ⁇ g total) containing mini lc-DNA (lc), mini lo-DNA (lo), or parental DNA (ccc) (6 nmol each), respectively.
  • a control vector (c) will be used.
  • Transfection efficiency will b controlled by cotransfection with EGFP-CNK.CT-expressing plasmid (pEGFPc2-CNK.CT, 0.35 ⁇ g). The total amount of DNA will be adjusted with vector DNA.
  • the presence of EGFP and EGFP-CNK.CT will be determined 48 h post transfection by Western blot analysis. The expected bands representing EGFP and EGFP-CNK.CT are indicated.
  • FIG. 11 presents an exemplary schematic for manufacturing a circular nucleic acid having, in the 5′ to 3′ direction, a BAMHI restriction site, an F1 ORI, an DD-ITR (mutant), a promoter linked to a transgene (indicated by red star), a DD-ITR (mutant), a promotor linked to a transgene (indicated by red star), a DD-ITR (mutant), and a HINDIII restriction site, and having adaptor sequences ligated at each end via the restriction sites.
  • a plasmid fragment is excised from the plasmid via cutting with a BAMHI and HINDIII restriction enzyme.
  • Adaptor sequences are ligated to the plasmid fragment, forming the template.
  • the template can be replicated in vitro or in vivo, e.g., in E. coli cells, cell extracts (e.g., E. coli cell extract), or bacterial packaging cells.
  • the exemplified order of the elements e.g., a cleavage site, an ORI, an ITR, or a promoter linked to a transgene
  • the elements can be in any order from 5′ to 3′.
  • coli cells e.g., E. coli cell extract
  • bacterial packaging cells e.g., E. coli cells, cell extracts (e.g., E. coli cell extract), or bacterial packaging cells.
  • the exemplified order of the elements e.g., a cleavage site, an ORI, an ITR, or a promoter linked to a transgene
  • the elements can be in any order from 5′ to 3′.
  • FIG. 13 presents an exemplary schematic for manufacturing a circular nucleic acid having, in the 5′ to 3′ direction, a BAMHI restriction site, an F1 ORI, a PVUII restriction site, an DD-ITR (mutant), a promotor linked to a transgene (indicated by star), DD-ITR (mutant), and a HINDIII restriction site, and having adaptor sequences ligated at each end via the restriction sites.
  • a plasmid fragment is excised from the plasmid via cutting with a BAMHI and HINDIII restriction enzyme.
  • Adaptor sequences are ligated to the plasmid fragment, forming the template.
  • the template can be replicated in vitro or in vivo, e.g., in E.
  • the circular nucleic acid is further cut with a PVUII restriction enzyme, removing an adaptor sequence and the ORI, and resulting in one open end, and one closed end.
  • a PVUII restriction enzyme removing an adaptor sequence and the ORI, and resulting in one open end, and one closed end.
  • FIG. 14 presents an exemplary schematic of manufacturing a self-complementary, single stranded DNA vector having in the 5′ to 3′ direction, an F1 ORI, an DD-ITR (mutant), a promotor linked to a transgene (indicated by star), a DD-ITR (mutant), a promotor linked to a transgene (indicated by star), a DD-ITR (mutant), a hairpin sequence, a complementary DD-ITR (mutant), a complementary promotor linked to a transgene (indicated by star), a complementary DD-ITR (mutant), a complementary promotor linked to a transgene (indicated by star), a complementary DD-ITR (mutant), and a ORI ⁇ 29.
  • This method uses a bacterial packaging cell and a helper phage.
  • Asterisk indicates a complementary sequence, e.g., a complementary TR or transgene sequence.
  • the exemplified order of the elements e.g., a cleavage site, an ORI, an ITR, or a promoter linked to a transgene
  • the exemplified order of the elements shown herein from 5′ to 3′ is not meant to be limiting, and it is to be understood the elements can be in any order from 5′ to 3′.
  • the DNA vector comprises at least one DD-ITRs and a predetermined nucleic acid sequence/construct (e.g., a regulatory sequence such as a promoter operably linked to a predetermined DNA sequence (e.g. a heterologous nucleic acid) that can anneal into expressible ds DNA).
  • a predetermined nucleic acid sequence/construct e.g., a regulatory sequence such as a promoter operably linked to a predetermined DNA sequence (e.g. a heterologous nucleic acid) that can anneal into expressible ds DNA).
  • the DNA vector is a covalently closed linear non-viral DNA construct.
  • the DNA vector can further self-replicate and/or recombine in the target cell (e.g., when the target cell divides).
  • the DNA vector construct having at least one DD-ITR, for delivery of nucleic acid to cells is linear DNA that has covalently closed hairpin ends and is not plasmid DNA, i.e. is not a DD-ITR plasmid.
  • the covalently closed linear DNA vector comprises two DD-ITRs (e.g. as shown in FIG. 1 ).
  • An ITR typically has regions of complementary palindromic sequences which can anneal, with intervening spacer sequences that allow the formation of a T or Y structure. Such regions are known in the art and referred herein as A, A′, B, B′, C, C′ and a D region (E.g. as described in U.S. Pat. No. 5,478,745). In the context of an AAV ITR, the D region that is a single stranded part of the genome. A DD-ITR has an additional D′ region which is complementary to the D region of the ITR (See also, Xiao et al. J. Virology vo. 71 (2). 1997: p941-948, incorporated herein by reference in its' entirety).
  • DD-ITR's there are two DD-ITR's, located such that they flank the predetermined nucleic acid sequence/construct (e.g., when viewed as shown in the bottom of FIG. 1 ).
  • at least one of the DD-ITR's is an AAV ITR.
  • the DNA construct further comprises a partial protelomerase binding site (e.g., such as is left following generation of covalently closed ends by a protelomerase enzyme activity in vitro).
  • a partial protelomerase binding site e.g., such as is left following generation of covalently closed ends by a protelomerase enzyme activity in vitro.
  • the spacer can be larger than 2 nucleotides, e.g., 5 or more nucleotides. In one embodiment, the spacer is at least 10 nucleotides, in one embodiment the spacer is 20 nucleotides or more, or 25 nucleotides or more. In one embodiment the spacer is from 5-50 nucleotides. In a preferred embodiment, the spacer is 20 nucleotides.
  • the DD-ITR acts as a promoter, to drive expression of the predetermined DNA nucleic acid.
  • the spacer can be larger than 2 nucleotides, e.g., 5 or more nucleotides.
  • the spacer is at least 10 nucleotides, in one embodiment the spacer is 20 nucleotides or more, or 25 nucleotides or more. In one embodiment the spacer is from 5-50 nucleotides.
  • the DNA construct/vector lacks sequences that encode an AAV Rep protein (e.g., a Rep protein corresponding to the AAV from which the DD-ITR is derived).
  • an AAV Rep protein e.g., a Rep protein corresponding to the AAV from which the DD-ITR is derived.
  • the majority of the sequence of the DNA construct/vector is mammalian DNA instead of bacterial DNA.
  • the construct is closed linear double stranded DNA that expresses a heterologous nucleic acid and is not closed circular double stranded plasmid DNA that can express a heterologous gene.
  • the ITR can be from any parvovirus, for example a dependovirus such as AAV.
  • a dependovirus such as AAV.
  • Numerous serotypes of AAV are known. See for example Table 1 below
  • the DNA construct/vector persist (e.g., for an extended period of time) in the target cell (e.g., via replication or recombination, and/or concatemer formation). This may occur through self-replication when the target cell divides and/or concatemer formation, or a combination of both.
  • the DNA construct/vector is converted into a concatemeric structures within a target cell.
  • the concatemeric structures persist (e.g., for an extended period of time) in the target cell (e.g., via replication or recombination). Persistence of the concatemeric structure may be extra-chromosomal (e.g., as a mini-chromosome) or by integration into the target cell chromosome.
  • Another aspect of the invention relates to a method for introducing a nucleic acid into a target cell for sustained expression by administering a covalently closed non-viral DNA construct comprising at least one ITR sequence and complementary strands of the nucleic acid construct that anneal into a linear dsDNA that is expressible.
  • the DNA construct is similar to those described above, in that it forms linear DNA with hairpin covalently closed ends. It may further comprise a partial protelomerase recognition sequence (reflective of it being generated through the protelomerase activity).
  • the ITR is a synthetic ITR such as those shown in FIG. 5 .
  • the ITR sequence may further comprise both D and D′ sequences located on either side of the hairpin structure, as described herein.
  • Another aspect of the invention relates to a cell or population thereof, generated from introduction of a DNA construct described herein.
  • a significant portion of the population receives the DNA construct and expresses the encoded nucleic acid.
  • at least 10% of the cells of the population express the introduced nucleic acid.
  • at least 20%, 30%, 40%, 50% or more express the introduced nucleic acid.
  • at least 60%, 70%, 80% or more of the cells in the population express the introduced nucleic acid.
  • sustained expression is meant that the expression of encoded product, e.g., protein or nucleic acid, is at a detectable level that persists for an extended period of time, if not indefinitely, following administration of the subject vector.
  • extended period of time is meant from 1-5 weeks, from 2-5 weeks, from 3-5 weeks, from 4-5 weeks, at least 5 weeks, at least 6 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7, 8, 9, 10, 11 or 12 months, from 1-12 months, from 1-10 years, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 years, or longer.
  • detectable level is meant that the expression of the encoded product is at a level such that one can detect the encoded product in target cell, or the mammal comprising the same, e.g., in the serum of the mammal, at a therapeutic concentration.
  • protein expression persists for a period of time at a detectable level that is at least about 2 fold, usually at least about 5 fold and more usually at least about 10 fold longer following the subject methods as compared to a control.
  • An encoded product is considered to be at a detectable level if it can be detected using technology and protocols readily available and well known to those of skill in the art.
  • the above-described sustained expression is not only at a detectable level, but at a high level.
  • a minimal vector is considered to provide for a high level of expression if, after a period of time following its administration, e.g., at least about 28 days, the protein or nucleic acid encoded by the expression cassette of the vector is present at high levels in the host, e.g., in the target cells, in the serum of the host, etc.
  • Levels of an encoded product are considered “high” for purposes of the invention if they are present in amounts such that they exhibit detectable activity (e.g., have an impact on the phenotype), e.g., therapeutic activity, in the host.
  • Whether or not the expression level of a particular product is high will necessarily vary depending on the nature of the particular product, but can readily be determined by those of skill in the art, e.g., by an evaluation of whether expression of the product is sufficient to exhibit a desired effect on the phenotype of the host, such as an amelioration of a disease symptom.
  • Covalently closed ends of the DNA construct described herein may be generated by a variety of known methods, including in vitro cell-free synthesis.
  • One method of generating the covalently closed ends is by incorporation of protelomerase binding sites in a precursor molecule, and exposure of the molecule to protelomerase to thereby cleave and ligate the DNA at the site.
  • Non-limiting examples of cell free in vitro synthesis are e.g. described in U.S. Pat. Nos. 9,109,250; 6,451,563; Nucleic Acids Res. 2015 Oct. 15; 43(18): e120; U.S. Pat. Nos. 9,499,847; 15/508,766; PCT/GB2017/052413; and Antisense & nucleic acid drug development 11:149-153 (2001); herein incorporated by reference in their entirety.
  • the template is used to produce closed linear vector.
  • the viral vector template comprises wild type ITRs, e.g., that can have deletions, insertions, or substitutions.
  • the vector template comprises at least one synthetic ITR (e.g. non-limiting examples are those described in FIG. 5 ), an expression cassette, and flanked on each side of the ITRs a telomerase target site, which can be cleaved by a telomerase that covalently closes the ends.
  • the vector comprises two DD ITRs, an expression cassette, and flanked on each side of the DD ITRs is a telomerase target site, which can be cleaved by the telomerase and covalently closes the ends.
  • a prokaryotic system can be used herein.
  • the bacteriophage N15 exists as a linear extrachromosomal DNA with covalently closed ends (see Rybchin V N, Svarchevsky A N (1999)
  • the plasmid prophage N15 a linear DNA with covalently closed ends. Mol Micro-biol 33:895-903).
  • This DNA arises by a cleaving joining reaction, which is exerted by a single enzyme, a protelomerase, for example, TelN (prokaryotic telomerase) [Deneke J, Ziegelin G, Lurz R, Lanka E (2000)
  • TelN prokaryotic telomerase
  • a protelomerase such as TelN recognizes a target sequence in double-stranded DNA.
  • the target site is an imperfect palindromic structure termed telRL (see FIG. 8 ), which is formed by the two halves telR and telL, corresponding to the covalently closed ends of the linear prophage.
  • the enzyme cleaves both DNA strands and joins the resulting ends to form covalently closed hairpin structures.
  • the resulting DNA molecule has two hairpin loops ( FIG. 8 ).
  • TelN is able to linearize a recombinant plasmid harboring the telRL site [Deneke J, Ziegelin G, Lurz R, Lanka E (2000)
  • the protelom-erase of temperate Escherichia coli phage N15 has cleaving-joining activity. Proc Natl Acad Sci USA 97:7721-7726]. Therefore, one can employee this enzyme on a plasmid DNA for expression in higher organisms.
  • a method that efficiently produces rAAV closed linear DNA in an in vivo cell system that can be used to make rAAV virus.
  • the method comprises using a cell that expresses a protelomerase, such as TelN, or other protelomerase, wherein the protelomerase gene is under the control of a regulatable promoter.
  • a regulatable promoter for example, an inducible promoter such as a small molecule regulated promoter or a temperature sensitive promoter, e.g. a heat shock promoter.
  • the protelomerase can be added to the cell by known means.
  • the closed linear AAV genome containing the ITRs can then be used in place of plasmid DNA in a transfection protocol to make rAAV virus.
  • the closed linear genome comprises a 1 ⁇ 2 protelomerase binding site on each end.
  • the in-vivo cell system is used to produce a non-viral DNA vector construct for delivery of a predetermined nucleic acid sequence into a target cell for sustained expression.
  • the non-viral DNA vector comprises, two DD-ITRs each comprising: an inverted terminal repeat having an A, A′, B, B′, C, C′ and D region; a D′ region; and wherein the D and D′ region are complementary palindromic sequences of about 5-20 nt in length, are positioned adjacent the A and A′ region; the predetermined nucleic acid sequence (e.g. a heterologous gene for expression); wherein the two DD-ITRs flank the nucleic acid in the context of covalently closed non-viral DNA and wherein the closed linear vector comprises a 1 ⁇ 2 protelomerase binding site on each end.
  • two DD-ITRs each comprising: an inverted terminal repeat having an A, A′, B, B′, C, C′ and D region; a D′ region; and wherein the
  • the TelN/telRL system described herein can be used to produce the closed linear DNA fragments either by linearizing a parental plasmid containing one telRL site or by excising the rAAV DNA fragment, or non-viral vector fragment, comprising a promoter, the gene of interest, a polyadenylation signal from the parental plasmid with two flanking ITRs, further having two telRL sites flanking the respective segment. In one embodiment, there is at least one double “D” ITR.
  • the resulting linear covalently closed DNA molecules are functional in vivo.
  • the system comprises recombinant host cells.
  • Suitable host cells for use in the present production system include microbial cells, for example, bacterial cells such as E. coli cells, and yeast cells such as S. cerevisiae .
  • Mammalian host cells may also be used including Chinese hamster ovary (CHO) cell for example of K1 lineage (ATCC CCL 61) including the Pro5 variant (ATCC CRL 1281); the fibroblast-like cells derived from SV40-transformed African Green monkey kidney of the CV-1 lineage (ATCC CCL 70), of the COS-1 lineage (ATCC CRL 1650) and of the COS-7 lineage (ATCC CRL 1651; murine L-cells, murine 3T3 cells (ATCC CRL 1658), murine C127 cells, human embryonic kidney cells of the 293 lineage (ATCC CRL 1573), human carcinoma cells including those of the HeLa lineage (ATCC CCL 2), and neuroblastoma cells of the lines IMR-32 (AT
  • the host cell is designed to encode at least one recombinase.
  • the host cell may also be designed to encode two or multiple recombinases.
  • the term “recombinase” refers to an enzyme that catalyzes DNA exchange at a specific target site, for example, a palindromic sequence, by excision/insertion, inversion, translocation and exchange.
  • suitable recombinases for use in the present system include, but are not limited to, TelN, Tel, Tel (gp26 K02 phage) Cre, Flp, phiC31, Int and other lambdoid phage integrases, e.g. phi 80, HK022 and HP1 recombinases.
  • the target sequences for each of these recombinases are, respectively:
  • telRL site SEQ ID NO: 31
  • pal site SEQ ID NO: 32
  • ⁇ K02 telRL site SEQ ID NO: 2
  • loxP site SEQ ID NO: 33
  • TAACT TC GTATAGCATACATTATACGAAGTTAT the FRT site
  • SEQ ID NO: 34 GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC
  • the phiC31 attP site SEQ ID NO: 35
  • ⁇ attP site SEQ ID NO: 36
  • telomere expression of the recombinase is under the control of any regulated or inducible promoter, i.e. a promoter which is activated under a particular physical or chemical condition or stimulus.
  • suitable promoters include thermally-regulated promoters such as the ⁇ pL promoter, the IPTG regulated lac promoter, the glucose regulated ara promoter, the T7 polymerase regulated promoter, cold-shock inducible cspA promoter, pH inducible promoters, or combinations thereof, such as tac (T7 and lac) dual regulated promoter.
  • the recombinant cells also incorporate at least one DD-ITR and an expression cassette adapted to express a nucleic acid of interest.
  • the DD-ITR containing expression vector includes regulatory expression sequences, e.g. promoter, initiation and termination sequences, and a nucleic acid sequence of interest appropriately positioned relative to the regulatory sequences so that expression of the nucleic acid of interest will occur, i.e. the nucleic acid of interest is expressibly incorporated within the expression vector as well as at least one flanking DD-ITR, preferably flanked on both ends by DD-ITRs. In one embodiment, one of the DD-ITRs can serve as the promoter.
  • the regulatory expression sequences and nucleic acid sequence of interest, i.e. the expression cassette is flanked on either side by a target sequence (e.g. target nucleic acid sequence) for at least a first recombinase.
  • Alternate methods of generating covalently closed ends are known in the art e.g., by formation of mini-circle DNA from plasmids (e.g. as described in U.S. Pat. Nos. 8,828,726, and 7,897,380, the contents of each of which are incorporated by reference in their entirety).
  • one method of cell-free synthesis of the DD-vectors combines the use of two enzymes—Phi29 DNA polymerase and a protelomerase, and generates high fidelity, covalently closed, linear DNA constructs.
  • the constructs contain no antibiotic resistance markers, and therefore eliminate the packaging of these sequences.
  • the process can amplify DD-AAV constructs in a 2-week process at commercial scale and maintain the ITR sequences required for virus production.
  • Phi29 DNA polymerase is used to amplify double-stranded DNA by rolling circle amplification, and a protelomerase to generate covalently closed linear DNA, which coupled with a streamlined purification process, results in a pure DNA product containing just the sequence of interest.
  • Phi29 DNA polymerase has high fidelity ( 1/10 6 - 1/10 7 ) and high processivity (approximately 70 kbp). These features make this polymerase particularly suitable for the large-scale production of GMP DNA.
  • Protelomerases also known as telomere resolvases
  • a pair of protelomerases recognizes inverted palindromic DNA recognition sequences and catalyzes strand breakage, strand exchange and DNA ligation to generate closed linear hairpin ends.
  • the formation of these closed ended structures makes the DNA resistant to exonuclease activity, allowing for simple purification and can improve stability and duration of expression.
  • the production of DD-constructs depends upon the introduction of protelomerase recognition sequences that flank the region of interest. These sites are palindromic sequences (e.g. 56 bp) that are highly specific to particular protelomerase enzymes.
  • the protelomerase proteins bind to these sites to perform a cleavage joining reaction that results in monomeric double-stranded, linear, covalently closed DNA constructs.
  • the DNA outside the gene of interest e.g., the original vector backbone
  • these regions can be removed by the sequential action of restriction enzymes cutting at restriction sites unique to the vector backbone and exonuclease digestion of the released fragments, leaving only the desired covalently closed linear DNA containing the DD regions.
  • the DD-constructs When denatured, the DD-constructs comprise circular DNA molecules that can be used as a starting material for further amplification reactions.
  • the DNA construct comprises a protelomerase binding site and the covalently closed ends are formed by protelomorase enzyme activity (e.g., in vitro).
  • protelomorase enzyme activity e.g., in vitro
  • protelomorase enzyme activity e.g., in vitro
  • protelomorase enzyme activity e.g., in vitro
  • protelomorase enzyme activity e.g., in vitro
  • protelomorase enzyme activity e.g., in vitro
  • protelomorase enzyme activity e.g., in vitro
  • protelomorase enzyme activity e.g., in vitro
  • a protelomerase target sequence as used in the invention preferably comprises a double stranded palindromic (perfect inverted repeat) sequence of at least 14 base pairs in length.
  • Preferred perfect inverted repeat sequences include the sequences of SEQ ID NOs: 1 to 6 and variants thereof.
  • SEQ ID NO: 1 (NCATNNTANNCGNNTANNATGN) is a 22 base consensus sequence for a mesophilic bacteriophage perfect inverted repeat. Base pairs of the perfect inverted repeat are conserved at certain positions between different bacteriophages, while flexibility in sequence is possible at other positions. Thus, SEQ ID NO: 1 is a minimum consensus sequence for a perfect inverted repeat sequence for use with a bacteriophage protelomerase in the process of the present invention.
  • SEQ ID NO: 2 (CCATTATACGCGCGTATAATGG) is a particularly preferred perfect inverted repeat sequence for use with E. coli phage N15, and Klebsiella phage Phi KO2 protelomerases.
  • SEQ ID NOs: 3 to 5 SEQ ID NO: 3 (GCATACTACGCGCGTAGTATGC), SEQ ID NO: 4 (CCATACTATACGTATAGTATGG), SEQ ID NO: 5 (GCATACTATACGTATAGTATGC), are particularly preferred perfect inverted repeat sequences for use respectively with protelomerases from Yersinia phage PY54, Halomonas phage phiHAP-1, and Vibrio phage VP882.
  • SEQ ID NO: 6 is a particularly preferred perfect inverted repeat sequence for use with a Borrelia burgdorferi protelomerase.
  • This perfect inverted repeat sequence is from a linear covalently closed plasmid, lpB31.16 comprised in Borrelia burgdorferi .
  • This 14 base sequence is shorter than the 22 bp consensus perfect inverted repeat for bacteriophages (SEQ ID NO: 1), indicating that bacterial protelomerases may differ in specific target sequence requirements to bacteriophage protelomerases. However, all protelomerase target sequences share the common structural motif of a perfect inverted repeat.
  • the perfect inverted repeat sequence may be greater than 22 bp in length depending on the requirements of the specific protelomerase used in the process of the invention. Thus, in some embodiments, the perfect inverted repeat may be at least 30, at least 40, at least 60, at least 80 or at least 100 base pairs in length. Examples of such perfect inverted repeat sequences include SEQ ID NOs: 7 to 9 and variants thereof.
  • SEQ ID NO: 7 (GGCATAC TATACGTATAGTATGCC); SEQ ID NO: 8 (ACCTATTTCAGCATACTACGCGCG-TAGTATGCTGAAATAGGT); SEQ ID NO: 9 (CCTATATTGGGCCACCTATGTATG-CACAGTTCGCCCATACTATACGTATAGTATGGGCGAACTGTGCATACATAGGTGGCC CAATATAGG).
  • SEQ ID NOs: 7 to 9 and variants thereof are particularly preferred for use respectively with protelomerases from Vibrio phage VP882, Yersinia phage PY54 and Halomonas phage phi HAP-1.
  • the perfect inverted repeat may be flanked by additional inverted repeat sequences.
  • the flanking inverted repeats may be perfect or imperfect repeats i.e may be completely symmetrical or partially symmetrical.
  • the flanking inverted repeats may be contiguous with or non-contiguous with the central palindrome.
  • the protelomerase target sequence may comprise an imperfect inverted repeat sequence which comprises a perfect inverted repeat sequence of at least 14 base pairs in length.
  • An example is SEQ ID NO: 14.
  • the imperfect inverted repeat sequence may comprise a perfect inverted repeat sequence of at least 22 base pairs in length.
  • An example is SEQ ID NO: 10.
  • Particularly preferred protelomerase target sequences comprise the sequences of SEQ ID NOs: 10 to 14 or variants thereof.
  • SEQ ID NO: 11 (TATCAGCACACAATTGCCCATTATACG-CGCGTATAATGGACTATTG TGTGCTGATA); SEQ ID NO: 12 (ATGCGCGCATCCATTATACGCGCGTATAATGGCGATAATAATACA); SEQ ID NO: 13: (TAGTCACCTATTTCAGCATACTACGCGCGTAGTATGCTGAAATAGGT TACTG); (GGGATCCCGTTCCATACATACATGTATCCATGTGGCATACTATACG TATAGTATGCCGATGTTACATATGGTATCATTCGGGATCCCGTT); SEQ ID NO: 14 (TACTAAATAAATATTATATATATAATTTTTTATTAGTA).
  • sequences of SEQ ID NOs: 10 to 14 comprise perfect inverted repeat sequences as described above, and additionally comprise flanking sequences from the relevant organisms.
  • a protelomerase target sequence comprising the sequence of SEQ ID NO: 10 or a variant thereof is preferred for use in combination with E. coli N15 TelN protelomerase and variants thereof.
  • a protelomerase target sequence comprising the sequence of SEQ ID NO: 11 or a variant thereof is preferred for use in combination with Klebsiella phage Phi K02 protelomerase and variants thereof.
  • a protelomerase target sequence comprising the sequence of SEQ ID NO: 12 or a variant thereof is preferred for use in combination with Yersinia phage PY54 protelomerase and variants thereof.
  • a protelomerase target sequence comprising the sequence of SEQ ID NO: 13 or a variant thereof is preferred for use in combination with Vibrio phage VP882 protelomerase and variants thereof.
  • a protelomerase target sequence comprising the sequence of SEQ ID NO: 14 or a variant thereof is preferred for use in combination with a Borrelia burgdorferi protelomerase.
  • Variants of any of the palindrome or protelomerase target sequences described above include homologues or mutants thereof. Mutants include truncations, substitutions or deletions with respect to the native sequence.
  • a variant sequence is any sequence whose presence in the DNA template allows for its conversion into a closed linear DNA by the enzymatic activity of protelomerase. This can readily be determined by use of an appropriate assay for the formation of closed linear DNA. Any suitable assay described in the art may be used. An example of a suitable assay is described in Deneke et al, PNAS (2000) 97, 7721-7726.
  • the variant allows for protelomerase binding and activity that is comparable to that observed with the native sequence.
  • variants of palindrome sequences described herein include truncated palindrome sequences that preserve the perfect repeat structure, and remain capable of allowing for formation of closed linear DNA.
  • variant protelomerase target sequences may be modified such that they no longer preserve a perfect palindrome, provided that they are able to act as substrates for protelomerase activity.
  • protelomerase target sequences for use in the invention on the basis of the structural principles outlined above.
  • Candidate protelomerase target sequences can be screened for their ability to promote formation of closed linear DNA using the assays described above.
  • the covalently closed vectors described herein may be generated in vitro or in vivo.
  • the vectors are covalently closed linear double stranded vectors capable of expressing transgene in a target cell.
  • One example of an in vitro process for the production of a closed linear expression cassette DNA comprises a) contacting a DNA template comprising at least one expression cassette flanked on either side by a protelomerase target sequence with at least one DNA polymerase in the presence of one or more primers under conditions promoting amplification of said template; and b) contacting amplified DNA produced in a) with at least one, protelomerase under conditions promoting formation of a closed linear expression cassette DNA.
  • the closed linear expression cassette DNA product may comprise, consist or consist essentially of a eukaryotic promoter operably linked to a coding sequence of interest, and optionally a eukaryotic transcription termination sequence.
  • the closed linear expression cassette DNA product may additionally lack one or more bacterial or vector sequences, typically selected from the group consisting of: (i) bacterial origins of replication; (ii) bacterial selection markers (typically antibiotic resistance genes) and (iii) unmethylated CpG motifs.
  • any DNA template comprising at least one protelomerase target sequence may be amplified according to the process of the invention.
  • the process of the invention may be used to produce any type of closed linear DNA.
  • the DNA template may be a double stranded (ds) or a single stranded (ss) DNA.
  • a double stranded DNA template may be an open circular double stranded DNA, a closed circular double stranded DNA, an open linear double stranded DNA or a closed linear double stranded DNA.
  • the template is a closed circular double stranded DNA.
  • Closed circular dsDNA templates are particularly preferred for use with RCA (rolling circle amplification) DNA polymerases.
  • a circular dsDNA template may be in the form of a plasmid or other vector typically used to house a gene for bacterial propagation.
  • the process of the invention may be used to amplify any commercially available plasmid or other vector, such as a commercially available DNA medicine, and then convert the amplified vector DNA into closed linear DNA.
  • An open circular dsDNA may be used as a template where the DNA polymerase is a strand displacement polymerase which can initiate amplification from at a nicked DNA strand.
  • the template may be previously incubated with one or more enzymes which nick a DNA strand in the template at one or more sites.
  • a closed linear dsDNA may also be used as a template.
  • the closed linear dsDNA template (starting material) may be identical to the closed linear DNA product. Where a closed linear DNA is used as a template, it may be incubated under denaturing conditions to form a single stranded circular DNA before or during conditions promoting amplification of the template DNA.
  • the DNA template typically comprises an expression cassette as described above, i.e comprising, consisting or consisting essentially of a eukaryotic promoter operably linked to a sequence encoding a protein of interest, and optionally a eukaryotic transcription termination sequence.
  • the expression cassette may be a minimal expression cassette as defined above, i.e lacking one or more bacterial or vector sequences, typically selected from the group consisting of: (i) bacterial origins of replication; (ii) bacterial selection markers (typically antibiotic resistance genes) and (iii) unmethylated CpG motifs.
  • the DNA template may be provided in an amount sufficient for use in the process by any method known in the art.
  • the DNA template may be produced by the polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • the DNA template is a dsDNA
  • it may be provided for the amplification step as denatured single strands by prior incubation at a temperature of at least 94 degrees centigrade.
  • the process of the invention preferably comprises a step of denaturing a dsDNA template to provide single stranded DNA.
  • the dsDNA template may be provided in double-stranded form. The whole or a selected portion of the DNA template may be amplified in the reaction.
  • the DNA template is contacted with at least one DNA polymerase under conditions promoting amplification of said template.
  • Any DNA polymerase may be used. Any commercially available DNA polymerase is suitable for use in the process of the invention. Two, three, four, five or more different DNA polymerases may be used, for example one which provides a proof reading function and one or more others which do not. DNA polymerases having different mechanisms may be used e.g. strand displacement type polymerases and DNA polymerases replicating DNA by other methods.
  • a suitable example of a DNA polymerase that does not have strand displacement activity is T4 DNA polymerase.
  • a DNA polymerase is highly stable, such that its activity is not substantially reduced by prolonged incubation under process conditions. Therefore, the enzyme preferably has a long half-life under a range of process conditions including but not limited to temperature and pH. It is also preferred that a DNA polymerase has one or more characteristics suitable for a manufacturing process. The DNA polymerase preferably has high fidelity, for example through having proof-reading activity. Furthermore, it is preferred that a DNA polymerase displays high processivity, high strand-displacement activity and a low Km for dNTPs and DNA.
  • a DNA polymerase may be capable of using circular and/or linear DNA as template. The DNA polymerase may be capable of using dsDNA or ssdNA as a template. It is preferred that a DNA polymerase does not display non-specific exonuclease activity. Strand displacement-type polymerases are preferred.
  • the DNA template is also contacted with one or more primers.
  • the primers may be non-specific (i.e random in sequence) or may be specific for one or more sequences comprised within the DNA template. It is preferred that the primers are of random sequence so as to allow for non-specific initiation at any site on the DNA template. This allows for high efficiency of amplification through multiple initiation reactions from each template strand. Examples of random primers are hexamers, heptamers, octamers, nonamers, decamers or sequences greater in length, for example of 12, 15, 18, 20 or 30 nucleotides in length.
  • a random primer may be of 6 to 30, 8 to 30 or 12 to 30 nucleotides in length. Random primers are typically provided as a mix of oligonucleotides which are representative of all potential combinations of e.g. hexamers, heptamers, octamers or nonamers in the DNA template.
  • the primers are specific. This means they have a sequence which is complementary to a sequence in the DNA template from which initiation of amplification is desired.
  • a pair of primers may be used to specifically amplify a portion of the DNA template which is internal to the two primer binding sites.
  • Primers may be unlabelled, or may comprise one or more labels, for example radionuclides or fluorescent dyes. Primers may also comprise chemically modified nucleotides. Primer lengths/sequences may typically be selected based on temperature considerations i.e as being able to bind to the template at the temperature used in the amplification step.
  • the contacting of the DNA template with the DNA polymerase and one or more primers takes place under conditions promoting annealing of primers to the DNA template.
  • the conditions include the presence of single-stranded DNA allowing for hybridisation of the primers.
  • the conditions also include a temperature and buffer allowing for annealing of the primer to the template.
  • the DNA template is contacted with the DNA polymerase and one or more primers, there is then a step of incubation under conditions promoting amplification of said template.
  • the process of the invention also comprises a processing step for production of closed linear DNA.
  • Amplified DNA is contacted with at least one protelomerase under conditions promoting production of closed linear DNA.
  • This simple processing step based on protelomerase is advantageous over other methods used for production of closed linear DNA molecules.
  • the amplification and processing steps can be carried out simultaneously or concurrently. However, preferably, the amplification and processing steps are carried out sequentially with the processing step being carried out subsequent to the amplification step (i.e on amplified DNA).
  • the process of the invention is carried out in an in vitro cell-free environment.
  • the process is carried out in the absence of a host cell and typically comprises use of purified enzymatic components.
  • the amplification of a template DNA and processing by protelomerase is typically carried out by contacting the reaction components in solution in a suitable container.
  • particular components may be provided in immobilised form, such as attached to a solid support.
  • the template is an amplified linear open ended DNA, with blunt ends or overhangs and a synthesized hairpin molecule is ligated to one or both ends to form the closed ended linear DNA comprising at least one DD-ITR, or e.g. an ITR from FIG. 5 .
  • the template can be e.g. synthesized or PCR amplified. Unligated hairpins are purified away using means well known to those of skill in the art.
  • the non-viral linear DNA is made within a cell.
  • the process of the invention may be carried out at any scale. However, it is preferred that the process is carried out to amplify DNA at a commercial or industrial scale i.e. generating amplified DNA in milligram or greater quantities. It is preferred that the process generates at least one milligram, at least 10 milligrams, at least 20 milligrams, at least 50 milligrams or at least 100 milligrams of amplified DNA.
  • the final closed linear DNA product derived from the amplified DNA may also preferably be generated in milligram or greater quantities.
  • the process generates at least one milligram, at least 2 milligrams, at least 5 milligrams, at least 10 milligrams, at least 20 milligrams, at least 50 milligrams, or at least 100 milligrams of closed linear DNA.
  • An alternative method of generating covalently closed ends of the DD-ITR of the DNA construct is by formation of mini-circle DNA from plasmids.
  • a parent nucleic that includes the DNA of interest e.g., the DD-ITR and predetermined nucleic acid sequence in the form of an expression cassette
  • flanking attB and attP sites of a unidirectional site specific recombinase is contacted with the unidirectional site specific recombinase that recognizes the flanking attB and attP sites under conditions sufficient for the unidirectional site specific recombinase to mediate a recombination event that produces a minicircle vector from the parent nucleic acid.
  • flanked is meant that the expression cassette and other sequence of interest that is to be present in the product minicircle vector, has an att site, e.g., attB and attP, at either end, such that the parent nucleic acid is described by the formula:
  • the order of the att sites does not generally matter.
  • the att sites are substrate sites for the unidirectional site specific recombinase, and are typically referred to as attB or attP sites by those of skill in the art.
  • Sites of interest include, but are not limited to, the att sites recognized by the specific integrase recombinases above, as well as mutants thereof.
  • the parent nucleic acid may be present as a variety of different forms, depending at least in part on whether the production method is an in vitro or in vivo method.
  • the parent nucleic acid may be a linear double stranded nucleic acid, a closed circular nucleic acid (such as a bacterial plasmid suitable for use in replication), integrated into genomic DNA, and the like.
  • the method may be practiced in vitro or in vivo, e.g., inside of a cell.
  • all necessary reagents e.g., parent nucleic acid, site specific integrase, etc.
  • the reaction mixture is maintained at a temperature of between about 20 and 40° C.
  • the method is an in vitro method in that the recombinase mediated production of the desired product minicircle vector occurs inside of a cell in culture.
  • the parent nucleic acid is a plasmid that replicated in a bacterial host to produce large copy numbers of the parent nucleic acid prior to the recombinase mediated vector production step.
  • the first step may generally be to first prepare a host cell that includes large numbers of the parent nucleic acid. This may conveniently be done by transforming a host cell, e.g., E. coli ., with a plasmid that will serve as the parent nucleic acid. The resultant transformed host cell is then maintained under conditions sufficient for the host cell to produce large copy numbers of the parent nucleic acid, as described above.
  • a host cell e.g., E. coli .
  • the unidirectional site-specific recombinase activity i.e., that mediates production of the desired vector from the parent nucleic acid
  • the desired recombinase activity may be produced in the cell using any convenient protocol.
  • the recombinase or a nucleic acid coding sequence therefore may be introduced into the host cell, e.g., as described above.
  • the coding sequence for the recombinase may already be present in the host cell but not expressed, e.g., because it is under the control of an inducible promoter.
  • the inducible coding sequence may be present on the parent nucleic acid, present on another episomal nucleic acid, or even integrated into the host's genomic DNA.
  • Representative inducible promoters of interest that may be operationally linked to the recombinase coding sequence include, but are not limited to: aracBAD promoter, the lambda pL promoter, and the like.
  • the step of providing the desired recombinase activity in the host cell includes inducing the inducible promoter to cause expression of the desired recombinase.
  • the resultant host cell is then maintained under conditions and for a period of time sufficient for the recombinase activity to mediate production of the desired minicircle vectors from the parent nucleic acids.
  • the host cell is maintained at a temperature of between about 20 and 40° C.
  • the product minicircles may then be separated from the remainder of their “synthesis” environment (e.g., reaction mixture, host cell, etc.) as desired. Any convenient protocol for separating the product minicircles may be employed. Representative protocols are described in U.S. Pat. Nos. 8,828,726, and 7,897,380.
  • One aspect of the invention described herein provides a method of manufacturing circular nucleic acid vectors containing a transgene comprising: (a) contacting a host system with a template, wherein the template comprises at least one flanking cleavage sites, and (i) at least one phage origin of replication (ORI); (ii) at least one Terminal Repeat (TR), and; (iii) a promoter sequence operatively linked to a transgene, wherein at least one TR is an adeno associated virus (AAV) Double D ITR (DD-ITR); (b) incubating the host system for a time sufficient for replication to occur resulting in circular nucleic acid production; and (c) recovering the circular nucleic acid production, wherein the circular nucleic acid self-anneals.
  • AAV adeno associated virus
  • DD-ITR Double D ITR
  • Another aspect of the invention described herein provides a method of manufacturing circular nucleic acid vectors containing a transgene comprising: (a) transforming a host system with a plasmid template, wherein the plasmid template comprises: (i) a phage origin of replication (ORI); (ii) a truncated phage ORI (e.g., ORI ⁇ 29); (iii) at least one Terminal Repeat (TR), and; (iv) a promoter sequence operatively linked to a transgene, wherein the plasmid template comprises, in the 5′ to 3′ direction, the sense sequence and the anti-sense sequence separated by a hairpin sequence that allows for annealing of the sense and anti-sense strand, and wherein at least one TR is an AAV Double D ITR (DD-ITR); (b) incubating the host system for a time sufficient for replication to occur resulting in circular nucleic acid production; and (c) recovering the circular nucleic acid production, wherein the
  • a template used to produce circular nucleic acids is generated by cutting double-stranded plasmid DNA which comprises the components of the template (for example, see FIGS. 11-13 ) with a nuclease that specifically targets the cleavage site present on the plasmid, e.g., a restriction enzyme.
  • double-stranded plasmid template can be used to produce circular nucleic acids (e.g., FIG. 14 ).
  • a plasmid comprising components of a template, or a plasmid template described herein can be generated using standard cloning techniques known in the art.
  • the plasmid fragment i.e., a single-stranded linear DNA found between the two cleavage sites.
  • the plasmid fragment is than annealed to adaptor proteins at the cut ends.
  • An adaptor sequence e.g., having a complementary sequence to the cleavage site, would be capable of annealing to the cleavage site using standard techniques known in the art, for example, via ligation. Annealing the adaptor sequences to the ends of the plasmid fragment circularizes the DNA, creating a closed-end DNA structure, referred to herein as a template.
  • a template can be replicated in vitro or in vivo in a host system.
  • E. coli cells using standard methods, e.g., as described in Shepherd, et al. Scientific Reports 9, Article number: 6121 (2019); cell extracts, e.g., E. coli cell extracts, as described in Wang, G., et al. Cell Research 7, 1-12(1997); or in a bacterial packaging cell line known in the art (the contents of these citations are incorporated herein by reference in their entireties).
  • a bacterial packaging cell line can express M13-based helper plasmids, e.g., as described in Chastenn, L., et al. Nucleic Acids Res. 2006 December; 34(21): e145, the contents of which are incorporated herein by reference in its entirety.
  • a template described herein need not undergo replication, and can be used to directly contact a host system, for example, an in vitro cell line.
  • Phage ORIs described herein independently initiate replication of single-stranded circle, i.e., circular nucleic acids.
  • the phage ORI located on the template initiates the replication of a single-stranded, complementary circle DNA, referred to herein as circular nucleic acid.
  • the template is incubated in the host system for a time sufficient to replicate circular nucleic acid.
  • the phage ORI initiates replication without requiring any additional components, e.g., helper phage.
  • phage ORI-initiated replication occurs in the presence of additional components, e.g., helper phage.
  • Helper phage particles for example, M13K07, provide the necessary gene products for particle formation when using phage vectors. Helper phage particles are further reviewed in, for example, in (2005) Helper Phage. In: Encyclopedic Reference of Genomics and Proteomics in Molecular Medicine. Springer, Berlin, Heidelberg; the contents of which are incorporated herein by reference in its entirety.
  • the template is single-stranded and in vitro or in vivo replication of the template generates single-stranded circular nucleic acids.
  • the single-stranded circular DNA can self-anneal, for example, at the transgene sequence, and become double stranded.
  • the single-stranded circular nucleic acid contains a self-complementary transgene, e.g., a therapeutic transgene.
  • the single-stranded circular nucleic acid contains the sense sequence of the transgene and the anti-sense sequence of the transgene on one strand.
  • the sense and the anti-sense sequences are separated by a linker, e.g., a Holliday linker or a defective ITR, that allows the strand to bend and binding of the sense and antisense sequences to occur.
  • a linker e.g., a Holliday linker or a defective ITR
  • the linker can be any sequence that allows for the bending of the strand that facilitates the binding of the sense and anti-sense sequences of the transgene.
  • the single-stranded circular nucleic acids further comprise a complement region and self-complement region flanking the ORI. See, e.g., FIG. 14 .
  • Circular nucleic acids are released (i.e., set free) from the host system using standard techniques known for a specific host system, such as mechanical-mediated release (sonication) or chemical-mediated release (detergents). Following release, circular nucleic acids are recovered using standard methods, for example, via purification using column chromatography.
  • a circular nucleic acid generated herein can be closed-ended, open-ended, or both open-ended and closed ended.
  • the circular nucleic acid is closed-ended.
  • a closed-ended DNA vector can have any configuration, for example, doggie bone, dumbbell, circular, closed-ended linear duplex, etc.
  • a circular nucleic acid replicate generated using methods described herein can be used for delivery of the transgene it expresses, or to generate more circular nucleic acids, e.g., via additional in vitro or in vivo replication.
  • Circular nucleic acids manufactured using methods described herein can be used in the production of recombinant vectors, e.g., a recombinant viral vector.
  • a host system used for replication of the circular nucleic acid can be, e.g., an in vitro or in vivo host system.
  • the host system can be a host cell, such as an insect cell, a mammalian cell, a virus, a bacterial packaging cell, or a cell free system.
  • a host system for manufacturing an AAV vector can further comprise a baculovirus expression system, for example, if the host system is an insect cell, e.g., Sf9, Sf21, Hi-5, and S2 insect cell lines. Baculovirus expression systems are further described in, e.g., U.S. Pat. Nos.
  • vectors can be synthesized and assembled in an in vitro system.
  • the cell-free system comprises helper phage particles.
  • the elements located on the circular nucleic acid, or template or plasmid template it is produced from are not limited with respect to their location on the circular nucleic acid, or template or plasmid template from 5′ to 3′.
  • an ORI can be located upstream of a dd-ITR, or downstream of a dd-ITR, or both up and downstream of an dd-ITR.
  • the ORI is flanked by the dd-ITRs and upstream of the promoter sequence operably linked to a transgene.
  • the template contains an F1 ORI and has the sequence of SEQ ID NO: 37.
  • the ORI is derived from M13 and facilitates M13 helper-dependent replication of the template.
  • M13 ORI has the nucleotide sequence of SEQ ID NO: 38.
  • the at least one ORI includes a second ORI that is mutated as compared to a wild-type ORI.
  • a mutated ORI can comprise single nucleotide mutations, e.g., nucleotide deletion, insertion, or substitutions) or can be truncated to lack at least a portion (e.g., at least five nucleotides) of the wild-type ORI sequence.
  • the mutant ORI is a mutant F1 ORI, F1-ORI ⁇ 29.
  • Mutant ORI ⁇ 29 is a truncated F1 ORI that lacks the capacity to initiate replication.
  • ORI ⁇ 29 is further reviewed in, e.g., Specthrie, L, et al. Journal of Mol Biol. V. 228(3), 1992.
  • ORI ⁇ 29 has the nucleotide sequence of SEQ ID NO: 39.
  • the mutant ORI is a mutant M13 ORI, M13-ORI ⁇ 29.
  • Mutant ORI ⁇ 29 is a truncated M13 ORI that lacks the capacity to initiate replication.
  • ORI ⁇ 29 has the nucleotide sequence of SEQ ID NO: 40.
  • Circular nucleic acids described herein do not comprise other types or species of ORI, for example, the vector does not comprise bacterial or mammalian ORI.
  • a cleavage site is a nucleotide sequence in which the phosphodiester backbone is selectively broken.
  • a nucleotide sequence recognized by a nuclease is a cleavage site because the enzyme will cut the phosphodiester backbone at selective sites within the sequence.
  • Such cleavage sites may be single or double-stranded, depending on the endonuclease.
  • chemical cleavage sites such as pyrimidine and purine cleavage reactions performed in Maxam and Gilbert sequencing, or cleavage through chemical methods such as oxidation as described in U.S. Pat. No. 4,795,700, which is incorporated herein by reference.
  • the template further comprises at least a second cleavage, and within the sites are the additional elements contained on the template, e.g., at least on ORI, at least one TR (at least one of which is a DD-ITR), and promotor operatively linked to a therapeutic transgene, such that the at least two cleavage sites flank these elements.
  • a third, unique cleavage site is located immediately downstream of the ORI.
  • the cleavage site is cut by a nuclease.
  • nuclease refers to molecules which possesses activity for DNA cleavage.
  • the nuclease is protelomerase and the cleavage site is a protelomerase target sequence, e.g., the TelN recognition site.
  • the nuclease is a restriction endonuclease and the cleavage site is a recognition site for the endonuclease (i.e., a restriction site). Restriction endonucleases are hydrolytic enzymes capable of catalyzing site-specific cleavage of DNA molecules.
  • the locus of restriction endonuclease action is determined by the existence of a specific nucleotide sequence. Such a sequence is termed the recognition site for the restriction endonuclease.
  • the at least two site can be the same cleavage sites or difference cleave sites.
  • a restriction site in the template is an uncommon restriction site, i.e., it is not commonly found in the sequence of transgenes.
  • Exemplary uncommon restriction sites include a mirror-like palindrome restriction site, or an 8 base pair restriction site.
  • the restriction site used in the template is not found in the transgene, i.e., therapeutic transgene, of the invention.
  • An adaptor sequence is a short, synthesized, single-stranded or double-stranded oligonucleotide that can be ligated to the ends of other DNA or RNA molecules.
  • an adaptor sequences described herein are single-stranded and close the DNA end it is ligated to, e.g., through a hairpin loop.
  • Adaptor sequences are added to one or both ends of the cut plasmid fragment as a means of circularizing the DNA.
  • the adaptor sequence is ligated to the plasmid fragment and directs the closure at the end of the cleaved DNA which it is ligated to (see e.g., FIGS. 11-13 ).
  • Exemplary adaptor proteins that can be used to close the DNA end include hairpin loops further described, e.g., in U.S. Application No. 2009/0098612; and U.S. Pat. Nos. 6,369,038; 6,451,563; 6,849,725; the contents of which are incorporated herein by reference in their entireties. It is envisioned that any sequence that can circularize the DNA when added to the cut end of a plasmid fragment excised from a plasmid can be an adaptor sequence.
  • a hairpin loop adaptor sequence having the sequence of SEQ ID NO. 41 can further comprise an Sfi1 restriction site sequence (e.g., GGCC GGCC; SEQ ID NO: 42).
  • Sfi1 restriction site sequence e.g., GGCC GGCC; SEQ ID NO: 42.
  • the adaptor sequence having a Sfi1 restriction site sequence can be digested with the restriction enzyme, Sfi1, for a time sufficient to cut the restriction site. This would create “sticky ends” on the adaptor sequence that can be used to hybridize the adaptor protein to a plasmid fragment excised via the Sfi1 restriction enzyme.
  • the DNA constructs of the present invention are useful for the delivery of nucleic acids to cells in vitro, ex vivo, and in vivo.
  • the DNA constructs can be advantageously employed to deliver or transfer nucleic acids to animal, including mammalian, cells.
  • nucleic acids of interest include nucleic acids encoding polypeptides, including therapeutic (e.g., for medical or veterinary uses), immunogenic (e.g., for vaccines), or diagnostic polypeptides.
  • Therapeutic polypeptides include, but are not limited to, cystic fibrosis transmembrane regulator protein (CFTR), dystrophin (including mini- and micro-dystrophins (see, e.g, Vincent et al., (1993) Nature Genetics 5:130; U.S. Patent Publication No. 2003/017131; International publication WO/2008/088895, Wang et al., Proc. Natl. Acad. Sci. USA 97:13714-13719 (2000); and Gregorevic et al., Mol. Ther.
  • CTR cystic fibrosis transmembrane regulator protein
  • dystrophin including mini- and micro-dystrophins
  • myostatin propeptide myostatin propeptide, follistatin, activin type II soluble receptor, IGF-1, anti-inflammatory polypeptides such as the Ikappa B dominant mutant, sarcospan, utrophin (Tinsley et al., (1996) Nature 384:349), mini-utrophin, clotting factors (e.g., Factor VIII, Factor IX, Factor X, etc.), erythropoietin, angiostatin, endostatin, catalase, tyrosine hydroxylase, superoxide dismutase, leptin, the LDL receptor, lipoprotein lipase, ornithine transcarbamylase, beta-globin, alpha-globin, spectrin, alphas-antitrypsin, adenosine deaminase, hypoxanthine guanine phosphoribosyl transferase, beta-glucocerebrosi
  • heterologous nucleic acid sequences encode suicide gene products (e.g., thymidine kinase, cytosine deaminase, diphtheria toxin, and tumor necrosis factor), proteins conferring resistance to a drug used in cancer therapy, tumor suppressor gene products (e.g., p53, Rb, Wt-1), TRAIL, FAS-ligand, and any other polypeptide that has a therapeutic effect in a subject in need thereof.
  • Parvovirus vectors can also be used to deliver monoclonal antibodies and antibody fragments, for example, an antibody or antibody fragment directed against myostatin (see, e.g., Fang et al., Nature Biotechnol. 23:584-590 (2005)).
  • Nucleic acid sequences encoding polypeptides include those encoding reporter polypeptides (e.g., an enzyme). Reporter polypeptides are known in the art and include, but are not limited to, Green Fluorescent Protein, beta-galactosidase, alkaline phosphatase, luciferase, and chloramphenicol acetyltransferase gene.
  • the nucleic acid may encode an antisense nucleic acid, a ribozyme (e.g., as described in U.S. Pat. No. 5,877,022), RNAs that effect spliceosome-mediated trans-splicing (see, Puttaraju et al., (1999) Nature Biotech 17:246; U.S. Pat. Nos.
  • a ribozyme e.g., as described in U.S. Pat. No. 5,877,022
  • RNAs that effect spliceosome-mediated trans-splicing see, Puttaraju et al., (1999) Nature Biotech 17:246; U.S. Pat. Nos.
  • RNAi interfering RNAs
  • siRNA siRNA
  • shRNA miRNA that mediate gene silencing
  • other non-translated RNAs such as “guide” RNAs (Gorman et al., (1998) Proc. Nat. Acad. Sci. USA 95:4929; U.S. Pat. No. 5,869,248 to Yuan et al.), and the like.
  • RNAi against a multiple drug resistance (MDR) gene product e.g., to treat and/or prevent tumors and/or for administration to the heart to prevent damage by chemotherapy
  • MDR multiple drug resistance
  • myostatin e.g., for Duchenne muscular dystrophy
  • VEGF e.g., to treat and/or prevent tumors
  • RNAi against phospholamban e.g., to treat cardiovascular disease, see, e.g., Andino et al., J. Gene Med. 10:132-142 (2008) and Li et al., Acta Pharmacol Sin.
  • phospholamban inhibitory or dominant-negative molecules such as phospholamban S16E (e.g., to treat cardiovascular disease, see, e.g., Hoshijima et al. Nat. Med. 8:864-871 (2002)), RNAi to adenosine kinase (e.g., for epilepsy), RNAi to a sarcoglycan (e.g., alpha., beta., gamma), RNAi against myostatin, myostatin propeptide, follistatin, or activin type II soluble receptor, RNAi against anti-inflammatory polypeptides such as the Ikappa B dominant mutant, and RNAi directed against pathogenic organisms and viruses (e.g., hepatitis B virus, human immunodeficiency virus, CMV, herpes simplex virus, human papilloma virus, etc.).
  • pathogenic organisms and viruses e.g., hepatitis B virus, human
  • the nucleic acid may encode protein phosphatase inhibitor I (I-1), serca2a, zinc finger proteins that regulate the phospholamban gene, Barkct, beta 2-adrenergic receptor, beta 2-adrenergic receptor kinase (BARK), phosphoinositide-3 kinase (PI3 kinase), a molecule that effects G-protein coupled receptor kinase type 2 knockdown such as a truncated constitutively active bARKct; calsarcin, RNAi against phospholamban; phospholamban inhibitory or dominant-negative molecules such as phospholamban S16E, enos, inos, or bone morphogenie proteins (including BNP 2, 7, etc., RANKL and/or VEGF).
  • I-1 protein phosphatase inhibitor I
  • serca2a zinc finger proteins that regulate the phospholamban gene
  • Barkct beta 2-adrenergic receptor
  • the DNA constructs may also comprise a nucleic acid that shares homology with and recombines with a locus on a host chromosome. This approach can be utilized, for example, to correct a genetic defect in the host cell.
  • the nucleic acid can encode any polypeptide that is desirably produced in a cell in vitro, ex vivo, or in vivo.
  • the DNA construct may be introduced into cultured cells and the expressed gene product isolated therefrom.
  • the nucleic acid may be in the context of an expression cassette. It will be understood by those skilled in the art that the nucleic acid(s) of interest can be operably associated with appropriate control sequences.
  • the nucleic acid can be operably associated with expression control elements, such as transcription/translation control signals, origins of replication, polyadenylation signals, internal ribosome entry sites (IRES), promoters, and/or enhancers, and the like.
  • the expression cassette comprises a eukaryotic promoter operably linked to a coding sequence of interest, and optionally a eukaryotic transcription termination sequence.
  • promoter/enhancer elements can be used depending on the level and tissue-specific expression desired.
  • the promoter/enhancer can be constitutive or inducible, depending on the pattern of expression desired.
  • the promoter/enhancer can be native or foreign and can be a natural or a synthetic sequence. By foreign, it is intended that the transcriptional initiation region is not found in the wild-type host/target cell into which the transcriptional initiation region is introduced.
  • the promoter/enhancer elements can be native to the target cell or subject to be treated.
  • the promoters/enhancer element can be native to the nucleic acid sequence.
  • the promoter/enhancer element is generally chosen so that it functions in the target cell(s) of interest. Further, in particular embodiments the promoter/enhancer element is a mammalian promoter/enhancer element.
  • the promoter/enhancer element may be constitutive or inducible.
  • Inducible expression control elements are typically advantageous in those applications in which it is desirable to provide regulation over expression of the heterologous nucleic acid sequence(s).
  • Inducible promoters/enhancer elements for gene delivery can be tissue-specific or -preferred promoter/enhancer elements, and include muscle specific or preferred (including cardiac, skeletal and/or smooth muscle specific or preferred), neural tissue specific or preferred (including brain-specific or preferred), eye specific or preferred (including retina-specific and cornea-specific), liver specific or preferred, bone marrow specific or preferred, pancreatic specific or preferred, spleen specific or preferred, and lung specific or preferred promoter/enhancer elements.
  • Other inducible promoter/enhancer elements include hormone-inducible and metal-inducible elements.
  • Exemplary inducible promoters/enhancer elements include, but are not limited to, a Tet on/off element, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, and a metallothionein promoter.
  • nucleic acid sequence(s) is transcribed and then translated in the target cells
  • specific initiation signals are generally included for efficient translation of inserted protein coding sequences.
  • exogenous translational control sequences which may include the ATG initiation codon and adjacent sequences, can be of a variety of origins, both natural and synthetic.
  • aspects of the invention relate to covalently closed non-viral linear DNA construct (sometimes closed linear DNA) to produce recombinant viral particles for delivery of construct DNA as a single stranded recombinant viral genome.
  • This involves adding the closed linear DNA construct comprising at least two DD-ITRs (e.g., see FIG. 1 ) into a host cell along with vectors or plasmids capable of (1) expressing AAV Rep proteins necessary to nick at least one of the DD-ITRs, and (2) expressing parvovirus viral capsid proteins, e.g., a dependovirus such as AAV, necessary to form a virion (viral particle) that can encapsidate the ITRs and the intervening DNA sequence.
  • DD-ITRs e.g., see FIG. 1
  • vectors or plasmids capable of (1) expressing AAV Rep proteins necessary to nick at least one of the DD-ITRs, and (2) expressing parvovirus viral capsid proteins, e
  • the DD-ITRs resolve and replication is initiated from the self-primed ITR in the presence of Rep to produce vector genomes that can be packaged.
  • the intervening DNA sequence contains a transgene sequence such as a therapeutic gene sequence.
  • the particular Rep protein that nicks, e.g., an AAV ITR is typically from the same serotype (for example, AAV2 ITR with AAV2Rep78) although any serotypes can be used as long as they retain at least 25% . . . 35% . . . 50% . . . 65% . . . 75% . . . 85% . . . 90% . . . 95% . . . 98% . .
  • the initial non-viral closed linear DNA construct rAAV genome vector template for example can have a Rep nick defective ITR or a hairpin sequence. See for example, U.S. Pat. Nos. 7,465,583, 7,790,154, 8,361,457, 8,784,799 incorporated by reference in their entirety.
  • the vector template can be an approximately 1 ⁇ 2 size genome template (e.g. around 1 ⁇ 2 size of a wild type AAV genome) and one of the DD-ITRs is a Rep-nick incompetent ITR.
  • the rescued and replicated rAAV genome would then be full length genome size and packageable.
  • the closed linear DNA construct rAAV genome vector template comprises a nick defective ITR, or e.g. a hairpin sequence, that is placed between to two Rep-nick competent DD-ITRs and the nick defective ITR, or hairpin sequence is further in between the sense and anti-sense sequences of the transgene, and the genome template is approximately full size, e.g.
  • the sense and anti-sense sequences are on a single strand of DNA in between ITRs and this vector genome can be packaged within the rAAV virion.
  • the host cell can already be expressing the Rep and viral capsid proteins or one can co-transfect the cells at the same or about the same time by standard means. Any of the known cell-types used in the art can be used in this process. For example, one can use an insect cell such as baculovirus. Methods for production using mammalian suspension cells are for example described in U.S. Pat. No. 9,411,206, incorporated herein by reference in its entirety.
  • compositions comprising the vectors described herein are also provided.
  • the ITR sequence is flanked on either side by complementary sequences D and D′ (e.g., is a DD-ITR).
  • the D regions contain a nicking site.
  • the ITR sequences of a nucleic acid or nucleic acid vector described herein can be derived from any parviovirus or any AAV serotype (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) or can be derived from more than one serotype.
  • the ITR sequences are derived from AAV2.
  • the ITR sequences are derived from an autonomus parvovirus.
  • ITR sequences and plasmids containing ITR sequences are known in the art and commercially available (see, e.g., products and services available from Vector Biolabs, Philadelphia, Pa.; Cellbiolabs, San Diego, Calif.; Agilent Technologies, Santa Clara, Ca; and Addgene, Cambridge, Mass.; and Gene delivery to skeletal muscle results in sustained expression and systemic delivery of a therapeutic protein.
  • Kessler PD Podsakoff G M, Chen X, McQuiston S A, Colosi P C, Matelis L A, Kurtzman G J, Byrne B J. Proc Natl Acad Sci USA. 1996 Nov. 26; 93(24): 14082-7; and Curtis A. Machida.
  • the expression construct is no more than 5 kilobases, no more than 4 kilobases, or no more than 3 kilobases in size. In some embodiments, the expression construct is between 4 and 7 kilobases in size.
  • the replicated genome obtained from rescue and replicaiton of the rAAV genome from the closed linear DNA vectors described herein is enccapsidated in a parvovirus particle such as a dependovirus particle.
  • a parvovirus particle such as a dependovirus particle.
  • the rAAV particle may be of any AAV serotype (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10), including any derivative (including non-naturally occurring variants of a serotype) or chimeric or pseudotype.
  • the replicated genome is a packageable size.
  • Non-limiting examples of derivatives and chimerics include AAV2-AAV3, AAVrh.10, AAVhu.14, AAV3a/3b, AAVrh32.33, AAV-HSC15, AAV-HSC17, AAVhu.37, AAVrh.8, CHt-P6, AAV2.5, AAV6.2, AAV2i8, AAV-HSC15/17, AAVM41, AAV9.45, AAV6(Y445F/Y731F), AAV2.5T, AAV-HAE1/2, AAV clone 32/83, AAVShHIO, AAV2 (Y->F), AAV8 (Y733F), AAV2.15, AAV2.4, AAVM41, and AAVr3.45 (see, e.g., Mol Ther.
  • the rAAV particle comprises a capsid that includes modified capsid proteins (e.g., capsid proteins comprising a modified VP3, VP1, or VP2). Methods of producing modified capsid proteins are known in the art (see, e.g., U.S. Patent Publication Number US20130310443, which is incorporated herein by reference in its entirety).
  • the rAAV particle comprises a modified capsid protein comprising at least one non-native amino acid substitution at a position that corresponds to a surface-exposed amino acid in a wild-type capsid protein (e.g., wild-type AAV2 capsid protein, such as SEQ ID NO: 15, or other wild-type AAV capsid protein).
  • the rAAV particle comprises a modified capsid protein comprising a non-tyrosine amino acid (e.g., a phenylalanine) at a position that corresponds to a surface-exposed tyrosine amino acid in a wild-type capsid protein, a non-threonine amino acid (e.g., a valine) at a position that corresponds to a surface-exposed threonine amino acid in the wild-type capsid protein, a non-lysine amino acid (e.g., a glutamic acid) at a position that corresponds to a surface-exposed lysine amino acid in the wild-type capsid protein, a non-serine amino acid (e.g., a valine) at a position that corresponds to a surface-exposed serine amino acid in the wild-type capsid protein, or a combination thereof.
  • a non-tyrosine amino acid e.g., a pheny
  • rAAV particles and nucleic acid vectors are also known in the art and commercially available (see, e.g., Zolotukhin et al. Production and purification of serotype 1, 2, and 5 recombinant adeno-associated viral vectors. Methods 28 (2002) 158-167; and U.S. Patent Publication Numbers US20070015238 and US20120322861, which are incorporated herein by reference; and plasmids and kits available from ATCC and Cell Biolabs, Inc.).
  • the nucleic acid vector (e.g., the closed linear vector comprising DD-ITR and heterologus gene) may be combined with one or more helper plasmids, e.g., that contain a rep gene (e.g., encoding Rep78, Rep68, Rep52 and Rep40) and a cap gene (encoding VP1, VP2, and VP3), and transfected into a producer cell line such that the rAAV vector genome can be replicated, packaged and subsequently purified.
  • helper plasmids e.g., that contain a rep gene (e.g., encoding Rep78, Rep68, Rep52 and Rep40) and a cap gene (encoding VP1, VP2, and VP3)
  • the cell is a mammalian cell.
  • the cell can be a trans-complementing packaging cell line that provides functions deleted from a replication-defective helper virus, e.g., 293 cells or other Ela trans-complementing cells.
  • the AAV replication and capsid sequences may be provided by any method known in the art. Current protocols typically express the AAV rep/cap genes on a single plasmid. The AAV replication and packaging sequences need not be provided together, although it may be convenient to do so.
  • the AAV rep and/or cap sequences may be provided by any viral or non-viral vector.
  • the rep/cap sequences may be provided by a hybrid adenovirus or herpesvirus vector (e.g., inserted into the Ela or E3 regions of a deleted adenovirus vector). EBV vectors may also be employed to express the AAV cap and rep genes.
  • EBV vectors are episomal, yet will maintain a high copy number throughout successive cell divisions (i.e., are stably integrated into the cell as extra-chromosomal elements, designated as an “EBV based nuclear episome,” see Margolski, (1992) Curr. Top. Microbiol. Immun. 158:67).
  • Modified capsid proteins of the invention can be produced by modifying the capsid protein of any AAV now known or later discovered.
  • the AAV capsid protein that is to be modified can be a naturally occurring AAV capsid protein (e.g., an AAV2, AAV3a or 3b, AAV4, AAV5, AAV8, AAV9, AAV10 or AAV11 capsid protein or any of the AAV shown in Table 1) but is not so limited.
  • AAV capsid protein e.g., an AAV2, AAV3a or 3b, AAV4, AAV5, AAV8, AAV9, AAV10 or AAV11 capsid protein or any of the AAV shown in Table 1
  • Those skilled in the art will understand that a variety of manipulations to the AAV capsid proteins are known in the art and the invention is not limited to modifications of naturally occurring AAV capsid proteins.
  • the capsid protein to be modified may already have alterations such as insertions, deletions or substitutions as compared with naturally occurring AAV (e.g., is derived from a naturally occurring AAV capsid protein, e.g., AAV2, AAV3a, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10 and/or AAV11 or any other AAV now known or later discovered).
  • AAV capsid proteins are also within the scope of the present invention.
  • the capsid protein can be modified such that it has a phenotype of decreased liver transduction and/or reduced glycan binding affinity as compared an unmodified capsid protein. It would be well known to one of skill in the art what the equivalent amino acids are in other AAV serotypes and the present invention encompasses such other AAV serotypes, comprising, consisting essentially of, or consisting of the mutation(s) of this invention at such equivalent amino acid positions, wherein said mutation(s) result in a phenotype of reduced liver transduction and/or reduced glycan binding affinity as compared to a control.
  • helper virus functions e.g., adenovirus or herpesvirus
  • helper virus sequences necessary for AAV replication are known in the art. Typically, these sequences will be provided by a helper adenovirus or herpesvirus vector.
  • the adenovirus or herpesvirus sequences can be provided by another non-viral or viral vector, e.g., as a non-infectious adenovirus miniplasmid that carries all of the helper genes that promote efficient AAV production as described by Ferrari et al., (1997) Nature Med. 3:1295, and U.S. Pat. Nos. 6,040,183 and 6,093,570.
  • helper virus functions may be provided by a packaging cell with the helper sequences embedded in the chromosome or maintained as a stable extrachromosomal element.
  • helper viruses sequences cannot be packaged into AAV virions, e.g., are not flanked by TRs.
  • the one or more helper plasmids includes a first helper plasmid comprising a rep gene and a cap gene and a second helper plasmid comprising other genes that assist in AAV production, such as a Ela gene, a Elb gene, a E4 gene, a E2a gene, and a VA gene.
  • the rep gene is a rep gene derived from AAV2 and the cap gene is derived from AAV5.
  • Helper plasmids, and methods of making such plasmids are known in the art and commercially available (see, e.g., pDM, pDG, pDPlrs, pDP2rs, pDP3rs, pDP4rs, pDP5rs, pDP6rs, pDG(R484E/R585E), and pDP8.ape plasmids from PlasmidFactory, Bielefeld, Germany; other products and services available from Vector Biolabs, Philadelphia, Pa.; Cellbiolabs, San Diego, Calif.; Agilent Technologies, Santa Clara, Ca; and Addgene, Cambridge, Mass.; pxx6; Grimm et al.
  • helper plasmids are produced or obtained, which comprise rep and cap ORFs for the desired AAV serotype and the adenoviral VA, E2A (DBP), and E4 genes under the transcriptional control of their native promoters.
  • HEK293 cells available from ATCC® are transfected via CaPO4-mediated transfection, lipids or polymeric molecules such as Polyethylenimine (PEI) with the helper plasmid(s) and a plasmid containing a nucleic acid vector described herein.
  • PEI Polyethylenimine
  • Sf9-based producer stable cell lines are infected with a single recombinant baculovirus containing the nucleic acid vector.
  • the rAAV particles can then be purified using any method known in the art or described herein, e.g., by iodixanol step gradient, CsCl gradient, chromatography, or polyethylene glycol (PEG) precipitation.
  • the disclosure also contemplates host cells that comprise at least one of the disclosed rAAV particles, expression constructs, or nucleic acid vectors.
  • host cells include mammalian host cells, with human host cells being preferred, and may be either isolated, in cell or tissue culture.
  • the transformed host cells may be comprised within the body of a non-human animal itself.
  • the rAAV using the closed linear or minicircle DNA is produced in a cell line, e.g. the Pro10 cell line as described in U.S. Pat. No. 9,441,206, herein incorporated by reference in its entirety.
  • the DNA vector constructs either the viral particles or the naked DNA of the invention may be delivered to target cells by various available means in the art.
  • Methods of delivery of nucleic acids include, without limitation infection by particles, lipofection, nucleofection, microinjection, biolistics, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA, and agent-enhanced uptake of DNA.
  • Lipofection is described in e.g., U.S. Pat. Nos. 5,049,386, 4,946,787; and 4,897,355) and lipofection reagents are sold commercially (e.g., TransfectamTM and LipofectinTM). Delivery can be to cells (e.g., in vitro or ex vivo administration) or target tissues (e.g., in vivo administration).
  • the DNA construct described herein is administered to a cell by transfection.
  • Transfection methods useful for the methods described herein include, but are not limited to, lipid-mediated transfection, cationic polymer-mediated transfection, or calcium phosphate precipitation.
  • Transfection agents suitable for use with the invention include transfection agents that facilitate the introduction of RNA, DNA and proteins into cells.
  • transfection reagents include TurboFect Transfection Reagent (Thermo Fisher Scientific), Pro-Ject Reagent (Thermo Fisher Scientific), TRANSPASSTM P Protein Transfection Reagent (New England Biolabs), CHARIOTTM Protein Delivery Reagent (Active Motif), PROTEOJUICETM Protein Transfection Reagent (EMD Millipore), 293fectin, LIPOFECTAMINETM 2000, LIPOFECTAMINETM 3000 (Thermo Fisher Scientific), LIPOFECTAMINETM (Thermo Fisher Scientific), LIPOFECTINTM (Thermo Fisher Scientific), DMRIE-C, CELLFECTINTM (Thermo Fisher Scientific), OLIGOFECTAMINETM (Thermo Fisher Scientific), LIPOFECTACETM, FUGENETM (Roche, Basel, Switzerland), FUGENETM HD (Roche), TRANSFECTAMTM (Transfectam, Promega, Madison, Wis.), TFX-10TM (Promega), TFX-10
  • the DNA construct described herein is administered to a cell by electroporation (e.g., nucleofection).
  • nucleic acids described herein are administered to a cell via microfluidics methods known to those of skill in the art.
  • the DNA construct is added to liposomes for delivery to a cell.
  • Liposomes are vesicles that possess at least one lipid bilayer. Liposomes are typically used as carriers for drug/therapeutic delivery in the context of pharmaceutical development. Liposomes work by fusing with a cellular membrane and repositioning its lipid structure to deliver a drug or active pharmaceutical ingredient (API).
  • API active pharmaceutical ingredient
  • Liposome compositions for such delivery are composed of phospholipids, especially compounds having a phosphatidylcholine group, however these compositions may also include other lipids.
  • the disclosure provides for a liposome formulation that includes one or more compounds with a polyethylene glycol (PEG) functional group (so-called “PEG-ylated compounds”) which can reduce the immunogenicity/antigenicity of, provide hydrophilicity and hydrophobicity to the compound(s) and reduce dosage frequency.
  • PEG polyethylene glycol
  • the liposome formulation simply includes polyethylene glycol (PEG) polymer as an additional component.
  • the molecular weight of the PEG or PEG functional group can be from 62 Da to about 5,000 Da.
  • the disclosure provides for a liposome formulation that will deliver an API with extended release or controlled release profile over a period of hours to weeks.
  • the liposome formulation may comprise aqueous chambers that are bound by lipid bilayers.
  • the liposome formulation encapsulates an API with components that undergo a physical transition at elevated temperature which releases the API over a period of hours to weeks.
  • the liposome formulation comprises sphingomyelin and one or more lipids disclosed herein. In some aspects, the liposome formulation comprises optisomes.
  • the disclosure provides for a liposome formulation that includes one or more lipids selected from: N-(carbonyl-methoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, (distearoyl-sn-glycero-phosphoethanolamine), MPEG (methoxy polyethylene glycol)-conjugated lipid, HSPC (hydrogenated soy phosphatidylcholine); PEG (polyethylene glycol); DSPE (di stearoyl-sn-glycero-phosphoethanolamine); DSPC (di stearoylphosphatidylcholine); DOPC (dioleoylphosphatidylcholine); DPPG (dipalmitoylphosphatidylglycerol); EPC (egg phosphatidylcholine); DOPS (dioleoylphosphatidylserine); POPC (palmitoyl
  • the disclosure provides for a liposome formulation including phospholipid, cholesterol and a PEG-ylated lipid in a molar ratio of 56:38:5. In some aspects, the liposome formulation's overall lipid content is from 2-16 mg/mL. In some aspects, the disclosure provides for a liposome formulation comprising a lipid containing a phosphatidylcholine functional group, a lipid containing an ethanolamine functional group and a PEG-ylated lipid.
  • the disclosure provides for a liposome formulation including a lipid containing a phosphatidylcholine functional group, a lipid containing an ethanolamine functional group and a PEG-ylated lipid in a molar ratio of 3:0.015:2 respectively.
  • the disclosure provides for a liposome formulation including a lipid containing a phosphatidylcholine functional group, cholesterol and a PEG-ylated lipid.
  • the disclosure provides for a liposome formulation including a lipid containing a phosphatidylcholine functional group and cholesterol.
  • the PEG-ylated lipid is PEG-2000-DSPE.
  • the disclosure provides for a liposome formulation comprising DPPG, soy PC, MPEG-DSPE lipid conjugate and cholesterol.
  • the disclosure provides for a liposome formulation comprising one or more lipids containing a phosphatidylcholine functional group and one or more lipids containing an ethanolamine functional group. In some aspects, the disclosure provides for a liposome formulation comprising one or more: lipids containing a phosphatidylcholine functional group, lipids containing an ethanolamine functional group, and sterols, e.g. cholesterol. In some aspects, the liposome formulation comprises DOPC/DEPC; and DOPE.
  • the disclosure provides for a liposome formulation further comprising one or more pharmaceutical excipients, e.g., sucrose and/or glycine.
  • the disclosure provides for a liposome formulation that is either unilamellar or multilamellar in structure. In some aspects, the disclosure provides for a liposome formulation that comprises multi-vesicular particles and/or foam-based particles. In some aspects, the disclosure provides for a liposome formulation that are larger in relative size to common nanoparticles and about 150 to 250 nm in size. In some aspects, the liposome formulation is a lyophilized powder.
  • the disclosure provides for a liposome formulation that is made and loaded with the DNA construct obtained by the process of Example 1 or otherwise disclosed herein, by adding a weak base to a mixture having the isolated DNA construct outside the liposome. This addition increases the pH outside the liposomes to approximately 7.3 and drives the API into the liposome.
  • the disclosure provides for a liposome formulation having a pH that is acidic on the inside of the liposome. In such cases the inside of the liposome can be at pH 4-6.9, and more preferably pH 6.5.
  • the disclosure provides for a liposome formulation made by using intra-liposomal drug stabilization technology. In such cases, polymeric or non-polymeric highly charged anions and intra-liposomal trapping agents are utilized, e.g., polyphosphate or sucrose octasulfate.
  • the disclosure provides for a liposome formulation comprising phospholipids, lecithin, phosphatidylcholine and phosphatidylethanolamine.
  • the disclosure provides for lipid formulations, for example, lipid nanoparticle formulations, that are useful in delivering the DNA construct.
  • lipid nanoparticle formulations for example, lipid nanoparticle formulations, that are useful in delivering the DNA construct.
  • the lipid nanoparticle formulations described in WO2017/173054 the contents of which are incorporated herein by reference in its entirety, are contemplated for use with the methods and compositions described herein.
  • the DNA vector constructs disclosed herein can be incorporated into pharmaceutical compositions suitable for administration to a subject for in vivo delivery to cells, tissues, or organs of the subject.
  • the pharmaceutical composition includes the DNA construct disclosed herein and a pharmaceutically acceptable carrier.
  • the DNA construct can be incorporated into a pharmaceutical composition suitable for a desired route of therapeutic administration (e.g., parenteral administration). Passive tissue transduction via high pressure intravenous or intra-arterial infusion, as well as intracellular injection, such as intranuclear microinjection or intracytoplasmic injection, are also contemplated.
  • Pharmaceutical compositions for therapeutic purposes can be formulated as a solution, microemulsion, dispersion, liposomes, or other ordered structure suitable to high DNA construct concentration.
  • Sterile injectable solutions can be prepared by incorporating the DNA construct compound in the required amount in an appropriate buffer with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization including a DNA construct can be formulated to deliver a transgene in the nucleic acid to the cells of a recipient, resulting in the therapeutic expression of the nucleic acid therein.
  • the composition can also include a pharmaceutically acceptable carrier.
  • compositions and vectors provided herein can be used to deliver a predetermined DNA sequence (e.g., a transgene or donor sequence) for various purposes.
  • the DNA sequence encodes an RNA or protein that is intended to be used for research purposes, e.g., to create a somatic transgenic animal model harboring the transgene, e.g., to study the function of the protein to which the expressed protein or RNA interacts.
  • the transgene encodes that is intended to be used to create an animal model of disease.
  • the transgene encodes one or more peptides, polypeptides, or proteins, which are useful for the treatment or prevention of disease states in a mammalian subject.
  • compositions for therapeutic purposes typically must be sterile and stable under the conditions of manufacture and storage.
  • the composition can be formulated as a solution, microemulsion, dispersion, liposomes, or other ordered structure suitable to high DNA construct or virus particle concentration.
  • Sterile injectable solutions can be prepared by incorporating the DNA construct compound in the required amount in an appropriate buffer with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
  • the methods comprise administering to the subject an effective amount of a composition comprising a DNA construct encoding a therapeutic protein or RNA or virus particle as described herein.
  • a composition comprising a DNA construct encoding a therapeutic protein or RNA or virus particle as described herein.
  • effective amount refers to the amount of the DNA construct composition administered that results in expression of the encoded protein or RNA in a “therapeutically effective amount” for the treatment of a disease.
  • the dosage ranges for the composition comprising a DNA construct depends upon the potency (e.g., efficiency of the promoter), and includes amounts large enough to produce the desired effect, e.g., expression of the desired protein or RNA, for treatment of a disease, e.g., cancer.
  • the dosage should not be so large as to cause unacceptable adverse side effects.
  • the dosage will vary with the particular characteristics of the DNA construct, expression efficiency and with the age, condition, and sex of the patient.
  • the dosage can be determined by one of skill in the art. For example in mice, where non-viral DNA vector is intravenously administered in saline, in one embodiment, the amount of vector that is administered to a target cell can range from about 1 to 200 ug, or about 10 to 50 ug. One of skill in that adjusts the dose accordingly for administration to humans or larger animals. In certain embodiments the size of the vector ranges from about 0.5 to 100 kb, or from about 2 to 15 kb.
  • terapéuticaally effective amount is an amount of an expressed therapeutic protein or RNA that is sufficient to produce a statistically significant, measurable change in expression of a disease biomarker or reduction in a given disease symptom (see “Efficacy Measurement” below). Such effective amounts can be gauged in clinical trials as well as animal studies for a given DNA construct or virus particle composition.
  • Agents useful in the methods and compositions described herein can be administered topically, intravenously (by bolus or continuous infusion), intracellular injection, intratissue injection, orally, by inhalation, intraperitoneally, intramuscularly, subcutaneously, intracavity, and can be delivered by peristaltic means, if desired, or by other means known by those skilled in the art.
  • the agent can be administered systemically, if so desired.
  • Efficacy of a given treatment for a given disease can be determined by the skilled clinician.
  • a treatment is considered “effective treatment,” as the term is used herein, if any one or all of the signs or symptoms of the disease or disorder is/are altered in a beneficial manner, or other clinically accepted symptoms or markers of disease are improved, or ameliorated, e.g., by at least 10% following treatment with a DNA construct encoding a therapeutic protein or RNA.
  • Efficacy can also be measured by failure of an individual to worsen as assessed by stabilization of the disease, or the need for medical interventions (i.e., progression of the disease is halted or at least slowed).
  • Treatment includes any treatment of a disease in an individual or an animal (some non-limiting examples include a human, or a mammal) and includes: (1) inhibiting the disease, e.g., arresting, or slowing progression of the disease (e.g., cancer); or (2) relieving the disease, e.g., causing regression of symptoms; and (3) preventing or reducing the likelihood of the development of the disease, or preventing secondary diseases/disorders associated with the disease, such as cancer (e.g., cancer metastasis).
  • cancer e.g., cancer metastasis
  • An effective amount for the treatment of a disease means that amount which, when administered to a mammal in need thereof, is sufficient to result in effective treatment as that term is defined herein, for that disease.
  • Efficacy of an agent can be determined by assessing physical indicators that are particular to a given disease.
  • physical indicators for cancer include, but are not limited to, pain, tumor size, tumor growth rate, blood cell count, etc.
  • the DNA construct according to the present invention provide a means for delivering nucleic acids into a broad range of cells, including dividing and non-dividing cells.
  • the cells are genetically deficient.
  • the cells are diseased.
  • the DNA construct can be employed to deliver a nucleic acid of interest to a cell in vitro, e.g., to produce a polypeptide in vitro or for ex vivo gene therapy.
  • the DNA construct are additionally useful in a method of delivering a nucleic acid to a subject in need thereof, e.g., to express an immunogenic or therapeutic polypeptide or a functional RNA.
  • the polypeptide or functional RNA can be produced in vivo in the subject.
  • the subject can be in need of the polypeptide because the subject has a deficiency of the polypeptide.
  • the method can be practiced because the production of the polypeptide or functional RNA in the subject may impart some beneficial effect.
  • the DNA construct can also be used to produce a polypeptide of interest or functional RNA in cultured cells or in a subject (e.g., using the subject as a bioreactor to produce the polypeptide or to observe the effects of the functional RNA on the subject, for example, in connection with screening methods).
  • the cell(s) into which the DNA vector construct is introduced can be of any type, including but not limited to neural cells (including cells of the peripheral and central, nervous systems, in particular, brain, cells such as neurons and oligodendrocytes), lung cells, cells of the eye (including retinal cells, retinal pigment epithelium, and corneal cells), blood vessel cells (e.g., endothelial cells, intimal cells), epithelial cells (e.g., gut and respiratory epithelial cells), muscle, cells (e.g., skeletal muscle cells, cardiac muscle cells, smooth muscle cells and/or diaphragm muscle cells), dendritic cells, pancreatic cells, (including islet cells), hepatic cells, kidney cells, myocardial cells, bone cells (e.g., bone marrow stem cells), hematopoietic stem cells, spleen cells, keratinocytes, fibroblasts, endothelial cells, prostate cells, germ cells, and the, like.
  • neural cells including
  • the cell can be any progenitor cell.
  • the cell can be a stem cell (e.g., neural stem cell, liver stem cell).
  • the cell can be a cancer or tumor cell.
  • the cell can be from any species of origin.
  • Gene transfer has substantial potential use for understanding and providing therapy for disease states.
  • diseases in which defective genes are known and have been cloned.
  • the disease states fall into two classes: deficiency states, usually of enzymes, which are generally inherited in a recessive manner, and unbalanced states, which may involve regulatory or structural proteins, and which are typically inherited in a dominant manner.
  • deficiency state diseases gene transfer can be used to bring a normal gene into affected tissues for replacement therapy, as well as to create animal models for the disease using antisense mutations.
  • unbalanced disease states gene transfer can be used to create a disease state in a model system, which can then be used in efforts to counteract the disease state.
  • DNA constructs according to the present invention permit the treatment and/or prevention of genetic diseases.
  • the DNA vector/construct according to the present invention may also be employed to provide a functional RNA to a cell in vitro or in vivo.
  • Expression of the functional RNA in the cell can diminish expression of a particular target protein by the cell.
  • functional RNA can be administered to decrease expression of a particular protein in a subject in need thereof.
  • Functional RNA can also be administered to cells in vitro to regulate gene expression and/or cell physiology, e.g., to optimize cell or tissue culture systems or in screening methods.
  • the therapeutic targets a protein for correction of a dysregulated cellular pathway of a disease state.
  • the DNA vector/construct of the present invention can be employed to deliver a nucleic acid encoding a polypeptide or functional RNA to treat and/or prevent any disease state for which it is beneficial to deliver a therapeutic polypeptide or functional RNA.
  • disease states include, but are not limited to: cystic fibrosis (cystic fibrosis transmembrane regulator protein) and other diseases of the lung, hemophilia A (Factor VIII), hemophilia B (Factor IX), thalassemia (beta-globin), anemia (erythropoietin) and other blood disorders, Alzheimer's disease (GDF; neprilysin), multiple sclerosis (.beta.-interferon), Parkinson's disease (glial-cell line derived neurotrophic factor (GDNF)), Huntington's disease (RNAi to remove repeats), amyotrophic lateral sclerosis, epilepsy (galanin, neurotrophic factors), and other neurological disorders, cancer
  • the invention can further be used following organ transplantation to increase the success of the transplant and/or to reduce the negative side effects of organ transplantation or adjunct therapies (e.g., by administering immunosuppressant agents or inhibitory nucleic acids to block cytokine production).
  • bone morphogenic proteins including BNP 2, 7, etc., RANKL and/or VEGF
  • the heterologous nucleic acid further encode reporter polypeptides (e.g., an enzyme).
  • reporter polypeptides are known in the art and include, but are not limited to, Green Fluorescent Protein, ⁇ -galactosidase, alkaline phosphatase, luciferase, and chloramphenicol acetyltransferase gene.
  • the heterologous nucleic acid encodes a secreted polypeptide (e.g., a polypeptide that is a secreted polypeptide in its native state or that has been engineered to be secreted, for example, by operable association with a secretory signal sequence as is known in the art).
  • a secreted polypeptide e.g., a polypeptide that is a secreted polypeptide in its native state or that has been engineered to be secreted, for example, by operable association with a secretory signal sequence as is known in the art.
  • the heterologous nucleic acid is operatively linked to a control element, such as transcription/translation control signals, origins of replication, polyadenylation signals, internal ribosome entry sites (IRES), promoters, and/or enhancers, and the like.
  • a control element such as transcription/translation control signals, origins of replication, polyadenylation signals, internal ribosome entry sites (IRES), promoters, and/or enhancers, and the like.
  • the heterologous nucleic acid may encode an antisense nucleic acid, a ribozyme (e.g., as described in U.S. Pat. No. 5,877,022), RNAs that effect spliceosome-mediated trans-splicing (see, Puttaraju et al. (1999) Nature Biotech. 17:246; U.S. Pat. Nos. 6,013,487; 6,083,702), interfering RNAs (RNAi) including siRNA, shRNA or miRNA that mediate gene silencing (see, Sharp et al.
  • RNAi interfering RNAs
  • RNAs such as “guide” RNAs (Gorman et al. (1998) Proc. Nat. Acad. Sci. USA 95:4929; U.S. Pat. No. 5,869,248 to Yuan et al.), and the like.
  • RNAi against a multiple drug resistance (MDR) gene product e.g., to treat and/or prevent tumors and/or for administration to the heart to prevent damage by chemotherapy
  • MDR multiple drug resistance
  • myostatin e.g., for Duchenne muscular dystrophy
  • VEGF e.g., to treat and/or prevent tumors
  • RNAi against phospholamban e.g., to treat cardiovascular disease, see e.g., Andino et al. J. Gene Med. 10:132-142 (2008) and Li et al. Acta Pharmacol Sin.
  • phospholamban inhibitory or dominant-negative molecules such as phospholamban S16E (e.g., to treat cardiovascular disease, see e.g., Hoshijima et al. Nat. Med. 8:864-871 (2002)), RNAi to adenosine kinase (e.g., for epilepsy), and RNAi directed against pathogenic organisms and viruses (e.g., hepatitis B and/or C virus, human immunodeficiency virus, CMV, herpes simplex virus, human papilloma virus, etc.).
  • pathogenic organisms and viruses e.g., hepatitis B and/or C virus, human immunodeficiency virus, CMV, herpes simplex virus, human papilloma virus, etc.
  • the DNA vector expresses an immunogenic polypeptide, e.g., for vaccination.
  • An immunogenic polypeptide can be any polypeptide suitable for eliciting an immune response and/or protecting the subject against an infection and/or disease, including, but not limited to, microbial, bacterial, protozoal, parasitic, fungal and/or viral infections and diseases.
  • the immunogenic polypeptide can be an orthomyxovirus immunogen (e.g., an influenza virus immunogen, such as the influenza virus hemagglutinin (HA) surface protein or the influenza virus nucleoprotein, or an equine influenza virus immunogen) or a lentivirus immunogen (e.g., an equine infectious anemia virus immunogen, a Simian Immunodeficiency Virus (SIV) immunogen, or a Human Immunodeficiency Virus (HIV) immunogen, such as the HIV or SIV envelope GP160 protein, the HIV or SIV matrix/capsid proteins, and the HIV or SIV gag, pol and env gene products).
  • an influenza virus immunogen such as the influenza virus hemagglutinin (HA) surface protein or the influenza virus nucleoprotein, or an equine influenza virus immunogen
  • a lentivirus immunogen e.g., an equine infectious anemia virus immunogen, a Simian Immunodefic
  • the immunogenic polypeptide can also be an arenavirus immunogen (e.g., Lassa fever virus immunogen, such as the Lassa fever virus nucleocapsid protein and/or the Lassa fever envelope glycoprotein), a poxvirus immunogen (e.g., a vaccinia virus immunogen, such as the vaccinia L1 or L8 gene product), a flavivirus immunogen (e.g., a yellow fever virus immunogen or a Japanese encephalitis virus immunogen), a filovirus immunogen (e.g., an Ebola virus immunogen, or a Marburg virus immunogen, such as NP and GP gene products), a bunyavirus immunogen (e.g., RVFV, CCHF, and/or SFS virus immunogens), or a coronavirus immunogen (e.g., an infectious human coronavirus immunogen, such as the human coronavirus envelope glycoprotein, or a porcine transmissible gastroenteritis virus immunogen, or an
  • the immunogenic polypeptide can further be a polio immunogen, a herpesvirus immunogen (e.g., CMV, EBV, HSV immunogens) a mumps virus immunogen, a measles virus immunogen, a rubella virus immunogen, a diphtheria toxin or other diphtheria immunogen, a pertussis antigen, a hepatitis (e.g., hepatitis A, hepatitis B, hepatitis C, etc.) immunogen, and/or any other vaccine immunogen now known in the art or later identified as an immunogen.
  • a herpesvirus immunogen e.g., CMV, EBV, HSV immunogens
  • a mumps virus immunogen e.g., a measles virus immunogen, a rubella virus immunogen, a diphtheria toxin or other diphtheria immunogen, a pertussis antigen
  • a hepatitis
  • the immunogenic polypeptide can be any tumor or cancer cell antigen.
  • the tumor or cancer antigen is expressed on the surface of the cancer cell. Exemplary cancer and tumor cell antigens are described in S. A. Rosenberg (Immunity 10:281 (1991)).
  • cancer and tumor antigens include, but are not limited to: BRCA1 gene product, BRCA2 gene product, gp100, tyrosinase, GAGE-1/2, BAGE, RAGE, LAGE, NY-ESO-1, CDK-4, ⁇ -catenin, MUM-1, Caspase-8, KIAA0205, HPVE, SART-1, PRAME, p15, melanoma tumor antigens (Kawakami et al. (1994) Proc. Natl. Acad. Sci. USA 91:3515; Kawakami et al. (1994) J. Exp. Med., 180:347; Kawakami et al. (1994) Cancer Res.
  • telomerases e.g., telomeres
  • nuclear matrix proteins e.g., telomeres
  • prostatic acid phosphatase e.g., papilloma virus antigens
  • antigens now known or later discovered to be associated with the following cancers: melanoma, adenocarcinoma, thymoma, lymphoma (e.g., non-Hodgkin's lymphoma, Hodgkin's lymphoma), sarcoma, lung cancer, liver cancer, colon cancer, leukemia, uterine cancer, breast cancer, prostate cancer, ovarian cancer, cervical cancer, bladder cancer, kidney cancer, pancreatic cancer, brain cancer and any other cancer or malignant condition now known or later identified (see, e.g., Rosenberg, (1996) Ann. Rev. Med. 47:481-91).
  • the DNA vectors of the present invention can be employed to deliver a heterologous nucleic acid encoding a polypeptide or functional RNA to treat and/or prevent any disease state for which it is beneficial to deliver a therapeutic polypeptide or functional RNA.
  • disease states include, but are not limited to: cystic fibrosis (cystic fibrosis transmembrane regulator protein) and other diseases of the lung, hemophilia A (Factor VIII), hemophilia B (Factor IX), thalassemia (3-globin), anemia (erythropoietin) and other blood disorders, Alzheimer's disease (GDF; neprilysin), multiple sclerosis ((3-interferon), Parkinson's disease (glial-cell line derived neurotrophic factor [GDNF]), Huntington's disease (RNAi to remove repeats), amyotrophic lateral sclerosis, epilepsy (galanin, neurotrophic factors), and other neurological disorders, cancer (endostatin, angio
  • Gaucher disease (glucocerebrosidase), Hurler's disease ( ⁇ -L-iduronidase), adenosine deaminase deficiency (adenosine deaminase), glycogen storage diseases (e.g., Fabry disease [ ⁇ -galactosidase] and Pompe disease [lysosomal acid ⁇ -glucosidase]) and other metabolic disorders, congenital emphysema (al-antitrypsin), Lesch-Nyhan Syndrome (hypoxanthine guanine phosphoribosyl transferase), Niemann-Pick disease (sphingomyelinase), Tays Sachs disease (lysosomal hexosaminidase A), Maple Syrup Urine Disease (branched-chain keto acid dehydrogenase), retinal degenerative diseases (and other diseases of the eye and retina; e.g., PDGF for macular degeneration and/or vas
  • the invention can further be used following organ transplantation to increase the success of the transplant and/or to reduce the negative side effects of organ transplantation or adjunct therapies (e.g., by administering immunosuppressant agents or inhibitory nucleic acids to block cytokine production).
  • organ transplantation or adjunct therapies e.g., by administering immunosuppressant agents or inhibitory nucleic acids to block cytokine production.
  • bone morphogenic proteins including BNP 2, 7, etc., RANKL and/or VEGF
  • the invention can also be practiced to treat and/or prevent a metabolic disorder such as diabetes (e.g., insulin), hemophilia (e.g., Factor IX or Factor VIII), a lysosomal storage disorder such as a mucopolysaccharidosis disorder (e.g., Sly syndrome ( ⁇ -glucuronidase), Hurler Syndrome ( ⁇ -L-iduronidase), Scheie Syndrome ( ⁇ -L-iduronidase), Hurler-Scheie Syndrome ( ⁇ -L-iduronidase), Hunter's Syndrome (iduronate sulfatase), Sanfilippo Syndrome A (heparan sulfamidase), B (N-acetylgl ucosaminidase), C (acetyl-CoA: ⁇ -glucosaminide acetyltransferase), D (N-acetylglucosamine 6-sulfatase), Morquio Syndrome A (galactose-6-sulfate
  • the invention can also be practiced to treat and/or prevent a lysosomal storage disorder, such as mucopolysaccharidosis disorder (e.g., Sly syndrome ( ⁇ -glucuronidase), Hurler Syndrome ( ⁇ -L-iduronidase), Scheie Syndrome ( ⁇ -L-iduronidase), Hurler-Scheie Syndrome ( ⁇ -L-iduronidase), Hunter's Syndrome (iduronate sulfatase), Sanfilippo Syndrome A (heparan sulfamidase), B (N-acetylglucosaminidase), C (acetyl-CoA: ⁇ -glucosaminide acetyltransferase), D (N-acetylglucosamine 6-sulfatase(, Morquio Syndrome A (galactose-6-sulfate sulfatase), B ( ⁇ -galactosidase), Maroteaux-Lamy Syndrome (N-acetylgalactos
  • the invention can also be used to produce induced pluripotent stem cells (iPS).
  • a DNA vector of the invention can be used to deliver stem cell associated nucleic acid(s) into a non-pluripotent cell, such as adult fibroblasts, skin cells, liver cells, renal cells, adipose cells, cardiac cells, neural cells, epithelial cells, endothelial cells, and the like.
  • Nucleic acids encoding factors associated with stem cells are known in the art.
  • Nonlimiting examples of such factors associated with stem cells and pluripotency include Oct-3/4, the SOX family (e.g., SOX1, SOX2, SOX3 and/or SOX15), the Klf family (e.g., Klf1, Klf2, Klf4 and/or Klf5), the Myc family (e.g., C-myc, L-myc and/or N-myc), NANOG and/or LIN28.
  • SOX family e.g., SOX1, SOX2, SOX3 and/or SOX15
  • the Klf family e.g., Klf1, Klf2, Klf4 and/or Klf5
  • the Myc family e.g., C-myc, L-myc and/or N-myc
  • NANOG e.g., NANOG and/or LIN28.
  • the present invention relates to the herein described compositions, methods, and respective component(s) thereof, as essential to the invention, yet open to the inclusion of unspecified elements, essential or not (“comprising).
  • other elements to be included in the description of the composition, method or respective component thereof are limited to those that do not materially affect the basic and novel characteristic(s) of the invention (“consisting essentially of”). This applies equally to steps within a described method as well as compositions and components therein.
  • the inventions, compositions, methods, and respective components thereof, described herein are intended to be exclusive of any element not deemed an essential element to the component, composition or method (“consisting of”).
  • PCR Polymerase Chain Reaction
  • AAV viral IRT will self-prime the elongation to produce a long T-shaped hairpin structure containing D and D′ on the stem. Upon denaturation, this DNA can serve as template for single-primed PCR.
  • pDD-2 ( FIG. 6 ) is an exemplary source of a DD-ITR.
  • the ligated plasmid is transformed into E. coli Sure strain (Stratagene). Positive clones are screened for the presence of a double-D terminal repeat and confirmed by dideoxy-sequencing with 7-deazo-dGTP substituted for dGTP (Sanger, F. et al., 1977, Proc. Natl. Acad. Sci. U.S.A. 74:5463-5467). Subsequently, a neogene is cloned into the SalI site of pDD resulting in the plasmid pDD-neo. pDD-neo is used as a source of the DD-ITR
  • Double stranded circular DNA containing a luciferase reporter gene in expressible form, the DD-ITR, and a protelomerase TelN binding sequence is used as the DNA template.
  • a single palindromic oligonucleotide complementary to a section of one half of the palindromic sequence that comprises the protelomerase TelN binding site is used to specifically prime both strands.
  • suitable primers include:
  • Y is T or C
  • W is A or T
  • R is A or G.
  • Denaturation of the double stranded circular template and the annealing of the single primer is carried out in an annealing/denaturation buffer containing, for example, 30 mM Tris-HCl pH 7.5, 20 mM KCl, 2.5 mM MgCl 2 . Denaturation is carried out by heating to 95° C. and maintaining at this temperature for 1 to 10 minutes followed by a carefully controlled cooling profile optimised for the maximum binding of the specific primer to the template. The temperature is then reduced to the optimum for DNA amplification by a suitable DNA polymerase.
  • a suitable enzyme is phi29 isolated from the Bacillus subtilis phage phi29 that works optimally at 30° C.
  • reaction buffer containing the enzymes phi29 and PPi (Yeast Inorganic pyrophosphatase), is then added to the annealed DNA/primer reaction.
  • the reaction mixture is incubated at around 30° C. for between 5 and 20 hours or longer.
  • a suitable reaction buffer typically contains 35 mM Tris-HCl, 50 mM KCl, 2.5 mM MgCl 2 , 10 mM (NH 4 ) 2 SO 4 , 4 mM DTT, 1 mM dNTP.
  • Concatemeric DNA amplified by RCA is then incubated at 30° C. with the protelomerase TelN in a suitable buffer such as 10 mM Tris HCl pH 7.6, 5 mM CaCl 2 , 50 mM potassium glutamate, 0.1 mM EDTA, 1 mM DTT until the reaction is complete.
  • a suitable buffer such as 10 mM Tris HCl pH 7.6, 5 mM CaCl 2 , 50 mM potassium glutamate, 0.1 mM EDTA, 1 mM DTT until the reaction is complete.
  • the resulting closed linear DNA product may be purified, for example, by gel electrophoresis or a suitable chromatographic method depending on the amount to be purified.
  • telomeric ends comprising the binding sequence of a protelomerase TelN is used as the DNA template.
  • Constructs that have spacers between the DD-ITR and the promoter of the luciferase reporter gene but are otherwise identical are generated.
  • Constructs with no spacers, and with spacers of 2, 5, 10, 20 and 25 nucleotides are generated.
  • a single palindromic oligonucleotide complementary to a section of one half of the palindromic sequence that comprises the telomeric ends of the template is used as a specific primer.
  • the primer binds to two identical sites on the DNA template. Examples of suitable primers include those shown in the above example.
  • Denaturation of the closed linear DNA template and the annealing of the single primer is carried out in an annealing/denaturation buffer containing, for example, 30 mM Tris-HCl pH 7.5, 20 mM KCl, 2.5 mM MgCl 2 . Denaturation is carried out by heating to 95° C. for 1 min and maintaining at this temperature for 1 to 10 minutes followed by a carefully controlled cooling profile optimised for the maximum binding of the specific primer to the template. The temperature is then reduced to the optimum for DNA amplification by a suitable DNA polymerase.
  • a suitable DNA polymerase is phi29 isolated from the Bacillus subtilis phage phi29 that works optimally at 30° C.
  • reaction buffer containing the enzymes phi29 and PPi (Yeast Inorganic pyrophosphatase) is then added to the annealed DNA/primer reaction.
  • the reaction mixture is incubated at around 30° C. for between 5 and 20 hours or longer.
  • a suitable reaction buffer typically contains 35 mM Tris-HCl, 50 mM KCl, 2.5 mM MgCl 2 , 10 mM (NH 4 ) 2 SO 4 , 4 mM DTT, 1 mM dNTP.
  • Concatameric DNA amplified by RCA is then incubated at 30° C. with the protelomerase TelN in a suitable buffer such as 10 mM Tris HCl pH 7.6, 5 mM CaCl 2 ), 50 mM potassium glutamate, 0.1 mM EDTA, 1 mM DTT until the reaction is complete.
  • a suitable buffer such as 10 mM Tris HCl pH 7.6, 5 mM CaCl 2
  • 50 mM potassium glutamate 0.1 mM EDTA, 1 mM DTT
  • the resulting closed linear DNA product may be purified, for example, by gel electrophoresis or a suitable chromatographic method depending on the amount to be purified.
  • E. coli K-12 strains are used in the generation of all recombinant cell constructs and DH5 ⁇ and JM109, in particular, are employed as hosts for plasmid constructions and amplification.
  • E. coli is used for chromosomal engineering studies and in vivo recombinase-expression as follows.
  • Protelomerase coding gene tel is amplified from bacteriophage PY54 lysate using the following primers: Tel-F 5′-GCGGATCCTGGGTTACTTTAATTTGTGTGTT-3′ (SEQ ID NO: 22) and Tel-R 5′-CGCTCGAGTTACTCCATATTTTCAGTCCATGCTTGT-3′ (SEQ ID NO: 23) (annealing Tm 64° C.).
  • Protelomerase coding gene telN is amplified from bacteriophage N15 lysate using primers: TelN-F 5′-ATCGGATCCCGATATCCAGAGACTTAGAAACGGG-3′ (SEQ ID NO: 24) and TelN-R 5′-ATATAAAGCTTCTTTTAGCTGTAGTACGTTTCCCATGCG-3′ (SEQ ID NO: 25) (annealing Tm 62° C.).
  • the recombinase encoding gene cre is amplified from bacteriophage Plrev6 lysate using primers: Cre-F 5′-GGAAATTCCGGTCGCTGGCGTTTCTATGAC-3′ (SEQ ID NO: 26) and Cre-R 5′-CGCTCGAGTGAATATTAGTGCTTACAGACAG-3′ (SEQ ID NO: 27) (annealing Tm 66° C.). Italicized regions denote restriction sites for BamHI, XhoI, HindIII, and EcoRI.
  • PCR amplifications is conducted using Phusion Flash High-Fidelity PCR Master Mix (New England Biolab) for 30 s at 98° C. for initial denaturation, 30 cycles of 5 s at 98° C., 10 s at annealing Tm, 45 s at 72° C., and 2 min at 72° C. for final extension to generate cre (1.3 kb), tel (2.1 kb), and telN (2.3 kb) fragments. Constructs are tested and confirmed by colony PCR and analytical digestion. PCR products are purified from 0.8% agarose gel (Qiagen Gel extraction kit), and digested with the listed enzymes (New England Biolabs).
  • Recombinase genes are cloned into the MCS of the inducible prokaryotic expression vector pPL451 (Accession #AB248919) to produce pNN1, pNN2, and pNN3 vectors.
  • pPL451 (4.2 kb) imparts temperature-regulated expression of the cloned gene via CI[Ts]857-mediated repression of the ⁇ P L strong promoter. All primers are designed using the Gene Runner 3.01 (Hastings Software, Inc) and synthesized commercially (Sigma-Aldrich, Inc).
  • R-cells are constructed via insertion of recombinase genes into E.
  • the amplified cassettes are cloned into the MCS of pBRINT (Cm R ) plasmid to produce pNN4, pNN5, and pNN6 integrating vector constructs.
  • Amplification is performed by the Phusion Flash High-Fidelity PCR Master Mix (New England Biolab) for 10 s at 98° C. for initial denaturation, 30 cycles of is at 98° C., 5 s at 68° C., 120 s at 72° C., and 1 min at 72° C. for final extension to generate cI857-cre (2.8 kb), cI857-tel (3.2 kb), and cI857-telN (3.5 kb) fragments. Constructs are tested and confirmed by colony PCR and analytical digestion.
  • the multi-purpose recombinase target site is designed to carry Cre, Flp and TelN minimal targets sites (loxP-FRT-telRL) respectively, all within the Tel 142 bp pal sequence, which provides the PY54 derived Tel target site.
  • SS also carries a 78 bp SV40 enhancer sequence that flanks each side of the pal sequence to facilitate nuclear translocation and enhancing transfection efficiency.
  • the SS fragment is synthesized by the GeneScript and cloned into the pUC57 by EcoRI and HindIII.
  • the plasmid described in Examples 1A and B above (5.8 kb) (Promega), is modified by replacement of the luc gene (1.65 kb) with egfp (790 bp) from pGFP (clontech) to form pDDEGFR.
  • SS is cloned immediately upstream of the SV40 promoter+intron site of pDDEFGR to form pDD3.
  • the SS fragment is cloned downstream of the poly A site of pDD3 to form pDD4.
  • This plasmid carries 2 SS sites that flank the EGFP gene cassette.
  • the multicopy plasmid can be conformed to mini circular (ccc) vector (mediated by Cre-loxP; Flp/FRT), or mini linear covalently closed (lee) vector (mediated by TelN-telRL; Tel/pal).
  • transformed R-cells are heat shocked to induce the recombinase expression at 42° C. for 30 min at mid-logarithmic phase of bacterial growth, before being transferred to 30° C. overnight.
  • Plasmid topology is assayed by agarose gel electrophoresis and digestion. Standard recombinant DNA techniques is performed as described by Sambrook et al. (1989).
  • Recombinant cells are constructed that place tel or telN recombinase genes under control of the bacteriophage ⁇ strong promoter, pL, that is regulated by the temperature-sensitive ⁇ repressor, CI[Ts]857 ( FIG. 10 ). Positive cre-expressing control cells are similarly prepared. Total cellular protein in tel and telN R-cells under repressed and fully induced (42° C.) conditions are examined. Both R-cells demonstrate minimal recombinase protein levels, identified at 72 KDa for both TelN and Tel at 30° C., where CI[Ts] actively binds the O L operator and represses transcription of the downstream recombinase gene.
  • ⁇ site-specific SS ⁇ and SS + integrants are incubated under conditions that provide none to very low (30° C.) or full (42° C.) expression of the recombinase, then cell viability is measured. Under repressed conditions (30° C.), all recombinant cells retain near full viability regardless of the presence or absence of the SS integrated in the chromosome. However, upon shifting temperature to 42° C. and inducing expression of Tel or TelN, recombinants that carried SS + shows dramatically reduced viability. And, in both systems, Tel-cells results in approximately 5-fold greater killing than that seen in TelN-cells.
  • HEK293 cells are grown in Dulbecco's Modified Eagles Medium supplemented with 10% fetal calf serum, 100 ⁇ g/ml streptomycin, and 100 IU/ml penicillin.
  • HEK293 cells are transiently transfected using lipofectamin (Invitrogen, Life Technologies, Carlsbad, USA) or calcium phosphate precipitation with a mixture of the telRL-carrying expression construct with or without pEGFPc2-CNK-CT as an internal control for transfection efficiency.
  • a plasmid containing a Double D ITR sequence and a reporter gene can be made as described in Examples 1A and 1B or using a Double D ITR plasmid modified by insertion of a SalI/NotI enhanced green fluorescent protein (EGFP) [Hartikka J, Sawdey M, Cornefert-Jensen F, Margalith M, Barnhart K, Nolasco M, Vahlsing H L, Meek J, Marquet M, Hobart P, Norman J, Manthorpe M (1996) An improved plasmid DNA expression vector for direct injection into skeletal muscle. Hum Gene Ther 7:1205-1217, See Example 2].
  • EGFP SalI/NotI enhanced green fluorescent protein
  • a telRL site derived from pJD105 [Deneke J, Ziegelin G, Lurz R, Lanka E (2000) The protelomerase of temperate Escherichia coli phage N15 has cleaving-joining activity.
  • Proc Natl Acad Sci USA 97:7721-7726 can be inserted as a 222-bp PvuII/DpnI fragment harboring the 56-bp telRL site into the filled-in NdeI site of pIRES.mu-IL12 [Schultz J, Pavlovic J, Strack B, Nawrath M, Moelling K (1999) Long-lasting anti-metastatic efficiency of interleukin 12-encoding plasmid DNA. Hum Gene Ther 10:407-417] and pVR1012.EGFP upstream of the CMV promoter.
  • a second telRL site is inserted into the filled-in BstXI site of the plasmid, located downstream of the polyA
  • the circular covalently closed coiled plasmid DNA (ccc-DNA) of the plasmid is converted to linear DNA with covalently closed ends (lc-DNA) using purified protelomerase TelN as described [Deneke J, Ziegelin G, Lurz R, Lanka E (2000) The protelomerase of temperate Escherichia coli phage N15 has cleaving-joining activity. Proc Natl Acad Sci USA 97:7721-7726].
  • lc-DNA is extracted with phenol/chloroform, washed with chloroform, and precipitated twice with ethanol. The same procedure is applied to DNA linearized by restriction enzymes and ccc-DNA. In the case of these plasmids the mini lc- and lo-DNAs are separated from the backbone fragments on 1.2% agarose gels and purified using Elutip columns (Schleicher and Schuell, Dassel, Germany).
  • a transcriptional unit consisting of promoter, intron A, gene of interest, and polyadenylation signal is sufficient.
  • DNA fragments containing a transcriptional unit are generated using restriction endonucleases, the resulting DNA molecules are sensitive for degradation by exonucleases.
  • Most naturally occurring DNA molecules have covalently closed ends for stabilization. Mechanisms to achieve this are circularization, integration into the host genome, or formation of covalently closed hairpin structures. The latter mechanism yields a linear DNA molecule.
  • This protelomerase is used to produce DNA fragments with covalently closed ends.
  • the gene encoding EGFP can be used. It is present on a circular plasmid DNA, which also harbored a telRL site upstream of the CMV promoter.
  • the presence of the protelomerase target site allows the conversion of the circular covalently closed coiled plasmid DNA (ccc-DNA) to a linear covalently closed DNA molecule by exposure to purified TelN.
  • the linear covalently closed DNA molecules lc-DNA and the molecules linearized by a restriction endonuclease linear open (10) DNA can be designated.
  • the linear covalently closed DNA functions as a template for transcription in mammalian cells.
  • the linearization of the plasmid DNA by TelN and XhoI is demonstrated by agarose gel electrophoresis.
  • ccc-DNA is used, which has been subjected to the same procedure without DNA-modifying enzymes.
  • Equal amounts of ccc-DNA, lc-DNA formed as described above or by Example 2, and lo-DNA are introduced into HEK293 cells by transient transfection using lipofectamine.
  • the linear covalently closed DNA can yield comparable expression levels of EGFP as the parental ccc-DNA, whereas the linear covalently closed DNA expressed significantly less EGFP. Similar results are obtained by transient calcium phosphate transfection. GFP activity can also be viewed by fluorescence microscopy. Since this method is not easily quantifiable, Western blot analysis can be used. This is expected to demonstrate that the TelN-derived linear DNA molecule is a functional template.
  • Mini lc- and lo-DNAs can be derived from the EGFP-expressing plasmid by digestion with TelN and MunI, respectively. Equimolar amounts of the mini DNAs and the ccc-DNA are used to transiently transfect HEK293 cells using lipofectamine ( FIG. 9B ). An empty vector DNA can be used as control. A second plasmid encoding a C-terminal fragment of connector enhancer of kinase suppressor of Ras (CNK) fused to EGFP is cotransfected to control for equal transfection efficiencies. Expression of EGFP from the mini lc-DNA is similar to the ccc-DNA, but substantially higher than from mini lo-DNA ( FIG. 9B ).
  • a helper plasmid that encodes the E2A, E4, and VA regions is used to transfect 293 cells of human embryonic kidney cells encodes the E1 region of the Ad5 genome, together with the closed DNA of Example 1 (vector plasmid), as well as the rep and cap genes (AAV-helper plasmid).
  • Trypsinized 293 cells at 5 ⁇ 10 6 cells per 225-cm 2 flask are used to generate a monolayer of 20% to 40% confluence when cells attach initially to the surface of the flask. Use 40 ml of medium per flask The plate is placed in an incubator in 5% CO 2 in air and cells are grown to 80% confluence (24 to 48 h.).
  • the medium is replaced with pre-warmed DMEM/F12 culture (contains 2% FCS).
  • pre-warmed DMEM/F12 culture contains 2% FCS.
  • 1 ml of 0.5 M EDTA is added to the flask and incubated for 3 min at room temperature.
  • the suspension of cells is collected and is centrifuged at 300 ⁇ g for 10 min.
  • the supernatant is removed and the cells in the pellet resuspended in 2 ml of TBS.
  • VTi65.2 rotor Spin the gradient at 65,000 rpm for 2 h at 16° C. in a VTi65.2 rotor (Beckman Instruments). Fractions of 0.5 ml each are collected and the virus-rich fraction is selected by semi-quantitative PCR analysis, Western blotting with antibodies against Cap, or quantitative DNA dot-blot hybridization.
  • a dialysis cassette (Slide-A-Lyzer; Pierce, Rockford, Ill.) is used to desalt the virus-rich fraction by three cycles of dilution with 300 ml of HNE buffer. The material is concentrated to 50 ⁇ L with Ultrafree-4 (Millipore, Bedford, Mass.) according to the manufacturer's instruction. The final titer usually ranges between 1 ⁇ 10 13 and 5 ⁇ 10 13 particles from 5 ⁇ 10 8 293 cells, as determined by quantitative DNA dot-blot hybridization or Southern blotting.
  • the above method is repeated except the closed linear DNA does not have the double D and is used as a comparator.
  • the double DD containing closed linear circle is expected to be more efficient—it has a higher yield of packaged genome infectious viral particles.
  • Example 1 The resultant closed end vectors of Example 1 containing the luciferase reporter gene are delivered to target cells by transfection. Constructs with no spacers, and with spacers of 2, 5, 10, 20 and 25 nucleotides generated in Example 1 are used delivered to HeLa cells to verify delivery of the vector, and expression of expression constructs (luciferase reporter gene) from covalently closed linear DNA produced in Example 1. Luciferase expression from cells transfected with constructs with no spacers, and with spacers of 2, 5, 10, 20 and 25 nucleotides is quantitatively detected by luciferase assay. Plasmid DNA and covalently closed circular DNA (e.g. containing the same expression construct), and open linear DNA of the same type, e.g.
  • Transfection is carried out at a 60% confluence in 20 mm diameter wells in RPMI using TransfectamTM (Promega) in accordance with manufacturer's instructions. Each transfection uses 400 ng of construct DNA. Transfection frequency is normalised within and between experiments by inclusion of an internal control using 40 ng of the Renilla luciferase-expressing plasmid pGL4.73 (containing the hRluc gene from Renilla reniformis ) in each transfection.
  • Firefly luciferase (luminescence from Photinus pyralis) and Renilla luciferase activity is measured sequentially using the Dual-LuciferaseTM Reporter (DLRTM) Assay System (Promega). Relative light units are measured using a GloMax Multi Luminometer (Promega) and results are expressed as the ratio of Firefly luciferase/ Renilla luciferase. All experiments are carried out in triplicate.
  • Results are expected to indicate that closed linear DNA or particles containing DD-ITRs, including that amplified by RCA, expresses luciferase at higher levels over time than the open linear PCR constructs and open linear PCR constructs lacking the DD-ITR.
  • This will demonstrate that closed linear DNA produced in accordance with the invention may be used to successfully express luciferase when introduced into mammalian cells.
  • the closed linear DNA vectors are expected to persist longer within the cell as compared to the controls.
  • DNA that have spacers between the DD-ITR and the promoter are expected to generate higher expression of luciferase than otherwise identical constructs without spacers. The size of the spacers is expected to correlate with expression levels, with larger spacers (e.g. 20-25 nucleotide spacers) leading to higher expression.
  • an expression cassette containing the human factor IX minigene driven by the ApoE enhancer/HCR and al-antitrypsin promoter (Miao et al., (2000) in vitro. Mol. Ther. 1:522-532) is delivered to the liver of hemophilia B mice using different vectors (the closed linear DNA comprising the DD-ITR and telomeric ends of the instant invention, corresponding linear DNA, and corresponding plasmid DNA.
  • the mice are analyzed for vector presence and for gene expression of factor IX by analysis of serum human factor IX concentrations at various times following the injections (3, 4, 5, 6, 7, 8, 9, 10 weeks, and at 3 months, 5 months, 10 months, over a year, etc).
  • the recipients of the DD-ITR constructs containing the factor IX expression cassette are expected to have higher amounts of vector present over time, and have higher concentrations of the factor IX than recipients of ss linear DNA and plasmid DNA controls.
  • the amount of vector present and the concentrations of the human factor IX is expected to persist over time in the recipients of the DD-ITR constructs, and to decrease over time in the recipients of the controls.
  • the expression of the factor IX in the DD-ITR construct in recipient mice is expected to persist at substantially higher levels and over a substantially longer period of time than expression of the Factor IX in recipients of the controls.
  • the vector is expected to form concatemers in recipient tissue cells that persist over time.
  • the concatemers persist extrachromasomally, or integrate into the host cell genome.
  • recipient mice liver tissue is analyzed by Southern blot analysis for the molecular structure of the vector DNA.
  • the DNA is isolated and then digested with a restriction endonuclease that either does not cut within the vector, or cuts once in the expression cassette. Analysis of the cut DNA is performed to determine integration of DNA into the mouse genome or retention extrachromasomally.
  • the production of a high molecular weight band in all samples from digestion with an endonuclease that fails to cut within the vector DNA is consistent with either the integration of the DNA vector into the mouse genome or rapid formation of concatemers in vivo.
  • mice are injected with either the DD-ITR vector DNA, or an integrating factor IX transposon (Yant et al., Nat. Genet. 25: 35-41) to a 2 ⁇ 3 partial hepatectomy.
  • the transposase expressed from one plasmid, mediates the release of the human factor IX expression cassette flanked by the transposon ITR from a second plasmid and the insertion of the released transgene expression cassette into the mouse genome.
  • mice Animal studies. Eight- to ten-week-old female C57BL/6 mice are obtained from Taconic Farms, Inc. (Germantown, N.Y.). All animal procedures are performed under the guidelines set forth by Stanford University and the National Institute of Health. Forty micrograms of DNA in 2 ml 0.85% saline is injected into mouse tail veins as previously described (Liu et al., (1999) Gene Ther. 6: 1258-1266; Zhang et al., (1999) Human Gene Therapy 10: 1735-1737). For each injection, the mass of DNA is the same while the molar ratio can vary (e.g., by twofold). In other studies, small variations in molar ratios is not expected to significantly affect gene expression.
  • mice are bled periodically by a retro-orbital technique. In some cases, mice are subjected to a surgical 2 ⁇ 3 partial hepatectomy as previously described (Park et al., Nat. Genet. 24: 49-52 (2000)). The bleeding times in mice are determined by measuring the time required for clotting of the blood from a 2- to 3-mm tail snip, as previously described (Yant et al., (2000) Nat. Genet. 25: 35-41).
  • the sections are incubated with a goat anti-digoxigenin antibody conjugated with alkaline phosphatase, and the alkaline phosphatase-bound vector DNA is visualized by nitroblue tetrazolium chloride-5-4-chloro-3-indolyl phosphate (Roche Molecular Biochemicals).
  • ELISA quantitation After DNA delivery, mouse blood is collected periodically, and human factor IX (hFIX) (Walter et al., (1996) PNAS USA 93: 3056-3061) is quantitated by ELISA.
  • hFIX human factor IX
  • a plasmid having, from 5′ to 3′, a BAMHI restriction site, a F1 ORI, a PvuII restriction site, an ITR-L, a promoter operatively linked to the coding region of CFTR, a Double D-ITR (DD-ITR), a promoter operatively linked to the coding region of CFTR, ITR-R, and a HINDIII restriction site is digested with BAMHI and HINDIII restriction enzymes for 24 hours at 37° C.
  • the digest is run on an electrophoresis gel to visual and isolate the plasmid fragment.
  • the plasmid fragment is cut out of the gel and purified.
  • An adaptor sequence having BAMHI restriction site sequence at the end of a hairpin loop and an adaptor sequence having a HINDIII restriction site sequence at the end of a hairpin loop are additionally digested and purified in the same manner.
  • the adaptor sequences are annealed to the cut ends of the plasmid fragment.
  • the purified plasmid fragment and adapter sequences are ligated in the presence of a ligase, such as T4 ligase, and ATP at room temperature for at least 1 hour.
  • the ligation reaction is then heat inactivated at 65° C. for 10 minutes to inactivate the ligase enzyme.
  • the circular nucleic template acid is transformed into E. coli cells and grown at 37° C., shaking, for 14-16 hours to induce replication of the circular nucleic acid.
  • the circular nucleic acid encoding the CFTR transgene is released from E. coli cells using a bacterial lysis reagent to cause cell lysis. Following release, the CFTR circular nucleic acid is recovered using standard methods, for example, via purification using column chromatography.
  • the circular nucleic acid can be recovered and used directly for delivery of the transgene in vivo, or used for viral production (see Example 8).
  • the recovered CFTR circular nucleic acid is further digested with a PvuII restriction enzyme for 24 hours at 25° C. to cut the PvuII cleavage site. Cutting PvuII removes the ORI and creates an open-end on the CFTR nucleic acid construct.
  • the open ended circular nucleic acid can be used for in vivo delivery of transgene or for production of recombinant viral DNA.
  • the circular nucleic acid need not be digested with PvuII to be used for recombinant viral production, or for in vivo delivery of transgene.
  • the open- and closed-ended CFTR nucleic acid construct is used to manufacture viral vectors in Pro10/HEK293 cells.
  • Pro10/HEK293 cells as described in U.S. Pat. No. 9,441,206, are ideal for scalable production of AAV vectors.
  • This cell line is contacted with the CFTR nucleic acid construct via transfection to express the circular nucleic acid. Expression of CFTR nucleic acid construct is confirmed via PCR-based assays using primers specific for the plasmid.
  • Pro10/HEK293 cells are transfected with CFTR circular nucleic acid and are also transfected with a Packaging plasmid encoding Rep2 and serotype-specific Cap2: AAV-Rep/Cap, and the Ad-Helper plasmid (XX680: encoding adenoviral helper sequences).
  • the cells are counted using a ViCell XR Viability Analyzer (Beckman Coulter) and diluted for transfection.
  • the following reagents are added to a conical tube in this order: plasmid DNA, OPTIMEM® I (Gibco) or OptiPro SFM (Gibco), or other serum free compatible transfection media, and then the transfection reagent at a specific ratio to plasmid DNA.
  • the cocktail is inverted to mix prior to being incubated at room temperature.
  • the transfection cocktail is pipetted into the flasks and placed back in the shaker/incubator. All optimization studies are carried out at 30 mL culture volumes followed by validation at larger culture volumes. Cells are harvested 48 hours post-transfection.
  • Wave bags are seeded 2 days prior to transfection. Two days post-seeding the wave bag, cell culture counts are taken and the cell culture is then expanded/diluted before so transfection. The wave bioreactor cell culture is then transfected. Cell culture are harvested from the wave bio-reactor bag at least 48 hours post-transfection.
  • AAV titers are calculated after DNase digestion using qPCR against a standard curve (AAV ITR specific) and primers specific to the CFTR circular nucleic acid.
  • rAAV Titering rAAV from Cell Lysate Using qPCR. 10 mL of cell culture is removed and centrifuged at 655 ⁇ g for 10 min using a Sorvall RC3C plus centrifuge and H6000A rotor. The supernatant is decanted from the cell pellet. The cell pellet is then resuspended in 5 mL of DNase buffer (5 mM CaCl2, 5 mM MgCl2, 50 mM Tris-HCl pH 8.0) followed by sonication to lyse the cells efficiently. 300 uL is then removed and placed into a 1.5 mL microfuge tube. 140 units of DNase I is then added to each sample and incubated at 37° C. for 1 hour.
  • DNase buffer 5 mM CaCl2, 5 mM MgCl2, 50 mM Tris-HCl pH 8.0
  • TReGFP plasmid is spiked into a non-transfected cell lysate with is and without the addition of DNase.
  • 504 of EDTA/Sarkosyl solution (6.3% sarkosyl, 62.5 mM EDTA pH 8.0) is added to each tube and incubated at 70° C. for 20 minutes.
  • 50 ⁇ L of Proteinase K (10 mg/mL) is then added and incubated at 55° C. for at least 2 hours. Samples are boiled for 15 minutes to inactivate the Proteinase K. An aliquot is removed from each sample to be analyzed by qPCR.
  • Two qPCR reactions are carried out in order to effectively determine how much rAAV vector is generated per cell.
  • One qPCR reaction is set up using a set of primers 2s designed to bind to a homologous sequence on the backbones of plasmids XX680, pXR2 and TReGFP.
  • the second qPCR reaction is set up using a set of primers to bind and amplify a region within the eGFP gene.
  • qPCR is conducted using Sybr green reagents and Light cycler 480 from 30 Roche. Samples are denatured at 95° C. for 10 minutes followed by 45 cycles (90° C. for 10 sec, 62° C. for 10 sec and 72° C. for 10 sec) and melting curve (1 cycle 99° C. for 30 sec, 65° C. for 1 minute continuous).
  • rAAV Purification of rAAV from Crude Lysate. Each cell pellet is adjusted to a final volume of 10 mL. The pellets are vortexed briefly and sonicated for 4 minutes at 30% yield in one second on, one second off bursts. After sonication, 550 U of DNase is added and incubated at 37° C. for 45 minutes. The pellets are then centrifuged at 9400 ⁇ g using the Sorvall RCSB centrifuge and HS-4 rotor to pellet the cell debris and the clarified lysate is transferred to a Type70Ti centrifuge tube (Beckman 361625).
  • Clarified AAV lysate is purified by column chromatography methods as one skilled in the art would be aware of and described in the following manuscripts (Allay et al., Davidoff et al., Kaludov et al., Zolotukhin et al., Zolotukin et al, etc), which are incorporated herein by reference in their entireties.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Plant Pathology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
US17/253,929 2018-06-22 2019-06-21 Vectors for gene delivery that persist within cells Pending US20210269828A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US17/253,929 US20210269828A1 (en) 2018-06-22 2019-06-21 Vectors for gene delivery that persist within cells

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US201862688982P 2018-06-22 2018-06-22
US201862689453P 2018-06-25 2018-06-25
US201862697750P 2018-07-13 2018-07-13
US201862717310P 2018-08-10 2018-08-10
PCT/US2019/038515 WO2019246544A2 (en) 2018-06-22 2019-06-21 Vectors for gene delivery that persist within cells
US17/253,929 US20210269828A1 (en) 2018-06-22 2019-06-21 Vectors for gene delivery that persist within cells

Publications (1)

Publication Number Publication Date
US20210269828A1 true US20210269828A1 (en) 2021-09-02

Family

ID=67297281

Family Applications (1)

Application Number Title Priority Date Filing Date
US17/253,929 Pending US20210269828A1 (en) 2018-06-22 2019-06-21 Vectors for gene delivery that persist within cells

Country Status (7)

Country Link
US (1) US20210269828A1 (zh)
EP (1) EP3810782A2 (zh)
JP (1) JP2021528959A (zh)
CN (1) CN112639110A (zh)
AU (1) AU2019290228A1 (zh)
CA (1) CA3104113A1 (zh)
WO (1) WO2019246544A2 (zh)

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3987043A4 (en) * 2019-06-21 2023-07-19 Asklepios Biopharmaceutical, Inc. PRODUCTION OF VECTORS USING THE PHAGEN REPLICATION ORIGIN
CZ308738B6 (cs) * 2020-01-20 2021-04-14 PortalGene s.r.o. Způsob úpravy molekuly nukleové kyseliny pro usnadění jejího přenosu do hostitelských buněk a upravená molekula nukleové kyseliny
US20230134550A1 (en) * 2020-03-24 2023-05-04 Generation Bio Co. Non-viral dna vectors and uses thereof for expressing gaucher therapeutics
US20230138409A1 (en) * 2020-03-24 2023-05-04 Generation Bio Co. Non-viral dna vectors and uses thereof for expressing factor ix therapeutics
CN116234917A (zh) 2020-07-27 2023-06-06 安杰瑞姆生物科学公司 Dna分子组合物及其制备方法和使用方法
GB202014751D0 (en) 2020-09-18 2020-11-04 Lightbio Ltd Targeting vector
US20240150793A1 (en) * 2021-03-29 2024-05-09 Kaneka Corporation Vector, linear covalently closed dna production method using vector, parvovirus vector production method, and parvovirus-vector-producing cell production method
AU2022211795A1 (en) * 2021-08-06 2023-02-23 Syte.Bio Inc. Hairpin loop ended self-complementary double-stranded covalently closed linear dna vector, manufacturing system and process, and uses of said resulting dna vector
CN116606834A (zh) * 2023-04-10 2023-08-18 天津中合基因科技有限公司 多种具有切割连接活性的原端酶及其应用

Family Cites Families (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4897355A (en) 1985-01-07 1990-01-30 Syntex (U.S.A.) Inc. N[ω,(ω-1)-dialkyloxy]- and N-[ω,(ω-1)-dialkenyloxy]-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US5049386A (en) 1985-01-07 1991-09-17 Syntex (U.S.A.) Inc. N-ω,(ω-1)-dialkyloxy)- and N-(ω,(ω-1)-dialkenyloxy)Alk-1-YL-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US4946787A (en) 1985-01-07 1990-08-07 Syntex (U.S.A.) Inc. N-(ω,(ω-1)-dialkyloxy)- and N-(ω,(ω-1)-dialkenyloxy)-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US4795700A (en) 1985-01-25 1989-01-03 California Institute Of Technology Nucleic acid probes and methods of using same
US5139941A (en) 1985-10-31 1992-08-18 University Of Florida Research Foundation, Inc. AAV transduction vectors
US4968603A (en) 1986-12-31 1990-11-06 The Regents Of The University Of California Determination of status in neoplastic disease
EP0442926A1 (en) 1988-11-10 1991-08-28 Imperial Cancer Research Technology Limited Polypeptides
US5194376A (en) 1989-02-28 1993-03-16 University Of Ottawa Baculovirus expression system capable of producing foreign gene proteins at high levels
FR2675803B1 (fr) 1991-04-25 1996-09-06 Genset Sa Oligonucleotides fermes, antisens et sens et leurs applications.
US5478745A (en) * 1992-12-04 1995-12-26 University Of Pittsburgh Recombinant viral vector system
US5869248A (en) 1994-03-07 1999-02-09 Yale University Targeted cleavage of RNA using ribonuclease P targeting and cleavage sequences
US5599706A (en) 1994-09-23 1997-02-04 Stinchcomb; Dan T. Ribozymes targeted to apo(a) mRNA
US6040183A (en) 1995-06-07 2000-03-21 University Of North Carloina At Chapel Hill Helper virus-free AAV production
US6093570A (en) 1995-06-07 2000-07-25 The University Of North Carolina At Chapel Hill Helper virus-free AAV production
EP0883344B2 (en) 1995-12-15 2010-06-09 VIRxSYS Corporation Therapeutic molecules generated by trans-splicing
US6083702A (en) 1995-12-15 2000-07-04 Intronn Holdings Llc Methods and compositions for use in spliceosome mediated RNA trans-splicing
US5962313A (en) 1996-01-18 1999-10-05 Avigen, Inc. Adeno-associated virus vectors comprising a gene encoding a lyosomal enzyme
EP0924298A1 (en) 1997-12-18 1999-06-23 Stichting Instituut voor Dierhouderij en Diergezondheid (ID-DLO) Protein expression in baculovirus vector expression systems
JP2002505110A (ja) 1998-03-04 2002-02-19 オニックス ファーマシューティカルズ，インコーポレイティド 遺伝物質の高生産性発現のためのバキュロウイルス発現系及び方法
CA2329947A1 (en) * 1998-06-09 1999-12-16 Merck & Co., Inc. Novel adenoviral vectors for gene therapy
DE19826758C1 (de) 1998-06-15 1999-10-21 Soft Gene Gmbh Darstellung von linearen kovalent geschlossenen DNA-Molekülen als Expressionskonstrukte
DE19935756A1 (de) 1999-07-27 2001-02-08 Mologen Forschungs Entwicklung Kovalent geschlossenes Nukleinsäuremolekül zur Immunstimulation
EP1290205B1 (en) 2000-06-01 2006-03-01 University Of North Carolina At Chapel Hill Duplexed parvovirus vectors
US6623729B2 (en) 2001-07-09 2003-09-23 Korea Advanced Institute Of Science And Technology Process for preparing sustained release micelle employing conjugate of anticancer drug and biodegradable polymer
ITRM20020253A1 (it) 2002-05-08 2003-11-10 Univ Roma Molecole chimeriche di snrna con sequenze antisenso per le giunzioni di splicing del gene della distrofina e applicazioni terapeutiche.
US20070015238A1 (en) 2002-06-05 2007-01-18 Snyder Richard O Production of pseudotyped recombinant AAV virions
AU2003268323A1 (en) 2002-08-29 2004-03-19 The Board Of Trustees Of The Leland Stanford Junior University Circular nucleic acid vectors, and methods for making and using the same
FR2874384B1 (fr) 2004-08-17 2010-07-30 Genethon Vecteur viral adeno-associe pour realiser du saut d'exons dans un gene codant une proteine a domaines dispensables
US7892824B2 (en) 2007-01-18 2011-02-22 University Of Missouri-Columbia Synthetic mini/micro-dystrophin genes to restore nNOS to the sarcolemma
US20120322861A1 (en) 2007-02-23 2012-12-20 Barry John Byrne Compositions and Methods for Treating Diseases
US9725485B2 (en) 2012-05-15 2017-08-08 University Of Florida Research Foundation, Inc. AAV vectors with high transduction efficiency and uses thereof for gene therapy
KR101414713B1 (ko) 2007-10-11 2014-07-03 삼성전자주식회사 리가제 및 엔도뉴클레아제의 존재하에서 롤링서클 증폭에의하여 표적 핵산을 증폭하는 방법
GB0901593D0 (en) * 2009-01-30 2009-03-11 Touchlight Genetics Ltd Production of closed linear DNA
KR101607702B1 (ko) 2009-05-29 2016-03-31 삼성디스플레이 주식회사 액정 표시 장치
ES2683695T3 (es) * 2010-01-12 2018-09-27 The University Of North Carolina At Chapel Hill Repeticiones terminales invertidas restrictivas para vectores virales
GB201013153D0 (en) 2010-08-04 2010-09-22 Touchlight Genetics Ltd Primer for production of closed linear DNA
WO2012109570A1 (en) 2011-02-10 2012-08-16 The University Of North Carolina At Chapel Hill Viral vectors with modified transduction profiles and methods of making and using the same
EP2500434A1 (en) * 2011-03-12 2012-09-19 Association Institut de Myologie Capsid-free AAV vectors, compositions, and methods for vector production and gene delivery
CN104520421B (zh) 2011-10-28 2017-05-24 北卡罗来纳-查佩尔山大学 用于生产腺伴随病毒的细胞系
US9290778B2 (en) * 2013-11-22 2016-03-22 Mediphage Bioceuticals, Inc. DNA vector production system
JP2015014459A (ja) 2013-07-03 2015-01-22 日本電波工業株式会社 放射線測定装置
WO2016081927A2 (en) * 2014-11-21 2016-05-26 University Of Florida Research Foundation, Inc. Genome-modified recombinant adeno-associated virus vectors
WO2017074526A1 (en) * 2015-10-28 2017-05-04 Sangamo Biosciences, Inc. Liver-specific constructs, factor viii expression cassettes and methods of use thereof
SG10201913688TA (en) * 2016-03-03 2020-03-30 Univ Massachusetts Closed-ended linear duplex dna for non-viral gene transfer
KR102617874B1 (ko) 2016-03-30 2023-12-22 인텔리아 테라퓨틱스, 인크. Crispr/cas 성분을 위한 지질 나노입자 제제

Also Published As

Publication number Publication date
WO2019246544A3 (en) 2020-02-13
JP2021528959A (ja) 2021-10-28
EP3810782A2 (en) 2021-04-28
CN112639110A (zh) 2021-04-09
CA3104113A1 (en) 2019-12-26
WO2019246544A2 (en) 2019-12-26
AU2019290228A1 (en) 2021-01-28

Similar Documents

Publication Publication Date Title
US20210269828A1 (en) Vectors for gene delivery that persist within cells
US20210189428A1 (en) Genome-modified recombinant adeno-associated virus vectors
US20220290186A1 (en) Gene editing using a modified closed-ended dna (cedna)
US20210071197A1 (en) Closed-ended dna vectors obtainable from cell-free synthesis and process for obtaining cedna vectors
US20210054405A1 (en) Closed-ended dna (cedna) vectors for insertion of transgenes at genomic safe harbors (gsh) in humans and murine genomes
CA3075168A1 (en) Modified closed-ended dna (cedna)
US20220175970A1 (en) Controlled expression of transgenes using closed-ended dna (cedna) vectors
US20220127625A1 (en) Modulation of rep protein activity in closed-ended dna (cedna) production
CN113316640A (zh) 包含对称的被修饰的反向末端重复序列的被修饰的封闭端dna(cedna)
WO2023122303A2 (en) Scalable and high-purity cell-free synthesis of closed-ended dna vectors
WO2023044059A2 (en) Liver-specific expression cassettes, vectors and uses thereof for expressing therapeutic proteins

Legal Events

Date Code Title Description
STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED