US20180312571A1 - CpG REDUCED FACTOR VIII VARIANTS, COMPOSITIONS AND METHODS AND USES FOR TREATMENT OF HEMOSTASIS DISORDERS - Google Patents
CpG REDUCED FACTOR VIII VARIANTS, COMPOSITIONS AND METHODS AND USES FOR TREATMENT OF HEMOSTASIS DISORDERS Download PDFInfo
- Publication number
- US20180312571A1 US20180312571A1 US15/772,025 US201615772025A US2018312571A1 US 20180312571 A1 US20180312571 A1 US 20180312571A1 US 201615772025 A US201615772025 A US 201615772025A US 2018312571 A1 US2018312571 A1 US 2018312571A1
- Authority
- US
- United States
- Prior art keywords
- aav
- nucleic acid
- vector
- fviii
- acid variant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/745—Blood coagulation or fibrinolysis factors
- C07K14/755—Factors VIII, e.g. factor VIII C (AHF), factor VIII Ag (VWF)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/36—Blood coagulation or fibrinolysis factors
- A61K38/37—Factors VIII
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
- A61K48/0066—Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
- C12N15/864—Parvoviral vectors, e.g. parvovirus, densovirus
- C12N15/8645—Adeno-associated virus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
- C12N2710/10341—Use of virus, viral particle or viral elements as a vector
- C12N2710/10342—Use of virus, viral particle or viral elements as a vector virus or viral particle as vehicle, e.g. encapsulating small organic molecule
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
- C12N2710/10341—Use of virus, viral particle or viral elements as a vector
- C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14145—Special targeting system for viral vectors
Definitions
- This invention relates to the fields of recombinant coagulation factor production and the treatment of medical disorders associated with aberrant hemostasis. More particularly, the invention provides nucleic acid variants (sequences) encoding Factor VIII (FVIII) protein, the variants optionally provide increased transcription and/or expression, and/or activity over wild-type FVIII proteins.
- nucleic acid variants sequences
- FVIII Factor VIII
- Hemophilia is an X-linked bleeding disorder present in 1 in 5,000 males worldwide. Therapies aimed at increasing clotting factor levels just above 1% of normal are associated with substantial improvement of the severe disease phenotype.
- Recent clinical trials for AAV-mediated gene transfer for hemophilia B (HB) have demonstrated sustained long-term expression of therapeutic levels of factor IX (FIX) but established that the AAV vector dose may be limiting due to anti-AAV immune responses to the AAV capsid. While these data relate the hemophilia B, 80% of all hemophilia is due to FVIII deficiency, hemophilia A (HA).
- gene therapy for HA presents 3 distinct challenges: (1) intrinsic properties of human FVIII (hFVIII) make it difficult to express compared to other proteins of similar size (2) the large size of the FVIII cDNA and sequence specific effects are correlated with rearrangements which hamper AAV production and (3) high rates of anti-FVIII antibody (inhibitors) formation in response to protein therapy that occurs in 25-30% of severe ( ⁇ 1% FVIII) HA patients.
- hFVIII human FVIII
- CpG reduced nucleic acid variants encoding Factor VIII (FVIII) protein are provided.
- CpG reduced nucleic acid variants are distinct from wild-type nucleic acid encoding FVIII and may encode, for example, human FVIII protein, optionally lacking, in whole or in part, the FVIII B domain.
- Such CpG reduced nucleic acid variants include variants that exhibit increased expression (e.g., 1-5 fold increased expression) compared to codon-optimized FVIII nucleic acids such as FVIII-CO3 (SEQ ID NO:21), when transferred into cells, leading to increased FVIII protein secretion and therefore increased activity.
- CpG reduced nucleic acid variants that encode FVIII, with or without deletion of, in whole or in part, the FVIII B domain can provide for increased expression of FVIII, increased production of FVIII protein in a mammal, as well as provide increased efficacy in the context of gene transfer by increased circulating levels of FVIII protein, and achieving hemostasis for beneficial therapeutic outcomes.
- a nucleic acid variant encoding FVIII has a reduced CpG content compared to wild-type nucleic acid encoding FVIII. In certain embodiments, a nucleic acid variant has at least 10 fewer CpGs than wild-type nucleic acid encoding FVIII (SEQ ID NO: 19). In certain embodiments, a nucleic acid variant has no more than 4 CpGs; has no more than 3 CpGs; has no more than 2 CpGs; or has no more than 1 CpG. In certain embodiments, a nucleic acid variant has at most 4 CpGs; 3 CpGs; 2 CpGs; or 1 CpG. In certain embodiments, a nucleic acid variant has no CpGs.
- a nucleic acid variant encoding FVIII has a reduced CpG content compared to wild-type nucleic acid encoding FVIII, and such CpG reduced nucleic acid variants have 90% or greater sequence identity to any of SEQ ID NOs: 1-18.
- CpG reduced nucleic acid variants have 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or greater sequence identity to any of SEQ ID NOs:1-18.
- CpG reduced nucleic acid variants have 90-95% sequence identity to any of SEQ ID NOs: 1-18.
- CpG reduced nucleic acid variants have 95%-100% sequence identity to any of SEQ ID NOs: 1-18.
- FVIII encoding CpG reduced nucleic acid variants are set forth in any of SEQ ID NOs: 1-18.
- CpG reduced nucleic acid variants are distinct from FVIIIvariant V3 (SEQ ID NO:20) and/or are distinct from FVIII variant CO3 (SEQ ID NO:21).
- a CpG reduced nucleic acid variants encoding FVIII protein provides for greater expression and/or exhibits superior biological activity as compared to wild type FVIII or as compared to wild type FVIII comprising a B domain deletion (e.g., as determined by a plasma levels or a clotting assay or reduced bleeding in a FVIII assay or FVIII deficiency model).
- CpG reduced nucleic acid variants encoding FVIII protein are at least 75% identical to wild type human FVIII nucleic acid or wild type human FVIII nucleic acid comprising a B domain deletion. In certain embodiments, CpG reduced nucleic acid variants encoding FVIII protein are about 75-95% identical (e.g., about 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95% identical) to wild type human FVIII nucleic acid or wild type human FVIII nucleic acid comprising a B domain deletion.
- CpG reduced nucleic acid variants encoding FVIII protein are mammalian, such as human.
- Such mammalian CpG reduced nucleic acid variants encoding FVIII protein include human forms, which may be based upon human wild type FVIII or human wild type FVIII comprising a B domain deletion.
- a vector or expression vector comprises an adenovirus-associated virus (AAV) vector, a retroviral vector, an adenoviral vector, a plasmid, or a lentiviral vector.
- AAV vector comprises an AAV serotype or an AAV pseudotype, such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, Rh10, Rh74 or AAV-2i8 AAV.
- an expression vector includes any of SEQ ID Nos: 1-18, or comprises SEQ ID NO: 23 or 24.
- an expression control element comprises a constitutive or regulatable control element, or a tissue-specific expression control element or promoter.
- an expression control element comprises an element that confers expression in liver.
- an expression control element comprises a TTR promoter or mutant TTR promoter, such as SEQ ID NO:22.
- an expression control element comprises a promoter set forth in PCT publication WO 2016/168728 (U.S. Ser. No. 62/148,696; 62/202,133; and 62/212,634), which are incorporated herein by reference in their entirety.
- virus vectors that include a CpG reduced nucleic acid variant encoding FVIII protein, or vectors or expression vectors comprising CpG reduced nucleic acid variant encoding FVIII protein.
- a virus vector comprises an AAV vector, a retroviral vector, an adenoviral vector, a plasmid, or a lentiviral vector.
- an AAV vector comprises an AAV serotype or an AAV pseudotype comprising an AAV capsid serotype different from an ITR serotype.
- an AAV vector comprises a VP1, VP2 and/or VP3 capsid sequence having 75% or more sequence identity (e.g., 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, etc.) to any of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, Rh10, Rh74 or AAV-2i8 AAV serotypes.
- an expression vector such as AAV vector further includes an intron, an expression control element, one or more AAV inverted terminal repeats (ITRs) (e.g., any of: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, Rh10, Rh74 or AAV-2i8 AAV serotypes, or a combination thereof), a filler polynucleotide sequence and/or poly A signal.
- ITRs AAV inverted terminal repeats
- an intron is within or flanks a CpG reduced nucleic acid variant encoding FVIII, and/or an expression control element is operably linked to the CpG reduced nucleic acid variant encoding FVIII, and/or an AAV ITR(s) flanks the 5′ or 3′ terminus of the CpG reduced nucleic acid variant encoding FVIII, and/or a filler polynucleotide sequence flanks the 5′ or 3′terminus of the CpG reduced nucleic acid variant encoding FVIII.
- an expression control element comprises a constitutive or regulatable control element, or a tissue-specific expression control element or promoter.
- an expression control element comprises an element that confers expression in liver (e.g., a TTR promoter or mutant TTR promoter).
- a host cell includes a CpG reduced nucleic acid variant encoding FVIII protein or an expression vector comprising a CpG reduced nucleic acid variant encoding FVIII protein.
- such host cells produce FVIII protein encoded by the nucleic acid variants and FVIII protein produced is recovered.
- FVIII protein produced by the cells optionally isolated and/or purified, can be administered to a subject.
- compositions comprising CpG reduced nucleic acid variant encoding FVIII, vectors and expression vectors set forth herein.
- pharmaceutical compositions include a vector, an expression vector, or a virus or AAV vector, in a biologically compatible carrier or excipient.
- Such pharmaceutical compositions optionally include empty capsid AAV (e.g., lack vector genome comprising FVIII encoding nucleic acid variant).
- CpG reduced nucleic acid variant encoding FVIII protein, vectors, expression vectors, or virus or AAV vectors are encapsulated in a liposome or mixed with phospholipids or micelles.
- a method includes administering or contacting a CpG reduced nucleic acid variant encoding FVIII, a vector comprising a CpG reduced nucleic acid variant encoding FVIII protein, an expression vector comprising a CpG reduced nucleic acid variant encoding FVIII protein, or a virus or AAV vector comprising a CpG reduced nucleic acid variant encoding FVIII protein to a mammal or mammalian cell, thereby delivering or transferring the nucleic acid sequence into the mammal or mammalian cell.
- Such methods introduce a CpG reduced nucleic acid variant encoding FVIII protein into a mammalian cell in culture or in a subject (e.g., a patient).
- Methods of the invention also include treating mammalian subjects (e.g., patients) such as humans in need of FVIII (the human produces an insufficient amount of FVIII protein, or a defective or aberrant FVIII protein).
- a method of treating a mammal in need of FVIII includes: providing a CpG reduced nucleic acid variant encoding FVIII, or a vector comprising a CpG reduced nucleic acid variant encoding FVIII; or an expression vector comprising CpG reduced nucleic acid variant encoding FVIII, or a virus or AAV vector comprising a CpG reduced nucleic acid variant encoding FVIII; and administering an amount of the CpG reduced nucleic acid variant encoding FVIII, or a vector comprising a CpG reduced nucleic acid variant encoding FVIII, or an expression vector comprising a CpG reduced nucleic acid variant encoding FVIII, or a virus or AAV vector comprising a
- a method for treatment of a hemostasis related disorder in a patient in need thereof includes administration of a therapeutically effective amount of a CpG reduced nucleic acid variant encoding FVIII, or a vector comprising a CpG reduced nucleic acid variant encoding FVIII, or an expression vector comprising a CpG reduced nucleic acid variant encoding FVIII, or a virus or AAV vector comprising a CpG reduced nucleic acid variant encoding FVIII in a biologically acceptable carrier to the patient.
- FVIII is expressed at levels having a beneficial or therapeutic effect on the mammal; and/or FVIII is expressed in a cell, tissue or organ of the mammal.
- Such embodiments include introduction of a CpG reduced nucleic acid variant encoding FVIII into a tissue or organ such as liver.
- Such embodiments also include introduction of a CpG reduced nucleic acid variant encoding FVIII into a secretory cell.
- Such embodiments further include introduction of a CpG reduced nucleic acid variant encoding FVIII into an endocrine cell or an endothelial cell.
- Such embodiments additionally include introduction of a CpG reduced nucleic acid variant encoding FVIII into an hepatocyte, a sinusoidal endothelial cell, a megakaryocyte, a platelet or hematopoetic stem cell.
- Candidate subjects e.g., a patient
- mammals e.g., humans
- administration e.g., delivery
- a CpG reduced nucleic acid variant encoding FVIII or a vector comprising a CpG reduced nucleic acid variant encoding FVIII, or an expression vector comprising a CpG reduced nucleic acid variant encoding FVIII, or a virus or AAV vector comprising a CpG reduced nucleic acid variant encoding FVIII
- a disorder such as: hemophilia A, von Willebrand diseases and bleeding associated with trauma, injury, thrombosis, thrombocytopenia, stroke, coagulopathy, disseminated intravascular coagulation (DIC) or over-anticoagulation treatment disorder.
- DIC disseminated intravascular coagulation
- Candidate subjects e.g., a patient
- mammals e.g., humans
- administration e.g., delivery
- Such subjects e.g., a patient
- mammals e.g., humans
- Compositions and methods of the invention therefore further include administering empty capsid AAV to said mammal or said patient.
- empty capsid of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV-12, AAV-Rh10 and/or AAV-Rh74 serotype is further administered to the mammal or patient.
- Methods of administration in accordance with the invention include any mode of contact or delivery, ex vivo or in vivo.
- administration e.g., delivery
- the invention also provide methods for testing CpG reduced nucleic acid variants encoding FVIII in small and large animal models that are tolerant to human FVIII in order to assess dosing and monitor immunogenicity of the variants.
- Use of animal models provide a setting that allows assessment of humans currently receiving protein replacement therapy with hFVIII-BDD without evidence of an anti-hFVIII antibody response who are likely to develop an immune response to such variants.
- FIG. 1 shows human FVIII (hFVIII) levels 24 hour following hydrodynamic tail vein (HTV) injection of 50 ⁇ g of plasmid, for 18 different clones (X01-X18 corresponding to SEQ ID Nos: 1-18, respectively) and FVIII-CO3 (SEQ ID NO:21).
- FIGS. 2A-2C show FVIII levels in hemophilia A/CD4 ⁇ / ⁇ mice after AAV vector administration of FVIII
- A CO3 (SEQ ID NO:21), X09 (SEQ ID NO:9), X12 (SEQ ID NO: 12) and X16 (SEQ ID NO: 16);
- B CO3 (SEQ ID NO:21), X01 (SEQ ID NO: 1) and X11 (SEQ ID NO: 11); or
- C CO3 (SEQ ID NO:21), X07 (SEQ ID NO:7) and X10 (SEQ ID NO: 10).
- FIGS. 3A-3B show levels of hFVIII antigen in ng/ml (B) or % total antigen (C) in plasma of NOD/SCID mice following intravenous administration of either vehicle (circle), 4 ⁇ 10 10 (square), 8 ⁇ 10 10 (triangle), or 1.6 ⁇ 10 11 vg/mouse (inverted triangle) of AAV-SPK-8005-hFVIII over the course of 87 days.
- Lines represent hFVIII averages ⁇ SD in each cohort.
- Human FVIII plasma levels were assayed by ELISA and ng/ml FVIII was converted to % normal FVIII levels by assuming 150 ng/ml is equivalent to 100% activity.
- FIG. 3C shows levels of D-dimers in plasma of NOD/SCID mice following intravenous administration of either vehicle, 4 ⁇ 10 10 , 8 ⁇ 10 10 or 1.6 ⁇ 10 11 vg/mouse of AAV-SPK-8005-hFVIII as illustrated, left to right at each timepoint, x-axis. Bars represent averages ⁇ SD of mice in each cohort. D-dimer levels were assayed by ELISA.
- FIG. 4 shows NHP Study design.
- FIGS. 5A-5D show hFVIII antigen levels in NHPs following intravenous administration of either 2 ⁇ 10 12 (A), 5 ⁇ 10 12 (B) or 1 ⁇ 10 13 vg/kg (C) of AAV-SPK-8005.
- Lines represent individual animals.
- FIGS. 6A-6C show ALT levels in NHPs, at 2 ⁇ 10 12 (A), 5 ⁇ 10 12 (B) or 1 ⁇ 10 13 vg/kg (C) of AAV-SPK-8005.
- FIGS. 7A-7C show D-Dimer levels in NHPs.
- the dotted line indicates 500 ng/ml, the upper limit of normal for D-dimers in humans.
- FIG. 8 shows a data summary of FVIII levels in the three doses of AAV-SPK-8005.
- FIGS. 9A-9D show levels of hFVIII in plasma of cynomolgus macaques following intravenous administration of either 2 ⁇ 10 12 (A), 6 ⁇ 10 12 (B) or 2 ⁇ 10 13 (vg/kg) (C) of AAV-SPK-8011 (LK03 capsid)-hFVIII.
- Lines represent individual animals.
- FIG. 10 shows a comparison of FVIII levels achieved with AAV-SPK-8011 (LK03 capsid)-hFVIII to the reported levels of FVIII delivered by way of AAV vectors with AAV5 and AAV8 capsids.
- AAV5 http://www.biomarin.com/pdf/BioMarin_R&D_Day_4_20_2016.pdf, slide 16.
- AAV8 McIntosh J et al. Blood 2013; 121(17):3335-44.
- FIG. 11 shows AAV-SPK (SEQ ID NO:28) and AAV-LK03 (SEQ ID NO:27) tissue biodistribution in non-human primates, predominanyl in kidney, spleen and liver (3 rd bar for each tissue).
- FIG. 12 shows hepatic and splenic FVIII expression after systemic administration of AAV-SPK-8005 into mice.
- FIG. 13 shows transduction efficiency of the AAV-LK03 capsid analyzed in vitro.
- X-axis cynomolgus (left vertical bar), human (right vertical bar).
- FIGS. 14A-14B show plasma concentration of hFIX in rabbits after AAV administration.
- Human FIX levels between groups were compared using a 2-tailed Mann-Whitney test. No significant differences were observed. Animals 5 and 15 in the low dose cohorts were excluded from the analysis due to misinjection. Animals 9 and 10 were also excluded from the graph as they developed neutralizing antibodies against human FIX.
- FIGS. 15A-15B show a time course of antibody formation to human FIX (anti-FIX).
- CpG reduced nucleic acid variants encoding FVIII distinct from wild-type nucleic acid that encode FVIII.
- Such CpG reduced nucleic acid variants encoding FVIII can be expressed at increased levels in cells and/or animals, which in turn can provide increased FVIII protein levels in vivo.
- CpG reduced nucleic acid variant encoding FVIII that can provide for greater biological activity in vitro and/or in vivo.
- Exemplary CpG reduced nucleic acid variant encoding FVIII can exhibit one or more of the following: 1) increased expression in cells and/or animals; 2) increased activity; and 3) a therapeutic effect at lower AAV doses than wild-type hFVIII.
- polynucleotide and “nucleic acid” are used interchangeably herein to refer to all forms of nucleic acid, oligonucleotides, including deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).
- Polynucleotides include genomic DNA, cDNA and antisense DNA, and spliced or unspliced mRNA, rRNA tRNA and inhibitory DNA or RNA (RNAi, e.g., small or short hairpin (sh)RNA, microRNA (miRNA), small or short interfering (si)RNA, trans-splicing RNA, or antisense RNA).
- RNAi e.g., small or short hairpin (sh)RNA, microRNA (miRNA), small or short interfering (si)RNA, trans-splicing RNA, or antisense RNA.
- Polynucleotides include naturally occurring, synthetic, and intentionally modified or altered polynucleotides (e.g., variant nucleic acid). Polynucleotides can be single, double, or triplex, linear or circular, and can be of any length. In discussing polynucleotides, a sequence or structure of a particular polynucleotide may be described herein according to the convention of providing the sequence in the 5′ to 3′ direction.
- modify or “variant” and grammatical variations thereof, mean that a nucleic acid, polypeptide or subsequence thereof deviates from a reference sequence. Modified and variant sequences may therefore have substantially the same, greater or less expression, activity or function than a reference sequence, but at least retain partial activity or function of the reference sequence.
- a particular example of a modification or variant is a CpG reduced nucleic acid variant encoding FVIII.
- nucleic acid or polynucleotide variant refers to a modified sequence which has been genetically altered compared to wild-type.
- the sequence may be genetically modified without altering the encoded protein sequence.
- the sequence may be genetically modified to encode a variant protein.
- a nucleic acid or polynucleotide variant can also refer to a combination sequence which has been codon modified to encode a protein that still retains at least partial sequence identity to a reference sequence, such as wild-type protein sequence, and also has been codon-modified to encode a variant protein.
- codons of such a nucleic acid variant will be changed without altering the amino acids of the protein (FVIII) encoded thereby, and some codons of the nucleic acid variant will be changed which in turn changes the amino acids of the protein (FVIII) encoded thereby.
- variant Factor VIII refers to a modified FVIII which has been genetically altered as compared to unmodified wild-type FVIII (e.g., SEQ ID NO: 19) or FVIII-BDD. Such a variant can be referred to as a “nucleic acid variant encoding Factor VIII (FVIII).”
- a particular example of a variant is a CpG reduced nucleic acid encoding FVIII or FVIII-BDD protein.
- variant need not appear in each instance of a reference made to CpG reduced nucleic acid encoding FVIII.
- the term “CpG reduced nucleic acid” or the like may omit the term “variant” but it is intended that reference to “CpG reduced nucleic acid” includes variants at the genetic level.
- FVIII constructs having reduced CpG content can exhibit improvements compared to wild-type FVIII or FVIII-BDD in which CpG content has not been reduced, and do so without modifications to the nucleic acid that result in amino acid changes to the encoded FVIII or FVIII-BDD protein.
- the CpG reduced nucleic acid encodes a FVIII protein that retains the B-domain, it is appropriate to compare it to wild-type FVIII expression; and if the CpG reduced nucleic acid encodes a FVIII protein without a B-domain, it is compared to expression of wild-type FVIII that also has a B-domain deletion.
- a “variant Factor VIII (FVIII)” can also mean a modified FVIII protein such that the modified protein has an amino acid alteration compared to wild-type FVIII. Again, when comparing activity and/or stability, if the encoded variant FVIII protein retains the B-domain, it is appropriate to compare it to wild-type FVIII; and if the encoded variant FVIII protein has a B-domain deletion, it is compared to wild-type FVIII that also has a B-domain deletion.
- a variant FVIII can include a portion of the B-domain.
- FVIII-BDD includes a portion of the B-domain.
- most of the B-domain is deleted.
- a variant FVIII can include an “SQ” sequence set forth as SFSQNPPVLKRHQR (SEQ ID NO:29).
- SQ SFSQNPPVLKRHQR
- SEQ ID NO:29 a variant FVIII with an SQ (FVIII/SQ) has a BDD, e.g., at least all or a part of BD is deleted.
- Variant FVIII, such as FVIII-BDD can have all or a part of the “SQ” sequence, i.e. all or a part of SEQ ID NO:29.
- a variant FVIII-BDD with an SQ sequence (SFSQNPPVLKRHQR, SEQ ID NO:29) can have all or just a portion of the amino acid sequence SFSQNPPVLKRHQR.
- FVIII-BDD can have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or 13 amino acid residues of SFSQNPPVLKRHQR included.
- SFSQNPPVLKRHQR with 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or 13 internal deletions as well as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or 13 amino- or carboxy terminal deletions are included in the variant FVIII proteins set forth herein.
- polypeptides “proteins” and “peptides” encoded by the “nucleic acid” or “polynucleotide” sequences,” include full-length native (FVIII) sequences, as with naturally occurring wild-type proteins, as well as functional subsequences, modified forms or sequence variants so long as the subsequence, modified form or variant retain some degree of functionality of the native full-length protein.
- FVIII native genome sequence
- a CpG reduced nucleic acid encoding FVIII protein can have a B-domain deletion as set forth herein and retain clotting function.
- polypeptides, proteins and peptides encoded by the nucleic acid sequences can be but are not required to be identical to the endogenous protein that is defective, or whose expression is insufficient, or deficient in the treated mammal.
- Non-limiting examples of modifications include one or more nucleotide or amino acid substitutions (e.g., 1-3, 3-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-40, 40-50, 50-100, 100-150, 150-200, 200-250, 250-500, 500-750, 750-850 or more nucleotides or residues).
- An example of a nucleic acid modification is CpG reduction.
- a CpG reduced nucleic acid encoding FVIII such as human FVIII protein, has 10 or fewer CpGs compared to wild-type sequence encoding human Factor FVIII; or has 5 or fewer CpGs compared to wild-type sequence encoding human Factor FVIII; or has no more than 5 CpGs in the CpG reduced nucleic acid encoding FVIII.
- amino acid modification is a conservative amino acid substitution or a deletion (e.g., subsequences or fragments) of a reference sequence, e.g. FVIII, such as FVIII with a B-domain deletion.
- a modified or variant sequence retains at least part of a function or activity of unmodified sequence.
- nucleic acid encoding proteins including other mammalian forms of the CpG reduced nucleic acid encoding FVIII and FVIII proteins disclosed herein are expressly included, either known or unknown.
- the invention includes genes and proteins from non-mammals, mammals other than humans, and humans, which genes and proteins function in a substantially similar manner to the FVIII (e.g., human) genes and proteins described herein.
- vector refers to small carrier nucleic acid molecule, a plasmid, virus (e.g., AAV vector), or other vehicle that can be manipulated by insertion or incorporation of a nucleic acid.
- vectors can be used for genetic manipulation (i.e., “cloning vectors”), to introduce/transfer polynucleotides into cells, and to transcribe or translate the inserted polynucleotide in cells.
- expression vector is a specialized vector that contains a gene or nucleic acid sequence with the necessary regulatory regions needed for expression in a host cell.
- a vector nucleic acid sequence generally contains at least an origin of replication for propagation in a cell and optionally additional elements, such as a heterologous polynucleotide sequence, expression control element (e.g., a promoter, enhancer), intron, ITR(s), selectable marker (e.g., antibiotic resistance), polyadenylation signal.
- expression control element e.g., a promoter, enhancer
- intron e.g., ITR(s)
- selectable marker e.g., antibiotic resistance
- a viral vector is derived from or based upon one or more nucleic acid elements that comprise a viral genome.
- Particular viral vectors include lentivirus, pseudo-typed lentivirus and parvo-virus vectors, such as adeno-associated virus (AAV) vectors.
- vectors comprising a CpG reduced nucleic acid encoding FVIII.
- recombinant as a modifier of vector, such as recombinant viral, e.g., lenti- or parvo-virus (e.g., AAV) vectors, as well as a modifier of sequences such as recombinant polynucleotides and polypeptides, means that the compositions have been manipulated (i.e., engineered) in a fashion that generally does not occur in nature.
- a recombinant vector such as an AAV vector would be where a polynucleotide that is not normally present in the wild-type viral (e.g., AAV) genome is inserted within the viral genome.
- a recombinant polynucleotide would be where a CpG reduced nucleic acid encoding a FVIII protein is cloned into a vector, with or without 5′, 3′ and/or intron regions that the gene is normally associated within the viral (e.g., AAV) genome.
- a vector such as viral and AAV vectors, as well as sequences such as polynucleotides, recombinant forms including polynucleotides, are expressly included in spite of any such omission.
- a recombinant viral “vector” or “AAV vector” is derived from the wild type genome of a virus, such as AAV by using molecular methods to remove the wild type genome from the virus (e.g., AAV), and replacing with a non-native nucleic acid, such as a CpG reduced nucleic acid encoding FVIII.
- a virus such as AAV
- ITR inverted terminal repeat
- a “recombinant” viral vector e.g., AAV
- AAV is distinguished from a viral (e.g., AAV) genome, since all or a part of the viral genome has been replaced with a non-native sequence with respect to the viral (e.g., AAV) genomic nucleic acid such as a CpG reduced nucleic acid encoding FVIII. Incorporation of a non-native sequence therefore defines the viral vector (e.g., AAV) as a “recombinant” vector, which in the case of AAV can be referred to as a “rAAV vector.”
- a recombinant vector (e.g., lenti-, parvo-, AAV) sequence can be packaged-referred to herein as a “particle” for subsequent infection (transduction) of a cell, ex vivo, in vitro or in vivo.
- a recombinant vector sequence is encapsidated or packaged into an AAV particle
- the particle can also be referred to as a “rAAV.”
- Such particles include proteins that encapsidate or package the vector genome. Particular examples include viral envelope proteins, and in the case of AAV, capsid proteins.
- a vector “genome” refers to the portion of the recombinant plasmid sequence that is ultimately packaged or encapsidated to form a viral (e.g., AAV) particle.
- the vector genome does not include the portion of the “plasmid” that does not correspond to the vector genome sequence of the recombinant plasmid.
- plasmid backbone This non vector genome portion of the recombinant plasmid is referred to as the “plasmid backbone,” which is important for cloning and amplification of the plasmid, a process that is needed for propagation and recombinant virus production, but is not itself packaged or encapsidated into virus (e.g., AAV) particles.
- a vector “genome” refers to the nucleic acid that is packaged or encapsidated by virus (e.g., AAV).
- transgene is used herein to conveniently refer to a nucleic acid that is intended or has been introduced into a cell or organism.
- Transgenes include any nucleic acid, such as a gene that encodes a polypeptide or protein (e.g., a CpG reduced nucleic acid encoding Factor VIII).
- transgene In a cell having a transgene, the transgene has been introduced/transferred by way of vector, such as AAV, “transduction” or “transfection” of the cell.
- vector such as AAV
- transduction or “transfection” of the cell.
- transduce and “transfect” refer to introduction of a molecule such as a nucleic acid into a cell or host organism.
- the transgene may or may not be integrated into genomic nucleic acid of the recipient cell. If an introduced nucleic acid becomes integrated into the nucleic acid (genomic DNA) of the recipient cell or organism it can be stably maintained in that cell or organism and further passed on to or inherited by progeny cells or organisms of the recipient cell or organism. Finally, the introduced nucleic acid may exist in the recipient cell or host organism extrachromosomally, or only transiently.
- a “transduced cell” is a cell into which the transgene has been introduced.
- a “transduced” cell e.g., in a mammal, such as a cell or tissue or organ cell
- a “transduced” cell means a genetic change in a cell following incorporation of an exogenous molecule, for example, a nucleic acid (e.g., a transgene) into the cell.
- a “transduced” cell is a cell into which, or a progeny thereof in which an exogenous nucleic acid has been introduced.
- the cell(s) can be propagated and the introduced protein expressed, or nucleic acid transcribed.
- a transduced cell can be in a subject.
- an “expression control element” refers to nucleic acid sequence(s) that influence expression of an operably linked nucleic acid.
- Control elements including expression control elements as set forth herein such as promoters and enhancers
- Vector sequences including AAV vectors can include one or more “expression control elements.”
- expression control elements are included to facilitate proper heterologous polynucleotide transcription and if appropriate translation (e.g., a promoter, enhancer, splicing signal for introns, maintenance of the correct reading frame of the gene to permit in-frame translation of mRNA and, stop codons etc.).
- Such elements typically act in cis, referred to as a “cis acting” element, but may also act in trans.
- Expression control can be at the level of transcription, translation, splicing, message stability, etc.
- an expression control element that modulates transcription is juxtaposed near the 5′ end (i.e., “upstream”) of a transcribed nucleic acid.
- Expression control elements can also be located at the 3′ end (i.e., “downstream”) of the transcribed sequence or within the transcript (e.g., in an intron).
- Expression control elements can be located adjacent to or at a distance away from the transcribed sequence (e.g., 1-10, 10-25, 25-50, 50-100, 100 to 500, or more nucleotides from the polynucleotide), even at considerable distances. Nevertheless, owing to the length limitations of certain vectors, such as AAV vectors, expression control elements will typically be within 1 to 1000 nucleotides from the transcribed nucleic acid.
- expression of operably linked nucleic acid is at least in part controllable by the element (e.g., promoter) such that the element modulates transcription of the nucleic acid and, as appropriate, translation of the transcript.
- the element e.g., promoter
- a specific example of an expression control element is a promoter, which is usually located 5′ of the transcribed sequence e.g., a CpG reduced nucleic acid encoding FVIII.
- a promoter typically increases an amount expressed from operably linked nucleic acid as compared to an amount expressed when no promoter exists.
- Enhancer elements can refer to a sequence that is located adjacent to the heterologous polynucleotide. Enhancer elements are typically located upstream of a promoter element but also function and can be located downstream of or within a sequence (e.g., a CpG reduced nucleic acid encoding FVIII). Hence, an enhancer element can be located 100 base pairs, 200 base pairs, or 300 or more base pairs upstream or downstream of a CpG reduced nucleic acid encoding FVIII. Enhancer elements typically increase expressed of an operably linked nucleic acid above expression afforded by a promoter element.
- An expression construct may comprise regulatory elements which serve to drive expression in a particular cell or tissue type.
- Expression control elements e.g., promoters
- Tissue-specific expression control elements include those active in a particular tissue or cell type, referred to herein as a “tissue-specific expression control elements/promoters.”
- Tissue-specific expression control elements are typically active in specific cell or tissue (e.g., liver).
- Expression control elements are typically active in particular cells, tissues or organs because they are recognized by transcriptional activator proteins, or other regulators of transcription, that are unique to a specific cell, tissue or organ type.
- Such regulatory elements are known to those of skill in the art (see, e.g., Sambrook et al. (1989) and Ausubel et al. (1992)).
- tissue specific regulatory elements in the expression constructs of the invention provides for at least partial tissue tropism for the expression of a CpG reduced nucleic acid encoding FVIII.
- promoters that are active in liver are the TTR promoter, human alpha 1-antitrypsin (hAAT) promoter; albumin, Miyatake, et al. J. Virol., 71:5124-32 (1997); hepatitis B virus core promoter, Sandig, et al., Gene Ther. 3:1002-9 (1996); alpha-fetoprotein (AFP), Arbuthnot, et al., Hum. Gene. Ther., 7:1503-14 (1996)], among others.
- An example of an enhancer active in liver is apolipoprotein E (apoE) HCR-1 and HCR-2 (Allan et al., J. Biol. Chem., 272:29113-19 (1997)).
- apoE apolipoprotein E
- Expression control elements also include ubiquitous or promiscuous promoters/enhancers which are capable of driving expression of a polynucleotide in many different cell types.
- Such elements include, but are not limited to the cytomegalovirus (CMV) immediate early promoter/enhancer sequences, the Rous sarcoma virus (RSV) promoter/enhancer sequences and the other viral promoters/enhancers active in a variety of mammalian cell types, or synthetic elements that are not present in nature (see, e.g., Boshart et al, Cell, 41:521-530 (1985)), the SV40 promoter, the dihydrofolate reductase promoter, the cytoplasmic 0-actin promoter and the phosphoglycerol kinase (PGK) promoter.
- CMV cytomegalovirus
- RSV Rous sarcoma virus
- PGK phosphoglycerol kinase
- Expression control elements also can confer expression in a manner that is regulatable, that is, a signal or stimuli increases or decreases expression of the operably linked heterologous polynucleotide.
- a regulatable element that increases expression of the operably linked polynucleotide in response to a signal or stimuli is also referred to as an “inducible element” (i.e., is induced by a signal).
- an inducible element i.e., is induced by a signal.
- Particular examples include, but are not limited to, a hormone (e.g., steroid) inducible promoter.
- the amount of increase or decrease conferred by such elements is proportional to the amount of signal or stimuli present; the greater the amount of signal or stimuli, the greater the increase or decrease in expression.
- MT zinc-inducible sheep metallothionine
- MMTV mouse mammary tumor virus
- T7 polymerase promoter system WO 98/10088
- the tetracycline-repressible system Gossen, et al., Proc. Natl. Acad. Sci . USA, 89:5547-5551 (1992)
- the tetracycline-inducible system Gossen, et al., Science. 268:1766-1769 (1995); see also Harvey, et al., Curr. Opin. Chem. Biol.
- Expression control elements also include the native elements(s) for the heterologous polynucleotide.
- a native control element e.g., promoter
- the native element may be used when expression of the heterologous polynucleotide is to be regulated temporally or developmentally, or in a tissue-specific manner, or in response to specific transcriptional stimuli.
- Other native expression control elements such as introns, polyadenylation sites or Kozak consensus sequences may also be used.
- operably linked means that the regulatory sequences necessary for expression of a coding sequence are placed in the appropriate positions relative to the coding sequence so as to effect expression of the coding sequence.
- This same definition is sometimes applied to the arrangement of coding sequences and transcription control elements (e.g. promoters, enhancers, and termination elements) in an expression vector.
- This definition is also sometimes applied to the arrangement of nucleic acid sequences of a first and a second nucleic acid molecule wherein a hybrid nucleic acid molecule is generated.
- the relationship is such that the control element modulates expression of the nucleic acid.
- two DNA sequences operably linked means that the two DNAs are arranged (cis or trans) in such a relationship that at least one of the DNA sequences is able to exert a physiological effect upon the other sequence.
- additional elements for vectors include, without limitation, an expression control (e.g., promoter/enhancer) element, a transcription termination signal or stop codon, 5′ or 3′ untranslated regions (e.g., polyadenylation (polyA) sequences) which flank a sequence, such as one or more copies of an AAV ITR sequence, or an intron.
- an expression control e.g., promoter/enhancer
- a transcription termination signal or stop codon e.g., a transcription termination signal or stop codon
- 5′ or 3′ untranslated regions e.g., polyadenylation (polyA) sequences
- polyA polyadenylation
- Further elements include, for example, filler or stuffer polynucleotide sequences, for example to improve packaging and reduce the presence of contaminating nucleic acid.
- AAV vectors typically accept inserts of DNA having a size range which is generally about 4 kb to about 5.2 kb, or slightly more. Thus, for shorter sequences, inclusion of a stuffer or filler in order to adjust the length to near or at the normal size of the virus genomic sequence acceptable for AAV vector packaging into virus particle.
- a filler/stuffer nucleic acid sequence is an untranslated (non-protein encoding) segment of nucleic acid.
- the filler or stuffer polynucleotide sequence has a length that when combined (e.g., inserted into a vector) with the sequence has a total length between about 3.0-5.5 Kb, or between about 4.0-5.0 Kb, or between about 4.3-4.8 Kb.
- An intron can also function as a filler or stuffer polynucleotide sequence in order to achieve a length for AAV vector packaging into a virus particle.
- Introns and intron fragments that function as a filler or stuffer polynucleotide sequence also can enhance expression.
- hemophilia related disorder refers to bleeding disorders such as hemophilia A, hemophilia A patients with inhibitory antibodies, deficiencies in coagulation Factors, VII, VIII, IX and X, XI, V, XII, II, von Willebrand factor, combined FV/FVIII deficiency, vitamin K epoxide reductase C1 deficiency, gamma-carboxylase deficiency; bleeding associated with trauma, injury, thrombosis, thrombocytopenia, stroke, coagulopathy, disseminated intravascular coagulation (DIC); over-anticoagulation associated with heparin, low molecular weight heparin, pentasaccharide, warfarin, small molecule antithrombotics (i.e. FXa inhibitors); and platelet disorders such as, Bernard Soulier syndrome, Glanzman thromblastemia, and storage pool deficiency.
- isolated when used as a modifier of a composition, means that the compositions are made by the hand of man or are separated, completely or at least in part, from their naturally occurring in vivo environment. Generally, isolated compositions are substantially free of one or more materials with which they normally associate with in nature, for example, one or more protein, nucleic acid, lipid, carbohydrate, cell membrane.
- the term “isolated” refers to a nucleic acid molecule that is separated from one or more sequences with which it is immediately contiguous (in the 5′ and 3′ directions) in the naturally occurring genome (genomic DNA) of the organism from which it originates.
- the “isolated nucleic acid” may comprise a DNA or cDNA molecule inserted into a vector, such as a plasmid or virus vector, or integrated into the DNA of a prokaryote or eukaryote.
- RNA molecules of the invention primarily refers to an RNA molecule encoded by an isolated DNA molecule as defined above.
- the term may refer to an RNA molecule that has been sufficiently separated from RNA molecules with which it would be associated in its natural state (i.e., in cells or tissues), such that it exists in a “substantially pure” form (the term “substantially pure” is defined below).
- isolated protein or “isolated and purified protein” is sometimes used herein. This term refers primarily to a protein produced by expression of an isolated nucleic acid molecule. Alternatively, this term may refer to a protein which has been sufficiently separated from other proteins with which it would naturally be associated, so as to exist in “substantially pure” form.
- isolated does not exclude combinations produced by the hand of man, for example, a recombinant vector (e.g., rAAV) sequence, or virus particle that packages or encapsidates a vector genome and a pharmaceutical formulation.
- a recombinant vector e.g., rAAV
- virus particle that packages or encapsidates a vector genome and a pharmaceutical formulation.
- isolated also does not exclude alternative physical forms of the composition, such as hybrids/chimeras, multimers/oligomers, modifications (e.g., phosphorylation, glycosylation, lipidation) or derivatized forms, or forms expressed in host cells produced by the hand of man.
- substantially pure refers to a preparation comprising at least 50-60% by weight the compound of interest (e.g., nucleic acid, oligonucleotide, protein, etc.).
- the preparation can comprise at least 75% by weight, or about 90-99% by weight, of the compound of interest. Purity is measured by methods appropriate for the compound of interest (e.g. chromatographic methods, agarose or polyacrylamide gel electrophoresis, HPLC analysis, and the like).
- phrases “consisting essentially of” when referring to a particular nucleotide sequence or amino acid sequence means a sequence having the properties of a given SEQ ID NO.
- the phrase when used in reference to an amino acid sequence, the phrase includes the sequence per se and molecular modifications that would not affect the basic and novel characteristics of the sequence.
- oligonucleotide refers to primers and probes, and is defined as a nucleic acid molecule comprised of two or more ribo- or deoxyribonucleotides, such as more than three. The exact size of the oligonucleotide will depend on various factors and on the particular application for which the oligonucleotide is used.
- probe refers to an oligonucleotide, polynucleotide or nucleic acid, either RNA or DNA, whether occurring naturally as in a purified restriction enzyme digest or produced synthetically, which is capable of annealing with or specifically hybridizing to a nucleic acid with sequences complementary to the probe.
- a probe may be either single-stranded or double-stranded. The exact length of the probe will depend upon many factors, including temperature, source of probe and method of use. For example, for diagnostic applications, depending on the complexity of the target sequence, the oligonucleotide probe typically contains 15-25 or more nucleotides, although it may contain fewer nucleotides.
- the probes herein are selected to be “substantially” complementary to different strands of a particular target nucleic acid sequence. This means that the probes must be sufficiently complementary so as to be able to “specifically hybridize” or anneal with their respective target strands under a set of pre-determined conditions. Therefore, the probe sequence need not reflect the exact complementary sequence of the target. For example, a non-complementary nucleotide fragment may be attached to the 5′ or 3′ end of the probe, with the remainder of the probe sequence being complementary to the target strand. Alternatively, non-complementary bases or longer sequences can be interspersed into the probe, provided that the probe sequence has sufficient complementarity with the sequence of the target nucleic acid to anneal therewith specifically.
- the term “specifically hybridize” refers to the association between two single-stranded nucleic acid molecules of sufficiently complementary sequence to permit such hybridization under pre-determined conditions generally used in the art (sometimes termed “substantially complementary”).
- the term refers to hybridization of an oligonucleotide with a substantially complementary sequence contained within a single-stranded DNA or RNA molecule of the invention, to the substantial exclusion of hybridization of the oligonucleotide with single-stranded nucleic acids of non-complementary sequence.
- primer refers to an oligonucleotide, either RNA or DNA, either single-stranded or double-stranded, either derived from a biological system, generated by restriction enzyme digestion, or produced synthetically which, when placed in the proper environment, is able to act functionally as an initiator of template-dependent nucleic acid synthesis.
- suitable nucleoside triphosphate precursors of nucleic acids, a polymerase enzyme, suitable cofactors and conditions such as a suitable temperature and pH
- the primer may be extended at its 3′ terminus by the addition of nucleotides by the action of a polymerase or similar activity to yield a primer extension product.
- the primer may vary in length depending on the particular conditions and requirements of the application.
- the oligonucleotide primer is typically 15-25 or more nucleotides in length.
- the primer must be of sufficient complementarity to the desired template to prime the synthesis of the desired extension product, that is, to be able to anneal with the desired template strand in a manner sufficient to provide the 3′ hydroxyl moiety of the primer in appropriate juxtaposition for use in the initiation of synthesis by a polymerase or similar enzyme. It is not required that the primer sequence represent an exact complement of the desired template.
- a non-complementary nucleotide sequence may be attached to the 5′ end of an otherwise complementary primer.
- non-complementary bases may be interspersed within the oligonucleotide primer sequence, provided that the primer sequence has sufficient complementarity with the sequence of the desired template strand to functionally provide a template-primer complex for the synthesis of the extension product.
- identity means that two or more referenced entities are the same, when they are “aligned” sequences.
- two polypeptide sequences are identical, they have the same amino acid sequence, at least within the referenced region or portion.
- two polynucleotide sequences are identical, they have the same polynucleotide sequence, at least within the referenced region or portion.
- the identity can be over a defined area (region or domain) of the sequence.
- An “area” or “region” of identity refers to a portion of two or more referenced entities that are the same.
- an “aligned” sequence refers to multiple polynucleotide or protein (amino acid) sequences, often containing corrections for missing or additional bases or amino acids (gaps) as compared to a reference sequence.
- the identity can extend over the entire length or a portion of the sequence.
- the length of the sequence sharing the percent identity is 2, 3, 4, 5 or more contiguous nucleic acids or amino acids, e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc. contiguous nucleic acids or amino acids.
- the length of the sequence sharing identity is 21 or more contiguous nucleic acids or amino acids, e.g., 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, etc. contiguous nucleic acids or amino acids.
- the length of the sequence sharing identity is 41 or more contiguous nucleic acids or amino acids, e.g.
- the length of the sequence sharing identity is 50 or more contiguous nucleic acids or amino acids, e.g., 50-55, 55-60, 60-65, 65-70, 70-75, 75-80, 80-85, 85-90, 90-95, 95-100, 100-150, 150-200, 200-250, 250-300, 300-500, 500-1,000, etc. contiguous nucleic acids or amino acids.
- CpG reduced nucleic acid variants encoding FVIII will be distinct from wild-type but may exhibit sequence identity with wild-type FVIII protein with, or without B-domain.
- a CpG reduced nucleic acid encoding FVIII at the nucleotide sequence level, a CpG reduced nucleic acid encoding FVIII will typically be at least about 70% identical, more typically about 75% identical, even more typically about 80%-85% identical to wild-type FVIII encoding nucleic acid.
- a CpG reduced nucleic acid encoding FVIII may have 75%-85% identity to wild-type FVIII encoding gene, or to each other, i.e., X01 vs. X02, X03 vs. X04, etc. as set forth herein.
- a variant such as a variant FVIII protein will be at least about 70% identical, more typically about 75% identical, or 80% identical, even more typically about 85 identity, or 90% or more identity.
- a variant such as a variant FVIII protein has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity to a reference sequence, e.g. wild-type FVIII protein with or without B-domain.
- FVIII CpG reduced nucleic acid encoding FVIII
- FVIII CpG reduced nucleic acid encoding FVIII
- homology means that two or more referenced entities share at least partial identity over a given region or portion.
- Areas, regions or domains of homology or identity mean that a portion of two or more referenced entities share homology or are the same. Thus, where two sequences are identical over one or more sequence regions they share identity in these regions.
- Substantial homology means that a molecule is structurally or functionally conserved such that it has or is predicted to have at least partial structure or function of one or more of the structures or functions (e.g., a biological function or activity) of the reference molecule, or relevant/corresponding region or portion of the reference molecule to which it shares homology.
- the extent of identity (homology) or “percent identity” between two sequences can be ascertained using a computer program and/or mathematical algorithm.
- comparisons of nucleic acid sequences are performed using the GCG Wisconsin Package version 9.1, available from the Genetics Computer Group in Madison, Wis.
- the Blastn 2.0 program provided by the National Center for Biotechnology Information (found on the world wide web at ncbi.nlm.nih.gov/blast/; Altschul et al., 1990 , J Mol Biol 215:403-410) using a gapped alignment with default parameters, may be used to determine the level of identity and similarity between nucleic acid sequences and amino acid sequences.
- a BLASTP algorithm is typically used in combination with a scoring matrix, such as PAM100, PAM 250, BLOSUM 62 or BLOSUM 50.
- FASTA e.g., FASTA2 and FASTA3
- SSEARCH sequence comparison programs are also used to quantitate extent of identity (Pearson et al., Proc. Natl. Acad. Sci . USA 85:2444 (1988); Pearson, Methods Mol Biol. 132:185 (2000); and Smith et al., J. Mol. Biol. 147:195 (1981)).
- Programs for quantitating protein structural similarity using Delaunay-based topological mapping have also been developed (Bostick et al., Biochem Biophys Res Commun. 304:320 (2003)).
- Nucleic acid molecules, expression vectors (e.g., vector genomes), plasmids, including CpG reduced nucleic acid variants encoding FVIII of the invention may be prepared by using recombinant DNA technology methods.
- the availability of nucleotide sequence information enables preparation of isolated nucleic acid molecules of the invention by a variety of means.
- CpG reduced nucleic acid variants encoding FVIII can be made using various standard cloning, recombinant DNA technology, via cell expression or in vitro translation and chemical synthesis techniques. Purity of polynucleotides can be determined through sequencing, gel electrophoresis and the like.
- nucleic acids can be isolated using hybridization or computer-based database screening techniques.
- Such techniques include, but are not limited to: (1) hybridization of genomic DNA or cDNA libraries with probes to detect homologous nucleotide sequences; (2) antibody screening to detect polypeptides having shared structural features, for example, using an expression library; (3) polymerase chain reaction (PCR) on genomic DNA or cDNA using primers capable of annealing to a nucleic acid sequence of interest; (4) computer searches of sequence databases for related sequences; and (5) differential screening of a subtracted nucleic acid library.
- PCR polymerase chain reaction
- Nucleic acids of the invention may be maintained as DNA in any convenient cloning vector.
- clones are maintained in a plasmid cloning/expression vector, such as pBluescript (Stratagene, La Jolla, Calif.), which is propagated in a suitable E. coli host cell.
- nucleic acids may be maintained in vector suitable for expression in mammalian cells. In cases where post-translational modification affects coagulation function, nucleic acid molecule can be expressed in mammalian cells.
- CpG reduced nucleic acid variants encoding FVIII of the invention include cDNA, genomic DNA, RNA, and fragments thereof which may be single- or double-stranded.
- this invention provides oligonucleotides (sense or antisense strands of DNA or RNA) having sequences capable of hybridizing with at least one sequence of a nucleic acid of the invention. Such oligonucleotides are useful as probes for detecting FVIII expression.
- a B-domain deleted, CpG reduced nucleic acid variant encoding FVIII of the invention may be prepared in a variety of ways, according to known methods.
- the protein may be purified from appropriate sources, e.g., transformed bacterial or animal cultured cells or tissues which express engineered FVIII by immune-affinity purification.
- CpG reduced nucleic acid variants encoding FVIII enables production of FVIII using in vitro expression methods known in the art.
- a cDNA or gene may be cloned into an appropriate in vitro transcription vector, such as pSP64 or pSP65 for in vitro transcription, followed by cell-free translation in a suitable cell-free translation system, such as wheat germ or rabbit reticulocyte lysates.
- in vitro transcription and translation systems are commercially available, e.g., from Promega Biotech, Madison, Wis. or BRL, Rockville, Md.
- larger quantities of FVIII may be produced by expression in a suitable prokaryotic or eukaryotic expression system.
- a CpG reduced nucleic acid variant encoding FVIII for example, may be inserted into a plasmid vector adapted for expression in a bacterial cell, such as E. coli or a mammalian cell line such as baby hamster kidney (BHK), CHO or Hela cells.
- a plasmid vector adapted for expression in a bacterial cell, such as E. coli or a mammalian cell line such as baby hamster kidney (BHK), CHO or Hela cells.
- BHK baby hamster kidney
- Hela cells such as baby hamster kidney (BHK), CHO or Hela cells.
- tagged fusion proteins comprising FVIII can be generated.
- Such FVIII-tagged fusion proteins are encoded by part or all of a DNA molecule, ligated in the correct codon reading frame to a nucleotide sequence encoding a portion or all of a desired polypeptide tag which is inserted into a plasmid vector adapted for expression in a bacterial cell, such as E. coli or a eukaryotic cell, such as, but not limited to, yeast and mammalian cells.
- Vectors such as those described herein optionally comprise regulatory elements necessary for expression of the DNA in the host cell positioned in such a manner as to permit expression of the encoded protein in the host cell.
- regulatory elements required for expression include, but are not limited to, promoter sequences, enhancer sequences and transcription initiation sequences as set forth herein and known to the skilled artisan.
- a FVIII encoded by a CpG reduced nucleic acid variant, produced by gene expression in a recombinant prokaryotic or eukaryotic system may be purified according to methods known in the art.
- a commercially available expression/secretion system can be used, whereby the recombinant protein is expressed and thereafter secreted from the host cell, to be easily purified from the surrounding medium.
- an alternative approach involves purifying the recombinant protein by affinity separation, such as by immunological interaction with antibodies that bind specifically to the recombinant protein or nickel columns for isolation of recombinant proteins tagged with 6-8 histidine residues at their N-terminus or C-terminus.
- Alternative tags may comprise the FLAG epitope, GST or the hemagglutinin epitope. Such methods are commonly used by skilled practitioners.
- FVIII proteins prepared by the aforementioned methods, may be analyzed according to standard procedures. For example, such proteins may be assessed for altered coagulation properties according to known methods.
- the invention also provides methods of making a polypeptide (as disclosed), the method including expression from nucleic acid encoding the polypeptide (generally nucleic acid). This may conveniently be achieved by culturing a host cell, containing such a vector, under appropriate conditions which cause or allow production of the polypeptide. Polypeptides may also be produced in in vitro systems.
- Methods and uses of the invention of the invention include delivering (transducing) nucleic acid (transgene) into host cells, including dividing and/or non-dividing cells.
- the nucleic acids, recombinant vector (e.g., rAAV), methods, uses and pharmaceutical formulations of the invention are additionally useful in a method of delivering, administering or providing a protein to a subject in need thereof, as a method of treatment.
- the nucleic acid is transcribed and the protein may be produced in vivo in a subject.
- the subject may benefit from or be in need of the protein because the subject has a deficiency of the protein, or because production of the protein in the subject may impart some therapeutic effect, as a method of treatment or otherwise.
- Vectors including lenti- or parvo-virus vector (e.g., AAV) sequences, recombinant virus particles, methods and uses may be used to deliver a CpG reduced nucleic acid variant encoding FVIII with a biological effect to treat or ameliorate one or more symptoms associated with a FVIII deficiency or abnormality.
- Recombinant lenti- or parvo-virus vector (e.g., AAV) sequences, plasmids, recombinant virus particles, methods and uses may be used to provide therapy for various disease states involving or due to a FVIII deficiency or abnormality.
- Invention nucleic acids, vectors, expression vectors (e.g., rAAV), and recombinant virus particles, methods and uses permit the treatment of genetic diseases, e.g., a FVIII deficiency.
- genetic diseases e.g., a FVIII deficiency.
- gene transfer can be used to bring a normal gene into affected tissues for replacement therapy, as well as to create animal models for the disease using antisense mutations.
- gene transfer could be used to create a disease state in a model system, which could then be used in efforts to counteract the disease state.
- the use of site-specific integration of nucleic acid sequences to correct defects is also possible.
- CpG reduced nucleic acid variants encoding FVIII may be used, for example, as therapeutic and/or prophylactic agents (protein or nucleic acid) which modulate the blood coagulation cascade or as a transgene in gene.
- CpG reduced nucleic acid variants encoding FVIII may have similar coagulation activity as wild-type FVIII, or altered coagulation activity compared to wild-type FVII.
- Cell-based strategies allow continuous expression of CpG reduced nucleic acid variants encoding FVIII in hemophilia A patients.
- certain modifications of FVIII molecules result in increased expression at the nucleic acid level, increased coagulation activity thereby effectively improving hemostasis.
- CpG reduced nucleic acid variants encoding FVIII may be used for a variety of purposes in accordance with the invention.
- a nucleic acid delivery vehicle i.e., an expression vector
- the expression vector comprises a CpG reduced nucleic acid variants encoding FVIII as described herein.
- Administration of FVIII-encoding expression vectors to a patient results in the expression of FVIII protein which serves to alter the coagulation cascade.
- expression of CpG reduced nucleic acid variants encoding FVIII protein as described herein, or a functional fragment increases hemostasis.
- compositions and methods are provided for administration of a viral vector comprising a CpG reduced nucleic acid variant encoding FVIII.
- the expression vector comprising CpG reduced nucleic acid variant encoding FVIII is a viral vector.
- Expression vectors comprising CpG reduced nucleic acid variants encoding FVIII may be administered alone, or in combination with other molecules useful for modulating hemostasis.
- vectors, expression vectors or combination of therapeutic agents may be administered to the patient alone or in a pharmaceutically acceptable or biologically compatible compositions.
- Viral vectors such as lenti- and parvo-virus vectors, including AAV serotypes and variants thereof provide a means for delivery of nucleic acid into cells ex vivo, in vitro and in vivo, which encode proteins such that the cells express the encoded protein.
- AAV are viruses useful as gene therapy vectors as they can penetrate cells and introduce nucleic acid/genetic material so that the nucleic acid/genetic material may be stably maintained in cells. In addition, these viruses can introduce nucleic acid/genetic material into specific sites, for example. Because AAV are not associated with pathogenic disease in humans, AAV vectors are able to deliver heterologous polynucleotide sequences (e.g., therapeutic proteins and agents) to human patients without causing substantial AAV pathogenesis or disease.
- heterologous polynucleotide sequences e.g., therapeutic proteins and agents
- Viral vectors which may be used in the invention include, but are not limited to, adeno-associated virus (AAV) vectors of multiple serotypes (e.g., AAV-1 to AAV-12, and others) and hybrid/chimeric AAV vectors, lentivirus vectors and pseudo-typed lentivirus vectors (e.g., Ebola virus, vesicular stomatitis virus (VSV), and feline immunodeficiency virus (FIV)), herpes simplex virus vectors, adenoviral vectors (with or without tissue specific promoters/enhancers), vaccinia virus vectors, retroviral vectors, lentiviral vectors, non-viral vectors and others.
- AAV adeno-associated virus
- AAV adeno-associated virus
- VSV vesicular stomatitis virus
- FMV feline immunodeficiency virus
- herpes simplex virus vectors e.g., adenovi
- AAV and lentiviral particles may be used to advantage as vehicles for effective gene delivery.
- Such virions possess a number of desirable features for such applications, including tropism for dividing and non-dividing cells. Early clinical experience with these vectors also demonstrated no sustained toxicity and immune responses were minimal or undetectable.
- AAV are known to infect a wide variety of cell types in vivo and in vitro by receptor-mediated endocytosis or by transcytosis. These vector systems have been tested in humans targeting retinal epithelium, liver, skeletal muscle, airways, brain, joints and hematopoietic stem cells.
- Non-viral vectors for example, based on plasmid DNA or minicircles, are also suitable gene transfer vectors for a large gene as that encoding FVIII.
- AAV and lentiviral vectors and methods for producing these vectors have been described in detail in a number of references, patents, and patent applications, including: Wright J. F. (Hum Gene Ther 20:698-706, 2009) a technology used for the production of clinical grade vector at Children's Hospital of Philadelphia.
- Lentiviral vector can also be produced at CHOP and the other vectors are available through the Lentivirus vector production core laboratory by NHLBI Gene Therapy Resource Program (GTRP)—Lentivirus Vector Production Core Laboratory.
- GTRP NHLBI Gene Therapy Resource Program
- a vector includes a lenti- or parvo-viral vector, such as an adeno-viral vector.
- a recombinant vector is a parvovirus vector.
- Parvoviruses are small viruses with a single-stranded DNA genome.
- Adeno-associated viruses (AAV) are in the parvovirus family.
- the invention provides viral vectors that include CpG reduced nucleic acid variants encoding FVIII.
- a recombinant AAV vector can include CpG reduced nucleic acid variants encoding FVIII, where the encoded FVIII protein optionally has B-domain deletion.
- Vector delivery or administration to a subject therefore provides FVIII to a subject such as a mammal (e.g., human).
- AAV vectors and lentiviral vectors do not typically include viral genes associated with pathogenesis.
- Such vectors typically have one or more of the wild type AAV genes deleted in whole or in part, for example, rep and/or cap genes, but retain at least one functional flanking ITR sequence, as necessary for the rescue, replication, and packaging of the recombinant vector into an AAV vector particle.
- the essential parts of vector e.g., the ITR and LTR elements, respectively are included.
- An AAV vector genome would therefore include sequences required in cis for replication and packaging (e.g., functional ITR sequences)
- Recombinant AAV vector include any viral strain or serotype.
- a recombinant AAV vector can be based upon any AAV genome, such as AAV-1, -2, -3, -4, -5, -6, -7, -8, -9, -10, -11, -12, -rh74, -rh10 or AAV-2i8, for example.
- Such vectors can be based on the same strain or serotype (or subgroup or variant), or be different from each other.
- a recombinant AAV vector based upon one serotype genome can be identical to one or more of the capsid proteins that package the vector.
- a recombinant AAV vector genome can be based upon an AAV (e.g., AAV2) serotype genome distinct from one or more of the AAV capsid proteins that package the vector.
- AAV vector genome can be based upon AAV2, whereas at least one of the three capsid proteins could be a AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, Rh10, Rh74 or AAV-2i8 or variant thereof, for example.
- adeno-associated virus (AAV) vectors include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, Rh10, Rh74 and AAV-2i8, as well as variants (e.g., capsid variants, such as amino acid insertions, additions, substitutions and deletions) thereof, for example, as set forth in WO 2013/158879 (International Application PCT/US2013/037170), WO 2015/013313 (International Application PCT/US2014/047670) and US 2013/0059732 (U.S. Pat. No. 9,169,299, discloses LK01, LK02, LK03, etc.).
- variants e.g., capsid variants, such as amino acid insertions, additions, substitutions and deletions
- AAV variants include variants and chimeras of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, Rh10, Rh74 and AAV-2i8 capsid. Accordingly, AAV vectors and AAV variants (e.g., capsid variants) that include (encapsidate or package) CpG reduced nucleic acid variants encoding FVIII, are provided.
- AAV and AAV variants may or may not be distinct from other AAV serotypes, including, for example, AAV1-AAV12, Rh74 or Rh10 (e.g., distinct from VP1, VP2, and/or VP3 sequences of any of AAV1-AAV12, Rh74 or Rh100 serotypes).
- serotype is a distinction used to refer to an AAV having a capsid that is serologically distinct from other AAV serotypes. Serologic distinctiveness is determined on the basis of the lack of cross-reactivity between antibodies to one AAV as compared to another AAV. Such cross-reactivity differences are usually due to differences in capsid protein sequences/antigenic determinants (e.g., due to VP1, VP2, and/or VP3 sequence differences of AAV serotypes).
- AAV variants including capsid variants may not be serologically distinct from a reference AAV or other AAV serotype, they differ by at least one nucleotide or amino acid residue compared to the reference or other AAV serotype.
- a serotype means that the virus of interest has been tested against serum specific for all existing and characterized serotypes for neutralizing activity and no antibodies have been found that neutralize the virus of interest.
- the new virus e.g., AAV
- this new virus e.g., AAV
- serology testing for neutralizing activity has yet to be performed on mutant viruses with capsid sequence modifications to determine if they are of another serotype according to the traditional definition of serotype.
- serotype broadly refers to both serologically distinct viruses (e.g., AAV) as well as viruses (e.g., AAV) that are not serologically distinct that may be within a subgroup or a variant of a given serotype.
- AAV vectors therefore include gene/protein sequences identical to gene/protein sequences characteristic for a particular serotype.
- an “AAV vector related to AAV1” refers to one or more AAV proteins (e.g., VP1, VP2, and/or VP3 sequences) that has substantial sequence identity to one or more polynucleotides or polypeptide sequences that comprise AAV1.
- an “AAV vector related to AAV8” refers to one or more AAV proteins (e.g., VP1, VP2, and/or VP3 sequences) that has substantial sequence identity to one or more polynucleotides or polypeptide sequences that comprise AAV8.
- AAV vector related to AAV-Rh74 refers to one or more AAV proteins (e.g., VP1, VP2, and/or VP3 sequences) that has substantial sequence identity to one or more polynucleotides or polypeptide sequences that comprise AAV-Rh74.
- AAV proteins e.g., VP1, VP2, and/or VP3 sequences
- Such AAV vectors related to another serotype e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, Rh10, Rh74 or AAV-2i8, can therefore have one or more distinct sequences from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, Rh10, Rh74 and AAV-2i8, but can exhibit substantial sequence identity to one or more genes and/or proteins, and/or have one or more functional characteristics of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, Rh10, Rh74 or AAV-2i8 (e.g., such as cell/tissue tropism).
- Exemplary non-limiting AAV variants include capsid variants of any of VP1, VP2, and/or
- an AAV vector related to a reference serotype has a polynucleotide, polypeptide or subsequence thereof that includes or consists of a sequence at least 80% or more (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, etc.) identical to one or more AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, Rh10, Rh74 or AAV-2i8 (e.g., such as an ITR, or a VP1, VP2, and/or VP3 sequences).
- a polynucleotide, polypeptide or subsequence thereof that includes or consists of a sequence at least 80% or more (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%
- compositions, methods and uses of the invention include AAV sequences (polypeptides and nucleotides), and subsequences thereof that exhibit less than 100% sequence identity to a reference AAV serotype such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, Rh10, or AAV-2i8, but are distinct from and not identical to known AAV genes or proteins, such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, Rh10, Rh74 or AAV-2i8, genes or proteins, etc.
- AAV sequences polypeptides and nucleotides
- subsequences thereof that exhibit less than 100% sequence identity to a reference AAV serotype such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10,
- an AAV polypeptide or subsequence thereof includes or consists of a sequence at least 75% or more identical, e.g., 80%, 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, etc., up to 100% identical to any reference AAV sequence or subsequence thereof, such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, Rh10, Rh74 or AAV-2i8 (e.g., VP1, VP2 and/or VP3 capsid or ITR).
- an AAV variant has 1, 2, 3, 4, 5, 5-10, 10-15, 15-20 or more amino acid substitutions.
- Recombinant AAV vectors including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, Rh10, Rh74 or AAV-2i8 and variant, related, hybrid and chimeric sequences, can be constructed using recombinant techniques that are known to the skilled artisan, to include one or more nucleic acid sequences (transgenes) flanked with one or more functional AAV ITR sequences.
- transgenes nucleic acid sequences flanked with one or more functional AAV ITR sequences.
- CpG reduced nucleic acid variants encoding FVIII, vector or expression vector may be administered to a patient via infusion in a biologically compatible carrier, for example, via intravenous injection.
- the CpG reduced nucleic acid variants encoding FVIII, vectors and expression vectors of the invention may optionally be encapsulated into liposomes or mixed with other phospholipids or micelles to increase stability of the molecule.
- CpG reduced nucleic acid variants encoding FVIII, vectors and expression vectors of the invention may be administered alone or in combination with other agents known to modulate hemostasis (e.g., Factor V, Factor Va or derivatives thereof).
- compositions well suited for different applications and routes of administration are well known in the art and are described hereinbelow.
- a preparation containing purified FVIII protein, produced by expression of CpG reduced nucleic acid variants encoding FVIII, vectors and expression vectors of the invention contains a physiologically acceptable matrix and may be formulated as a pharmaceutical preparation.
- the preparation can be formulated using substantially known prior art methods, it can be mixed with a buffer containing salts, such as NaCl, CaCl 2 , and amino acids, such as glycine and/or lysine, and in a pH range from 6 to 8.
- the purified preparation containing FVIII can be stored in the form of a finished solution or in lyophilized or deep-frozen form.
- a preparation can be stored in lyophilized form and is dissolved into a visually clear solution using an appropriate reconstitution solution.
- the preparation according to the invention can also be made available as a liquid preparation or as a liquid that is deep-frozen.
- the preparation according to the invention may optionally be especially stable, i.e., it can be allowed to stand in dissolved form for a prolonged time prior to administration or delivery.
- the preparation according to the invention can be made available as a pharmaceutical preparation with FVIII activity in the form of a one-component preparation or in combination with other factors in the form of a multi-component preparation.
- the purified protein Prior to processing the purified protein into a pharmaceutical preparation, the purified protein is subjected to the conventional quality controls and fashioned into a therapeutic form of presentation.
- the purified preparation is tested for the absence of cellular nucleic acids as well as nucleic acids that are derived from the expression vector, such as is described in EP 0 714 987.
- the pharmaceutical protein preparation may be used at dosages of between 30-100 IU/kg (One I.U is 100 ng/ml) at as single daily injection or up to 3 times/day for several days. Patients may be treated immediately upon presentation at the clinic with a bleed. Alternatively, patients may receive a bolus infusion every eight to twelve hours, or if sufficient improvement is observed, a once daily infusion of the FVIII.
- invention nucleic acids, vectors, recombinant vectors (e.g., rAAV), and recombinant virus particles and other compositions, agents, drugs, biologics (proteins) can be incorporated into pharmaceutical compositions.
- Such pharmaceutical compositions are useful for, among other things, administration and delivery to a subject in vivo or ex vivo.
- compositions also contain a pharmaceutically acceptable carrier or excipient.
- excipients include any pharmaceutical agent that does not itself induce an immune response harmful to the individual receiving the composition, and which may be administered without undue toxicity.
- pharmaceutically acceptable and “physiologically acceptable” mean a biologically acceptable formulation, gaseous, liquid or solid, or mixture thereof, which is suitable for one or more routes of administration, in vivo delivery or contact.
- a “pharmaceutically acceptable” or “physiologically acceptable” composition is a material that is not biologically or otherwise undesirable, e.g., the material may be administered to a subject without causing substantial undesirable biological effects.
- such a pharmaceutical composition may be used, for example in administering a nucleic acid, vector, viral particle or protein to a subject.
- Pharmaceutically acceptable excipients include, but are not limited to, liquids such as water, saline, glycerol, sugars and ethanol.
- Pharmaceutically acceptable salts can also be included therein, for example, mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like.
- auxiliary substances such as wetting or emulsifying agents, pH buffering substances, and the like, may be present in such vehicles.
- the pharmaceutical composition may be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the corresponding, free base forms.
- a preparation may be a lyophilized powder which may contain any or all of the following: 1-50 mM histidine, 0.1%-2% sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use.
- compositions include solvents (aqueous or non-aqueous), solutions (aqueous or non-aqueous), emulsions (e.g., oil-in-water or water-in-oil), suspensions, syrups, elixirs, dispersion and suspension media, coatings, isotonic and absorption promoting or delaying agents, compatible with pharmaceutical administration or in vivo contact or delivery.
- Aqueous and non-aqueous solvents, solutions and suspensions may include suspending agents and thickening agents.
- Such pharmaceutically acceptable carriers include tablets (coated or uncoated), capsules (hard or soft), microbeads, powder, granules and crystals.
- Supplementary active compounds e.g., preservatives, antibacterial, antiviral and antifungal agents
- compositions can be formulated to be compatible with a particular route of administration or delivery, as set forth herein or known to one of skill in the art.
- pharmaceutical compositions include carriers, diluents, or excipients suitable for administration by various routes.
- compositions suitable for parenteral administration comprise aqueous and non-aqueous solutions, suspensions or emulsions of the active compound, which preparations are typically sterile and can be isotonic with the blood of the intended recipient.
- Non-limiting illustrative examples include water, buffered saline, Hanks' solution, Ringer's solution, dextrose, fructose, ethanol, animal, vegetable or synthetic oils.
- Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
- suspensions of the active compounds may be prepared as appropriate oil injection suspensions.
- Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.
- the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
- Cosolvents and adjuvants may be added to the formulation.
- cosolvents contain hydroxyl groups or other polar groups, for example, alcohols, such as isopropyl alcohol; glycols, such as propylene glycol, polyethyleneglycol, polypropylene glycol, glycol ether; glycerol; polyoxyethylene alcohols and polyoxyethylene fatty acid esters.
- Adjuvants include, for example, surfactants such as, soya lecithin and oleic acid; sorbitan esters such as sorbitan trioleate; and polyvinylpyrrolidone.
- compositions After pharmaceutical compositions have been prepared, they may be placed in an appropriate container and labeled for treatment.
- labeling For administration of FVIII-containing vectors or polypeptides, such labeling would include amount, frequency, and method of administration.
- compositions and delivery systems appropriate for the compositions, methods and uses of the invention are known in the art (see, e.g., Remington: The Science and Practice of Pharmacy (2003) 20 th ed., Mack Publishing Co., Easton, Pa.; Remington's Pharmaceutical Sciences (1990) 18 th ed., Mack Publishing Co., Easton, Pa.; The Merck Index (1996) 12 th ed., Merck Publishing Group, Whitehouse, N.J.; Pharmaceutical Principles of Solid Dosage Forms (1993), Technonic Publishing Co., Inc., Lancaster, Pa.; Ansel and Stoklosa, Pharmaceutical Calculations (2001) 11 th ed., Lippincott Williams & Wilkins, Baltimore, Md.; and Poznansky et al., Drug Delivery Systems (1980), R. L. Juliano, ed., Oxford, N.Y., pp. 253-315).
- the invention also provides methods for introducing CpG reduced nucleic acid variants encoding FVIII into a cell or an animal.
- the invention provides methods for modulating hemostasis.
- a method includes contact or administration of an individual (patient or subject such as a mammal) with a nucleic acid delivery vehicle (e.g., an AAV vector) comprising CpG reduced nucleic acid variant encoding FVIII under conditions wherein the FVIII polypeptide is expressed in the individual.
- a nucleic acid delivery vehicle e.g., an AAV vector
- a method in another embodiment, includes providing cells of an individual (patient or subject such as a mammal) with a nucleic acid delivery vehicle (e.g., an AAV vector) comprising a CpG reduced nucleic acid variant encoding FVIII under conditions wherein the FVIII polypeptide is expressed in the individual.
- a nucleic acid delivery vehicle e.g., an AAV vector
- CpG reduced nucleic acid variants encoding FVIII may be used in the treatment of disorders associated with deficient, insufficient or aberrant blood coagulation.
- compositions of CpG reduced nucleic acid variants encoding FVIII including vectors, recombinant vectors (e.g., rAAV), and recombinant virus particles can be administered, and methods and uses of the invention can be provided, in a sufficient or effective amount to a subject in need thereof.
- vectors e.g., rAAV
- recombinant virus particles e.g., rAAV
- an “effective amount” or “sufficient amount” refers to an amount that provides, in single or multiple doses, alone or in combination, with one or more other compositions (therapeutic or immunosupprosive agents such as a drug), treatments, protocols, or therapeutic regimens agents, a detectable response of any duration of time (long or short term), an expected or desired outcome in or a benefit to a subject of any measurable or detectable degree or for any duration of time (e.g., for minutes, hours, days, months, years, or cured).
- Doses can vary and depend upon the type, onset, progression, severity, frequency, duration, or probability of the disease to which treatment is directed, the clinical endpoint desired, previous or simultaneous treatments, the general health, age, gender, race or immunological competency of the subject and other factors that will be appreciated by the skilled artisan.
- the dose amount, number, frequency or duration may be proportionally increased or reduced, as indicated by any adverse side effects, complications or other risk factors of the treatment or therapy and the status of the subject. The skilled artisan will appreciate the factors that may influence the dosage and timing required to provide an amount sufficient for providing a therapeutic or prophylactic benefit.
- the dose to achieve a therapeutic effect e.g., the dose in vector genomes/per kilogram of body weight (vg/kg) will vary based on several factors including, but not limited to: route of administration, the level of heterologous polynucleotide expression required to achieve a therapeutic effect, the specific disease treated, any host immune response to the viral vector, a host immune response to the heterologous polynucleotide or expression product (protein), and the stability of the protein expressed.
- route of administration e.g., the level of heterologous polynucleotide expression required to achieve a therapeutic effect
- the specific disease treated any host immune response to the viral vector
- a host immune response to the heterologous polynucleotide or expression product (protein) protein
- stability of the protein expressed e.g., the stability of the protein expressed.
- One skilled in the art can determine a rAAV/vector genome dose range to treat a patient having a particular disease or disorder based on the aforementioned factors, as well as
- doses will range from at least 1 ⁇ 10 8 , or more, for example, 1 ⁇ 10 9 , 1 ⁇ 10 10 , 1 ⁇ 10 11 , 1 ⁇ 10 12 , 1 ⁇ 10 13 or 1 ⁇ 10 14 , or more, vector genomes per kilogram (vg/kg) of the weight of the subject, to achieve a therapeutic effect.
- AAV dose in the range of 1 ⁇ 10 10 -1 ⁇ 10 11 in mice, and 1 ⁇ 10 12 -1 ⁇ 10 13 in dogs have been effective.
- hemophilia B As an example, generally speaking, it is believed that, in order to achieve a therapeutic effect, a blood coagulation factor concentration that is greater than 1% of factor concentration found in a normal individual is needed to change a severe disease phenotype to a moderate one.
- a severe phenotype is characterized by joint damage and life-threatening bleeds.
- a blood coagulation factor concentration greater than 5% of normal is needed.
- FVIII levels in normal humans are about 150-200 ng/ml plasma, but may be less (e.g., range of about 100-150 ng/ml) or greater (e.g., range of about 200-300 ng/ml) and still considered normal due to functioning clotting as determined, for example, by an activated partial thromboplastin time (aPTT) one-stage clotting assay.
- aPTT activated partial thromboplastin time
- a therapeutic effect can be achieved by expression of FVIII such that the total amount of FVIII in the subject/human is greater than 1% of the FVIII present in normal subjects/humans, e.g., 1% of 100-300 ng/ml.
- a typical dose is at least 1 ⁇ 10 10 vector genomes (vg) per kilogram (vg/kg) of the weight of the subject, or between about 1 ⁇ 10 10 to 1 ⁇ 10 11 vg/kg of the weight of the subject, or between about 1 ⁇ 10 11 to 1 ⁇ 10 12 vg/kg of the weight of the subject, or between about 1 ⁇ 10 12 to 1 ⁇ 10 13 vg/kg of the weight of the subject, to achieve a desired therapeutic effect.
- AAV vector doses can be at a level, typically at the lower end of the dose spectrum, such that there is not a substantial immune response against the FVIII or AAV vector.
- an “effective amount” or “sufficient amount” for treatment typically are effective to provide a response to one, multiple or all adverse symptoms, consequences or complications of the disease, one or more adverse symptoms, disorders, illnesses, pathologies, or complications, for example, caused by or associated with the disease, to a measurable extent, although decreasing, reducing, inhibiting, suppressing, limiting or controlling progression or worsening of the disease is a satisfactory outcome.
- An effective amount or a sufficient amount can but need not be provided in a single administration, may require multiple administrations, and, can but need not be, administered alone or in combination with another composition (e.g., agent), treatment, protocol or therapeutic regimen.
- another composition e.g., agent
- the amount may be proportionally increased as indicated by the need of the subject, type, status and severity of the disease treated or side effects (if any) of treatment.
- an effective amount or a sufficient amount need not be effective or sufficient if given in single or multiple doses without a second composition (e.g., another drug or agent), treatment, protocol or therapeutic regimen, since additional doses, amounts or duration above and beyond such doses, or additional compositions (e.g., drugs or agents), treatments, protocols or therapeutic regimens may be included in order to be considered effective or sufficient in a given subject.
- Amounts considered effective also include amounts that result in a reduction of the use of another treatment, therapeutic regimen or protocol, such as administration of recombinant clotting factor protein (e.g., FVIII) for treatment of a clotting disorder (e.g., hemophilia A).
- methods and uses of the invention also include, among other things, methods and uses that result in a reduced need or use of another compound, agent, drug, therapeutic regimen, treatment protocol, process, or remedy.
- a method or use of the invention has a therapeutic benefit if in a given subject a less frequent or reduced dose or elimination of administration of a recombinant clotting factor protein to supplement for the deficient or defective (abnormal or mutant) endogenous clotting factor in the subject.
- methods and uses of reducing need or use of another treatment or therapy are provided.
- An effective amount or a sufficient amount need not be effective in each and every subject treated, nor a majority of treated subjects in a given group or population.
- An effective amount or a sufficient amount means effectiveness or sufficiency in a particular subject, not a group or the general population. As is typical for such methods, some subjects will exhibit a greater response, or less or no response to a given treatment method or use.
- a detectable or measurable improvement includes a subjective or objective decrease, reduction, inhibition, suppression, limit or control in the occurrence, frequency, severity, progression, or duration of the disease, or complication caused by or associated with the disease, or an improvement in a symptom or an underlying cause or a consequence of the disease, or a reversal of the disease.
- an effective amount would be an amount that reduces frequency or severity of acute bleeding episodes in a subject, for example, or an amount that reduces clotting time as measured by a clotting assay, for example.
- compositions of the invention include compositions wherein the active ingredients are contained in an effective amount to achieve the intended therapeutic purpose. Determining a therapeutically effective dose is well within the capability of a skilled medical practitioner using the techniques and guidance provided in the invention.
- Therapeutic doses will depend on, among other factors, the age and general condition of the subject, the severity of the aberrant blood coagulation phenotype, and the strength of the control sequences regulating the expression levels of CpG reduced nucleic acid variants encoding FVIII. Thus, a therapeutically effective amount in humans will fall in a relatively broad range that may be determined by a medical practitioner based on the response of an individual patient to vector-based FVIII treatment. Such doses may be alone or in combination with an immunosuppressive agent or drug.
- compositions such as pharmaceutical compositions may be delivered to a subject, so as to allow production of a biologically active protein (e.g., Factor VIII (FVIII) encoded by CpG reduced nucleic acid variant) or by inducing continuous expression of the FVIII transgene in vivo by gene- and or cell-based therapies or by ex-vivo modification of the patient's or donor's cells.
- a biologically active protein e.g., Factor VIII (FVIII) encoded by CpG reduced nucleic acid variant
- pharmaceutical compositions comprising sufficient genetic material to enable a recipient to produce a therapeutically effective amount of a FVIII polypeptide can influence hemostasis in the subject.
- compositions may be administered alone.
- CpG reduced nucleic acid variant encoding FVIII, vector, expression vector/recombinant vector (e.g., rAAV), or recombinant virus particle provides a therapeutic effect without an immunosuppressive agent.
- the therapeutic effect of FVIII optionally is sustained for a period of time, e.g., 2-4, 4-6, 6-8, 8-10, 10-14, 14-20, 20-25, 25-30, or 30-50 days or more, for example, 50-75, 75-100, 100-150, 150-200 days or more without administering an immunosuppressive agent.
- CpG reduced nucleic acid variant encoding FVIII, vector, expression vector/recombinant vector (e.g., rAAV), or recombinant virus particle provide a therapeutic effect without administering an immunosuppressive agent for a period of time.
- compositions may be administered in combination with at least one other agent.
- CpG reduced nucleic acid variant encoding FVIII, vector, expression vector/recombinant vector (e.g., rAAV), or recombinant virus particle are administered in conjunction with one or more immunosuppressive agents prior to, substantially at the same time or after administering a CpG reduced nucleic acid variant encoding FVIII, vector, expression vector/recombinant vector (e.g., rAAV), or recombinant virus particle.
- CpG reduced nucleic acid variant encoding FVIII, vector, expression vector/recombinant vector (e.g., rAAV), or recombinant virus particle are administered in conjunction with one or more immunosuppressive agents after a period of time following administering a CpG reduced nucleic acid variant encoding FVIII, vector, expression vector/recombinant vector (e.g., rAAV), or recombinant virus particle, e.g., 1-12, 12-24 or 24-48 hours, or 2-4, 4-6, 6-8, 8-10, 10-14, 14-20, 20-25, 25-30, 30-50, or more than 50 days following administering a CpG reduced nucleic acid variant encoding FVIII, vector, expression vector/recombinant vector (e.g., rAAV), or recombinant virus particle.
- one or more immunosuppressive agents after a period of time following administering a CpG reduced nucleic acid variant encoding FVIII, vector,
- a period of time e.g. 20-25, 25-30, 30-50, 50-75, 75-100, 100-150, 150-200 or more than 200 days following administering a CpG reduced nucleic acid variant encoding FVIII, vector, expression vector/recombinant vector (e.g., rAAV
- an immunosuppressive agent is an anti-inflammatory agent.
- an immunosuppressive agent is a steroid.
- an immunosuppressive agent is cyclosporine (e.g., cyclosporine A), mycophenolate, Rituximab or a derivative thereof. Additional particular agents include a stabilizing compound.
- compositions may be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water.
- the compositions may be administered to a patient alone, or in combination with other agents (e.g., co-factors) which influence hemostasis.
- Factor VIII alone or in combination with other agents may be administered or contacted or directly infused into a patient in an appropriate biological carrier as described herein.
- Vectors and expression vectors of the invention comprising a CpG reduced nucleic acid variant encoding FVIII, may be administered to a patient by a variety of means to achieve and optionally maintain for a period of time a prophylactically and/or therapeutically effective level of FVIII polypeptide.
- One of skill in the art could readily determine specific protocols for using the FVIII encoding expression vectors of the invention for the therapeutic treatment of a particular patient.
- AAV vectors are employed to deliver Factor VIII (FVIII) encoded by CpG reduced nucleic acid variants to a patient in need thereof.
- Factor VIII (FVIII) encoded by CpG reduced nucleic acid variants delivered by way of AAVvectors of the invention may be administered to a patient by any means known.
- compositions may be delivered subcutaneously, epidermally, intradermally, intrathecally, intraorbitally, intramucosally, intraperitoneally, intravenously, intra-pleurally, intraarterially, orally, intrahepatically, via the portal vein, or intramuscularly.
- a clinician specializing in the treatment of patients with blood coagulation disorders may determine the optimal route for administration of the adenoviral-associated vectors comprising CpG reduced nucleic acid variants encoding FVIII based on a number of criteria, including, but not limited to: the condition of the patient and the purpose of the treatment (e.g., enhanced or reduced blood coagulation).
- inventions and uses can be combined with any compound, agent, drug, treatment or other therapeutic regimen or protocol having a desired therapeutic, beneficial, additive, synergistic or complementary activity or effect.
- exemplary combination compositions and treatments include second actives, such as, biologics (proteins), agents (e.g., immunosuppressive agents) and drugs.
- biologics (proteins), agents, drugs, treatments and therapies can be administered or performed prior to, substantially contemporaneously with or following any other method or use of the invention, for example, a therapeutic method of treating a subject for a blood clotting disease such as HemA.
- the compound, agent, drug, treatment or other therapeutic regimen or protocol can be administered as a combination composition, or administered separately, such as concurrently or in series or sequentially (prior to or following) delivery or administration of a nucleic acid, vector, recombinant vector (e.g., rAAV), or recombinant virus particle.
- a nucleic acid e.g., rAAV
- rAAV recombinant vector
- the invention therefore provides combinations in which a method or use of the invention is in a combination with any compound, agent, drug, therapeutic regimen, treatment protocol, process, remedy or composition, set forth herein or known to one of skill in the art.
- the compound, agent, drug, therapeutic regimen, treatment protocol, process, remedy or composition can be administered or performed prior to, substantially contemporaneously with or following administration of a nucleic acid, vector, recombinant vector (e.g., rAAV), or recombinant virus particle of the invention, to a subject.
- a nucleic acid e.g., rAAV
- recombinant vector e.g., rAAV
- virus particle of the invention e.g., rAAV
- the invention is useful in animals including human and veterinary medical applications. Suitable subjects therefore include mammals, such as humans, as well as non-human mammals.
- the term “subject” refers to an animal, typically a mammal, such as humans, non-human primates (apes, gibbons, gorillas, chimpanzees, orangutans, macaques), a domestic animal (dogs and cats), a farm animal (poultry such as chickens and ducks, horses, cows, goats, sheep, pigs), and experimental animals (mouse, rat, rabbit, guinea pig).
- Human subjects include fetal, neonatal, infant, juvenile and adult subjects.
- Subjects include animal disease models, for example, mouse and other animal models of blood clotting diseases such as HemA and others known to those of skill in the art.
- Subjects appropriate for treatment in accordance with the invention include those having or at risk of producing an insufficient amount or having a deficiency in a functional gene product (e.g., FVIII protein), or produce an aberrant, partially functional or non-functional gene product (e.g., FVIII protein), which can lead to disease.
- Subjects appropriate for treatment in accordance with the invention also include those having or at risk of producing an aberrant, or defective (mutant) gene product (protein) that leads to a disease such that reducing amounts, expression or function of the aberrant, or defective (mutant) gene product (protein) would lead to treatment of the disease, or reduce one or more symptoms or ameliorate the disease.
- Target subjects therefore include subjects having aberrant, insufficient or absent blood clotting factor production, such as hemophiliacs (e.g., hemophilia A).
- Subjects can be tested for an immune response, e.g., antibodies against AAV.
- Candidate hemophilia subjects can therefore be screened prior to treatment according to a method of the invention.
- Subjects also can be tested for antibodies against AAV after treatment, and optionally monitored for a period of time after treatment.
- Subjects developing antibodies can be treated with an immunosuppressive agent, or can be administered one or more additional amounts of AAV vector.
- Subjects appropriate for treatment in accordance with the invention also include those having or at risk of producing antibodies against AAV.
- AAV vectors can be administered or delivered to such subjects using several techniques. For example, empty capsid AAV (i.e., AAV lacking a FVIII nucleic acid) can be delivered to bind to the AAV antibodies in the subject thereby allowing the AAV vector bearing CpG reduced nucleic acid variant encoding FVIII to transform cells of the subject. Amounts of empty capsid AAV to administer can be calibrated based upon the amount of AAV antibodies produced in a particular subject.
- Empty capsid can be of any AAV serotype, for example, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, Rh10, Rh74 or AAV-2i8.
- AAV vector can be delivered by direct intramuscular injection (e.g., one or more slow-twitch fibers of a muscle).
- a catheter introduced into the femoral artery can be used to delivery AAV vectors to liver via the hepatic artery.
- Non-surgical means can also be employed, such as endoscopic retrograde cholangiopancreatography (ERCP), to deliver AAV vectors directly to the liver, thereby bypassing the bloodstream and AAV antibodies.
- ERCP endoscopic retrograde cholangiopancreatography
- Other ductal systems such as the ducts of the submandibular gland, can also be used as portals for delivering AAV vectors into a subject that develops or has preexisting anti-AAV antibodies.
- Administration or in vivo delivery to a subject can be performed prior to development of an adverse symptom, condition, complication, etc. caused by or associated with the disease.
- a screen e.g., genetic
- Such subjects therefore include those screened positive for an insufficient amount or a deficiency in a functional gene product (e.g., FVIII protein), or that produce an aberrant, partially functional or non-functional gene product (e.g., FVIII protein).
- Administration or in vivo delivery to a subject in accordance with the methods and uses of the invention as disclosed herein can be practiced within 1-2, 2-4, 4-12, 12-24 or 24-72 hours after a subject has been identified as having the disease targeted for treatment, has one or more symptoms of the disease, or has been screened and is identified as positive as set forth herein even though the subject does not have one or more symptoms of the disease.
- methods and uses of the invention can be practiced 1-7, 7-14, 14-21, 21-48 or more days, months or years after a subject has been identified as having the disease targeted for treatment, has one or more symptoms of the disease, or has been screened and is identified as positive as set forth herein.
- a “unit dosage form” as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity optionally in association with a pharmaceutical carrier (excipient, diluent, vehicle or filling agent) which, when administered in one or more doses, is calculated to produce a desired effect (e.g., prophylactic or therapeutic effect).
- Unit dosage forms may be within, for example, ampules and vials, which may include a liquid composition, or a composition in a freeze-dried or lyophilized state; a sterile liquid carrier, for example, can be added prior to administration or delivery in vivo.
- Individual unit dosage forms can be included in multi-dose kits or containers.
- Recombinant vector (e.g., rAAV) sequences, recombinant virus particles, and pharmaceutical compositions thereof can be packaged in single or multiple unit dosage form for ease of administration and uniformity of dosage.
- Subjects can be tested for FVIII amounts or FVIII activity to determine if such subjects are appropriate for treatment according to a method of the invention.
- Candidate hemophilia subjects can be tested for FVIII amounts or activity prior to treatment according to a method of the invention.
- Subjects also can be tested for amounts of FVIII or FVIII activity after treatment according to a method of the invention.
- Such treated subjects can be monitored after treatment for FVIII amounts or FVIII activity, periodically, e.g., every 1-4 weeks or 1-6 months.
- Subjects can be tested for one or more liver enzymes for an adverse response or to determine if such subjects are appropriate for treatment according to a method of the invention.
- Candidate hemophilia subjects can therefore be screened for amounts of one or more liver enzymes prior to treatment according to a method of the invention.
- Subjects also can be tested for amounts of one or more liver enzymes after treatment according to a method of the invention.
- Such treated subjects can be monitored after treatment for elevated liver enzymes, periodically, e.g., every 1-4 weeks or 1-6 months.
- Exemplary liver enzymes include alanine aminotransferase (ALT), aspartate aminotransferase (AST), and lactate dehydrogenase (LDH), but other enzymes indicative of liver damage can also be monitored.
- ALT alanine aminotransferase
- AST aspartate aminotransferase
- LDH lactate dehydrogenase
- a normal level of these enzymes in the circulation is typically defined as a range that has an upper level, above which the enzyme level is considered elevated, and therefore indicative of liver damage.
- a normal range depends in part on the standards used by the clinical laboratory conducting the assay.
- Subjects can be monitored for bleeding episodes to determine if such subjects are eligible for or responding to treatment, and/or the amount or duration of responsiveness.
- Subjects can be monitored for bleeding episodes to determine if such subjects are in need of an additional treatment, e.g., a subsequent AAV vector administration or administration of an immunosuppressive agent, or more frequent monitoring. Hemophilia subjects can therefore be monitored for bleeding episodes prior to and after treatment according to a method of the invention.
- Subjects also can be tested for frequency and severity of bleeding episodes during or after treatment according to a method of the invention.
- kits with packaging material and one or more components therein typically includes a label or packaging insert including a description of the components or instructions for use in vitro, in vivo, or ex vivo, of the components therein.
- a kit can contain a collection of such components, e.g., a nucleic acid, recombinant vector, virus (e.g., AAV) vector, or virus particle and optionally a second active, such as another compound, agent, drug or composition.
- kits refers to a physical structure housing one or more components of the kit.
- Packaging material can maintain the components sterilely, and can be made of material commonly used for such purposes (e.g., paper, corrugated fiber, glass, plastic, foil, ampules, vials, tubes, etc.).
- Labels or inserts can include identifying information of one or more components therein, dose amounts, clinical pharmacology of the active ingredient(s) including mechanism of action, pharmacokinetics and pharmacodynamics. Labels or inserts can include information identifying manufacturer, lot numbers, manufacture location and date, expiration dates. Labels or inserts can include information identifying manufacturer information, lot numbers, manufacturer location and date. Labels or inserts can include information on a disease for which a kit component may be used. Labels or inserts can include instructions for the clinician or subject for using one or more of the kit components in a method, use, or treatment protocol or therapeutic regimen. Instructions can include dosage amounts, frequency or duration, and instructions for practicing any of the methods, uses, treatment protocols or prophylactic or therapeutic regimes described herein.
- Labels or inserts can include information on any benefit that a component may provide, such as a prophylactic or therapeutic benefit. Labels or inserts can include information on potential adverse side effects, complications or reactions, such as warnings to the subject or clinician regarding situations where it would not be appropriate to use a particular composition. Adverse side effects or complications could also occur when the subject has, will be or is currently taking one or more other medications that may be incompatible with the composition, or the subject has, will be or is currently undergoing another treatment protocol or therapeutic regimen which would be incompatible with the composition and, therefore, instructions could include information regarding such incompatibilities.
- Labels or inserts include “printed matter,” e.g., paper or cardboard, or separate or affixed to a component, a kit or packing material (e.g., a box), or attached to an ampule, tube or vial containing a kit component.
- Labels or inserts can additionally include a computer readable medium, such as a bar-coded printed label, a disk, optical disk such as CD- or DVD-ROM/RAM, DVD, MP3, magnetic tape, or an electrical storage media such as RAM and ROM or hybrids of these such as magnetic/optical storage media, FLASH media or memory type cards.
- a nucleic acid includes a plurality of such nucleic acids
- a vector includes a plurality of such vectors
- reference to “a virus” or “particle” includes a plurality of such viruses/particles.
- all numerical values or numerical ranges include integers within such ranges and fractions of the values or the integers within ranges unless the context clearly indicates otherwise.
- reference to 80% or more identity includes 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94% etc., as well as 81.1%, 81.2%, 81.3%, 81.4%, 81.5%, etc., 82.1%, 82.2%, 82.3%, 82.4%, 82.5%, etc., and so forth.
- references to an integer with more (greater) or less than includes any number greater or less than the reference number, respectively.
- a reference to less than 100 includes 99, 98, 97, etc. all the way down to the number one (1); and less than 10, includes 9, 8, 7, etc. all the way down to the number one (1).
- Reference to a series of ranges includes ranges which combine the values of the boundaries of different ranges within the series.
- reference to a series of ranges for example, of 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-75, 75-100, 100-150, 150-200, 200-250, 250-300, 300-400, 400-500, 500-750, 750-850, includes ranges of 1-20, 1-30, 1-40, 1-50, 1-60, 10-30, 10-40, 10-50, 10-60, 10-70, 10-80, 20-40, 20-50, 20-60, 20-70, 20-80, 20-90, 50-75, 50-100, 50-150, 50-200, 50-250, 100-200, 100-250, 100-300, 100-350, 100-400, 100-500, 150-250, 150-300, 150-350, 150-400, 150-450, 150-500, etc.
- the invention is generally disclosed herein using affirmative language to describe the numerous embodiments and aspects.
- the invention also specifically includes embodiments in which particular subject matter is excluded, in full or in part, such as substances or materials, method steps and conditions, protocols, or procedures.
- materials and/or method steps are excluded.
- the invention is generally not expressed herein in terms of what the invention does not include aspects that are not expressly excluded in the invention are nevertheless disclosed herein.
- each gene construct can optionally include one or more of an expression control (e.g., promoter) element, factor VIII gene and other regulatory features required for expression of the gene, such as introns, ITRs, stop codons, poly A signals, etc.
- an expression control e.g., promoter
- factor VIII gene e.g., factor VIII gene and other regulatory features required for expression of the gene, such as introns, ITRs, stop codons, poly A signals, etc.
- CpG reduced nucleic acid variants encoding FVIII (SEQ ID NOs: 1-18) were produced and assessed in expression assays.
- CpG reduced human FVIII cDNA constructs were generated with a mutant transthyretin (TTRmut) promoter (SEQ ID NO:22).
- AAV-SPK-8011 expression cassette has the CpG reduced FVIII-X07 nucleic acid sequence and the LK03 capsid for packaging.
- LK03 capsid has substantial homology to AAV3, a non-pathogenic, naturally replication deficient single-stranded DNA virus.
- Packaging plasmid pLK03 is a 7,484 bp plasmid construct that carries the AAV2 Rep and AAV-LK03 Cap genes under the control of AAV2 p5 promoter, bacterial origin of replication and gene conferring resistance to Kanamycin in bacterial cells.
- the p5 rep promoter has been moved 3′ of the cap gene to reduce the potential for formation of wild-type or pseudo wild type AAV species, and to increase yield of the vector.
- the cloned DNA for gene transfer is a gene expression cassette, packaged into the AAV-LK03 capsid as a single-stranded genome, encoding human coagulation factor VIII (hFVIII) under control of a liver-specific promoter.
- the expression plasmid is referred to as pAAV-TTRmut-hFVIII-X07. It was modified by the introduction of 4 point mutations in the TTR promoter, and the coding region optimized to increase expression of human FVIII.
- the AAV expression cassette contains the following elements:
- Three DNA plasmid constructs are used to transfect human embryo kidney 293 cells to produce the SPK-8011 vector by a helper virus-free process (Matsushita et al. 1998):
- the cell substrate used for AAV vector production is a derivative of primary human embryonic kidney cells (HEK) 293.
- HEK293 cell line is a permanent line transformed by sheared human adenovirus type 5 (Ad5) DNA (Graham et al. 1977).
- Ad5 human adenovirus type 5
- the Working Cell Bank is derived from a characterized HEK293 Master Cell Bank from the Center for Cellular and Molecular Therapeutics (CCMT) at The Children's Hospital of Philadelphia (CHOP).
- FVIII transgene constructs (hFVIII) were packaged into adeno-associated viral (AAV) vectors and delivered to mice.
- AAV adeno-associated viral
- groups of 4 hemophilia A/CD4 ⁇ / ⁇ mice were injected at 8-10 weeks of age with 4 ⁇ 10 12 vg/kg of AAV-hFVIII vectors.
- Immunodeficient mice were used to enable quantification of FVIII plasma levels, as the inhibitory antibodies to FVIII that are generated in normal mice prevent long-term analysis of FVIII expression.
- Levels of FVIII expression were determined and in several instances were higher than expression provided by the CO3 sequence (SEQ ID NO:21) encoding hFVIII.
- CO3 sequence SEQ ID NO:21
- vectors including AAV-SPK-8005 expressed higher hFVIII levels compared to reference AAV-CO3vector.
- the data surprisingly reveal that several of the DNA sequences expressed higher levels of FVIII than a codon-optimized sequence (CO3, SEQ ID NO:21) encoding FVIII.
- AAV-Spark8005 also designated SPK-8005
- AAV-LK03-hFVIII also designated AAV-LK03-hFVIII and SPK-8011
- hFVIII transgene expression was used in this study to ensure efficient transduction (i.e.; hFVIII transgene expression) of mouse hepatocytes.
- this study was designed to evaluate the safety of sustained hFVIII expression, and not the safety of the AAV-LK03 capsid.
- the three doses of AAV-SPK-8005-hFVIII used (4 ⁇ 10 10 , 8 ⁇ 10 10 , 1.6 ⁇ 10 11 vg/mouse; approximately 1.6 ⁇ 10 12 , 3.2 ⁇ 10 12 , 6.4 ⁇ 10 12 vg/kg, based on mouse weight of 25 g) were chosen to generate approximately 5-25, 25-75, and 50-150% hFVIII antigen levels, respectively.
- mice were treated with either vehicle or one of the three doses of vector (4 ⁇ 10 10 , 8 ⁇ 10 10 , 1.6 ⁇ 10 11 vg/mouse).
- Ten mice were used for day 29/30 assessments of clinical chemistries, 10 were used for hematology, and coagulation assessments were made on the remaining 10 animals. These 30 mice were sacrificed on day 29 or 30.
- the other group of 30 mice that were treated with either vehicle or one of the three vector doses was handled similarly at the day 87 timepoint, and they were sacrificed on day 87.
- gross pathology observations were performed on all animals in the Main study and comprehensive histopathology was performed on 10 animals/cohort per timepoint (hematology subset).
- Another cohort of 30 na ⁇ ve mice was used for background control clinical pathology measurements.
- mice were injected with vehicle or one of the three vector doses. These animals were bled prior to test article injection and serially on days 15, 30, 60, and 87.
- the intended volume of plasma collected for each sample should have been sufficient for determination of both hFVIII antigen and D-dimer levels.
- due to insufficient plasma volume collections only a single assay was performed on individual mouse plasma at all timepoints, with the exception of the terminal timepoint.
- some mice were evaluated for circulating levels of hFVIII antigen and others for D-dimer levels. Since more plasma is required to perform the hFVIII ELISA (minimum of 50 uL) than the D-dimer ELISA (minimum of 20 uL), the choice of assay was dictated by the volume of plasma collected.
- hFVIII antigen As shown in FIGS. 3A-3B , a dose-response was observed in the circulating levels of hFVIII antigen over the course of 87 days.
- average hFVIII levels 64+/ ⁇ 49 ng/ml were seen at day 60 post-injection, and 115+/ ⁇ 60 ng/ml and 273+/58 ng/ml were seen at the mid and high doses, respectively.
- antigen levels represent 43, 77, and 182% of normal hFVIII antigen (150 ng/mL is equivalent to 100%).
- the six Main study animals were evaluated histopathologically, and malignant lymphomas were observed in four of these six mice, including one vehicle control-injected mouse. (Group 1 animal 7729, Group 3 animal 7871, Group 3 animal 7880, and Group 3 animal 7874).
- the biological significance of the neoplastic findings was considered to be equivocal.
- Statistical significance of individual group comparisons to the control group was considered unlikely.
- a high spontaneous frequency of thymic lymphomas, as well as neoplastic enlargements of spleens and lymph nodes are known to occur in this strain (Prochazka, Gaskins, Shultz, & Leiter, 1992).
- Non-neoplastic findings related to the test article were not present in these six mice.
- the microscopic findings observed were considered incidental and of the nature commonly observed in this strain and age of mice, and/or were of similar incidence and severity in control and treated animals and, therefore, were considered unrelated to administration of AAV-SPK-8005-hFVIII.
- mice included in the Main study survived to the scheduled timepoints. No adverse or AAV-SPK-8005-hFVIII-related clinical observations occurred in the mice throughout the study. All clinical observations of scab formation, fur loss or thin cover and bent tail were considered unrelated to administration of AAV-SPK-8005-hFVIII, because these observations are common in this mouse species and/or occurred across groups. Body weights and body weight gains were comparable among dose groups and unaffected by administration of AAV-SPK-8005-hFVIII.
- Clinical pathology was performed on the Main study animals. Clinical chemistry parameters were analyzed on 10 mice/cohort per time point (day 29/30 and day 87). Coagulation assessments were performed on another group of 10 mice/cohort, and hematology measurements were made on the other group of 10 mice/cohort. Gross pathology was performed on all animals and histopathology was performed on the group of 10 mice utilized for hematology assessments. There were no AAV-SPK-8005-hFVIII-related changes in hematology or clinical chemistry parameters in mice from either the Day 29/30 and Day 87 euthanasia timepoints.
- Another group of 120 Main study mice (30/cohort) were sacrificed 87 days post-injection and analyzed in a similar manner. Although no gross pathology observations considered related to AAV-SPK-8005-hFVIII were seen, lesions were observed in four mice (one enlarged thymus not analyzed histologically, one enlarged thymus correlated to malignant lymphoma, one enlarged spleen not analyzed histologically, one discolored testis). In contrast to what was observed at day 29/30, decreased heart weights, not increased weights were observed. In addition, decreases in liver weights were seen. The statistically significant changes in heart weight were small and not clearly related to dose.
- liver weights to body and brain weight were comparable among groups. Therefore the slight changes were interpreted as incidental and unrelated to administration of AAV-SPK-8005-hFVIII. No other organ weight changes were noted at Day 87.
- mice on day 87 post-injection identified four animals with neoplastic findings. Malignant lymphoma was observed in one Group 2 animal (7808) and three Group 3 animals (7868, 7869 and 7870). No neoplastic findings were observed in Group 1. The biological significance of the neoplastic findings is considered to be equivocal. Statistical significance of individual group comparisons to the control group is unlikely. However, it is noteworthy that neoplastic findings were only observed in treated animals at Day 87. In the absence of historical control data for NOD SCID mice at a comparable age these neoplastic findings are inconclusive.
- AAV-SPK-8005-hFVIII did not result in any test article-related mortality, adverse clinical observations or changes in body weight. There were no toxicologically important differences in organ weights, hematology or coagulation parameters and no treatment-related gross pathology or histopathology findings in the male mice at Days 29/30 or Day 87.
- FVIII transgene constructs packaged into adeno-associated viral (AAV) vectors were delivered to non-human primates (NHPs).
- NHPs received an intravenous infusion via the saphenous vein using a calibrated infusion pump over approximately 30 minutes. Macaques were prescreened for neutralizing antibodies against the AAV capsid. All treated animals were initially determined to have a ⁇ 1:3 titer before vector administration. This was done to ensure successful hepatic transduction, as even low titers inhibit vector uptake by liver cells after systemic delivery (Jiang et al. 2006). All animals were also negative for the presence of neutralizing antibodies against FVIII before gene transfer.
- Plasma levels of hFVIII were measured by a human-specific ELISA that does not detect the cynomolgus endogenous FVIII. All the animals in the study, with the exception of one macaque in the mid dose cohort, express hFVIII following vector delivery. Human factor VIII antigen levels peaked at around 1-2 weeks following vector administration. At one week after gene transfer, NHPs transduced with 2 ⁇ 10 12 vg/kg of AAV-SPK-8005 expressed hFVIII antigen levels of 13.2 ⁇ 3% (average ⁇ standard error of the mean). At one week after gene transfer, average hFVIII levels in two of the three animals in the next treatment cohort (5 ⁇ 10 12 vg/kg) were 27 ⁇ 0.2%.
- D-dimer antigen levels were measured in this study. It should be noted that reports on the clinical relevance or even the normal values of D-dimer antigen levels in cynomolgus macaques are scarce; as a reference, the normal range for D-dimers in humans is below 500 ng/ml. Since the animals express endogenous cynomolgus FVIII, production of hFVIII as a result of hepatic gene transfer will result in supraphysiological levels of FVIII activity.
- D-dimer levels up to week 5 are shown in FIG. 7 .
- One animal in the high dose cohort had a slight (577 ng/ml), transient elevation in D-dimer levels one week after vector administration, when circulating human FVIII peaked at around 100%; the D-dimer levels rapidly returned to normal after this single elevate measurement.
- there was no correlation between D-dimer levels and hFVIII antigen levels FIG. 7 , bottom panels).
- the hFVIII antigen data is shown in FIG. 9 .
- Average hFVIII antigen levels peaked around week 2-3 with 22.3 ⁇ 6.2% hFVIII seen in the low dose cohort and 61.6 ⁇ 15.7% and 153 ⁇ 58.1% observed in the mid and high dose cohorts, respectively, using 150 ng/ml as the 100% normal hFVIII antigen level ( FIGS. 9A-9D ).
- the LK03 AAV capsid serotype efficiently transduces NHP hepatocytes in vivo unlike mouse liver.
- FVIII expression levels attained with AAV-SPK-8011 were compared to reported levels of FVIII attained with AAV5 and AAV8 capsid based AAV vectors for delivery of FVIII.
- a comparison revealed levels of FVIII achieved with AAV-SPK-8011 (LK03 capsid) were greater than the reported levels of FVIII delivered by way of AAV vectors with AAV5 and AAV8 capsids ( FIG. 10 ).
- Humoral response to hFVIII in plasma of cynomolgus macaques was measured following administration of either 2 ⁇ 10 12 , 6 ⁇ 10 12 or 2 ⁇ 10 13 vg/kg of AAV-SPK-8011 (LK03 capsid). The animals were assessed for anti-hFVIII IgG antibodies by ELISA at baseline and at the indicated time points.
- AAV-LK03 capsid Biodistribution of the AAV-LK03 capsid in non-human primates was evaluated in a non-GLP study. Intravenous administration of an AAV-LK03-encapsidated vector encoding human coagulation factor IX (AAV-LK03-hFIX) showed that the two main target tissues are the liver and the spleen ( FIG. 11 ). The splenic tropism is not a unique characteristic of AAV-LK03. For example, the AAV5 capsid, which has been used in several liver-directed gene therapy trials (e.g.
- NCT02396342, NCT02082860, NCT02576795 targets the spleen with the same if not higher efficacy than it targets the liver of non-human primates (Paneda et al. 2013).
- the SPK-8011 expression cassette uses the mouse transthyretin or TTR promoter, which is considered liver-specific (Costa, 1991).
- a PCR-based expression analysis measured vector-derived FVIII expression in the livers and spleens of mice after administration of a different AAV vector packaging the same expression cassette as SPK-8011 (i.e. AAV-SPK-8005).
- human FVIII expression in the spleen is several orders of magnitude lower compared with that derived from hepatocytes.
- AAV-LK03 This is the first clinical study to use AAV-LK03, although studies have been conducted using other AAV vectors including several for hemophilia B (NCT02396342, NCT01620801 NCT00076557, NCT02484092, NCT02618915, NCT00979238, NCT01687608) and one for hemophilia A (NCT02576795).
- a study conducted by St. Jude Children's Research Hospital in collaboration with University College London utilized an AAV8 vector carrying a self-complementary genome encoding a codon-optimized human factor IX cDNA, scAAV2/8-LP1-hFIXco.
- luciferase expression was analyzed.
- the AAV-LK03 capsid uniquely demonstrated significantly higher efficiency in transducing human hepatocytes in culture.
- LK03 demonstrated approximately 5-fold higher efficiency in transducing human hepatocytes as compared to non-human primate hepatocytes in vitro. Importantly, these results are consistent across multiple MOIs and replicate studies.
- New Zealand white rabbits were obtained from Covance Research Products (Denver, Pa.) and treated at 6 months of age with AAV vectors produced at the Children's Hospital of Philadelphia Vector Core. The test and control articles were administered via the marginal ear vein.
- An artificial vagina developed by researchers at Argus Research Lab, Inc. (Horsham, Pa.) was used for semen collection.
- the AV is lined with a condom from which the tip is removed and a collection tube is added, and the AV is filled with warm water (55° C.).
- Semen samples were obtained from a practiced buck stimulated by a teaser doe. Samples were collected prior to injection and at 1, 2, 4, 6, 8, and 10 weeks and 3-8 months post-injection. Semen samples were shipped to Charles River Laboratories (Reno, Nev.) for analysis of vector copy number using a validated real-time quantitative PCR assay.
- Blood was collected by medial auricular artery or marginal ear vein puncture prior to AAV administration and at multiple time points (pre, 1 week and 1-6 months post-injection). Each sample was placed on ice following collection, processed to plasma and. stored in an ⁇ 80° C. freezer until shipment to the Sponsor, where it was also kept in an ⁇ 80° C. freezer until the assay was performed.
- FIX human FIX
- FIX:EIA sandwich-style FIX ELISA kit
- Reference plasma with a known human hFIX concentration was diluted to generate a standard curve (the highest standard [500 ng/ml] was serially diluted down to 7.8 ng/ml).
- Sample plasmas were diluted depending on the expected concentration so that the absorbance values fell within the range of the standard curve.
- HRP horseradish peroxidase
- the anti-hFIX assay is conceptually and methodologically similar to the hFIX ELISA described above.
- plates were coated with 1 ⁇ g/ml of recombinant hFIX (Benefix, Wyeth).
- a goat anti-rabbit IgG HRP-conjugated antibody (SIGMA, A4914) is used for detection. Samples with an IgG level two-fold higher than baseline readings were considered positive.
- Q-PCR quantitative polymerase chain reaction
- Semen samples were considered to be positive if they had detectable hFIX levels above the lower limit of quantitation (LLOQ) (10 copies/reaction or 50 copies/ ⁇ g at approximately 200 ng/reaction). Semen samples from rabbits that were negative for hFIX vector sequences on at least three consecutive timepoints were not analyzed further.
- LLOQ lower limit of quantitation
- Pretreatment semen DNA from all vector and vehicle-injected animals was negative for hFIX sequences.
- the semen from rabbits injected with the low dose of AAV-SPK-hFIX (1 ⁇ 10 12 vg/kg) was in general negative for hFIX sequences, except for three animals that had low levels at weeks 1-4 (maximum 3151 copies/ ⁇ g DNA or ⁇ 1 ⁇ 10 ⁇ 2 copies/haploid genome). None of the samples collected beyond week 4 were positive for vector sequences (Table 3).
- Circulating hFIX levels were measured in plasma samples from the animals described above at the indicated timepoints ( FIGS. 14A-14B and Table 4).
- the AAV-LK03 vector appeared to be a more potent vector compared with AAV-SPK, as measured by circulating hFIX levels.
- this difference did not reach statistical significance, likely due to the limited number of animals.
- no hFIX expression was detected seven days after administration of the AAV-SPK vector, whereas robust expression derived from the AAV-LK03 was observed at the same time point.
- the low hFIX levels in two of the animals (rabbits #5 and #15), barely detectable above background, might be attributed to failed injections. Eliminating these animals from the analysis did not change the lack of statistical significance.
- the two capsids appeared to be equally potent when tested at the high dose. Specifically, six months after treatment with 1 ⁇ 10 13 vg/kg of AAV-LK03 or AAV-SPK, average hFIX levels were 2226 ⁇ 868 ng/ml vs. 2052 ⁇ 909 ng/ml, respectively ( FIG. 14B ).
- two different hFIX coding sequences were used in the AAV-SPK group, i.e. three animals received AAV-SPK-hFIX.C16 and two animals were treated with AAV-SPK-hFIX.C19-Padua (PD).
- hFIX.C16 and hFIX.C19-PD transgenes are codon-optimized and encodes a high specific activity hFIX variant, which affects the biological activity of the protein, but not antigen levels, as measured by ELISA.
- FIGS. 15A-15B and Tables 5A and 5B summarize anti-AAV IgG levels in this study.
- three out of five animals treated with the low dose of AAV-LK03 were positive for human FIX antibodies one month after vector administration, but the IgG levels declined with time and only one animal was barely twice the baseline levels at the end of the study (Table 5B).
- AAV-SPK and AAV-LK03 vectors to semen were quantified using a validated assay over the course of up to eight months.
- AAV-SPK vector sequences were detected in semen of all five rabbits one week after administration of the high vector dose. The majority of the animals cleared the sequences by week 10 and the last detected positive sample occurred at month 5. This is similar to the time course of an AAV8 vector administered to rabbits at the same dose vectors (Favaro P, et al., Molecular Therapy 17:1022-1030 (2009)).
- very limited distribution of AAV-LK03 was observed following a high dose of this vector, with three of five animals showing no vector sequences in semen at any timepoint.
- AAV-SPK has a similar pattern as the previously investigated serotypes, AAV2 and AAV8 vectors (Favaro P, et al., Molecular Therapy 17:1022-1030 (2009)). That is, there is a dose-dependent dissemination of AAV vector sequences to semen, with complete clearance over time.
- AAV-LK03 differs from AAV2, AAV8, and AAV-SPK, in that very little vector distributes to the semen, potentially making this vector capsid safer than the others in terms of genotoxicity.
- a clinical study will be conducted to determine safety and kinetics of a single IV infusion of AAV-FVIII.
- the AAV capsid that will be used for the AAV vector will have shown in preclinical studies to have had good safety and efficacy, the ability to achieve clinically relevant FVIII activity levels at dose of about 1 ⁇ 10 12 vg/kg or greater, optionally after 1-3 months of vector infusion; and cross reacting neutralizing antibodies (Ab) to the AAV capsid approximately 10% less prevalent than AAV8.
- the design of a representative clinical study can be as shown in Table 6.
- TTR transthyretin
- TTR promoter with 4 nucleotide mutation SEQ ID NO: 22 GTCTGTCTGCACATTTCGTAGAGCGAGTGTTCCGATACTCTAATCTCCCT AGGCAAGGTTCATATT GACT TAGGTTACTTATTCTCCTTTTGTTGACTAA GTCAATAATCAGAATCAGCAGGTTTGGAGTCAGCTTGGCAGGGATCAGCA GCCTGGGTTGGAAGGAGGGGGTATAAAAGCCCCTTCACCAGGAGAAGCCG TCACACAGATCCACAAGCTCCT
- BDD all or at least part of B domain (BD) deleted
- FVIII-BDD FVIII with B domain deletion
- FVIII/SQ FVIII with SQ FVIIIX01-X18: CpG reduced FVIII encoding nucleic acid variants, set forth as SEQ ID Nos: 1-18, respectively.
- TTRmut TTR promoter with 4 mutations, from TAmGTGTAG to TATTGACTTAG CO3: codon optimized FVIII nucleic acid variant, set forth as SEQ ID NO:21
- NHP Non human primate ALT: Alanine aminotransferase D-dimer: A protein fragment from the break down of a blood clot SPK-8005: AAV capsid (SEQ ID NO:28)+TTRmut-hFVIII-X07; also referred to as AAV-SPK-8005 SPK-8011: AAV LK03 capsid (SEQ ID NO:27)+TTRmut-hFVIII-X07; also referred to as AAV-SPK-8011
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Medicinal Chemistry (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Epidemiology (AREA)
- Hematology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Toxicology (AREA)
- Transplantation (AREA)
- Diabetes (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US15/772,025 US20180312571A1 (en) | 2015-10-30 | 2016-10-31 | CpG REDUCED FACTOR VIII VARIANTS, COMPOSITIONS AND METHODS AND USES FOR TREATMENT OF HEMOSTASIS DISORDERS |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201562249001P | 2015-10-30 | 2015-10-30 | |
| US201662331872P | 2016-05-04 | 2016-05-04 | |
| US201662349532P | 2016-06-13 | 2016-06-13 | |
| US201662357874P | 2016-07-01 | 2016-07-01 | |
| PCT/US2016/059793 WO2017075619A1 (en) | 2015-10-30 | 2016-10-31 | Cpg reduced factor viii variants, compositions and methods and uses for treatment of hemostasis disorders |
| US15/772,025 US20180312571A1 (en) | 2015-10-30 | 2016-10-31 | CpG REDUCED FACTOR VIII VARIANTS, COMPOSITIONS AND METHODS AND USES FOR TREATMENT OF HEMOSTASIS DISORDERS |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2016/059793 A-371-Of-International WO2017075619A1 (en) | 2015-10-30 | 2016-10-31 | Cpg reduced factor viii variants, compositions and methods and uses for treatment of hemostasis disorders |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US18/960,905 Continuation US20250171521A1 (en) | 2015-10-30 | 2024-11-26 | CpG REDUCED FACTOR VIII VARIANTS, COMPOSITIONS AND METHODS AND USES FOR TREATMENT OF HEMOSTASIS DISORDERS |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| US20180312571A1 true US20180312571A1 (en) | 2018-11-01 |
Family
ID=58630834
Family Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US15/772,025 Abandoned US20180312571A1 (en) | 2015-10-30 | 2016-10-31 | CpG REDUCED FACTOR VIII VARIANTS, COMPOSITIONS AND METHODS AND USES FOR TREATMENT OF HEMOSTASIS DISORDERS |
| US15/462,660 Active US11168124B2 (en) | 2015-10-30 | 2017-03-17 | CpG reduced factor VIII variants, compositions and methods and uses for treatment of hemostasis disorders |
| US18/960,905 Pending US20250171521A1 (en) | 2015-10-30 | 2024-11-26 | CpG REDUCED FACTOR VIII VARIANTS, COMPOSITIONS AND METHODS AND USES FOR TREATMENT OF HEMOSTASIS DISORDERS |
Family Applications After (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US15/462,660 Active US11168124B2 (en) | 2015-10-30 | 2017-03-17 | CpG reduced factor VIII variants, compositions and methods and uses for treatment of hemostasis disorders |
| US18/960,905 Pending US20250171521A1 (en) | 2015-10-30 | 2024-11-26 | CpG REDUCED FACTOR VIII VARIANTS, COMPOSITIONS AND METHODS AND USES FOR TREATMENT OF HEMOSTASIS DISORDERS |
Country Status (19)
| Country | Link |
|---|---|
| US (3) | US20180312571A1 (https=) |
| EP (1) | EP3368560B1 (https=) |
| JP (3) | JP7088831B2 (https=) |
| KR (1) | KR20180090795A (https=) |
| CN (1) | CN108368164A (https=) |
| AU (1) | AU2016344030B2 (https=) |
| BR (1) | BR112018008766A2 (https=) |
| CA (1) | CA3002689A1 (https=) |
| CL (1) | CL2018001107A1 (https=) |
| CO (1) | CO2018005306A2 (https=) |
| IL (1) | IL258959B2 (https=) |
| MX (2) | MX2018005490A (https=) |
| MY (1) | MY190926A (https=) |
| PE (2) | PE20231949A1 (https=) |
| PH (1) | PH12018501055A1 (https=) |
| RU (1) | RU2745506C2 (https=) |
| SA (1) | SA518391463B1 (https=) |
| SG (1) | SG11201802972UA (https=) |
| WO (1) | WO2017075619A1 (https=) |
Families Citing this family (27)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB201508026D0 (en) | 2015-05-11 | 2015-06-24 | Ucl Business Plc | Capsid |
| MX390848B (es) | 2015-06-23 | 2025-03-21 | Childrens Hospital Philadelphia | Factor ix modificado, y composiciones, metodos y usos para la transferencia de genes a celulas, organos y tejidos. |
| PE20231949A1 (es) * | 2015-10-30 | 2023-12-05 | Spark Therapeutics Inc | VARIANTES DEL FACTOR VIII REDUCIDO CON CpG, COMPOSICIONES Y METODOS Y USOS PARA EL TRATAMIENTO DE TRASTORNOS DE LA HEMOSTASIA |
| IL305149A (en) | 2016-07-26 | 2023-10-01 | Biomarin Pharm Inc | Novel adeno-associated virus capsid proteins |
| PE20200722A1 (es) * | 2017-08-01 | 2020-07-21 | Spark Therapeutics Inc | Metodos de terapia genica del factor viii (fviii) |
| NZ762100A (en) | 2017-08-09 | 2025-12-19 | Bioverativ Therapeutics Inc | Nucleic acid molecules and uses thereof |
| KR101952102B1 (ko) * | 2017-12-07 | 2019-02-26 | 주식회사 지앤피바이오사이언스 | 단백질 발현량이 증대된 인자 ⅷ 변이체 발현벡터 |
| TW202016314A (zh) | 2018-05-09 | 2020-05-01 | 美商拜奧馬林製藥公司 | 治療苯丙酮尿症之方法 |
| TW202016298A (zh) | 2018-05-14 | 2020-05-01 | 美商拜奧馬林製藥公司 | Aav 載體於幼年受試者中之穩定表現 |
| TW202005978A (zh) | 2018-05-14 | 2020-02-01 | 美商拜奧馬林製藥公司 | 新穎肝靶向腺相關病毒載體 |
| EP3833766A1 (en) | 2018-08-09 | 2021-06-16 | Bioverativ Therapeutics Inc. | Nucleic acid molecules and uses thereof for non-viral gene therapy |
| US10842885B2 (en) | 2018-08-20 | 2020-11-24 | Ucl Business Ltd | Factor IX encoding nucleotides |
| GB201813528D0 (en) | 2018-08-20 | 2018-10-03 | Ucl Business Plc | Factor IX encoding nucleotides |
| BR112021003399A2 (pt) * | 2018-08-24 | 2021-05-18 | Spark Therapeutics, Inc. | sequências de promotores otimizadas, construtos de expressão livres de íntron e métodos de uso |
| CA3119349A1 (en) * | 2018-11-16 | 2020-05-22 | Spark Therapeutics, Inc. | In vitro assay for detecting enhancers and inhibitors of adeno associated virus (aav) vector transduction and/or detecting or quantitating anti-aav binding antibodies |
| GB201900702D0 (en) | 2019-01-18 | 2019-03-06 | Univ Bristol | Therapy |
| SG11202108357PA (en) | 2019-02-15 | 2021-08-30 | Crispr Therapeutics Ag | Gene editing for hemophilia a with improved factor viii expression |
| SG11202109850SA (en) | 2019-03-13 | 2021-10-28 | Generation Bio Co | Non-viral dna vectors and uses thereof for expressing fviii therapeutics |
| CN114929735A (zh) * | 2019-11-01 | 2022-08-19 | 自由行疗法有限公司 | 因子viii构建体 |
| JP2023510392A (ja) * | 2020-01-16 | 2023-03-13 | 武田薬品工業株式会社 | フェニルケトン尿症に対するアデノ随伴ウイルスベースの遺伝子治療 |
| GB202009039D0 (en) | 2020-06-15 | 2020-07-29 | Univ Bristol | Therapy |
| WO2023036054A2 (en) * | 2021-09-08 | 2023-03-16 | Inspirar Limited | Composition and method for treating hemophilia |
| KR20250007615A (ko) * | 2022-04-28 | 2025-01-14 | 조인트 스탁 컴퍼니 "바이오케드" | Fviii-bdd를 인코딩하는 코돈 최적화된 핵산 |
| JP2025529195A (ja) * | 2022-08-31 | 2025-09-04 | ハイドロジーン セラピューティクス,インコーポレイテッド | 流体力学的遺伝子送達のための方法および組成物 |
| CN115948408A (zh) * | 2022-09-23 | 2023-04-11 | 上海信致医药科技有限公司 | 改进的人凝血因子viii基因表达盒及其应用 |
| WO2025164792A1 (ja) * | 2024-02-02 | 2025-08-07 | 学校法人自治医科大学 | 高比活性/高分泌発現型の第viii因子改変体、高発現型の第viii因子コード核酸及びそれらの用途 |
| WO2025180508A1 (en) * | 2024-02-29 | 2025-09-04 | Shanghai Vitalgen Biopharma Co., Ltd. | Human factor viii variant expression cassettes and uses thereof for treating hemophilia a |
Family Cites Families (31)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6093699A (en) | 1987-07-09 | 2000-07-25 | The University Of Manitoba | Method for gene therapy involving suppression of an immune response |
| WO1994017810A1 (en) | 1993-02-12 | 1994-08-18 | The Wistar Institute Of Anatomy And Biology | Recombinant cytomegalovirus vaccine |
| EP0708658A4 (en) | 1993-04-16 | 1997-05-21 | Wistar Inst | RECOMBINANT CYTOMEGALOVIRUS VACCINE |
| WO1995005864A1 (en) | 1993-08-27 | 1995-03-02 | Government Of The United States Of America, Represented By The Secretary Of The Department Of Health And Human Services | Convection-enhanced drug delivery |
| AT401270B (de) | 1994-09-26 | 1996-07-25 | Immuno Ag | Verfahren zur quantifizierung von genomischer dna |
| US5998205A (en) | 1994-11-28 | 1999-12-07 | Genetic Therapy, Inc. | Vectors for tissue-specific replication |
| US6818439B1 (en) | 1994-12-30 | 2004-11-16 | Chiron Corporation | Methods for administration of recombinant gene delivery vehicles for treatment of hemophilia and other disorders |
| EA001616B1 (ru) | 1995-02-28 | 2001-06-25 | Зе Риджентс Оф Зи Юнивесити Оф Кэлифоньэ | Способ лечения болезни сердца, способ лечения недостаточности периферических сосудов и способ ограничения доставки и экспрессии трансгенной конструкции в определенном органе или структуре |
| AU2319497A (en) | 1996-03-07 | 1997-09-22 | Regents Of The University Of California, The | Helper-free, totally defective adenovirus for gene therapy |
| US6458563B1 (en) * | 1996-06-26 | 2002-10-01 | Emory University | Modified factor VIII |
| EP0931158A1 (en) | 1996-09-06 | 1999-07-28 | The Trustees Of The University Of Pennsylvania | An inducible method for production of recombinant adeno-associated viruses utilizing t7 polymerase |
| US20020065236A1 (en) | 1998-09-09 | 2002-05-30 | Yew Nelson S. | CpG reduced plasmids and viral vectors |
| US20060099685A1 (en) | 1999-04-15 | 2006-05-11 | Yallop Christopher A | Recombinant expression of factor VIII in human cells |
| EP1240900B1 (en) * | 1999-12-24 | 2009-05-06 | Juridical Foundation, The Chemo-Sero-Therapeutic Research Institute | Factor viii or von willebrand factor for the treatment of hemorrhagic diseases associating thrombopathy |
| PL206105B1 (pl) * | 2000-09-19 | 2010-07-30 | Emory Universityemory University | Zmodyfikowany ludzki czynnik VIII oraz sposób modyfikacji ludzkiego czynnika VIII ze zmniejszeniem reaktywności na przeciwciało hamujące i zachowaniem aktywności prokoagulacyjnej |
| DE102004037611B4 (de) * | 2004-08-03 | 2013-10-02 | Geneart Ag | Induzierbare Genexpression |
| GB0908515D0 (en) | 2009-05-18 | 2009-06-24 | Apitope Technology Bristol Ltd | Peptide |
| GB0911870D0 (en) * | 2009-07-08 | 2009-08-19 | Ucl Business Plc | Optimised coding sequence and promoter |
| PT3513804T (pt) | 2011-07-08 | 2022-06-02 | Bioverativ Therapeutics Inc | Polipéptidos fator viii híbridos e quiméricos, e métodos de utilização dos mesmos |
| ES2857773T5 (es) | 2011-08-24 | 2024-06-04 | Univ Leland Stanford Junior | Nuevas proteínas de la cápside de AAV para la transferencia de ácidos nucleicos |
| EP2822577B1 (en) * | 2012-02-15 | 2019-02-06 | Bioverativ Therapeutics Inc. | Recombinant factor viii proteins |
| NZ701693A (en) | 2012-04-18 | 2017-02-24 | The Children’S Hospital Of Philadelphia | Composition and methods for highly efficient gene transfer using aav capsid variants |
| US20140271550A1 (en) | 2013-03-14 | 2014-09-18 | The Trustees Of The University Of Pennsylvania | Constructs and Methods for Delivering Molecules via Viral Vectors with Blunted Innate Immune Responses |
| IL297919A (en) | 2013-07-22 | 2023-01-01 | Childrens Hospital Philadelphia | Variant aav and compositions, methods and uses for gene transfer to cells, organs and tissues |
| EP3044231B1 (en) | 2013-09-12 | 2020-08-05 | BioMarin Pharmaceutical Inc. | Aav vectors comprising a gene encoding factor viii |
| WO2015054439A2 (en) * | 2013-10-08 | 2015-04-16 | Haplomics, Inc. | Hybrid factor viii polypeptides for use to treat hemophilia a |
| GB201403684D0 (en) * | 2014-03-03 | 2014-04-16 | King S College London | Vector |
| CN107427557B (zh) * | 2014-08-13 | 2022-01-04 | 费城儿童医院 | 用于包装和表达变体因子viii以治疗血友病的改良表达组件 |
| MY189674A (en) | 2015-10-28 | 2022-02-24 | Sangamo Therapeutics Inc | Liver-specific constructs, factor viii expression cassettes and methods of use thereof |
| PE20231949A1 (es) * | 2015-10-30 | 2023-12-05 | Spark Therapeutics Inc | VARIANTES DEL FACTOR VIII REDUCIDO CON CpG, COMPOSICIONES Y METODOS Y USOS PARA EL TRATAMIENTO DE TRASTORNOS DE LA HEMOSTASIA |
| PE20200722A1 (es) | 2017-08-01 | 2020-07-21 | Spark Therapeutics Inc | Metodos de terapia genica del factor viii (fviii) |
-
2016
- 2016-10-30 PE PE2023001716A patent/PE20231949A1/es unknown
- 2016-10-31 EP EP16861065.7A patent/EP3368560B1/en active Active
- 2016-10-31 PE PE2018000713A patent/PE20181168A1/es unknown
- 2016-10-31 MX MX2018005490A patent/MX2018005490A/es unknown
- 2016-10-31 MY MYPI2018000612A patent/MY190926A/en unknown
- 2016-10-31 BR BR112018008766-1A patent/BR112018008766A2/en active IP Right Grant
- 2016-10-31 IL IL258959A patent/IL258959B2/en unknown
- 2016-10-31 RU RU2018119710A patent/RU2745506C2/ru active
- 2016-10-31 KR KR1020187015213A patent/KR20180090795A/ko active Pending
- 2016-10-31 AU AU2016344030A patent/AU2016344030B2/en active Active
- 2016-10-31 JP JP2018521281A patent/JP7088831B2/ja active Active
- 2016-10-31 WO PCT/US2016/059793 patent/WO2017075619A1/en not_active Ceased
- 2016-10-31 SG SG11201802972UA patent/SG11201802972UA/en unknown
- 2016-10-31 US US15/772,025 patent/US20180312571A1/en not_active Abandoned
- 2016-10-31 CN CN201680063183.9A patent/CN108368164A/zh active Pending
- 2016-10-31 CA CA3002689A patent/CA3002689A1/en active Pending
-
2017
- 2017-03-17 US US15/462,660 patent/US11168124B2/en active Active
-
2018
- 2018-04-26 CL CL2018001107A patent/CL2018001107A1/es unknown
- 2018-04-29 SA SA518391463A patent/SA518391463B1/ar unknown
- 2018-04-30 PH PH12018501055A patent/PH12018501055A1/en unknown
- 2018-04-30 MX MX2023001600A patent/MX2023001600A/es unknown
- 2018-05-21 CO CONC2018/0005306A patent/CO2018005306A2/es unknown
-
2022
- 2022-06-09 JP JP2022093877A patent/JP2022137029A/ja active Pending
-
2024
- 2024-08-08 JP JP2024131729A patent/JP2024170416A/ja active Pending
- 2024-11-26 US US18/960,905 patent/US20250171521A1/en active Pending
Non-Patent Citations (2)
| Title |
|---|
| Kattenhorn et al. "Adeno-Associated Virus Gene Therapy for Liver Disease."Hum Gene Ther . 2016 Dec;27(12):947-961. (Year: 2016) * |
| Provide. (verb) In Merriam-Webster’s collegiate dictionary. https://www.merriam-webster.com/thesaurus/provide. acessed 6/22/2024 (Year: 2024) * |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20250171521A1 (en) | CpG REDUCED FACTOR VIII VARIANTS, COMPOSITIONS AND METHODS AND USES FOR TREATMENT OF HEMOSTASIS DISORDERS | |
| US20200237930A1 (en) | Factor viii (fviii) gene therapy methods | |
| EP3180022B1 (en) | An improved expression cassette for packaging and expression of variant factor viii for the treatment of hemostasis disorders | |
| US20190144524A1 (en) | Factor viii variants, nucleic acid sequences, and methods and uses for treatment of hemostasis disorders | |
| US20250073353A1 (en) | Factor viii (fviii) gene therapy methods | |
| RU2808274C2 (ru) | Способы генотерапии с использованием гена фактора viii (fviii) | |
| BR112017002781B1 (pt) | Variante de ácido nucleico codificando o fator viii, seu uso, vetor de expressão, vetor viral, vetor aav, célula hospedeira in vitro e composição farmacêutica |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AS | Assignment |
Owner name: SPARK THERAPEUTICS, INC., PENNSYLVANIA Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ANGUELA, XAVIER;REEL/FRAME:045671/0395 Effective date: 20170303 Owner name: INTEGRATED DNA TECHNOLOGIES, INC., IOWA Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:SHEN, SAM HSIEN-I;REEL/FRAME:045671/0602 Effective date: 20170602 Owner name: SPARK THERAPEUTICS, INC., PENNSYLVANIA Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:INTEGRATED DNA TECHNOLOGIES, INC.;REEL/FRAME:045671/0841 Effective date: 20170602 |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: NON FINAL ACTION MAILED |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: NON FINAL ACTION MAILED |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: FINAL REJECTION MAILED |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: NON FINAL ACTION MAILED |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: FINAL REJECTION MAILED |
|
| STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION |