US20150086581A1 - Fast Diagnosis and Personalized Treatment for Acne - Google Patents

Fast Diagnosis and Personalized Treatment for Acne Download PDF

Info

Publication number
US20150086581A1
US20150086581A1 US14/385,576 US201314385576A US2015086581A1 US 20150086581 A1 US20150086581 A1 US 20150086581A1 US 201314385576 A US201314385576 A US 201314385576A US 2015086581 A1 US2015086581 A1 US 2015086581A1
Authority
US
United States
Prior art keywords
seq
acnes
locus
strain
strains
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US14/385,576
Other languages
English (en)
Inventor
Huiying Li
Shuta Tomida
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of California San Diego UCSD
Original Assignee
University of California San Diego UCSD
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of California San Diego UCSD filed Critical University of California San Diego UCSD
Priority to US14/385,576 priority Critical patent/US20150086581A1/en
Assigned to THE REGENTS OF THE UNIVERSITY OF CALIFORNIA reassignment THE REGENTS OF THE UNIVERSITY OF CALIFORNIA ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: MODLIN, ROBERT L., TOMIDA, SHUTA, MILLER, JEFFERY F., FITZ-GIBBON, SOREL T., LI, HUIYING
Assigned to NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT reassignment NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: UNIVERSITY OF CALIFORNIA LOS ANGELES
Publication of US20150086581A1 publication Critical patent/US20150086581A1/en
Assigned to THE REGENTS OF THE UNIVERSITY OF CALIFORNIA reassignment THE REGENTS OF THE UNIVERSITY OF CALIFORNIA ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: TOMIDA, SHUTA, LI, HUIYING
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/74Bacteria
    • A61K35/741Probiotics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/76Viruses; Subviral particles; Bacteriophages
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/02Bacterial antigens
    • A61K39/0208Specific bacteria not otherwise provided for
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/02Bacterial antigens
    • A61K39/05Actinobacteria, e.g. Actinomyces, Streptomyces, Nocardia, Bifidobacterium, Gardnerella, Corynebacterium; Propionibacterium
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/10Anti-acne agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701Specific hybridization probes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2795/00Bacteriophages
    • C12N2795/00011Details
    • C12N2795/00032Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/112Disease subtyping, staging or classification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/16Primer sets for multiplex assays

Definitions

  • Acne is a skin condition that causes pimples or “zits.” This includes whiteheads, blackheads, and red, inflamed patches of skin (such as cysts). Acne occurs when tiny pores on the surface of the skin become clogged. Each pore opens to a follicle. A follicle contains a hair and an oil gland. The oil released by the gland helps remove old skin cells and keeps your skin soft. When glands produce too much oil, the pores can become blocked. Dirt, bacteria, and cells build up. The blockage is called a plug or comedone. If the top of the plug is white, it is called a whitehead. If the top of the plug is dark, it is called a blackhead. If the plug breaks open, swelling and red bumps occur. Acne that is deep in your skin can cause hard, painful cysts. This is called cystic acne.
  • Acne is most common in teenagers, but anyone can get acne. 85% of teenagers have acne. Hormonal changes may cause the skin to be more oily. Acne tends to run in families. It may be triggered by hormonal changes related to puberty, menstrual periods, pregnancy, birth control pills, or stress; greasy or oily cosmetic and hair products; certain drugs (such as steroids, testosterone, estrogen, and phenyloin); or high levels of humidity and sweating.
  • acne treatments work by reducing oil production, speeding up skin cell turnover, fighting bacterial infection, reducing the inflammation or doing all four.
  • These types of acne treatments include over-the-counter topical treatments, antibiotics, oral contraceptives and cosmetic procedures.
  • Acne lotions may dry up the oil, kill bacteria and promote sloughing of dead skin cells.
  • Over-the-counter (OTC) lotions are generally mild and contain benzoyl peroxide, sulfur, resorcinol, salicylic acid or sulfur as their active ingredient.
  • OTC Over-the-counter
  • Antibiotics may cause side effects, such as an upset stomach, dizziness or skin discoloration.
  • Isotretinoin Amnesteem, Claravis, Sotret
  • isotretinoin has many side effects, such as dry skin, depression, severe stomach pain, and muscle/joint/back pain, and can cause birth defects in babies whose mothers use isotretinoin.
  • Oral contraceptives including a combination of norgestimate and ethinyl estradiol (Ortho Tri-Cyclen, Previfem, others), can improve acne in women.
  • oral contraceptives may cause other side effects, such as headaches, breast tenderness, nausea, and depression.
  • Chemical peels and microdermabrasion may be helpful in controlling acne.
  • These cosmetic procedures which have traditionally been used to lessen the appearance of fine lines, sun damage, and minor facial scars, are most effective when used in combination with other acne treatments. They may cause temporary, severe redness, scaling and blistering, and long-term discoloration of the skin.
  • the present invention is directed to methods of diagnosis and personalized treatment in patients afflicted with acne.
  • the invention provides a method for determining whether an individual possesses acne comprising: obtaining a skin sample from an individual; isolating bacterial DNA from said sample; amplifying 16S ribosomal DNA in said sample; sequencing said amplified DNA products; and typing the individual's DNA based on one or more of the ten major ribotypes (RTs) of P. acnes strains, RT1-RT10 (SEQ ID NOs 1-10), wherein said typing occurs by determining whether said individual possesses one or more of RT1-RT10 and wherein said individual is diagnosed as having acne if said individual possesses RT4, RT5, RT7, RT8, RT9, or RT10.
  • said individual may be diagnosed as having acne if said individual possesses RT4 (SEQ ID NO:4), RT5 (SEQ ID NO:5), or RT8 (SEQ ID NO:8).
  • the invention provides a method for diagnosing different types of acne comprising: obtaining a skin sample from a subject; isolating bacterial DNA from said sample; amplifying 16S ribosomal DNA in said sample; sequencing said amplified DNA products; and typing the subject's DNA based on one or more of the five major microbiome types of P. acnes strains, wherein said subject is diagnosed as having acne if said subject is typed to microbiome IV or V.
  • the invention provides a method for rapidly diagnosing acne comprising: obtaining a skin sample from a subject; isolating bacterial DNA from said sample; using one or more primer sets to amplify said DNA; and analyzing said amplified DNA for the presence of a sequence having at least 95% homology with at least one of SEQ ID NOs 29-32 and 82-434, wherein said subject is diagnosed as having acne if the presence of a sequence having at least 95% homology with at least one of SEQ ID NOs 29-32 and 82-434 exists.
  • said amplified DNA may be analyzed for the presence of a sequence having at least 99% homology with at least one of SEQ ID NOs 29-32 and 82-434 and wherein said subject is diagnosed as having acne if the presence of a sequence having at least 99% homology with at least one of SEQ ID NOs 29-32 and 82-434 exists.
  • said amplified DNA may be analyzed for the presence of at least one of SEQ ID NOs 29-32 and 82-434 and wherein said subject is diagnosed as having acne if the presence of at least one of SEQ ID NOs 29-32 and 82-434 exists.
  • the invention provides a method for rapidly diagnosing acne comprising: obtaining a skin sample from a subject; isolating bacterial DNA from said sample; using one or more primer sets to amplify said DNA; using one or more probes to detect said amplified DNA; and analyzing said probe signals for the presence of Locus 1 (at least one sequence having at least 95% homology to at least one of SEQ ID NOs 29 and 82-97), Locus 2 (at least one sequence having at least 95% homology to at least one of SEQ ID NOs 30 and 98-186), Locus 3 (at least one sequence having at least 95% homology to at least one of SEQ ID NOs 31 and 187-423), and/or Locus 4 (at least one sequence having at least 95% homology to at least one of SEQ ID NOs 32 and 424-434), wherein said subject is diagnosed as having acne if one or more of Loci 1-4 are present.
  • the signals may be analyzed for the presence of Locus 1, Locus 1, Locu
  • a primer of said primer sets may be selected from the group consisting of SEQ ID NOs 11, 12, 17, and 18 (for Locus 1), SEQ ID NOs 13, 14, 20, and 21 (for Locus 2), SEQ ID NOs 15, 16, 23, and 24 (for Locus 3), and SEQ ID NOs 26 and 27 (for Locus 4).
  • said probes may be SEQ ID NO:19 (for Locus 1), SEQ ID NO:22 (for Locus 2), SEQ ID NO:25 (for Locus 3), and SEQ ID NO:28 (for Locus 4).
  • the invention provides a vaccine for the prevention and/or treatment of acne caused by P. acnes comprising a heat inactivated P. acnes strain, an attenuated protein of said strain, or combination thereof, wherein said strain is an RT4 strain, an RT5 strain, an RT7 strain, an RT8 strain, an RT9 strain, or an RT10 strain.
  • the invention provides a vaccine for the prevention and/or treatment of acne caused by P. acnes comprising a heat inactivated P. acnes strain, an attenuated protein of said strain, or combination thereof identified to be specific to a subject based on 16S rDNA sequence analysis of the strains of P. acnes affecting said subject.
  • said heat inactivated P. acnes strain, attenuated protein, or combination thereof may be specific for at least one of unique genomic loci, regions, or sequences identified for the strains of P. acnes .
  • Said heat inactivated P. acnes strain, attenuated protein, or combination thereof may be specific for at least one of Locus 1 (SEQ ID NOs 29 and 82-97), Locus 2 (SEQ ID NOs 30 and 98-186), Locus 3 (31 and 187-423), and Locus 4 (32 and 424-434).
  • the invention provides a method for the personalized treatment of acne comprising determining the strains of P. acnes affecting a subject and treating said subject with an active ingredient directed to at least one detected strain of P. acnes , wherein the active ingredient comprises a drug targeting specific strains of P. acnes , wherein the targeting drug comprises small molecules, antisense molecules, siRNA, biologics, antibodies, and combinations thereof targeting genomic elements specific for strains of P. acnes associated with acne.
  • the invention provides a method for treating acne comprising: administering an effective amount of a probiotic that comprises at least one strain of P. acnes that is associated with healthy or normal skin based on its 16S rDNA.
  • Said strain may be an RT6 strain.
  • Said strain may have at least 95% homology to SEQ ID NO:51 SEQ ID NO:52, SEQ ID NO:53, or SEQ ID NO:54, such as at least 99% homology or 100% homology.
  • the invention provides a method for treating acne comprising: administering an effective amount of a metabolite produced by a strain of P. acnes that is associated with healthy or normal skin, wherein said metabolite is selected from the group comprising bacterial culture supernatant, cell lysate, proteins, nucleic acids, lipids, and other bacterial molecules.
  • Said strain may be an RT6 strain.
  • Said strain may have at least 95% homology to SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, or SEQ ID NO:54, such as at least 99% homology or 100% homology.
  • the invention provides a method for treating acne in a subject comprising: administering an effective amount of a drug specifically targeting RT4, RT5, RT7, RT8, RT9, or RT10, when said subject is determined to possess RT4, RT5, RT7, RT8, RT9, or RT10, respectively.
  • a drug specifically targeting RT4, RT5, RT7, RT8, RT9, or RT10, when said subject is determined to possess RT4, RT5, RT7, RT8, RT9, or RT10, respectively.
  • Said drug may be a small molecule, antisense molecule, siRNA, biologic, antibody, or combination thereof.
  • the invention provides a composition comprising at least one strain of P. acnes that is associated with healthy or normal skin.
  • Said strain may be an RT6 strain.
  • Said strain may have at least 95% homology to SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, or SEQ ID NO:54, such as at least 99% homology or 100% homology.
  • the invention provides a method for diagnosing IB-3-based acne comprising: obtaining a skin sample from a subject; isolating bacterial DNA from said sample; using one or more primer sets to amplify said DNA; and analyzing said amplified DNA for the presence of a sequence having at least 95% homology with at least one of SEQ ID NOs 55-81, wherein said subject is diagnosed as having IB-3-based acne if the presence of a sequence having at least 95% homology with at least one of SEQ ID NOs 55-81 exists.
  • the invention provides a method for the personalized treatment of acne comprising determining the strain(s) of acne affecting a subject and administering to said subject an effective amount of at least one phage specifically directed to said strain(s).
  • the subject may be treated with phage directed against an RT4 strain, an RT5 strain, an RT7 strain, and RT8 strain, an RT9 strain, and/or an RT10 strain.
  • the invention provides a method for treating an individual suffering from acne of microbiome type I comprising administering to said individual an effective amount of a phage, wherein said phage is selected from the group consisting of: PHL113M01 (SEQ ID NO:36), PHL111M01 (SEQ ID NO:33), PHL082M00 (SEQ ID NO:47), PHL060L00 (SEQ ID NO:34), PHL067M10 (SEQ ID NO:42), PHL071N05 (SEQ ID NO:41), PHL112N00 (SEQ ID NO:35), PHL037M02 (SEQ ID NO:40), PHL085N00 (SEQ ID NO:46), PHL115M02 (SEQ ID NO:43), PHL085M01 (SEQ ID NO:44), PHL114L00 (SEQ ID NO:37), PHL010M04 (SEQ ID NO:38), and PHL066M04 (SEQ ID NO:39).
  • PHL113M01 SEQ ID
  • the invention provides a method for treating an individual suffering from acne of microbiome type I with IB-3 strain comprising administering to said individual an effective amount of a phage, wherein said phage is selected from the group consisting of: PHL082M00 (SEQ ID NO:47) and PHL071N05 (SEQ ID NO:41).
  • the invention provides a method for treating an individual suffering from acne of microbiome type II comprising administering to said individual an effective amount of a phage, wherein said phage is selected from the group consisting of: PHL113M01 (SEQ ID NO:36), PHL060L00 (SEQ ID NO:34), PHL112N00 (SEQ ID NO:35), and PHL085M01 (SEQ ID NO:44).
  • the invention provides a method for treating an individual suffering from acne of microbiome type III or dominant RT8 comprising administering to said individual an effective amount of a phage, wherein said phage is selected from the group consisting of: PHL113M01 (SEQ ID NO:36), PHL111M01 (SEQ ID NO:33), PHL082M00 (SEQ ID NO:47), PHL060L00 (SEQ ID NO:34), PHL067M10 (SEQ ID NO:42), PHL071N05 (SEQ ID NO:41), PHL112N00 (SEQ ID NO:35), PHL037M02 (SEQ ID NO:45), PHL085N00 (SEQ ID NO:46), PHL115M02 (SEQ ID NO:43), PHL085M01 (SEQ ID NO:44), PHL114L00 (SEQ ID NO:37), PHL073M02 (SEQ ID NO:40), PHL010M04 (SEQ ID NO:38), and P
  • the invention provides a method for treating an individual suffering from acne of microbiome type IV comprising administering to said individual an effective amount of a phage, wherein said phage is selected from the group consisting of: PHL113M01 (SEQ ID NO:36), PHL111M01 (SEQ ID NO:33), PHL082M00 (SEQ ID NO:47), PHL060L00 (SEQ ID NO:34), PHL067M10 (SEQ ID NO:42), PHL071N05 (SEQ ID NO:41), PHL112N00 (SEQ ID NO:35), PHL037M02 (SEQ ID NO:45), PHL085N00 (SEQ ID NO:46), PHL115M02 (SEQ ID NO:43), PHL085M01 (SEQ ID NO:44), PHL114L00 (SEQ ID NO:37), PHL073M02 (SEQ ID NO:40), PHL010M04 (SEQ ID NO:38), and PHL066M04
  • the invention provides a method for treating an individual suffering from acne of microbiome type V comprising administering to said individual an effective amount of a phage, wherein said phage is selected from the group consisting of: PHL113M01 (SEQ ID NO:36), PHL111M01 (SEQ ID NO:33), PHL082M00 (SEQ ID NO:47), PHL060L00 (SEQ ID NO:34), PHL067M10 (SEQ ID NO:42), PHL071N05 (SEQ ID NO:41), PHL112N00 (SEQ ID NO:35), PHL037M02 (SEQ ID NO:45), PHL085N00 (SEQ ID NO:46), PHL115M02 (SEQ ID NO:43), PHL085M01 (SEQ ID NO:44), PHL114L00 (SEQ ID NO:37), PHL073M02 (SEQ ID NO:40), PHL010M04 (SEQ ID NO:38), and PHL066M04
  • the invention provides a method for treating a Propionibacterium humerusii -associated malady comprising administering to said individual an effective amount of a phage, wherein said phage is selected from the group consisting of: PHL113M01 (SEQ ID NO:36), PHL111M01 (SEQ ID NO:33), PHL082M00 (SEQ ID NO:47), PHL067M10 (SEQ ID NO:42), PHL071N05 (SEQ ID NO:41), PHL085N00 (SEQ ID NO:46), PHL085M01 (SEQ ID NO:44), PHL114L00 (SEQ ID NO:37), PHL073M02 (SEQ ID NO:40), and PHL010M04 (SEQ ID NO:38).
  • PHL113M01 SEQ ID NO:36
  • PHL111M01 SEQ ID NO:33
  • PHL082M00 SEQ ID NO:47
  • PHL067M10 SEQ ID NO:42
  • the invention provides a kit for diagnosing acne in a subject, wherein said kit comprises: at least one primer selected from the group comprising SEQ ID NOs 11-18, 20, 21, 23, 24, 26, and 27; and instructions for use.
  • the invention provides a kit for diagnosing acne in a subject, wherein said kit comprises: at least one primer selected from the group comprising SEQ ID NOs 11-18, 20, 21, 23, 24, 26, and 27; at least one probe selected from the group comprising SEQ ID NOs 19, 22, 25, and 28; and instructions for use.
  • FIG. 1 shows that P. acnes dominates the microbiota of pilosebaceous units, accounting for 87% of the clones.
  • P. acnes was dominant in pilosebaceous units in both acne patients and individuals with normal skin.
  • P. acnes sequences accounted for 87% of all the clones.
  • Species with a relative abundance greater than 0.35% are listed in order of relative abundance.
  • Species distribution from a metagenomic shotgun sequencing of pooled samples from normal individuals confirmed the high abundance of P. acnes in pilosebaceous units, as shown on the far right column.
  • FIG. 2 shows that the rank abundance of P. acnes ribotypes shows a distribution similar to that seen at the higher taxonomic levels. A few highly-abundant ribotypes and a large number of rare ribotypes were observed in the samples. Some ribotypes were highly enriched in acne patients. Only the top 30 most abundant ribotypes are reflected in FIG. 2 .
  • FIG. 3 shows that the most abundant P. acnes ribotypes in pilosebaceous units were also abundant at other body sites.
  • the major ribotypes found in acne patients and normal individuals were compared to the datasets from the HMP and Grice et al. (2009).
  • the top three ribotypes are the most abundant ones in different datasets.
  • the excess RT4 and RT5 seen in the dataset by Grice et al. (2009) was due to one subject, HV4, whose P. acnes strain population was dominated by these two ribotypes at every skin site sampled. After removal of this subject, the ribotype distribution is similar to the HMP samples and the normal skin samples studied.
  • RT6 is also found abundant in the HMP dataset, which were collected from healthy individuals.
  • FIG. 4 shows that P. acnes population structures differ in acne and normal skin.
  • P. acnes populations from samples were clustered using principal coordinates analysis of the weighted UniFrac distance matrix for the top ten most abundant ribotypes.
  • the principal coordinate 1 (P1) explains 43.64% of the variation and P2 explains 20.07% of the variation.
  • the analysis was performed using QIIME (Caporaso et al. 2010).
  • FIG. 5 shows the distribution of the top ten most abundant P. acnes ribotypes in acne patients and individuals with normal skin. Each column represents the percentage of the top ten ribotypes identified in each subject. The average P. acnes clone number per subject was 262 and the average clone number of top ten ribotypes was 100. Five major microbiome types at the P. acnes strain level were observed in the data. Types IV and V were mostly found in acne patients. Two samples (one from acne, one from normal skin) with fewer than 50 P. acnes 16S rDNA sequences are not displayed.
  • FIG. 6 shows the distribution of the top ten most abundant P. acnes ribotypes in all samples without separating the two groups of acne and normal skin. Each column represents the percentage of the top ten ribotypes identified in each sample. When all samples were clustered, the same five major microbiome types at the P. acnes strain level were observed, indicating that microbiome classification does not depend on the states of the disease. Only three out of 99 samples were clustered differently compared to the one shown in FIG. 5 (marked with asterisks). Two samples, one from acne and one from normal skin, with fewer than 50 P. acnes 16S rDNA sequences are not shown.
  • FIG. 7 shows that the same five major microbiome types were observed in multiple datasets.
  • Samples from the study, HMP, and Grice at al. (2009) were clustered together based on the top ten most abundant P. acnes ribotypes. In total, 284 samples were included. Each column represents the percentage of the top ten ribotypes identified in each sample. Both HMP samples and samples from Grice et al. (2009) were collected from healthy individuals, therefore the percentage of microbiome types IV and V are under-represented in the analysis. Samples with fewer than ten sequences of the top ten ribotypes were not included.
  • FIG. 8 indicates that the genome comparison of 71 P. acnes strains showed that the genomes of RT4 and RT5 are distinct from others.
  • Two chromosomal regions, loci 1 and 2 are unique to clade IA-2 and one other genome HL086PA1.
  • clade IA-2 consists of mainly RT4 and RT5 that were highly enriched in acne.
  • the presence of a plasmid (locus 3) is also characteristic of RT4 and RT5.
  • Each row represents a P. acnes genome colored according to the ribotypes. Rows are ordered by the phylogeny calculated based on the SNPs in the P. acnes core genome. Only the topology is shown.
  • the clades were named based on their recA types (IA, IB and II). Columns represent predicted open reading frames (ORFs) in the genomes and are ordered by ORF positions along the finished genome HL096PA1, which encodes a 55 Kb plasmid. Only the first 300 ORFs on the chromosome (on the left) and all the ORFs on the plasmid (on the right) are shown.
  • the colored plasmid regions represent genes on contigs that match exclusively to the HL096PA1 plasmid region. The genes that fall on contigs that clearly extend beyond the plasmid region are likely to be chromosomally located and are colored in grey. Acne index for the ribotypes was calculated based on the percentage of clones of each ribotype found in acne as shown in column 5 in Table 1.
  • FIG. 9 shows the phylogentic tree constructed based on the 96,887 SNPs in P. acnes core genome, which shows that the 71 genomes cluster into distinct clades, consistent with recA types that have been used to classify P. acnes strains.
  • the 16S ribotypes of the genomes represent the relationship of the lineages to a large extent.
  • clades IA-2 and IB-1 mainly consist of the ribotypes enriched in acne, and at the other end of the tree, RT6 in clade II was mainly found in healthy subjects.
  • Bootstrap test with 1,000 replicates were performed. The distances between the branches were calculated based on the SNPs in the core genome and do not represent the non-core regions of each genome.
  • the enlarged branches were colored according to the 16S ribotypes as shown in FIG. 8 .
  • FIG. 10 provides a genome comparison of 71 P. acnes strains and shows that the genomes of RT4 and RT5 are distinct from others. All of the predicted open reading frames (ORFs) encoded on the chromosome are shown. Each row represents a P. acnes genome colored according to the ribotypes. Rows are ordered by the phylogeny calculated based on the SNPs in P. acnes core genome. Only the topology is shown. Columns represent ORFs in the genomes and are ordered by their positions along the finished genome HL096PA1. Loci 1 and 2, which are unique to mainly RT4 and RT5 strains, and locus 4, which is unique to mainly RT8 strains, can be seen in the figure.
  • ORFs predicted open reading frames
  • FIG. 11 provides a sequence coverage comparison between the chromosome and the plasmid region in all genomes harboring a putative plasmid, which shows that the copy number of plasmid ranges from 1 to 3 per genome.
  • the X-axis represents the DNA sequences along the chromosome based on the coordinates of the finished genome HL096PA1, followed by plasmid sequences.
  • the Y-axis represents the sequence coverage.
  • the genomes were in the same order as in FIG. 8 , except HL056PA1 (as a negative control).
  • FIG. 12 reflects that quantitative PCR (qPCR) confirmed that the copy number of plasmid in each genome is 1-3 as predicted from sequence coverage comparison.
  • Pak and RecA are housekeeping genes located on the chromosome and TadA is a conserved gene in the Tad locus located on the plasmid.
  • the copy number ratio between TadA and Pak ranges from 1 to 3 in genomes, while the ratio between RecA and Pak is 1 in all the genomes.
  • the TadA gene in HL078PA1 and HL045PA1 had amplification in late cycles in qPCR.
  • Conventional PCR confirmed the amplification of TadA in these two strains, while other strains without the plasmid showed no amplification (data not shown).
  • FIG. 13 shows a power law regression for new genes (n) discovered with the addition of new genome sequences (N). Circles are the medians of n for 200 simulations. Error bars indicate the standard deviations for the 200 simulations.
  • FIG. 14 shows a power law regression for total genes (n) accumulated with the addition of new genome sequences (N). Circles are the medians of n for 200 simulations. Error bars indicate the standard deviations for the 200 simulations.
  • FIG. 15 shows the proportion of the 123,223 SNPs in the core regions specific to recA types I, II and III.
  • FIG. 16 shows the phylogenetic tree of 82 P. acnes strains constructed based on the 123,223 SNPs in the core regions (2.20 Mb). The distances between strains were calculated as nucleotide substitution rates at all SNP sites, colored according to the scale bar. The strains from the same individuals (SSIs) belonging to the same lineages were marked with “+”.
  • FIG. 17 shows the pan-genomes of types IA (A), IB (B) and II (C) strains. Circles are the medians of n for 200 simulations. Error bars are standard deviations for the 200 simulations.
  • FIG. 18 shows the SNP distribution in core regions.
  • FIG. 18 a shows SNP frequencies (percentage of polymorphic sites) of the genes in the core regions.
  • FIG. 18 b provides K-S statistics for genes that had higher SNP frequencies with more than two standard deviations (SD).
  • FIG. 18 c reflects non-synonymous mutation frequencies of the genes in the core regions.
  • FIG. 18 d provides K-S statistics for genes that had higher non-synonymous mutation frequencies with more than 2 standard deviations.
  • FIG. 19 provides the distances between P. acnes strains in the same lineage ( FIG. 19 a ) and in different lineages ( FIG. 19 b ).
  • FIG. 20 reflects that P. acnes strains within each lineage share unique non-core genomic regions. Rows represent 82 P. acnes genomes and columns represent 314 non-core regions that are longer than 500 bp. The genomes and the non-core regions were clustered based on similarity, respectively. The width of each block plotted is not proportional to the genomic length of each non-core region. The presence of a non-core region is colored in yellow, and the absence is colored in blue. The color schemes used for RT and clades are the same as in FIG. 16 .
  • FIG. 21 provides CRISPR spacer sequences in RT2 and RT6 strains.
  • a total of 48 CRISPR spacer sequences were found in 11 P. acnes genomes, 29 of which were unique. Some CRISPR spacers were found in multiple strains.
  • spacer 2 (S2) was shared by HL060PA1 and HL082PA2.
  • Spacer 17 (S17) was shared by J139, ATCC11828, HL110PA3, HL110PA4, HL042PA3 and HL202PA1.
  • Spacer 18 (S18) was shared by J139, ATCC11828, HL110PA3, HL110PA4, and HL202PA1.
  • the tree was from FIG. 16 constructed based on the 123,223 SNPs in the core regions.
  • FIG. 22 reflects genes with putative lipase activity in the P. acnes genomes.
  • FIG. 22 a gives a summary of 13 genes with putative lipase activity based on the annotations of KPA171202 and SK137 genomes.
  • FIG. 22 b reflects Insertions/deletions and frameshift observed in ORF HMPREF0675-4856.
  • FIG. 23 reflects fast detection of acne associated P. acnes strains using multiplex PCR targeting loci 1, 2, and 3.
  • FIG. 24 shows the relative abundances of Locus 1 and Locus 2 as compared to the housekeeping gene Pak.
  • FIG. 25 reflects qPCR triplex amplification plots for clinical samples #1
  • FIG. 25A shows amplification of P. acnes Locus 1, Locus 3, and Pak.
  • FIG. 26 shows the evolutionary relationships/phylogenetic tree of 32 phages.
  • FIG. 27 shows a diagram of the methods of the invention for the diagnosis and personalization of therapy for acne.
  • FIG. 28 shows a flow chart of the methods of the invention for the diagnosis and personalization of therapy for acne.
  • FIG. 29 provides P. acnes phage genomes and annotations. Genome organizations of all 15 phages are shown. Hatched arrows in previously published genomes represent newly annotated ORFs proposed. Italicized legend entries refer to newly-annotated or revised ORFs.
  • FIG. 30 provides a phylogenetic tree of 29 sequenced phage genomes constructed based upon the 6,148 SNPs in the core regions. Branches with bootstrap values less than 80 (based on 200 resamplings) were collapsed.
  • FIG. 31 provides phylogentic trees based on the genome sequences.
  • FIG. 31 a provides a phylogenetic tree constructed based on the entire genome sequences of all 16 phages. With the exception of PHL112N00, the phylogenetic relationships among the phages remain the same as using the core regions only, shown in FIG. 30 .
  • FIG. 31 b shows the phylogenetic tree that was constructed using only the left-arm of the genomes, which are highly conserved among the phages.
  • FIG. 31 s shows the phylogenetic tree that was constructed using only the right-arm coding regions. Groups I and II from FIG. 30 are also indicated in the trees. Branches with bootstrap values less than 80 (based on 5,000 resamplings) were collapsed.
  • FIG. 32 shows the phylogentic trees constructed based upon the nucleotide sequences of amidase ( FIG. 32 a ) and head protein ( FIG. 32 b ) from all phages, including the sequences from Lood et al.
  • the phylogenetic relationships among the phages from the previous study remain the same in these trees.
  • Groups I and II remain the same as in the genome shown in FIG. 30 .
  • FIG. 33 reflects multiple alignments generated for genomes from Groups I and II of closely-related phages. Sites of nucleotide variations are mapped to a member from each group. The density of variable sites in each 50-nt window of the genome is indicated in red, with 100% density indicating that all 50 sites in the window vary between the group members.
  • FIG. 33 a provides variations among Group I phages (PHL010M04, PHL066M04, PHL073M02) mapped to the PHL010M04 genome.
  • FIG. 33 b provides variation among Group II phages (PHL115M02, PHL085M01, PHL085N00, PHL037M02) mapped to the PHL115M02 genome. Gray arrows represent ORFs in each genome.
  • FIG. 34 shows host range and specificity of P. acnes phages.
  • the susceptibility/resistance of 66 P. acnes strains, three P. humerusii strains, and one P. granulosum strain against 15 newly sequenced phages is shown.
  • Dendrograms on the top and to the left represent the respective phylogenetic trees of the phages and P. acnes strains (only topology is shown).
  • “S” indicates that the tested Propionibacterium strain was susceptible to the tested phage. Numbers in red represent the fold increase in resistance of the Propionibacteria strains against phages relative to P. acnes strain ATCC6919.
  • FIG. 35 provides a correlation between P. acnes resistance to phages and the presence of matched CRISPR spacers.
  • the colored pixels in each cell represent the CRISPR spacers encoded in each P. acnes strain (shown in rows). Each red pixel means that this spacer has an exact protospacer match in the corresponding phage (shown in columns). Each orange pixel means that this spacer has a partially matched protospacer (one to two mismatches) in the corresponding phage. Gray pixels mean no matched protospacers. Pink cells indicate the bacterial resistance to the phages.
  • FIG. 36 reflects that each of the 15 sequenced phages was aligned to all 8 CRISPR spacer arrays identified in the P. acnes strains to identify protospacer sequences in each phage genome that have an exact match (red) or up to two mismatches (orange). Plus- and minus-strand protospacers are shown above and below the genomes, respectively.
  • FIG. 37 reflects sequence conservation in protospacers and PAMs.
  • the protospacers that match exactly to the CRISPR spacers encoded in strain HL042PA3 and their associated PAM sequences are shown.
  • Sequence conservation among the protospacer motifs from the phages that HL042PA3 is resistant to is shown in (A) and susceptible to is shown in (B).
  • the invention provides a method for determining whether an individual possesses acne comprising: obtaining a skin sample from an individual; isolating bacterial DNA from said sample; amplifying 16S ribosomal DNA in said sample; sequencing said amplified DNA products; and typing the individual's DNA based on one or more of the ten major ribotypes (RTs) of P. acnes strains, RT1-RT10 (SEQ ID NOs 1-10), wherein said typing occurs by determining whether said individual possesses one or more of RT1-RT10 and wherein said individual is diagnosed as having acne if said individual possesses RT4, RT5, RT7, RT8, RT9, or RT10.
  • said individual may be diagnosed as having acne if said individual possesses RT4 (SEQ ID NO:4), RT5 (SEQ ID NO:5), or RT8 (SEQ ID NO:8).
  • the invention provides a method for diagnosing different types of acne comprising: obtaining a skin sample from a subject; isolating bacterial DNA from said sample; amplifying 16S ribosomal DNA in said sample; sequencing said amplified DNA products; and typing the subject's DNA based on one or more of the five major microbiome types of P. acnes strains, wherein said subject is diagnosed as having acne if said subject is typed to microbiome IV or V.
  • the invention provides a method for rapidly diagnosing acne comprising: obtaining a skin sample from a subject; isolating bacterial DNA from said sample; using one or more primer sets to amplify said DNA; and analyzing said amplified DNA for the presence of a sequence having at least 95% homology with at least one of SEQ ID NOs 29-32 and 82-434, wherein said subject is diagnosed as having acne if the presence of a sequence having at least 95% homology with at least one of SEQ ID NOs 29-32 and 82-434 exists.
  • said amplified DNA may be analyzed for the presence of a sequence having at least 99% homology with at least one of SEQ ID NOs 29-32 and 82-434 and wherein said subject is diagnosed as having acne if the presence of a sequence having at least 99% homology with at least one of SEQ ID NOs 29-32 and 82-434 exists.
  • said amplified DNA may be analyzed for the presence of at least one of SEQ ID NOs 29-32 and 82-434 and wherein said subject is diagnosed as having acne if the presence of at least one of SEQ ID NOs 29-32 and 82-434 exists.
  • the invention provides a method for rapidly diagnosing acne comprising: obtaining a skin sample from a subject; isolating bacterial DNA from said sample; using one or more primer sets to amplify said DNA; using one or more probes to detect said amplified DNA; and analyzing said probe signals for the presence of Locus 1 (at least one sequence having at least 95% homology to at least one of SEQ ID NOs 29 and 82-97), Locus 2 (at least one sequence having at least 95% homology to at least one of SEQ ID NOs 30 and 98-186), Locus 3 (at least one sequence having at least 95% homology to at least one of SEQ ID NOs 31 and 187-423), and/or Locus 4 (at least one sequence having at least 95% homology to at least one of SEQ ID NOs 32 and 424-434), wherein said subject is diagnosed as having acne if one or more of Loci 1-4 are present.
  • the signals may be analyzed for the presence of Locus 1, Locus 1, Locu
  • a primer of said primer sets may be selected from the group consisting of SEQ ID NOs 11, 12, 17, and 18 (for Locus 1), SEQ ID NOs 13, 14, 20, and 21 (for Locus 2), SEQ ID NOs 15, 16, 23, and 24 (for Locus 3), and SEQ ID NOs 26 and 27 (for Locus 4).
  • said probes may be SEQ ID NO:19 (for Locus 1), SEQ ID NO:22 (for Locus 2), SEQ ID NO:25 (for Locus 3), and SEQ ID NO:28 (for Locus 4).
  • the invention provides a vaccine for the prevention and/or treatment of acne caused by P. acnes comprising a heat inactivated P. acnes strain, an attenuated protein of said strain, or combination thereof, wherein said strain is an RT4 strain, an RT5 strain, an RT7 strain, an RT8 strain, an RT9 strain, or an RT10 strain.
  • the invention provides a vaccine for the prevention and/or treatment of acne caused by P. acnes comprising a heat inactivated P. acnes strain, an attenuated protein of said strain, or combination thereof identified to be specific to a subject based on 16S rDNA sequence analysis of the strains of P. acnes affecting said subject.
  • said heat inactivated P. acnes strain, attenuated protein, or combination thereof may be specific for at least one of unique genomic loci, regions, or sequences identified for the strains of P. acnes .
  • Said heat inactivated P. acnes strain, attenuated protein, or combination thereof may be specific for at least one of Locus 1 (SEQ ID NOs 29 and 82-97), Locus 2 (SEQ ID NOs 30 and 98-186), Locus 3 (31 and 187-423), and Locus 4 (32 and 424-434).
  • the invention provides a method for the personalized treatment of acne comprising determining the strains of P. acnes affecting a subject and treating said subject with an active ingredient directed to at least one detected strain of P. acnes , wherein the active ingredient comprises a drug targeting specific strains of P. acnes , wherein the targeting drug comprises small molecules, antisense molecules, siRNA, biologics, antibodies, and combinations thereof targeting genomic elements specific for strains of P. acnes associated with acne.
  • the invention provides a method for treating acne comprising: administering an effective amount of a probiotic that comprises at least one strain of P. acnes that is associated with healthy or normal skin based on its 16S rDNA.
  • Said strain may be an RT6 strain.
  • Said strain may have at least 95% homology to SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, or SEQ ID NO:54, such as at least 99% homology or 100% homology.
  • the invention provides a method for treating acne comprising: administering an effective amount of a metabolite produced by a strain of P. acnes that is associated with healthy or normal skin, wherein said metabolite is selected from the group comprising bacterial culture supernatant, cell lysate, proteins, nucleic acids, lipids, and other bacterial molecules.
  • Said strain may be an RT6 strain.
  • Said strain may have at least 95% homology to SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, or SEQ ID NO:54, such as at least 99% homology or 100% homology.
  • the invention provides a method for treating acne in a subject comprising: administering an effective amount of a drug specifically targeting RT4, RT5, RT7, RT8, RT9, or RT10, when said subject is determined to possess RT4, RT5, RT7, RT8, RT9, or RT10, respectively.
  • a drug specifically targeting RT4, RT5, RT7, RT8, RT9, or RT10, when said subject is determined to possess RT4, RT5, RT7, RT8, RT9, or RT10, respectively.
  • Said drug may be a small molecule, antisense molecule, siRNA, biologic, antibody, or combination thereof.
  • the invention provides a composition comprising at least one strain of P. acnes that is associated with healthy or normal skin.
  • Said strain may be an RT6 strain.
  • Said strain may have at least 95% homology to SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, or SEQ ID NO:54, such as at least 99% homology or 100% homology.
  • the invention provides a method for diagnosing IB-3-based acne comprising: obtaining a skin sample from a subject; isolating bacterial DNA from said sample; using one or more primer sets to amplify said DNA; and analyzing said amplified DNA for the presence of a sequence having at least 95% homology with at least one of SEQ ID NOs 55-81, wherein said subject is diagnosed as having IB-3-based acne if the presence of a sequence having at least 95% homology with at least one of SEQ ID NOs 55-81 exists.
  • the invention provides a method for the personalized treatment of acne comprising determining the strain(s) of acne affecting a subject and administering to said subject an effective amount of at least one phage specifically directed to said strain(s).
  • the subject may be treated with phage directed against an RT4 strain, an RT5 strain, an RT7 strain, and RT8 strain, an RT9 strain, and/or an RT10 strain.
  • the invention provides a method for treating an individual suffering from acne of microbiome type I comprising administering to said individual an effective amount of a phage, wherein said phage is selected from the group consisting of: PHL113M01 (SEQ ID NO:36), PHL111M01 (SEQ ID NO:33), PHL082M00 (SEQ ID NO:47), PHL060L00 (SEQ ID NO:34), PHL067M10 (SEQ ID NO:42), PHL071N05 (SEQ ID NO:41), PHL112N00 (SEQ ID NO:35), PHL037M02 (SEQ ID NO:40), PHL085N00 (SEQ ID NO:46), PHL115M02 (SEQ ID NO:43), PHL085M01 (SEQ ID NO:44), PHL114L00 (SEQ ID NO:37), PHL010M04 (SEQ ID NO:38), and PHL066M04 (SEQ ID NO:39).
  • PHL113M01 SEQ ID
  • the invention provides a method for treating an individual suffering from acne of microbiome type I with IB-3 strain comprising administering to said individual an effective amount of a phage, wherein said phage is selected from the group consisting of: PHL082M00 (SEQ ID NO:47) and PHL071N05 (SEQ ID NO:41).
  • the invention provides a method for treating an individual suffering from acne of microbiome type II comprising administering to said individual an effective amount of a phage, wherein said phage is selected from the group consisting of: PHL113M01 (SEQ ID NO:36), PHL060L00 (SEQ ID NO:34), PHL112N00 (SEQ ID NO:35), and PHL085M01 (SEQ ID NO:44).
  • the invention provides a method for treating an individual suffering from acne of microbiome type III or dominant RT8 comprising administering to said individual an effective amount of a phage, wherein said phage is selected from the group consisting of: PHL113M01 (SEQ ID NO:36), PHL111M01 (SEQ ID NO:33), PHL082M00 (SEQ ID NO:47), PHL060L00 (SEQ ID NO:34), PHL067M10 (SEQ ID NO:42), PHL071N05 (SEQ ID NO:41), PHL112N00 (SEQ ID NO:35), PHL037M02 (SEQ ID NO:45), PHL085N00 (SEQ ID NO:46), PHL115M02 (SEQ ID NO:43), PHL085M01 (SEQ ID NO:44), PHL114L00 (SEQ ID NO:37), PHL073M02 (SEQ ID NO:40), PHL010M04 (SEQ ID NO:38), and P
  • the invention provides a method for treating an individual suffering from acne of microbiome type IV comprising administering to said individual an effective amount of a phage, wherein said phage is selected from the group consisting of: PHL113M01 (SEQ ID NO:36), PHL111M01 (SEQ ID NO:33), PHL082M00 (SEQ ID NO:47), PHL060L00 (SEQ ID NO:34), PHL067M10 (SEQ ID NO:42), PHL071N05 (SEQ ID NO:41), PHL112N00 (SEQ ID NO:35), PHL037M02 (SEQ ID NO:45), PHL085N00 (SEQ ID NO:46), PHL115M02 (SEQ ID NO:43), PHL085M01 (SEQ ID NO:44), PHL114L00 (SEQ ID NO:37), PHL073M02 (SEQ ID NO:40), PHL010M04 (SEQ ID NO:38), and PHL066M04
  • the invention provides a method for treating an individual suffering from acne of microbiome type V comprising administering to said individual an effective amount of a phage, wherein said phage is selected from the group consisting of: PHL113M01 (SEQ ID NO:36), PHL111M01 (SEQ ID NO:33), PHL082M00 (SEQ ID NO:47), PHL060L00 (SEQ ID NO:34), PHL067M10 (SEQ ID NO:42), PHL071N05 (SEQ ID NO:41), PHL112N00 (SEQ ID NO:35), PHL037M02 (SEQ ID NO:45), PHL085N00 (SEQ ID NO:46), PHL115M02 (SEQ ID NO:43), PHL085M01 (SEQ ID NO:44), PHL114L00 (SEQ ID NO:37), PHL073M02 (SEQ ID NO:40), PHL010M04 (SEQ ID NO:38), and PHL066M04
  • the invention provides a method for treating a Propionibacterium humerusii -associated malady comprising administering to said individual an effective amount of a phage, wherein said phage is selected from the group consisting of: PHL113M01 (SEQ ID NO:36), PHL111M01 (SEQ ID NO:33), PHL082M00 (SEQ ID NO:47), PHL067M10 (SEQ ID NO:42), PHL071N05 (SEQ ID NO:41), PHL085N00 (SEQ ID NO:46), PHL085M01 (SEQ ID NO:44), PHL114L00 (SEQ ID NO:37), PHL073M02 (SEQ ID NO:40), and PHL010M04 (SEQ ID NO:38).
  • PHL113M01 SEQ ID NO:36
  • PHL111M01 SEQ ID NO:33
  • PHL082M00 SEQ ID NO:47
  • PHL067M10 SEQ ID NO:42
  • the invention provides a kit for diagnosing acne in a subject, wherein said kit comprises: at least one primer selected from the group comprising SEQ ID NOs 11-18, 20, 21, 23, 24, 26, and 27; and instructions for use.
  • the invention provides a kit for diagnosing acne in a subject, wherein said kit comprises: at least one primer selected from the group comprising SEQ ID NOs 11-18, 20, 21, 23, 24, 26, and 27; at least one probe selected from the group comprising SEQ ID NOs 19, 22, 25, and 28; and instructions for use.
  • Nucleotide, polynucleotide, or nucleic acid sequence will be understood to mean both a double-stranded or single-stranded DNA in the monomeric and dimeric forms and the transcription products of said DNAs.
  • Homologous nucleotide sequence means a nucleotide sequence having at least a percentage identity with the bases of a nucleotide sequence according to the invention of at least 80%, preferably 90%, 95%, 96%, 97%, 98%, 99% or 100%. This percentage is statistical and the differences between two nucleotide sequences may be determined at random or over the whole of their length.
  • the invention comprises the polypeptides encoded by a nucleotide sequence according to the invention, including a polypeptide whose sequence is represented by a fragment.
  • polypeptide encoded by a nucleotide sequence according to the invention, including a polypeptide whose sequence is represented by a fragment.
  • Polypeptides allow monoclonal or polyclonal antibodies to be prepared which are characterized in that they specifically recognize the polypeptides.
  • the invention relates to mono- or polyclonal antibodies or their fragments, or chimeric antibodies, characterized in that they are capable of specifically recognizing a polypeptide.
  • Polypeptides used in vaccine compositions according to the invention may be selected by techniques known to the person skilled in the art such as, for example, depending on the capacity of said polypeptides to stimulate the T cells, which is translated, for example, by their proliferation or the secretion of interleukins, and which leads to the production of antibodies directed against said polypeptides.
  • Vaccine combinations will preferably be combined with a pharmaceutically acceptable vehicle and, if need be, with one or more adjuvants of the appropriate immunity.
  • Pharmaceutically acceptable vehicle means a compound or a combination of compounds that does not provoke secondary reactions and which allows, for example, the facilitation of the administration of the active compound, an increase in its duration of life and/or its efficacy in the body, an increase in its solubility in solution, or an improvement in its conservation.
  • Some of the P. acnes lineages and microbiome types are highly enriched in acne patients and some are associated with healthy skin.
  • the unique genomic components of each major lineage including a linear plasmid that is unique to acne-associated lineages, have been identified. This information is used to, for example: (1) for a method/kit to isolate bacterial DNA/RNA from pilosebaceous units for downstream analysis: (2) rapidly and accurately detect/diagnose/identify the microbiome type of the affected subject and the major strains of P. acnes present in the pores of the affected subject; (3) develop vaccines against acne-associated P.
  • acnes strains (4) develop probiotics using the strains associated with healthy skin in topical creams, solutions, and the like; (5) develop drugs, including small molecules, biologics, and antibodies targeting the genetic elements and biological pathways unique to the P. acnes strains associated with acne, and (6) to develop bacteriophage-based strain specific therapy to treat acne.
  • microbiome type of a subject affected with acne is diagnosed, several approaches described below may be used formulate an effective treatment plan. For example, if the subjects have microbiome types IV or V, or are dominated by P. acnes RT10 strains, it is less likely that antibiotic treatment will succeed because these strains are antibiotic resistant. However, other method treatments remain available, such as retinoids.
  • target specific drugs including small molecules, biologics, and antibodies may be more effective treatments.
  • such a patient may be treated with antibodies targeting the genetic elements and biological pathways that are unique to P. acnes strains associated with acne.
  • the additional treatment of phage therapy may be more effective.
  • the present invention also pertains to alternative treatment strategies for acne treatment to balance the relative abundance of P. acnes strains by promoting the growth of health-associated strains.
  • the present invention pertains to methods and kits to isolate bacterial DNA/RNA from pores of affected subjects for downstream genetic analysis. More specifically, the present invention pertains to protocols for the extraction of bacterial genomic DNA and RNA from microcomedone samples.
  • Biore® Deep Cleansing Pore Strips may be used to sample the bacteria from a subject.
  • Genomic DNA may be extracted according to methods known in the art.
  • the QIAamp DNA Micro Kit (Qiagen) is a commercially available kit that may be used to extract genomic DNA from the supernatant obtained by lysing cells/microcomedones using a beadbeater.
  • the present invention also pertains to fast and accurate methods and kits for the detection and/or diagnosis of microbiome types in affected subjects.
  • the microbiome typing/microbiome-specific treatment is based on ten major lineages of P. acnes strains and five major microbiome types in the human pilosebaceous unit found through a comprehensive metagenomic analysis using full length 16S rDNA sequencing.
  • samples were PCR-amplified using 16S rDNA specific primers with the following sequences: 27f-MP 5′AGRGTTTGATCMTGGCTCAG-3′ and 1492r-MP 5′-TACGGYTACCTTGTTAYGACTT-3′.
  • the 1.4 Kb product is excised and further purified using, for example, a Quigen QIAquick Gel Extraction Kit.
  • the purified product is cloned into OneShot E coli . cells using, for example, a TOPO TA cloning kit from Invitrogen.
  • Sequencing is done with a universal forward, universal reverse, and for a subset, internal 16S rDNA primer 907R with sequences of TGTAAAACGACGGCCAGT (forward), CAGGAAACAGCTATGACC (reverse), and CCGTCAATTCCTTTRAGTTT (907R). Sequence reactions were loaded on ABI 3730 machines from ABI on 50 cm arrays with a long read run module.
  • Each lineage of P. acnes has unique genomic loci, regions, and sequences. Accordingly, specific primers may be generated to target the lineage-specific genomic regions to detect the presence or absence of each lineage, as well as the relative amount of each lineage using methods known in the art, such as PCR/qPCR. This occurs within several hours of obtaining the samples. Prior to Applicants' invention, this required much more time—often weeks using culture-based methods. According to one embodiment of the invention, affected subjects are grouped for microbiome specific treatments based on these diagnoses.
  • unique genomic loci 1, 2, and 3 for strains of ribotypes 4 and 5 have been shown to be associated with acne.
  • lineages that contain these loci can be distinguished from lineages that lack these loci.
  • the relative abundance of each strain may also be detected.
  • Analysis of a mock community has shown that isolates with loci 1, 2 and 3 in an abundance of 7.5% or higher in the microbiome may be detected using these techniques. Given the sensitivity of qPCR, lower abundance levels to a few DNA copies may also be detectable.
  • vaccines are developed against acne-associated P. acnes strains.
  • personalized vaccines are developed against acne-associated P. acnes strains.
  • vaccines are developed against acne-associated P. acnes strains using inactive P. acnes strains or heat attenuated proteins. Strains suitable for use as vaccines may be identified based on 16S rDNA sequencing, identifying lineages of P. acnes strains associated with acne, and the unique genomic loci, regions, and sequences for each lineage to specifically target strains of P. acnes associated with acne and not those strains associated with healthy skin.
  • loci 1, 2, and 3 may be targets for vaccination because these loci are unique to ribotypes 4 and 5, and are not found in commensal strains.
  • Locus 4, which is unique to ribotype 8 may also serve as a potential target for vaccine therapy.
  • Table 2 The list of genes encoded in loci 1, 2, 3, and 4 are shown in Table 2.
  • the present invention also pertains to probiotics developed using P. acnes strains associated with healthy skin in medicines, compositions, topical creams, solutions, or other cosmetic products.
  • Probiotics have, in the past, been used in topical creams.
  • PROBIOTIC LABTM announced that mixture of 14 specific strains of bacteria was used for treatment of cystic acne (http://www.probiotic-lab.com/aboutusprobioticlab.html).
  • Probiotic skin care/DERMBIOTIX has a product line—Probiotic Collagen Complex (PC3), which is claimed to have targeted anti-aging benefits to the skin. However, this is not targeted to acne treatment.
  • PC3 Probiotic Collagen Complex
  • Probiotic Collagen Complex infuses the skin with the positive bacteria required to effectively combat and eradicate excess negative bacteria caused by external factors (http://www.dermbiotix.com).
  • PC3 Probiotic Collagen Complex
  • skin probiotics are developed for acne treatment using P. acnes strains associated with healthy/normal skin.
  • skin probiotics are developed for acne treatment using P. acnes strains associated with healthy/normal skin based on the 16S rDNA sequencing.
  • the RT6 lineage of P. acnes and associated with healthy skin is used as a topical product.
  • the RT6 lineage of P. acnes is used by inoculating this isolate on the human skin in order to compete off the acne associated strains.
  • molecules, including proteins, nucleic acids, lipids, and other metabolites, supernatant of cultures, and/or cell lysate of these strains may be used at probiotics.
  • the present invention also pertains to drugs targeting acne associated P. acnes strains. This is based upon multiple genome comparison of P. acnes in combination with 16S rDNA metagenomic analysis, thereby identifying certain strains and genomic variations associated with acne.
  • Drugs intended to target acne associated P. acnes include custom designed small molecules, antisense molecules, siRNA molecules, biologics, and antibodies targeting genomic elements specific for strains which are associated with acne.
  • Antisense RNA, antibodies, or small molecules can be designed targeting loci 1, 2, 3, and 4. Strains with ribotypes 4, 5, and 10 are antibiotic resistant. Thus, there is a need in the art for new antibiotics targeting ribotypes 4, 5, and 10.
  • the present invention also pertains to personalized phage therapy for subjects affected with acne comprising phages specific to certain strains of P. acnes .
  • P. acnes is commensal and some strains play a protective role for hosts.
  • personalized phage therapies include a selections of phages targeting P. acnes strains that have been shown to lack a protective role for subjects affected by acne.
  • personalized phage therapy may be developed according to their bacterial host specificity of the phages to target specific strains of P. acnes , leaving health associated strains intact.
  • P. acnes lineages RT2 and RT6 have a CRISPR/Cas structure, indicating they have resistance against certain phage infection and plasmid conjugation.
  • Table 5 shows the sensitivity and resistance of specific P. acnes strains to specific P. acnes phages.
  • the human skin microbiome plays important roles in skin health and disease.
  • the bacterial population structure and diversity at the strain level was poorly understood.
  • the inventors compared the skin microbiome at the strain level and genome level of Propionibacterium acnes , a dominant skin commensal, between 49 acne patients and 52 healthy individuals by sampling the pilosebaceous units on their noses. Metagenomic analysis demonstrated that while the relative abundances of P. acnes were similar, the strain population structures were significantly different in the two cohorts. Certain strains were highly associated with acne and other strains were enriched in healthy skin.
  • sequencing 66 novel P. acnes strains and comparing 71 P. acnes genomes the inventors identified potential genetic determinants of various P.
  • acnes strains in association with acne or health.
  • the analysis indicates that acquired DNA sequences and bacterial immune elements may play roles in determining virulence properties of P. acnes strains and some may be targets for therapeutic interventions.
  • This study demonstrates a previously-unreported paradigm of commensal strain populations that explains the pathogenesis of human diseases. It underscores the importance of strain level analysis of the human microbiome to define the role of commensals in health and disease.
  • MRSA methicillin-resistant Staphylococcus aureus
  • acnes contributes to acne pathogenesis while being a major commensal of the normal skin flora (Bek-Thomsen et al., 2008; Cogen et al., 2008; Costello et al., 2009; Dominguez-Bello et al., 2010; Fierer et al., 2008; Gao et al., 2007; Grice et al., 2009).
  • P. acnes protects the human skin as a commensal bacterium or functions as a pathogenic factor in acne, or both, remained to be elucidated.
  • Applicants compared the skin microbiome at the strain level and genome level in 49 acne patients and 52 normal individuals using a combination of metagenomics and genome sequencing.
  • 16S ribosomal DNA rDNA
  • rDNA 16S ribosomal DNA
  • the population structure of P. acnes strains was determined in each sample.
  • each P. acnes strain was assigned an “acne index” by calculating its prevalence in acne patients based on the 16S rDNA metagenomic data.
  • the P. acnes strains associated with the acne patient group were identified, as well as the strains enriched in the individuals with normal skin.
  • positions 27 to 1492 were PCR amplified. Yet, when analyzing the sequence only positions 29-1483 are studied. The numbering of positions is based on the E. coli system of nomenclature. Thus, the sequences between 29-1483 are important for determining the ribotype (there are many ribotypes, not just 10). As for the top 10 ribotypes, sequences between positions 529-1336 of the 16A rRNA are sufficient.
  • each unique 16S rDNA sequence as a 16S rDNA allele type is called a ribotype (RT).
  • RT1 ribotype 1
  • All other defined ribotypes have 99% or greater sequence identity to RT1.
  • Ribotypes 4, 5, 7, 8, 9, and 10 were found predominantly in acne patients, with four of these six statistically significantly enriched in acne (p ⁇ 0.05, Wilcoxon test).
  • Ribotypes 4, 5, and 10 contain a nucleotide substitution G1058C in the 16S rDNA sequences, which has previously been shown to confer increased resistance to tetracycline (Ross et al., 1998; Ross et al., 2001).
  • HMP Human Microbiome Project
  • a comparative genome analysis among all 71 genomes grouped by ribotypes was performed.
  • the analysis revealed genetic elements by which acne-associated strains could contribute to acne pathogenesis and the elements by which health-associated strains could contribute to maintaining skin health.
  • RT4 and RT5 which had a strong association with acne
  • RT6 which was found enriched in normal skin.
  • loci 1, 2, and 3 Three distinct regions, loci 1, 2, and 3, were found almost exclusively in strains that belong to clade IA-2 in the phylogenetic tree.
  • Clade IA-2 consists of mainly RT4 and RT5 ( FIGS. 8 and 10 ). Loci 1 and 2 are located on the chromosome.
  • Locus 1 contains prophage-related genes and appears to be a genomic island.
  • Locus 2 has plasmid integration sites and may be derived from a plasmid sequence.
  • Locus 3 appears to be on a large mobile genetic element, likely a plasmid.
  • the plasmid is approximately 55 Kb long and has inverted terminal repeats according to the finished genome HL096PA1. The sequence data suggest that the plasmid is linear and possibly originated from a phage (Hinnebusch and Tilly (1993)).
  • RT4 and RT5 have at least 60% of the genes of the plasmid represented, and all of them have regions homologous to the inverted terminal repeats in the plasmid, suggesting that they harbor the same or a similar linear plasmid ( FIG. 8 ).
  • the copy number of the plasmid in the genomes ranges from 1 to 3 based on genome sequencing coverage, which was confirmed by quantitative PCR ( FIGS. 11 and 12 ).
  • RT4 and RT5 strains carry a linear plasmid and two unique loci of genomic islands indicates that these plasmid and chromosomal regions play a role in acne pathogenesis.
  • the linear plasmid encodes a tight adhesion (Tad) locus, which has been suggested to play a role in virulence in other organisms (Kachlany et al., 2000; Schreiner et al., 2003).
  • Tad locus is found in all but one of the fifteen genomes of RT4 and RT5, and is only occasionally found in other ribotypes.
  • FIG. 6 summarizes the genes that are mostly unique to RT4 and RT5, several of which play essential roles in virulence in other organisms. Some of these genes encoded in RT4 and RT5 increase virulence, promote stronger adherence to the human host, or induce a pathogenic host immune response.
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • acnes consists of a series of cas genes—cas3, cse1, cse2, cse4, cas5e, cse3, cas1, and cas2, which are homologous to the CRISPR locus reported in E. coli (FIG. S 10 ) and the CRISPR4 locus in Streptococcus thermophilus (Horvath and Barrangou, 2010).
  • CRISPR arrays are composed of a cluster of identical repetitive sequences separated by spacer sequences of similar length but with different nucleotide sequences. It has been found that spacer sequences are identical or with one or two mismatches to phage or plasmid DNA sequences. A total of 39 spacer sequences were found in eight P. acnes strains, 25 of which were unique as shown in Table 2.
  • acnes phage PA6 gp15 (minor tail protein) 5 CGGTGTTAACGGCTTGCCTGGCTTGGATGGAG No hits RT2 HL060PA1 1 CGCCTACCGTCAGCTGACTCACGCCTCCGCGTT No hits 2 TCACACCAGTCATCAGCGTCATAGTCCTCTCGG No hits RT2 HL082PA2 1 GGCTCAGCCCTGCCCGATGCCTACGCCAAATGG C.
  • leptum DSM 753 CLOLEP_00129 Locus 3 (cell wall-associated hydrolases (invasion-associated proteins)) 2 TCACACCAGTCATCAGCGTCATAGTCCTCTCGG No hits RT2 HL103PA1 1 CACCGGGCCCATCCCGGTCGGCCTCCTGAAAGG C. leptum DSM 753 CLOLEP_00135 Locus 3 RT2 HL106PA1 1 GATCGAGTTGGCTGAGTCGAAGGTGTTGCGGTT P. acnes phage PA6 gp16 (conserved protein) P.
  • acnes SK137 HMPREF0675_3193 domain of unknown function 2 CAGGCGCTCCACTCCCTCGCCCTGGCCACCAAC No hits RT6 HL110PA3 1 CTATGTGGACAGTGTTGGTTACTGTGGGGGGAA P. acnes phage PA6 intergenic region between gp45 and gp46 HL110PA4 2 GCACTGCACCGATATCGTCGTGGCTGTCACTTG No hits 3 CCCAGACAACCTCGACAACCTGTTCAGGGGATG P. acnes phage PAS50 gp25 4 CATGGCTAGCCCGGATITTTGGCTGCCTGAGCG P. acnes phage PA6 gp34 (mutidrug resistance protein-like transporters) P.
  • acnes phage PAD20 gp34 (DNA helicase) 5 CGGCCTGCGGCAGATTTTTGTTGCGTTGAATCC P. acnes phage PA6 gp14 (tape measure protein) P. acnes phage PAD20 gp14 (tape measure protein) P. acnes phage PAS50 gp14 (tape measure protein) 6 CGGGCAGAGGATGTGTTGCTCGTTCCTGGATGG P. acnes phage PA6 gp32 (CHC2 zinc finger) P. acnes phage PAD20 gp32. (DNA primase) P.
  • acnes phage PAS50 gp6 major head protein gene 8 CGAGGGCTACCACGTGGTCGATTTGGACTGTCG C. leptum DSM 753 CLOLEP_00167 Locus 2 P. acnes SK137 HMPREF0675_3193 (Domain of unknown function) 9 CAGGCGCTCCACTCCCTCGCCCTGGCCACCAAC No hits Abbreviations: BLAST, Basic Local Alignment Search Tool; CRISPR, Clustered Regularly Interspaced Short Palindromic Repeat; C. leptum , Clostridium leptum ; P. acnes , Propionibacterium acnes ; RT, ribotype.
  • Subjects with acne and subjects with normal skin were recruited from various clinics in Southern California including private practice, managed care, and public hospital settings, as well as outside of dermatology clinics, to best represent the diversity of populations and history of medical care.
  • the diagnosis of acne was made by board-certified dermatologists.
  • the presence of acne was graded on a scale of 0 to 5 relating closely to the Global Acne Severity Scale (Dreno et al., 2011).
  • Grades were recorded for both the face and the nose separately where zero represents normal skin and 5 represents the most severe inflammatory cystic acne.
  • the grades of the face ranged from 1 to 5 with an average of 2.1, and the grades of the nose ranged from 0 to 2 with an average of 0.3. The presence of scarring was also noted.
  • Subjects with normal skin were determined by board-certified dermatologists and were defined as people who had no acneiform lesions on the face, chest, or back. They were also excluded if they had other skin problems that the investigators felt would affect sampling or the microbial population on the skin.
  • 59 were female (31 acne patients and 28 normal subjects) and 42 were male (18 acne patients and 24 normal subjects).
  • the average age of the acne cohort was 22.2 and the average age of the normal cohort was 29.6. There was no significant difference in ethnicity between the acne and normal populations.
  • the subjects responded to a written questionnaire, administered by a physician or a well-trained study coordinator who went over each question with the subjects. Most of the subjects had not been treated for acne in the past or were not being treated when samples were collected ( FIG. 3 ). Only nine out of 78 subjects, who provided treatment information, were being treated for acne when samples were taken. Among the nine subjects, two were being treated with antibiotics, five were being treated with topical retinoids, one was being treated with both antibiotics and retinoids, and one did not list the treatment. Subjects were asked for acne treatment history in the past (anytime in their life).
  • Skin microcomedone (white head or black head) samples were taken from the nose of the subjects using Bioré Deep Cleansing Pore Strips (Kao Brands Company, Cincinnati, Ohio) following the instruction of the manufacturer. Clean gloves were used for each sampling. After being removed from the nose, the strip was immediately placed into a 50 mL sterile tube and kept on ice or at 4° C. The cells were lysed within four hours in most of the cases.
  • Genomic DNA was extracted using QIAamp DNA Micro Kit (Qiagen, Valencia, Calif.). 16S rDNA was amplified and cloned according to the protocol by HMP, which is described in detail in Supplementary Information. Nearly full length sequences were obtained by Sanger method.
  • Colonies with the macroscopic characteristics of P. acnes were picked from each sample plate and were passed twice.
  • the ribotype of each isolate was determined by PCR amplification and sequencing of the full length of the 16S rDNA gene by Sanger method.
  • Genome HL096PA1 was sequenced using Roche/454 FLX and was assembled using a combination of PHRAP/CONSED (Gordon et al., 1998) and GSMAPPER (Roche, Branford, Conn.) with extensive manual editing in CONSED. The remaining 65 genomes were sequenced using Illumina/Solexa GAIIx (Illumina, San Diego, Calif.). Sequence datasets were processed by quality trimming and were assembled using Velvet (Zerbino and Birney, 2008). Coding sequences were predicted using GeneMark (Borodovsky and McIninch, 1993) and GLIMMER (Salzberg et al., 1998).
  • the final gene set was processed through a suite of protein categorization tools consisting of Interpro, psort-b and KEGG. A more detailed protocol can be found at http://hmpdacc.org/doc/sops/reference_genomes/annotation/WUGC_SOP_DACC.pdf.
  • All sequenced P. acnes genomes encode three copies of 16S rRNA genes, which are identical within each isolate, except KPA171202.
  • KPA171202 Based on the KPA171202 genome (Bruggemann et al., 2004), one copy of the 16S rRNA gene has one nucleotide difference from the other two identical copies of RT1. However, this mutation was never observed in the 16S rDNA dataset. Multiple clones of 16S rDNA gene from KPA171202 were amplified, cloned, and sequenced and a sequence harboring this mutation was not found. Thus, KPA171202 also has three identical copies of 16S rDNA.
  • RT6 (6.3%) was found to be more abundant than RT4 and RT5 combined (2.8%) in the HMP data, similar to those found in the normal cohort where RT6 represents 4.8% and RT4 and RT5 combined represent 1.2% of the clones. The same five main microbiome types were observed in the two datasets ( FIG. 7 ).
  • the recA gene has been widely used to classify P. acnes strains into four known types: IA, IB, II, and III (McDowell et al., 2008; McDowell et al., 2005).
  • the phylogenetic tree of the 71 genomes based on the SNPs in the core genome matched the recA types perfectly except one isolate, HL097PA1.
  • Most of the genomes with ribotypes 1, 4, 5, and 532 were grouped to recA Type IA clade, which can be further divided into subclades IA-1 and IA-2.
  • Clade IA-2 is composed of mostly RT4 and RT5. RT4 and most of RT5 genomes seem to belong to the same lineage with very similar genome sequences.
  • the associations of P. acnes lineages with health and disease states were further analyzed. There was a clear shift of the association strength of the clades with acne along the phylogenetic tree ( FIG. 9 ).
  • the three sequenced ribotypes identified as being strongly associated with acne (RT4, RT5, and RT8) were found at one end of the tree in clades IA-2 and IB-1, while the RT6 identified as being associated with normal skin was at the other end of the tree at the tip of clade II ( FIG. 9 ).
  • P. acnes ribotypes 4, 5, and 10 have a single nucleotide substitution G1058C in the 16S rDNA sequences, which has previously been shown to confer increased resistance to tetracycline (Ross et al., 1998a; Ross et al., 2001).
  • the substitution in the 16S rDNA sequences it was determined that all the strains of RT4 and RT5 that were sequenced have a nucleotide substitution in the 23S rDNA sequences, which confers increased resistance to a different class of antibiotics, erythromycin and clindamycin (Ross et al., 1997; Ross et al., 1998b). It was experimentally confirmed that these isolates, except two that were unculturable, were resistant to tetracycline, erythromycin, and clindamycin.
  • PCR reactions contained 0.5 U/ ⁇ L Platinum Taq DNA Polymerase High Fidelity (Invitrogen), 1 ⁇ Pre-mix E PCR buffer from Epicentre Fail-Safe PCR system, 0.12 ⁇ M concentration of each primer 27f-MP and 1492r-MP, and Sigma PCR grade water.
  • One microliter of DNA ranging from 0.2-10 ng total was added to each reaction.
  • the G-Storm GS4 thermocycler conditions were as following: initial denaturation of 96° C. for 5 minutes, and 30 cycles of denaturation at 94° C. for 30 seconds, annealing at 57° C. for 1 minute, and extension at 72° C. for 2 minutes, with a final extension at 72° C. for 7 minutes.
  • an A-tailing reaction was performed by the addition of 1 U of GOTaq DNA Polymerase directly to the amplification reaction and incubation in the thermocycler at 72° C. for 10 minutes.
  • the three PCR amplification reactions from each source DNA were pooled and gel purified (1.2% agarose gel stained with SYBR Green fluorescent dye).
  • the 1.4 Kb product was excised and further purified using the Qiagen QIAquick Gel Extraction kit.
  • the purified product was cloned into OneShot E. coli cells using TOPO TA cloning kit from Invitrogen.
  • 16S rDNA was amplified using universal primers 8F (5′-AGAGTTTGATYMTGGCTCAG-3′) and 1510R (5′-TACGGYTACCTTGTTACGACTT-3′) (Gao et al., 2007). Thermocycling conditions were as following: initial denaturation step of 5 minutes at 94° C., 30 cycles of denaturation at 94° C. for 45 seconds, annealing at 52° C. for 30 seconds and elongation at 72° C. for 90 seconds, and a final elongation step at 72° C. for 20 minutes.
  • PCR products were purified using DNA Clean and Concentrator Kit (Zymo Research). Subsequently, the 16S rDNA amplicons were cloned into pCR 2.1-TOPO vector (Invitrogen). One-Shot TOP-10 Chemically Competent E. coli cells (Invitrogen) were transformed with the vectors and plated on selective media. Individual positive colonies were picked and inoculated into selective LB liquid medium. After 14 hours of incubation, the plasmids were extracted and purified using PrepEase MiniSpin Plasmid Kit (USB Corporation) or Zyppy Plasmid Miniprep Kit (Zymo Research). The clones were sequenced bidirectionally using Sanger sequencing method with 1 ⁇ 8th chemistry using ABI 3730 sequencer (Applied Biosystems Inc.).
  • Microcomedones on the inner surface of the nose strip were mashed and scraped using a sterile loop (Fisherbrand, Pittsburgh, Pa.), and plated onto a blood agar plate (Teknova Brucella Agar Plate with Hemin and Vitamin K, Teknova, Hollister, Calif.). The plates were incubated at 37° C. for 5-7 days anaerobically using the AnaeroPack System (Mitsubishi Gas Chemical Company, Tokyo, Japan).
  • Colonies with the macroscopic characteristics of P. acnes were picked from each sample plate and were streaked onto A-media plates (Pancreatic Digase of Casine, Difco yeast extract, glucose, KH2PO4, MgSO4, Difco Agar, and water). These first-pass plates were then incubated anaerobically at 37° C. for 5-7 days. As the second pass, single isolated colonies were picked from the first-pass plates and streaked onto new A-Media plates. These plates were then incubated anaerobically at 37° C. for 5-7 days. The colonies on these plates were picked for culturing, genotyping, and genome sequencing in the subsequence steps.
  • Each isolate was analyzed by PCR amplification of the 16S rDNA gene.
  • the ribotypes were determined based on the full length sequences. Isolates with desired ribotypes were selected for future culturing and genome sequencing.
  • Isolates were grown in 5 mL of Clostridial medium under anaerobic conditions at 37° C. for 5-7 days. Cultures were pelleted by centrifugation and washed with 3 mL phosphate buffer saline (PBS). The same protocol used for the metagenomic DNA extraction was used for extracting the genomic DNA of the isolates.
  • PBS phosphate buffer saline
  • Metagenomic DNA samples from microcomedone samples from 22 individuals with normal skin were pooled and sequenced using Roche/454 FLX. The average read length was 236 bp. The sequencing was limited with 13,291 sequence reads. Sequence reads were aligned against the NCBI's non-redundant database using BLAST. Species assignment was based on 97% identity and 100% of the read length aligned.
  • sequences with at least 99% identity over 1,400 nucleotides to P. acnes KPA171202 (Bruggemann et al., 2004) 16S rDNA were trimmed to positions 29-1483 (numbering based on the E. coli system of nomenclature (Brosius et al., 1978)). Sequences without full coverage over this region were excluded from further strain level analysis. Chimera screening, as described above, resulted in removal of less than 0.35% of the sequences. This may be an under-estimation of the chimeras, since the majority of sequences differ by only 1 or 2 nucleotides.
  • QIIME Caporaso et al., 2010b was used to cluster the sequences into OTUs using 99% identity cutoff, furthest neighbor, and UCLUST (Edgar, 2010). Representative sequences (most abundant) were selected and aligned using PYNAST (Caporaso et al., 2010a) to the greengenes database. Taxonomy was assigned using RDP method (Cole et al., 2009). The alignment was filtered with the lanemask provided by greengenes, and a phylogenetic tree was built using FastTree (Price et al., 2009).
  • the number of clones of each of the top ten ribotypes was normalized by the total number of P. acnes clones of the sample.
  • the normalized counts were used to test the significance in enrichment between the acne group and the normal group.
  • the function wilcox_test in the R program http://www.R-project.org) was used to calculate the p-values.
  • Microbiome types were assigned based on the largest clades seen when samples were clustered using thetayc similarity in MOTHUR (Schloss et al., 2009) ( FIGS. 5 and 6 ) or hierarchical clustering (Eisen at al., 1998) ( FIG. 7 ).
  • Sequences were assigned to a ribotype if they met the following criteria. First, there was a single best match. Second, it covered the range required to discriminate between the top 45 ribotypes (58-1388). Third, there were no Ns at discriminatory positions. Lastly, there were no more than ten non-discriminatory differences.
  • the unedited 16S rDNA sequences were assigned to ribotypes by the same method described above and the result is shown in FIG. 3 . Less than 0.6% of the sequences were unassigned due to greater than ten mismatches to RT1, and 1.7% was unassigned due to equal best matches.
  • the genome was sequenced using Roche/454 FLX at the UCLA Genotyping and Sequencing Core. A total of 590,054 sequence reads were generated with an average read length of 230 bp. Of these, 433,896 were assembled into two contigs, a circular main chromosome of 2,494,190 by and a linear plasmid of 55,585 bp. Assembly was accomplished by a combination of PHRAP/CONSED (Gordon et al., 1998) and GSMAPPER (Roche) with extensive manual editing in CONSED. GeneMark v2.6r (Borodovsky and McIninch, 1993) and GLIMMER v2.0 (Salzberg et al., 1998) were used to performed ab initio protein coding gene prediction.
  • tRNAScan-SE 1.23 was used for tRNA identification and RNAmmer was used for predicting ribosomal RNA genes (5S, 16S, and 23S).
  • Genome annotation results were based on automated searches in public databases, including Pfam (http://pfam.jouy.inra.fr/), KEGG (http://www.genome.jp/kegg), and COG (http://www.ncbi.nlm.nih.gov/COG/). Manual inspection of the annotation was also performed.
  • the genomes were sequenced using Illumina/Solexa Genome Analyzer IIx and annotated by the Genome Center of Washington University at St. Louis.
  • Each genomic DNA sample was randomly sheared and an indexed library was constructed using standard Illumina protocols. Twelve uniquely tagged libraries were pooled and run on one lane of a GAIIx flowcell and paired end sequences were generated. Following deconvolution of the tagged reads into the separate samples, datasets were processed using BWA (L1 and Durbin, 2009) quality trimming at a q10 threshold.
  • Coding sequences were predicted using GeneMark v3.3 (Borodovsky and McIninch, 1993) and GLIMMER v2.13 (Salzberg et al., 1998). Intergenic regions not spanned by GeneMark and GLIMMER were aligned using BLAST against NCBI's non-redundant database and predictions were generated based on protein alignments. tRNA genes were determined using tRNAscan-SE 1.23 and non-coding RNA genes were determined by RNAmmer-1.2 and Rfam v8.0. The final gene set was processed through a suite of protein categorization tools consisting of Interpro, psort-b and KEGG. The gene product naming comes from the BER pipeline (JCVI). A more detailed standard operating protocol (SOP) can be found at http://hmpdacc.org/doc/sops/reference_genomes/annotation/WUGC_SOP_DACC.pdf.
  • SOP standard operating protocol
  • the “core” regions were defined as genome sequences that are present in all 71 genomes.
  • P. acnes KPA171202 was used as the reference genome.
  • Each of the other 70 genome sequences (a series of contigs in most of the genomes and two complete genomes) was mapped to the reference genome using Nucmer (Kurtz et al., 2004).
  • All the 70 “.coords” output files of Nucmer program were analyzed to identify overlap regions based on the KPA171202 coordinates using a Perl script.
  • “core” sequences were extracted based on the genome sequence of KPA171202 with the coordinates calculated above. On average, 90% (ranging from 88% to 92%) of the genomes were included in the core regions.
  • Single nucleotide polymorphisms were identified by using “show-snps” utility option of the Nucmer program (Kurtz et al., 2004) with the default settings. Genome sequence of P. acnes KPA171202 was used as the reference genome. All the 70 “.snps” output files of Nucmer program were analyzed to identify unique SNP positions based on the KPA171202 coordinates using a Perl script. The SNPs in the core regions were further analyzed to construct a phylogenetic tree.
  • the 71 concatenated sequences of the 96,887 SNP nucleotides in the core regions were used to construct a phylogenetic tree of the P. acnes genomes.
  • the evolutionary distance of the core regions among the genomes was inferred using the Neighbor-Joining method (Saitou and Nei, 1987).
  • the bootstrap tree inferred from 1,000 replicates was taken. Branches corresponding to partitions reproduced in less than 80% bootstrap replicates were collapsed.
  • FIG. 8 shows only the topology.
  • FIG. 9 the tree was drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree.
  • the evolutionary distances were computed using the p-distance method and are in the units of the number of nucleotide differences per site. This tree shows the comparison based on only the core regions. The distance does not represent the true evolutionary distance between different genomes, since the non-core regions of each genome were not considered here. All positions containing gaps and missing data were eliminated. Evolutionary analysis was conducted using MEGA5 (Tamura et al., 2007).
  • CRISPRFinder (Grissa et al., 2007) was used to identify the CRISPR repeat-spacer sequences.
  • the annotation of HL110PA3 was used for BLAST alignment in order to identify the presence of CRISPR/Cas structure and CRISPR repeat-spacer sequences in strains of HL001PA1, HL060PA1, HL082PA2, HL103PA1, HL106PA1, HL110PA4 and J139.
  • Each spacer sequence was annotated by BLAST alignment against NCBI's non-redundant nucleotide database and the reference genomic sequences database (refseq_genomic).
  • MAQ (Li et al., 2008) was used to map the raw sequence reads from Illumina/Roche platform to the reference genomes. Briefly, “map” command was used for mapping, and “assemble” command was used for calling the consensus sequences from read mapping, then “cnd2win” command was used to extract information averaged in a tilling window. A window size of 1,000 by was used. Randomly selected 1 million reads were used for mapping. This accounted for approximately 40 ⁇ coverage for all the genomes except HL096PA2, HL096PA3, HL097PA1 and HL099PA1, which had approximately 55 ⁇ to 75 ⁇ coverage. BWA (L1 and Durbin, 2010) was used to map the raw sequence reads from Roche/454 platform to the reference genome HL096PA1. The average coverage was calculated in 1,000 by window.
  • Quantitative PCR targeting TadA on the plasmid (Locus 3) and housekeeping genes Pak and RecA on the chromosome was performed using the genomic DNA extracted from the P. acnes isolates.
  • LightCyler 480 High Resolution Melting Master kit was used (Roche Diagnostics GmbH, Mannheim, Germany). Each 10 ⁇ L reaction solution was consisted of 5 ⁇ L master mix (2 ⁇ concentrate), 1 ⁇ L 25 mM MgCl2, 0.5 ⁇ L 4 ⁇ M forward and reverse primers, and DNA template.
  • Four qPCR runs were performed on Roche LightCycler 480.
  • Primer sequences for TadA are 5′-GATAATCCGTTCGACAAGCTG-3′ (forward) and 5′-ACCCACCACGATGATGTTT-3′ (reverse).
  • Primer sequences for pak are 5′-CGACGCCTCCAATAACTTCC-3′ (forward) and 5′-GTCGGCCTCCTCAGCATC-3′ (reverse).
  • Primer sequences for recA are 5′-CCGGAGACAACGACAGGT-3′ (forward) and 5′-GCTTCCTCATACCACTGGTCATC-3′ (reverse). All samples were run in duplicates in each qPCR run, except the second run, which was not duplicated.
  • Thermocycling conditions were as following: initial activation step of 10 minutes at 95° C.; 50 amplification cycles with each consisting of 10 seconds at 95° C., 15 seconds at 65° C. in the first cycle with a stepwise 0.5° C. decrease for each succeeding cycle, and 30 seconds at 72° C.; and final melting curve step starting at 65° C. and ending at 99° C. with a ramp rate of 0.02° C./s and acquisition rate of 25° C. DNA concentration standards were run in duplicates. Copy number ratios of genes were calculated based on the concentrations of the genes on the plasmid and chromosome.
  • 16S rDNA sequences have been deposited at GenBank under the project ID 46327.
  • Whole genome shotgun sequences and annotations of the P. acnes strains have been deposited at GenBank under the accession numbers ADWB00000000, ADWC00000000, ADWF00000000, ADWH00000000, ADWI00000000, ADXP00000000, ADXQ00000000, ADXR00000000, ADXS00000000, ADXT00000000, ADXU00000000, ADXW00000000, ADXX00000000, ADXY00000000, ADXZ00000000, ADYA00000000, ADYB00000000, ADYC00000000, ADYD00000000, ADYE00000000, ADYF00000000, ADYG00000000, ADYI00000000, ADYJ00000000, ADYK00000000, ADYL00000000, ADYM00000000, ADYN00000000, ADY000000000, ADYP00000000, ADYQ00000000, ADYR00000000, ADYS0000, ADYT00000000, ADY
  • Propionibacterium acnes is a major human skin bacterium. To understand whether different strains have different virulent properties and thus play different roles in health and diseases, the genomes of 82 P. acnes strains, most of which were isolated from acne or healthy skin, were compared. Lineage-specific genetic elements were identified that may explain the phenotypic and functional differences of P. acnes as a commensal in health and as a pathogen in diseases. By analyzing a large number of sequenced strains, an improved understanding of the genetic landscape and diversity of the organism at the strain level and at the molecular level is provided.
  • Propionibacterium acnes is a major commensal of the human skin. It contributes to maintaining the skin health by inhibiting the invasion of common pathogens, such as Staphylococcus aureus and Streptococcus pyogenes . It does so by hydrolyzing triglycerides and releasing free fatty acid that contributes to the acidic pH of the skin surface (1).
  • P. acnes has been historically linked to acne vulgaris, a chronic inflammatory disease of the pilosebaceous unit affecting more than 85% of adolescents and young adults (2).
  • a metagenomic study previously demonstrated that P. acnes was a dominant bacterium in the pilosebaceous unit in both healthy individuals and acne patients (3, 4). At the strain level, however, the population structures of P. acnes were different between the two groups.
  • P. acnes has been classified into three distinct types. Studies by Johnson and Cummins (7) first revealed two distinct phenotypes of P. acnes , known as types I and II, that could be distinguished based on serological agglutination tests and cell wall sugar analysis. McDowell et al. (8) differentiated types I and II P. acnes by monoclonal antibody typing. Furthermore, their phylogenetic analysis of P. acnes strains based on the nucleotide sequences of the recA gene and a more variable hemolysin/cytotoxin gene (tly) demonstrated that types I and II represent distinct lineages. Their investigations also revealed that strains within the type I lineage could be further split into two clades, known as types IA and IB (8, 9).
  • the first complete genome sequence of P. acnes , KPA171202, a type IB strain provided insights on the pathogenic potential of this Gram-positive bacterium (14).
  • the genome is 2.56 M by with 60% of GC content. It encodes 2,333 open reading frames (ORFs) including multiple gene products involved in degrading host molecules, such as sialidases, neuraminidases, endoglycoceramidases, lipases, and pore-forming factors.
  • ORFs 2,333 open reading frames
  • the sequence of a single genome does not reflect the genetic landscape of the organism and how genetic variations among strains determine their various phenotypes and pathogenic properties.
  • HMP Human Microbiome project
  • the 69 strains included 19 RT1 strains, five RT2 strains, 15 RT3 strains, eight RT4 strains, seven RT5 strains, four RT6 strains, six RT8 strains, four strains of minor ribotypes, and one type III strain.
  • the average genome size was 2.50 Mb (ranging from 2.46 to 2.58 Mb) and the GC content was 60%.
  • each genome encoded 2,626 ORFs (ranging from 2,393 to 2,806) (Table 2-1).
  • These 13 genomes include six RT1 strains, two RT2 strains, four RT3 strains, and one RT5 strain, however, no genomes of RT4, RT6, RT8 and type III strains were available.
  • pan-genome based on the 82 P. acnes genomes was estimated.
  • the number of new genes that would be discovered by sequencing additional P. acnes genomes by using a power law regression analysis, n ⁇ N ⁇ (24), was estimated ( FIG. 13 ).
  • the average number of new genes added by a novel genome was three when the 82nd genome was added.
  • the number of P. acnes pan-genes that would be accumulated by sequencing additional P. acnes genomes by using a power law regression analysis, n ⁇ N ⁇ , was then estimated ( FIG. 14 ).
  • pan-genome of P. acnes is defined as open, as the exponent a was less than one and ⁇ was greater than zero (24). However, since a was close to one and ⁇ was close to zero, it is believed that this organism evolved tightly without large expansions.
  • a genome comparison of the 82 P. acnes strains revealed that 2.20 Mb (88% of the average genome) was shared by all the P. acnes genomes, which are referred to herein as the “core regions.” Within the core regions, 123,223 unique single nucleotide polymorphisms (SNPs) were detected among the strains. Twenty seven percent of the SNPs were unique to type I, 22% were unique to type II, and 22% were unique to type III ( FIG. 15 ). A phylogenetic tree based on the 123,223 SNPs in the core regions was constructed ( FIG. 16 ). The tree showed that the recA type classification of the strains was consistent with the major clades based on the genomes.
  • SNPs single nucleotide polymorphisms
  • the recA type IA, IB, and II strains were all clustered together within each type, respectively, except HL097PA1 and PRP-38.
  • the only recA type III strain, HL201 PA1 formed a separate branch from type I and type II strains.
  • the tree also showed that the 16S rRNA ribotypes of the strains were consistent with the phylogenetic relationships inferred from the genome sequences.
  • Most of the RT1 strains were clustered in clade IA-1, while all the RT4 and most of the RT5 strains were clustered in clade IA-2. All six RT8 strains were clustered together in clade IB-1.
  • RT3 and RT16 strains were clustered together in clade IB-2 except SK187.
  • HL030PA1 and KPA171202 were clustered together with 6609, as a distinct IB-3 clade.
  • HL097PA1 and PRP-38 were clustered together and were classified as a novel type IC recently named by McDowell et al. (22).
  • All the RT2 strains were clustered in clade II, distant from clade I, together with RT6 strains.
  • HL202PA1 which is a RT6 strain and was isolated from an oral site, was not much different from the skin RT6 isolates and was clustered together.
  • acnes strains included 49 SSIs: 13 duets (i.e., 13 pairs of strains isolated from 13 individuals), five trios, and two quartets. Twenty three SSIs were clustered in the same clades, nine in clade IA-1, four in clade IA-2, two in clade IB-1, six in clade IB-2 and two in clade II. The distance (substitution rate at the 123,223 SNP sites in the core regions) between each pair of SSIs was calculated ( FIG. 16 ). The average distance of the SSIs in clade IA-1 was 0.0014, while that of strains from different individuals in clade IA-1 was 0.0064 (P ⁇ 0.001).
  • RT4 and RT5 strains may be transmitted among individuals. This finding is consistent with the previous clinical report that antibiotic-resistant Propionibacteria were transmissible between acne-prone individuals including dermatologists (26), as most of the antibiotic-resistant P. acnes strains belong to RT4 and RT5 (4,13).
  • the analysis of SSIs further supports the theory that RT4 and RT5 strains may be a pathogenic factor in acne.
  • non-core genome regions were identified that were not shared by all 82 strains.
  • the total length of the non-core regions was approximately 0.90 Mb.
  • the average GC content of the non-core regions was slightly lower than that of the core regions, 58% ⁇ 6.9%, suggesting that part of the non-core regions might be originated from other species via horizontal gene transfer.
  • GI2 genomic island-like cluster 2
  • Clade IB-1 consisted of all RT8 strains, which were also highly associated with acne based on our metagenomic study (4). They all have a unique genomic island (locus 4), which is 20 Kb long and encodes a series of nonribosomal peptide synthetases (NRPS), which may contribute to increased virulence of these strains. Most RT3 and RT16 strains belong to clade IB-2 and have fewer non-core regions than the strains in other clades.
  • locus 3 a linear plasmid, which is highly homologous to the locus 3 in the RT4 and RT5 strains of clade IA-2 and encodes a tight adhesion locus originated from Clostridium leptum (4).
  • locus 3 a linear plasmid, which is highly homologous to the locus 3 in the RT4 and RT5 strains of clade IA-2 and encodes a tight adhesion locus originated from Clostridium leptum (4).
  • strains in different lineages had a similar genome size with similar gain and loss of genetic materials, they harbor distinct genetic elements which may give rise to their different virulent properties.
  • RT2 and RT6 were more distantly related to the strains in clade I. Based on the metagenomic study, strains in clade II were not associated with acne, as RT2 was evenly distributed between acne patients and healthy individuals, while RT6 was significantly enriched in healthy individuals (4). Compared to type I strains, the genomes of RT2 and RT6 strains lack several regions, which are approximately 92 Kb long in total and encode 107 ORFs. RT2 and RT6 genomes have additional genomic regions with a similar size encoding 93 ORFs ( FIG. 20 ). Based on the COG classification, there were no significant differences in the distribution of the functional categories between the 107 type I specific ORFs and 93 type II specific ORFs.
  • CRISPR clustered regularly interspaced short palindromic repeats
  • CRISPR/Cas locus The most unique genomic feature of RT2 and RT6 strains is represented by the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas locus (4).
  • CRISPR/Cas system provides acquired bacterial immunity against viruses and plasmids by targeting nucleic acids in a sequence-specific manner (28). All the sequenced strains of RT2 and RT6 encoded a complete set of CRISPR/Cas genes and at least one repeat and spacer sequence, while none of the other ribotype strains did. Based on its complete genome sequence (20), strain ATCC11828 appeared to be an exception, having only terminal sequence but no spacer sequence. However, using PCR and sequencing it was determined that ATCC11828 has one repeat-spacer sequence (Table S2).
  • Type III strains are rarely found on the skin surface.
  • a type III P. acnes strain isolated from refractory endodontic lesion, HL201 PA1 was sequenced. This first available type III genome permitted the identification of the genetic elements specific to this lineage. Compared to type I and type II strains, the genome of HL201 PA1 lacks a few regions with a total length of 43 Kb ( FIG. 20 ).
  • ORFs encoded in these regions including anaerobic dimethyl sulfoxide reductase (PPA0516-PPA0517), iron(III) dicitrate transport system permease (PPA0792-PPA0793), 3-isopropylmalate dehydratase (PPA1361-PPA1363), and maltose transport system permease (PPA1553-PPA1554).
  • This study presents a comparative genome analysis of a major skin commensal, P. acnes , based on a large number of sequenced strains. This collection of strains not only includes strains associated with either healthy skin or acne, but also a large number of strain pairs that were isolated from the same individuals. This allowed the comparison of phylogenetic relationships and microevolution of the P. acnes strains associated with health vs. disease as well as of the strains in the same individual microbiome.
  • 16S ribotyping has a much higher resolution than recA typing and is much easier and faster than the traditional MLST method.
  • This method can be applied in a high-throughput manner by combining with next-generation sequencing, and thus allows one to detect the microbiome variations at the strain level (4). This is advantageous and important, as identifying and understanding the strain level variations of the human microbiome is medically important.
  • FIGS. 16 and 19 The genomes of the sets of strains isolated from the same individual samples were compared ( FIGS. 16 and 19 ). This collection of genome data is unique and no such kind of study has been performed to investigate the microevolution of a human commensal within an individual microbiome. It was found that while multiple P. acnes strain populations co-existed in the same individual microbiome, clonal expansions occurred in each population with little recombination among different populations. Within each lineage, the strains isolated from the same individuals were significantly more similar to each other than strains from different individuals except the disease associated strains, RT4 and RT5 strains ( FIG. 19 ). Although isolated from different individuals, they appeared to be clonal and have evolved from the same virulent ancestor strain ( FIG. 16 ). This supports the observation that these strains were transmissible (26) and that they may play a role in acne pathogenesis (4). This finding is important and will help control the spread of antibiotic resistant strains and develop new targeted therapy for acne.
  • RT4 and RT5 strains encode three distinct loci originated from mobile elements
  • RT8 strains encode a distinct region containing a set of NRPS.
  • the virulent genes encoded in these strain-specific regions may explain the associations of these strains with acne and help the development of new drugs targeting against these strains.
  • RT2 and RT6 strains which were not associated with acne and were enriched in healthy skin, respectively, all encode CRISPR/cas elements. The CRISPR mechanism may prevent these strains from acquiring virulent genes from invading foreign mobile elements.
  • these strains contain genomic variations in lipases that may alter lipid metabolism and reduce their virulence ( FIG. 22 ).
  • HL042PA3 The genome of HL042PA3 was sequenced using Roche/454 FLX and assembled using a combination of PHRAP/CONSED (32) and GSMAPPER (Roche).
  • HL201PA1 and HL202PA1 were sequenced using Illumina MiSeq (250 bp, paired-end) and assembled using Velvet (33).
  • the remaining 66 genomes were sequenced previously as described (4). Coding sequences were predicted using GeneMark (34) and GLIMMER (35).
  • the core regions were defined as genome sequences that were present in all 82 genomes, while the non-core regions were defined as genome sequences that were not present in all the genomes.
  • KPA171202 was used as the reference genome. Each of the other 81 genome sequences (a series of contigs in most of the genomes and ten complete genomes) was mapped to the reference genome using Nucmer (36). All the 81 “.coords” output files of Nucmer program were analyzed to identify overlap regions based on the KPA171202 coordinates using a Perl script. Core sequences were then extracted based on the genome sequence of KPA171202 with the coordinates calculated above.
  • SNPs Single nucleotide polymorphisms
  • the 82 concatenated sequences of the 123,223 SNP nucleotides in the core region were used to construct a phylogenetic tree of the P. acnes genomes.
  • MEGA5 (37) was used to calculate the distance based on the SNPs in the core regions using the Neighbor-Joining method and the p-distance method.
  • the bootstrap tree inferred from 200 replicates was taken.
  • sequence types of the 82 isolates were determined based on the MLST schemes published previously (11-13).
  • the MLST gene sequences were aligned using BLAST against all the alleles used in the two MLST schemes.
  • CRISPRFinder (38) was used to identify the CRISPR repeat-spacer sequences.
  • the annotation of HL110PA3 was used for BLAST alignment in order to identify the presence of CRISPR/Cas structure and CRISPR repeat-spacer sequences in strains of HL001PA1, HL060PA1, HL042PA3, HL082PA2, HL103PA1, HL106PA1, HL110PA4, HL202PA1, J139 and ATCC11828.
  • Each spacer sequence was annotated by BLAST (39) against NCBI's non-redundant nucleotide database and the reference genomic sequences database (refseq_genomic).
  • 314 non-core fragments with a length of >500 by (747,189 by in total, corresponding to 83% of all the non-core regions) were extracted and used in hierarchical clustering of the non-core regions.
  • Cluster 3.0 program (40) and average linkage method was used.
  • the clustering matrix was composed of 314 rows and 82 columns, in which 1 denotes presence of the non-core region and 0 denotes absence of the non-core region.
  • Java TreeView program (41) was used to display the clustering result.
  • Skin microcomedone (white head or black head) samples were taken from the skin of the subjects using a specialized adhesive tape. The skin was moistened with water before the adhesive tape was put on. The tape was left on the skin for 15-20 minutes until it became dry. Clean gloves were used for each sampling. After being taken off from the skin, the tape was placed into a 50 mL sterile tube. This can be applied to many skin sites, such as the nose, forehead, chin, and back.
  • Microcomedones were individually picked or scraped off from the adhesive tape using sterile forceps and placed in a 2 mL sterile microcentrifuge tube filled with Buffer ATL (Qiagen) and 0.1 mm diameter glass beads (BioSpec Products, Inc., Bartlesville, Okla.). Cells were lysed using a beadbeater for 3 minutes at 4,800 rpm at room temperature. After centrifugation at 14,000 rpm for 5 minutes, the supernatant was retrieved and used for genomic DNA extraction using QIAamp DNA Micro Kit (Qiagen). The manufacturer protocol for extracting DNA from chewing gum was used. Concentration of the genomic DNA was determined by a spectrometer.
  • 16S rDNA was amplified using primers 8F (5′-AGAGTTTGATYMTGGCTCAG-3′) and 1510R (5′-TACGGYTACCTTGTTACGACTT-3′). Thermocycling conditions were as following: initial denaturation step of 5 minutes at 94° C., 30 cycles of denaturation at 94° C. for 45 seconds, annealing at 52° C. for 30 seconds and elongation at 72° C. for 90 seconds, and a final elongation step at 72° C. for 20 minutes. PCR products were purified using column-based method. Subsequently, the 16S rDNA amplicons were cloned into pCR 2.1-TOPO vector (Invitrogen).
  • E. coli cells (Invitrogen) were transformed with the vectors and plated on selective media. Individual positive colonies were picked and inoculated into selective LB liquid medium. After 14 hours of incubation, the plasmids were extracted and purified, either using column-based plasmid extraction kit or traditional methods. The clones were sequenced bidirectionally using Sanger sequencing method. The microbiome type of each individual was determined based on the 16S rDNA sequence data of the top 10 major ribotypes. See FIG. 5 and SEQ ID NOs 1-10.
  • FIG. 23 shows that Loci 1, 2, and 3 were amplified from various P. acnes strains as predicted based on the genome data.
  • Target locus Forward primer Reverse primer Locus 1 GGTATCCACCGAGATGGAAG GTGGTCCCAGGTGACATTCT (SEQ ID NO: 11) (SEQ ID NO: 12) Locus 2 CGACATCGACGTTTCATCTG GTGTTCTCCTCGTGCTGGTT (SEQ ID NO: 13) (SEQ ID NO: 14) Locus 3 GATAATCCGTTCGACAAGCTG ACCCACCACGATGATGTTT (SEQ ID NO: 15) (SEQ ID NO: 16) Pak CGACGCCTCCAATAACTTCC GTCGGCCTCCTCAGCATC Additional primers targeting these loci can be designed based on the genome sequences of loci 1-4 (SEQ ID NOs 15-18, respectively).
  • Each 20 ⁇ L reaction contains 12.7 ⁇ L molecular grade H2O, 2 ⁇ L 10 ⁇ High Fidelity Buffer, 0.6 ⁇ L 50 mM MgSO4, 0.4 ⁇ L 10 nM dNTP, 0.8 ⁇ L of each primer (final primer concentrations is 400 nM), 0.1 ⁇ L Platinum Taq DNA Polymerase High Fidelity (All reagents from Invitrogen) and 1 ⁇ L gDNA template (approx. 40 ng gDNA).
  • the thermocycling conditions are as following: initial denaturation step of 10 minutes at 95° C.; 35 cycles with each consisting of 45 seconds at 95° C., 30 seconds at 65° C. and 45 seconds at 72° C.; and final elongation step of 10 minutes at 72° C.
  • thermocycling conditions were as following: initial activation step of 10 minutes at 95° C.; 40 amplification cycles with each consisting of 10 seconds at 95° C., 15 seconds at 65° C. during first cycle, but with a stepwise 0.5° C. decrease for each succeeding cycle and 30 seconds at 72° C.; and finally, a melting curve step, starting at 65° C. and ending at 99° C., with ramp rate of 0.02° C./s and acquisition rate of 25 per ° C.
  • the concentration of each locus was quantified from standards derived from Locus 1, Locus 2, and Pak PCR amplicons.
  • the copy number of each gene was quantified from genomic DNA standards that were derived from TadA (in Locus 3) and Pak amplicons using conventional PCR. See FIG. 24 .
  • Benchtop amplification was carried out to assess specificity of designed primers and to determine optimum cycling conditions prior to multiplexing.
  • Amplification was carried out using a BioRad C1000 thermal cycler.
  • Singleplex PCR reactions contained 0.2 ⁇ M target specific primers, 10 ⁇ Platinum Taq buffer (Invitrogen), 1.0 mM MgCl2, 0.2 mM each dNPT, 0.5 U/pl Platinum Taq polymerase, 1 ⁇ l DNA template and made up to a final volume of 10 ⁇ l. Cycling was as follows: initial denaturation 94° C. for 5 minutes, followed by 30 cycles of denaturation at 94° C. for 30 seconds, annealing at 60° C. for 30 seconds and extension at 72° C. for 30 seconds, and one final extension cycle at 72° C. for 5 minutes. Amplification products were analysed electrophoretically on a 1% agarose/TBE gel to check for correct amplification of target and cross-species reactivity with primer targets.
  • Triplex qPCR was carried out using an Applied Biosystems 7900HT instrument. 1-2 ⁇ l of sample DNA were added to mastermix containing X2 QuantiTect Multiplex PCR Master Mix (Qiagen), 0.2 ⁇ M primers; Locus1_F, Locus1_R, Pak F, Pak R; 0.2 ⁇ M probes; Locus1_Probe and Pak_Probe, and 0.1 ⁇ M primers Locus3_F and Locus3_R, and 0.1 ⁇ M Locus3_Probe. The reaction mix was made up to a final volume of 20 ⁇ l with sterile PCR grade water. The PCR program consisted of one cycle at 50° C.
  • Calibrations curves for P. acnes targets Locus 1 and Pak were constructed by plotting mean Ct values for a series of log dilutions of quantified genomic DNA standards extracted from P. acnes from pure culture. Genome equivalents were estimated. Five replicates of P. acnes calibrators were used to calculate mean Ct values and standard deviations. These data were used to determine sensitivity of the assay and the limits of detection (LOD). Calibration plots were used to determine the number of P. acnes genomes in clinical samples, with one copy of Locus1 and Pak targets per genome. DNA concentration and copy number were determined and serial ten-fold dilutions of the purified product were used as standards for construction of the Locus3 calibration plot.
  • Locus1 and Locus 3 were used for Locus1 and Pak calibration: HL038PA1 (Locus1+, Locus3+), HL083PA1 (Locus1+, Locus3 ⁇ ), HL078PA1 (Locus1 ⁇ , Locus3+) and HL063PA1 (Locus1 ⁇ , Locus3 ⁇ ).
  • the assay was validated using sequenced P. acnes strains from pure culture with known loci before being applied to clinical samples. The specificity of the assay for each target was tested using other bacterial species including skin commensals and other Propionibacteria.
  • RT6 is mostly found in healthy skin. These strains can be used as probiotics in topical products for acne prevention and treatment. Four RT6 strains, including HL110PA3, HL110PA4, HL042PA3, and HL202PA1, were isolated and sequenced.
  • bacterial culture supernatant and/or cell lysate can be used in creams, solutions, and other cosmetic products to prevent the growth of strains associated with acne. Sequences sharing at least 95% homology with SEQ ID NOs 51-54 may be used for the development of probiotics and the like.
  • the “core” genome regions of P. acnes were defined as genome sequences that are present in all of the 82 genomes, while the “non-core” regions were defined as genome sequences that are NOT present in all the genomes. See S. Tomida et al., Pan-genome and Comparative Genome Analyses of Propionibacterium acnes Reveal Its Genomic Diversity in the Healthy and Diseased Human Skin Microbiome (in press); see also Example 2. Non-core regions specific to strains of RTs 4 and 5, e.g., loci 1, 2, and 3, were identified, as mentioned previously.
  • Non-core regions specific to strains of RT8 were also identified as well as several other strains such as HL078PA1, HL030PA2, HL063PA2, P.acn17, HL097PA1, and PRP38. See FIG. 20 .
  • the genomic sequence of Locus 4 is set forth as SEQ ID NO:18.
  • the genes in loci 1-4 below (Tables 4-1, 4-2, and 4-3) that are mostly unique to acne associated strains RT4, RT5, and RT8 are listed below.
  • Non-core sequences are also set forth. The genes encoded in these loci are drug targets.
  • Bacteriophages play an important role in regulating the composition and dynamics of microbial communities, including the human skin microbiota.
  • Bacteriophages of Propionibacterium acnes a major skin commensal, were previously isolated and used as a typing system to distinguish different serotypes of P. acnes .
  • molecular characterization of these phages had been lacking.
  • Recent efforts in genome sequencing have improved our understanding of P. acnes phages and their interactions with bacterial hosts.
  • Bacteriophages are the most abundant organisms on earth (Mc Grath & van Sinderen, 2007) and are believed to outnumber bacteria by 10:1 in many diverse ecosystems (Rohwer, 2003). As important components of microbial communities, bacteriophages are a reservoir of diversity-generating elements (Rohwer & Thurber, 2009) and regulate both the abundances (Suttle, Chan, & Cottrell, 1990) and diversity of microbial hosts by predation (Rodriguez-Valera et al., 2009). The human skin is inhabited by hundreds of microbial species, including bacteria, fungi, and viruses (Grice & Segre, 2011).
  • the homeostasis of this ecosystem is important to its function as a barrier against the invasion and colonization of pathogens on the skin.
  • the relative abundances and interactions between bacteriophages and their bacterial hosts on the skin remained to be elucidated.
  • P. acnes The microbial community in the pilosebaceous unit of the skin is dominated by Propionibacterium acnes , which accounts for approximately 90% of the microbiota (“(Nature Precedings Paper),” n.d.).
  • P. acnes has been suggested as a pathogenic factor in the development of acne vulgaris (Bojar & Holland, 2004; Leyden, 2001), one of the most common human skin diseases.
  • Above-detailed studies classified P. acnes strains into ribotypes (RT) based on their 16S ribosomal RNA (rRNA) sequences, and demonstrated that P. acnes strain population structure in pilosebaceous units differs between healthy skin and acne affected skin.
  • RT ribotypes
  • rRNA 16S ribosomal RNA
  • P. acnes bacteriophages exist on the human skin.
  • Zierdt at al. Zierdt, Webster, & Rude, 1968 isolated such a phage, named phage 174, from spontaneous plaques of a P. acnes isolate (at the time known as Corynebacterium acnes ).
  • Phage 174 was able to lyse nearly all P. acnes strains tested in the study [10].
  • P. acnes phages were isolated which exhibited varied life cycles that range from lytic to temperate [11, 12].
  • the study of P. acnes bacteriophages had been limited to the development of phage typing systems to distinguish the different serotypes of P. acnes [ 13, 14]_ENREF — 4, and extensive molecular characterization of the phages has been lacking.
  • acnes phages have diverse host specificities among different lineages of P. acnes strains [14]. Phage host specificity is important in determining how these phages regulate the composition and dynamics of P. acnes populations in the community. On the other hand, certain P. acnes strains may also influence phage populations through their anti-viral mechanisms, such as the bacterial immune system based on the transcription of clustered, regularly-interspaced short, palindromic repeat (CRISPR) sequence arrays.
  • the CRISPR arrays contain oligonucleotide ‘spacers’ derived from phage DNA or plasmid DNA.
  • CRISPR-associated (Cas) proteins In a manner analogous to RNA interference, the transcribed, single-stranded CRISPR RNA elements interact with CRISPR-associated (Cas) proteins to direct the degradation of DNA targets containing complementary ‘protospacer’ sequences from foreign DNA [16]. While characterizing the genome diversity of P. acnes , Applicants discovered that P. acnes strains of RT2 and RT6 harbor CRISPR arrays. The CRISPR mechanism may play a role in defending against phage or plasmid invasion.
  • Group I consists of PHL066M04, PHL010M04, and PHL073M02, which are separated by an average phylogenetic distance of 0.002 at the genome level.
  • Group II consists of PHL085M01, PHL085N00, PHL115M02, and PHL037M02, with an average phylogenetic distance of 0.004.
  • the sites of sequence variation among Group I phages lie primarily within the region encoding a putataive type II holin and a peptidoglycan amidase (Gp20 and Gp21 as annotated in PA6, FIG. 33 ). These endolysins permeabilize the membrane and degrade the extracellular peptidoglycan layer to release new phage particles from the bacterial host.
  • the majority of the sequence variations in these two genes among the Group I phage genomes are mostly synonymous and do not appear to affect the functions of the proteins.
  • the genomes of PHL010M02 and PHL066M02 differ at only 11 sites, 9 of which occur in predicted coding regions.
  • Group II members reside in a region encoding homologs of Gp16, Gp17, and Gp18 in PA6 ( FIG. 33 ). These proteins' location near the 3′ end of the left arm between structural proteins and lysis proteins suggests that they may be late-acting genes involved in viral protein processing and packaging.
  • P. acnes phage strains provided an opportunity to validate and refine initial annotations of the P. acnes phage genomes. Based on the analysis, several alternative annotations of the phage genomes were confirmed.
  • the minus-strand Gp22/23 ORFs from most genomes are homologs of each other, except those in PHL067M10 and PHL114L00.
  • the Gp22/23 ORFs in these two genomes form a separate group and share little nucleotide similarity to the other Gp22/23 ORFs despite being present at the same locus in the genome.
  • This ORF appears in all the phage genomes on the minus strand suggests that this region may be part of the right arm. This is consistent with previous reports of a plus-strand transcriptional terminator that separates Gp22/23 from the rest of the left arm in PA6, PAD20, and PAS50 [11].
  • the sequenced phages were screened against a panel of 69 Propionibacterium strains, including 65 P. acnes strains, three P. humerusii strains, and one P. granulosum strain. Except for the P. acnes strains KPA171202 and ATCC11828, all of these Propionibacterium strains were isolated from the same cohort of subjects sampled for phages. The genomes of all 65 P. acnes strains and three P. humerusii strains were sequenced. A phylogenetic tree of the 65 P. acnes strains based on the SNPs in their core genomic regions was constructed ( FIG. 33 , left dendrogram).
  • the bacterial collection included all major lineages of P. acnes found on the human skin, with multiple strains representing each type: IA-1, IA-2, IB-1, IB-2, IB-3 and II.
  • the susceptibility/resistance of each of the 69 bacterial strains against each of our 15 sequenced phages was determined using a crossstreak method. In total, 1,035 bacterium-phage interactions were determined. Each experiment was repeated at least five times.
  • EOP efficiency of plaquing
  • Type IB-3 strains encode components of a type III restriction modification system (genes PPA1611 and PPA1612 in KPA171202). This may explain their resistance to phages.
  • KPA171202 encodes a cryptic prophage in the genome [17].
  • sequence of the prophage is not related to any of the sequenced P. acnes phages, therefore, the presence of the cryptic prophage is unlikely to explain the resistance to phages.
  • Three type II strains were also highly resistant to some of the phages. This is consistent with previous observations that strains of this type were more frequently resistant to phages [14].
  • P. granulosum is a common skin commensal with approximately 1.1% abundance in the pilosebaceous unit [7].
  • P. humerusii is a newly-defined species [18].
  • P. humerusii is one of the major species found on the skin with an abundance of 1.9% in the pilosebaceous unit [7]. It is closely related to P. acnes with >98% identity in the 16S rRNA gene sequence [18]. While the P.
  • P. humerusii strains showed strong resistance to all the phages tested, two P. humerusii strains, HL037PA2 and HL037PA3, were susceptible to all the phages.
  • the third P. humerusii strain, HL044PA1 was lysed by ten of the 15 phages tested. This suggests that the host range of P. acnes phages is not limited to P. acnes but also includes P. humerusii and possibly other closely-related Propionibacterium species.
  • RT2 and RT6 (RecA type II) and encode CRISPR/Cas genes, which function as a bacterial adaptive immune mechanism against foreign DNA.
  • These RT2 and RT6 strains each have one to nine spacers, 33 nucleotides long, in their CRISPR arrays. In total, they encode 42 spacers, 28 of which are unique.
  • the short nucleotide motif downstream of the protospacer known as the protospacer-adjacent motif (PAM)
  • PAM protospacer-adjacent motif
  • Mutations in these nucleotides have been found to disrupt CRISPR-mediated resistance despite complete complementarity in the protospacer sequence [20-22].
  • the PAMs of the nine protospacers that have exact matches to the spacer sequences encoded in HL042PA3 were examined.
  • acnes strains does not correlate with the presence of CRISPR spacers that match to phage protospacers, suggesting that additional mechanisms, such as regulation of the CRISPR/Cas system and/or other antiviral mechanisms, are needed in conferring the phage resistance.
  • P. acnes, P. humerusii , and P. granulosum strains were cultured under anaerobic conditions in Clostridial media (Oxoid) at 37° C. for 4-6 days.
  • Propionibacterium cultures were used to prepare top agar overlays for phage culture on A media plates (12 g/L pancreatic digest of casein, 12 g/L Difco yeast extract, 22.2 mM D-glucose, 29.4 mM g/L potassium phosphate monobasic, 8 mM magnesium sulphate heptahydrate, 20 g/L Difco agar).
  • Plaques found on skin sample culture plates were isolated by puncturing the agar with a pipet tip and resuspending in 50 ⁇ L SM buffer (0.1 M sodium chloride, 8 mM magnesium sulfate heptahydrate, 1M Tris-HCl, pH 7.5, 2% gelatin, 1 mM calcium chloride).
  • the phage resuspension was spread onto A media plates with top agar containing P. acnes strain ATCC 6919. After incubation at 37° C. for 2 days, phages were eluted with 8 mL SM buffer at room temperature, filtered with 0.22 uM PES filter (Millipore), and stored at 4° C. Phage titers were determined by plaque assay.
  • Phage DNA extraction was performed using the Lambda Mini Kit (Qiagen) with the following modifications. Phage particles were precipitated in Buffer L2 by centrifugation at 20,000 g for 1 hour. Extracted DNA was eluted with Buffer QF and precipitated with isopropanol overnight at ⁇ 20° C. before centrifugation.
  • Phage genomes were sequenced in multiplex using the Roche GS FLX Titanium or Illumina MiSeq platforms. De novo assembly of reads was performed with MIRA [24], and the resulting contigs were manually finished in Consed [25]. For phages covered by more than 20,000 reads, assembly was performed on a randomly-selected subset of 10,000 reads for 454 data or 20,000 reads for MiSeq data. Fully assembled phage genomes were annotated using Genemark.hmm [26] and Glimmer v3.02 [27].
  • Sequences present in all 16 phage genomes were defined as core regions of the phage genome. To identify these core regions, alignments were first generated between the PA6 genome and each of the other 15 phage genomes using Nucmer [28]. This yielded 15 sets of starting and ending coordinates describing intervals within the PA6 genome that align with any given phage genome. The core regions were then calculated for all phages by determining the overlapping intervals between all of the 15 coordinate sets. The core region sequences were concatenated for the subsequent multiple sequence alignments. Single nucleotide polymorphisms (SNPs) on the core regions were identified by using the “show-snps” option of Nucmer with the default setting. Using MEGA5 [29], phylogenetic trees were constructed by the Neighbor Joining method on p-distances based on SNP sites. Bootstrapping was based on 200 replicates.
  • SNPs Single nucleotide polymorphisms
  • the susceptibilities/resistances of Propionibacterium strains against 15 phages were determined using a modified cross-streak assay.
  • the bacterial strains were cultured and streaked in parallel across A media plates (5-6 isolates on each plate, ⁇ 1 cm apart, along with ATCC 6919 as a control). Approximately 5 ⁇ L of 106 pfu/mL phage suspension was applied onto each streak, and then the plates were incubated at 37° C. anaerobically for 2 days. At least five replicates of each cross-streak experiment were performed to determine whether the strains were susceptible or resistant judged based on lysis. The resistance of the bacterial strains was further quantified by assaying the efficiency of plaquing of the phages relative to P. acnes strain ATCC 6919, calculated as the following:
  • CRISPR spacer sequences were identified in P. acnes genomes using CRISPRfinder [35]. The extracted spacer sequences were aligned against all phage sequences using BLASTn. Protospacers with up to two mismatches were identified.
  • the genomes of 15 P. acnes phages isolated from human skin were sequenced.
  • the phage genomes showed moderately high sequence similarity and were comparable in size and organization. Based on a comparison of the genomes, most phages diverge from each other, while some of them form closely-related groups that were not described previously.
  • these phages When tested against a panel of 69 Propionibacterium strains, these phages lysed all P. acnes strains except some strains from type IB-3 and II. Some of the phages were also able to lyse Propionibacterium humerusii strains.
  • SEQ ID NOs 55-81 include four unique genomic sequences for strains in the IB-3 lineage and for several other strains, such as IB-3-s1 (IB-3 and SK187), IB-3-s2 (IB-3 and HL025PA1), IB-3-s3 (IB-3 and HL201PA1), IB-3-s4 (IB-3 and HL201PA1). The sequence similarities range from 95% to 100%. Primers targeting these sequences can be used to estimate and predict the effectiveness of phage therapy.
  • FIG. 26 shows the phylogenetic tree of the 32 phages including the 18 sequenced phages.
  • phage strains highly similar to each other, such as the ones in Groups I and II. This suggests that the same phages can be found in different individuals and supports that a particular phage strain can be used as a common treatment agent for different individuals.
  • SEQ ID NOs 33-50 reflect the genome sequences of the 18 sequenced phages, including the 15 phages shown in Table 5.
  • PHL113M01 PHL111M01, PHL082M00, PHL060L00, PHL067M10, PHL071N05, PHL112N00, PHL037M02, PHL085N00, PHL115M02, PHL085M01, PHL114L00, PHL073M02, PHL010M04, and PHL066M04.
  • PHL113M01 PHL060L00, PHL112N00, and PHL085M01.
  • PHL113M01 PHL111M01, PHL082M00, PHL060L00, PHL067M10, PHL071N05, PHL112N00, PHL037M02, PHL085N00, PHL115M02, PHL085M01, PHL114L00, PHL073M02, PHL010M04, and PHL066M04.
  • PHL113M01 PHL111M01, PHL082M00, PHL060L00, PHL067M10, PHL071N05, PHL112N00, PHL037M02, PHL085N00, PHL115M02, PHL085M01, PHL114L00, PHL073M02, PHL010M04, and PHL066M04.
  • PHL113M01 PHL111M01, PHL082M00, PHL060L00, PHL067M10, PHL071N05, PHL112N00, PHL037M02, PHL085N00, PHL115M02, PHL085M01, PHL114L00, PHL073M02, PHL010M04, and PHL066M04.
  • P. acnes phage strains can lyse a closely related Propionibacterium species, P. humerusii , which has been hypothesized to be associated with infection in prostheses.
  • P. acnes phage strains that can lyse P. humerusii strains can be potentially used as a therapeutic agent for P. humerusii associated diseases.
  • PHL113M01 PHL111M01, PHL082M00, PHL067M10, PHL071N05, PHL085N00, PHL085M01, PHL114L00, PHL073M02, and PHL010M04.
  • the patient has microbiome types IV or V, or is dominated by P. acnes RT10 strains, it is less likely antibiotic treatment would succeed, because these strains are antibiotic resistant.
  • These patients should be treated using other therapies, such as retinoids or the methods.
  • drugs targeting specifically to RT4, RT5, and RT8 can be used.
  • small molecules, antisense molecules, siRNA, biologics, antibodies, or combinations thereof targeting the genetic elements and biological pathways unique to the P. acnes strains associated with acne, detailed above, can be used.
  • additional treatment of phage therapy based on the foregoing can be used.
  • bacteriophage-based strain-specific therapy to treat acne can be employed.
  • An alternative treatment strategy is to balance the relative abundance of the P. acnes strains by promoting the growth of health-associated strains.
  • the strains associated with health can be used as probiotics. These can be topical creams, solutions, or other cosmetic products.
  • vaccine can be developed against virulent strains of P. acnes.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Mycology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Epidemiology (AREA)
  • Virology (AREA)
  • Pathology (AREA)
  • Biomedical Technology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Dermatology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
US14/385,576 2012-03-17 2013-03-15 Fast Diagnosis and Personalized Treatment for Acne Abandoned US20150086581A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/385,576 US20150086581A1 (en) 2012-03-17 2013-03-15 Fast Diagnosis and Personalized Treatment for Acne

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US201261612290P 2012-03-17 2012-03-17
PCT/US2013/032551 WO2013142378A1 (en) 2012-03-17 2013-03-15 Fast diagnosis and personalized treatments for acne
US14/385,576 US20150086581A1 (en) 2012-03-17 2013-03-15 Fast Diagnosis and Personalized Treatment for Acne

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/032551 A-371-Of-International WO2013142378A1 (en) 2012-03-17 2013-03-15 Fast diagnosis and personalized treatments for acne

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US15/257,423 Division US10364473B2 (en) 2012-03-17 2016-09-06 Fast diagnosis and personalized treatments for acne

Publications (1)

Publication Number Publication Date
US20150086581A1 true US20150086581A1 (en) 2015-03-26

Family

ID=49223275

Family Applications (5)

Application Number Title Priority Date Filing Date
US14/385,576 Abandoned US20150086581A1 (en) 2012-03-17 2013-03-15 Fast Diagnosis and Personalized Treatment for Acne
US15/257,423 Active US10364473B2 (en) 2012-03-17 2016-09-06 Fast diagnosis and personalized treatments for acne
US16/390,575 Abandoned US20190316183A1 (en) 2012-03-17 2019-04-22 Fast diagnosis and personalized treatments for acne
US17/033,034 Active US11692229B2 (en) 2012-03-17 2020-09-25 Fast diagnosis and personalized treatments for acne
US18/217,206 Abandoned US20240117446A1 (en) 2012-03-17 2023-06-30 Fast diagnosis and personalized treatments for acne

Family Applications After (4)

Application Number Title Priority Date Filing Date
US15/257,423 Active US10364473B2 (en) 2012-03-17 2016-09-06 Fast diagnosis and personalized treatments for acne
US16/390,575 Abandoned US20190316183A1 (en) 2012-03-17 2019-04-22 Fast diagnosis and personalized treatments for acne
US17/033,034 Active US11692229B2 (en) 2012-03-17 2020-09-25 Fast diagnosis and personalized treatments for acne
US18/217,206 Abandoned US20240117446A1 (en) 2012-03-17 2023-06-30 Fast diagnosis and personalized treatments for acne

Country Status (9)

Country Link
US (5) US20150086581A1 (https=)
EP (3) EP3360560A1 (https=)
JP (3) JP2015512255A (https=)
CN (2) CN104364394B (https=)
AU (3) AU2013235340B2 (https=)
BR (1) BR112014023005A2 (https=)
CA (1) CA2867621A1 (https=)
SG (1) SG11201405783VA (https=)
WO (1) WO2013142378A1 (https=)

Cited By (75)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9457077B2 (en) 2009-11-18 2016-10-04 Katherine Rose Kovarik Method and system for targeting the microbiome to promote health and treat allergic and inflammatory diseases
WO2016172196A1 (en) * 2015-04-20 2016-10-27 Pätzold Bernhard Methods and compositions for changing the composition of the skin microbiome using complex mixtures of bacterial strains
US9585920B2 (en) 2011-02-04 2017-03-07 Katherine Rose Kovarik Method and system for treating cancer cachexia
WO2017044871A1 (en) * 2015-09-09 2017-03-16 uBiome, Inc. Method and system for microbiome-derived diagnostics and therapeutics for eczema
WO2017044885A1 (en) * 2015-09-09 2017-03-16 uBiome, Inc. Method and system for microbiome-derived diagnostics and therapeutics for conditions associated with cerebro-craniofacial health
WO2017044880A1 (en) * 2015-09-09 2017-03-16 uBiome, Inc. Method and system for microbiome-derived diagnostics and therapeutics infectious disease and other health conditions associated with antibiotic usage
US9730967B2 (en) 2011-02-04 2017-08-15 Katherine Rose Kovarik Method and system for treating cancer cachexia
WO2017185018A1 (en) * 2016-04-21 2017-10-26 Naked Biome, Inc. Synthetic bacteria and methods of use
WO2017184992A1 (en) * 2016-04-21 2017-10-26 Naked Biome, Inc. Compositions and methods for treatment of skin disorders
US9970030B2 (en) 2014-08-27 2018-05-15 Caribou Biosciences, Inc. Methods for increasing CAS9-mediated engineering efficiency
US9987224B2 (en) 2011-02-04 2018-06-05 Joseph E. Kovarik Method and system for preventing migraine headaches, cluster headaches and dizziness
US10010568B2 (en) 2011-02-04 2018-07-03 Katherine Rose Kovarik Method and system for reducing the likelihood of a spirochetes infection in a human being
WO2017136738A3 (en) * 2016-02-05 2018-08-23 The Regents Of The University Of California Compositions and methods for promoting skin health
US10086024B2 (en) 2015-11-30 2018-10-02 Joseph E. Kovarik Method and system for protecting honey bees, bats and butterflies from neonicotinoid pesticides
US10085938B2 (en) 2011-02-04 2018-10-02 Joseph E. Kovarik Method and system for preventing sore throat in humans
US10086018B2 (en) 2011-02-04 2018-10-02 Joseph E. Kovarik Method and system for reducing the likelihood of colorectal cancer in a human being
US10111913B2 (en) 2011-02-04 2018-10-30 Joseph E. Kovarik Method of reducing the likelihood of skin cancer in an individual human being
EP3283084A4 (en) * 2015-04-13 2018-12-19 Ubiome Inc. Method and system for microbiome-derived characterization, diagnostics and therapeutics for cutaneous conditions
US10245288B2 (en) 2011-02-04 2019-04-02 Joseph E. Kovarik Method and system for reducing the likelihood of developing NASH in an individual diagnosed with non-alcoholic fatty liver disease
US10314865B2 (en) 2011-02-04 2019-06-11 Katherine Rose Kovarik Method and system for treating cancer and other age-related diseases by extending the healthspan of a human
US10347379B2 (en) 2014-10-21 2019-07-09 uBiome, Inc. Method and system for microbiome-derived characterization, diagnostics and therapeutics for cutaneous conditions
US10360346B2 (en) 2014-10-21 2019-07-23 uBiome, Inc. Method and system for microbiome-derived diagnostics
US10364473B2 (en) * 2012-03-17 2019-07-30 The Regents Of The University Of California Fast diagnosis and personalized treatments for acne
US10512661B2 (en) 2011-02-04 2019-12-24 Joseph E. Kovarik Method and system for reducing the likelihood of developing liver cancer in an individual diagnosed with non-alcoholic fatty liver disease
US10548761B2 (en) 2011-02-04 2020-02-04 Joseph E. Kovarik Method and system for reducing the likelihood of colorectal cancer in a human being
US10568916B2 (en) 2015-11-30 2020-02-25 Joseph E. Kovarik Method and system for protecting honey bees, bats and butterflies from neonicotinoid pesticides
US10583033B2 (en) 2011-02-04 2020-03-10 Katherine Rose Kovarik Method and system for reducing the likelihood of a porphyromonas gingivalis infection in a human being
US10584344B2 (en) 2014-06-17 2020-03-10 Crown Laboratories, Inc. Genetically modified bacteria and methods for genetic modification of bacteria
US10675347B2 (en) 2015-11-30 2020-06-09 Joseph E. Kovarik Method and system for protecting honey bees from fipronil pesticides
US10687975B2 (en) 2011-02-04 2020-06-23 Joseph E. Kovarik Method and system to facilitate the growth of desired bacteria in a human's mouth
CN111867608A (zh) * 2017-12-05 2020-10-30 拜欧麦克斯有限公司 用于痤疮和生物膜的噬菌体治疗
US10835560B2 (en) 2013-12-20 2020-11-17 Joseph E. Kovarik Reducing the likelihood of skin cancer in an individual human being
US10842834B2 (en) 2016-01-06 2020-11-24 Joseph E. Kovarik Method and system for reducing the likelihood of developing liver cancer in an individual diagnosed with non-alcoholic fatty liver disease
US10933128B2 (en) 2015-11-30 2021-03-02 Joseph E. Kovarik Method and system for protecting honey bees from pesticides
US10940169B2 (en) 2015-11-30 2021-03-09 Joseph E. Kovarik Method for reducing the likelihood of developing cancer in an individual human being
WO2021087415A1 (en) * 2019-10-31 2021-05-06 University Of Maryland, College Park Method of treating infections by bacteriolytic enzymes and manufacture thereof
US11026982B2 (en) 2015-11-30 2021-06-08 Joseph E. Kovarik Method for reducing the likelihood of developing bladder or colorectal cancer in an individual human being
US11191665B2 (en) 2011-02-04 2021-12-07 Joseph E. Kovarik Method and system for reducing the likelihood of a porphyromonas gingivalis infection in a human being
US11213552B2 (en) 2015-11-30 2022-01-04 Joseph E. Kovarik Method for treating an individual suffering from a chronic infectious disease and cancer
US20220002782A1 (en) * 2018-11-01 2022-01-06 Kao Corporation Method for preparing nucleic acid derived from skin cell of subject
US11273187B2 (en) 2015-11-30 2022-03-15 Joseph E. Kovarik Method and system for reducing the likelihood of developing depression in an individual
US11357722B2 (en) 2011-02-04 2022-06-14 Seed Health, Inc. Method and system for preventing sore throat in humans
US11419903B2 (en) 2015-11-30 2022-08-23 Seed Health, Inc. Method and system for reducing the likelihood of osteoporosis
US11504404B2 (en) 2016-02-24 2022-11-22 Crown Laboratories, Inc. Skin probiotic formulation
US11523934B2 (en) 2011-02-04 2022-12-13 Seed Health, Inc. Method and system to facilitate the growth of desired bacteria in a human's mouth
US11529379B2 (en) 2013-12-20 2022-12-20 Seed Health, Inc. Method and system for reducing the likelihood of developing colorectal cancer in an individual human being
US11529412B2 (en) 2015-11-30 2022-12-20 Seed Health, Inc. Method and system for protecting honey bees from pesticides
US11541081B2 (en) * 2016-10-19 2023-01-03 S-Biomedic Nv Methods and compositions for changing the composition of the skin microbiome using complex mixtures of bacterial strains
US11642382B2 (en) 2013-12-20 2023-05-09 Seed Health, Inc. Method for treating an individual suffering from bladder cancer
US11672835B2 (en) 2013-12-20 2023-06-13 Seed Health, Inc. Method for treating individuals having cancer and who are receiving cancer immunotherapy
US11826388B2 (en) 2013-12-20 2023-11-28 Seed Health, Inc. Topical application of Lactobacillus crispatus to ameliorate barrier damage and inflammation
US11833177B2 (en) 2013-12-20 2023-12-05 Seed Health, Inc. Probiotic to enhance an individual's skin microbiome
US11839632B2 (en) 2013-12-20 2023-12-12 Seed Health, Inc. Topical application of CRISPR-modified bacteria to treat acne vulgaris
US11844720B2 (en) 2011-02-04 2023-12-19 Seed Health, Inc. Method and system to reduce the likelihood of dental caries and halitosis
US11903984B1 (en) 2017-04-21 2024-02-20 Phi Therapeutics, Inc. Compositions comprising Propionibacterium acnes bacteriophages for treating acne
US11908128B2 (en) * 2019-07-10 2024-02-20 L'oreal Systems and methods to process images for skin analysis and to visualize skin analysis
US11913061B2 (en) 2016-07-08 2024-02-27 Kao Corporation Method for preparing nucleic acid sample
US11915795B2 (en) * 2016-12-23 2024-02-27 The Regents Of The University Of California Method and device for digital high resolution melt
US11951140B2 (en) 2011-02-04 2024-04-09 Seed Health, Inc. Modulation of an individual's gut microbiome to address osteoporosis and bone disease
US11951139B2 (en) 2015-11-30 2024-04-09 Seed Health, Inc. Method and system for reducing the likelihood of osteoporosis
US11969445B2 (en) 2013-12-20 2024-04-30 Seed Health, Inc. Probiotic composition and method for controlling excess weight, obesity, NAFLD and NASH
US11980643B2 (en) 2013-12-20 2024-05-14 Seed Health, Inc. Method and system to modify an individual's gut-brain axis to provide neurocognitive protection
US11998479B2 (en) 2011-02-04 2024-06-04 Seed Health, Inc. Method and system for addressing adverse effects on the oral microbiome and restoring gingival health caused by sodium lauryl sulphate exposure
US11998574B2 (en) 2013-12-20 2024-06-04 Seed Health, Inc. Method and system for modulating an individual's skin microbiome
US12005085B2 (en) 2013-12-20 2024-06-11 Seed Health, Inc. Probiotic method and composition for maintaining a healthy vaginal microbiome
US12102710B2 (en) 2020-06-23 2024-10-01 Crown Laboratories, Inc. Probiotic skin formulations
US12150967B2 (en) 2018-08-18 2024-11-26 Seed Health, Inc. Methods and compositions for honey bee health
US12239706B2 (en) 2015-11-30 2025-03-04 Seed Health, Inc. Method and system for protecting monarch butterflies from pesticides
US12246043B2 (en) 2013-12-20 2025-03-11 Seed Health, Inc. Topical application to treat acne vulgaris
US12257272B2 (en) 2015-12-24 2025-03-25 Seed Health, Inc. Method and system for reducing the likelihood of developing depression in an individual
US12279989B2 (en) 2011-02-04 2025-04-22 Seed Health, Inc. Method and system for increasing beneficial bacteria and decreasing pathogenic bacteria in the oral cavity
US12318377B2 (en) 2013-12-20 2025-06-03 Seed Health, Inc. Method and system for reducing the likelihood of a porphyromonas gingivalis infection in a human being
US12329783B2 (en) 2013-12-20 2025-06-17 Seed Health, Inc. Method and system to improve the health of a person's skin microbiome
US12416038B2 (en) 2019-07-16 2025-09-16 Meliolabs Inc. Methods and devices for single-cell based digital high resolution melt
US12533312B2 (en) 2011-02-04 2026-01-27 Seed Health, Inc. Method and system for preventing sore throat in humans

Families Citing this family (57)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP6261500B2 (ja) 2011-07-22 2018-01-17 プレジデント アンド フェローズ オブ ハーバード カレッジ ヌクレアーゼ切断特異性の評価および改善
AU2014281553A1 (en) 2013-06-18 2016-01-28 Prodermiq, Inc. Customized skin care products and personal care products based on the analysis of skin flora
JP6637885B2 (ja) 2013-07-21 2020-01-29 ペンデュラム セラピューティクス, インコーポレイテッド マイクロバイオームの特性解明、モニタリング、および処置のための方法およびシステム
US20150044192A1 (en) 2013-08-09 2015-02-12 President And Fellows Of Harvard College Methods for identifying a target site of a cas9 nuclease
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US9388430B2 (en) 2013-09-06 2016-07-12 President And Fellows Of Harvard College Cas9-recombinase fusion proteins and uses thereof
US9340799B2 (en) 2013-09-06 2016-05-17 President And Fellows Of Harvard College MRNA-sensing switchable gRNAs
AU2014346559B2 (en) 2013-11-07 2020-07-09 Editas Medicine,Inc. CRISPR-related methods and compositions with governing gRNAs
US20150165054A1 (en) 2013-12-12 2015-06-18 President And Fellows Of Harvard College Methods for correcting caspase-9 point mutations
EP3139939B1 (en) * 2014-05-07 2023-09-06 The Regents of The University of California Compositions and methods for treating skin and mucous membrane diseases
WO2016022363A2 (en) 2014-07-30 2016-02-11 President And Fellows Of Harvard College Cas9 proteins including ligand-dependent inteins
US10169541B2 (en) 2014-10-21 2019-01-01 uBiome, Inc. Method and systems for characterizing skin related conditions
JP6046849B1 (ja) * 2015-07-21 2016-12-21 TAK−Circulator株式会社 身体状態の評価方法、情報の提示方法、および身体状態を改善又は予防する物質のスクリーニング方法
CN108271392B (zh) * 2015-08-06 2023-01-10 阿瑞斯遗传股份有限公司 在微生物中利用基因组中结构变化对抗微生物药物的基因抗性预测
EP4345725A3 (en) 2015-09-17 2024-06-19 Prodermiq, Inc. Predicting skin age based on the analysis of skin flora and lifestyle data
JP7109784B2 (ja) 2015-10-23 2022-08-01 プレジデント アンド フェローズ オブ ハーバード カレッジ 遺伝子編集のための進化したCas9蛋白質
JP6872222B2 (ja) * 2015-11-04 2021-05-19 学校法人慶應義塾 対象物の使用者を判定する方法
GB2544481B (en) * 2015-11-16 2019-12-11 Century International Enterprises Ltd A wearable article and a method for producing a wearable article
CA3022294A1 (en) * 2016-04-25 2017-11-02 uBiome, Inc. Method and system for characterizing skin-related conditions
EP3243907A1 (en) * 2016-05-13 2017-11-15 Curetis GmbH Stable pan-genomes and their use
CN109689861A (zh) * 2016-05-15 2019-04-26 加州大学评议会 用于治疗痤疮的组合物和方法
CN106167820A (zh) * 2016-05-19 2016-11-30 胤安国际(辽宁)基因科技股份有限公司 鉴定或辅助鉴定痤疮丙酸杆菌的专用引物及其应用
CN113481294B (zh) * 2016-07-08 2024-03-12 花王株式会社 核酸样品的制备方法
KR102547316B1 (ko) 2016-08-03 2023-06-23 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 아데노신 핵염기 편집제 및 그의 용도
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
EP3526320A1 (en) 2016-10-14 2019-08-21 President and Fellows of Harvard College Aav delivery of nucleobase editors
JP6815006B2 (ja) 2016-11-01 2021-01-20 株式会社桃谷順天館 アクネ菌株選択的抗菌剤
EP3538119A4 (en) * 2016-11-08 2020-07-01 The Regents of The University of California COMPOSITIONS AND METHODS FOR TREATING SKIN DISEASES AND MAINTAINING HEALTHY SKIN
WO2018119359A1 (en) 2016-12-23 2018-06-28 President And Fellows Of Harvard College Editing of ccr5 receptor gene to protect against hiv infection
JP2020510038A (ja) 2017-03-09 2020-04-02 プレジデント アンド フェローズ オブ ハーバード カレッジ がんワクチン
EP3592853A1 (en) 2017-03-09 2020-01-15 President and Fellows of Harvard College Suppression of pain by gene editing
WO2018165621A1 (en) 2017-03-10 2018-09-13 Prodermiq, Inc. Customized skin care products and personal care products based on the analysis of skin flora
JP2020510439A (ja) 2017-03-10 2020-04-09 プレジデント アンド フェローズ オブ ハーバード カレッジ シトシンからグアニンへの塩基編集因子
CA3057192A1 (en) 2017-03-23 2018-09-27 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable dna binding proteins
WO2018209320A1 (en) 2017-05-12 2018-11-15 President And Fellows Of Harvard College Aptazyme-embedded guide rnas for use with crispr-cas9 in genome editing and transcriptional activation
WO2019023680A1 (en) 2017-07-28 2019-01-31 President And Fellows Of Harvard College METHODS AND COMPOSITIONS FOR EVOLUTION OF BASIC EDITORS USING PHAGE-ASSISTED CONTINUOUS EVOLUTION (PACE)
EP3676376B1 (en) 2017-08-30 2025-01-15 President and Fellows of Harvard College High efficiency base editors comprising gam
KR20250107288A (ko) 2017-10-16 2025-07-11 더 브로드 인스티튜트, 인코퍼레이티드 아데노신 염기 편집제의 용도
WO2019079612A1 (en) * 2017-10-20 2019-04-25 Naked Biome, Inc. SYSTEMS AND METHODS OF BACTERIAL DETECTION AND TREATMENT
WO2019118949A1 (en) 2017-12-15 2019-06-20 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
EP3797160A1 (en) 2018-05-23 2021-03-31 The Broad Institute Inc. Base editors and uses thereof
US12522807B2 (en) 2018-07-09 2026-01-13 The Broad Institute, Inc. RNA programmable epigenetic RNA modifiers and uses thereof
WO2020092453A1 (en) 2018-10-29 2020-05-07 The Broad Institute, Inc. Nucleobase editors comprising geocas9 and uses thereof
AU2019380669B2 (en) * 2018-11-16 2025-01-30 S-biomedic N.v. Compositions for treating oxidative stress-associated skin diseases and skin ageing and diagnosis of oxidative stress-associated skin diseases
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
JP7657726B2 (ja) 2019-03-19 2025-04-07 ザ ブロード インスティテュート,インコーポレーテッド 編集ヌクレオチド配列を編集するための方法および組成物
US12473543B2 (en) 2019-04-17 2025-11-18 The Broad Institute, Inc. Adenine base editors with reduced off-target effects
EP3764370B1 (fr) * 2019-07-12 2024-09-04 bioMérieux Procédé d'identification et de surveillance épidémiologique d'un foyer bactérien
EP4003381A4 (en) * 2019-07-22 2024-02-28 The Regents of the University of California COMPOSITIONS AND METHODS FOR TREATING SKIN INFECTIONS AND OTHER DISEASES
US12435330B2 (en) 2019-10-10 2025-10-07 The Broad Institute, Inc. Methods and compositions for prime editing RNA
DE112021002672T5 (de) 2020-05-08 2023-04-13 President And Fellows Of Harvard College Vefahren und zusammensetzungen zum gleichzeitigen editieren beider stränge einer doppelsträngigen nukleotid-zielsequenz
JP2024512491A (ja) * 2021-03-19 2024-03-19 パラレル・ヘルス・インコーポレイテッド マイクロバイオーム同定およびバクテリオファージ製剤
CN113066533B (zh) * 2021-04-02 2023-04-04 欧蒙医学诊断(中国)有限公司 一种mNGS病原体数据分析方法
US12502424B2 (en) 2023-05-05 2025-12-23 Sanofi Pasteur Inc. Compositions for use in treatment of acne
CN118737269B (zh) * 2024-08-30 2024-11-19 墨卓生物科技(浙江)有限公司 在单细胞微生物基因组测序结果中区分菌株的方法
WO2026075853A1 (en) * 2024-10-01 2026-04-09 L'oreal Skin microbiome-based methods for acne assessment and treatment

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013142378A1 (en) * 2012-03-17 2013-09-26 The Regents Of The University Of California Fast diagnosis and personalized treatments for acne
US20150005373A1 (en) * 2008-01-23 2015-01-01 Thesan Pharmaceuticals, Inc. Method of Treating Acne
US20150361436A1 (en) * 2014-06-17 2015-12-17 Xycrobe Therapeutics, Inc. Genetically modified bacteria and methods for genetic modification of bacteria
US20160074505A1 (en) * 2009-11-18 2016-03-17 Katherine Rose Kovarik Method and System for Targeting the Microbiome to Promote Health and Treat Allergic and Inflammatory Diseases

Family Cites Families (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU670777B2 (en) 1992-04-16 1996-08-01 Ortho Pharmaceutical Corporation Aqueous gel vehicles for retinoids
US5836999A (en) 1995-09-28 1998-11-17 Esc Medical Systems Ltd. Method and apparatus for treating psoriasis using pulsed electromagnetic radiation
EP0895534A1 (en) 1996-04-15 1999-02-10 Nymox Corporation Compositions containing bacteriophages and methods of using bacteriophages to treat infections
JPH11171783A (ja) 1997-08-15 1999-06-29 Vetoquinol Sa 所定の動物に関して細胞性免疫と体重増加を生じる濃度でのバクテリアの経口投与
US7005257B1 (en) * 1998-05-22 2006-02-28 Seapro Theranostics International Detection of antibiotic resistance in microorganisms
US6726913B1 (en) 1999-10-15 2004-04-27 The Van Kampen Group, Inc. Treatment of dermal tumors, warts, and viral infections of the respiratory tract in humans using heat-killed P. acnes
CA2407352A1 (en) 2000-04-21 2001-11-01 Corixa Corporation Compositions and methods for the therapy and diagnosis of acne vulgaris
US20030092163A1 (en) * 2001-07-26 2003-05-15 Collins John Kevin Probiotic bifidobacterium strains
WO2003033515A1 (en) * 2001-10-15 2003-04-24 Corixa Corporation Compositions and methods for the therapy and diagnosis of acne vulgaris
US20040157837A1 (en) 2002-11-07 2004-08-12 Serbedzija George N. Combinations for the treatment of fungal infections
NZ539076A (en) * 2005-03-29 2008-05-30 Blis Technologies Ltd Skin treatment compositions
EP1907534B2 (en) * 2005-07-12 2024-04-10 Micreos B.V. Bacteriophage and their uses
US20070269813A1 (en) 2005-11-03 2007-11-22 Dewhirst Floyd E Methods and arrays for identifying human microflora
JP5201818B2 (ja) * 2006-11-10 2013-06-05 キヤノン株式会社 プローブセット、プローブ固定担体及び遺伝子検査方法
WO2009018447A2 (en) 2007-07-31 2009-02-05 New York University Diagnostic and treatment methods for characterizing bacterial microbiota in skin conditions
WO2009105592A2 (en) * 2008-02-19 2009-08-27 Hogan James J Compositions and methods for detection of propionibacterium acnes nucleic acid
EP2381920A4 (en) 2008-12-05 2013-04-17 Univ California METHOD AND COMPOSITIONS FOR TREATING P.ACNES
US8784830B2 (en) * 2010-05-27 2014-07-22 Kenichiro Hasumi Antigen peptide and use thereof
EP2664919A1 (fr) * 2012-05-15 2013-11-20 Jean Hilaire Saurat Une méthode pour identifier les ligands du récepteur AhR possédant une activité sebosuppressive thérapeutique
EP2885421A1 (en) * 2012-07-13 2015-06-24 L'Oréal SA Method of in vitro diagnosing a pellicular state in a subject and related applications
US9234204B2 (en) 2012-08-07 2016-01-12 TopGeniX, Inc. Topical composition comprising transformed bacteria expressing a compound of interest
US8906668B2 (en) * 2012-11-23 2014-12-09 Seres Health, Inc. Synergistic bacterial compositions and methods of production and use thereof
CA2899925A1 (en) * 2013-02-04 2014-08-07 Seres Therapeutics, Inc. Compositions and methods for inhibition of pathogenic bacterial growth
EP3074027B1 (en) * 2013-11-25 2024-12-18 Seres Therapeutics, Inc. Synergistic bacterial compositions and methods of production and use thereof
US9737592B1 (en) * 2014-02-14 2017-08-22 David Gordon Bermudes Topical and orally administered protease inhibitors and bacterial vectors for the treatment of disorders and methods of treatment
EP3139939B1 (en) 2014-05-07 2023-09-06 The Regents of The University of California Compositions and methods for treating skin and mucous membrane diseases
EP3328417A4 (en) * 2015-07-31 2019-02-06 The Regents of The University of California MYCOBACTERIUM LYSTERASE: A NEW TREATMENT FOR AKNE
WO2017136738A2 (en) * 2016-02-05 2017-08-10 The Regents Of The University Of California Compositions and methods for promoting skin health
EP3448398A4 (en) * 2016-04-21 2019-12-18 Naked Biome, Inc. COMPOSITIONS AND METHODS FOR TREATING SKIN DISEASES
CN109689861A (zh) * 2016-05-15 2019-04-26 加州大学评议会 用于治疗痤疮的组合物和方法
KR102584057B1 (ko) * 2016-10-19 2023-09-27 에스-바이오메딕 엔브이 박테리아 균주의 복합 혼합물을 사용하여 피부 마이크로바이옴의 조성을 변경하기 위한 방법 및 조성물
BR112020010580A2 (pt) * 2017-12-05 2020-10-27 Biomx Ltd. tratamento bacteriofágico para acne e biofilmes
CA3183350A1 (en) * 2020-06-23 2021-12-30 Thomas M. Hitchcock Probiotic skin formulations

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150005373A1 (en) * 2008-01-23 2015-01-01 Thesan Pharmaceuticals, Inc. Method of Treating Acne
US20150094351A1 (en) * 2008-01-23 2015-04-02 Thesan Pharmaceuticals, Inc. Composition for topical use
US9011885B2 (en) * 2008-01-23 2015-04-21 Thesan Pharmaceuticals, Inc. Method of treating acne
US20160074505A1 (en) * 2009-11-18 2016-03-17 Katherine Rose Kovarik Method and System for Targeting the Microbiome to Promote Health and Treat Allergic and Inflammatory Diseases
WO2013142378A1 (en) * 2012-03-17 2013-09-26 The Regents Of The University Of California Fast diagnosis and personalized treatments for acne
US20150361436A1 (en) * 2014-06-17 2015-12-17 Xycrobe Therapeutics, Inc. Genetically modified bacteria and methods for genetic modification of bacteria
WO2015195845A1 (en) * 2014-06-17 2015-12-23 Xycrobe Therapeutics, Inc. Genetically modified bacteria and methods for genetic modification of bacteria

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
Alexeyev et al, Journal of Investigative Dermatology (2013), Volume 133:2292-2294 *
Bojar et al, Clinics in Dermatology, 2004, 22:375–379 *
Craft et al, J. Investigative Dermatology, 2013, 133:2295-2297 *
Eady et al, Journal of Investigative Dermatology (2013), Volume 133:2294-2295 *
Fitz-Gibbon et al, Journal of Investigative Dermatology (2013) 133:2152–2160 *
Grice et al, 29 MAY 2009 VOL 324 SCIENCE, pp. 1190-1192 *
Nakatsuji et al, J. Investigative Dermatology, 2008, 128:2451-2457 *

Cited By (100)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9457077B2 (en) 2009-11-18 2016-10-04 Katherine Rose Kovarik Method and system for targeting the microbiome to promote health and treat allergic and inflammatory diseases
US9750802B2 (en) 2009-11-18 2017-09-05 Katherine Rose Kovarik Method and system for targeting the microbiome to promote health and treat allergic and inflammatory diseases
US10245288B2 (en) 2011-02-04 2019-04-02 Joseph E. Kovarik Method and system for reducing the likelihood of developing NASH in an individual diagnosed with non-alcoholic fatty liver disease
US10668014B2 (en) 2011-02-04 2020-06-02 Joseph E. Kovarik Method and system for preventing sore throat in humans
US11844720B2 (en) 2011-02-04 2023-12-19 Seed Health, Inc. Method and system to reduce the likelihood of dental caries and halitosis
US10548761B2 (en) 2011-02-04 2020-02-04 Joseph E. Kovarik Method and system for reducing the likelihood of colorectal cancer in a human being
US10314866B2 (en) 2011-02-04 2019-06-11 Joseph E. Kovarik Method of reducing the likelihood of skin cancer in an individual human being
US9585920B2 (en) 2011-02-04 2017-03-07 Katherine Rose Kovarik Method and system for treating cancer cachexia
US12533312B2 (en) 2011-02-04 2026-01-27 Seed Health, Inc. Method and system for preventing sore throat in humans
US11523934B2 (en) 2011-02-04 2022-12-13 Seed Health, Inc. Method and system to facilitate the growth of desired bacteria in a human's mouth
US11357722B2 (en) 2011-02-04 2022-06-14 Seed Health, Inc. Method and system for preventing sore throat in humans
US11191665B2 (en) 2011-02-04 2021-12-07 Joseph E. Kovarik Method and system for reducing the likelihood of a porphyromonas gingivalis infection in a human being
US9987224B2 (en) 2011-02-04 2018-06-05 Joseph E. Kovarik Method and system for preventing migraine headaches, cluster headaches and dizziness
US10010568B2 (en) 2011-02-04 2018-07-03 Katherine Rose Kovarik Method and system for reducing the likelihood of a spirochetes infection in a human being
US11998479B2 (en) 2011-02-04 2024-06-04 Seed Health, Inc. Method and system for addressing adverse effects on the oral microbiome and restoring gingival health caused by sodium lauryl sulphate exposure
US11951140B2 (en) 2011-02-04 2024-04-09 Seed Health, Inc. Modulation of an individual's gut microbiome to address osteoporosis and bone disease
US9730967B2 (en) 2011-02-04 2017-08-15 Katherine Rose Kovarik Method and system for treating cancer cachexia
US10086018B2 (en) 2011-02-04 2018-10-02 Joseph E. Kovarik Method and system for reducing the likelihood of colorectal cancer in a human being
US10111913B2 (en) 2011-02-04 2018-10-30 Joseph E. Kovarik Method of reducing the likelihood of skin cancer in an individual human being
US10864109B2 (en) 2011-02-04 2020-12-15 Joseph E. Kovarik Method and system for reducing the likelihood of colorectal cancer in a human being
US12279989B2 (en) 2011-02-04 2025-04-22 Seed Health, Inc. Method and system for increasing beneficial bacteria and decreasing pathogenic bacteria in the oral cavity
US10716815B2 (en) 2011-02-04 2020-07-21 Katherine Rose Kovarik Method and system for treating cancer and other age-related diseases by extending the healthspan of a human
US10085938B2 (en) 2011-02-04 2018-10-02 Joseph E. Kovarik Method and system for preventing sore throat in humans
US10314865B2 (en) 2011-02-04 2019-06-11 Katherine Rose Kovarik Method and system for treating cancer and other age-related diseases by extending the healthspan of a human
US10687975B2 (en) 2011-02-04 2020-06-23 Joseph E. Kovarik Method and system to facilitate the growth of desired bacteria in a human's mouth
US10512661B2 (en) 2011-02-04 2019-12-24 Joseph E. Kovarik Method and system for reducing the likelihood of developing liver cancer in an individual diagnosed with non-alcoholic fatty liver disease
US10583033B2 (en) 2011-02-04 2020-03-10 Katherine Rose Kovarik Method and system for reducing the likelihood of a porphyromonas gingivalis infection in a human being
US10555976B2 (en) 2011-02-04 2020-02-11 Joseph E. Kovarik Method of reducing the likelihood of skin cancer in an individual human being
US10364473B2 (en) * 2012-03-17 2019-07-30 The Regents Of The University Of California Fast diagnosis and personalized treatments for acne
US11692229B2 (en) 2012-03-17 2023-07-04 The Regents Of The University Of California Fast diagnosis and personalized treatments for acne
US12318377B2 (en) 2013-12-20 2025-06-03 Seed Health, Inc. Method and system for reducing the likelihood of a porphyromonas gingivalis infection in a human being
US11833177B2 (en) 2013-12-20 2023-12-05 Seed Health, Inc. Probiotic to enhance an individual's skin microbiome
US12357662B2 (en) 2013-12-20 2025-07-15 Seed Health, Inc. Modulation of an individual's gut microbiome to address osteoporosis and bone disease
US11642382B2 (en) 2013-12-20 2023-05-09 Seed Health, Inc. Method for treating an individual suffering from bladder cancer
US12329783B2 (en) 2013-12-20 2025-06-17 Seed Health, Inc. Method and system to improve the health of a person's skin microbiome
US11969445B2 (en) 2013-12-20 2024-04-30 Seed Health, Inc. Probiotic composition and method for controlling excess weight, obesity, NAFLD and NASH
US11672835B2 (en) 2013-12-20 2023-06-13 Seed Health, Inc. Method for treating individuals having cancer and who are receiving cancer immunotherapy
US12246043B2 (en) 2013-12-20 2025-03-11 Seed Health, Inc. Topical application to treat acne vulgaris
US11826388B2 (en) 2013-12-20 2023-11-28 Seed Health, Inc. Topical application of Lactobacillus crispatus to ameliorate barrier damage and inflammation
US11529379B2 (en) 2013-12-20 2022-12-20 Seed Health, Inc. Method and system for reducing the likelihood of developing colorectal cancer in an individual human being
US12318414B2 (en) 2013-12-20 2025-06-03 Seed Health, Inc. Method and system to modify an individual's gut-brain axis to provide neurocognitive protection
US11980643B2 (en) 2013-12-20 2024-05-14 Seed Health, Inc. Method and system to modify an individual's gut-brain axis to provide neurocognitive protection
US11839632B2 (en) 2013-12-20 2023-12-12 Seed Health, Inc. Topical application of CRISPR-modified bacteria to treat acne vulgaris
US12005085B2 (en) 2013-12-20 2024-06-11 Seed Health, Inc. Probiotic method and composition for maintaining a healthy vaginal microbiome
US12318411B2 (en) 2013-12-20 2025-06-03 Seed Health, Inc. Probiotic method and composition for maintaining a healthy vaginal microbiome
US10835560B2 (en) 2013-12-20 2020-11-17 Joseph E. Kovarik Reducing the likelihood of skin cancer in an individual human being
US11998574B2 (en) 2013-12-20 2024-06-04 Seed Health, Inc. Method and system for modulating an individual's skin microbiome
US10584344B2 (en) 2014-06-17 2020-03-10 Crown Laboratories, Inc. Genetically modified bacteria and methods for genetic modification of bacteria
US12049633B2 (en) 2014-06-17 2024-07-30 Crown Laboratories, Inc. Genetically modified bacteria and methods for genetic modification of bacteria
US9970030B2 (en) 2014-08-27 2018-05-15 Caribou Biosciences, Inc. Methods for increasing CAS9-mediated engineering efficiency
US10347379B2 (en) 2014-10-21 2019-07-09 uBiome, Inc. Method and system for microbiome-derived characterization, diagnostics and therapeutics for cutaneous conditions
US10354757B2 (en) 2014-10-21 2019-07-16 uBiome, Inc. Method and system for microbiome-derived characterization, diagnostics and therapeutics for cutaneous conditions
US10410749B2 (en) 2014-10-21 2019-09-10 uBiome, Inc. Method and system for microbiome-derived characterization, diagnostics and therapeutics for cutaneous conditions
US10803991B2 (en) 2014-10-21 2020-10-13 Psomagen, Inc. Method and system for microbiome-derived diagnostics and therapeutics
US10354756B2 (en) 2014-10-21 2019-07-16 uBiome, Inc. Method and system for microbiome-derived characterization, diagnostics and therapeutics for cutaneous conditions
US10360346B2 (en) 2014-10-21 2019-07-23 uBiome, Inc. Method and system for microbiome-derived diagnostics
US10380325B2 (en) 2014-10-21 2019-08-13 uBiome, Inc. Method and system for microbiome-derived diagnostics and therapeutics
US10381117B2 (en) 2014-10-21 2019-08-13 uBiome, Inc. Method and system for microbiome-derived characterization, diagnostics and therapeutics for cutaneous conditions
EP3283084A4 (en) * 2015-04-13 2018-12-19 Ubiome Inc. Method and system for microbiome-derived characterization, diagnostics and therapeutics for cutaneous conditions
US10774305B2 (en) 2015-04-20 2020-09-15 S-Biomedic Nv Methods and compositions for changing the composition of the skin microbiome using complex mixtures of bacterial strains
WO2016172196A1 (en) * 2015-04-20 2016-10-27 Pätzold Bernhard Methods and compositions for changing the composition of the skin microbiome using complex mixtures of bacterial strains
US11987788B2 (en) 2015-04-20 2024-05-21 S-Biomedic Nv Methods and compositions for changing the composition of the skin microbiome using complex mixtures of bacterial strains
WO2017044880A1 (en) * 2015-09-09 2017-03-16 uBiome, Inc. Method and system for microbiome-derived diagnostics and therapeutics infectious disease and other health conditions associated with antibiotic usage
US11773455B2 (en) 2015-09-09 2023-10-03 Psomagen, Inc. Method and system for microbiome-derived diagnostics and therapeutics infectious disease and other health conditions associated with antibiotic usage
WO2017044871A1 (en) * 2015-09-09 2017-03-16 uBiome, Inc. Method and system for microbiome-derived diagnostics and therapeutics for eczema
WO2017044885A1 (en) * 2015-09-09 2017-03-16 uBiome, Inc. Method and system for microbiome-derived diagnostics and therapeutics for conditions associated with cerebro-craniofacial health
US11213552B2 (en) 2015-11-30 2022-01-04 Joseph E. Kovarik Method for treating an individual suffering from a chronic infectious disease and cancer
US10940169B2 (en) 2015-11-30 2021-03-09 Joseph E. Kovarik Method for reducing the likelihood of developing cancer in an individual human being
US11273187B2 (en) 2015-11-30 2022-03-15 Joseph E. Kovarik Method and system for reducing the likelihood of developing depression in an individual
US10568916B2 (en) 2015-11-30 2020-02-25 Joseph E. Kovarik Method and system for protecting honey bees, bats and butterflies from neonicotinoid pesticides
US11026982B2 (en) 2015-11-30 2021-06-08 Joseph E. Kovarik Method for reducing the likelihood of developing bladder or colorectal cancer in an individual human being
US10086024B2 (en) 2015-11-30 2018-10-02 Joseph E. Kovarik Method and system for protecting honey bees, bats and butterflies from neonicotinoid pesticides
US11419903B2 (en) 2015-11-30 2022-08-23 Seed Health, Inc. Method and system for reducing the likelihood of osteoporosis
US11529412B2 (en) 2015-11-30 2022-12-20 Seed Health, Inc. Method and system for protecting honey bees from pesticides
US10933128B2 (en) 2015-11-30 2021-03-02 Joseph E. Kovarik Method and system for protecting honey bees from pesticides
US12239706B2 (en) 2015-11-30 2025-03-04 Seed Health, Inc. Method and system for protecting monarch butterflies from pesticides
US11951139B2 (en) 2015-11-30 2024-04-09 Seed Health, Inc. Method and system for reducing the likelihood of osteoporosis
US10675347B2 (en) 2015-11-30 2020-06-09 Joseph E. Kovarik Method and system for protecting honey bees from fipronil pesticides
US12257272B2 (en) 2015-12-24 2025-03-25 Seed Health, Inc. Method and system for reducing the likelihood of developing depression in an individual
US10842834B2 (en) 2016-01-06 2020-11-24 Joseph E. Kovarik Method and system for reducing the likelihood of developing liver cancer in an individual diagnosed with non-alcoholic fatty liver disease
US20210137997A1 (en) * 2016-02-05 2021-05-13 The Regents Of The University Of California Compositions and methods for promoting skin health
WO2017136738A3 (en) * 2016-02-05 2018-08-23 The Regents Of The University Of California Compositions and methods for promoting skin health
US11504404B2 (en) 2016-02-24 2022-11-22 Crown Laboratories, Inc. Skin probiotic formulation
US11207357B2 (en) 2016-04-21 2021-12-28 Symbiome, Inc. Compositions and methods for treatment of skin disorders
WO2017185018A1 (en) * 2016-04-21 2017-10-26 Naked Biome, Inc. Synthetic bacteria and methods of use
WO2017184992A1 (en) * 2016-04-21 2017-10-26 Naked Biome, Inc. Compositions and methods for treatment of skin disorders
US9889165B2 (en) 2016-04-21 2018-02-13 Naked Biome, Inc. Compositions and methods for treatment of skin disorders
US10293007B2 (en) 2016-04-21 2019-05-21 Naked Biome, Inc. Compositions and methods for treatment of skin disorders
US11913061B2 (en) 2016-07-08 2024-02-27 Kao Corporation Method for preparing nucleic acid sample
US11541081B2 (en) * 2016-10-19 2023-01-03 S-Biomedic Nv Methods and compositions for changing the composition of the skin microbiome using complex mixtures of bacterial strains
US11915795B2 (en) * 2016-12-23 2024-02-27 The Regents Of The University Of California Method and device for digital high resolution melt
US11903984B1 (en) 2017-04-21 2024-02-20 Phi Therapeutics, Inc. Compositions comprising Propionibacterium acnes bacteriophages for treating acne
CN111867608A (zh) * 2017-12-05 2020-10-30 拜欧麦克斯有限公司 用于痤疮和生物膜的噬菌体治疗
US12150967B2 (en) 2018-08-18 2024-11-26 Seed Health, Inc. Methods and compositions for honey bee health
US20220002782A1 (en) * 2018-11-01 2022-01-06 Kao Corporation Method for preparing nucleic acid derived from skin cell of subject
US11908128B2 (en) * 2019-07-10 2024-02-20 L'oreal Systems and methods to process images for skin analysis and to visualize skin analysis
US12416038B2 (en) 2019-07-16 2025-09-16 Meliolabs Inc. Methods and devices for single-cell based digital high resolution melt
WO2021087415A1 (en) * 2019-10-31 2021-05-06 University Of Maryland, College Park Method of treating infections by bacteriolytic enzymes and manufacture thereof
US12516309B2 (en) 2019-10-31 2026-01-06 University Of Maryland, College Park Method of treating infections by bacteriolytic enzymes and manufacture thereof
US12102710B2 (en) 2020-06-23 2024-10-01 Crown Laboratories, Inc. Probiotic skin formulations

Also Published As

Publication number Publication date
JP2019050833A (ja) 2019-04-04
WO2013142378A1 (en) 2013-09-26
US20190316183A1 (en) 2019-10-17
EP2825676B1 (en) 2017-12-20
CN110055320A (zh) 2019-07-26
US11692229B2 (en) 2023-07-04
AU2019219817A1 (en) 2019-09-12
EP2825676A1 (en) 2015-01-21
EP3692999A1 (en) 2020-08-12
EP2825676A4 (en) 2015-09-30
US20240117446A1 (en) 2024-04-11
AU2013235340B2 (en) 2019-05-23
CA2867621A1 (en) 2013-09-26
US10364473B2 (en) 2019-07-30
AU2013235340A1 (en) 2014-10-16
US20210123092A1 (en) 2021-04-29
HK1207402A1 (en) 2016-01-29
SG11201405783VA (en) 2014-10-30
CN104364394B (zh) 2019-02-22
JP2021013395A (ja) 2021-02-12
US20170058328A1 (en) 2017-03-02
WO2013142378A9 (en) 2014-01-23
AU2020227049A1 (en) 2020-09-17
EP3360560A1 (en) 2018-08-15
BR112014023005A2 (pt) 2017-07-18
JP2015512255A (ja) 2015-04-27
CN104364394A (zh) 2015-02-18

Similar Documents

Publication Publication Date Title
US20240117446A1 (en) Fast diagnosis and personalized treatments for acne
Cornuault et al. Phages infecting Faecalibacterium prausnitzii belong to novel viral genera that help to decipher intestinal viromes
Liu et al. The diversity and host interactions of Propionibacterium acnes bacteriophages on human skin
Meehan et al. Molecular epidemiology of group B streptococci in Ireland reveals a diverse population with evidence of capsular switching
Chaguza et al. Mechanisms and impact of genetic recombination in the evolution of Streptococcus pneumoniae
Fittipaldi et al. Full-genome dissection of an epidemic of severe invasive disease caused by a hypervirulent, recently emerged clone of group A Streptococcus
Tokajian et al. Molecular characterization of Staphylococcus aureus in Lebanon
Borges et al. Helicobacter pullorum isolated from fresh chicken meat: antibiotic resistance and genomic traits of an emerging foodborne pathogen
Tulyaprawat et al. Emergence of multi-drug resistance and its association with uncommon serotypes of Streptococcus agalactiae isolated from non-neonatal patients in Thailand
Schindler et al. Group B streptococcus virulence factors associated with different clinical syndromes: Asymptomatic carriage in pregnant women and early-onset disease in the newborn
Kerkhof et al. Diagnostic approach for detection and identification of emerging enteric pathogens revisited: the (Ali) arcobacter lanthieri case
Di Mento et al. A retrospective molecular epidemiological scenario of carbapenemase-producing Klebsiella pneumoniae clinical isolates in a Sicilian transplantation hospital shows a swift polyclonal divergence among sequence types, resistome and virulome
WO2010062897A1 (en) Methods and compositions to detect clostridium difficile
Amarantini et al. Identification and characterization of Salmonella typhi isolates from Southwest Sumba District, East Nusa Tenggara based on 16S rRNA gene sequences
HK40011589A (en) Fast diagnosis and personalized treatments for acne
Gruner et al. Outbreak of typhoid fever in a non-endemic area: comparison of three molecular typing methods
HK1207402B (zh) 痤疮的快速诊断和个体化治疗
Kitano et al. First human case of infected lymphocele with bloodstream infection caused by Staphylococcus coagulans transmitted from a pet dog: a case report
Khan Detailed genomic and antimicrobial resistance comparison of UK Streptococcus agalactiae isolates from adults to those of diverse global origins
Conde-Pérez et al. Evidence for translocation of oral Parvimonas micra from the subgingival sulcus of the human oral cavity to the colorectal adenocarcinoma
de Oliveira et al. Neisseria gonorrhoeae arthritis in a patient with systemic lupus: resistance and virulence profiles
JP2009515525A (ja) Usa300市中感染メチシリン−耐性黄色ブドウ球菌の同定
Seemi Understanding Mycobacterial Genome Diversity Using a Cultureomics Approach
Ene Exploring the Role of Lactobacillus jensenii and Lactobacillus mulieris in the Urogenital Tract
Mir et al. Research Article Supershed Escherichia coli O157: H7 Has Potential for Increased Persistence on the Rectoanal Junction Squamous Epithelial Cells and Antibiotic Resistance

Legal Events

Date Code Title Description
AS Assignment

Owner name: THE REGENTS OF THE UNIVERSITY OF CALIFORNIA, CALIF

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:LI, HUIYING;TOMIDA, SHUTA;MODLIN, ROBERT L.;AND OTHERS;SIGNING DATES FROM 20130820 TO 20140915;REEL/FRAME:033786/0788

AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:UNIVERSITY OF CALIFORNIA LOS ANGELES;REEL/FRAME:034793/0568

Effective date: 20150108

AS Assignment

Owner name: THE REGENTS OF THE UNIVERSITY OF CALIFORNIA, CALIF

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:LI, HUIYING;TOMIDA, SHUTA;SIGNING DATES FROM 20141211 TO 20150326;REEL/FRAME:035322/0372

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION