WO2019079612A1

WO2019079612A1 - Systems and methods for bacterial detection and treatment

Info

Publication number: WO2019079612A1
Application number: PCT/US2018/056535
Authority: WO
Inventors: Emma Taylor; David Hanzel; Daniel J. NILSON
Original assignee: Naked Biome, Inc.
Priority date: 2017-10-20
Filing date: 2018-10-18
Publication date: 2019-04-25

Abstract

Described herein are methods and systems for determining the presence and/or quantity of a target molecule or bacteria of interest within a sample.

Description

SYSTEMS AND METHODS FOR BACTERIAL DETECTION AND TREATMENT

CROSS-REFERENCE

[0001] This application claims the benefit of U.S. Provisional Application No. 62/575,311, filed October 20, 2017, and U.S. Provisional Application No. 62/678, 184 filed May 30, 2018, each of which is incorporated herein by reference in its entirety.

BACKGROUND OF THE INVENTION

[0002] Detection of bacteria in biological, environmental, industrial, food, and other samples is traditionally performed using costly sequencing methods or methods that require preparation of the sample to isolate genetic material. There is currently a need for rapid and cost-effective methods for detecting bacteria from a given sample.

SUMMARY OF THE INVENTION

[0003] In one aspect, the present application provides methods and systems for detecting a bacteria of interest from a sample that does not require laborious sample preparation or strict storage requirements traditionally employed in sequencing or other amplification methods. For instance, an exemplary method employing quantitative polymerase chain reaction (qPCR) described herein does not require sample storage at 4 °C or lower and/or does not require isolation or purification of genomic material prior to qPCR.

[0004] Strains of Propionibacterium acnes, HP3A11, HP4G1 and HP5G4, described herein, were deposited in the American Tissue Culture Collection (10801 University Boulevard

Manassas, VA 20110-2209 USA) on April 6, 2017 in accordance with and under the provisions of the Budapest Treaty for the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure. The strains were tested by the American Tissue Culture

Collection (ATCC) and determined to be viable. The ATCC has assigned ATCC deposit accession numbers: PTA-124010 to strain HP3A11; PTA-124011 to strain HP4G1; and PTA 124012 to HP5G4.

[0005] In one aspect, provided herein is a method for determining a quantity of bacteria within a sample, the method comprising quantifying the presence of a ribosomal ribonucleic acid (rRNA) sequence within the sample, thereby determining the quantity of bacteria within the sample , wherein the quantifying comprises quantitative polymerase chain reaction. In some

embodiments, the rRNA sequence comprises a sequence at least about 90% or 95% identical to any one of SEQ ID NOS: 33-43. In some embodiments, the rRNA sequence is quantified using a quantitative polymerase chain reaction (qPCR). In some embodiments, the qPCR method is TaqMan™. In some embodiments, the qPCR method comprises contacting the sample with a probe having a fluorophore and quencher. In some embodiments, the qPCR method comprises contacting the sample with a primer comprising a sequence at least about 90% or 95% identical to SEQ ID NO: 7. In some embodiments, the qPCR method comprises contacting the sample with a primer comprising a sequence at least about 90% or 95% identical to SEQ ID NO: 8. In some embodiments, the qPCR method comprises contacting the sample with a forward primer and a reverse primer in a nucleic acid amplification reaction, wherein the forward primer and reverse primer hybridize to the respective ends of the rRNA sequence; and detecting the presence of the amplified rRNA sequence with a probe capable of hybridizing to a nucleic acid sequence located within the amplified rRNA sequence. In some embodiments, the probe is hydrolysable. In some embodiments, the forward primer comprises a sequence at least about 90% or 95% identical to SEQ ID NO: 7. In some embodiments, the reverse primer comprises a sequence at least about 90% or 95% identical to SEQ ID NO: 8. In some embodiments, the probe comprises a sequence at least about 90% or 95% identical to SEQ ID NO: 9. In some embodiments, the rRNA sequence comprises a sequence at least about 10 nucleotides in length and 90% or 95% identical to a sequence between SEQ ID NO: 7 and SEQ ID NO: 8 within a bacterial rRNA. In some embodiments, the sample is obtained from the skin of a human face. In some embodiments, the sample is obtained from a pilosebaceous unit from an individual. In some embodiments, the quantitative PCR comprises a fluorescence based real-time polymerase chain reaction method.

[0006] In some embodiments, provided is a method of determining the percentage of bacteria containing a target molecule within the total bacteria of the sample, comprising quantifying the amount of target molecule within the sample, and dividing the amount of target molecule by the quantity of bacteria within the sample as determined by the method described above. In some embodiments, the target molecule comprises deoR. In some embodiments, the target molecule comprises Cas5. In some instances, methods comprise quantifying the amounts of multiple target molecules.

[0007] In some embodiments, the method does not comprise performing a DNA sequencing assay. In some embodiments, the method does not require purifying or isolating DNA from the sample. In some embodiments, the method comprises selecting a colony of bacteria grown from the sample and quantifying the rRNA sequence from the colony. In some embodiments, the colony is diluted in water to provide a template for a nucleic acid amplification reaction.

[0008] In another aspect, provided herein is a method of determining the quantity of bacteria comprising a target molecule within a bacterial sample, the method comprising (a) determining the number of copies of the target molecule in the sample, and (b) determining the number of copies of a reference nucleic acid sequence present in a plurality of different bacteria in the sample, and relating the value of (a) to (b), thereby determining the quantity of bacteria comprising the target molecule within the bacterial sample, wherein determining the number of copies of the target molecule comprises quantitative polymerase chain reaction. In some instances, methods may comprise determining the number of copies of multiple target molecules in the sample. In some embodiments, relating the value of (a) to (b) comprises dividing (a) by (b) to generate a percentage of bacteria within the bacterial sample comprising the target molecule. In some embodiments, the reference nucleic acid sequence comprises a 23 S rRNA sequence. In some embodiments, the 23 S rRNA sequence comprises a sequence at least about 90% or 95% identical to any one of SEQ ID NOS: 33-43. In some embodiments, the number of copies of the reference nucleic acid sequence is determined using a quantitative polymerase chain reaction (qPCR). In some embodiments, the number of copies of the target molecule is determined using a quantitative polymerase chain reaction (qPCR). In some embodiments, the qPCR method is TaqMan™. In some embodiments, the qPCR method comprises contacting the sample with a probe having a fluorophore and quencher. In some embodiments, determining the number of copies of the reference nucleic acid sequence in the sample comprises combining the sample with a primer comprising a sequence at least about 90% or 95% identical to SEQ ID NO: 7. In some embodiments, determining the number of copies of the reference nucleic acid sequence in the sample comprises contacting the sample with a primer comprising a sequence at least about 90% or 95% identical to SEQ ID NO: 8. In some embodiments, determining the number of copies of the reference nucleic acid sequence in the sample comprises contacting the sample with a probe comprising a sequence at least about 90% or 95% identical to SEQ ID NO: 9. In some embodiments, the qPCR comprises contacting the sample with a forward primer and a reverse primer in a nucleic acid amplification reaction, wherein the forward primer and reverse primer hybridize to the respective ends of the reference nucleic acid sequence; and detecting the presence of the amplified reference nucleic acid sequence with a probe capable of hybridizing to a nucleic acid sequence located within the amplified reference nucleic acid sequence. In some embodiments, the forward primer comprises a sequence at least about 90% or 95% identical to SEQ ID NO: 7. In some embodiments, the reverse primer comprises a sequence at least about 90%) or 95% identical to SEQ ID NO: 8. In some embodiments, the probe comprises a sequence at least about 90% or 95% identical to SEQ ID NO: 9. In some embodiments, the quantitative PCR comprises a fluorescence based real-time polymerase chain reaction method.

[0009] In some embodiments, the sample is obtained from a human subject. In some embodiments, the sample is obtained from the face of the human subject. In some embodiments, the sample is obtained from a pilosebaceous unit of the human subject. In some embodiments, the sample is a probiotic sample for administration to a subject. In some embodiments, the sample is obtained from a medical facility. In some embodiments, the sample is obtained from a food. In some embodiments, the sample is obtained from a farm animal. In some embodiments, the sample is obtained from a companion animal. In some embodiments, the sample is obtained during manufacture or production of a food, drug, probiotic, vaccine, insecticide, enzyme, fuel, solvent, bacterial starter culture, or a combination thereof. In some embodiments, the drug is an antibiotic.

[0010] In some embodiments, determination of the quantity of bacteria comprising the target molecule within the sample provides for an assessment of the purity of the sample. In some embodiments, determination of the quantity of bacteria comprising multiple target molecules within the sample provides for an assessment of the purity of the sample. In some embodiments, determination of the quantity of bacteria comprising the target molecule within the sample provides for an assessment of the genetic stability of the sample. In some embodiments, determination of the quantity of bacteria comprising the target molecule within the sample provides for an assessment of a level of bacterial contamination within the sample. In some embodiments, the method does not comprise performing a DNA sequencing assay. In some embodiments, the method does not require purifying or isolating DNA from the sample. In some embodiments, the method comprises selecting a colony of bacteria grown from the sample and quantifying the target molecule and reference nucleic acid from the colony. In some

embodiments, the method confirms clonal identity of the bacteria within the sample. In some embodiments, the method assesses genetic stability of the bacteria within the sample. In some embodiments, the colony is diluted in water to provide a template for a nucleic acid amplification reaction.

[0011] In some embodiments, the target molecule comprises deoR. In some embodiments, the target molecule comprises Cas5. In some embodiments, if the percentage of deoR within the bacterial sample is greater than about 20%, the sample comprises health-associated bacteria. In some embodiments, if the percentage of Cas5 within the bacterial sample is greater than about 20%, the sample comprises health-associated bacteria. In some embodiments, the method comprises monitoring the efficacy of a treatment configured to alter the percentage of bacteria comprising the target molecule in a subject, wherein the treatment is administration of a probiotic and the sample is obtained after treatment, and wherein if the percentage of deoR in the sample is greater than about 20%, engraftment of the probiotic to the subject has been achieved. In some embodiments, the method comprises monitoring the efficacy of a treatment configured to alter the percentage of bacteria comprising the target molecule in a subject, wherein the treatment is administration of a probiotic and the sample is obtained after treatment, and wherein if the percentage of Cas5 in the sample is greater than about 20%, engraftment of the probiotic to the subject has been achieved. In some embodiments, the probiotic comprises health-associated bacteria. In some embodiments, the treatment further comprises administering to the subject an active agent configured to alter the amount of a health-associated bacteria within the sample. In some embodiments, the sample is obtained from a subject administered a probiotic comprising a deoR+ bacteria, the method comprising monitoring engraftment of the probiotic to the subject, wherein if the percentage of deoR in the sample is greater than about 20%, engraftment of the probiotic to the subject has been achieved. In some embodiments, the sample is obtained from a subject administered a probiotic comprising a Cas5+ bacteria, the method comprising monitoring engraftment of the probiotic to the subject, wherein if the percentage of Cas5 in the sample is greater than about 20%, engraftment of the probiotic to the subject has been achieved. In some embodiments, the health-associated bacteria comprise P. acnes. In some embodiments, the health-associated bacteria comprise one or more P. acnes bacteria, each P. acnes bacteria having a ribotype selected from RTl, RT2, RT3, and RT6.

[0012] In some embodiments, provided is a method of treating a subject with health-associated bacteria, provided that a sample from the subject comprises less than about 10% of deoR/23S rRNA, as measured by a method described herein. In some embodiments, provided is a method of treating a subject with health-associated bacteria, provided that a sample from the subject comprises less than about 10% of Cas5/23S rRNA, as measured by a method described herein.

[0013] In some embodiments, the presence and/or quantity of the target molecule is indicative of the presence of one or more bacteria of interest in the sample. In some embodiments, the presence and/or quantities of multiple target molecules are indicative of the presence of one or more bacteria of interest in the sample. In some embodiments, the one or more bacteria of interest comprise one or more P. acnes bacteria. In some embodiments, the one or more P. acnes bacteria comprise P. acnes bacteria selected from RTl, RT2, RT3, RT6, or a combination thereof. In some embodiments, the plurality of different bacteria in the sample comprises at least about 50%, 60%, 70%, 75%, 80%, 85%, or 90% of the total population of bacteria within the sample.

[0014] In some embodiments, provided is a method of determining the efficacy of a treatment configured to alter the quantity of bacteria comprising the target molecule in a subject, the method comprising determining the quantity of bacteria comprising the target molecule(s) within the bacterial sample as performed by a method described herein, provided that the bacterial sample is obtained from the subject prior to, during, and/or after the treatment. [0015] In some embodiments, provided is a method of determining the purity of a probiotic, comprising measuring the quantity of bacteria comprising a target molecule within a sample of the probiotic by a method described herein. In some embodiments, provided is a method of determining the purity of a probiotic, comprising measuring the quantity of bacteria comprising multiple target molecules within a sample of the probiotic by a method described herein.

[0016] In some embodiments, provided is a method of determining the identity of a bacteria within the bacterial sample prior to performing a sequencing reaction, comprising measuring the quantity of bacteria comprising a target molecule within the bacterial sample by a method described herein. In some embodiments, provided is a method of determining the identity of a bacteria within the bacterial sample prior to performing a sequencing reaction, comprising measuring the quantity of bacteria comprising multiple target molecules within the bacterial sample by a method described herein.

[0017] In some embodiments, provided is a method for determining the stability of bacteria of interest within a sample, the method comprising measuring the quantity of a target molecule present in the bacteria of interest within the sample by a method described herein. In some instances, methods comprise measuring the quantities of multiple target molecules. In some embodiments, the method is performed after the sample has been stored for at least about 1 day, 1 week, 1 month, 2 months, 3 months, 6 months, 1 year, 2 years, or 5 years.

[0018] In some embodiments, the target molecule comprises transposase 2. In some embodiments, the target molecule comprises a sequence at least about 90% or 95% identical to SEQ ID NO: 22. In some embodiments, the target molecule comprises hyaluronidase. In some embodiments, the target molecule comprises a sequence at least about 90% or 95% identical to SEQ ID NO: 21. In some embodiments, the target molecule comprises dermatan-sulfate adhesin. In some embodiments, the target molecule comprises a sequence at least about 90% or 95% identical to SEQ ID NO: 19. In some embodiments, the target molecule comprises a sequence at least about 90% or 95% identical to SEQ ID NO: 20. In some embodiments, the target molecule comprises Type I lipase. In some embodiments, the target molecule comprises a sequence at least about 90% or 95% identical to SEQ ID NO: 23. In some embodiments, if the percentage of target molecule within the bacterial sample is greater than about 20%, the sample comprises disease-associated bacteria. In some embodiments, the sample is obtained from a subject administered a probiotic, and the method comprises monitoring engraftment of the probiotic to the subject, wherein if the percentage of bacteria comprising the target molecule within the total bacterial sample is less than about 20%, engraftment of the probiotic to the subject has been achieved. In some embodiments, the method comprises monitoring the efficacy of a treatment configured to alter the percentage of bacteria comprising the target molecule in a subject, wherein the treatment is administration of a probiotic and if the percentage of bacteria comprising the target molecule within the total bacterial sample after treatment is less than about 20%, engraftment of the probiotic to the subject has been achieved. In some embodiments, the treatment comprises administering to the subject health-associated bacteria. In some

embodiments, the treatment comprises administering to the subject an active agent configured to alter the amount of a health-associated bacteria within the sample. In some embodiments, the health-associated bacteria comprise P. acnes. In some embodiments, the health-associated bacteria comprise one or more P. acnes bacteria, each P. acnes bacteria having a ribotype selected from RT1, RT2, RT3, and RT6.

[0019] In some embodiments, the sample is obtained from a subject. In some embodiments, the quantity of bacteria comprising the target molecule(s) within the sample is indicative of a healthy condition in the subject. In some embodiments, a low quantity of bacteria comprising the target molecule(s) within the sample is indicative of a disease in the subject. In some

embodiments, a low quantity of bacteria comprising the target molecule(s) within the sample is indicative of a propensity for developing a disease in the subject. In some embodiments, the low quantity is less than about 5%, 10%, 15%, or 20%. In some embodiments, the target molecule is deoR. In some embodiments, the target molecule is Cas5. In some embodiments, the quantity of bacteria comprising the target molecule(s) within the sample is indicative of the presence of a disease in the subject. In some embodiments, a low quantity of bacteria comprising the target molecule(s) within the sample is indicative of the presence of the disease in the subject. In some embodiments, a high quantity of bacteria comprising the target molecule(s) within the sample is indicative of the presence of health-associated bacteria in the subject. In some embodiments, the low quantity is less than about 5%, 10%, 15%, or 20%. In some embodiments, the quantity of bacteria comprising the target molecule(s) within the sample is indicative of a propensity for developing a disease in the subject. In some embodiments, a low quantity of bacteria comprising the target molecule within the sample is indicative of the propensity for developing a disease in the subject. In some embodiments, the low quantity is less than about 5%, 10%, 15%, or 20%. In some embodiments, the disease is acne. In some embodiments, the disease is eczema. In some embodiments, the method comprises treating the subject for the disease. In some embodiments, the treatment comprises administering to the subject health-associated bacteria. In some embodiments, the health-associated bacteria comprise P. acnes. In some embodiments, the health-associated bacteria comprise one or more P. acnes bacteria, each P. acnes bacteria having a ribotype selected from RT1, RT2, RT3, and RT6. [0020] In another aspect, provided herein is a kit comprising: a first primer pair specific for hybridizing to and amplifying a nucleic acid sequence comprising at least about 20 contiguous nucleotides of deoR in a nucleic acid amplification reaction, and a second primer pair specific for hybridizing to and amplifying a nucleic acid sequence comprising at least about 20 contiguous nucleotides of a reference nucleic acid in a nucleic acid amplification reaction, provided that the reference nucleic acid is a nucleic acid present in a plurality of bacteria present on the human face. In some embodiments, the reference nucleic acid sequence comprises a 23 S rRNA sequence. In some embodiments, the 23 S rRNA sequence comprises a sequence at least about 90% or 95% identical to any one of SEQ ID NOS: 33-43. In some embodiments, the first primer pair comprises a sequence at least about 90% or 95% identical to SEQ ID NO: 1. In some embodiments, the first primer pair comprises a sequence at least about 90% or 95% identical to SEQ ID NO: 2. In some embodiments, the second primer pair comprises a sequence at least about 90% or 95% identical to SEQ ID NO: 7. In some embodiments, the second primer pair comprises a sequence at least about 90% or 95% identical to SEQ ID NO: 8. In some

embodiments, the kit further comprises a probe configured to hybridize to the deoR, or an amplification product thereof. In some embodiments, the probe is configured to hybridize to a nucleic acid sequence amplified with a primer pair comprising SEQ ID NOS: 1 and 2. In some embodiments, the probe comprises a sequence at least about 90% or 95% identical to SEQ ID NO: 3. In some embodiments, the probe comprises a fluorophore and a quencher. In some embodiments, the probe is hydrolysable. In some embodiments, the kit further comprises a probe configured to hybridize to the reference nucleic acid. In some embodiments, the probe comprises a sequence at least about 90% or 95% identical to SEQ ID NO: 9. In some embodiments, the kit comprises a sample collection device. In some embodiments, the sample collection device does not require storage at temperatures lower than 20 °C. In some embodiments, a sample comprising genetic material retained on the sample collection device does not require storage at temperatures lower than 20 °C.

[0021] In another aspect, provided herein is a kit comprising: a first primer pair specific for hybridizing to and amplifying a nucleic acid sequence comprising at least about 20 contiguous nucleotides of Cas5 in a nucleic acid amplification reaction, and a second primer pair specific for hybridizing to and amplifying a nucleic acid sequence comprising at least about 20 contiguous nucleotides of a reference nucleic acid in a nucleic acid amplification reaction, provided that the reference nucleic acid is a nucleic acid present in a plurality of bacteria present on the human face. In some embodiments, the reference nucleic acid sequence comprises a 23 S rRNA sequence. In some embodiments, the 23 S rRNA sequence comprises a sequence at least about 90% or 95% identical to any one of SEQ ID NOS: 33-43. In some embodiments, the first primer pair comprises a sequence at least about 90% or 95% identical to SEQ ID NO: 4. In some embodiments, the first primer pair comprises a sequence at least about 90% or 95% identical to SEQ ID NO: 5. In some embodiments, the second primer pair comprises a sequence at least about 90% or 95% identical to SEQ ID NO: 7. In some embodiments, the second primer pair comprises a sequence at least about 90% or 95% identical to SEQ ID NO: 8. In some

embodiments, the kit further comprises a probe configured to hybridize to the Cas5, or an amplification product thereof. In some embodiments, the probe is configured to hybridize to a nucleic acid sequence amplified with a primer pair comprising SEQ ID NOS: 4 and 5. In some embodiments, the probe comprises a sequence at least about 90% or 95% identical to SEQ ID NO: 6. In some embodiments, the probe comprises a fluorophore and a quencher. In some embodiments, the probe is hydrolysable. In some embodiments, the kit further comprises a probe configured to hybridize to the reference nucleic acid. In some embodiments, the probe comprises a sequence at least about 90% or 95% identical to SEQ ID NO: 9. In some embodiments, the kit comprises a sample collection device. In some embodiments, the sample collection device does not require storage at temperatures lower than 20 °C. In some embodiments, a sample

comprising genetic material retained on the sample collection device does not require storage at temperatures lower than 20 °C.

[0022] In another aspect, provided herein is a sample collection device that comprises a sample of bacteria obtained from the skin of a subject retained on a polyester fiber of the sample collection device. In some embodiments, the sample of bacteria retained on the polyester fiber is stored at a temperature greater than about 4 °C, 10 °C, 15 °C, or 20 °C. In some embodiments, provided is a method of analyzing the bacteria in a total bacterial sample removed from the sample collection device, comprising quantifying the amount of bacteria within the total bacterial sample comprising a target nucleic acid. In some embodiments, the target nucleic acid comprises: deoR, Cas5, transposase 2, dermatan-sulfate adhesin, DNA binding response regulator, phosphoglycerate kinase, ABC transporter, alanine hydrogenase, or a combination thereof.

[0023] In another aspect, provided herein is a method of identifying the presence or absence of a target molecule within a sample, the method comprising obtaining genomic material from a sample without purification or isolation of the genomic material from the sample, diluting the sample in water, and performing a nucleic acid amplification reaction comprising contacting the genomic material with a probe capable of hybridizing to the target molecule(s) or an

amplification product thereof. In some embodiments, the genomic material does not require storage below 20 °C prior to determining the presence or absence of the target molecule(s). In some embodiments, the sample is selected from a biological sample, industrial sample, hospital sample, food sample, and seed sample. In some embodiments, the sample is obtained using a swab. In some embodiments, the sample is stored on the swab prior to identifying the presence or absence of the target molecule(s) within the sample for at least about 1 day, 1 week, 2 weeks, 1 month, or 6 months. In some embodiments, the storage is greater than about 10 °C. In some embodiments, the target molecule is specific to a bacterial DNA sequence. In some

embodiments, the target molecule is specific to a viral DNA or RNA sequence. In some embodiments, the target molecule is specific to a DNA sequence from a plant.

[0024] In another aspect, provided herein is a method of determining the quantity of bacteria comprising a target molecule within a bacterial sample, the method comprising (a) providing a plurality of clonal populations obtained from the bacterial sample and (b) determining the presence or absence of the target molecule in each clonal population, wherein the proportion of clonal populations comprising the presence of the target molecule is indicative of the quantity of bacteria comprising the target molecule within the bacterial sample, and wherein the target molecule is selected from deoR, Cas5, dermatan-sulfate adhesin, hyaluronidase, and transposase 2. In some embodiments, the target molecule comprises two or more target molecules and the presence or absence of each of the two or more target molecules is determined in each clonal population, and wherein the two or more target molecules comprise deoR, Cas5, dermatan- sulfate adhesin, hyaluronidase, transposase 2, or any combination thereof. In some embodiments, the quantity of bacteria comprising the target molecule within the bacterial sample is a

percentage of clonal populations comprising the presence of the target molecule. In some embodiments, the presence or absence of the target molecule in each clonal population is determined using a quantitative polymerase chain reaction (qPCR) method. In some

embodiments, the qPCR method is TaqMan™. In some embodiments, the qPCR method comprises contacting each clonal population with a probe having a fluorophore and quencher. In some embodiments, the qPCR method comprises contacting each clonal population with a forward primer and a reverse primer in a nucleic acid amplification reaction, wherein the forward primer and reverse primer hybridize to respective ends of a nucleic acid sequence of the target molecule; and detecting the presence of the amplified nucleic acid sequence with a probe capable of hybridizing to a nucleic acid sequence located within the amplified nucleic acid sequence.

[0025] In some embodiments, the target molecule comprises deoR. In some embodiments, the target molecule comprises Cas5. In some embodiments, if the percentage of deoR+ clonal populations is greater than about 20%, the bacterial sample comprises health-associated bacteria. In some embodiments, if the percentage of Cas5+ clonal populations is greater than about 20%, the bacterial sample comprises health-associated bacteria. In some embodiments, the method comprises monitoring the efficacy of a treatment configured to alter the percentage of bacteria comprising the target molecule in a subject, wherein the treatment is administration of a probiotic to the subject and the bacterial sample is obtained from the subject after treatment, and wherein if the percentage of deoR in the bacterial sample is greater than about 20%, engraftment of the probiotic to the subject has been achieved. In some embodiments, the method comprises monitoring the efficacy of a treatment configured to alter the percentage of bacteria comprising the target molecule in a subject, wherein the treatment is administration of a probiotic to the subject and the bacterial sample is obtained from the subject after treatment, and wherein if the percentage of Cas5 in the bacterial sample is greater than about 20%, engraftment of the probiotic to the subject has been achieved. In some embodiments, the probiotic comprises health-associated bacteria. In some embodiments, the treatment further comprises administering to the subject an active agent configured to alter the amount of a health-associated bacteria within the bacterial sample. In some embodiments, the health-associated bacteria comprise P. acnes. In some embodiments, the health-associated bacteria comprise one or more P. acnes bacteria, each P. acnes bacteria having a ribotype selected from RT1, RT2, RT3, and RT6. In some

embodiments, the bacterial sample is obtained from a subject administered a probiotic comprising a deoR+ bacteria, the method comprising monitoring engraftment of the probiotic to the subject, wherein if the percentage of deoR in the bacterial sample is greater than about 20%, engraftment of the probiotic to the subject has been achieved. In some embodiments, the bacterial sample is obtained from a subject administered a probiotic comprising a Cas5+ bacteria, the method comprising monitoring engraftment of the probiotic to the subject, wherein if the percentage of Cas5 in the bacterial sample is greater than about 20%, engraftment of the probiotic to the subject has been achieved.

[0026] In some embodiments, provided is a method of treating a subject with health-associated bacteria, provided that the bacterial sample from the subject comprises less than about 10% of deoR+ clonal populations, as measured by a method described herein. In some embodiments, provided is a method of treating a subject with health-associated bacteria, provided that a sample from the subject comprises less than about 10% of Cas5+ clonal populations, as measured by a method described herein.

[0027] In some embodiments, the bacterial sample is obtained from a subject. In some embodiments, the quantity of bacteria comprising the target molecule within the bacterial sample is indicative of a healthy condition in the subject. In some embodiments, a low quantity of bacteria comprising the target molecule within the bacterial sample is indicative of a disease in the subject. In some embodiments, a low quantity of bacteria comprising the target molecule within the bacterial sample is indicative of a propensity for developing a disease in the subject. In some embodiments, the low quantity is less than about 5%, 10%, 15%, or 20%. In some embodiments, the disease is acne. In some embodiments, the disease is eczema. In some embodiments, the method comprises treating the subject for the disease. In some embodiments, treating comprises administering to the subject health-associated bacteria. In some embodiments, the health-associated bacteria comprise P. acnes. In some embodiments, the health-associated bacteria comprise one or more P. acnes bacteria, each P. acnes bacteria having a ribotype selected from RT1, RT2, RT3, and RT6.

[0028] In some embodiments, the target molecule comprises transposase 2. In some

embodiments, the target molecule comprises a sequence at least about 90% or 95% identical to SEQ ID NO: 22. In some embodiments, the target molecule comprises hyaluronidase. In some embodiments, the target molecule comprises a sequence at least about 90% or 95% identical to SEQ ID NO: 21. In some embodiments, the target molecule comprises dermatan-sulfate adhesin. In some embodiments, the target molecule comprises a sequence at least about 90% or 95% identical to SEQ ID NO: 19. In some embodiments, the target molecule comprises a sequence at least about 90% or 95% identical to SEQ ID NO: 20. In some embodiments, the target molecule comprises Type I lipase. In some embodiments, the target molecule comprises a sequence at least about 90% or 95% identical to SEQ ID NO: 23. In some embodiments, if the percentage of target molecule within the bacterial sample is greater than about 20%, the bacterial sample comprises disease-associated bacteria. In some embodiments, the bacterial sample is obtained from a subject administered a probiotic, and the method comprises monitoring engraftment of the probiotic to the subject, wherein if the percentage of bacteria comprising the target molecule within the total bacterial sample is less than about 20%, engraftment of the probiotic to the subject has been achieved. In some embodiments, the method comprises monitoring the efficacy of a treatment configured to alter the percentage of bacteria comprising the target molecule in a subject, wherein the treatment is administration of a probiotic and if the percentage of bacteria comprising the target molecule within the total bacterial sample after treatment is less than about 20%), engraftment of the probiotic to the subject has been achieved. In some embodiments, the probiotic comprises health-associated bacteria. In some embodiments, the treatment further comprises administering to the subject an active agent configured to alter the amount of a health- associated bacteria within the bacterial sample. In some embodiments, the health-associated bacteria comprise P. acnes. In some embodiments, the health-associated bacteria comprise one or more P. acnes bacteria, each P. acnes bacteria having a ribotype selected from RT1, RT2, RT3, and RT6.

[0029] In some embodiments, the bacterial sample is obtained from a human subject. In some embodiments, the bacterial sample is obtained from the face of the human subject. In some embodiments, the bacterial sample is obtained from a pilosebaceous unit of the human subject. In some embodiments, the bacterial sample is a probiotic sample for administration to a subject. In some embodiments, the bacterial sample is obtained from a medical facility. In some embodiments, the bacterial sample is obtained from a food. In some embodiments, the bacterial sample is obtained from a farm animal. In some embodiments, the bacterial sample is obtained from a companion animal. In some embodiments, the bacterial sample is obtained during manufacture or production of a food, drug, probiotic, vaccine, insecticide, enzyme, fuel, solvent, bacterial starter culture, or a combination thereof. In some embodiments, the drug is an antibiotic. In some embodiments, the bacterial sample is obtained from a probiotic and the quantity of bacteria comprising the target molecule is indicative of the purity of the probiotic.

[0030] In some embodiments, determination of the quantity of bacteria comprising the target molecule within the bacterial sample provides for an assessment of the purity of the bacterial sample. In some embodiments, determination of the quantity of bacteria comprising the target molecule within the bacterial sample provides for an assessment of the genetic stability of the bacterial sample. In some embodiments, determination of the quantity of bacteria comprising the target molecule within the bacterial sample provides for an assessment of a level of bacterial contamination within the bacterial sample. In some embodiments, determination of the quantity of bacteria comprising the target molecule within the bacterial sample does not comprise performing a DNA sequencing assay. In some embodiments, the method does not require purifying or isolating DNA from the bacterial sample. In some embodiments, the presence or absence of the target molecule within each clonal population is indicative of the presence or absence, respectively, of one or more bacteria of interest within each clonal population. In some embodiments, the one or more bacteria of interest comprise one or more P. acnes bacteria. In some embodiments, the one or more P. acnes bacteria comprise P. acnes bacteria selected from RTl, RT2, RT3, RT6, or a combination thereof. In some embodiments, determining the presence or absence of the target molecule within at least one of the plurality of clonal populations is performed prior to a performing a sequencing reaction on the at least one of the plurality of clonal populations. In some embodiments, the quantity of bacteria comprising the target molecule is indicative of the stability of the bacteria in the bacterial sample. In some

embodiments, the method is performed after the bacterial sample has been stored for at least about 1 day, 1 week, 1 month, 2 months, 3 months, 6 months, 1 year, 2 years, or 5 years. [0031] Disclosed herein, in some aspects, are methods of characterizing a population of heterogeneous samples comprising a target molecule, the methods comprising: providing a plurality of the heterogeneous samples, provided that two or more of the heterogeneous samples are obtained from different pilosebaceous units of the skin of a subject, and the two or more heterogeneous samples comprise a microbe, and determining the presence or absence of the target molecule in the two or more heterogeneous samples, thereby characterizing the population of heterogeneous samples comprising the target molecule. In some instances, each heterogeneous sample is obtained from a different pilosebaceous unit. In some instances, each heterogeneous sample comprises a microbe. In some instances, methods comprise determining the presence or absence of the target molecule in each heterogeneous sample. In some instances, the microbe comprises bacteria, a virus, a fungus, or a combination thereof. In some instances, the target molecule is encoded within the genome of a microbe of interest. In some instances, the presence of the target molecule in one or more of the heterogeneous samples is indicative of the presence of the microbe of interest in the one or more heterogeneous samples. In some instances, the microbe of interest is bacteria that has been administered to the subject prior to the step of providing the plurality of the heterogeneous samples obtained from different pilosebaceous units from the skin of the subject. In some instances, the microbe of interest is health-associated bacteria. In some instances, the health-associated bacteria comprise P. acnes. In some instances, the health-associated bacteria comprise one or more P. acnes bacteria, each P. acnes bacteria having a ribotype selected from RT1, RT2, RT3, and RT6. In some instances, the P. acnes comprise HP4G1. In some instances, the microbe is capable of replication and/or growth in a suitable medium after removal from the pilosebaceous unit. In some instances, the plurality of heterogeneous samples is between about 2 and about 100 samples. In some instances, the plurality of heterogeneous samples is between about 2 and about 50 samples. In some instances, the plurality of heterogeneous samples is between about 15 and about 40 samples. In some instances, each of the heterogeneous samples is obtained from a lipid pillar extracted from one of the different pilosebaceous units from the skin of the subject. In some instances, each lipid pillar is obtained by a process comprising: application of an adhesive strip to the skin of the subject in a manner that allows for adhesive of the adhesive strip to contact each lipid pillar from the different pilosebaceous units, and removal of the adhesive strip in a manner that retains each lipid pillar on the adhesive strip. In some instances, the adhesive strip comprising each lipid pillar is stored at a temperature less than or equal to about 8 °C. In some instances, the adhesive strip comprising each lipid pillar is stored at a temperature less than or equal to about 4 °C. In some instances, each of the plurality of heterogeneous samples is provided by a processing comprising: combining each lipid pillar extracted from one of the different pilosebaceous units with a culture medium and growing the microbe in the culture medium. In some instances, each of the plurality of heterogeneous samples is provided by a processing comprising: combining each lipid pillar extracted from one of the different pilosebaceous units with a solution and plating the resulting mixture on an agar plate to generate colonies of the microbe. In some instances, the solution comprises a detergent. In some instances, the detergent is Tween 80. In some instances, determining the presence or absence of the target molecule comprises performing a PCR method on each sample. In some instances, the PCR method comprises a qPCR method. In some instances, the PCR method comprises a multiplex PCR method. In some instances, the target molecule comprises Cas5, deoR, transposase 2, or a combination thereof. In some instances, methods further comprise determining the quantity of the target molecule in each sample. In some instances, methods further comprise determining the quantity of a reference molecule in each sample. In some instances, the reference molecule is an rRNA sequence. In some instances, the quantity of the reference molecule is indicative of the quantity of a reference microbe in the sample. In some instances, methods further comprise relating the quantity of target molecule within each sample with the quantity of reference microbes in each sample. In some instances, the relating comprises determining the percentage of reference microbes in each sample comprising the target molecule. In some instances, methods further comprise culturing the microbe from each sample of the population of heterogeneous samples having the presence of the target molecule to obtain a clonal population of the microbe. In some instances, methods further comprise growing a plurality of the clonal population in a culture medium. In some instances, methods further comprise screening each of the plurality of the clonal populations for the presence of the target molecule. In some instances, methods further comprise storing each of the plurality of the clonal populations having the presence of the target molecule at a temperature less than or about -10 °C. In some instances, methods further comprise storing each of the plurality of the clonal populations having the presence of the target molecule at a temperature less than or about -20 °C. In some instances, methods further comprise storing each of the plurality of the clonal populations having the presence of the target molecule at a temperature less than or about -50 °C. In some instances, methods further comprise storing each of the plurality of the clonal populations having the presence of the target molecule at a temperature less than or about -80 °C. In some instances, methods further comprise performing a DNA sequencing assay on each of the plurality of the clonal populations having the presence of the target molecule.

[0032] Further disclosed herein, in some aspects, are methods of characterizing a population of heterogeneous samples comprising a target molecule, the methods comprising: providing a plurality of the heterogeneous samples, provided that two or more of the heterogeneous samples are obtained from different pilosebaceous units of the skin of a subject, and the two or more heterogeneous samples comprise a microbe, determining the presence or absence of the target molecule in the two or more heterogeneous samples, thereby characterizing the population of heterogeneous samples comprising the target molecule, and administering to the subject a bacterial composition. In some instances, the dosage of the bacterial composition is related to the characterization of the population of heterogeneous samples comprising the target molecule. In some instances, the method of characterizing a population of heterogeneous samples is performed after treatment of the subject with a bacterial composition. In some instances, methods further comprise continuing the treatment of the subject. In some instances, methods further comprise adjusting the treatment of the subjected based on the characterization of the population of heterogeneous samples comprising the target molecule. In some instances, the bacterial composition comprises health-associated bacteria. In some instances, the health-associated bacteria comprise P. acnes. In some instances, the health-associated bacteria comprise one or more P. acnes bacteria, each P. acnes bacteria having a ribotype selected from RT1, RT2, RT3, and RT6. In some instances, the ⁵. acnes comprise HP4G1.

[0033] Disclosed herein, in some aspects are methods of profiling heterogeneous microbial samples from the skin of a subject, the method comprising: providing a plurality of the heterogeneous microbial samples, each microbial sample obtained from a different pilosebaceous unit of the skin, and performing a separate genetic analysis on each of the microbial samples to determine the microbial profile of each sample. In some instances, the genetic analysis comprises DNA sequencing. In some instances, the genetic analysis comprises a PCR method. In some instances, the PCR method is a qPCR method. In some instances, the qPCR method comprises a multiplex qPCR method. In some instances, the microbial profile comprises the presence or absence of a target molecule within each sample. In some instances, the microbial profile comprises the quantity of microbes within the microbial sample comprising a target molecule. In some instances, the microbial profile comprises the presence or absence of a microbe of interest in the microbial sample. In some instances, the microbial profile comprises the quantity of a microbe of interest in the microbial sample. In some instances, the microbe of interest is bacteria. In some instances, the microbe of interest is bacteria that have been administered to the subject prior to the step of providing the plurality of the heterogeneous microbial samples. In some instances, the microbe of interest is health-associated bacteria. In some instances, the health- associated bacteria comprise P. acnes. In some instances, the health-associated bacteria comprise one or more P. acnes bacteria, each P. acnes bacteria having a ribotype selected from RT1, RT2, RT3, and RT6. In some instances, t e P. acnes comprises HP4G1. In some instances, each heterogeneous sample is obtained from a different pilosebaceous unit. In some instances, each heterogeneous sample comprises a microbe. In some instances, methods comprise determining the presence or absence of the target molecule in each heterogeneous sample. In some instances, the microbe comprises bacteria, a virus, a fungus, or a combination thereof. In some instances, the target molecule is encoded within the genome of a microbe of interest. In some instances, the presence of the target molecule in one or more of the heterogeneous samples is indicative of the presence of the microbe of interest in the one or more heterogeneous samples. In some instances, the microbe of interest is a bacteria that has been administered to the subject prior to the step of providing the plurality of the heterogeneous samples obtained from different pilosebaceous units from the skin of the subject. In some instances, the microbe of interest is a health-associated bacteria. In some instances, the health-associated bacteria comprises P. acnes. In some instances, the health-associated bacteria comprises one or more P. acnes bacteria, each P. acnes bacteria having a ribotype selected from RT1, RT2, RT3, and RT6. In some instances, the P. acnes comprises HP4G1. In some instances, the microbe is capable of replication and/or growth in a suitable medium after removal from the pilosebaceous unit. In some instances, the plurality of heterogeneous samples is between about 2 and about 100 samples. In some instances, the plurality of heterogeneous samples is between about 2 and about 50 samples. In some instances, the plurality of heterogeneous samples is between about 15 and about 40 samples. In some instances, each of the heterogeneous samples is obtained from a lipid pillar extracted from one of the different pilosebaceous units from the skin of the subject. In some instances, each lipid pillar is obtained by a process comprising: application of an adhesive strip to the skin of the subject in a manner that allows for adhesive of the adhesive strip to contact each lipid pillar from the different pilosebaceous units, and removal of the adhesive strip in a manner that retains each lipid pillar on the adhesive strip. In some instances, the adhesive strip comprising each lipid pillar is stored at a temperature less than or equal to about 8 °C. In some instances, the adhesive strip comprising each lipid pillar is stored at a temperature less than or equal to about 4 °C. In some instances, each of the plurality of heterogeneous samples is provided by a processing comprising: combining each lipid pillar extracted from one of the different pilosebaceous units with a culture medium and growing the microbe in the culture medium. In some instances, each of the plurality of heterogeneous samples is provided by a processing comprising: combining each lipid pillar extracted from one of the different pilosebaceous units with a solution and plating the resulting mixture on an agar plate to generate colonies of the microbe. In some instances, the solution comprises a detergent. In some instances, the detergent is Tween 80. In some instances, determining the presence or absence of the target molecule comprises performing a PCR method on each sample. In some instances, the PCR method comprises a qPCR method. In some instances, the PCR method comprises a multiplex PCR method. In some instances, the target molecule comprises Cas5, deoR, transposase 2, or a combination thereof. In some instances, methods further comprise determining the quantity of the target molecule in each sample. In some instances, methods further comprise determining the quantity of a reference molecule in each sample. In some instances, the reference molecule is a rRNA sequence. In some instances, the quantity of the reference molecule is indicative of the quantity of a reference microbe in the sample. In some instances, methods further comprise relating the quantity of target molecule within each sample with the quantity of reference microbes in each sample. In some instances, the relating comprises determining the percentage of reference microbes in each sample comprising the target molecule. In some instances, methods further comprise culturing the microbe from each sample of the population of heterogeneous samples having the presence of the target molecule to obtain a clonal population of the microbe. In some instances, methods further comprise growing a plurality of the clonal population in a culture medium. In some instances, methods further comprise screening each of the plurality of the clonal populations for the presence of the target molecule. In some instances, methods further comprise storing each of the plurality of the clonal populations having the presence of the target molecule at a temperature less than or about -10 °C. In some instances, methods further comprise storing each of the plurality of the clonal populations having the presence of the target molecule at a temperature less than or about -20 °C. In some instances, methods further comprise storing each of the plurality of the clonal populations having the presence of the target molecule at a temperature less than or about -50 °C. In some instances, methods further comprise storing each of the plurality of the clonal populations having the presence of the target molecule at a temperature less than or about -80 °C. In some instances, methods further comprise performing a DNA sequencing assay on each of the plurality of the clonal populations having the presence of the target molecule.

[0034] Further disclosed herein, in some aspects are methods of profiling heterogeneous microbial samples from the skin of a subject, the method comprising: providing a plurality of the heterogeneous microbial samples, each microbial sample obtained from a different pilosebaceous unit of the skin; performing a separate genetic analysis on each of the microbial samples to determine the microbial profile of each sample; and administering to the subject a bacterial composition. In some instances, the dosage of the bacterial composition is related to the characterization of the population of heterogeneous samples comprising the target molecule. In some instances, the method of characterizing a population of heterogeneous samples is performed after treatment of the subject with a bacterial composition. In some instances, methods further comprise continuing the treatment of the subject. In some instances, methods further comprise adjusting the treatment of the subjected based on the characterization of the population of heterogeneous samples comprising the target molecule. In some instances, the bacterial composition comprises a health-associated bacteria. In some instances, the health-associated bacteria comprises P. acnes. In some instances, the health-associated bacteria comprises one or more P. acnes bacteria, each P. acnes bacteria having a ribotype selected from RT1, RT2, RT3, and RT6. In some instances, the ⁵. acnes comprises HP4G1.

[0035] Further disclosed herein, in some aspects, are methods of characterizing heterogeneous samples from skin of a subject, the method comprising: providing a plurality of the

heterogeneous samples, provided that each sample is obtained from a different pilosebaceous unit from the skin of the subject, and each sample comprises a microbe, and performing a genetic assay on each sample. In some instances, the genetic assay comprises DNA sequencing. In some instances, the genetic assay comprises a PCR method. In some instances, the PCR method is a qPCR method. In some instances, the PCR method is a multiplex PCR method.

[0036] Disclosed herein, in some aspects, are methods for analyzing the bacterial profile of skin from a subject, the method comprising: providing a plurality of samples comprising bacteria from the skin of the subject, each of the plurality of samples obtained from a pilosebaceous unit of the skin, determining the presence or absence of a target molecule in at least one of the plurality of samples, selecting a subpopulation of the plurality of samples determined to have the presence of the target molecule, and performing a genetic analysis on at least one member of the subpopulation to determine the presence or absence of a bacteria of interest within at least one of the plurality of samples.

[0037] Further disclosed herein, in some aspects, are kits comprising: an adhesive strip configured for application to and removal from skin of a subject, whereby adhesive of the adhesive strip binds to and removes a bacterial sample from the skin after application and removal; a sample collection device for storing the adhesive strip and bacterial sample from the skin; and instructions for storing the adhesive strip comprising the bacterial sample at a temperature less than about 8 °C.

[0038] Disclosed herein, in some aspects, are methods of removing a bacterial sample from the skin of a subject, the method comprising applying the adhesive strip to the skin and removing the adhesive strip from the skin in a manner that adheres the bacterial sample to the adhesive strip. In some instances, methods further comprise storing the adhesive strip comprising the bacterial sample at a temperature less than about 8 °C. In some instances, the adhesive strip is stored at a temperature at or less than about 4 °C. In some instances, methods comprise shipping the adhesive strip comprising the bacterial sample to a facility for analysis of the bacterial sample. In some instances, the adhesive strip comprising the bacterial sample is shipped in a package configured for maintenance of a temperature at or below about 8 °C for at least about 5 days.

BRIEF DESCRIPTION OF THE DRAWINGS

[0039] FIG. 1 shows the percentage of reads from samples of healthy volunteers (free of acne) that map to P. acnes to ribotype RTlthat are both deoR+ and Type II lipase positive, versus the percentage of reads from the samples that map to P. acnes RT2 that are both deoR+ and Type II lipase positive.

[0040] FIG. 2 shows a portion of a 23 S, ribosomal RNA sequence from bacteria commonly found on the human face that is useful for characterizing a subject's skin microbiome. Numbers listed to the left of sequences correspond to bacterial strains as follows: (1) P.

ac«es_KPA171202_RTl_2; (2) P. ac«es_KPA171202_RTl_3; (3) P. acnes ATCC

11828 RT2 1; (4) P. acnes ATCC 11828 RT2 2; (5) P. avidum 44067; (6) P. acidipropionici ATCC 4875; (7) S. aureus 04-02981; (8) S. aureus Bmb9393; (9) S. aureus FDA209P; (10) S. epidermidis ATCC 12228; and (11) S. epidermidis PM221. Sequences 1-5 correspond to SEQ ID NOs: 33 to 37. Sequence 6 corresponds to SEQ ID NO: 38. Sequences 7-11 correspond to SEQ ID NOs: 39-43.

[0041] FIG. 3 shows a standard curve of health-associated P. acnes (comprising deoR or Cas5 or PANBAC) diluted with S. spidermidis (comprising PANBAC), which can be used to quantitate a percentage of health-associated P. acnes within the total bacteria present in a sample.

[0042] FIG. 4 shows mutations in a gene encoding a P. acnes Type I lipase that result in a gene encoding a P. acnes Type II lipase. Type I lipase Intergenic Region corresponds to SEQ ID NO. : 44. Type I lipase Second lipase (region) (HMPREF0675 4856) corresponds to SEQ ID NOS: 45, 46 and 47, respectively, in order of appearance. Type II lipase Second lipase (region) (HMPREF0675 4856) corresponds to SEQ ID NOS: 50, 55 and 56, respectively, in order of appearance. Type I lipase Intergenic Region corresponds to SEQ ID NO.: 44. Type II lipase Intergenic Region corresponds to SEQ ID NO.: 49. SEQ ID NO: 57 is disclosed as the sequence extending from the Type I lipase Intergenic Region through the next 12 residues in the Type I lipase Second lipase (region). SEQ ID NO: 58 is disclosed as the sequence extending from the Type II lipase Intergenic Region through the next 12 residues in the Type II lipase Second lipase (region). [0043] FIG. 5 shows the percentages of deoR positive bacteria (%deoR) and Cas5 positive bacteria (%Cas5) in a sample of bacteria removed from the faces of two healthy subjects and two subjects having acne vulgaris. The percentages were determined using the PA BAC assay described herein to determine total quantity of bacteria within the sample.

[0044] FIG. 6 shows percentages of a microbe population in a single lipid pillar that express genes of interest (deoR, Cas5, and TPase2).

[0045] FIG. 7 shows relative expression of deoR, Cas5 and TPase2 in single clones from lipid pillars.

[0046] FIG. 8 shows a representation of repetitive and spacer sequences in a CRISPR encoding region in various P. acnes and control strains.

DETAILED DESCRIPTION OF THE INVENTION

[0047] In one aspect, the present application provides methods and systems for detecting a bacteria of interest from a sample by determining the presence, absence, and/or quantity of a target molecule from the bacteria within the sample. Some such methods comprise performing quantitative polymerase chain reaction (qPCR) to detect the target molecule of the bacteria. The qPCR methods described herein may not require sample storage at 4 °C or lower and/or may not require isolation or purification of genomic material prior to qPCR. Further methods involve determining the percentage of the bacteria of interest from the sample by dividing the number of bacteria of interest, e.g., as identified using a qPCR method described herein, by the total number of bacteria in the sample. Exemplary methods involve using an assay described herein {e.g., PANBAC) to determine the total number of bacteria in the sample. Further methods comprise determining a microbial profile of the sample that comprises the percentage of target molecule and/or percentage of bacteria within the sample comprising the target molecule.

[0048] Samples that may be tested using the methods and systems described include biological samples, such as those isolated from a subject. Other exemplary samples include industrial, food, and environmental samples. For instance, target molecules and/or bacteria from any surface may be tested as a sample herein. Such surfaces include, but are not limited to, surfaces from a building {e.g., medical and lab facilities), plant or seed surfaces, surfaces from a subject {e.g., skin samples), surfaces from the home or business, and the like. In some other cases, removal of a sample from the surface of a material of interest is not required for testing. For instance, a sample may be a portion of a material of interest, e.g., a portion of a biopsy or other skin sample, leaf, seed, dirt material, etc.

[0049] Some methods involve determining the presence, absence, and/or quantity of a target molecule in a biological sample from Propionibacterium acnes, an important skin commensal and yet also a pathogenic factor in several diseases, including acne vulgaris. Other methods involve determining a microbial profile of the sample comprising the percentage of bacteria within the sample comprising a target molecule, or genetic marker, of P. acnes. P. acnes type IA-2 (primarily ribotype 4 [RT4] and RT5) strains have been associated with acne, while some type II strains, e.g., some RT2 and RT6 strains, are less associated with acneic skin and have been characterized as health-associated strains in the context of acne. Using methods described herein, health-associated P. acnes bacteria may be differentiated from disease-associated P. acnes bacteria based on genetic markers of the bacteria, such that in some cases, differentiation is not solely based on ribotype. For instance, using the methods herein, a health-associated P. acnes and a disease-associated P. acnes may be of the same ribotype, e.g., ribotype 1.

[0050] Methods that comprise determining the presence, absence, and/or quantity of a genetic marker that is specific to either the health-associated or disease-associated P. acnes may be useful for selecting candidates for acne prophylactic treatment and/or monitoring treatment. Exemplary treatment includes administration of a health-associated bacteria to a subject.

Engraftment of the health-associated bacteria may be determined by monitoring the percentage of bacteria in a sample from the treated subject comprising a genetic marker that is present in health-associated P. acnes and not disease-associated P. acnes. Patient selection includes selecting patient populations who have a low percentage of health-associated P. acnes and thus may be candidates for treatment. Methods for assessing the profile of P. acnes from an individual may also be useful for selecting patients suitable for eczema treatment. For example, newborn patients may be tested for eczema using the methods described herein. Some methods are also useful for monitoring the treatment of acne and/or selecting patients who may be susceptible to prophylactic therapy.

[0051] In certain embodiments, a health-associated P. acnes, such as one traditionally defined as a type II strain, carries clustered regularly interspaced short palindromic repeat (CRISPR) elements not found in disease-associated strains. As an example, a health-associated P. acnes comprises Cas5 while a disease-associated P. acnes lacks Cas5. In some cases, the Cas5 is selected from the Cas5 found in P. acnes, GenBank: AER05233.1. In some cases, the Cas5 comprises a sequence as set forth in SEQ ID NO: 11, or a sequence having at least about 90% sequence identity to SEQ ID NO: 11.

[0052] In addition to genetic differences, there may be a link between increased P. acnes derived molecules such as porphyrins, proteases, lipases, and hemolysins, and disease. Genes encoding for biosynthesis of P. acnes derived molecules {e.g., porphyrins, proteases, lipase, and hemolysins) can be used to distinguish between health-associated P. acnes and disease-associated P. acnes. Porphyrins are a group of pro-inflammatory metabolites important in acne development. Disease-associated P. acnes have been found to inherently produce significantly higher levels of these porphyrins than health-associated P. acnes. Accordingly, in some cases the presence of a repressor of an operon encoding for porphyrin biosynthesis, such as a deoR repressor, is a genetic marker that contributes to differentiating between P. acnes bacteria. In some cases, the deoR is selected from P. acnes subsp. defendens (ATCC 11828, GenBank:

AER05724.1).

[0053] Additional molecules or genetic markers whose presence, absence, and/or quantity in a sample could be indicative of the identity of a bacterial species include the pIMPLE plasmid (a plasmid found in some disease-associated P. acnes bacteria), alanine dehydrogenase, DNA- binding response regulator, phosphoglycerate kinase, ABC transporter, dermatan-sulfate adhesin, hyaluronidase, transposase 2 and/or certain types of lipases, such as Type I lipase and Type II lipase.

[0054] Accordingly, provided herein are methods of identifying or differentiating health- associated P. acnes bacteria from disease-associated P. acnes bacteria based on the presence, absence, and/or quantity of bacteria having one or more particular genetic markers. Exemplary methods described comprise measuring the presence, absence, and/or expression of one or more genetic markers including, but not limited to, deoR, Cas5, pEVIPLE, Type I lipase, Type II lipase, alanine dehydrogenase, DNA-binding response regulator, phosphoglycerate kinase, ABC transporter, dermatan-sulfate adhesin, hyaluronidase, and transposase 2. In some instances, methods for differentiating between health-associated P. acnes and disease-associated P. acnes comprise differentiation based on ribotype. As a non-limiting example, P. acnes RT6 comprises a DNA-binding response regulator and/or phosphoglycerate kinase, which is absent in RT1, RT2, RT3, RT4, and RT5. As another example, an ABC transporter gene is absent from RT6 and present in RT1, RT2, RT3, RT4, and RT5.

[0055] Further provided herein are methods of diagnosing a disease or condition, determining susceptibility for developing the disease or condition, and/or monitoring treatment of the disease or condition in an individual comprising determining the presence quantity, and/or percentage of a target molecule and/or bacteria of interest in a sample from the individual. In some cases, the bacteria of interest is a health-associated P. acnes. Certain methods for quantification as provided herein comprise detecting at least one of the following genetic markers: deoR, DNA encoding a CRISPR-associated protein {e.g., Cas5), pIMPLE plasmid, DNA encoding: Type I lipase, Type II lipase, alanine dehydrogenase, DNA-binding response regulator,

phosphoglycerate kinase, ABC transporter, dermatan-sulfate adhesin, hyaluronidase, and/or transposase 2.

[0056] Further provided herein are methods for determining a microbiome profile in an individual, which is the community of microorganisms living on and/or within the individual. The microbiome consists of many different bacterial species, some of which are beneficial, neutral or deleterious to human health. Alterations in the microbiome have been connected to many disease states such as inflammatory diseases, metabolic disease, developmental diseases, psychological diseases and cancer. Determining the composition of the microbiome, and altering the microbiome from a pathological to healthy state, holds great therapeutic promise for many different diseases. In some cases, the quantity or percentage of a particular bacteria within the microbiome is determined by detecting and/or quantifying the presence of a target molecule from the particular bacteria. Exemplary methods for determining P. acnes comprise measuring the presence, absence, and/or quantity of at least one of: deoR, DNA encoding a CRISPR-associated protein, pF PLE plasmid, and DNA encoding: Type I lipase, Type II lipase, alanine

dehydrogenase, DNA-binding response regulator, phosphoglycerate kinase, ABC transporter, dermatan-sulfate adhesin, hyaluronidase, and/or transposase 2. For determining relative quantities of bacteria in a sample, 23 S ribosomal RNA sequences may be used to estimate total bacteria in a sample from the individual {e.g., using the PANBAC assay described herein).

Determination of a microbiome profile may be useful before or during treatment, for example, treatment with a health-associated bacteria. Methods for monitoring a treatment regimen following determination of a microbiome profile are also disclosed.

[0057] Further provided herein are kits for detecting a particular bacteria, e.g., a health- associated P. acnes bacteria, based on the presence, absence, and/or quantity of a genetic markers. Kits can comprise regents such as primers and/or probes used to measure the genetic markers. For example, kits comprise primers or probes for detecting at least one of deoR, DNA encoding a CRISPR-associated protein {e.g., Cas5), pFMPLE plasmid, and DNA encoding: Type I lipase, Type II lipase, alanine dehydrogenase, DNA-binding response regulator, phosphoglycerate kinase, ABC transporter, dermatan-sulfate adhesin, hyaluronidase, and/or transposase 2. In some cases, the kit does not require storage at temperatures below room temperature, for example, at temperatures below about 20 °C. Storage times include periods of about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 6 months, 1 year, or longer.

[0058] Further provided are kits comprising a sample collection device. Some such devices are useful for obtaining a sample comprising genetic material from a material to be tested for the presence and/or quantity of a bacteria of interest. An exemplary collection device is a swab. For use in collecting samples, one method involves contacting the swab to the surface of the material to be tested. In some cases, the swab containing the sample from the material does not require storage below room temperature, for example, it does not require storage at temperatures longer than 20 °C. Storage times include periods of about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 6 months, 1 year, or longer. Another exemplary collection device is an adhesive strip. The strip may be applied to the skin of a subject in a manner which allows for the adhesive to bond to genetic material from the skin.

Upon removal of the strip, the genetic material remains on the strip. In some cases, the genetic material is removed from a pilosebaceous unit. For example, a lipid pillar is adhered to the removed strip. An exemplary adhesive strip is one supplied by Biore® as a "pore strip."

[0059] In the following description, certain specific details are set forth in order to provide a thorough understanding of various embodiments. However, one skilled in the art will understand that the embodiments provided may be practiced without these details. Unless the context requires otherwise, throughout the specification and claims which follow, the word "comprise" and variations thereof, such as, "comprises" and "comprising" are to be construed in an open, inclusive sense, that is, as "including, but not limited to." As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the content clearly dictates otherwise. It should also be noted that the term "or" is generally employed in its sense including "and/or" unless the content clearly dictates otherwise. Further, headings provided herein are for convenience only and do not interpret the scope or meaning of the claimed embodiments.

[0060] As used herein the term "about" refers to an amount that is near the stated amount by about 10%, 5%, or 1%.

[0061] As used herein "health-associated" means a microbe that is more prevalent in healthy or disease free individuals than in individuals diagnosed with a given disorder. In certain

embodiments, the disease may be acne, eczema, seborrheic dermatitis, psoriasis, rosacea, or any combination thereof. A health-associated microbe can be determined statistically. For example, by comparing the microbiome or the prevalence of certain microbial species or strains on the skin, in the oral cavity, or in the digestive system of a healthy non-disease afflicted individual as compared to an individual with a given disease. Genera, species, or strains that are more prevalent in/on healthy individuals are health-associated. A health-associated strain can also be a strain that has been genetically modified or selected to express low levels of virulence factors that are associated with a given skin disease. A health-associated strain can also be a strain that has been genetically modified or selected to express high levels of beneficial genes, RNAs, or proteins that are associated with protection from a given skin disease. A health-associated strain can also be a strain that has been genetically modified or selected to express, not express, or express desirable levels of markers, as described herein.

[0062] As used herein "disease-associated" refers to a microbe that is more prevalent in an individual having a disease or given disorder. In certain embodiments, the disease is acne, eczema, psoriasis, rosacea, or any combination thereof. A disease-associated microbe can be determined statistically. For example, by comparing the microbiome or the prevalence of certain microbial species or strains on the skin, in the oral cavity, or in the digestive system of a disease afflicted individual as compared to a healthy or non-diseased individual. Genera, species, or strains that are more prevalent in/on diseased individuals are disease-associated. A disease- associated strain can also be a strain that has been genetically modified or selected to express high levels of virulence factors that are associated with a given skin disease. A disease-associated strain can also be a strain that has been genetically modified or selected to express low levels of beneficial genes, RNAs, or proteins that are associated with protection from a given skin disease.

[0063] As used herein, the terms "homologous," "homology," or "percent homology" when used herein to describe to an amino acid sequence or a nucleic acid sequence, relative to a reference sequence, can be determined using the formula described by Karlin and Altschul (Proc. Natl. Acad. Sci. USA 87: 2264-2268, 1990, modified as in Proc. Natl. Acad. Sci. USA 90:5873- 5877, 1993). Such a formula is incorporated into the basic local alignment search tool (BLAST) programs of Altschul et al. (J. Mol. Biol. 215: 403-410, 1990). Percent homology of sequences can be determined using the most recent version of BLAST, as of the filing date of this application.

[0064] As used herein, "bacteria" is not limited to bacteria, but includes other microbial organisms, such as bacteria, viruses, fungi, and parasites. Furthermore, any method and system described herein that is suitable for determining the presence, absence, and/or quantity of a bacteria is also suitable for use in detecting and/or quantifying any microbe, including, but not limited to, bacteria, viruses, fungi, and parasites.

Methods of Detecting a Target Molecule or Bacteria

[0065] In one aspect, provided are methods of detecting the presence, absence, and/or quantity of a target molecule or bacteria of interest in a sample. In some cases, the target molecule (including a molecule of a bacteria of interest) is detected by combining genetic material from the sample with a primer or probe that specifically binds or hybridizes to the target molecule. Exemplary methods involve qPCR, which includes the TaqMan™ technology. Target molecules include DNA, for example, genes or other genetic material that are unique to the bacteria of interest.

[0066] In some cases, the bacteria of interest is a bacteria associated with a disease or condition that afflicts a subject. In some cases, the bacteria of interest is associated with a healthy condition of a subject. Subjects include both human and animal populations. As a non- limiting example, a biological sample from an individual is tested using a method provided herein to determine the relative quantity of the bacteria of interest in the sample. Such bacteria of interest may be one associated with a healthy condition, and as such, is useful for monitoring treatment (e.g. , treatment with the health-associated bacteria). Some bacteria of interest that are associated with a disease state may be detected using the methods provided herein in order select a patient population for treatment and/or prophylactic treatment if the subject is determined to be susceptible to the disease.

[0067] In some cases, the sample to be tested using the methods provided herein is not isolated from a subject. For instance, the bacteria is isolated from the surface of a material to be tested. As a non-limiting example, the surface is a surface from a medical facility. The methods are thus suitable for testing for the presence and/or quantity of a bacteria such as methicillin- resistant Staphylococcus aureus (MRSA).

[0068] Some methods for identifying and/or genotyping a bacteria involve determining the presence, absence, and/or quantity of a target molecule specific for the bacteria. As used herein, detecting a target molecule includes identifying the presence, absence, and/or quantity of the target molecule in a sample. Some such methods involve combining genetic material that may comprise the target molecule, or an amplified product thereof, with a probe that is hybridizable to the target molecule (e.g., using a TaqMan™ assay). Furthermore, detecting a target molecule includes detecting the presence of the target molecule, e.g., a nucleic acid sequence when the target molecule is a DNA sequence, and also includes detecting the presence of the nucleic acid sequence encoding for the target molecule when the target molecule is a protein sequence.

[0069] In some embodiments, the presence, absence, and/or quantity of a target molecule is determined by sequencing genetic material from the sample. For example, pF PLE plasmid percentage can be determined by sequencing of P. acnes bacteria. In some embodiments, the pEVIPLE percentage is percentage of total sequencing reads that align to pIMPLE. Sequencing can be performed with any appropriate sequencing technology, including but not limited to single-molecule real-time (SMRT) sequencing, Polony sequencing, sequencing by ligation, reversible terminator sequencing, proton detection sequencing, ion semiconductor sequencing, nanopore sequencing, electronic sequencing, pyrosequencing, Maxam -Gilbert sequencing, chain termination (e.g., Sanger) sequencing, +S sequencing, or sequencing by synthesis. Sequencing methods also include next-generation sequencing, e.g., modern sequencing technologies such as Illumina sequencing (e.g., Solexa), Roche 454 sequencing, Ion torrent sequencing, and SOLiD sequencing. In some cases, next-generation sequencing involves high-throughput sequencing methods. Additional sequencing methods available to one of skill in the art may also be employed.

[0070] In some instances, a number of nucleotides that are sequenced are at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 300, 400, 500, 2000, 4000, 6000, 8000, 10000, 20000, 50000, 100000, or more than 100000 nucleotides. In some instances, the number of nucleotides sequenced is in a range of about 1 to about 100000 nucleotides, about 1 to about 10000 nucleotides, about 1 to about 1000 nucleotides, about 1 to about 500 nucleotides, about 1 to about 300 nucleotides, about 1 to about 200 nucleotides, about 1 to about 100 nucleotides, about 5 to about 100000 nucleotides, about 5 to about 10000 nucleotides, about 5 to about 1000 nucleotides, about 5 to about 500 nucleotides, about 5 to about 300 nucleotides, about 5 to about 200 nucleotides, about 5 to about 100 nucleotides, about 10 to about 100000 nucleotides, about 10 to about 10000 nucleotides, about 10 to about 1000 nucleotides, about 10 to about 500 nucleotides, about 10 to about 300 nucleotides, about 10 to about 200 nucleotides, about 10 to about 100 nucleotides, about 20 to about 100000 nucleotides, about 20 to about 10000 nucleotides, about 20 to about 1000 nucleotides, about 20 to about 500 nucleotides, about 20 to about 300 nucleotides, about 20 to about 200 nucleotides, about 20 to about 100 nucleotides, about 30 to about 100000 nucleotides, about 30 to about 10000 nucleotides, about 30 to about 1000 nucleotides, about 30 to about 500 nucleotides, about 30 to about 300 nucleotides, about 30 to about 200 nucleotides, about 30 to about 100 nucleotides, about 50 to about 100000 nucleotides, about 50 to about 10000 nucleotides, about 50 to about 1000 nucleotides, about 50 to about 500 nucleotides, about 50 to about 300 nucleotides, about 50 to about 200 nucleotides, or about 50 to about 100 nucleotides.

[0071] Universal assay for determining quantity of total bacteria

[0072] For methods where the percentage of a particular bacteria of interest is desired, an assay may be performed to determine the total quantity of bacteria within the sample. In some embodiments, the assay comprises measuring the amount of 23 S rRNA. In some cases, the assay measures 23 S rRNA of bacteria found on the human face. FIG. 2 shows a portion of 23 S rRNA that may be exploited in these methods. Exemplary primers for determining total 23 S rRNA have SEQ ID NOS: 7 and 8. It was surprising to locate a genomic sequence that is both amenable to a robust TaqMan™ assay and ubiquitous across different phyla; in partiucluar multiple single nucleotide polymorphisms are avoided by careful placement of the probe sequence between the two primers as shown in Fig 2. An exemplary probe for determining total 23 S rRNA has SEQ ID NO: 9. These exemplary sequences are suitable for use in a TaqMan™ assay, but may also be utilized in other amplification or qPCR methods.

[0073] Method of detecting P. acnes

[0074] Some applications of the methods provided herein are directed to determining the presence and/or quantity of a P. acnes bacteria in a sample. P. acnes bacteria include health- associated P. acnes and disease-associated P. acnes, and as such, some methods comprise differentiating between these bacteria and/or determining relative amounts of these bacteria in a sample. For example, the sample is from an individual having both health-associated and disease-associated P. acnes, and determining the relative amounts of these bacteria is useful for determining a state of disease or condition in the individual. A non-limiting disease or condition is acne. In other cases, the methods involve determining the presence and/or quantity of health- associated P. acnes in the sample. The term "quantity" of bacteria includes the amount of bacteria of interest in the sample, as well as the percentage of bacteria of interest within the total population of bacteria in the sample.

[0075] Detecting P. acnes includes analyzing genetic markers that are present or absent in a P. acnes bacteria. As a non-limiting example, genetic markers include a repressor of porphyrin biosynthesis, Type I lipase, Type II lipase, a CRISPR element {e.g., as found in P. acnes strain ATCC 11828, or P. acnes strain HL106PA1), pIMPLE plasmid, alanine dehydrogenase, DNA- binding response regulator, phosphoglycerate kinase, ABC transporter, dermatan-sulfate adhesin, hyaluronidase, and transposase 2. As further described herein, presence of a deoR, a Type II lipase, and/or Cas5, and absence or low copies of a pF PLE plasmid, or a combination thereof, is generally associated with probiotics and health-associated bacteria disclosed herein. In contrast, disease-associated bacteria disclosed herein are generally associated with the presence or high copies of pFMPLE plasmid, presence of a Type I lipase, absence of a DNA binding response regulator, absence of a phosphoglycerate kinase, or a combination thereof. However, it would be understood to one of skill in the art that nature presents exceptions to such generalities.

Therefore, expression patterns of these markers that are alternative or contrary to those described herein are contemplated as well.

[0076] Detection methods provided herein also include characterizing a sample comprising or suspected of comprising a P. acnes bacteria as comprising or not comprising a P. acnes bacteria. In some cases, characterizing comprises detecting the presence or absence of a target nucleic acid sequence encoding for a marker of P. acnes in the sample. In some cases, characterizing comprises detecting the presence or absence of a nucleic acid sequence encoding for one or more markers of P. acnes that correlate to a health-associated P. acnes bacteria, a disease-associated P. acnes bacteria, or a combination thereof. In some cases, characterization provides a method by which relative amounts or percentages of disease-associated and health- associated P. acnes bacteria within a sample are calculated.

[0077] In some instances, P. acnes is characterized at the nucleic acid level. Nucleic acid- based techniques include, for example, quantitative polymerase chain reaction (qPCR), gel electrophoresis, immunochemistry, in situ hybridization such as fluorescent in situ hybridization (FISH), cytochemistry, and next generation sequencing. In some embodiments, the methods involve TaqMan™ qPCR, which involves a nucleic acid amplification reaction with a specific primer pair, and hybridization of the amplified nucleic acids with a hydrolysable probe specific to the target nucleic acid sequence. The present disclosure provides exemplary probes that are hybridizable to deoR (SEQ ID NO: 3) and Cas5 (SEQ ID NO: 6). Exemplary qPCR methods are provided in the present Examples section.

[0078] Provided herein, in certain embodiments, are methods of evaluating a sample for a bacteria of interest by determining the presence, absence, or quantity of a nucleic acid sequence of a genetic marker from the bacteria, such as a target nucleic acid sequence. In some cases, the target nucleic acid sequence comprises DNA. In some instances, the target nucleic acid sequence comprises a denatured DNA molecule or fragment thereof. In some instances, the target nucleic acid sequence comprises DNA selected from: genomic DNA, viral DNA, mitochondrial DNA, plasmid DNA, amplified DNA, circular DNA, circulating DNA, cell-free DNA, or exosomal DNA. In some instances, the DNA is single-stranded DNA (ssDNA), double-stranded DNA, denaturing double-stranded DNA, synthetic DNA, and combinations thereof. The circular DNA may be cleaved or fragmented.

[0079] Provided herein, in certain embodiments, are methods of evaluating a sample for a bacteria of interest by determining the presence, absence, or quantity of a target nucleic acid sequence comprising RNA. In some instances, the target nucleic acid sequence comprises fragmented RNA. In some instances, the target nucleic acid sequence comprises partially degraded RNA. In some instances, the target nucleic acid sequence comprises a microRNA or portion thereof. In some instances, the target nucleic acid sequence comprises an RNA molecule or a fragmented RNA molecule (RNA fragments) selected from: a microRNA (miRNA), a pre- miRNA, a pri-miRNA, a mRNA, a pre-mRNA, a viral RNA, a viroid RNA, a virusoid RNA, circular RNA (circRNA), a ribosomal RNA (rRNA), a transfer RNA (tRNA), a pre-tRNA, a long non-coding RNA (IncRNA), a small nuclear RNA (snRNA), a circulating RNA, a cell-free RNA, an exosomal RNA, a vector-expressed RNA, an RNA transcript, a synthetic RNA, and combinations thereof.

[0080] In some instances, the methods involve hybridization or amplification assays that include, but are not limited to, Southern or Northern analyses, polymerase chain reaction analyses, and probe arrays. Non-limiting amplification reactions include, but are not limited to, qPCR, self-sustained sequence replication, transcriptional amplification system, Q-Beta Replicase, rolling circle replication, or any other nucleic acid amplification known in the art. As discussed, reference to qPCR herein includes use of TaqMan™ methods.

[0081] In some cases, a method provided herein comprises determining the presence, absence, and/or quantity of a genetic marker, or portion thereof. Table 1 below provides a non-limiting example of P. acnes bacteria that can be distinguished by analysis of different genetic markers. The + symbol indicates the presence of deoR, Cas5, ABC XP, DBRR, and PGK nucleic acids in the columns labeled deoR, Cas5, ABC XP, DBRR, and PGK, respectively. The - symbol indicates absence of deoR, Cas5, ABC XP, DBRR, and PGK nucleic acids in the columns labeled deoR, Cas5, ABC XP, DBRR, and PGK respectively. % pIMPLE plasmid refers to the number of reads aligned/number of reads tested when bacteria is sequenced for pIMPLE plasmid.

Table 1. Sequences of P. acnes genetic elements.

ABC XP = ATP binding cassette transporter

DBRR = DNA binding response regulator

PGK = phosphoglycerate kinase

[0082] In some embodiments, a health-associated P. acnes (i) comprises a deoR repressor of porphyrin and a Type II lipase, (ii) does not comprise Cas5, and (iii) does not comprise, or comprises less than about 5% of the pIMPLE plasmid. In some cases, this health-associated P. acnes is ribotype 1. An exemplary health-associated P. acnes of ribotype 1 is HP3A11.

[0083] In some embodiments, a health-associated P. acnes (i) comprises a deoR repressor of porphyrin, a Type II lipase, and Cas5, and (ii) does not comprise, or comprises less than about 5% of the pFMPLE plasmid. In some cases, this health-associated P. acnes is ribotype 2. Exemplary health-associated P. acnes of ribotype 2 include HP4G1 and HP5G4.

[0084] In some embodiments, a health-associated P. acnes (i) comprises a deoR repressor of porphyrin, a Type II lipase, and Cas5, and (ii) comprises more than about 5% of the pIMPLE plasmid. In some cases, this health-associated P. acnes is ribotype 6. Exemplary health- associated P. acnes of ribotype 6 include HL110PA3 and HL110PA4.

[0085] In some cases, a health-associated P. acnes comprises two or more strains of P. acnes, for example, two or more of group C, D and G, as shown in Table 1. For instance, if the health- associated P. acnes is used as a therapeutic, the therapeutic comprises a single strain of P. acnes, or a combination of P. acnes strains. In a non-limiting example, a health-associated P. acnes comprises one or more of HP3A11, HP4G1, HP5G4, HL110PA3, and HL110PA4.

[0086] In some embodiments, a disease-associated P. acnes (i) comprises a Type I lipase, (ii) lacks both a deoR repressor of porphyrin and Cas5, and (iii) comprises more than about 5% of the pIMPLE plasmid. In some cases, this disease-associated P. acnes is ribotype 1.

[0087] In some embodiments, a disease-associated P. acnes (i) comprises a deoR repressor of porphyrin and a Type I lipase, (ii) lacks Cas5, and (iii) does not comprise, or comprises less than about 5% of the pIMPLE plasmid. In some cases, this disease-associated P. acnes is ribotype 1.

[0088] In some embodiments, a disease-associated P. acnes (i) comprises a Type I lipase, (ii) lacks a deoR repressor of porphyrin, and (iii) comprises more than about 1% of the pIMPLE plasmid. In some cases, this disease-associated P. acnes is ribotype 4. In some cases, this disease-associated P. acnes is ribotype 5. An exemplary disease-associated P. acnes of ribotype 4 is HL045PA1. An exemplary disease-associated P. acnes of ribotype 4 is HL043PA1.

[0089] In some embodiments, P. acnes is characterized as a health-associated P. acnes or a disease-associated P. acnes by measuring the presence, absence, and/or quantity of deoR. In some embodiments, P. acnes is characterized by presence, absence, or relative abundance of deoR nucleic acid. In some embodiments, the deoR is a deoR family transcriptional regulator expressed in Propionibacterium acnes subsp. defendens (ATCC 11828, GenBank: AER05724.1). In some embodiments, deoR is found in P. acnes strain ATCC 11828. In some embodiments, deoR comprises a sequence as set forth in SEQ ID NO: 10. In some embodiments, deoR comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%), or 100%) sequence identity to SEQ ID NO: 10. In some embodiments, deoR comprises at least or about 95% homology to SEQ ID NO: 10. In some embodiments, deoR comprises at least or about 97% homology to SEQ ID NO: 10. In some embodiments, deoR comprises at least or about 99%) homology to SEQ ID NO: 10. In some embodiments, deoR comprises at least or about 100%) homology to SEQ ID NO: 10. In some instances, deoR comprises at least a portion having at least or about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 550, 650, 700, 750, 800, 900, or more than 900 bases of SEQ ID NO: 10. In some embodiments, a health-associated P. acnes comprises deoR. In some embodiments, a disease-associated P. acnes does not comprise deoR. Methods for determining the presence, absence, and/or quantity of deoR include qPCR. As an example, the qPCR method employed is TaqMan™.

[0090] In some embodiments, P. acnes is characterized as a health-associated P. acnes or a disease-associated P. acnes by measuring the presence, absence, and/or quantity of Cas5. In some embodiments, Cas5 is found in P. acnes strain ATCC 11828 (GenBank: AER05233.1) . In some embodiments, Cas5 comprises a sequence as set forth in SEQ ID NO: 11. In some embodiments, Cas5 comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 11. In some

embodiments, Cas5 comprises at least or about 95% homology to SEQ ID NO: 11. In some embodiments, Cas5 comprises at least or about 97% homology to SEQ ID NO: 11. In some embodiments, Cas5 comprises at least or about 99% homology to SEQ ID NO: 11. In some embodiments, Cas5 comprises at least or about 100% homology to SEQ ID NO: 11. In some instances, Cas5 comprises at least a portion having at least or about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 550, 650, 700, or more than 700 bases of SEQ ID NO: 11. In some embodiments, a health-associated P. acnes comprises Cas5. In some embodiments, a disease-associated P. acnes does not comprise Cas5. In some cases, a health-associated P. acnes expresses Cas5. In some cases, a disease-associated P. acnes does not express Cas5. Methods provided herein are applicable to detecting both DNA encoding for Cas5 {e.g., using qPCR), and expression of and/or presence of the Cas5 protein. Methods for determining the presence, absence, and/or quantity of Cas5 include qPCR. As an example, the qPCR method employed is TaqMan™.

[0091] In some embodiments, P. acnes is characterized as a health-associated P. acnes or a disease-associated P. acnes by measuring the presence, absence, and/or quantity of pEVIPLE. In some embodiments, pEVIPLE is found in P. acnes strain ATCC 11828. In some embodiments, P. acnes does not comprise or comprises a low copy number of a pIMPLE plasmid, which, in some cases, is indicative of a health-associated P. acnes. In some embodiments, a health-associated P. acnes comprises less than 5 copies of pEVIPLE plasmid per bacterial genome. In some

embodiments, a health-associated P. acnes comprises less than 4 copies of pEVIPLE plasmid per bacterial genome. In some embodiments, a health-associated P. acnes comprises less than 3 copies of pIMPLE plasmid per bacterial genome. In some embodiments, a health-associated P. acnes comprises less than 2 copies of pIMPLE plasmid per bacterial genome. In some

embodiments, a health-associated P. acnes comprises 1 copy of pIMPLE plasmid per bacterial genome. In some embodiments, a health-associated P. acnes comprises less than about 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% pIMPLE plasmid. In some embodiments, a health-associated P. acnes comprises less than about 1.0%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1% pIMPLE plasmid. pIMPLE plasmid percentage can be determined by next-generation sequencing of P. acnes bacteria, as % reads aligned. In some embodiments, the pIMPLE percentage is percentage of total sequencing reads that align to pIMPLE from HL096PA1 (an RT5). In some embodiments, pIMPLE comprises a sequence as set forth in SEQ ID NO: 12. In some embodiments, pIMPLE comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 12. In some embodiments, pIMPLE comprises at least or about 95% homology to SEQ ID NO: 12. In some embodiments, pIMPLE comprises at least or about 97% homology to SEQ ID NO: 12. In some embodiments, pIMPLE comprises at least or about 99% homology to SEQ ID NO: 12. In some embodiments, pIMPLE comprises at least or about 100% homology to SEQ ID NO: 12. In some instances, pIMPLE comprises at least a portion having at least or about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 550, 650, 700, 750, 800, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, or more than 6000 bases of SEQ ID NO: 12.

[0092] In some embodiments, P. acnes is characterized as a health-associated P. acnes or a disease-associated P. acnes by measuring the presence, absence, and/or quantity of a lipase.

Exemplary methods involve determining the presence, absence, and/or quantity of DNA encoding a lipase in a sample. In some embodiments, the lipase is Type I lipase. In some embodiments, the lipase is Type II lipase. In some embodiments, P. acnes expresses a lipase. In some embodiments, P. acnes does not comprise a gene encoding for a Type I lipase. In some embodiments, P. acnes does not comprise a gene encoding for a Type II lipase. In some embodiments, P. acnes comprises a nucleic acid encoding a Type II lipase. Type I lipase and Type II lipase, as described herein, may be encoded by a similar nucleic acid. For example, a gene encoding Type I lipase will encode a Type II lipase upon a 6bp deletion in the intergenic region and a single base deletion, the latter causing a frameshift that creates premature STOP codon, see, e.g., the lipase sequence alignment of FIG. 4. [0093] In some embodiments, at least a portion of the DNA encoding Type II lipase comprises SEQ ID NO. : 24. SEQ ID NO. : 24 is found in the complete circular genome of Propionibacterium acnes ATCC 11828 and starts at position 390,423 of ATCC 11828. The following subsequent positions are in reference to the first nucleotide of SEQ ID NO.: 24. The lipase coding sequence is bases 22-1032, referred to herein as ADE0051, HMPREF0675 4856, and SEQ ID NO.: 14. Bases 1-21 is an intergenic region. Type II Lipase has a G in position 7 and an A in position 16. In some embodiments, at least a portion of the Type I lipase is expressed from a nucleic acid sequence comprising SEQ ID NO. : 23. In contrast, relative to SEQ ID NO. 24, SEQ ID NO. 23 has a 6bp sequence TAGATA inserted between base pairs 1 and 2, an A in position 7, a G in position 16, and a G between base pairs 145 and 146. FIG. 4 illustrates the differences between sequences encoding Type I lipase and Type II lipase.

[0094] In some embodiments, P. acnes is characterized as a health-associated P. acnes or a disease-associated P. acnes by measuring the presence, absence, and/or quantity of Type I lipase. In some embodiments, Type I lipase is found in P. acnes strain ATCC 11828. In some embodiments, Type I lipase comprises a sequence as set forth in SEQ ID NO: 13. In some embodiments, Type I lipase comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 13. In some embodiments, Type I lipase comprises at least or about 95% homology to SEQ ID NO: 13. In some embodiments, Type I lipase comprises at least or about 97% homology to SEQ ID NO: 13. In some embodiments, Type I lipase comprises at least or about 99% homology to SEQ ID NO: 13. In some embodiments, Type I lipase comprises at least or about 100% homology to SEQ ID NO: 13. In some instances, Type I lipase comprises at least a portion having at least or about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 550, 650, 700, 750, 800, 1000, or more than 1000 bases of SEQ ID NO: 13. In some embodiments, a health-associated P. acnes does not comprise, or has a low quantity of, Type I lipase, and/or the gene encoding for Type I lipase, relative to a reference strain {e.g., pathogenic strain, not a health-associated strain). In some embodiments, a health-associated P. acnes does not express or expresses a low quantity of Type I lipase relative to a reference strain. Methods for determining the presence, absence, and/or quantity of Type I lipase include qPCR. As an example, the qPCR method employed is TaqMan™.

[0095] In some embodiments, P. acnes is characterized as a health-associated P. acnes or a disease-associated P. acnes by measuring the presence, absence, and/or quantity of Type II lipase. A non-limiting example of a Type II lipase is Lipase ADE00051, HMPREF0675 4856. In some embodiments, Type II lipase is found in P. acnes strain ATCC 11828. In some embodiments, Type II lipase comprises a sequence as set forth in SEQ ID NO: 14. In some embodiments, Type II lipase comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 14. In some embodiments, Type II lipase comprises at least or about 95% homology to SEQ ID NO: 14. In some embodiments, Type II lipase comprises at least or about 97% homology to SEQ ID NO: 14. In some embodiments, Type II lipase comprises at least or about 99% homology to SEQ ID NO: 14. In some embodiments, Type II lipase comprises at least or about 100% homology to SEQ ID NO: 14. In some instances, Type II lipase comprises at least a portion having at least or about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 550, 650, 700, 750, 800, 1000, or more than 1000 bases of SEQ ID NO: 14. In some embodiments, a health-associated P. acnes comprises Type II lipase, and/or the gene encoding for Type II lipase. In some embodiments, a health- associated P. acnes comprises greater expression of Type II lipase as compared to a reference strain {e.g., pathogenic strain, not a health-associated strain). In some embodiments, a health- associated P. acnes has a greater quantity of the gene encoding for Type II lipase as compared to the reference strain. Methods for determining the presence, absence, and/or quantity of Type II lipase include qPCR. As an example, the qPCR method employed is TaqMan™.

[0096] In some embodiments, P. acnes is characterized as a health-associated P. acnes or a disease-associated P. acnes by measuring the presence, absence, and/or quantity of alanine dehydrogenase. In some embodiments, alanine dehydrogenase is found in P. acnes strain ATCC 11828. In some embodiments, alanine dehydrogenase comprises a sequence as set forth in SEQ ID NO: 15. In some embodiments, alanine dehydrogenase comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 15. In some embodiments, alanine dehydrogenase comprises at least or about 95% homology to SEQ ID NO: 15. In some embodiments, alanine dehydrogenase comprises at least or about 97% homology to SEQ ID NO: 15. In some embodiments, alanine dehydrogenase comprises at least or about 99% homology to SEQ ID NO: 15. In some embodiments, alanine dehydrogenase comprises at least or about 100% homology to SEQ ID NO: 15. In some instances, alanine dehydrogenase comprises at least a portion having at least or about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 550, 650, 700, 750, 800 or more than 800 bases of SEQ ID NO: 15. In some embodiments, a P. acnes RT6 strain does not comprise alanine dehydrogenase. In some embodiments, a P. acnes RT2 strain comprises the alanine dehydrogenase. Methods for determining the presence or absence of alanine dehydrogenase include qPCR. As an example, the qPCR method employed is TaqMan™.

[0097] In some embodiments, P. acnes is characterized as P. acnes RT6 by detecting the absence of an ABC transporter. In some embodiments, the ABC transporter comprises a sequence as set forth in SEQ ID NO: 16. In some embodiments, the ABC transporter comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity to SEQ ID NO: 16. In some embodiments, the ABC transporter comprises at least or about 95% homology to SEQ ID NO: 16. In some embodiments, the ABC transporter comprises at least or about 97% homology to SEQ ID NO: 16. In some embodiments, the ABC transporter comprises at least or about 99% homology to SEQ ID NO: 16. In some embodiments, the ABC transporter comprises at least or about 100% homology to SEQ ID NO: 16. In some instances, the ABC transporter comprises at least a portion having at least or about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 550, 600, 650, 700, 750, 800, 850, 900 or more than 900 bases of SEQ ID NO: 16. In some cases, a gene encoding ABC transporter is absent in RT6, but present in RT1, RT2, RT3, RT4 and RT5. Methods for determining the presence or absence of ABC transporter include qPCR. As an example, the qPCR method employed is TaqMan™.

[0098] In some embodiments, P. acnes is characterized as P. acnes RT6 by detecting the presence of a DNA-binding response regulator. In some embodiments, the DNA-binding response regulator comprises a sequence as set forth in SEQ ID NO: 17. In some embodiments, the DNA-binding response regulator comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 17. In some embodiments, the DNA-binding response regulator comprises at least or about 95% homology to SEQ ID NO: 17. In some embodiments, the DNA-binding response regulator comprises at least or about 97% homology to SEQ ID NO: 17. In some embodiments, the DNA- binding response regulator comprises at least or about 99% homology to SEQ ID NO: 17. In some embodiments, the DNA-binding response regulator comprises at least or about 100% homology to SEQ ID NO: 17. In some instances, the DNA-binding response regulator comprises at least a portion having at least or about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 550, 600 or more than 600 bases of SEQ ID NO: 17. In some cases, the gene encoding DNA binding response regulator is present in P. acnes of ribotype RT6, but not in RT1, RT2, RT3, RT4 and RT5. Methods for determining the presence, absence, and/or quantity of DNA-binding response regulator include qPCR. As an example, the qPCR method employed is TaqMan™.

[0099] In some embodiments, P. acnes is characterized as P. acnes RT6 by detecting the presence of a phosphoglycerate kinase. In some embodiments, the phosphoglycerate kinase comprises a sequence as set forth in SEQ ID NO: 18. In some embodiments, the

phosphoglycerate kinase comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 18. In some embodiments, the phosphoglycerate kinase comprises at least or about 95% homology to SEQ ID NO: 18. In some embodiments, the phosphoglycerate kinase comprises at least or about 97% homology to SEQ ID NO: 18. In some embodiments, the phosphoglycerate kinase comprises at least or about 99% homology to SEQ ID NO: 18. In some embodiments, the phosphoglycerate kinase comprises at least or about 100% homology to SEQ ID NO: 18. In some instances, the phosphoglycerate kinase comprises at least a portion having at least or about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 550 or more than 550 bases of SEQ ID NO: 18. In some cases, the gene encoding phosphoglycerate kinase is present in P. acnes of ribotype RT6, but not in RT1, RT2, RT3, RT4 and RT5. Methods for determining the presence, absence, and/or quantity of phosphoglycerate kinase include qPCR. As an example, the qPCR method employed is

TaqMan™.

[00100] In some embodiments, P. acnes is characterized as a health-associated P. acnes or a disease-associated P. acnes by detecting the absence, presence, and/or quantity of dermatan- sulfate adhesin. In some embodiments, a health-associated P. acnes does not comprise dermatan- sulfate adhesin. In some embodiments, dermatan-sulfate adhesin is DSA1 or DSA2. In some embodiments, the dermatan-sulfate adhesin comprises a sequence as set forth in SEQ ID NO: 20. In some embodiments, the dermatan-sulfate adhesin comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 20. In some embodiments, the dermatan-sulfate adhesin comprises at least or about 95% homology to SEQ ID NO: 20. In some embodiments, the dermatan-sulfate adhesin comprises at least or about 97% homology to SEQ ID NO: 20. In some embodiments, the dermatan-sulfate adhesin comprises at least or about 99% homology to SEQ ID NO: 20. In some embodiments, the dermatan-sulfate adhesin comprises at least or about 100% homology to SEQ ID NO: 20. In some instances, the dermatan-sulfate adhesin comprises at least a portion having at least or about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 550, 600, 650, 700, 750, 800, 850, 900 or more than 900 bases of SEQ ID NO: 20.

[00101] In some embodiments, the dermatan-sulfate adhesin comprises a sequence as set forth in SEQ ID NO: 19. In some embodiments, the dermatan-sulfate adhesin comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 19. In some embodiments, the dermatan-sulfate adhesin comprises at least or about 95% homology to SEQ ID NO: 19. In some embodiments, the dermatan-sulfate adhesin comprises at least or about 97% homology to SEQ ID NO: 19. In some embodiments, the dermatan-sulfate adhesin comprises at least or about 99% homology to SEQ ID NO: 19. In some embodiments, the dermatan-sulfate adhesin comprises at least or about 100%) homology to SEQ ID NO: 19. In some instances, the dermatan-sulfate adhesin comprises at least a portion having at least or about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 550, 600, 650, 700, 750, 800, 850, 900 or more than 900 bases of SEQ ID NO: 19.

[00102] In some embodiments, a health-associated P. acnes does not comprise dermatan-sulfate adhesin. In some cases, a health-associated P. acnes does not comprise the gene encoding dermatan-sulfate adhesin. In some cases, a health-associated P. acnes does not express or expresses a lower quantity of dermatan-sulfate adhesin as compared to a reference strain {e.g. , pathogenic strain, not a health-associated strain). Methods for determining the presence, absence, and/or quantity of dermatan-sulfate adhesin include qPCR. As an example, the qPCR method employed is TaqMan™.

[00103] In some embodiments, P. acnes is characterized as a health-associated P. acnes or a disease-associated P. acnes by detecting the absence, presence, and/or quantity of hyaluronidase. In some embodiments, a health-associated P. acnes does not comprise hyaluronidase.

Hyaluronidase is also known as hyaluronate lyase (locus tag PPA RS01930). In some embodiments, the hyaluronidase comprises a sequence as set forth in SEQ ID NO: 21. In some embodiments, the hyaluronidase comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 21. In some embodiments, the hyaluronidase comprises at least or about 95% homology to SEQ ID NO: 21. In some embodiments, the hyaluronidase comprises at least or about 97% homology to SEQ ID NO: 21. In some embodiments, the hyaluronidase comprises at least or about 99% homology to SEQ ID NO: 21. In some embodiments, the hyaluronidase comprises at least or about 100% homology to SEQ ID NO: 21. In some instances, the hyaluronidase comprises at least a portion having at least or about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 550, 600, 650, 700, 750, 800, 850, 900 or more than 900 bases of SEQ ID NO: 21. In some embodiments, a health- associated P. acnes does not comprise hyaluronidase. In some cases, a health-associated P. acnes does not comprise the gene encoding hyaluronidase. In some cases, a health-associated P. acnes does not express or expresses a lower quantity of hyaluronidase as compared to a reference strain {e.g., pathogenic strain, not a health-associated strain). Methods for determining the presence, absence, and/or quantity of hyaluronidase include qPCR. As an example, the qPCR method employed is TaqMan™.

[00104] In some embodiments, P. acnes is characterized as a health-associated P. acnes or a disease-associated P. acnes by detecting the absence, presence, and/or quantity of transposase 2. In some embodiments, a health-associated P. acnes does not comprise transposase 2. In some embodiments, the transposase 2 comprises a sequence as set forth in SEQ ID NO: 22. In some embodiments, the transposase 2 comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 22. In some embodiments, the transposase 2 comprises at least or about 95% homology to SEQ ID NO: 22. In some embodiments, the transposase 2 comprises at least or about 97% homology to SEQ ID NO: 22. In some embodiments, the transposase 2 comprises at least or about 99% homology to SEQ ID NO: 22. In some embodiments, the transposase 2 comprises at least or about 100% homology to SEQ ID NO: 22. In some instances, the transposase 2 comprises at least a portion having at least or about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 550, 600, 650, 700, 750, 800, 850, 900 or more than 900 bases of SEQ ID NO: 22. In some embodiments, a health- associated P. acnes does not comprise transposase 2. In some cases, a health-associated P. acnes does not comprise the gene encoding transposase 2. In some cases, a health-associated P. acnes does not express or expresses a lower quantity of transposase 2 as compared to a reference strain {e.g., pathogenic strain, not a health-associated strain). Methods for determining the presence, absence, and/or quantity of transposase 2 include qPCR. As an example, the qPCR method employed is TaqMan™. [00105] In some instances, methods of detecting a health-associated P. acnes comprises detecting a repressor of porphyrin. In some instances, the repressor of porphyrin is deoR. In some instances, methods of detecting a health-associated P. acnes comprises detecting a clustered regulatory interspersed short palindromic repeats (CRISPR) associated protein of P. acnes. In some instances, the CRISPR protein is Cas5. In some instances, methods of detecting a health-associated P. acnes comprise not detecting, or detecting a low percentage {e.g., <5%) of pIMPLE. In some instances, methods of detecting a health-associated P. acnes comprise not detecting Type I lipase. In some instances, methods of detecting a health-associated P. acnes comprise detecting Type II lipase. In some instances, methods of detecting a health-associated P. acnes comprise detecting or not detecting alanine dehydrogenase. In some instances, methods of detecting a health-associated P. acnes comprise detecting or not detecting ABC transporter, DNA-binding response regulator, and/or phosphoglycerate kinase, e.g., to distinguish between RT6 and RT1, RT2, RT3, RT4, and RT5 P. acnes. In some instances, methods of detecting a health-associated P. acnes comprise detecting or not detecting dermatan-sulfate adhesin, hyaluronidase, and/or transposase 2. Methods described herein comprise identifying the presence or absence of at least one of: deoR, CRISPR-associated protein or the coding nucleic acid sequence thereof, pIMPLE, Type I lipase or the coding nucleic acid sequence thereof, Type II lipase or the coding nucleic acid sequence thereof, alanine dehydrogenase or the coding nucleic acid sequence thereof, ABC transporter or the coding nucleic acid sequence thereof, DNA-binding response regulator or the coding nucleic acid sequence thereof, phosphoglycerate kinase or the coding nucleic acid sequence thereof, dermatan-sulfate adhesin or the coding nucleic acid sequence thereof, hyaluronidase or the coding nucleic acid sequence thereof, and transposase 2 or the coding nucleic acid sequence thereof. In some cases, the health-associated P. acnes comprises deoR, Cas5, and/or Type II lipase, and does not comprise one or more of Type I lipase, dermatan-sulfate adhesin, hyaluronidase, and transposase 2. In some cases, RT6 comprises DNA binding response regulator and/or phosphoglycerate kinase, and does not comprise ABC transporter and/or alanine dehydrogenase.

[00106] In some instances, methods of detecting a disease-associated P. acnes comprises not detecting a repressor of porphyrin. In some instances, the repressor of porphyrin is deoR. In some instances, methods of detecting a disease-associated P. acnes comprises not detecting a clustered regulatory interspersed short palindromic repeats (CRISPR) associated protein of P. acnes. In some instances, the CRISPR protein is Cas5. In some instances, methods of detecting a disease-associated P. acnes comprise detecting pIMPLE. In some instances, methods of detecting a disease-associated P. acnes comprise detecting Type I lipase. In some instances, methods of detecting a disease-associated P. acnes comprise not detecting Type II lipase. In some instances, methods of detecting a disease-associated P. acnes comprise detecting or not detecting alanine dehydrogenase. In some instances, methods of detecting a disease-associated P. acnes comprise detecting or not detecting ABC transporter, DNA-binding response regulator, and/or phosphoglycerate kinase, e.g., to distinguish between RT6 and RT1, RT2, RT3, RT4, and RT5 P. acnes. Methods described herein comprise identifying the presence or absence of at least one of: deoR, CRISPR-associated protein or the coding nucleic acid sequence thereof, pIMPLE, Type I lipase or the coding nucleic acid sequence thereof, Type II lipase or the coding nucleic acid sequence thereof, alanine dehydrogenase or the coding nucleic acid sequence thereof, ABC transporter or the coding nucleic acid sequence thereof, DNA-binding response regulator or the coding nucleic acid sequence thereof, phosphoglycerate kinase or the coding nucleic acid sequence thereof, dermatan-sulfate adhesin or the coding nucleic acid sequence thereof, hyaluronidase or the coding nucleic acid sequence thereof, and transposase 2 or the coding nucleic acid sequence thereof. In some cases, the disease-associated P. acnes does not comprise deoR, Cas5, and/or Type II lipase, and comprises one or more of Type I lipase, dermatan-sulfate adhesin, hyaluronidase, and transposase 2.

[00107] In some instances, methods of detecting or otherwise characterizing a bacteria of interest comprise contacting nucleic acids from a sample with a nucleic acid polymer that hybridizes to the target nucleic acid sequence. In some instances, the target nucleic acid sequence is a sequence of a repressor of porphyrin. In some instances, the repressor of porphyrin is deoR. In some instances, deoR comprises SEQ ID NO: 10. In some instances, the target nucleic acid sequence is a sequence encoding for a CRISPR-associated protein. The CRISPR- associated protein can be at least one of Cas5, Cas9, Cpfl, Cas3, Cas8a, Cas8b, Cas8c, CaslOd, Csel, Cse2, Csyl, Csy2, Csy3, GSU0054, CaslO, Csm2, Cmr5, CaslO, Csxl l, CsxlO, Csfl, Csn2, Cas4, C2cl, C2c3, C2c2. In some instances, the CRISPR-associated protein is Cas5. In some instances, Cas5 comprises SEQ ID NO: 11. In some instances, the target nucleic acid sequence is pIMPLE. In some instances, pIMPLE comprises SEQ ID NO: 12. In some instances, the target nucleic acid sequence is Type I lipase. In some instances, Type I lipase comprises SEQ ID NO: 13. In some instances, the nucleic acid sequence is Type II lipase. In some instances, Type II lipase comprises SEQ ID NO: 14. In some instances, the nucleic acid sequence is a sequence encoding for alanine dehydrogenase. In some instances, alanine dehydrogenase comprises SEQ ID NO: 15. In some instances, the nucleic acid sequence is a sequence encoding for ABC transporter. In some instances, the ABC transporter comprises SEQ ID NO: 16. In some instances, the nucleic acid sequence is a sequence encoding for DNA- binding response regulator. In some instances, the DNA-binding response regulator comprises SEQ ID NO: 17. In some instances, the nucleic acid sequence is a sequence encoding for phosphoglycerate kinase. In some instances, the phosphoglycerate kinase comprises SEQ ID NO: 18. In some instances, the nucleic acid sequence is a sequence encoding for dermatan-sulfate adhesin. In some instances, the dermatan-sulfate adhesin comprises SEQ ID NO: 20. In some instances, the nucleic acid sequence is a sequence encoding for hyaluronidase. In some instances, the hyaluronidase comprises SEQ ID NO: 21. In some instances, the nucleic acid sequence is a sequence encoding for transposase 2. In some instances, the transposase 2 comprises SEQ ID NO: 22.

[00108] The nucleic acid polymer can comprise an oligonucleotide of at least or about 5, 10, 25, 50, 75, 100 or more nucleotides in length and sufficient to specifically hybridize to a target nucleic acid sequence as described herein. In some instances, the nucleic acid polymer comprises an oligonucleotide 5 to 100. In some instances, the nucleic acid polymer comprises an

oligonucleotide at least 5 nucleotides in length. In some instances, the nucleic acid polymer comprises an oligonucleotide at most 100 nucleotides in length. In some instances, the nucleic acid polymer comprises an oligonucleotide 5 to 25, 5 to 50, 5 to 100, 10 to 25, 10 to 50, 10 to 100, nucleotides in length. In some instances, the nucleic acid polymer hybridizes the target nucleic acid sequence of least one of deoR, Cas5, pIMPLE, Type I lipase, Type II lipase, alanine dehydrogenase, ABC transporter, DNA-binding response regulator, phosphoglycerate kinase, dermatan-sulfate adhesin, hyaluronidase, and transposase 2. In some instances, the nucleic acid polymer hybridizes to the target nucleic acid sequence comprising SEQ ID NO: 10, 11, 12, 13, 14, 15, 16, 17, or 18. Exemplary sequences for deoR, Cas5, pIMPLE, Type I lipase, Type II lipase, alanine dehydrogenase, ABC transporter, DNA-binding response regulator,

phosphoglycerate kinase, dermatan-sulfate adhesin, hyaluronidase, transposase 2, and 23 S are provided in Table 2.

Table 2. Sequences of P. acnes genetic elements. Sequence

deoR:

GGGACAGCGACCGGTGAAGGGTCCGCTGGGAGCAAGGGGATCGTCAGTCGGTGTCTGCAGGCTGAAGGG

GCGCTTGGATGACGTGGTGTCCGCTCCGGCGGAAGGCACCGAGCTTCTCGCTCAGCTCACTGTTCGACGA

CTGGACGGTGACGATCCCCGTCCGGGGCGGTATCGATGCCCAATATGGTTCGCTACCGGTGGTGAGGATC

TTGGTGGGATCAGCGAGGATCCACGACGTGCGAGCCCGCGTCATCGCTTCGTGTTTGAACTCGACGGACT

CCAGGAGTGGGCAGTTGAGCCCGTCGGTCGCAGAGACTGCGTCGCAGCCGATGAACGCGACATCAGGGG

TGATGCTGCGCAGGTTTGATGACGCCCACGGTCCCAGAAGGCTTCCGCTGTGCTGCCTTAACGCCCCGCC

GAGCACCATGACGTTGGCGGTGCCTTCGGCCACGGCCTGGAGCACGGACAGGCCGCCTACGAGGATGGT

GATGTCGTTACGAGTCGACAGAAGGCGGCCCAGTGCTGCGGTGGACGTTCCGGAATCGAGCAGAACTAG

GTCACTCTCGTTCACGAGGTGTTTGGCGGCATATGTGGCCATTGCTGCCTTGGAGACGTGCTCGCATTGTT

CCTTCTCGTGCCAGGTAGGCTCGTGTCGTCGGATCATGACGTCTCCCCCGGAAATCTTCCAGATCTTGGAT TCATCCGAGAGGGCATCGACATCGCGGCGAATCGTCGATGTAGAGACACCGAACAGTTGGGAAAGATCT CCGATGGACTCCGAGTGCCCCAAAGAACGCAGATGGTCGACAATGTGTCGGCGTCGGGCAGCTGTCGCC GTGCGCGGCTGTTTGGGTGTTGTGCTCATGGTGTCTTGATCGGTGACGTGGTTTGGCTGATCCAATTTGAG GACCGCCTCTAAGGATAACCCAGCGGCATCACTGCTGGACTCGGTCTGTTTGGGTGGTCGGTCCAAGAAT TTCTCAGGTCACAGGCTAATAAGGTTACCTCGTCGGTGCACT (SEQ ID NO. 10)

Cas5:

GTGACCGTCCTGCTCTTACGCCTCGCGGGGCCCTTGCAATCCTGGGGAGATTCCAGCCGATTTACGACCC

GGGCCACACGACGGGAACCGACGAAGTCCGGCGTCATCGGGTTGTTGGCTGCGGCGCAGGGACGACGTC

GCACCGACAGTCTCGAAGACCTGCTCACCCTGCGATTCGGTGTGCGAACCGACCAGCCGGGGTCGATCGT

GCGGGACTTCCAGACAGCCATGGACTGGGCACATCCCAAAAAGGACGGCCGCGTCAAAGCCATGCCGTT

GTCAAACCGCTACTACTTGGCCGACGCAGTCTTCGTGGCGGCGGTCGAAGGAGACCCGTCCTCCTCCAGG

CGTTGGACGAGGCAATCAGAGACCCGGAGTTCCCGCTCTACCTCGGCCGAAGATCCTGTCCCACGGAAGG

ACAGGTGTCCTTAGGCGTGCGAGAGAGCGAGCTGGTGAAGACCTTGGAAAATGAGCCTTGGCACGCCAA

GCTGTGGCACCAACGCCGACTGGGACGATCCGTCCGACTTCCCATCGCCTATGACGCCGGGCCGGGACAG

ATCGGCGACACCGTCCGCGACATACCGCTGAGCTTCAACCCTGAGCGGCGCGAGTACGGCTGGCGCGAC

GTCACGACGACAACGATTGTCGTCGACAACCCCAACGGAAGCGACGAGCCCGACTGGTTCGCAGGCCTA

GAAG (SEQ ID NO. 11)

pIMPLE:

TGCCGACGCCTTCGGCGTCGGGTGAGCGCGTGGATAGGCGCCCCTTCGGGGCACCTGTAAGCCTGTATCG

CTGCGGTTTACAGCCTTGGCCACCCAAAGGGGCAGCAAGGGGCCCGGAGGGGGCATTCTGCGCCGCTGA

TAGCATCTCACATGTGAGTTATTCTCTCAACTATCCTTCAAGTCAAGCGTATTAGATTATTTATCTAGTACT

CTTGACAGTCCGTCTATCGGGCTATATATTTATAAGCAGAACGAGAGATCGGGAAAGGAATCAACGATG

AAGTACACCGCACACGTCAACATGGTGACCAAGCCCTACATCGGACTTCCCACTACCCGAACCCCCTACA

CCCTCGTCGACGCCGACTGGGCCACAACATGGATGATCGACGAAACCTACGAAGCCCACTACCACGGCA

CCAGCGTGGAGATCAGCATCTACGGCGAAGGCCCCAACTGCTCCGTACTCACCAACCGCATCTACACCGA

CCAGCCCACCGATGTGACCGCTGCACTCGCCAACTACGGCTTCACCATCGACACCACCAACACATCCAAA

ACCATCCTCACGCTCACCCGCACAGCCACCATCTCCCACCTACTAGCCATCCTCGATGGCCTACCCCAAG

CCGAGGGGACTCACTGGCTCAACACTCAACCCGACCTCCACCACATCACCCTCGACGACTCCACCACCGG

CTGGGCCACCAACCGCACCGACGACACCGACACCGGCGTCTGCTACGACACCAGCACCCACAACTGGCA

GATCTGCTGACAGCATAACGGGCCTGCCCTTGAAGGGTTGGACTCTGCACCCATTTCAGCCGGGTACGTT

GCCGGCTGGGCGAAGGAAGCAGACGGCGCCGCGATTGAAGCTGCCGCCGAGCACGTCGCGAAGACCTCC

CACGCGATTGCCGAGGCGTTGCAGCTCACCGCACAGTGAGCCCCACGGGGCGACCGGCTCACCCCGGTC

GCCCCTCACCCCCCGACAGGGGAACCGTTCCCGCCGCCTGAATCTCCATACCCCTGATACGTACTACGCG

GGGTCGAGGAGTGGACTCCCCCACCCTCGTGTAGTACACTATACTACACAGTCATTGAGGATAGAGGTGA

CGTCATGAGTTTTTCGATCCGTTTAACCGACCATGAGCGCCGCTTAGCTGATTCCTACGCCCGCCTGCACT

CGCAGTCCCTGAGTGAGGCTTTCAAGCAAGCCCTCTTCGACCGCATCGCCGACGAGTTCGATCTGCAAGT

AGCCCGTGAGGCACTCACCGACTACGCCCGCGACAACTACCAGTCTCGCCCCATCAGCGAGCTATGGGAC

GAGTGTGACCTATGAGCTGGCAGATCGAAACCACGAGCCGGTTCGATAAAGAATTCAAAAAGCTAGACC

GCTACACCCAAAAACTCATTCACGGCTGGATCACGAAAAACATCGACAACACCGACGATCCCCGCCGCC

ACGGCAAGCCCCTCACCGGTGATCTTTCCGGACTGTGGCGCTACCGCATCGGCGACTACCGCCTCATCTG

CACACTCAACGATAACCGCCTCACCATCCTCGCCCTGTCCATCGGTCACCGCCGCGACATCTACCGATAA

GCCGTTGCAAGACTGCGGCGTCGACACCGCCGGGACCCTGGCCCAGGCCTTGGGCCTGGAGGAGGACGA

GAGCGAGGAGCACGCCGCCTGAGCGGTCGCCGGCACTTCCCATAACAGCACCGGTCCCGGCGGCCCGGC

CCCGCGTCTGGTGCTCGGACCGATGCCGGCGCCTGGCCTCCGACGCCCGCCGGGGCCAGCGGCTGGGCTA

CCTCGACGTCGACGTACAACGGGCCGAACGAACCGTGCGCTGATTTACCACCGCTTCCGCACAGAGAACA

TGCCTCTGACTAGGAGAAATGACGTTTTCCACAGGGCCTCTATTACTAATATCCCTATTATCTCTATCCAC

GCGCGCGAGCCTCAGCGTTCAAGCTTCAGGTCTTGCTCGTCTCCCTCGCGCCTCGCTGCGCTCGTTGCTAC

TGCCGCCCCACCCGGCAAGCCGGGTGGGTTGCCATCGGAATACCGTGGACCATCCCGGCGCATACACCCA

GACGGTCCAAGATCCAATCCACGCTCACCCGCGACGCCGCTAACGATCCTCATACACCGTAGATGCCGTT

CTGAGAGCCTTCCAGACCCGCACGTGGGTTTATTGCACCGAGACCCAAATCCCCTCAGAAGCGATCCTGA

AACCGTCTACGCCCCATTTCCGACGGACGCTGGACAGGCTGGGCGGCTTGTCTCCCGCCGCAGACATGGC

CCTGGCATATGCGGTTGCCGACTGGTGGGATCAGGGATTGGATCACACGGCAGACGGCTGGTCCAAGGC

GGGTGTGCAGGTGCGGTGAGCGGCAGACGTGACCGGTGGGGTGCACTGTCATGGCCGGGCATCTGCCGA

GCCACCATGCGGGCCCTGGACCAGGAGGCAGCCCGCTGCGAGGACTGGGGGAAGACGGCGGCACGGAT

GGGCCGTCGGGATGCGGCGGCCGAATTCACCGAGACTGCGGTGCAGCATCGTGGACAGATGCACCACCT

CATGTCGGCACAAAAAGTGTGGGTGTCGACCGACATGGTGTCGGCTACACTGGACGCCGCAGGAGACGT

GCCGAGTTTCGAGGCCGTCGACGTCCCTGCCGCCGGGCTCATGGGTTTGGCCAGCCCCCTGCCGCCGGTT

ACCCTGCAGCATCCGCTGTATCTGCGCAGCGACGAGGGTGTGACAACCTTCACTGATCCGGTTCTCGTCG

ACGCGCTGGGATGGTGGATGGATTCTGGGCGTGTGCACGTGGTGATGTGCACACGCACACCCCGGCTGCC

CAACCCGGTTTATGCGGTGGCCTCCCCACTGACGGTGGTGGAGAAAATCACGGTGCCCACCGGCATCGAG

TTCGAGACCATGGAGTCCAGGATCCTGACCCCCGGCGGCGTGACAGGCGTCTCACGGCAGGGCACACGC ATGATGATCCGGTTGGCGTCATGGCTGGGTGCCGCGTGGGTGCTCATGGCGACTCCGACGGTGTCGGAGC

CGCACCCTATGGATGGCCGGTGGGGAGGCCCAGCAACGGGGCAGACCCGGCCGCGTGATCGGGTGACCG

TGGTCGACATGCGGCCCATGAGGCAGGTGCACACCACCACCGACCCCACCGGCAGGCGGTTGACGACCC

GGCATGTCGTGCGAGGACACTGGACACACCAACCCTACGGCCCGGCCCGCAGTCTCCGACGCCTGCAGT

GGGTCGCCCCATTCATCCGCGGCCCCGAAGGGGCTCCGTTCGTCGGCACCGACACCGTCACCGTATGGCG

CCGCTAGATACGCGGGCGCGGGGGGTTGACGAACGATGCCCCCCTCTTTGTGTTGTGATCAGTCGTGATC

GGCGGGTTTTAGGTCGGGGTAGGTGTCGAGAATGGCCTTGAGGACGAGGTCTTGGATTGTGGTGTCATTC

TGGGCTGCCTTGACCTTCAGTCCAACGCCGATGTCCCGGGGGATTCTGGTCTGCAACTTGAACAGGTCTG

CCTCCTTGGTTTTGAACAGTTTGGCTGCAGGGTTGGCAACGGGCTGTTCTTGGCGCTGGCGTCCAAGGTTG

CTTTTCTTTCGGGCGGTCATGACATCATCTCCAACAGTTCGTCGGCAACATCGGCGAAGAAGGCGATAGT

TTCCGGCTCAGGGGTACAGCCGTAGGCGCGCTTGATGACTTGACGCTTGGGGATGACGTGATCGACCAAC

TGCGTCTGGGAGTCGTTGGCTAGAAGGTCGCGACCTTCCTTGAACAGGGAGGTATTCGGTTCAGCTTTGG

AAAGCAGCACCACGCGCGGGGTTCCTGCGGCGGCGTCGTGCGTCTCCCAGGTGCGCGCCATGTCGAGCCC

GGACGTGTCGGTGGGGATGATAACCAGATCGGCGGCGCGAATGGCGGCGGTGATGATGTCACCGTTGCC

CGGCGGGGTGTCAATGATGACAACTTCTTCGGGTCCGGCGACGAGGTGCTGGAGCGTCGCCTTGTTGGCC

GGTTCCACGGGGAACCCCAAGGGGTCGGCGTTACTCAGTGTGCACTCGGCCCAGGATGATGCTGACCCTT

GAGGGTCGGCATCTTTGACGCGGACCATACGGCCCGTCTCATGGAGAGCTGCAGCCAGCAGGATCGCTGC

CGTGGTCTTACCGACGCCACCCTTGGCGTTGATAATGCTCCAGATCATGGTGACACCTTTCAGTGAGGAT

GCATATCAGTTTACCTGCAAGGAGTAAAGACGGCAAGCAGTTATGCCGTTTCTGCGGCAAGCCGTCTTGC

ATCCTTGGATGTATAGATAGTTGTCTACTTATGGTTGTGGATCGTGGTGTCTCGTACCAGGATTTAGTGTG

CTCGCTGATATGCACGACTTTCGGGCGGCCTGATCTGGCGGTGGTGCCACTAACCCAGGAGTCTGATCCG

CAAGGTGTCCTCGACTTTGAGGAAGGGGTCTCTGCTTTCGTGTTGACCTAAAGTCAACGGCCCTGGGCGA

TCACTGAATCCTAATAACTTTGTATCCTTCCCTGATTGCATCTTAGCATCCTTGAATTCAAACAGGGATGG

AGCCATGCTGTTTTGACGACATGGATGCACTGGGGTTTGGTTGTTGCCGATGCGGAGCGTCAGGCGGCCC

GGGACGCCGCCACCGCCGACACGCTGCGGGAGATCGTGGGACTGCTGGGCCGGGGCGGCGAGGTCCCGC

CCGCCAAGACGGGGCGTAAGACGACCGGCAGGCCGGCCCCGGCCCGCAAGTCGTCGGCCACGCAGTAAA

GGCAGGGATCCGTCCCTACGCAGAGAGCGGAGGCAGATCCTGGGGGATCCGACTCTTCGGTTCCGTGATC

TTCCCGGAGATCTTCCCGGATCCCCCAGGGCTCATCCTGATACGGGGTCCGCCGACGGACCCCGTATCAG

TGGGGGCGCTGCCACCAGTGATGGCGGGCGGGTCGGTCGGCGTCTAGGCCCCGCCCGATGGTCGCCTGGT

CTACCTCGCAGGCCCGTGCTGTTGCCGAGGCCGAGAACGTCTGCCCACTTGTTGCCGATTCAGTCCCCTCT

CCGTCTGCCATGTCGCCAACCTTTCCTATCTGGCGTGCTCATGGACATGCCCGGGCACGCCCTCGCTGCTC

AGAGGCCTGCTCGTTCCACCTCTGGCCGCGAACCGTATTTCTGCTGACCACTCCTCGTGCGTGAATATTTG

CCAGCCTTGGCCATTCATATTTGGACTACTCTGCACCAGATATCGGACTGGGAAACCTCTTGCACATCTCT

AATTGTCATCTATTCGTTGGGCGCGCGCTGTTAGATCGTGATCATACCAATCAGAAGACAAAGCGACGCC

CTTTTGAGCGGCTTTTCGAACGATTCTAGACCGCGCTATATCAGCATTTCTACCGCGCGGCCAGAGTGCTA

CACTAAATTCCTCTCTGCAATCCTTAAGTCCATTCTTTACTTCCTCATCCAATTTCTGCGACAGCATTTTTA

TGGAAGCATCGCACTCTGACTCATCATCAAATGCCTCAATTGCGTGCGTTCGCCATTCACGGCGCGTATTA

TCGTAGCCGTAATGAAGTATTACCCACCGATCCACAGAATCATCGTTAGGATCTACAACTGTCATGAATG

GCCCAACTCTCGCTCTGGTGTATTCTCAATTGCAGTTCAGTGACTTTACTTGACCAGTCCCGGATTTAGTA

GACGTAGACGGAGAGTACCCCGCCGGGAACTTGACTGACATCACTGCTGTACCGTACTGCTTTCCCGGGT

GGCAACCATCGTAAGCAGCATTTGCCGTGACGTACCTAGTGCTCTTTCTCTGAGTGCCGGTAATCGCCTTA

TATGGTACAGGTGGGTGAATCGTAGCCGTTACGGCTACCGATGACACGTTTGCATCACATGAAGCTGTGG

CGACATAATTAGTTGTCCCATTGACATGATGAGAGTCGTGGACATACTGTCGAGGATCGAGAGTGCAGGT

TATTGTTGACGCCGTTGTTCTGGTACCAGCTGCTTTCGAGCTCTTTGTTGCAGTTACAGTCTGCGGCCCTG

AAGGTTTTACTGACGCGACTGATGTGTTCGCGTGTTTTGCGGCAGTGCTTTGATTTGGTTGTGCTTGTGTA

GCAGTTGCTGATGTCGCCAGTGATGCCCCCATTACCATAGCTGTGATTATGGCGTAGTCTTTACGCTTCAT

TGCGCCCCCAAATAAGCATGTTAGTTTGCTATTTTGAATAGGAAACGAGACATCGCCATGACTTGTCAAG

GGCAGAAGTAGAAAGAATCGGGGGGTATCAAGAAAGATGTGCTTTCATCAGGACGAAAGCGGATGGGTC

CGTTCGACTTGGTGACGAATGATCCGGCCTTGCGTCGCGGAGACCAGGCCGGCGAGTTTGTCGAGCAGGG

CCGCCGTGGCCTCATCGTCGGGCACATCACTAAAGGGACGAACAACCATGACGGCTAGGGCCAGAAACG

ACCGGAACTGAATCGCATGTGGACCCCCATCTGGCACCAGGCACACACCTACCGACCGGAAACCCTGCA

CCCTGTCGCTCCCAGTTCACCTCCTAATATGCGCCTATAGTCTGTGCTAGTAGACATTATTTTGTGTGTTGT

TTCCCATCTGGCATGTCTGGCCCCGGACCCGCCGCGACACGCGGTGGTGGATAACAGACCAGGACCCCCG

GACCATAGAGACCAGGGGGACGAGACAGTCCCCCGGTGAGGATGTCTCGATGTGCAGATCAGGAACAGA

ATCGCCGGGCACGACCCGGCGCCGGTGCCGGTGCAGTGAACCCGTGGCCCATCGACTCCACGAACGAAC

GTCTCGCCTTCCTCAACTGGTGTTGGCGGCAAGGCTACTCAGCAGCCATCGTGGAAACGATGGACGCCGC

GGGAGCCTACGACCACCTCGACGACGACCAGACCAGCAACCAGCACGACTAACGCCGCTCCCAGCACGG

GGGAAGGCGGCGCACCAGGTGCGCCGCCTTCCCCCGTGCTGGTGTCTCGTCGGCTTACTGGTGGGGGTCG

TAGGGGAACCCGTAGGTGTGTTCCAGGGCCTTGCGGAGAAGGTCGTTCATAGTTGTGTGTTCGGCGACGG

CCTTCATCTTCAGCGCCGTGTGGGTGGCGGTGGGTAGCTTGACGTTGAACGCGGTGATCGGGGTCTTGGC

CGACTGGAAGGTTTCAGAGACACTGGCTCCCTGGCTGGCCGCCATTTGGTCGGCGTAACGGCTGGCTTTG

TCGGCGGCGGTGGGTTTGCGGTTCTTACTCACTTCAGCATCTCCTTGATTCGGTCGGCAACCTGGGCGAAC TCTCCTAGATCTGTTGGCCGGGTTCCGATGGCTTGCCGATAGGCGACCCGTCGATGAACCTCCGCATCGA

GAACGTCTAGGCCCTCAACGGCGGCGGCCCCCTCGTGGGCATCACGGTATTGCCTGGTCCAATCGGCTTT

GTTGAAGAGCAGGGCCCGGCGTGTGCCGTGGGCCACCTGGTAGGTCATTAGCGCTCGGTCCATGTCCAGG

TCCCCCGACTCGGTCGGGATGATGACCACATCGGCGATGTCGAGGGCTGCGGTGATCGTCTGAGAGTCAC

CGGGGGGAGTGTCGATGATGACAAGGTCGGCGTCGATGTCACGGCAGCGCCTGACGATAGGGGCATTAG

CCGGGCGGACCTCGAAGCCCAGCGGGTCACCAGTCTCGAAAGCGTCGGTAGCCCATGACGTCGCCGATC

CTTGCGGGTCGGCGTCAAGCAAGATGACTCGGTACTGAGCTGCTAAGGCCGTTGCCAGGTAGACCGCCGT

GGTCGTTTTCCCGACCCCGCCCTTGGTGTTGACAATAGAAATACTACGCATAAATACATCATTACACATGT

GCATCGATGTATCTGTATATATGTGTATCGGCGTGTTGTGAGGGAAAACCCGGGCCACATACAACGATCC

CCCAGCCACCACAGCCGGGGGATCTCTCAGTAAAGCCAGCAACTCCCACAGAAGTTGCACCCCCACGAT

ACCCACCACATCCGTGTCAAGCCCCCACAACACCCACCAGCGCCCTAGGCTTCCCCCATGAACATTGACA

TGGACACACCAACCGAAACCGAAGCCGACACCTTCGATGCCGTCCTCGCCGACATTAACCACATCAACCG

CCTCACCGCCGACGAAATCGAGTGCTACTCCATGGGAGCCTGTCTCCTCCTCCTCAACCACCACCCCTTCT

CCGAACTCCGCCAACACTGGGCCGACAACCCCACCGACGAAACCACGTGGACCCTCTACGGGGCCATCA

TCGCCGCCTCCACCCTGGACCCCCACCTCAGCATCGACGCCCTAGCCCGCCTCTACCAGCTCCCCCTCGAC

CTCGTGACCCAAGCCCTCACCGTCTAAGCGTCGATGAGCGGGGGAGAGGTAGCGCACTATCGGCTAAGG

AACCCCACAAACACCAAACCCTTGTCACTGGGAAGGGTTTGGTGTTATGCTGGTCTCACAACTCAACAGA

GGAGGTGAGACATGGGAAATGAGTACCAGAAGTCGCTCAAAGTCCTGTTCAAGAAACTGGAATCTGAGC

AAGGAGCCCGCATCGAGACCCGGCGCAAAGGATGGATGATCTACCCGCCGGATACGTCACGATCAGCGG

TCATGATCCACAAGACTCCATCAGATCGCAGAGCATGGGCCAACATGCTTTCCGAACTGAGACGCTCAGG

ATTCACCGTCTAACTCAGTGAAGGGGGCTGGAGCTCCAGCCCCCTTTCAACCACCTCCCCCGGACACCAC

ACAAGAAAAGGAGAACATGATGTGGCACGTTCGGTTGTCGCTTCGCGCAATCAGCGAGGACATGCTGTTC

GACGCCCTGGACACCCTCGACCCCTTATCCCCGGTGGCCACACTGGGCCCCGATGAGCACACCGGATCAT

TGGCGGTGTTCGTCGAGGCTGACTCACTGACAGACGCCATCGAGACTGCCCGCACAGCCATCACCAACGC

ATGCAACACCGCCACCATAACCGGCGTAGAAGCCCGCCCCGAAGACGAATGCTTCGCAGACGTTGACCG

GCCCCTGTTCCCGCCAGTGGTCGGATACACCGAAATCGCTGAAACCGCAGGACTCTCACGTCAGCGCATC

CGCCAGCTCGCAGGCACCGCCGGGTTCCCCGCACCTGTCATCAAGACCGCGGCCGGCCCGCTGTTTCCCA

AAGCCGCCGCCGAGCAGTGGGCGCGGACACGCCAGCCTAAGGCAGGCCGCCCAAAACTCCAGACCACCA

CCTCATAACACATCCCGTGTGCTGAACCTGTTGGCCGGCCCAGCACACACCCCCAGGGGCCGGGCCCAGC

CCGGCCCCGCCCCACACCCAACCGCCCCCTGTTGCCGCCGTGGCGAAACGATCAGGCGAGCCACGACCAT

CGCCAAGCTGAATGGAGAGCGAGCATGAGCACCACCCCTGCCGGGTTCGACTTCGACGCTCTGGCCGAGT

GGGCCGAGAGCGATGAGGCGACCCACACCCCGCAAACCAGCCCCGTGTTCCGGGGCAAGGACGCCGCGC

GCGCCAGCCGCGCATTCCTCGGCCGAGGACGGCCCACCCTCGGCTCAGACCACGCCACCGGCGAGGGCC

GGTCGCCCCGCCGTCAGGTACGGCTCGACGCACGCACCAACGCGCGACTCGACGCCTACGCAGCCGCAA

CCGGCACCAGCGCCTCCCAGATCATCCGCGACGCCCTCGCTGACTACCTGCCCGCCTGATCCCACCCCAA

TCCACTCGGGCGCCTGTCAGTGCCCCCTCTTCTGGGTGGTGGTCCGGGGCGTCACCGCCCCGGACCAGTT

GGGTAGTCATCTCAGTTGAAATAAGCGATTAGTGATACGCCCCTCATGCTTTCCGGTGCTGTCATGAGCGT

CTGACAACAGCGACACCTCGGGGCAGCCGACGGACAGTCCTCTGGCTGCCGCTCTGATCCCATGCCCACG

GCACGAAGGTGTCGGACAGCTCGGTCTCGTCATGTGCCCAAATAGCGTCGTGGGCCTGTCGCCAAGCTTC

TCGGGAGCCCCACACGGGCACGACCGGGCCACACCGGTGTCCTGGTCTCCAGTGTCGCGACACTGTCGAT

TTCGGTACGTGCAATGCGGCGGCGGTTTGACGGATCGACATCCCAGACTCCCGCGCGTCCCAGATCGCCA

TGTGGAGAGTATTTGCCTCCAGTGCGGCCGCCACACTTGCACGCTCTCGCGCACGCTCGAATGCCCGCCT

AGTGCTCTCAAATGTCGTCACGACGCCTCCCCCTGAAAATACTCAGGGTGTCCCACGGTGGGACACCCTG

AGTATTTCATACCCCAACTCGCCTCACCACACGTCGACCTCGACACCGATCAAGCGACCCGTATCAGCGA

CATTGCCGTACCGCTGCCCCGCCTGGTCCTCCAGCCACGACAACGCATCCCGAAACAGCCCGACGTCTTC

CAAAGCTAAACCACAGTCGTAGCCGCCCTTGTCCCCCAACCGCACAATCTGGCGCTCCCGGTGGCCTCCC

TCGTCGACCTCGATCCACAGTTTCGCGTGCATCCGCTGGCCTCGGCCCTCTGACAGGATCTCGGTGAGCA

GGTCGGACGCCTGCCCTCGCGCATCCTCGTTACTGCGGGGGAATTGGAGTATGTGGGAGGAACGGTGGTG

GGGCAGGTTTGTGACCTCGTGACGCAGCAGGTTGCGCTTGTGCATCTGCCGTTCGAGACGCTCGGGCTGA

CCTGTTGACGGGGTTGAGCCGTGGCGCCGCTTCCTCGGCGGGGTCTCGATCCGTTGCTCTTCCGGCGGTTC

GGCGTCAGGTTGTGGTGCGCGATCTCCCCTAGGACGGGGGGGCTCGCCACCTATATCCGAGGGACGATGA

GACGGCCTTCCACGCTTGCTGCGCACTTTCGCAGCCCGCCCCTTGCGGTCACATCGACGCGGCGGCGGAG

TGACGTCCTCACCGCGCGCTAACTGCGTCAACGCCGCCACCAGGTTGGTGCCCGGTTTCAGCCCTTTCAGC

ACGAACCGCACCAGGCGGGGGTCTCGGCCGATTCGTCGGGCAATCTCGGCTTGGCTCCACCCTTCGGCTA

ACAGGGTGCGCAACAAGTCTTGGGCCCGGTTATCACGCTCAGTCACTGGTCGCCTCCTCGGGGAGTCCTG

CCTGCTCGGCCTGCTCTGATAGAGCAGCCCGTTCCGATCCGGTCTGGGGCGCTTTCAGGGGACCGGGTAG

GACACCTTTGACACGCAGTCGCCCGTCCTTGCCGTCGTCGCCGCCCCCCTGGGCCACAGGGAGCGCCCAG

GGGGGCACGTTGCTGGTGTAGATGGCGTCGCCGTGGATAGCCAGCAGGGTGCGGGAGTTCATGCGTAGT

GCTCCTCCCTTGGTTGTGGCGTTTTTTCCGGTGGTGGGGTCGGCGATGGGTGTGTTGAGGGTGCGTACGCG

GGACAGGGCCCAGATACGGGCGGCGATTTCGGGGTGCCAGGTGTCGGGGTCGGGGCGGCGGCGGGCGGT

TTGGTATTGGTAGGCGATGGTGTCACCGGTTTTGTTGCGGATGACGTCGAAGCCTTCGATGTCGGAGGGG

ATGTCGTCGGCGTCGTAGACGACGGTGGTGGTGACGGGGTTGGAGGCCGACATTTGGCCGATGGTCACGC GCAGCATGTTTTTCAACGCGGAGGTGAGGATTGTCGTGGCGGTGGGGTTCTTGTCTGCCCAGCGTTTCTCG

GCGATGTCGATCATGTCTTGGATGGTTTTGACCCATCCTCGGATGGGATCGACTTTGGTCAGTTTGATCCC

TCCAAGGAACTCGATGGGCTTAGTAACGGGCCCGTCAGGACCGAATTCGGTGTCCCAGCCTTCGTCGATG

GCTAGTTTCAGTTCGGCGGCGTCAACCCATGTTTCGTGGGTGGTGCCGGGCACGTTGGGCCAAAACCATC

CTGCTCGTCCTTTGGTGCGTTTGACCGGTAGTAGGCCGATGTCGTCCCACCAGGATGGCACGGTGAAGCG

GATGTGGTAGCGGGCCGGGTGCCAGGGGTTGTTGGTGAACAGGTCGTGAGCTTCGGTGGCGCTGAGCAG

AGTGGCGGGTGCGGCACCGATCTCTCCGGTCACTGATCCGGCATACATGAATCGGCCGTCGATGTACACG

AAGTTAGGGATAGGGCCGGCAGGCACGGTGGGGCGCCAACCTTGTTCGCGGTCCTCGGGGTTGCCGTCGT

CGACGCATAGTTCGTAGCGGTGCTGAGGGGAGGTGTGTTGGATGAGTGCGCCCAGTTCGGGGTCCATCGG

CTCCATGCGATAGGACTCGGGGGTCCGTAGCTTCCAGAGGTTGATTCCTTCTGCTCCGGGGCGGTCCATG

AGGGCCCAGTCGCGGTCGATTCTGGTGGCGATGATGTGGGTTAATTCGCGCCATGCCCAGCGGGCCTGGA

TTGGGGTGAGGGTCTGGCCAGGGAACCATTCATCAGCGACCAGAATGTCGAGGTTGCGGTCGGTTTCTTT

GTGGGTGAACCGGCCTCGGGCGGGCCGCCCGGACAGCATGAACAGGCCCCGCACGTGCCAGTCCTGGTT

GAACTCGCGGGTGTGAGCGGGGGTGTCAGGCAGCAGCCAGGATTGAGGCTGGTCGGGGATGTTACCGCA

GACGATCAGGCGTCGGGCGTTGTGGTGTAGCGCGGTTGTTAGCAGGTCTGACAGGGTCGCGTGCTTGGTG

CGCCGCCCCCCTAGCACTGGCAGGATCTCGTTTCCGGCCGCGTCGACTCCCCGGGCGGTGTCGATGTCTA

GCCACACTGTTTCGGGGTCGGGGGGCCGATGTGGGGCGGGACGGCGCTGCTCCTGGTCGTCTCTCATGGT

TTCCTCCTTTGGGCCAGGGAGCGGCCGGCGTCGAGGGCGTTCATGCGCTCGCGTTGTTCTTCGCGTAGTTG

GTAGACCCGGCCTCGTGACACTCCTGCTGCCTCGGCGATGGTGGTGGCCGGCAGGTGGCCGATGGCGGCA

GCGTCGGCAAGGACGTCACGCCAGGCCAGGTCAATGGTTCCCAGCTGGGCTAGAGCTTCGTCGCGGCGG

CGGGTGGCATCAGCCACTACGGAGGCCCACCCTGTGGGGTGGATGGTCTTGACGACGATTCGGTTGTGGC

GGATGGGGCCCCATGCATCAGCGGGGACTTGCCAGCCGTGATTGGCGGCGGACTCGGTGATCTTGAGGC

GTCGCTCAGGTGCGCGGGTGCGGGCAGTGACGTCGGTGTTCCAGGTCTGGACTGGTACCCACGTCCCCTC

TCGGATGCGTTCGATGACGCACGTGGTGACCTCGTCGGTGACTGTGATGACCAGACGATAATCTTTCCCG

TCTGGGGTGGTTCGGTAGCTGGGCATGTCACCCTCCCCTATCTGTCAAATGAGCTAGACACAGTGTCTATT

TAATTTGACGCAAAGTCAAGTGCATTAGACGCCTTTGTGTGGATCCGCCCCACCAGACAAACACTCGCGC

CTCATGACCCGCCGCGAAGCCTTAACGAAACCAAACCGCTTATAGAACCGCTCCGCAGCGCTCCCCGAGG

GCTTTAGCTCCAAGGTAAGACCTTGCTCGTCGGCCCATTGGCAGACTTGTGTGAGGATCTGTGAGCCGTA

GCCCTGATTTCGGGGGGCGGCATGCACGCACATCAGCATGTGACCATGACGGCGGGTCGGCGGGCTGAC

ATAAGCCCCACCACGCCAGTCCGGTGTGATCTGCCAACTTCGCCATGCCGCAGCGCGCCAGCGGCGGGCC

TCGGTAGCCACCATGATCACCATGATGATGGACAGGGTTACGACGCCGACTATGGTCAGCTCACTCCAGC

CAGGCCAGTTCCCGGAGATGATCCAGCCTCCCAGCGCCCAGATGATCATGGCTTCCACGCCCGCCGCAAT

CGGGACGAGTGGGGCAGTACGGATGCGGCCTGCCATGATCTCGGTGATCTCGCTGCGATGCCATGACAA

GGAGAATTCCCACGACTCTTGAATCATGCTGATGTGTGAACGGCTTCCTCGGCTTCGCCCTGCCATAGCTT

CTCTAGACGGCGCTCGGCTAGCTCGTCGGGGCACGGCGACAGCCTGCCGCACTCGGAGCAGACCCCGAA

GTGGCGCGAGAGAGTGATGACCGGCTCATCGGGAGCATGAACCGATTCAACGACCGGGTGCTGCTCATC

GGTGAGTCCTGAGGCGTGACCAATCTCGGCTAGACGGAGGTGAACCATACCGTCGTAGTAGTCGAGGCCT

TCAACGTGGAACGGGTAGGAGCCGTCCGCGGTGTGGCCTGCAACCAGGTCCCCGACTTCCAGCTGACTGG

CGGTCATGGTTCGCACCGGCGGCAGCGGGGTCCGGGTCGCGTTGATCCTCATGGTCTCTCCTTGCTTCTGC

GCCTTCATAGATGAAGGTGCCACAGCCGGGGTTGATGTGCGGAACCACAGCCACTTTTTCAATAAATCCA

TCACCACGGTCTCACCCCTTCCCAAATGTGTAAACCGTGGTTTACGCTTTAAGGCATGATCGAACACACA

CCGACACCCGCCGCGCCTCGCGTGGCCATCATTTCCCCTAGCGGGCCACCACGGTTCTTGGCCGAGCCTC

CCAGCGCCGCGCTGCGACGCCATGGTCGGACCCGCATGAGGTCCCTTCCCCTATCCCCTCACATTCGCGC

CTGGGTCTCCACCAGCGGCCGTAAACCCAATCCCATAGCCACCGCCCTGATCTGGATGCATACCGGAGCC

CTGCTGCCGGTGTGGGACACCGCCGTTTTGACTGGGCCTGCCCTCGGCAGACGTGTGCGCCCTCTCAGCA

GTGACGCCGAACTGACCTCTCGGCGGTGGCTCGACCAGGTTGCCGACCATCCCGGCTTTCTCGACACCCT

TATCGAGGCCGCCCGCATCACCGATGGATGGCATCACGCGACGCCTCCGCACATTCAGGCCCCTTACCGG

ACCCTTCATCAGTGAACGGAGGTACAACGACATGACCAGCGACATTGACATTGACCGGACCCACAAACC

CGACGACCGCGCCGAGGCTCCTCTTTACCGGTCCTGGGCCAGGAGACTCGTGCACGTCTCCGGGATGCCC

TGGCGTATCGTCGCCGCCTTGGCCGGGGTCTCCCCCACCTCCATGCACCGGCTTCTATTCGGCCGCAACGG

TCGACCCGTGGAATGGATCGGCATCAATGATGCTCGCGCCCTGATGGATATCGGCATCGATGATCTCGCC

TCAGCGTCCACCGACCGTATCCCGGCCCGCGAATCCCGCGAGCTGTTGGTAGCCCTGCACACCCTCGGCT

GGACCGATGAGCATCTAAGCCGCTGGCTGACCAGTTCCGACCTCGACCTGACCACCGCCCCCAAAGCCCT

CTACGTCACTCGACTATCCGCCGCCCGCATCCAGGCCACCTACGACATGCTCATCAGCCAGCCCGTCCGC

CGCTGCGGCCACCCCCGCACCCCGCCCGTCTCGTCCCCGACCCCTGCTGTCCTACCCCAGCCCAGACCCA

ACAACACCGAACCGTTCCAACCCGCCCTGTTCGAGCTGGCCGACTGCGCATGAGGACCCTGCACAGACGT

GATTAAATCGAAGGGCTCAACCAGTCATCAGGAGTCCCCCGTGCGTTTGTACCGCGCTGTTCTCGCCGAC

ACCGACATCCATATCACCATCCGTATCTGGAACACTACCGATCGTGACTGGACCTGGGCCCCCCTTGACA

CTTGGGCCCCCGACCCGGCCCCGACCACACCAGCCCAGTTAGCCGATGAACTTCACCGTCACGGATGGAT

CACCCCTGAGGTCCCTACTACCCTCACCGAGGTGGCTGTCATCCCCGAGAACTGGCAAGCTTTCGTCGAG

CATGCCCTCGCTGTCCGGAACCAGCAGGCTGACCAATTGCGCGTCGCCGAGAACATCCTCACCGACATCC

TCGGCGACGCCGCCGACGCCGGCCTGTCTGTCACCGCTCTCGCCCGCACGACCGGACTATCCCGAGTCGC CGTCTACAAACGCAGCGCCAAAACCATCGACTCCATGAGACACGCCACCCAGGCCGGCGGAATCCTCAC

CCCCTCCTGTCTCACCCACGCTGAGAGAACAGCGCTCGGCCTGCCCGACGAGTAACCCATCGTTTACATC

CTCGACTGGTCCCTGCGACCAGTGAACCGTGCCCCCACTGCGCCCACAATGATCAGCACACCCACGGCGA

TCATCAGGTGGGCAGCACTAACTGATCCCAACGAACCAAGATCAAACAAGCCCTGCCCGGGAGCGTCGA

GCAGTCCGTGGGCGCGAAGCCATGCTCCGAGATTGCCAATGATCTTGGGGATCATCTTGTTCAGTAGGGC

TATCCCTCCGATGCCGACAACGAGGAAGACGAGGATTTCTTCGCCTGCGTTGTTTCTTCCTGTGTTTGCGG

TCATGCTGCCTTCTCGGGGTGGATGGCCAGCCAGCTGATGAGGTTGTCGGTGATCTGCCCTGAGATTTGG

ATCAGTTCGACTTGCCCGGCCTGCCATGCCCGCGATGTGCCGGCCAGCAATGATGCTGGGACCCCTACTG

CGCGGCCACGGGATGCAACCTCAGCCAAGGCGGCGCGTAACTCCTCGACGGTGCTTTCGATGTACCAACT

GCCGTCAGTACTAGTCTCAGCGGCATCGGTGGTAGCGATAAGAGCATCGGTGAGGTCGTCGACGGCGCG

GTCCAGATCAGCGATGTCCGGTAGGGCTACAGGAGTCATGGTGTGTCTTCCTTCTAGGGTGCCTTCACTG

GTGAAGGGTCCCTAGCCCCGGCCGATGTGCGGTGCTGTGGGAAAAATGCTTCCCATTGGTCCGTCTTAGT

TAGGAAACTTGGCCTAAGTGCTGTCGAGGGTCGCGTGTTCGTGACCGGTTCGAAGACACTGCCGCCTTGT

CTTCTTGCCCGTGGCGCTTCCGAGATGGTCAGTGGGCGATGGCTAGGCCGATGAGGGCGCCGCTGCACAG

GCTGGGCGCCCAGGGAAGGAATCGGGTGGTGTGGTGTCGGAACCGGTCGATTAGGGCATATAGGGCGAT

CAGGGTGAGGCCGGCTATGACAGTGACCTGGATCGTGTCGATGCCGGTTGCTGCGGCCGGGGCTGCCCAC

AGTGGTGTGATGCGCACATCAGAGAAACCGAATCCGCCTCGGGAGATGAGCCAGGCGATCATCCACGCT

GCGAAGATGATGGCGGTAGCGATGACAGCACGTATCGCCGCAGTATGGTCCGAGAGGGCGGTAACGACT

ACAGCCCCGATCCATCCGGCCCATCCGGTCCACGCTAGGACTGCCGGTATCCATGTGGTGATGGCGTCAA

TGACGGCAACCCATGCCCCGATGGTGGCTAGCAGAGCCCAGGCCGGCCAGGTGGGTGCTGGGGCCCACG

CTACGGCGGCGATCATGGTTGTCGCAGATGCAGCACAGACAGCGATCAAGCTTCGGAGGCTGTAGGTGTC

GCGGTAGACGATCTTGTCGGGATTGGCGGTAGCTGGTTCTGGCAGGACGCGGGTGAGGGCAGGCCATCCT

GCGACCGCAATAGCCGCGACGGCGACCACCCACACAATCTGTTGCATGGGTCTCATCATGGCCCATCATC

GATGAGTATGGGTGGCCGACATGGGGTCACTCGTAGAGGGGATCGAGGGGTGTGCGGGCGAGCATGGCT

TCCTGTGTGCCGAGCATGAGGGTGCCAGAATCCTCGCCAGCCGATTCCCAGTCGACGATGACCTGGTCGC

CGTCAACGCTGGATTCGGCGATGGTCACCCATTCTCCGTCGATATTGATGAGCACCCCAGCGGCCAGCTC

CGTGGCAGCAACCGGGTGAGGTGGGTTGTAGAAGCGGTCGATGTCGCAGGCAGGGTCGTCGGGTTCCTC

GACTACCGGAGGTGGGGTCGATCTGGCTGTCTCGGTGTCGTCGGCCAGGTCGGCTCCCAGGATGCGCTCC

CATTCGGGGCTGGTTTTCTTGCCCGCTGAGGCCATCGTCTCGTCGATCTGTTCGTCAGTGGGCCACACAAA

TTTCTTTTTGGTCCAGGTCGTGGTGTCGGGTCGCAGCTGATCCAGCAGTTCCAGGTCTTGCGGGGAGTGGG

CCTTGCGGGGGTCGGGGGTGTAGAAGAATTGGACTTCCTTGGGGGCTGATTCGCCGGATAGGTAGGTGCC

GCGGCCGCGTTTGCCGAACGGGATGCCCACGCCGACGTGTTCGGAGCCGAACATCATGCGGGCTCCGTCA

GCGGACAGGGGTCCGGTGGCGGCACGCCCGGAGAAGTTGTCTCGGATTTCGCCGCCCAGGAACTCGGCG

TCGGGGCGTTGGGTCCCCAGATCGACGTGGATACGGCAGGCGGCTGCCATGCGCAGCAGGGAGCCGATC

CGTAGAACTGGCGGTACTCGTCGATGAGGACCAGCACGCGGGTGAAGTCGGTCTCGCGGGCCCCTTCTTC

TTCGATGCGGCGGTAGCGGTCCTCCATGAGAGACCACAGCCAGTGGATGAGGGCGACCTGGTCGGGGAC

GGTAGTGGCGACCATCTCGATGTTGGGCCACTCCCGCAGGCCCAGGTACTCGATGCGTTTAGGGTCGATG

ACGAAGACGCGCCAGTTGCGGCGGGCACCCTCGACGGCGTCGCCGATCATGGACACCGTTTTTCCGGTAC

GGGTGCGGCCGGCCTTGAGCTGGTGGGCCATGACACCGGAGATGTCCCAGAAACAGGTGTTGCCGTCCTC

GTCGACGGCCTGGGGGATTTTCTCCCAGTCTGGGGAGTCTGGGCCCGGAAGGGCCACGGGTCGGGGCAC

CATCGAGGGCAGGGGGTGGCGGCGGGTGACGGTGATGGTGTCGTGTTCCAGGTCGAAGTCGCTGCGCCA

CTGGCCGAGCATCATCGCCGAGGTCACCGCGGCCAGGCGCAATTGGATGTTCGGGCTGGACAAATGGGC

GCCACGTTGGTGGTGAATGGTGAAGCCGTCCAGGTTCCCCCGATCGGTTTTCCAGGAATCGACGGTGACC

GCCGACCCATAGATCTGAGTGGCTACTTCTTTAGCCCGTTCCTTGTCTCGGTCCAGATCGGTTTTGTCAGG

GTCAGGGGTCGGGGCGCGGTATTGCAGGACGAACCGGCCGGCCGGGATCGTTGCGGATGTCACCGTGAA

CTCTGCCGGCGACCAGGCAGCCGCGGCCGCCTGGGTGAGGGCCATTGGCATGGTCTCGACGGCAGCCTCC

TCGGGGGGGATGGTGAGGGTCAGGCGTCGCGGATGCGTCTTCTTGCGATTCCATGTGACTTTCTGCCTCA

CCGGCACCTTCGCCGCCGACTGAATGGCTAGGCGAGCTGATTCGGCAGTTTCGGTACGCCGGCCAGCGCG

TAGCGCCCGTCGTGCGTGAAGGCTGCCCACCACAGCACAGCCCATACACGGCAGCCACGAGCGCGGATC

AGCGGCTGCTGCATAGCCCCCGGTAGCTAGTACCGCACCTGACCAGCCGGCCGCGATACTTTTCCACGCC

GGTTTCGCGCCACCAGGACCAGCGTTATGGACGGTCTGCTTCGAGGCTGCGGAGGGACGAGACAGCGGA

GTGCTGGTCATGCCGCGGCCTCCTTGTGGCAGGTCATTTCACAGGCATGCCGGCCAGCGATGATGCCGTG

GCGCACCGCCCCGGTAGCCGCATAGACCGCGCACAACTCAAACACGGGGCACCCATCGCAGGCCGCCGG

GTTCATGCTTTCTTTGTCCCACGATGGTGGGTCATCGGTGCACGGCACGGCCAGGCCATCCTGTTGAGCGG

CGCTGATAGCGGTGAATAGGCGCAGCTGGGCGCGAACTTGGTCTGGGGTCAGGTTGACGGTGCGGGCTA

CACGCATGGGGTTCCTTCCTCTTCACCAGTGAAGGTTCCCTAGACCCGGCCGATGTGCGGAGGGATTTCA

GTGTTTTATCGAGGTGACCAGCCAGCCGGTCTGCGCTGCGGGTTCAGGTACCAGGGTCAGATGCAGCATG

GTGTGGTCGGCTAGGGGCACGGCGACCAGGGGCCCGTCGGCGCTCGCCCCGGTGAGGGTGGGAGTTCCG

GCCACGGTGGTGGCGGGAATCTGGTTGGGTTTCGCGGCCATCAGGGAGCCCATGAGGGTCGGGGCGGCG

ATCTGGACGAGGGCGACTTTGCGGGCGGCGGGATCGCGGGTCAACCAGCCGCGGGTGAAGGTGAGCGCA

GCCGACGTGATATCGGGGCTCAGCGGGGCTGGTGTGGCGGCGGGGTGGGCCGTTGAGGAGGGCCATACG CGCGGTAGCGCTGGCGACATCGAGCGGGTCGGAGTGGGGTCAGGTGTGGGGCTTAGGGTCCGATGTGGC

GATGGGGCTACCGCCCCGGTGGTGGGAGACGAGACTGGTTGGGGGTGGTGTTGAGGGCGTGGGATCAGG

GTGAAGGCAGCCAAACTGGCCGGGATGAGGATGACGGCCGCGCCGACACTTCGGAGCGAGGTCATGTGA

CGATCCTTCGGTAGCTCGACGGGTTGCCGTAGATCTTTTCCACGTTGATGCCACTATGTGGGTTGTCGGCG

CTAACCATTTGGCCTCCACCGATGTAGACGGCCACGTGGTGGGCAGGGCTTCCCCAGAGGATGAGGTCGC

CGACTTTGAGCTGGTCACGGGCCACCGCGGTGCCGACTTTCTGCTGGTCGGCGGCGGTGCGGGGAAGGCT

AATGCCGATACGCCGGTACAGCGCCGAGGTCAGGCCTGAGCAGTCGTAGCCGCCATCGGCTTTGCCGTTG

CCACCCCACACGTAGGCGTAGGAGTTGTTGTCGGCGATCGATTTGGCCCATGCCACGGCTTCGGCCAGGT

TCTTCGACACACCGGTCTCGTTAGCGGCCCCGGTGGCACAGTTGTTTGACAGGTGCCCTGTAGTAGTGGA

TCCCACTATTTGTTTGGCCATGGTTTCCCATTTGGCGTAGGCATCGGGCAGGGCTGAGCCTTGCACTGCCT

GAGCTGCCTGCGTCAGCGGCATCTTCTGCCAGTCAGCGATGTCGACTAAACCGGGAATGTGGAATCCAGG

GCCGCCGGCCGATCCGGGGCCAGCGTAGGTGATGGTGTGGCCTTTCAAGAACGCCTCGGTGGCGTAGGC

ATCATTGTTGACCTGATCCAGAGTCCCGTACCAGCCCGGCAGGATGCGCTGCTGAAAGGGGCCGGCGTCA

CCGTCACCGTTAGCCTTCGCTGAGGTAGGGTCGGCCCCAAGATCTGATTCTTGTTTGGCGGTCATAATAGC

GATGACCGCTGCCTGGGTAGGCAGTTTGTCACGCTGGACCACAGTGACGATGGTGGTCACGAGCTGCTTC

TGCCTGGCCGTGAGGCCTCCGGCACCCACAGTGCCTCCGGTGACGGTACCCACGCAAGCATCCCCGCCGA

CACTGCCACCGCCGACGCCAGAGTTGTCGTCGAGGGCCCCAGAGCCTACTGACAGCAGCGGCACAATGA

TCACGGTCGCGGGCAAGACCGCCAGGCCCGCCAGCATCAGCACTGCTGCACTCACCACGGCGATCACGT

GAGATGCTTTCAACGCTGCCCACCTTTCGCTGGTTTGAGGGGGCGACGCCTGCTGGTACGCACAGGCTTG

GTTGGTCCAGTCCGCCGTTGGTTGGCAGGCCTGGGTTTGATCGGCTTGCTGGGACCCGGTTTGGGCTCCGG

AGTCTTAGGCTCCGGCTTCACATGCCTAGGCACTTCGGCTGCGGTGGGAGGAGTCAGCACGTGGCGTACC

GGCTTGGTGACCTTCTGGGCACCCGAAACAACCGGCTTAGACACCACCTTGGCACCTTTGACCACCGGTG

CGGCTGCCTTCGCGCCGGCCTTCTTGACTGCACGATGCGCTTTGATAGCCCCGGCCTCGGCCCGGCCAAC

CCTGCTAGCAGTAGCATCGAGGGCTCTGTGGCCCGTCGTTGCCCTCACCGGTGCATCCTTGCCCTGGCGG

GTCTGCTTAGCGATCGCCGACATGCCGCCTCGCAATGCCGAAACATGATTGTGGGCGTGGGCGATCGCCG

ACATGCCGGCCGTCGCGATTTTTGACTGGCCCTGCGGGGCCCCTGCCCCAGCACGAATCTGCTGGTAAGC

CGCCGACGTGCCACGAGCACCCGCCGCCATTCGCGCCACCTTCGCAGCCCTAGTCACTCCCGTCGACACG

CCACCCGTGGCTACCGCAGCAGCACCCGAGACCACAGTCGAGGCCATCCGCCTTCGACCCAATCCGGTGA

GCTTGCGACCACCGCTGCGCACCATCCGGCGAGCACCCCGCCCAGCCCACTGGCCGATCACCGAGCCCCT

TTCGGAACGCTTGCTGCGCATCCAATCGTTGATCTTGTCCCTCAGCCCCTTCTCGCCCTTGTGACGACGCC

ACATGGACATCAAGAACCCGATAATCCCCACGAGCTCGAGCATGTTGACAACCATGACCTTGATGGCGAC

ATCACCGTCAGAGGCGAAAACCGACTTGATGATGAGCATGACCACACCCAACATCACCATCGACCCGAC

AATGCCGATCATCGAGTACAAGATCGAACACAGATCCCGGATGAGCGGATCTGTGCGGCCAGGGATAGC

CCGCAACACGTTGAGCATCGACATGAACGCCGACCACACCAACTTGCACACGTAGAACCAGCACATGCC

CGCGAACACCAGCAGGACCACAGCCAAACCCGCCACCGTCGACGAGTAAAAGAAGAACCCCACCAACC

ACGAACCATCCGCAATATCGCCGGCGTAATCCGACAACCCCTCATCACAGTCACCAAGGTCGTCGCGAGC

ATCCGAGACGTCATCGTAAGGGCCACCCTTGAGCACCTCGATGTACTTGTCGTGGCACTTCGCATCAATA

ATGCGGCCATAGTTGAGCTGCTGATGAACCGGCGCCACGAACGAGTCCACAATGATCGCCGACAGCTTCG

GATCCTTCGAGTCTCCCGTCGAGGTCATGTCATCAGGAATCTCGACCTCACCAGCGGTCGCCGTCGCAGG

ATCAACCGAACTGGTAATCATATGAGACAGCGCCACACCGAACTGCTGGGTGCGAGCCAGCGGAGTAGC

CAACGTCGTCGTATCGCCTGCGAACTTCGCCACCGGGGCCGCCAAGAAACCCAACGCCAGCGCCGCAGC

AATCGCCGCACGCGCACCCGTAGCCCACGCCCCTGCCGTACGTCCCCTCATCATCTTGACGACCACGCCC

ACACCGGCGCACGTCGTCAGCAACGTCAACACCGTTCCACCCCAGCTGTCCGCTCCCAGCGGGGCCAAAA

CCTTGTCGTGGATGTCGTTCTGTAACCCCACCAGCGGTCCGGTAATCCACCCGACCCAGCTCATCGCCACG

GTCCAGTCCAACAACCGGCACAACAGGGCAATGACCATCAGGTACGTGTTCCAACACATGCCAATAATG

GAGGCCCACATAGCCTTCAGCGGGGCCGTAACGCCACCATCGTCCATCGACATCTGGTACTGAAACAAGT

GAATACCGTTGGAGTCAGTCACATTGAAACCGTCACCCATCCAGCCCAGCCCCGGGCCCGATGCCATGGC

AGGCACACTGCTCAGCGCCACCACCAGAACCAGCGTGGTGACGATGATACGGAACCGCCGCTCCCCGGC

CCCGGGGCGGCGTGGATGACGGCTCACGCTGTCTCCTGGTCGTGCTCGGGCGGGTTGGAGCTGGCGGCTT

CGCGGTGGGGAGCGTAGGCAGGTCTCAGTAGTCGAATTTCACCGACGTTGCCGTGTTGGTCGGCGTACAG

GCCACAACCGGGGCCTCCGGGGTTGAGGGCAATCTTGACCAGGTCAGCGAACTCTTCAGGGGACGTTTTA

GGGTCCACGCCCAGGAACTCGACACCTTTCTGGGCGAGGTTGATGTTGTCGCACAGCAACACGATGCGAT

GCTGAATGAGGTTGCGGACGGTCTCGTTGGGGTAATCGGCCTCGGGGTCGTGGGAGCCGGTGATAAGCC

AGGCATTGGCTCGGCGGGATTCGCGCACGTACTCGTCAATGGCGTGGGAGGCTTCCGGCGAGGACGACA

TGTGATGAAACTCGTCAACAATGAAAGCGGCGTCGCGGGCCCGGTCGCTGAAGCACACCAGGCGAGCCA

GACGGGCAATGAGCGCGTAGAGGGCTCGGCCAAACACCTTGTGCGGGGGCAGCTGCCGAAACAGATGTT

CTGACAGCATCTCCTCGGCGTTAGGAAGAGCGATGCCACAAGTGCCAATGATGAGGATGTCGGCACTCA

GGTCGGCGGGAGGAAGGTCCGGGTCAAAGATGGCCGAAGCTAGGGAGGCCGAGTTCTCGATGTCAGCGA

ACACGGCAATCCTGTCAGCGATCGCGGTGGCCTCGGGAAGGTCGCACTCCTCGGCCAGGTGGCGGGCCA

AACGCCCACACGAGGTGATCTGGTGGTCACGCATGTAGGCCGGTTTGAGGACCTTGGCCAGCGTGGTCCC

GGCCACACCGATGGTCTCCAAGTTAAGCAAGGTCAGCAAGAACGACTGGGCGACCTGCCCGGCCATCTC

CGGGGGAAGGATGCGCAGCGGGTCCAGCGACAGCTTGGGGTGGGCCGTGTCGACGATCTGGCGTCTAAC CCCGTCGATAGAGTTGACAAAGGTTACCCACTCCCGCTCATCGGAGTTGTCGGTGGCAATAATGCGCCCG

CCCCGGGCCGCGATGGCTGCGCACAGCCGCTTCTCGGCCATCGTCTTGCCCGCGCCCATCTTGCCGATGA

ACGCCACCGTGTTGCCTTTCTGATCCTGAGTGTCGGCATGCAAATCGAGGTAGGCCAGCGACTGCAACGG

GGAGCCTGTGACCACAGCCAACGGGATGCCGGTGGTACGGCCCAACCGGTACTCAACCACCGGGATAGA

TGCGGCGAACGCGGAGGCGTGAGTCAGCTGACGGTAGGCGTTAAGCGAGGAGGAGAACCGGCCACCGG

GCCGGGCAGCCCACAGCAAGTCCTCCTGACGGCCCACGGGACGCACCCACGTGAAGTCACCGAACACCG

GATCATTGACGAACGCTCCTGCCAGCTCCTCGGTGGTCTCAAAGTCAGGAGACGAGACAGTGACGGTGAT

AAGAGCCTGGATCTCGACCTCACGCTCATCGGCGGCCAGCTCGGCGTTGTAGTCGACGAGCACCTGAGCG

GAATGCTCGATAGACATGAGGGTCGAAGCCTGGGTCATCTCACCGCCCTCGACGTTGTCGAGCTGATCGA

CCGTTTGACGGATAGCCCGCTGATTTTTCTGCATCGCAGCGTGACGGGTCCGGGCCACTCCCCGGATCGC

CACGTCGACCGGCACGCCAGTGTCGTCGATACGGCCCAAAAACTCGTAGGCAGGCCACGTCATCGTGCG

GGGCACCTTACCCAGCACGATATGGGACTGGTAGACGGTCTCGCCGGTGTCGGCACCGATTTTGAGGACG

CGACGATTCCACGCCTGAGCCGTCCGGGACATGTGGGAGACTCGCTTGTCATCCTCGCTGGCCAGCAGGT

CGGAGGTCGCGGCCTCATCGATGACCAACTCCCCCAGCGCGGCACGTCCAACCTCATCCATGAGGGCGAT

TCCCTCGCCAGGGGCATCATCACGCAACCGGGTCGGGTGGCCTGACAGGTGCTGCCGAAGCCAGATCTGT

TCATCAACGGTGACCGGGCGGGGTTGGAACGCTGCCGGCAGTTTCGCACCGAATTCCTTAGCCTGACGGA

GGGCCCACTCCCGTGCGACACGGCCAGGAGCGGTGGTCATGAGTCCGGCGGCTTCGGTGATTTTGTTGAG

GGCGGCGGTCCAGGCGGTGTGGGTGCGTATTTTCTGGTCTTGGTTGAGTTTGATCGATAGGAACCACACG

CGCCGGCCTAGGGATTCGGTTTCAGGCTGGTCGAGGGTGGCGTCGATTTCGTCGGCCCACACGGGGTGTT

CGCTCAGGTCAAGGCCGGCGGCCATGGCGTCGACGATTTCTGTGGGGTCGGTCCAGGTGAGGGCTCCGTT

GAGGCAGAACTCGTGGCGGGCGAGGTGGCGGAATAGGTCGCGGTGAGCTGCGGCGACGGTGAGGGAGG

CGTTCTCGGTGACGGGTCGCTGGAGGGGAGTGAGTCGCCAGGTGGCCCAGATGTCGCCGGTGGAGGTCC

AGACGAGGTTGTCGAAGAGGAACCGTTCGGGGATGGACATCATGACTCCTTTTCGGCGGCGGCGAGGAA

GGCTTCCAGGCCGCTGCGGCGTACAGCGTTCCCGGTAGGGTGCAGGGGTTTTCTGGGGGTGGGTTCAGAT

TTCGAATGTGGGAGGGGTTTGTGGATGGTATCGGTGTCCTCGGCGAGGGCTTGGTCGAGCAGGCAGGTGG

CCGGGGTGTCGGTAGTCTCGTCCAGCTCGTCGATCATCTCGTCGAGGAGGTTGGGGGTGGTGGATGCGGC

CCACACAGGTGGGATAGCCGGTGCGGGTCGAGGCGGTGTGGGGAGGCGGAGTTTGGTTTGGCCCCAGAG

GGGTGTGTGGGTCATGCCGGCGGGAGTGGTGGCGGCGTGAGTGGTCACACGCCACCAGCCCGCCAGCCA

TGCCAGAGGTGACCAGGTCCAGTCGATGCGACCAACAACGAACTGGGCGAGCCATCCGGCAGCCAGCGC

GAAAATGAAACCGCGGATGGTCATGCCCCCGTCGATAATTTTGAAGCCCATCATCGCGGCAGGAACTACG

CCGCCGACAGCGAGCACCTGATAGATCGTGTAGGGCCCGCCAGGAATCCTTCGACCTGAGGAATCCTTAC

CGATAATGCGGGGCTGCTGGCGGGCCTCGGTGTGCCACTGAATATCCACGATCAGCTCTTGCCCAATCCT

TGCATCATCTGTCCGAAGAATTGGATCGCGTTACCTTCGATAAGCCAGTGCGCCATACCACACACAAACA

GCATGGAGACGATCTTGGCCAGGCTCATACCGTGTTTGAAGATGTTGAACGCGGCAATGCCCACGACTAC

GACCATGGCGACGGCTCGCACCGCGGACTGACCTTCACCTGCCTTGATCGTCGTCCATTCGAAGAGGTTC

TGCGATTCCAGTGGCAGCAGGAGGAATTGATCGAGCATGAGAGGTTTTCCTTTCAGGAAGCCGACCGGG

ATGGTCCCGGTACTGACGGGCTGGACGGCACGGGTGTGCCGGCCAGGGGCAGAAGGCGTGACGGCTGGT

CGAGGGAGGCAACCTCCCAGCGGCCTGCACGGCTGACAAGAGTCAGGCCGTACTGGCTGGTCCGGGTAG

TGGATTCGTCGCCGGTGGGCTGGCATGTCACGGTCACCGTGACGGTAATCTTCTGCCGGTCTGAGGGGGT

GGGGACCTCGTCAGGTCCCACCACATGAGTGGTTTTCACTGATACGCATGGGGCTGGGTCAACCGCGGTG

AAAGCGGTCCCTGGGCTGCTCCATCTCGACAGGTCGGTATTCCCGGTCAGCATGGCGGTTAGGAAGCCTG

AAGAGGCTTGGGCGGCCGGGTCGGCGGTGCGAAGCTCCGAGGTGTCTAGGGTGGGGGCTGAGGCCGGTG

CAGGCATGGGGATCTGTCCAGGTAGACGCAAGGCGATGGCCTTGCCGTTGGAATCGACGTGGACCGGGA

CTGACCAGGCCTGTCCGCTCCCGGATTGGCCGCCCATGGTGACCACGGTGACCTGCCACAGGCTCGGATC

AGACGGGGAGACGGTAGCGTCATAGGCGGTGACGGTGGTGGGCGCTGGACCAGGTTTGCGGGGCATGCG

CGCATCGGTGATCTTGGCCGCCACCAGGTGTTCCAGATTGTCCAAGTGCCCGGAGTCAGAGGTCAGCAGA

AGAGTAGTCACCTCGACCGCGGTGGCTGAGGCGATCTGAGCTGTGCGGCGGTCGTGATGGGTGGTGTCAG

TGCTGACAGCTGTGGTGGGAGCGGATGCCGGGGCCGCCGAACGGACCAGGGCAACGGGGCCGCATGCGA

CTCCGCACAGCACGAGGGCAAGGAAGCCTTTGGTGGCCATCGATCCGGTGTGGGGCCAGGGACCCACGT

TTTCCTGTGCCTGTTTTTTCTTGGCCGACCAACGGCGGGACTTAGGGTTAGCGGATGCACCTTCTGGGGTG

CATGCTCGTCTCAATCGCATCGGTCACCTCCTTCACTGGATGAAGGGACCAAGGAGGTGACCGATGTGCG

GTCGAACCCGAAAAAGTTCAAACTTTTTTCTGGGTCTGCCTCAAGTACGACAGAAGGCCTGCATCATCAC

GGCGTTGTGGTAGCAGATCTTGCGTCAGCGCAAATGTATGGGCCTCGTAGGAGTAGCTCTTAGGTGGGTC

CCGGTGGTTGCGGCCAGGGCGAGGGTGTCGGGTATGTGTAGCGCTAGTCCCGGGTTCGTGGTGTGAGGGC

TTTTGGGTGCTGACATGCACTACCCATTGCTAGACGCTGTGCTGTGGCATGGCTGGACGTCTAGCAGACG

GGTTGACATCACCTTTAGGCTGGCAGCGCCCGAGGCCGCAGGCCAGAGGAAGCGGACAGCCTAACGATT

GACGTCCCCCTCTCCTTTCCCCAACCTCCTGGAGTCGATGACCCGGAGATAGATCGATGTCTATGCATCTG

TGCATCGATATACCTATGTATCTGTCTGTGGTTTTTAGAGGCCACTCCCGTCGCCCCGGGCCGCTCAGCGA

TACCGCAAGGCTGTGTGGGATCAGCTGTGCCGCTCTCCCGACATGGCAGACAGCACCCTGCGGACTGACT

GACACTGTGGCGCCGCGGAGGTCTCCCGCGGCGTCCGCTGGGGCGAGTGCATGCCTGTCAGCTCATCTTT

TATCGTCATGTTTCCCCTTGTCAGAGCGGTCTTTGCAAAGTGACAACGTCAGGGGTCTTGACGACAACATC

CTCGACAACATCGTGGCGGTGGTCTGTGTCTCGTCAGTTCAACGCACCGGGGAAAGAGGCACCGCTGATG TTCACCACCACAAACACCCTCAACGATGAGTGGGACCAGATTCGCGCCACTGAGATCGATTGGCATGACT

GCCCTGAACTGATGCACTGCATCGACGTTGATGATGTGTTGGCCGTCATTCCTGCCGCCCCCGACGCCATC

TTGGGCTACCTCATTGCCCGGGCTCAGGGCGGTGACGAGTTGGCCACCCGCACTATCATCCAAGCGTTCA

CAGGCAAGCTTATCTTGATGGCCACGGCCACCAAGGTGCGCCGTACTAATGACGGCTTCAATGATCTGTT

GGCGGGTCTGTGGGAGACGATCATCACGTACCCGTTGGATCGTCGCCCTGACAAGATCGCTGCGAACCTC

ATCCTCGACACGTTGCACCGGGTTACCCGGTTCTGGCGTGCTGATTCCCCCGATGAGGAAGAGGCTCACG

GTCTGGTGCCCTTCCCTGACACTCTCATCGCCCCAGAGCCCGATGAGGACGTCACAGCTAGCCAGGCCAT

CGCCTTGGCGGTGGACCGCAACTGGATTACCGAGGACCTAGCCCGCCTCATGAGCCATATTTACTGTGAC

GGTATGACTGGAGCTGATGCGGGTCGTCTGCATGGCTGCGCTCCAGCTACGGTGCGATCTCGATGCCGTG

ATGGTCGGGCCGTGTTGCAGCGCAACGCCGAGACGATCCTGGCCGTCTGCTGATCCCTCTCTTGCTCATGC

CTGCCGCCACCCTACCCCTACCTGCTAGAAACATAGCCATGTCTCCAGCAACGCATCTAGCGTATCTTCTA

GCAATTGATCTAGCTATGTATATAGCTGATGATCTAGCTACCATATAGCTGTGTCTCCAGCCCAAAGGAC

AGCCCAATGGCATGCTTGCCACAGGAAGGTGCGTCAGCCTCCCGAAATACTGGAAGGAGCTTTACCGTGC

AGGACATGACCTCGACCAGACCGATTGACCGATCCCCGTTCGACCGCACTATTGCGGTGTGGAACCACAA

AGGCGGCACGTTCAAGACGTCCGTCGTGGCGAACCTGGGATACCTGTTCGCCGCCGGTGGCAACAAGGT

GCTGCTGGTCGACATGGACCCCCAGGCCAATCTCGACATTGACTTCGGTATACCCGCGGGAGAACGTGAA

CGGGGCATGGGATTAGCCGAGGCGCTACGTGAGGGGACGGCCCTTCCCCCACCGCAGCATCTCAGCGAA

AACCTTCACCTGGTCAGTGGCGGCGCTGCTCTCAACGAGTTCACCGACCCCGCATCCTTAGCGGCCATCCT

CGACCGAGTCACCACCGCACGCTACGACCTGCTAGCTCAGGCCCTTGCCCCGCTGGCCTGGGACTATGAC

CTCATCTTCATCGACTCCGGGCCGGCACAAACTCTGCTGTCCCAGACCATCCTTGGAGTAGCCCGCTGGCT

GGTAGTGCCCACCCGCACCGATAACGCCTCAATCACTGGCCTCGTCGACGTTCAAGACGCCATCGACGGG

GTTGCCTCCTGCAACCCTGACCTTCAACTACTCGGCGTTGTCCTAGCCGGCGTGGGGGCCCGGGCCACCC

GGATCGCCGCAGATAAACGCCACGCCATCGACACAGTGCTGGGGGCAGGAACCGTTTTCGATGCGGTCA

TCCACTACTCCGAGAAGGTGTCCGTGCTCGCACGCCAGCAGGGCAAGACCGTCGCCGAGCTAGCCAACG

AGTACCACAACACCCAGCCCGCCTACACCTACCTAGCTAAAGGCCAGAACATCCCCAACGTCGCCAAGG

CAGCCGTCAGCATCGAAACTGATTATCTGAGGCTGGCCACCGAGATCAGCGACCGCATGTTCACCAGCGA

CGAGCAGGAGCCTGATCATGACTGACGATCCGACTCCATCCGAGCAGAACAACCCCACCAGCGACGACA

TGCGCTTGGCCGAAGAATGGGCCAACAGCGGCCGCACAGTGGGAGCCCTGCCGCGCCGTCAACGGCCTC

AGCGACCCACACCCCGCACCACCAGCCAACCCCCTGTCTCGTCCCCTGACACACCGGCTCCGAAAAAACC

CCAGAAGACCCCCACCAGCCAGCCTGGCCGTCAACGGATCAACGTCACCGTCTACGTTGTGCCCGAACTC

CATGAGCGGCTGCGCTCCCGATCGGCGGCGACGGGGGTGACGGTCTCGGATCTGGTGGTGCATGCGTTAG

CGTTCGTCGCCGATCATGCGGGGGAGGCGATCGCCGATGATCTGCGCGTCGAGACGGGCCCCGGCATGG

GGGCCGGACTGTTCGATGTGACCCCATCGCGGCCAGTAGGGGTCGCCAAAACCCAGCTGGGGGTGCGAA

TGACCCGCCACAACAAGGATGGTTTGGACCAGCTGACCCGGACGAGTGGAGCCCGTGACCGCAGCCATC

TTGTGTCTGTCGCCGTGCGCGACTATCTCGACTCCAACCCTGTAAAGAAAGGCCGACATGTCCGCTGATG

AAACTCCTGCCGCCCGGGGTGGGCGACGCTTTGATACGACCGTCAAGCCCAGGCGCCGTCCCATGCTTAT

CGCCGCCGGTATCGCCATCGTGATAGTCGGCGCGCTCCTCATCACTCAGTTGATTCGCTCCGCCCAAACCG

AGCATCGCGTGCTGGAAGTCCACGCCGATGTGGCTCGCGGCGAGGTCATCCGTGACACCGATCTGGTATC

GGTGACTGTCGGCCAGGTCGACAACGTATCAACGGTTCCCGCAGACCAGCTCGACTCACTGGTCGGCAAA

CGCGCCACGGCAGATCTTCGAGCCGGATCACTCTTGCCTGCTGGGGCTATCGGCCCGGCCGATGTCGTTC

CAGCTCCGGGCAAGTCGCTGGTCGGGCTGAAGCTAGCCGCCGGACAGATCCCTATCGGAGACCTTGCTGT

CGGGACGAAGCTGCGCCTGATCCAGACGTCGGCACCCAGCGGCTCATCCACCACCACTGATAGCAGCAC

CAATACCGATGGCCAGTCGTGGGAGGCAACAATGGCGACCGGCACCAAAAAGACCGAGCAGGTCACCTT

GATCAACGCCGAAGTGAACTCGCGTGATGCCGCCCGGATCGCCCAACTGACGTCACAGGGCCGTATCGCC

GTAGTGAAGGATCCGATCCGATGAGCACCATTGTTTTGACCAGCGTCTCGGGAGCCCCAGGGGTCACCAC

GACAGCGATCGGGCTGGGCAGGGTCTGGCCACAATCGAGCCTGGTCGTCGAGGATGACACCCACCACGC

CATGCTGGCGGGCTACCTGCGAGCCTCCCAGCACGCCGAACCGAACCTGGCCGCAGTGGCGAACCTGAC

GTCGACTCCAACCAACGCCCAAACGGTGTGGGAATCTATCGCCAGACCCCTACCCACCGATGACCCAGTC

GGCGGGCTGCGACGCAAAGGCATCCTCGGCCCGCCCACGCCGTGGTCTCGCGCAGGCATCGACCCCCGA

TGGGGATTCATGCTGGCCCTGTGGCGGCAACTGGAGGAGGCTGGCATCGACACCATCATCGATTTGGGTC

GCCTAGCCACACCACTGACCTCAACGCCACACCTGATCGCCGCACCCATCGTCGAGGACGCCGACATGAT

CTTGGTGATGATCGAGGCGACACTACGCGACATCGCCGGCGCCCGCACGATGGTGGAGGGACTCGCTGA

GCAGATGAACTTGGCCGGCGCCTACCGACGTCTCGGACTGCTTGTCCACCGTGGCGGCCAGGCCCGCGGC

GTCGCCGAGTTCAATGACAAGGAGATCACCTCGGCGTTACGACTCCCGGTCATCGGGGCCATTACCCACG

ACCCGGCCGGAGCCGCCCAACTCTCCGACGGGGTCGGGCAGCGGTTCGACAAGTCACGTCTGGCCCACTC

ACTATCAAAGGTGGCGGCCAGCCTCGTCGATGCCATAAACAAGCGCCACGCTGATGACGAGGAGGATCT

GTGATGGCCAGTTTTGCTGATAATCCGTTCGACAAGCTGCGCTCCCAGGATGCGGCAAGAGCTTCGGTAG

AGCAGGAGCCTGATGCCGGATTAGCGTCGGAGTTGTTTTCGACGTCGTCGGGGTGGGCCAGCTCTCAGCA

GGTGTCCCAAGCTCAACCGGTGATGACCCGTTCGGAGAACGTGGATTGGCCGGTTGTCGCGGAGCTAGCC

AGTACGGCCACTGATGAGGTTGAGGCTGAGATCAGCAGGTGGAGTTCCACTCATGATGGGGTGGCGACG

CTAGACATTCGCCAGGCCATCGCGGAGCCTGCTATTGCCTCGGCGGTGTCTACGTATGCTGACCGACGCC

AGATCGATGTAGGGGAGACCTGGCCTGATCTGGTACGCCAGCGATACCGCAAGGCTGTGTGGGATCAGC TGTTCGGGATGGGGCGGTTGCAGCCGCTGTTCGAAATCAGCGACGCCGAAAACATCATCGTGGTGGGTAA

CCATGAGGTGGTTGTCGACCACAACGATGGTTCCCGGTCAACGCTGCCGCCGGTGGCCGACTCGGATGCC

GAGCTGGAATCCCAGATCGCCCGGATGGCGAGGAATGCGACCCCGCGGCGAGCCTTCGACGCCGATCAC

ACCGATGTGACGATCATGCACCAACAGAAGTTCCGTATCCACGCGATCTCTTCGGAGGTGTCGTTGCAAC

CGTCGGTGGTCATCCGCCAACATTTGCTCACCCAAATCAGTCTGGGGGACCTGTCCCAGCGGGGAATGAT

GCCGGTGGAAGTGGCCCGGTTCCTCGATGAGGCGGTACAAGCTGGCAAGTCCATCGTGGTCGCCGGCGA

GCAGGGGGCAGGCAAGACGACGTTTTTACGAGCGTTGATCCACGCCATTCCGATGCGGGAGCGGTTCGCC

ACGTTGGAGACCGATCAGGAGTTGTTCGCTCATCTGATGCCTGGCCGGGAAAACACGCTGGTGCTGTTCG

CCCGTGATGGTAACGGCGAGGTGGATCCGGCGACTGGCACCCAGCACGGCGCTATCGAGATCGCCCAGC

TGATTCCTCCTAGCCTGCGCCAGGCGTTAACTAGGGTCATTGTCGGTGAGGTGCGCGGCAATGAGGCTTC

GGCCATGTTCCAGGCTATGCAGTCGGGGACTGGCACTATGAGCAGTATCCACTCCCCGCGAGCCTCTGAG

GTGCCGTCCCGGCTAGCCCAAATGATTTCGATGGGCCCGGTCTACGATCTGGATCAGGCCATGCTGCAGA

TCGGTCATTCGATCGACTACATCGTCTTTGTTCGTAAGCGTGACCTGCCTGATGGGAGCCGGCTGCGATTT

GTTGAGCAGATCCGTTCAGTCTCGCCTGGTGATTCGACAACTCCCAGTCTTGGCGAGGTGTACACGGCTG

ACTCGTGGACAGGCCAGCCGCTTACGCCACTCATGCCTGGTTCGGCCGCCGACGAGCTGTCTCACTTCGC

CCGAGACCTGGATTACTGCGAGGCCCACTGATGAACACCCCAGCGCTGATAGCAGCCCTCATCGTGACCG

GCCTGGGACTGATCATGGCCATCAACGGCCTGATCCCGGCCACACCCAAACCCGGCACCACGCTGACGCT

GTCACAGCGGTGGGCCCGGGCCACCCACCGCCCAGCCGGGGCAGCCGGGCGCCGACGCGACCTGCGCTG

GGCGCTGGCCGGTCTCGTCGGCATCGTGCTGTTCGTCCTCACAGGTTGGGTCGCTGCCCTGGCCCTGGGCC

CCATCACCGTGCTGCTAGCACCCACCCTGCTGGGGGCGGCCCCACCGACCGATATTCCGCTGATGGAGGC

GTTGGATCGGTGGGTGCGTCAGGTCGCTGCGGTGCTGCCACAGGGGCGAGACATCATCACAGCGGTGCG

GATCTCACGGCCGCGGGCCCCGAAGCTGATCGCCGGGTCGGTGGATCAACTGGTGTCCCGGTTGGATGGC

CGTATGGAGCCGAGGGAGGCGTTCCAGCGGATGGCCGACGAGCTGGACTCGGCTGAGGCTGACGCGGTG

CTGGCCTCACTAGCGTTGGCGGCCACTCATCCGCGGGGAGCCTCGACAACGTTGAAGGCTATTGCTGGCA

ACATCCAACAGCGGTTGAAAGTGCTGCGGCAGGTGGAGGCTGAGCGGTCTAAGCCGCGTAACTCGGTGC

GCCAGATCACACTGGTCACGATCGCCATGTTCGGGGGGCTGCTCGTGATCGGACGGTCGTTTCTGGCCCC

GCTGGCGACCCCTCCCGGTCAGGTGCTGGTGGCCGTGGCGGTGGTCATGTATGTCATCGCACTAGTGCAG

ATGTATCGGATGGCGCGGCCCCGTCGACGCACCCGGATCATGGTCAGGAGGACCCGATGACCATTACTGC

TTTGTCCCTGCTGGCCGGGGCCATCGTCACTGTCGGACTGCTGGTCATCGTGGCAGCGTTCCGCCCAGCCC

CAGGCCCTGACCTGGTTGCCGCTCTGGAGGTGGTGTCGGGTCGCACCTCAAGCGTCGCCGAGAACGTCGA

CCAGACCCGGATCGGGCGGATAGGTCGCAGCGTGACCCGCACATTCCATGTGTCGGTGTCCCCGGCCATG

CGGGCCGCACTGCGACTCCAAGGCACGACCCCCGAAGCGTTCTACGGTCGACGCCTGATCTGCGCACTGA

TCGGGGCGATCCTGCCGTGGCTGCTCAACGCGGTAGCCATCGCGGTAGGGGCGAATTCCCCGAACCTACT

CATCCCTTCGGCGCTGTGTGTGGCGTTAGCTGGCGCTGGATGGATGCTGCCGGCAGCACGGTTGAAGGCT

GCGGCCGGGCCCACCAACGATGACTCGTTCGAAGCGCTGCTGGTATTCATCGATTTGGTCGTGCTGGAAC

GGCTCGCCAACGAAACCTCCGTCGACGCGCTCACCAATGCGGCAAACATGTCGGACTCGCCGCTATTCGT

CCAGATCCGTCAAGTCCTCAACCGTGCCTCCCTGGAAAACGTCGACCCGTGGAACGGGCTAGACCGGCTA

GCCGAGGACATCAAACTGCCCGAACTCACCGATGTGGTCTCCATCGCCCGCCTCCAAAACGAAGGCGCCT

CCCTCGTCGACAGTTTCCGGGCCCGAGTCGCCGAGTTGCGCGACGCCTACCTGCTGCGCCTGCAACAAGA

ATCCACCGCCATCACCCAGCGGCTTGGTTTGTGGACGATCCTGCAAGCCGGCTCGGTCATGCTCATCTTGC

TGGGGGCGGCCGCCCTCACACTCATCACAGCCGGATAAACCGACATCGTGTCGAGCCCCCATATGGGCCG

CGAACCTTTCATAATGATGCCTGTAAGCACCACAATATTGATCACAACCTAACAATGAAGGAGAAATCAT

GATGACCGATCTCGACCTGGCTAAAAAACAGATCACCTGGCTGGCGGCGCACCTGCGTTCCCGGATCGTT

GACGAGCGTGGCGGTGGTAGCTCTACCGTGGAGACACTGATTTGGATTGGTGTCATCGTGGCGCTGGTGA

TTGGTGTGGGCGTCGGGGTGACGGCCTATATCAGGTCGAAGATGCCTCACTGACGACGATGCGTAGCAGG

TTCACAACTGATCAGCGTGGCGGTGGTAGCGCGTCGGTGGGGATGCTCCTGCTGATGCCTGCGATCATGC

TGCTGGCATTCGGTGGGATCGAGGTCGGGATGTGGTGTCACGCCCATCAGTCGACCATCGCGGCAGCCCA

AAGCGCCGCGGAGGCTCAGCGTGTCGTCCATCCGGTCCCGGGGTCGGCACAGGAGGCAGCCTCGCAGAT

CACTAGTCATGGCGGGGTGCGTGATACCCGGATATCGGTCAGTGATGACGGGGCCACTGTCACGGTGACC

GTCTCAGGTCGGGCCCCATCGATGCTGGGGCTGCATCTTCCGGCTGTGTCGTCGACAGCGTCGATGCCCA

AGGAGCGCCTGTCGTGAGGCGAAGTGAGCGCGGTGGAGCAAGTCTAAGCGTCGAGGTGCTCATGTGGGC

GCCGATCGCGCTGGTGATCATCGGGTTTGTTGTGGGTATCGGCCGGATGTCGATGGCCCAGGACGCGGTG

AATGGCGCGGCGGGTGCTGCGGCCCGTGCGGCGTCGTTGGAGCGTGATGGACAGTCGGCTCAGTCTGCG

GCGCAGCAGGCGGCGTCGGCGAACCTGTCGTCCGGTGGGCTGGCATGTGCGCCGAATGTGAGCGTGGAC

ACGTCAGTGTTTGCCCGTCCTGCCGGGCAGGCGGGCACGGTTCACGCCACGGTCACGTGTGTCACCTCGC

TGGGTCTTGGGTTCGGGTCCCGGACGGTGCACGCAACGGGGTCTGCCCCGGTAGACACCTATCGGGAAAG

GAGAGGCTGAGATGGCCCGTGATGAGCGTGGTGGCGGCTCGGTGTCGGTGTGGATGCTGCTCATGGTGCC

GGTGATTCTGGTCATGGCCGGCCTGGTTTTTGACGGGTCCCGTCAGATATCGGCAACCCAGGCGGCCCAG

GACGCGGCGGTTGCGGCATCCCGCGCCGGAACTGATGCGGCAGCGACACCGCAGCTTGCTGGCCACGAC

GGGGCGGCCGTAGCAGTCCAAGCGGCCCGCCAGGCACTATCTGCTGCCGGGGTGGACGGGTCGGTGCAG

GAGGACGGGTCGACCATCACGGTGACCACGTCTCAAAGTCGGCCGACAGTGTTCCTGTCAGCGATCGGA

ATCAGCCAGGTAAGGGGGCATGGGCAGGCCCATGCTCAGCTTGTGGGACCGGGAGAACGCCCATGACAG TGATACGTCGTATCGGTGCCCTGGTGGCACTGCTGGTGGTGATAGCCGGCTTACCGGCCGGGCTCGTGGC

CGCAGGCGCCCCGCTAGTACCGGCGGGCCTGTCATGGGCCCATGTGCGGCATCTGTTGGTTACCCCAGAC

ATGACCGGGTCGGTGCTGGTGTGGCTGGTCAGCCTCATCGGCTGGATCGGGTGGGCATGGTTCGCCCTGG

CCGTCGCAGCCGAAGCGGTGACGATGCTCTCAGGGCAGCGGCTGCACTGGCACATGCCCGGCCCTCGCCT

AGTGCGCCGAGTGGCAGCCGGTCTTCTCATTGCCGCGTTCGCGGCCGCACCGGCAGCCACAAGCACGGCT

CACGCCGCCGAGGCCACCCATGTGGCGGTCGCCGCCCAGGCTGGACCGGCACACGCGGCCCCCGCCCAG

GACAGCCCCGCCACCACCTCTCAGGCCCCGGACGCCTCCACCACTCCGAAAATCTGGAAGACCTACACGG

TGCGGGCCAACGACTACCTGTGGAAGATCGCCGAGCACTACTACGGTGACGGCGCCCAATTCCGTCGTAT

CGCCGAAGCCTCCGGTATCGACCCGCACTCAGAGCTGAAAGTCGGCCAGAAACTGATCCTGCCGGTTCCT

AAGAACACGGCCGCAGTTCATTCGGTTAAAGCGGGGGAGTATCTGTGGGAGATCGCCGAGCACTACTAC

GGTGACGGCGCCCAGTACCATAAAATCGCTGAAGCTTCCGGTATCGATGCCCATTCCGATCTAGCCGTGG

GCCAAAAACTCGTCATCCCCGGGCCCCTCCGCCACGACGCCACGCCGCCACACCACTCGGCGTCGACCCA

CGCGAAGGCCGCCACCCCAGCCCACACGCCCACGCGACGGCCTGCGCCTGCCCACAAAGCCACGCCCGC

CCCGACGCCGGCCACCCCAACTACTCCGACCCACACGGTGACCCCAGCTCCGGCCTCTGCCGGCCACTCG

ACCAGCGACGAGCACCCACTCCATACGGATACCGCCGCAGCGGACAAGGCCAGCAACGAGGACGCCCTG

TCCCCAATCCAGGTGGGTTTGACCGCCAGCGTCGGACTGGTGCTGGTCGCCGGACTGATCACCACCCTCA

ACCGCCGCTACCGGACCCGGTTCACCCGCCAGCCCCGCGGCAAGGCCATGACCCTGCCCAGCCCGGACG

CCCAAACTGCCGAGATAGCGCTGCGCAGCACCGGGGCGACTGACACTCTGACGATCACCTGCCTCGACC

AGGCGCTCCGCGCGATCGGCGCATGGTGCCACCACTGCGGGCACCCGCTGCCACCCCTGCTGGCCGCCCG

CGTCGATGACGACCGGATCGACCTGCTGCTATCCCAGGCGGCCCCCGACCATCCCGAGGCGGTGGAGCTG

GCCGCCGACGGATCGGTGTGGACCCTCACCGCCGACCGGATCGACGACCTGCTAGCCCACACCGATGAC

AACCAAGCGGCTCCGTGGCCGTCTCTGGTCACACTGGGACGCGACGACGACGGCGCCCACATCCTCATCG

ACTTGGAAGCCGCAGGAACCTTGCACCTGATCGCCGATGACGACCAGGTCGACGCGGCCCTCGCCGCGAT

CGCCGTGGAACTGGCCACCTGCGACTGGTCCGACGAAGTCAACGTCACCCTCGTCGGCCAGGTGTGCCCG

GGCCTAGAAGACGCACTAGAGTCTCCGACCCTGACCCGCGCCACCGACGTGGACACCCTCCTCACCACCC

TAGAAGCTCGCGCCGACGACCAGCGACACATCCTCACCGAAGGAAACCCCCTCGCCGCTCACCGAGCCG

ACCCCGCCATCTCCGACGGGTTCGACGCCGAAGTGATCCTCCTCGACACCGAACTCACCGAAGACCACCG

CAACCGCCTCGCCAGCCTCGTCGAGGCTCTTCCCCGCGTGTCAGTCGCCGCGGTAACAACCAGCCCCACC

AGCTCAGACGAATGGTCCCTCACCCTGACAGGTGACCCACTAGCCGCCGACCTGGCTCCCCTCGGCTGGC

ACATCCACCCCCAAACCCTCTCCCCCGACCTGTACAACCGCATGGTTGAACTACTCGCCAACTCCGCCGC

CGCAGACTACGAACCCGCCAGCTGGTGGAACCACGACGCCGACGACGAGCCCACCACCGACCCCACCAA

CGAGGAAGAATCTACCCCGAGCAGGCGAGCCCGCCCGAATATCCGCCTGACCACCCTGACCGGCGGCAT

CGACCTATCCAGCGTCGACATCGACGACATCATCGACGAAGCCAACCAGGCCCTCGACAACACCGACCA

GACCACCAACCAGGTTCGCGTCGACACCAACCAACCCGGCACCGACACCCCCTTCCCCATCGACGACATC

GACCCGCTGAGCTCCGACCATCCGGTCCTATCCATCATCGGCCACCCCGACATCACAGGTGCCACTGGAA

CCGTTGGGCGCTCCCCGTGGCGCTGCCAACAGTTGGCTCTCTACATCGCTGAGCATCCGGGAGCATCGGG

GGCGACTATCGCCGATGATTTGGGGCTATCAGCGTCGACGGTGCGCTCGATTGCTACACACCTGCGACAC

TGGTTGGGAGCCGACGATGCCGGGGTGGCTTACATGCCGGCGGCGACGCGCGGCTACCGGCTCGATGAG

CGGATCGTCACAGATGTGGACCTGATCGACGCTGCTGTGGCCGGGGCAGGCATTAACACCGCTGAGACG

GCCACACTGGTGGCCATTTTGAAGCTGGGCCGCGGACGGGTCTTCGCTGGGGTTCCTGACTCGGAACTTC

GCCAGTTCAGGGCGTCGATGTACCACGTGGAGGCCCGCATCGTCGATGCTGCCCTCCAAGTGACAGACCG

GGCCCTGGAAGCCGGGGACCTGGGGCTGGCCCGGTGGGCGTTGACCCAAGGGCTACTGGTGTCTCCCGAT

CATGAGGACCTGGTCACCGGTTGTCTGCGCACCGAGTACCAGGCCGGCAACATGGACAAGGTTTCCGAGC

TGGTCGATCACCTGTCGGCTACCGCACGACGCCTGGGCGTCGATTTGAGCGCCGACACCACCCGGATCAT

CGACTCCGTTATTACCCATACACGCAGGAGAGCATCATGATCTCCCGTTGCACTCATCTCCGTCAGGAAG

GTTCCTATGCACCATTATCGTCTTGGTATCGGCACTGCCCTCATCGCGGTAGCAGCCGTGGCCGGCTGTCG

CTCAACAGACTCGACACCCACACCACCTCCATCCCGTGTCTCCGCCACGACATCAGCGAGCTCTACCCTC

AGCCCGACCCCGTCAGCCGGAGCGATCAGTGCCGCCGACGCCGAAAACATCTACCGCACCGTCCAAGCT

AACAAGATCGCACTGTACAAAAAGGGTGGCCTGGCACCCGGGGAACCCGCACCCGCGACACTGTCGAAC

TACGCCACCGGCCAGGCTCTCACCGACTACATGACCTACATGCACCAAATCTCGGGGCAGGGCATCAAAA

TCACATCGGGGAACTCCTCGGTTACCGCGGTGCGGGAGAAAAAGGGTGATACCACCTACCCCGAAGCCG

CTATCGCCTTGGAATCGTGCGAAGACGACAGTTCGATTCGTACCGTGGACCGCCACGGAAAGGCTGATCA

TGGACGCATTTTCCATGTCGACAGTTGGTATGCCCGCGATAAGAAGGGCACCGTCAAGATGATCGCATTC

AACTCAACGGAGGTCCCCACATGCGACGTCAAGTAATCACCGCGGCCGTACTGGGCCTGGCCCTGGCCAC

CACCTCCCTGCCCGCCCTCGCAGGCGGCGGCGACTTGAACGGCAGTGTGGACACGGATGGCCCTGGTTAC

GATGTGCGTACTGAGGTGGATTACCATCACACCACCGGTGGTGCGGGTGGGGGTGCCACGACAGGGGGC

CATCATGGGGGCAAAACCCACGGTGATGGTGAAGGTGAGGCTATTGATGGGCGTTCTCGCGCCGATGCC

GAAGCCGAACTAGACGAAGCCGACCGTAACCAGGACTTGACTTGTGATGTCTTGCTCCCACCGGCGCCGA

ATACCCCAGCCGGCCAGGAATGGGCGAAAGAATGCAATCCCCCAGCGAAAAAGGGGCAGAAGGCCACC

CCGAAGCCCGATCCGGTGTTAGTGGGCCGTCACGCGGCCTTGCAGCTCACCCTTCCCGGCGCGGCCCCTC

GTATCGATCCGTCCCCCGACCTTAACCGGTGGCACTCGGCAGCAGTGGGCCAGGCTTTGTGGTTGTCGGT

TGATGACCCCACCGCCACTACGCAGAAATCGATCACGTTTATGGGCCAGGTTGTCTCGTTGAGCGCCAAA CGTAACGGTTTGTCGTTTGATATGGGTGATGGTCATGTCGTGCACTGTGATGCCACGACGACATGGACGG

AGTCGGTGGAACCGGGGACCCCCTCACCCACGTGCGGTTACACCTACCAACAGGCAGCCCCGGCCGGGG

GCTATAAGGTCACCGCAATCACGTCGTGGGATGTGACCTGGTCGGTACTAGGACACACGGGCACAGTCCA

CATCCAGAAGGCCGGTGGGCAGATGCTTCCGGTCGGCGAGTTGGAGTCTGTTGTTACACGGCGATGACTC

CTGATAGTCCGACGCTGTATGAGGTGTTGGAGGTCTGCCCTGATGCCACTGATGACCAGATCAAGACGGC

GTGGCGTCGTGCCGCGAAAGTGACTCACCCTGATGCCGGTGGCACTAGTGAGGCGTTCGCGGCCGCCCGG

CACGCCTGGGAGGTGTTGTCTGATCCTGCCCGGCGCACCGCCTACGATGCCGACCTGGCGGGGGAGGATG

ATCCCGACGACGAAGCCGCCGACGCCTTCGACGTTGATCCGTTCACGGCATGGCCCTGGTGCGCCCCGTA

CATCGACGCCACCCCCACCCTGCGCCACACCTGCCCCGGCACGATCAAGGCCATCGTGGTCGCCATCGCC

GGGATCATGGCCGGAATCGGCTGGCAGGAAGCGCTGGAGGCCGTGGTGTCGCCGCCGGGGTTTCTGGGG

GCGTGCTGGATAGTCTCAGTGCCGGTTGTCGTCGCAGTGACATGGCTGGCAGCGGTGACGGGTCTGGCAT

TTTTCACCATGGCGGCCATCTGGTGTGGATGGTCGTTGATAGGTGGTGCGTTGCTGTGGGGCCAGACGTC

GGTGGTGTGGCTGATTGCTGCGGGGTGGCTGGCATGGCTGGTGTGTGCGTGGGTGTGGTGGAACCGTCAT

CTGGCGTGGAGTAGCGAGCTGATGCAGGAAGGCAATTTGTACGGCCTTCCCGAGGAAGACCCGTTGTGG

GGCGAGGCCGTGGAGCTGGTAGCGGGACTTATCCCCTCTGTGCGGGCGATGTGGTCGCACGATGGGCAG

ACCGTGACTGTGTCGGCTGGCCGGCGGGTGGCGACACTGGGGATGCCGATGCGGGGATGGCGTGGTATC

GAGATGCGCGGCTGGAATCCAGTGGGCGCCGATACGTGGTGGATCGTTGACCAGGTGGGTAGTTGGCTG

GTCGATCAGGATGAGCCGATGGTCGTTGACGGGAGGGTGCTCCATGAGGCGTGGGAACGGTCGCAGATG

GTCCGTTCAGGCCGCTGAGAAAAAATTTAGGTCCGCCCTGCATATCGGGGCCTCTTCATACCTTCAAAAG

TGTGAAGGGAATACAGACTCTTCGACTGGAATTAAAATGGTATATGGCGTGTCCGGTCCGCACCCAGCTC

CACGATGCGCCATAGGGGAGCCATAACTTCACCAATCGTATACGATATGAGTGTAGGTGAGCATCTACCG

GTGGCCGACAGTCAGATACAAGCATGGGCGGATGAAGCAGAAGCTGATTATGACCTCAGCATGCTTCCG

CCGTCTCGACGTGGTCGCCCACCGGTGGGGAGGGGCCCGGGCACTGTGGTCCCTGTGCGCTTCGACGCGG

ACACTCTCAAGGCGTTGTCACAACGAGCCCCTGACGAAGGATTGACCACGCGTTCTGACGCGATCCGTGC

TGCGGTTAACCAGTGGCTCGGCCTCGGCTCGTAAACATTATCGGCGCGACAACCTTACTGATGACGCTGT

TGGTTACGCCGTAGAGCACATCTTGTACTCGTGGGCGCTCGACGATGCTGATGATCCTCGTTGCTGGATG

ATGATTCGGTGTTGACCCAGCTGGCCTCCTCATGGAGCTAGTTATCCTCATCTACGACGATGGCTATGAAC

TCCTGATCCACGCCATGAAAGCCCGCCCTCAGTATCTGAGCTACTTCGCTATCTAGTGTTGTTGGGCGAGT

TGAACTCAACTTTTCTCCGACGCAAGCGCCAATAAAAGGCTGATCCATCCGAATACCACCAAACACGGCT

GACGTGTGGAACAGATTCAGCAAGACAGGGTGCGGTGCTCGGGTGCGTTGGGGAGATGAGGATATTCAG

GCTTCTGGCGGGATGTGGCTTGATGACGTCCAGGATCACCGGTTCGGTTTTGAAGGTGCCTTGCATTAATG

TCGACAGGGTCGTACGACTCGAGGACTGGATCGACCAGCCCGTTGCGTCTGAAGAACTTCATCCACCCCG

GTGGAGCTCCGGCCGCGTACTGGTGCAACGGATCATTAGCATGGGTAGCGTGAGTATGCCTTCGATCGTG

GTCAGTGCTGTCATCATCCAAGGTTCTGACGGGCGGCTTCTCACTGTCCGTAAACGAGGCACCGAGGCAT

TCATGCTGCCAGGCGGCAAGCCGGAGCCCGGCGAGGACTCGCGTCAGGCAGTAGTCCGGGAAGTGCACG

AAGAGCTCGGCGTCGCATTGTCTTCCGACGACCTGCGTCGGGTGGGAGTGTTCACCACGCGAGCAGCGAA

TGAGGCCGGCCATCAGGTGGTGGCGACGATTTTCACCCACACCCCGGTTGCGGTGAGTGAGCCAGCTGCT

GAGATCGAGCAGATTCGTTGGCTCGATTGGAGTGTCGACGCCCTGCCTGATGACCTGGCCCCGCTGCTGG

TCGAGGCAGTCATCCCGTGGCTGCGGCGCCGTATCCGGTCGGTCGCTGTATTCACGGGTGCGAAGGATGG

AACCGACCCTCATTATCGTGTCGAAGCAACCGCCTTGGGCCGGGGTCTCGCACACGCCGGGATCACCCTG

GTTTATGGCGGCGGGAAGGTCGGGATGATGGGTGCTGTTGCTGATGCGGCCCTCGCTGCTGGCGGCGCTG

TGATCGGAGTGATGCCGCAGCACTTGGTGGACGGGGAGATCGCCCATCCTAGTCTGACTCACCTCGAGGT

AGTGCGGACTATGCATGAGCGCAAGCAGCGGATGAGTGACCTAGCTGACGCGTTCGTCGCGCTACCCGG

CGGCGGCGGAACCCTTGACGAGCTATTCGAAGCATGGACATGGCAGCAGCTCGGTGTACACAGCAAACC

CGTGGCCTTGTACGACTCGACCTTCTGGGCACCGCTGACCGCGCTACTCAACCACATGACCATCGAAGGC

TTCATCCGCCCTGAGGACCGCGCCTCGCTCGTGATCGCCGATACCATACATCAGCTGATGGCCGATCTTG

AGGGATGGACCCCACCACCACCGAAGTGGCGCTCGTGACATAGAACAAATGATTCTGACTATGGCTCATT

GACATCTGCGCAGCGGCTACTAGCTCCATTGACTTCAAATCGGGCCTTGGCCGAGGCTCGGTTCAGGTGG

CCCGGAATGGATCCCCACAAATTGAATGCTCATGATCGAGGTGATGAACGCCCACTCTATTGTCCTACGC

CCGGTTGTATCCAGCGAGCAATTGAAGGTGCTGCGCCTGTTGGTCGACCAGGCCGAGCCACTCATCATCG

ACGGGCGCATCTTGTACGAGGCATGGGACAGGCTGCAAACAGCCCGTCCGGCCCGCTAGAAAAAATTTTT

AGGGCCCGCTCCGCACATCCCGGTCTGTACCCACACCTTCAAGGGTGTGAAGGGAATAAAAACACACCTA

ACAACAACTTTGTTTCATGATTTGGCGCGTCGGACCCTTTCTGACCGATGTCGTGCGCAACAATGGACCCA

TGAGTTCGCCTACCAAGATGCGCCGGAAGGGGACACGCGGCCCGAAACCTCGCAGCGACGAGGAGCTAA

CGGCTGTGATGTTCCGCGTCCCAGAGTCAGTGGCCGAACGTGTCAGCGATATGGCTTGGGAGCTGAGGCT

CTCCCGATCCGATCTTGTGGGCTGGTCGGCCCTCTATGCACTCAACTCGATGCTCAGACAGCGCGGAGAG

GACACGATTCCGGTTCCGGAGTATCTGGACAAGGCCGTGCTCGCTGCGTTGTATCCCGATGGGTTGCCCTT

CGACGAGGACACCGAGGAGCCGGGCGAGAATGCCGGGCAGGAGGAGCTTGCGATGACTGGATGAGCCC

GAACATGGTTGAAGGCCGCCCCGCCAGGCGACCTTCAATCAATGGTTTCGGTTGTCAGCTGCAGCCACCC

TTGCCAGGTGCTGTGGTTCTTCTCCAGAGGAGGAGGGACCGCCATGAAGACCCAGAAGACCTAGAAGAT

CCAAAAGAACCGGTTTCGGCTGTTGCTTCGGTCTTCATGGTAGCTGATAGCCCGCGTCGTTGGAAGTGCG

ACGACGCCGATCCTCATCGGTATCGCACCCTGTTCCAGGGTCGAGAATGTGAAGGATTAACAACCATGAC AAGTCATGAGACGCCCTCCCGGAGGGCGTCATGACCGCTTTAATTCAAGCTCTGCCGACAGCTGAACTGT

CTGCTGGACCTGGTGCTAGCAGTCCAGCTAGACCCTCTGCTGAGGGCTTCATCAAGATTCACCACGACCT

CATTAGTGCGGGCGTGTCGGGTAACGCGATGGCGTTGTTCGTCGCGTTACGTAACCAGCCCGGCTGTGAT

CAGTGGACCCGTCACTCGTACCTGCGGCTAGCCCAATGGTGCGGCTGGGATGGGCTGTCGGAGGCGGCG

GGCTGTAAGCGGGTGCAGCGGGCCGCTGCTGAGCTCGCTAGCGGTGGTTGGCTGGAATCGCGGGTCGGC

CATGATCGTCGCACCGCTAAGACGCTGGTGTGGCATCGGTTGACCAGCCCCGACACCGACCGCTGGGAGC

AATTGCCGCGGATTGTGTGGGCGAGGATCTGCCAGATCGCCGGGGAGACGTCGGGAGAGTGGGTGAGGC

ATTGGCTGGTGTGGCGGATGCTGGCCGGTCGTACTGGTGTGGCTCAGGCCCCTACGTCCATCGTGGCCCG

GTTCCTGGGCTGTTCTTCGCGCCAGGTCTCTCATATCCGTGGGGCTCTCGTTGATGCCGGTCTGCTCGGCT

GTGACGAGGTCTCGGGGGCGGCGAGCCGGGTGTGGTTCCCCTCGATGGCCGAGGAGTGTGCAGCGGATC

GTGAGGTGGTCGATGGGGCCGTCGTCGATGCTGAGGTGGGCTCTGGTGAAGGTGTCGAGGAGGGCGGGG

AACCCCTGTCGATTTTGTCCACCCACCCCTGTCGATTTTGTCCACCCACCCCTGTCGATTTTGTCCGCCAAG

TATTAGACAAACCATTAGACAGTGAATTAGACCCTGGGTCGCGTCAGCGTGTGAACTCACCAACGCGCGC

GCGCGCGGCGGCCGAGCCGCCGAAGCCAAAGAAACCCATACCACCAACGCCTGAACCAGCAGCCCCCGC

TTCAGACAGTCCTGTGTCAGCGCACGCTGATGAGGCTGCCGAGTTGGCGTGGCAGTTCGTGGGGTGGTGT

CCTCAGCTGGTAGGGGCACCGAAGAAGGTGCGTGGCCAGCTCCGCCAGATGGTCGCTGCCGAGATCCGC

CGGAATCCGGGCTGGCTGGATGCGCCAGCGTTGGAGGTTGTTGCCCAGCGGGTACGTGCTGAAGGTGCGC

TGGGGGTCCAGCACTGTGAGATTGTGCGAGCCGAGCTGCACGGGGTGATCGCCGACCAGAAGGCCGCCC

CCGCCCGCCCCGACGCCCTGCACGCGCGGGAGCCCAAGTGGTGGGACGACGTGTACTACGAAGGAAACA

CAACCGTGTGGTACGACTCTGACGAAACCAGTGACGACGACGAGGCGTGGAACCGGTCGCAGGTATGTC

ATGTTGCTGAGCGTGACGACATGGCTGGCGGGATTGCTACCAACCTGCTGGCCTCCCACGCTGATGATCC

GATGGCCTGGCTGACTCGCCGTCAAACCATGCTGATGGCTCGTTTCCCCCACGCCCAGAACGAGGTCATC

GCGATGTGCCACATCGTGCGCACCGCCCTGGAGGCCGACATGGCCGCCGGAACCCGGTGGGAGGACTGA

TGAGGGTCTCCCGGCGCGCCCTCATGGCCGTGGCCCGTGCCGACGCTGCCGCAGCAGACCATGCCACCGG

CCGATGGGTGGCCACAGCCAACGCCACCGTCGCCCGGCTGACCGGACTGTGCGAACGCACCGTCCAATA

CGCCCGCGCCACCCTGGTCCACCTGGGCCTGTGCCGCGTCGTGGCCACCGGCCGCTACCTCACCGCCGAC

GAGCGGCGCACGGCTGCTCGCACCCATGGCGGCCGCCAGATGCGCGCCGCCTCCACCCGCGTCCTCACCA

TGTCCTGCGCAATCGTTTGCGCCCTACCCCGAAGGGGTCACCACTACAGGAAAGTTAAGTTCCTAGATGG

TCACCAACGCACGCGCAGGCGCGTGCGAAGGCCAGCAACACCAGAGAAGAAACCCCTGTGGCTGCAAAA

ACTCGCAGCCCTCCTCGACCAGCACCTGCCCTGGCTGGTGAGAAACCATCACATCGGCCGACTGTGCCAC

GCCCTCACCGCCCTGGGCATCGACGAACACTGGCAACCCGCAGACCTCGACGCCCTCCTCGACGCCATGA

ACCGCAGGAACCGTCGCCTCGGCCTCGACGTGCCATGCGCCGACGACCAGCACAACCCCTTGGGACTGTT

CATCCATCAGGCCCGAGACACCCTCACCCACGACAACCCCCATGAACGCCGCCTAGCCCGTGACGCTGAA

CGCGCCCGGCTCATCGACGACCAACTCCGCCGCCGCGCAGAAACCGCCACCTGCGCAGCCCGCCTCGCA

GCCGAGCACGCCGACCCCGACTACCAGACCCGCCGTCGTGAACGCAGGGAAACCCTGCGAGCCACACTC

AGGGCCGCCCAGCAGCATGTCAGGACACACTGATACCCGCTCATACGCACACCATGAAACACGACAAGC

CACCTGACAGTATCAGCTGCAAGACGCATGACAACATAGAAGGACATGATGAAATACACATAGACACAA

CCCCGCACAGCAGTTTCGCAACAAATCATGATAGTCTCATGGCAGTATCGCTTGATACACACATAGCATC

ACTCCCACATAGGCAGTTATGCTGATATACTCCTACTAGGTTATCCGTCCAACATGCTGAGTGGGTTCCTG

TACAGCATGAAAGGAGCATGGCATGATATGGGCCGTTCTCAACTGCAAGGGTGGTGTCGGCAAGACGAC

CAGTGCCCTCCTGCTGGCGGCAGCCGCCGCCAAGCAGGGCCACACCACCCTGGTGGCCGACGCTGACCCC

CAGGGCACCGCATCCCAGTGGTCAGCCCTGGCAACCAAAAACGACGAACCCCTGCCCTTCCCGGTGCAA

GCGGTCAACATCGCCACCATGGAGGCACTGCCCACCACCACCGACGCCCATGATCTCATCCTCGTTGACA

CACCCCCCTCGGCAGGCGATCTGATGTTCCAGGCATGCCGCATCGCCGACCTCATCATCATCCCCACCGC

CACCTCCGGACCCGACATCTCCCGAACATGGGTCACCATGGACGCCACACAAGGCACACCACGCGCGAT

CCTCCTCACCCAAACCGAACACAACCGTGTCGTCTACCGCCAAGCTCGCACTGCCCTCGCCGCCGACGAC

ACCGTCGTTCTCCTGGACCACGACATCCCCCGCCGTGAATCCATCCGCACAGCATGGGGCACCAACCCCC

CAGACGACGTCATCACCTACTACCTGCCCGTCCTCAACGAACTCATGGAGGCCCTGTCATGACCACCAAG

AAAACCGACCCATTCGCCCGCCAGAAAGCAGCAGAAGACCGCGCCCACCAACTCCAAGACGAAGCCCAA

CGCCACGCCCACCCCAAACGCGTCATCGGCCCCACCGCACGATTCCAGTTCGTCCTGCCAGCCGACGTGC

TCACCGGCCTCAAACACCTCGCCCTCACCCGCGGCACCACCGCCCGCCAACTCACCCTCGACGCCCTCGA

CACCGCCTACGGCCTCGACACCCTCGCCAACAGCGGGAAGAAAACCCACCCATGACCCGTGGGTCCCCCT

GCCACCACCCCCTCGACGGCAACTGTGTGCGAGCCACAGGCCCGCACACAGGCGGCAGCCCAGTGCCGT

CCCCGCCAGGAAAGGAACTGAACTTTTCTGGAGTGCTGGCTCCCTATCACCCCTTATGGTGCTATCAGATC

CAGTAGCGCCAGCCCGAGAGGAAACCCATGAGCTACATCGTCCGCACCGGAAATCTAGCCGGCACCCCC

GAGCTGCGCGAGGGGTAGCCGACACGGCGGACCGTGCCCCTGACAGTAAGCGGCACTACTGGAGACATC

ACCATGACCGCTCAGATCCTCGCCCCGTGCAACCAGAAGGCTGCCGTCATCGAAGGAGCCCTGCCATGAA

CCAACCTACCCCCCACAAGGCCGACGAGTCACAGACGAGCAACACCACGAGGAAGTGGCGGCACAAGGT

GTCGTTCTACCAAGACCCGGCCGACACCGACCGAGTCCGCGGAGCGATCCTCCACACCATGACAACCGA

AGGCAACCGGAACCTGAGCCAGTTCGTCAACGATGCCGTCATGGCCAAGGTGACCGAACTGGAAGCAAA

ATACAACCACGGCGAGCCATTCCCCGCCGTGGGAGCCCGAGGACTCCCCCAGGGCGGCGCAGCCGCCAA

CAGATAAGAGGGCGGGGACCACCAATAGCAGTCGATTTCGGATCCAGATCGGGTAGACAGGACCCATGA TGAATTTCATATCCTCCCTGCTCTCGGCCATCCTGACCCTCTTTGCGATGGTAGCCGTGGCGATAGGAGTG

GTGAACATTGTGCCGGGAATATGCGCCATCATCGGTGCACGGAAATACGGCGACCAGGACCGTGTGCGG

GCAGGACAACGAAAGATCCTTCTTGGTGCTATCGCCTTGGTGGTAGCAGTAGGCATTCACCCGTGACCCA

CGGTTACCGGAAGCCCCGCCGCAATCGATACCACTGTCAGTACCATCAGGGGCGATAGGGGTCAAGCTCT

CCTTGTCACAATCCCTTCCCCGGCAGCCCAGTAACCGTCGCTTACAGCCATACATGGATATGCGCCCATTC

GTCGGCACCGACGCCGTGCGGGTTGGCGACGCTGACCCGTCTGCTCACAAACGACCCTTCCAGCCCAGCA

CCACCCACTACACCGACACGATCCACGAAGCTGAAACCGAACCTCCCATCCCCGTCCGAAACATCAACG

AACTCATCAACCCCACCAACCATGCATGAACGCACGATCGCCTACCGGCCAGCCTTCCTGCGCGACGTGA

AGCGGCTCAAAAACAAGCACTACAACATGAACACACACTCAAATGGGCGGTAAGGTCACGAAGTCGACG

TGGCTGCCTCACGGATGGCTTCGGCGAGCTCTTGGGGTCGACTCCACATGGGCCAGTGGCCGGTTGGCAG

ATCCATCGCGGTGAAGTTGGTCAGGTGCGCGACGGCGCTGAACATCGGATTGCCTGCTGCGGCCAGCTCG

AGGACCTGGACGCTGGGAATGGAGCAGCAGATCAACGTGGTTAGTACATCATGGCGAGCGCTATTGGAC

AGCGCGACCCGTGCCCGGGCCACTTGCGCGGGTTCAGGAACCGCCCGTGCCCGGAACCGGTCAAGGTGC

TCGTTGCTGAGGCCCTCTAAACTGGCCTGCTTGCCGAGAGTATCGAAGTCAGGAAGTGGCAGCTCAGCTG

TTTCCTCAGGTAGATCTGGTGCGAAGGCACCTCCATCGCTCATGGGACCGGAGTCCACCCAGACGATCCG

ATGGACCAACTCTGGGTGCCTGTCTACAACTAGGCTCACCGGCCCGTTCGCGCCACTGTGTCCCACCAGG

ACCGCATCGCCGCCCATCTCGTCCAGGATGGCTGAGATGGCGTCAGCTTGGTCGTCGAGCGTGCGCGTAG

TGCGCTGGGTGTCCTCCGGATCGAGGCCAGGCAGCGTCAGCCCCACGGCTCGACTGCCAGCAGTGTTCAA

TAACTCGACTACCTCGTCCCAAGCCCAGGCTCCGAGCCAGTAACCAGGAACGAGGACGATAGGCCGATG

CTGGTCAGGTCGCGATGTTGAAGTCATGGAGACATAGTTGCACAGTGCGCGGACAAGGGAGTGGCACTA

TTTCTGGCATGAATTTAGATCTGGGTGTCCGGTGAGGCGATCAGAACGCCTCCATGTACTGTCCGAGTGTC

TACGATGCAGCGGACACAGTCGAGCAGCTGGCTCACAAGTTTCCAGGTGTCCTTCTGCCCCTATGAGGGA

AGTCGGCTGCTCTCGCAACCTTTGAGGGCTGCTCTGGGGTCGGAACCAGTTACAGATCGTTCAAGTTCCG

GGAACTACCGCCGGTCACGCTGATTGATTCCCGGGCGATCTCGCTTCTGACGACAGTGGTCGGTAACCGA

GAGGCGTCCTACTCTGACCCCGCTGCTGCGGTGAGTAAATCACGGGCGTCCCGGATCCGGCCACCCGTCC

AAGTGCCAGCCAGCTTGATCGGCTAGGCATCGTCAAGGAGCGACGATGAGGTGATGATGCGATGTGAGC

GCACCGCGAAGTGAGGTATAAAGAAGCCTTCCCGGGCGCATGCGTCGCCCAGGAAGGCCAGGTTGGCCC

CTGGACGGCTGAATGGTTGGGCGGATCAGGCTGTAGCGGAGACGTGCAGTACCTCGTAGGCGATGGCGT

TGGTTGGGCTCTGGTCTGCATCGTGGCTACTGAGTTCGACGAGGATGACGGTCCAGGTGGTGATGTCGAC

GGCGGTGACGCGGGCGATGGTGGAATCAGTGGATGCTGCAAGGAAGTCGGCGGTTATGTCTTCGATGCA

GTGGGACGGAGCAGTGCTGGTGGGCAGGGGCACGGTCTTGACGGTCAGGCTTCGGGCAGCAGAGTAATC

GGCGGTTCCGTTAACAAGCTGGTGGACGGTCCAGTCCTGGATCGGGTGCCGGCCGAAGTCGCGTACGATA

GCCGAGTAACCAAGTTCGCCCCAGCAGAACTGGCGCATCCCCTCTATGTCGCGCCAGACGTAGAAGGGC

GCGTAGGAGTTCTGGGGTGCGCCTTTGACCTTTTCTTGGATGAGGTAGGCCTTGAACTCCAGTCCATGGTA

GCCGTCCATGAGGTGTCCAGTCTGGATGACGCGGTCGCGGATGATCTGCATGTCATAGTCGGTGGGCAGG

GTGATCTGATATTGCATGGCGTACATCAGCGGTTCTCCTTGGTTTCGTGGGAGTAGGTCGTGGGGATGAC

GGGTTCCTGCCAATCGATGGTTGACAAGTCGTCGGCGGCTTGTTGGTAGGTAAGGTGGATCATTGGCTGT

TTGAGTGCAGCGCCATGCCAGTGTCTCTGGCCGGCGTCGATCCAGATGGATTCGCCCTTGGTCAGGTGCT

GGGGTGCTTGTCCTTCAATATGGACCAGGGCAACGCCGCCCGTGACGTAGAGGCCCTGTCCCTTGGGGTG

TGTGCCTCAGCGGCAAACGTGACGGCGTGGGCGGCACGCCCGGCGTCTTCCGTGGCACGATCGGCCGGAT

CCATGGCGGCGCGCAGCTGCTGTTCTGCAGCCAGGCGTCCAGGTCACGGCGGGCAGCATCGACACCCAG

GGCAGCCTCGACGGCTTCAGGGCTACGACGCTGGCCGGGCTGGTTGACCGCAGACCACTGGTGCCGGGC

GTCGTCCAGATCATGGCCGGCGGCGTCGATGAGGGCGGTGGTGGCTTCGGCGCAGCATCGCCTGATCCAC

TCCGAACGTGACAGGCCAGCTGTCTCGGCGGCACTGTCAATGCGCGCCAGGAGAGATTTCATGGGCGCTC

ATCTGTAGCCTCCAGATAGGCGTTGATGTAGCGCAGAGCCTGATCCGTCATGTCGATGGCGGCTGCCTCG

GCAGACGACACAACGGGCTGTGGATGATAAGACCACCCAACATAGACGGCGAACATCAATTTCTCGACA

GCTTTCATGAGGTCCCCGGCGGCAACCGCATCCGCCTCATCATCCGAGGAGAACCACTTCAGGTCTGAAC

GGCTGTACATAGCCCCTAGGTCCTGATGTGGGTCGAGGTCCTTGGAATGATGGAAGTTCCTACACACCCA

TCGCCAAAGACCTCAACATGGACAACGCTACCTTCACCACTCCCTCATCTGTGAAGAGCCAGTTTATGCA

CGGTGTTGAAAGAGGCGTCGGTCTACGACGAATGCGGGTTAATGGTCTTGCGGTGTGGGGCGCTGGGCG

ATGGCATCGAGAACGCGTGAGTGGGTGGCGATCCATTCCGCGTCGGGGTTGATGTTGCGGGCGACGGTGT

CGATCGCTGTTACGTAGTGGGCAAGCCTGCGAATCTCAGCTTGTTGGTCAGGGTGATCGCTGATGAGAGG

CTCTTGATGGGAGGCGCGGTTACGGACGTGGCGGATGAGCTCCACGTTTTCCTCGAAGTCGCGTCGGCTA

CGCCCCGGGTAGTGAGGCATACCTCCGTTACGTAAGTCAGTGAGAGCTTTCCATACGGTTGCTTCCAGGC

GCGGGGTGAGCAGAAAGCGCCAGTTGTCCAGTGACAGACTCGCCACGATCTGGATCAGGGGTCGCATCG

AGTCCTCGCGCGCCCGCAGTCGCTTCTCGGCCCTGGCGACGTTACGCGGGAAACCACCGAGCCGATAGCT

CGGGGATTCCCACCAACGCCGTATGCCAGTATCGGCGCTCAGGCGCACGTCAATGAAGTTTCTCAGGAGT

ACCTCGACATGGCTGATGTCTTCCAAGAACGCTTTCGAGATGCGGGTGTTCCACACGTACCACGCATCGA

CTGGTTCGATCCGGTAGCGGCTGAGCCTGGCGGGTGAGAACCACTCCTGCAACGTCTCACGACTCACCGT

GGGAGCGTGGTAGGATTGATGACGATAGGCCTCGGGAAGGTCAATGCCGCGAAATATCGGTATACCCCC

GAGGTCATTGTTTTGCCCAGGCCCCTCCTCGCATACTTGCGGGGCGTCATTGGCTGCCGTCATCTCGTCTC

TTCCCGGTACGTGGCTGTCCATGTTCACGGGCAGGTACGGCAATGAGGTTCCCGCACACAAACCTCTACC AAGCATACGCTGGCAAGCCCCGACGAGACGACGCCTCCGCCCGCCACACCAACGGTCACCGCCACGGCC

ACGGTGACCGTGACCGTGGCACCGAAACCCAAGCCAAAGCCCAAGGCCAAGCCAAAGGTAAAACCCAA

ACCGAAGCCCAAGGCCCATTCATGATCGCAGTGCCCGATACAAGGTGGAGCGGCCCACACCAAGCTGGG

CCGCCACCTTCGTTTTCGGGACACCCTCGGCAACGAGGCGGCGAGCGCGGGCAAGCTGGCCCTCGCTCAA

TGCCGGTTTCCGGCCTCGATAGCGGCCCTGCTTCTTCGCCACCGCGATCCCCTCGGCCTGTCGTTCATGGA

TCAACGCCCGCTCGAACTCGGCCAAGGCACCCAGCAGATGCAACATGAGCTGGCTCACCGGATCAGCGG

ACCCCGGCCCATAGACCTGCCCTTCAAGGGCAGGCCCGTTATGCTGTCAGCAGATCTGCCAGTTGTGGGT

GCTGGTGTCGTAGCAGACGCCGGTGTCGGTGTCGTCGGTGCGGTTGGTGGCCCAGCCGGTGGTGGAGTCG

TCGAGGGTGATGTGGTGGAGGTCGGGTTGAGTGTTGAGCCAGTGAGTCCCCTCGGCTTGGGGTAGGCCAT

CGAGGATGGCTAGTAGGTGGGAGATGGTGG (SEQ ID NO. 12)

Type I lipase:

ATGAAGAAAAACTGGTTACTCACAACCCTCCTTGCCACAATGATGATCGCCATGGGCACGACGACCACCG

CCTTCGCCAGCCCGCCTACCGACATCACTCCCGAACATCCAGGCGGGGTTACCGCGCCTCACAGCCCCGA

CGGAATCCCCTCGAATATTGAGGGGCCAAGTATGCCCAGCTGGACCTCTGCAATCAGGTTCGCAATGAAG

AACCCCGGCACGAAAGTCCCGGGCACCAACGACTTCACCTGCAAACCGAGGAAAGGCACCCATCCCGTC

GTGCTCATCCCGGGCACATCCGAGGACGCCTTCATCACGTGGTCGTACTACGGTCCCCGCCTCAAGGCAG

CAGGATTCTGCGCCTACACGTTCAACTACAACCCGGAAACACATCCGCTTGTGGAAGCCGCTGAGACCAG

CGGCAACATCTACTCCACGGCAGCTTTCATGGCCCACTTCGTTGACAGAGTGCTCAAGGCAACCGGTGCT

CAGAAGGTCAACCTCGTCGGCCATTCTCAGGGCGGCGGCCCCCTGCCGCGCGCGTACATCAAATATTACG

GGGCGCCAAGAAAGTCCTCATCTCGTCGGTTTGGTTCCTTCCAACAGGGGAACACGCATGCTCGGCCTGG

AGAAGTTCCTCAATGCCAGCGGAAACCCGCTCAGCACTATCTTCAATGCTGCAGCACAGTTTCGAAAGCT

GGAATCCCTGCCCCAACAGTTGCAAGACTCCACATTTCTCAGGGAACTCAACGCGGATGGAATGACCGTC

CCCGGCATCACATACACCGTCATCGCCACCCAGTTCGACAACCGAGTATTTCCGTGGACTAATACCTTCAT

CAATGAGCCCGGGGTCAAGAACATCGTCATCCAAGACGTCTGTCCCTTGGACCACAGCGCCCACACGGAT

ATCCCTAGGACCCGATGACCCTTCAGATTGTCATCAACGCCTTGGACCCCGAGCGGGCCGCCCCGGTCAC

CTGCACCATTCGCCCATTCAGGCCCAGTTAG (SEQ ID NO. 13)

Type II lipase:

ATGAAGAAAAACTGGTTACTCACAACCCTCCTTGCCACAATGATGATCGCCATGGGCACGACGACCACCG

CCTTCGCCAGCCCGCCTACCGACATCACTCCCGAACATCCAGGCGGGGTTACCCGCCTCACAGCCCCGAC

GGAATCCCCTCGAATATTGAGGGGCCAAGTATGCCCAGCTGGACCTCTGCAATCAGGTTCGCAATGAAGA

ACCCCGGCACGAAAGTCCCGGGCACCAACGACTTCACCTGCAAACCGAGGAAAGGCACCCATCCCGTCG

TGCTCATCCCGGGCACATCCGAGGACGCCTTCATCACGTGGTCGTACTACGGTCCCCGCCTCAAGGCAGC

AGGATTCTGCGCCTACACGTTCAACTACAACCCGGAAACACATCCGCTTGTGGAAGCCGCTGAGACCAGC

GGCAACATCTACTCCACGGCAGCTTTCATGGCCCACTTCGTTGACAGAGTGCTCAAGGCAACCGGTGCTC

AGAAGGTCAACCTCGTCGGCCATTCTCAGGGCGGCGGCCCCCTGCCGCGCGCGTACATCAAATATTACGG

GGCGCCAAGAAAGTCCTCATCTCGTCGGTTTGGTTCCTTCCAACAGGGGAACACGCATGCTCGGCCTGGA

GAAGTTCCTCAATGCCAGCGGAAACCCGCTCAGCACTATCTTCAATGCTGCAGCACAGTTTCGAAAGCTG

GAATCCCTGCCCCAACAGTTGCAAGACTCCACATTTCTCAGGGAACTCAACGCGGATGGAATGACCGTCC

CCGGCATCACATACACCGTCATCGCCACCCAGTTCGACAACCGAGTATTTCCGTGGACTAATACCTTCATC

AATGAGCCCGGGGTCAAGAACATCGTCATCCAAGACGTCTGTCCCTTGGACCACAGCGCCCACACGGATA

TCCCTAGGACCCGATGACCCTTCAGATTGTCATCAACGCCTTGGACCCCGAGCGGGCCGCCCCGGTCACC

TGCACCATTCGCCCATTCAGGCCCAGTTAG (SEQ ID NO. 14)

Alanine dehydrogenase:

ATGCGTGTTGGTGTTCCTACTGAGGTTAAGAATAGTGAGTTTCGTGTGGCTGTGACGCCGGCGGGTGTTC

ATGCGTTGGTTGGTCGTGGTCATGAGGTGTTGGTTCAGGCTGGTGCTGGTGTGGGTTCGGGTATTCCGGAT

TCGGATTTTGTGGGTGCTGGTGCGCGGGTTGTGGGTGATGTGGAGTCGGTGTGGGGTGATGCTGATTTGG

TGTTGAAGGTGAAGGAGCCTGTTGCGGAGGAGTATGGGCGGTTGCATGAGGGTTTGGTTCTTTTTACGTA

TCTTCATTTGGCTGCTGATGAGGCGTTGACTCGTGAGCTTTTGGGGCGTGGGGTGACGTCGATTGCGTATG

AGACGGTGGAGTTGGCTGATCATTCGTTGCCGTTGTTGTCTCCGATGTCGGAGATTGCGGGTCGGTTGGCT

GCTCAGGTGGGTGCGAATTGTTTGTTGCAGTCTGCTGGGGGTCGTGGTGTGTTGTTTGGTGGTGGTTCGGG

TGTGCGTCGTGGTCGGGTGAGTGTGCTTGGTGGTGGTGTGGCTGGGTTGTGTGCGGCTCGTGTGGCTGCG

GGTATGGGTGCTGATGTGACGGTGTTTGATGTGGATGTGGCGCGGATGCGTTATATCGATGAGGTGTGGG

GTGGGCGTATTGGTACGCGGTTTTCGAGTCCGTTGGCGGTTCGGGAGGCGTGTGGTGAGTCTGATGTGGT

GATTGGGTCGGTGTTGGTGCCTGGTGCTCGGACTCCGCATTTGGTGGATCATGAGATGGTGTTGGGGATG

GTGCCGGGGTCGGTGTTGGTGGATGTTGCGGTGGATCAGGGTGGGTGTTTTGAGGATTCTCATCCGACGA

CGCATGCGGATCCGACGTTTGTGGTGGGGGGTTCGGTGTTTTATTGTGTGGCGAATATGCCGGGTGCGGT

GCCGCATACGTCGACGTATGCGTTGACGAATGCGACGATGCGGTATGTGTTGTTGTTGGCTGATGAGGGT

TGGAGGGGTGCGTGTGGGTCGCGTGATGATTTGCGGCGTGGTTTGGCGACTTGTGATGGGAAGTTGGTGA

GTGCGCCGGTGGGTGAGGCGTTGGGTATTGAGTGTGTGCCTGTGTCTGAGGTGTTGTGA (SEQ ID NO. 15)

ABC transporter:

ATGGACAAACCAGCGATAGAGATACGCGATCTCGTCAAGTCGTTCCCCCAGGCCGGCAGCCGCGAACGC CTCATTGCCGTCGACCACTTGTCAATGACGATCAACCGCGGAGAGGTCGTGGCCTTCCTCGGGCCCAACG

GCGCCGGTAAATCCACGACCGTCGACATGCTCCTTGGCATGACCAGACCCGACAGTGGGAAGGTCACTGT

CCTGGGCTCCGATCCGAGAACAGCCGCCCGTACTGGTTGCATCAGCGCCGTCTTTCAAACTGGCGGACTG

CTACCCGACTTCACCGTCGCAGAGACCATGAAGGCCATCGCTGCCGCACACGGGCAGCGCTCGAGGGTC

AAGCCCCTCACCGAGAGGTGGGAGTTGGCCCCATTCGCCGGAACCAAGGTCGGCAAATGCTCGGGGGGG

GGGTCAGCGGCAGCGACTTCGTTTCGCCCTCGCGATGCTGCCTAACCCCGATGTGCTTATTCTCGACGAGC

CGACAACCGGTCTGGACGTTGAAGCTCGTCGACGCTTCTGGCAGGTCATGGGTGAGGAGGCCGACGCCG

GACGTACGGTCATTTTCGCCACCCACTACATCGAGGAGGCCGATTCCTTCGCCCGTCGCGTCGTCCTCGTC

AGTGGTGGACAGCTCGTCGCGGACGGTCCCATCAATGAGGTTCGCGCCTCGGTGTCCGGATCCACTGTCA

GAGCGACTCTCACTGATCCCTCCGTACTGGCCGAGGGTCTGCGCACCTTCCCTGGGATTAACGACATCAC

CGTCCAGGGCCAGCAACTCATCGTGCACACTAGTCAGCCTGACGACCTGGCACGTCACCTTCTGACCTAC

ACCGACGCTCACGGGCTGCTCATCTCGACGATGACCCTTGAGGACGCCTTCGTCCGGCTCACAGGCTCCA

ATGATTCCCGTGACGATGTTGACGACTGGGAGGCAGCAGCATGA (SEQ ID NO. 16)

DNA-binding response regulator:

ATGATCGATAAGACCATGATCAAGCTCGTGCTGGCCGACGACCAGACCCTCGTACGCGGCGCTCTGGCAG

CCCTGCTTAGCATGGAGAACGACCTGGAGATCGTTGGTACGTGTGGTCGGGGAGACGAGGTGTTCGCCCT

TGTGCAGGCCACCCATGCCGACGTGTGTCTGCTCGACATCGAGATGCCAGGTATCGACGGGATCACCGTC

GCCGCTGAGCTGAGAGACCAGGCATCGTGGTGTCGAGTTCTCATCGTGACGACCTTCGGGCGGCCGGGTT

ATCTGCGGCGGGCCATGGATGCCGGTGTGGCTGGGTTCCTCGTCAAGGACACCCCAGCTGAGGACCTGGC

CCGAGTGGTGCGCGAGGTCCATGCCGGAGGTCGAGTTATCGACCCAGCTTTGGCCGCCGAATCCCTCATC

GAGGGACACAATCCCTTGTCGGAGCGGGAACGGGAGATTCTGCGGCTGGCCGAGTCGGGGGCCTCCATC

TCCCTCATCGCCTCCCAGCTCTATCTGTCGGTGGGCACGGTGCGCAACCACGTGTCCTCGGCCATCGGCAA

GACGGGTGCTGCGAATCGCACCGAGGCTGCCGTCACGGCTCGACAGCGGGGGTGGTTGTGA (SEQ ID NO. phosphoglycerate kinase:

GTGAGTCGCATCGTCATCGTCAGGCACGGGCAGTCGACGTGGAATCGTCAAGGGCGCATCCAAGGGCAG

ACAATGGGTATTCCCCTGACGATGCTCGGGAGACGCCAGGCTCGCCAGGCCGCTCACACGGTGGCAGGTC

TGGTACCCCACGACACCCCGATCATCGCCTCCGACCAGAAGCGGGCGCGTCAGACAGCTCGTCCTATCGC

GCGGGTGCTGGGCGTACCAGCGACGACCGATCCACGGCTGCGCGAGCAAGGGTTGGGAGCCATGGAGGG

TCACACCGCGGATGATCTCGAGCCCCTTCCCCAGCCAACGGGTGTACATCCGGCCGACGTGCGATGGGCT

GGTGGGGAGTCGCTCGCGGATGTGGCGGAGAGGTGCCGCAGCCTGTTGGATGACGTGGCAGCTCGCGAC

CTACCGGCGATCGTCCTCGTCACCCACGGTGACACCATGCGGGTCCTGCTGGGGATTCTCGACGGTCGCA

GTCACCGCGACCTCGACTGGGACCTTCCACTGACGAACGGAAGTGTCATAGCGCGAGATGTGAACCTCAG

CGAGTCGCATCGGCGGCTTTCGCTGTCGTAA (SEQ ID NO. 18)

dermatan-sulfate adhesin:

ATACGTCGGTCAAGAATTGCTGTCGCTGCTGCGACGGCTACTGCGCTGGTCGGATCAATCGCAGCAATCA

CCCCCTCCCCCCCCCCCCCAGGCAGAAGCTAGCTCCAATAGGCCACGCTCGGTAGCTCAAGCCGCTATCG

CCACGGATGGAAAGGGGATAATCGACAAGGACTGCCGTGATGCAGTCATCAACGATGCAAAGCTACGTG

CCGCGATTGCCGGTGCGTTGGTTAAGGCTGGATTTAGTTCCGCCGACGCGGTGGCTCTAGCGCCGCGTAT

TGCCAAAGAAATGGCAAAAGAGGGCGTCCTCCTCATCAACCACCACAAGCTAAAGGCTCTCATCGGAGC

CCAGCTGGGTCTGCTCACTGATGCGAAGATCCAGCGTGCTGCCGCTGCAGTGGACCTCGGCATCAAAGCC

ACTCTAGCTGCGACAATCATTCCCAACGCGCTGCATTCAGCGGCATTCAAGGATGCGGTGGTCGCAAACC

TTGTCGCCGCCGGCGTTGACAAGAAGTTGGCAAAGGCTACGGCTGTCGCCATTGCCGCAACTGCGCTCAA

TCCCGCTCTCGGGCCGATCGCAAAGACTGAGGCTATTAAGGCCGAGATCGCTGCCCAGGCAGCTCTCCTG

GTGGGCAGGGGCGTGCACCTCAAGAAAGCAGCCATCGAACATATCATCGGTCGGAGTTTCGACGCTGCC

GTTGCCACGGCAATCGTCAGTTCTCCCATCCTAAATGCGCGTATCGTCACCCACTTGGTTAGGGCTGGGAT

AGACAAGTCCCTTGCAGTCCAGATCGCACCTC

GCATTATCGATCGGCTGGCCAAGGAGCCGCTTCTTGCGCTCAACACCGCCAAGCTCATGAAGAACATCAC

TCGACAGATTGTTGACGTTATCACCGCCGACAAAGCTATCAAGACTGCTGAGCAGCTCGAGAAAGAACTG

CCGGCTCTGGACGACCTTGTGAAGAAGGCTTGCTCCTGCCCGAAGCCGACTCCTACTCCGACTCCCACTC

CTACTCCAACACCAAAACCAACCCCAACTCCAACACCAAAACCAACCCCAACACCGAAGCCAAAGCCAA

CCCCGGCTCCGGCTCCGACTAGTGGGGCGACCTCTGATGAGTCGACCAGCCGCTCGGGAGGCCATTCGCA

GGGTGGCTCCGGGACTCATTACATCCATCACGGTGTTGCCCCTGTGCTGACCCACTCAAGTGATCTTCCGT

CAACGGGATTCTGA (SEQ ID NO. 19)

dermatan-sulfate adhesin:

ATGCGTCGAACAAGAATCACTGTGGCAGCTGTGACAGCAACTGCCTTAATCGGCTCACTATCAGCTATCA

CCCCCTCCCCGCGAATGCTGCTTCTAACGGGAACAGCTCCATAACCCAGTCAGCTGCCTTCAGCCCCCGC

GCCACGACAAAGATCAGCGAGGACTGCCGCAAAGCCATCATCAACGACCTGAAACTGCGCGGCGCGATC

GTCGGAGCACTCGTCAAGGCTGGACTCAGCGCAGCCGACGCAGCCGCCCTGGCCCCCCGTATCGCCGCCG

AAATGGCAGCGGAGGGTACCCTTACCATCAACCATCACCGACTGAAGGTCCTCGTCGCTTCCCAGCTGGG

CCTCGTAGCAGACGCTGCGGTCCAACACGCAGCTGCAGCCATCGACCTCAGCTTCAAGGCCATCCTAGGC GCGTCGATCATCCCCAACGCACTAGGATCAGCCGCGTTCAAGAACGCGGTCATCGCAAACCTCGTCGCTG

CTGGTATCGACAAGCACCTGGCACGAGCCACCGCCGTGGCGATCGTCGCCACCGCACTGAACCCCGCCCT

CGGGCCCATCGCGAAGTTCGAACTCATCAAAGCTGAGATCGCCGCCCAAGCAGCTCTTCTCATCCGAAGG

GGCGTCCATCTCCAGAAGGCAGCCATCGAGCACGTCATCGGCCGCGCCTTCGACGCCGCTGTCGCGACCG

CGATTATCAGCTCTCCGATCCTGAGTGCACGCATCGTCACTCACCTGGTCAGGGCTGGAATAGACAAGTC

CATTGCCATCAGCCTTGCACCGCATATCGTCAAGCGCCTGGCCAAGGAGCCGCTACTGGCGTTCAACACC

GCCAAGCTCGTCAAGGACATCGCCCGGCAAATCGTCGACATCCGCAACACCCAGGAAGCCATAGCAGTC

TACAAGCAACTCAAGGCTGAACTACCAACCCTGGACGGACTCGTGCAGAAGGCCTGCACCCCCGAGCCG

ACTCCTACGCCGACCCCGACTCCTACGCCGACACCGACACCGGCTCCGACACCGACACCGGCTCCGACAC

CGACACCGGCTCCGACACCGGCTCCGACACCGACACCGGCTCCGACACCGACACCAACGCCCACTCCAA

CACCGACCCCAACCCCAACCCACGGGGCCACAACCACCACGCCGATCAGCCGGACAACGGACCGCCACA

ACCTCGGGTCTCATCACACCCGCATCGCGGCCCCCGCACTGATCCACGCGAAGGCCCTCCCAGCAACAGG

AACGGGAGCCTGA (SEQ ID NO. 20)

Hyaluronidase:

ATGGCGCTCGCCGCTTCTCCCACAGTGACGGACGCCATTGCCGCCCCCGGGCCCGACAGCTGGTCGGCGC

TGTGCGAGCGATGGATCGACATCATCACCGGACGCAGAGCCGCCCGGACCTCTGACCCACGTGCCCGAG

CGATCATCGCCAAGACCGACCGGAAGGTCGCCGAGATCCTCACCGACCTCGTATCCGGCTCGAGCCGTCA

GACCGTTCTGATCTCGGCAGACCTCCGCAAGGAGCAGTCGCCCTTCATCACCAAGACAGCCCGAGCCATC

GAGTCGATGGCCTGCGCCTGGGCCACACCCGGGTCCAGCTACCACAAGGATCCCGAAATCCTCTCCGCGT

GCATCGAGGGGCTCAGGGACTTCTGCCGACTTCGGTACAACCCCTCCCAGGACGAGTATGGGAACTGGTG

GGACTGGGAGGACGGCGCGTCAAGAGCTGTCGCCGATGTCATGTGCATCCTGCACGACGTCCTGCCGCCC

GAGGTCATGTCCGCAGCGGCAGCCGGCATCGACCACTTCATCCCCGACCCCTGGTTCCAGCAGCCGGCGT

CGGTCAAGCCCACTGCCAACCCCGTTCAGCCCGTGGTCTCGACAGGCGCGAATCGCATGGACCTGACCCG

TGCCGTCATGTGCCGTTCCATCGCGACCGGCGACGAGAAGAGGCTGCGTCATGCCGTTGACGGATTGCCT

GACGCCTGGCGCGTCACCACCGAAGGTGACGGTTTCCGTGCCGACGGCGGATTCATCCAGCACTCCCACA

TCCCCTACACCGGCGGCTACGGCGACGTCCTGTTCAGCGGACTGGCAATGCTCTTCCCGCTGGTCTCCGG

GATGAGGTTCGACATCGTCGAATCGGCTCGTAAGGCTTTCCACGACCAGGTCGAACGCGGCTTCATCCCC

GTCATGTACAACGGCCAGATCCTCGACGACGTGCGCGGCCGATCCATCTCGCGCATCAACGAGTCTGCCG

CCATGCACGGCATCTCGATCGCCCGTGCCATGCTCATGATGGCTGATGCCCTGCCGACACACCGCGCCGA

ACAGTGGCGAGGGATCGTGCACGGTTGGATGGCTCGAAACACCTTCGATCACCTGTCCGAGCCGTCCACC

CTTGTCGACATCTCCCTGTTCGACGCCGCCGCCAAGGCGCGCCCCGTCCCGGAGTCGTCGACGCCGAGCT

ACTTCGCGTCCATGGACCGTCTCGTCCACCGCACCGCGGACTGGCTAATCACCGTCTCCAACTGTTCGGAT

CGCATTGCCTGGTACGAGTACGGCAACGGGGAGAACGAATGGGCGTCCAGGACCAGCCAGGGAATGCGT

TACCTCCTGCTGCCCGGAGACATGGGACAGTACGAGGACGGGTACTGGGCCACCGTCGACTACTCAGCAC

CGACGGGGACGACGGTGGACTCCACTCCGCTCAAACGCGCCGTCGGAGCCTCGTGGGCGGCCAAGACCC

CGACCAACGAATGGTCCGGGGGCCTCGCATCGGGGTCGTGGTCTGCCGCCGCGTCCCACATCACCTCCCA

GGACTCCGCCCTCAAGGCACGCCGCCTATGGGTGGGTCTGAAGGACGCCATGGTAGAGCTGACGACCGA

CGTGACCACCGACGCATCGCGGGCCATAACCGTCGTCGAGCACCGCAAGGTGGCCAGCTCGTCGACGAA

ACTCCTCGTCGACGGCAACCGGGTCTCATCCGCGACCTCCTTCCAGAACCCCCGGTGGGCCCATCTGGAC

GGAGTCGGCGGTTACGTCTTCGCCACTGACACCGATCTCTCCGCAGATGTGGCGACGAGAAAGGGAACGT

GGATCGACGTCAATCCCTCCCGCAAGGTCAAGGGGGCTGACGAGGTCATCGAGCGCGCCTACGCATCCCT

GCACGTCACCCACCACGATCGTCCAGTCGCGTGGGCGCTGCTTCCCACTGCCAGCCGTTCCCACACGATG

GCCCTGGCCACGCGCCCAGGAGTCGAGCCGTTCACCGTGCTCCGGAATGACGCAACCGTCCAGGCCGTCC

GCTCTGCGGGTGCCCTCTTGACGAAGGACCCCACTGTCGTCACCACCTTGGCTTTTTGGAAGCCAGCTACC

TGCGGCGGCGTGGCAGTTAACCGTCCTGCGCTGGTGCAGACTCGGGAGAGCGCAAACCAAATGGAGGTC

GTCATCGTCGAACCCACCCAGAAGAGGGGATCACTTACCGTAACTATTGAGGGAAGCTGGAAGGTCAAA

ACCGCAGATAGCCACGTTGATGTCAGCTGCGAAAACGCGGCCGGGACTCTGCATGTCGACACGGCGGGG

CTAGGCGGCCAGTCCGTGCGAGTAACGCTGGCACGCCAGGTAACTCAAACTCCCTCCGGCGGCGGCCGC

CACGACCGAGCCTGA (SEQ ID NO. 21)

transposase 2:

ATGACAGACAGGTCCTATCCGGCGATGATCCGGCTTCGGCGCAACGCCTGGACCGAGTTCGTCCCGTTCC TGGATTACGACGTCGAGATCCGCAAGATCCTCTGCTCGACGAACGCGATCAAGTCGTTGAACACCCGCTT

CCGCACGGTCATGCGGGCGCAGGGTCATTTCCCGACGCGCTGA (SEQ ID NO. 22)

23 S rRNA (P. acnes _KPA171202_RT1_2): AGTCGGTCCC AAGGGTTGGG CTGTTCGCCC

ATTAAAGCGG CACGCGAGCT GGGTTCAGAA CGTCGTGAGA CAGTTCGGTC CCTATCCG (SEQ ID NO.

33)

23 S rRNA (P. ac«es_KPA171202_RTl_3): AGTCGGTCCC AAGGGTTGGG CTGTTCGCCC

ATTAAAGCGG CACGCGAGCT GGGTTCAGAA CGTCGTGAGA CAGTTCGGTC CCTATCCG (SEQ ID NO.

34)

23 S rRNA (P. acnes ATCC 11828 RT2 1): AGTCGGTCCC AAGGGTTGGG CTGTTCGCCC ATTAAAGCGG CACGCGAGCT GGGTTCAGAA CGTCGTGAGA CAGTTCGGTC CCTATCCG (SEQ ID NO.

35)

23 S rRNA (P. acnes ATCC 11828 RT2 2): AGTCGGTCCC AAGGGTTGGG CTGTTCGCCC

ATTAAAGCGG CACGCGAGCT GGGTTCAGAA CGTCGTGAGA CAGTTCGGTC CCTATCCG (SEQ ID NO.

36)

23 S rRNA (P. avidum 44067): AGTCGGTCCC AAGGGTTGGG CTGTTCGCCC ATTAAAGCGG

CACGCGAGCT GGGTTCAGAA CGTCGTGAGA CAGTTCGGTC CCTATCCG (SEQ ID NO. 37)

23 S rRNA (P. acidipropionici ATCC 4875): AGTCGGTCCC AAGGGTTGGG CTGTTCGCCC

ATTAAAGCGG CACGCGAGCT GGGTTTAGAA CGTCGTGAGA CAGTTCGGTC CCTATCCG (SEQ ID NO. 38)

23 S rRNA (S. aureus 04-02981): AGTCGGTCCC AAGGGTTGGG CTGTTCGCCC ATTAAAGCGG

TACGCGAGCT GGGTTCAGAA CGTCGTGAGA CAGTTCGGTC CCTATCCG (SEQ ID NO. 39)

23 S rRNA (S. aureus Bmb9393) : AGTCGGTCCC AAGGGTTGGG CTGTTCGCCC ATTAAAGCGG

TACGCGAGCT GGGTTCAGAA CGTCGTGAGA CAGTTCGGTC CCTATCCG (SEQ ID NO. 40)

23 S rRNA (S. aureus FDA209P) : AGTCGGTCCC AAGGGTTGGG CTGTTCGCCC ATTAAAGCGG

TACGCGAGCT GGGTTCAGAA CGTCGTGAGA CAGTTCGGTC CCTATCCG (SEQ ID NO. 41)

23 S rRNA (S. epidermidis ATCC 12228): AGTCGGTCCC AAGGGTTGGG CTGTTCGCCC

ATTAAAGCGG TACGCGAGCT GGGTTCAGAA CGTCGTGAGA CAGTTCGGTC CCTATCCG (SEQ ID NO.

42)

23 S rRNA (S. epidermidis PM221): AGTCGGTCCC AAGGGTTGGG CTGTTCGCCC ATTAAAGCGG

TACGCGAGCT GGGTTCAGAA CGTCGTGAGA CAGTTCGGTC CCTATCCG (SEQ ID NO. 43)

Type I lipase:

GTAGATACAGATACATCTGAGGAGATCCATGAAGAAAAACTGGTTACTCACAACCCTCCTTGCCACAAT

GATGATCGCCATGGGCACGACGACCACCGCCTTCGCCAGCCCGCCTACCGACATCACTCCCGAACATCCA

GGCGGGGTTACCGCGCCTCACAGCCCCGACGGAATCCCCTCGAATATTGAGGGGCCAAGTATGCCCAGCT

GGACCTCTGCAATCAGGTTCGCAATGAAGAACCCCGGCACGAAAGTCCCGGGCACCAACGACTTCACCT

GCAAACCGAGGAAAGGCACCCATCCCGTCGTGCTCATCCCGGGCACATCCGAGGACGCCTTCATCACGTG

GTCGTACTACGGTCCCCGCCTCAAGGCAGCAGGATTCTGCGCCTACACGTTCAACTACAACCCGGAAACA

CATCCGCTTGTGGAAGCCGCTGAGACCAGCGGCAACATCTACTCCACGGCAGCTTTCATGGCCCACTTCG

TTGACAGAGTGCTCAAGGCAACCGGTGCTCAGAAGGTCAACCTCGTCGGCCATTCTCAGGGCGGCGGCCC

CCTGCCGCGCGCGTACATCAAATATTACGGGGCGCCAAGAAAGTCCTCATCTCGTCGGTTTGGTTCCTTCC

AACAGGGGAACACGCATGCTCGGCCTGGAGAAGTTCCTCAATGCCAGCGGAAACCCGCTCAGCACTATC

TTCAATGCTGCAGCACAGTTTCGAAAGCTGGAATCCCTGCCCCAACAGTTGCAAGACTCCACATTTCTCA

GGGAACTCAACGCGGATGGAATGACCGTCCCCGGCATCACATACACCGTCATCGCCACCCAGTTCGACAA

CCGAGTATTTCCGTGGACTAATACCTTCATCAATGAGCCCGGGGTCAAGAACATCGTCATCCAAGACGTC

TGTCCCTTGGACCACAGCGCCCACACGGATATCCCTAGGACCCGATGACCCTTCAGATTGTCATCAACGC

CTTGGACCCCGAGCGGGCCGCCCCGGTCACCTGCACCATTCGCCCATTCAGGCCCAGTTAG (SEQ ID NO.

23)

Type II lipase:

GCAGATGCATCTGAGAAGATCCATGAAGAAAAACTGGTTACTCACAACCCTCCTTGCCACAATGATGATC

GCCATGGGCACGACGACCACCGCCTTCGCCAGCCCGCCTACCGACATCACTCCCGAACATCCAGGCGGG

GTTACCCGCCTCACAGCCCCGACGGAATCCCCTCGAATATTGAGGGGCCAAGTATGCCCAGCTGGACCTC

TGCAATCAGGTTCGCAATGAAGAACCCCGGCACGAAAGTCCCGGGCACCAACGACTTCACCTGCAAACC

GAGGAAAGGCACCCATCCCGTCGTGCTCATCCCGGGCACATCCGAGGACGCCTTCATCACGTGGTCGTAC

TACGGTCCCCGCCTCAAGGCAGCAGGATTCTGCGCCTACACGTTCAACTACAACCCGGAAACACATCCGC

TTGTGGAAGCCGCTGAGACCAGCGGCAACATCTACTCCACGGCAGCTTTCATGGCCCACTTCGTTGACAG

AGTGCTCAAGGCAACCGGTGCTCAGAAGGTCAACCTCGTCGGCCATTCTCAGGGCGGCGGCCCCCTGCCG

CGCGCGTACATCAAATATTACGGGGCGCCAAGAAAGTCCTCATCTCGTCGGTTTGGTTCCTTCCAACAGG

GGAACACGCATGCTCGGCCTGGAGAAGTTCCTCAATGCCAGCGGAAACCCGCTCAGCACTATCTTCAATG

CTGCAGCACAGTTTCGAAAGCTGGAATCCCTGCCCCAACAGTTGCAAGACTCCACATTTCTCAGGGAACT

CAACGCGGATGGAATGACCGTCCCCGGCATCACATACACCGTCATCGCCACCCAGTTCGACAACCGAGTA

TTTCCGTGGACTAATACCTTCATCAATGAGCCCGGGGTCAAGAACATCGTCATCCAAGACGTCTGTCCCTT

GGACCACAGCGCCCACACGGATATCCCTAGGACCCGATGACCCTTCAGATTGTCATCAACGCCTTGGACC

CCGAGCGGGCCGCCCCGGTCACCTGCACCATTCGCCCATTCAGGCCCAGTTAG (SEQ ID NO. 24)

Bold characters in the lipases sequences highlight the sequence variation between Type I and

Type II lipase.

[00109] Further provided are primers useful for amplifying a nucleic acid of a target molecule described herein. In some instances, the primers hybridize to at least one of deoR, 23 S rRNA, and/or a nucleic acid of: Cas5, pIMPLE, Type I lipase, Type II lipase, alanine dehydrogenase, ABC transporter, DNA-binding response regulator, phosphoglycerate kinase, dermatan-sulfate adhesin, hyaluronidase, and/or transposase 2. In some instances, the primer comprises SEQ ID NO: 1. In some instances, the primer comprises at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 1. In some instances, the primer comprises SEQ ID NO: 2. In some instances, the primer comprises at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 2. In some instances, the primer comprises SEQ ID NO: 4. In some instances, the primer comprises at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 4. In some instances, the primer comprises SEQ ID NO: 5. In some instances, the primer comprises at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%), 97%), 98%) or 99% sequence identity to SEQ ID NO: 5. In some instances, the primer comprises SEQ ID NO: 7. In some instances, the primer comprises at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 7. In some instances, the primer comprises SEQ ID NO: 8. In some instances, the primer comprises at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 8. Exemplary sequences for the primers are seen in Table 3.

[00110] Further provided are probe or reporter sequences that hybridize to a target molecule described herein. In some cases the probes are reporters that comprise a dye label on one end and a quencher on the other end. When the probes are hybridized to the target DNA, an added DNA polymerase may cleave those hybridized probes, separating the reporter dye from the quencher, and thus increasing fluorescence by the reporter. Exemplary deoR and Cas5 probe sequences are shown in Table 3. The probes may be used to detect and/or quantify the presence of a target nucleic acid in a given sample.

[00111] In some instances, the probe comprises SEQ ID NO: 3. In some instances, the probe comprises at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 3. In some instances, the probe comprises SEQ ID NO: 6. In some instances, the probe comprises at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 6. Examples of molecules that are utilized as probes include, but are not limited to, RNA and DNA. The term "nucleic acid probe" refers to any molecule that is capable of selectively binding to a specifically intended target nucleic acid polymer. In some instances, probes are specifically designed to be labeled, for example, with a radioactive label, a fluorescent label, an enzyme, a chemiluminescent tag, a colorimetric tag, or other labels or tags that are known in the art. In some instances, the fluorescent label comprises a fluorophore. In some instances, the fluorophore is an aromatic or heteroaromatic compound. In some instances, the fluorophore is a pyrene, anthracene, naphthalene, acridine, stilbene, benzoxaazole, indole, benzindole, oxazole, thiazole,

benzothiazole, canine, carbocyanine, salicylate, anthranilate, xanthenes dye, coumarin.

Exemplary xanthene dyes include, e.g., fluorescein and rhodamine dyes. Fluorescein and rhodamine dyes include, but are not limited to 6-carboxyfluorescein (FAM), 2'7'-dimethoxy-4'5'- dichloro-6-carboxyfluorescein (JOE), tetrachlorofluorescein (TET), 6-carboxyrhodamine (R6G), Ν,Ν,Ν; N'-tetramethyl-6-carboxyrhodamine (TAMRA), 6-carboxy-X-rhodamine (ROX).

Suitable fluorescent probes also include the naphthylamine dyes that have an amino group in the alpha or beta position. For example, naphthylamino compounds include 1- dimethylaminonaphthyl-5-sulfonate, l-anilino-8-naphthalene sulfonate and 2-p-toluidinyl-6- naphthalene sulfonate, 5-(2'-aminoethyl)aminonaphthalene-l -sulfonic acid (EDANS). Exemplary coumarins include, e.g., 3 -phenyl -7-isocyanatocoumarin; acridines, such as 9- isothiocyanatoacridine and acridine orange; N-(p-(2-benzoxazolyl)phenyl) maleimide; cyanines, such as, e.g., indodi carbocyanine 3 (Cy3), indodicarbocyanine 5 (Cy5), indodicarbocyanine 5.5 (Cy5.5), 3-(-carboxy-pentyl)-3'-ethyl-5,5'-dimethyloxacarbocyanine (CyA); 1H, 5H, 11H, 15H- Xantheno[2,3, 4-ij : 5,6, 7-i'j ']diquinolizin-18-ium, 9-[2 (or 4)-[[[6-[2,5-dioxo-l- pyrrolidinyl)oxy]-6-oxohexyl]amino]sulfonyl]-4 (or 2)-sulfophenyl]-2,3, 6,7, 12, 13, 16,17- octahydro-inner salt (TR or Texas Red); or BODIPYTM dyes. In some cases, the probe comprises FAM as the dye label.

Table 3. Select P. acnes primer and probe sequences.

[00112] In some instances, primers and/or probes described herein for detecting a target molecule are used in an amplification reaction. In some instances, the amplification reaction is qPCR. An exemplary qPCR is a method employing a TaqMan™ assay.

[00113] In some instances, qPCR comprises using an intercalating dye. Examples of intercalating dyes include SYBR green I, SYBR green II, SYBR gold, ethidium bromide, methylene blue, Pyronin Y, DAPI, acridine orange, Blue View or phycoerythrin. In some instances, the intercalating dye is SYBR. In some instances, a number of amplification cycles for detecting a target molecule is about 5 to about 30 cycles. In some instances, the number of amplification cycles for detecting a target molecule is at least about 5 cycles. In some instances, the number of amplification cycles for detecting a target molecule is at most about 30 cycles. In some instances, the number of amplification cycles for detecting a target molecule is about 5 to about 10, about 5 to about 15, about 5 to about 20, about 5 to about 25, about 5 to about 30, about 10 to about 15, about 10 to about 20, about 10 to about 25, about 10 to about 30, about 15 to about 20, about 15 to about 25, about 15 to about 30, about 20 to about 25, about 20 to about 30, or about 25 to about 30 cycles.

[00114] P. acnes ribotype determination

[00115] In some instances, presence of deoR target nucleic acid sequence is indicative of a ribotype (RT) of a health-associated P. acnes bacteria. In some instances, the ribotype is at least one of RT2, RT3, RT6, and RT1. For example, presence of deoR target nucleic acid is indicative of a health-associated P. acnes having RT2. In some instances, presence of deoR target nucleic acid is indicative of a health-associated P. acnes having RT6. In some instances, presence of deoR target nucleic acid is indicative of a health-associated P. acnes having RT1.

[00116] In some instances, presence of a CRISPR-associated target nucleic acid is indicative of a ribotype (RT) of a health-associated P. acnes bacteria. In some instances, the ribotype is at least one of RT2, RT6, and RT1. In some instances, the presence of CRISPR-associated target nucleic acid is indicative of a health-associated P. acnes having RT2. In some instances, presence of CRISPR-associated target nucleic acid is indicative of a health-associated P. acnes having RT6. In some instances, presence of CRISPR-associated target nucleic acid is indicative of a health-associated P. acnes having RT1. In some instances, the CRISPR-associated target nucleic acid is Cas5.

[00117] In some instances, the presence or absence of at least one of Type I lipase and Type II lipase target nucleic acid sequence is indicative of a ribotype (RT) of a health-associated P. acnes bacteria. In some instances, the ribotype is at least one of RT2, RT6, and RT1. For example, the presence or absence of at least one of Type I lipase and Type II lipase target nucleic acid is indicative of a health-associated P. acnes having RT2. In some instances, presence or absence of at least one of Type I lipase and Type II lipase target nucleic acid is indicative of a health- associated P. acnes having RT6. In some instances, the presence or absence of at least one of Type I lipase and Type II lipase target nucleic acid is indicative of a health-associated P. acnes having RTl .

[00118] In some instances, the presence or absence of alanine dehydrogenase target nucleic acid sequence is indicative of a ribotype (RT) of a health-associated P. acnes bacteria. In some instances, the ribotype is RT2. In some instances, the ribotype is RT6. In some instances, the ribotype is RTl . In some instances, the ribotype is RT3. For example, the presence or absence of alanine dehydrogenase target nucleic acid is indicative of a health-associated P. acnes having RT2. In some instances, presence or absence of alanine dehydrogenase target nucleic acid is indicative of a health-associated P. acnes having RT6. In some instances, the presence or absence of alanine dehydrogenase target nucleic acid is indicative of a health-associated P. acnes having RTl .

[00119] In some instances, the presence or absence of ABC transporter target nucleic acid sequence is indicative of a ribotype (RT) of P. acnes bacteria. In some instances, the absence of ABC transporter indicates RT6.

[00120] In some instances, the presence or absence of DNA-binding response regulator target nucleic acid sequence is indicative of a ribotype (RT) of P. acnes bacteria. In some instances, the presence of DNA-binding response regulator indicates RT6.

[00121] In some instances, the presence or absence of phosphoglycerate kinase target nucleic acid sequence is indicative of a ribotype (RT) of P. acnes bacteria. In some instances, the absence of phosphoglycerate kinase indicates RT6.

[00122] In some instances, the absence of dermatan-sulfate adhesin target nucleic acid sequence is indicative of a health-associated P. acnes bacteria. In some instances, the absence of hyaluronidase target nucleic acid sequence is indicative of a health -associated P. acnes bacteria. In some instances, the absence of transposase 2 target nucleic acid sequence is indicative of a health -associated P. acnes bacteria. In some instances, the presence of dermatan-sulfate adhesin target nucleic acid sequence is indicative of a disease-associated P. acnes bacteria. In some instances, the presence of hyaluronidase target nucleic acid sequence is indicative of a disease- associated P. acnes bacteria. In some instances, the presence of transposase 2 target nucleic acid sequence is indicative of a disease-associated P. acnes bacteria.

[00123] In some instances, the presence or absence of target nucleic acid of deoR, CRISPR- associated, pIMPLE, Type I lipase, Type II lipase, alanine dehydrogenase, ABC transporter, DNA-binding response regulator, phosphoglycerate kinase, dermatan-sulfate adhesin,

hyaluronidase, transposase 2, or combinations thereof is indicative of a ribotype (RT) of a health- associated P. acnes bacteria. In some instances, the ribotype is at least one of RT2, RT6, and RTl . For example, presence of deoR target nucleic acid and Type II lipase target nucleic acid, absence of CRISPR-associated target nucleic acid, and absence of pIMPLE target nucleic acid or presence of at most about 10% of pIMPLE target nucleic acid is indicative of a health-associated strain of P. acnes having RTl . In some instances, presence of deoR target nucleic acid, Type II lipase target nucleic acid, and CRISPR-associated target nucleic acid, and absence of pIMPLE target nucleic acid or presence of at most about 10% of pIMPLE target nucleic acid is indicative of a health-associated strain of P. acnes having RT2. In some instances, presence of deoR target nucleic acid, Type II lipase target nucleic acid, CRISPR-associated target nucleic acid, and pIMPLE target nucleic acid is indicative of a health-associated strain of P. acnes having RT6.

[00124] In some instances, the presence or absence of a target nucleic acid sequence is indicative of a disease-associated P. acnes bacteria. In some instances, the target nucleic acid sequence is at least one of deoR, CRISPR-associated (e.g. Cas5), pIMPLE, Type I lipase, Type II lipase, alanine dehydrogenase, ABC transporter, DNA-binding response regulator,

phosphoglycerate kinase, dermatan-sulfate adhesin, hyaluronidase, and transposase 2. For example, absence of deoR target nucleic acid and the CRISPR-associated target nucleic acid, presence of Type I lipase, and presence of the pFMPLE target nucleic acid is indicative of a disease associated P. acnes bacteria.

[00125] In some instances, absence of deoR target nucleic acid sequence is indicative of a ribotype (RT) of a disease-associated P. acnes bacteria. In some instances, the RT of the disease- associated P. acnes bacteria is at least one of RT3, RT4, RT5, RT8, RT16, and RT532. In some cases, absence of deoR target nucleic acid and absence of the CRISPR-associated target nucleic acid, presence of Type I lipase, and absence of the pFMPLE target nucleic acid or presence of up to about 10%) of the pFMPLE target nucleic acid is indicative of a disease-associated P. acnes having RTl. In some instances, at most about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or at most 10%) of the pFMPLE target nucleic acid is present.

Diagnosis of a Disease

[00126] In certain embodiments, the methods described herein for detecting the presence, absence, and/or quantity of a target molecule and/or bacteria of interest are useful for

determining whether an individual has a particular disease and/or whether an individual is susceptible for developing the disease . In one example, the methods are useful for determining the quantity (e.g., percentage) of a bacteria associated with a disease in the individual. In such cases, the individual may be treated for the disease or condition, or treated prophylactically for the disease. Diseases and conditions that may be diagnosed using the methods herein include acne, eczema, psoriasis, seborrheic dermatitis, rosacea, autoimmune disease, lichen sclerosis, lichen planus, pruritus, prurigo nodularis, confluent and reticulated papillomatosis, prurigo pigmentosa, tinea versicolor, cellulitis, erysipelas, erythrasma, paronychia, sarcoidosis and lichen simplex chronicus, or a combination thereof. In certain embodiments, an individual is diagnosed with acne if the individual is determined to possess an acne associated strain of P. acnes. In some cases, an acne-associated strain of P. acnes is a disease-associated P. acnes as described herein. In certain embodiments, the acne associated strain of P. acnes comprises a ribotype (RT) that is associated with acne. In certain embodiments, the acne associated strain of P. acnes comprises at least one of RT1, RT3, RT 4, RT5, RT8, RT16, and RT532.

Methods of Treatment

[00127] Further provided herein are methods of treating an individual having, or being susceptible to having, a disease or condition. In some cases, the disease or condition is acne or other skin disease or disorder. An individual susceptive to having a disease or condition includes an individual who has a particular quantity of bacteria or other target molecule associated with the disease or condition, but may not yet exhibit signs or symptoms of the disease or condition. The "particular quantity" of bacteria may be a low amount of a health-associated bacteria and/or a high amount of a disease-associated bacteria. In some cases, this detection allows for early intervention and prophylactic treatment of the individual. In the context of acne, some methods comprise determining a low quantity of health-associated bacteria and/or a high quantity of disease-associated bacteria in a youth, which will assist in proactive treatment of the youth. In another example, a method is provided for determining the presence of bacteria in infants that is associated with the development of eczema.

[00128] In some instances, disclosed herein are methods of treating an individual having acne or other skin disease or disorder by administrating to the individual a health-associated P. acnes, provided that the individual has been determined to comprise a certain low quantity of a health or high level of disease-associated bacteria. In additional embodiments, progression of treatment and/or engraftment efficacy of the health-associated P. acnes bacteria is monitored. In some instances, the methods of determining the quantity of bacteria comprise identifying the presence or absence of at least one of a target nucleic acid of deoR, a CRISPR-associated protein, pIMPLE, Type I lipase, Type II lipase, alanine dehydrogenase, ABC transporter, DNA-binding response regulator, phosphoglycerate kinase, dermatan-sulfate adhesin, hyaluronidase, and transposase 2. In some instances, the CRISPR-associated protein is Cas5.

[00129] In certain embodiments, diagnosing an individual with a disease or condition, or diagnosing an individual as being susceptible to developing the disease or condition, and/or monitoring treatment efficacy and/or engraftment in the case of treatment with a probiotic, involves obtaining a biological sample from the individual. In certain embodiments, the biological sample is a skin sample or biopsy. In certain embodiments, the biological sample comprises the contents of a pilosebaceous unit, such as a lipid pillar. An exemplary method of collecting the contents of a pilosebaceous unit comprises application of an adhesive strip to the skin and removal of the adhesive strip with the lipid pillar attached to the adhesive of the strip. As a non-limiting example, the adhesive strip is a Biore® strip or the like. In certain

embodiments, the biological sample is a stool or fecal sample. In certain embodiments, the biological sample is an oral or oral mucosal sample. In certain embodiments, the biological sample is a swab, obtained using a cotton swab or other compatible swab. In certain

embodiments, the sample contains bacteria. In certain embodiments, the sample contains a fungus. In certain embodiments, the sample contains a virus. In certain embodiments, the virus is a bacteriophage.

[00130] An exemplary device for collecting a biological sample is a swab that can be contacted with the surface of an individual, or a sample from the individual, to collect the biological sample comprising genetic material from the individual. In some cases, the swab comprises cotton. In some cases, the swab is produced in a DNA controlled environment to minimize contamination with extraneous genetic material. In some cases, the swab is a FAB SWAB from Puritan® Medical Products. In addition, the collection device or swab may be used to collect non- biological samples containing a target molecule to be assayed using a method described herein.

[00131] In certain embodiments, the sample is stored after it has been collected, but before additional steps are to be performed. In certain embodiments, this storage is less than 8° C. In certain embodiments, this storage is less than 4° C. In certain embodiments, this storage is less than 0° C. In certain embodiments, this storage is less than -20° C. In certain embodiments, this storage is less than -70° C. In some embodiments, the sample is stored at a temperature greater than 4° C, greater than 8° C , greater than 16° C, or greater than 24° C. In some embodiments, the sample does not require storage at temperatures less than 20° C, 16° C, 8° C or 4° C.

[00132] In certain embodiments, a collected sample is stored in a denaturing solution, glycerol, glycol, dimethyl sulfoxide, growth media, nutrient broth or any combination thereof. In certain embodiments, the sample is desiccated before analysis. In certain embodiments, the sample is stored for 1, 2, 3, 4, 5, 6, or 7 days. In some embodiments, the sample is stored for 1, 2, 3, or 4 weeks. In some embodiments, the sample is stored for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 months. In some embodiments, the sample is cultured at a physiological temperature suitable for bacterial growth such as 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40° C. In some embodiments, the sample is cultured in a liquid growth media. In some embodiments, the sample is cultured on a solid growth media such as an agar plate. In some embodiments, the plates are blood agar. [00133] In certain embodiments, after a biological sample is obtained the sample is processed further before analysis. In some embodiments, no extraction or processing procedures are performed on the sample. For example, the DNA is not purified from the sample. In other embodiments, nucleic acid is extracted from the sample. In some embodiments, the nucleic acid is DNA. In some embodiments, the DNA is bacterial DNA. In some embodiments where bacterial target molecules are being detected, total genomic bacteria DNA is determined by measuring 23 S ribosomal DNA. Other exemplary bacterial DNA include 16S ribosomal DNA and 18S ribosomal DNA. In some embodiments, the nucleic acid is ribosomal DNA. In some embodiments, the nucleic acid is RNA. In some embodiments, the nucleic acid is ribosomal RNA.

[00134] In certain embodiments where nucleic acids are extracted, the nucleic acids are extracted using any technique that does not interfere with subsequent analysis. In certain embodiments, this technique uses alcohol precipitation using ethanol, methanol or isopropyl alcohol. In certain embodiments, this technique uses phenol, chloroform, or any combination thereof. In certain embodiments, this technique uses cesium chloride. In certain embodiments, this technique uses sodium, potassium or ammonium acetate or any other salt commonly used to precipitate DNA. In certain embodiments, this technique utilizes a column or resin based nucleic acid purification scheme such as those commonly sold commercially, one non-limiting example would be the GenElute Bacterial Genomic DNA Kit available from Sigma Aldrich. In certain embodiments, after extraction the nucleic acid is stored in water, Tris buffer, or Tris-EDTA buffer before subsequent analysis. In an exemplary embodiment, the nucleic acid material is extracted in water. In some cases, extraction does not comprise DNA purification. In certain embodiments, extracted nucleic acid material is stored at less than 8° C. In certain embodiments, this storage is less than 4° C. In certain embodiments, this storage is less than 0° C. In certain embodiments, this storage is less than -20° C. In certain embodiments, this storage is less than - 70° C. In some embodiments, the extract is stored at a temperature greater than 4° C, greater than 8° C , greater than 16° C, or greater than 24° C. In some embodiments, the extract does not require storage at temperatures less than 20° C, 16° C, 8° C or 4° C. In certain embodiments, the nucleic acid is stored for 1, 2, 3, 4, 5, 6, or 7 days. In some embodiments, the nucleic acid is stored for 1, 2, 3, or 4 weeks. In some embodiments, the nucleic acid is stored for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, or 12 months.

[00135] After the samples have been obtained, the samples are analyzed using the methods described herein to detect the presence, absence, and/or quantity of a target molecule (e.g., target nucleic acid) in the sample. In some instances, the target nucleic acid is at least one of deoR, CRISPR-associated (e.g. Cas5), pIMPLE, Type I lipase, Type II lipase, alanine dehydrogenase, ABC transporter, DNA-binding response regulator, phosphoglycerate kinase, dermatan-sulfate adhesin, hyaluronidase, and transposase 2.

[00136] In certain embodiments, the sample is analyzed for the presence, absence, or quantity of a target nucleic acid using a hybridization and/or amplification reaction. In some instances, the amplification reaction is PCR. In some instances, the amplification reaction is quantitative such as qPCR. In certain embodiments, the PCR reaction utilizes a Taqman™ or a similar quantitative PCR technology. In some instances, the target nucleic acid is at least one of deoR, CRISPR- associated (e.g. Cas5), pIMPLE, Type I lipase, Type II lipase, alanine dehydrogenase, ABC transporter, DNA-binding response regulator, phosphoglycerate kinase, dermatan-sulfate adhesin, hyaluronidase, and transposase 2. In certain embodiments, at least one primer or probe used in the qPCR has a sequence that corresponds to SEQ ID NO 1, 2, 3, 4, 5, 6, 7, 8, or 9.

[00137] In certain embodiments, the sample is analyzed by sequencing genomic DNA within the sample. In some cases, this DNA is bacterial DNA. In certain embodiments, the nucleic acid sequence is bacterial 16S ribosomal DNA. In certain embodiments, the nucleic acid sequence is bacterial 18S ribosomal DNA. In certain embodiments, the nucleic acid sequence is bacterial 23 S ribosomal DNA. In certain embodiments, the nucleic acid sequenced is bacteriophage DNA. In certain embodiments, the sequencing is performed using the Sanger sequencing method. In certain embodiments, the sequencing involves the use of chain terminating dideoxynucleotides. In certain embodiments, the sequencing involves gel-electrophoresis. In certain embodiments, the sequencing is performed using a next generation sequencing method. In certain embodiments, the method is pyrosequencing. In certain embodiments, the method is ion semiconductor sequencing. In certain embodiments, the method is sequencing by synthesis. In certain embodiments, the method is sequencing by ligation. In certain embodiments, the method is single molecule real time sequencing.

[00138] After the nucleic acids are sequenced, or detection of the presence or absence of a target nucleic acid is determined, such as by qPCR, a diagnosis may be made. In certain embodiments, diagnosis requires the use of a computer, statistical analysis, statistical analysis software, sequence analysis software, or any combination thereof. In further embodiments, a diagnostic report may be sent through or accessed by the internet. A diagnostic report may be sent through the mail to a health care provider, physician, or patient.

Methods of Treatment Monitoring

[00139] Also disclosed herein are methods of monitoring and/or optimizing the treatment of an individual comprising: determining the quantity (e.g., percentage) of healthy and/or disease- associated bacteria in a sample from the individual and modifying, discontinuing, or continuing the treatment based on the quantity. An exemplary method comprises optimizing the therapy of an individual having acne or a skin disorder, comprising: identifying the presence, absence, and/or quantity at least one of a target nucleic acid of deoR, a CRISPR-associated protein, pIMPLE, Type I lipase, Type II lipase, alanine dehydrogenase, ABC transporter, DNA-binding response regulator, phosphoglycerate kinase dermatan-sulfate adhesin, hyaluronidase, and transposase 2; and modifying, discontinuing, or continuing the treatment based on the presence, absence, and/or quantity of the at least one target nucleic acid. In some cases, the method comprises determining the percentage of bacteria from a sample of the individual comprising a health-associated bacteria, or a target molecule associated with the health-associated bacteria.

[00140] An exemplary treatment that may be monitored or otherwise evaluated using a method provided herein is application of a health-associated P. acnes bacteria to an individual. In some cases, the individual comprises a low percentage of health-associated bacteria within a total sample of bacteria from the individual. Exemplary low percentages for deoR are 0-7.5% and 0- 5%o for Cas5. In some cases, an individual comprising a low percentage of health-associated bacteria comprises from about 0% to about 7.5%, from about 0% to about 7%, from about 0% to about 6.5%), from about 0% to about 6%, from about 0% to about 5.5%, from about 0% to about 5%), from about 0% to about 4.5%, from about 0% to about 4%, from about 0% to about 3.5%, from about 0% to about 3%, from about 0% to about 2.5%, from about 0% to about 2%, from about 0%) to about 1.5%, from about 0% to about 1%, from about 0% to about 0.5%, from about 1%) to about 7.5%), from about 1% to about 7%, from about 1% to about 6.5%, from about 1% to about 6%), from about 1% to about 5.5%, from about 1% to about 5%, from about 1% to about 4.5%), from about 1% to about 4%, from about 1% to about 3.5%, from about 1% to about 3%, from about 1% to about 2.5%, from about 1% to about 2%, from about 1% to about 1.5%, from about 2%) to about 7.5%, from about 2% to about 7%, from about 2% to about 6.5%, from about 2%) to about 6%), from about 2% to about 5.5%, from about 2% to about 5%, from about 2% to about 4.5%), from about 2% to about 4%, from about 2% to about 3.5%, from about 2% to about 3%), from about 2% to about 2.5%, from about 3% to about 7.5%, from about 3% to about 7%, from about 3% to about 6.5%, from about 3% to about 6%, from about 3% to about 5.5%, from about 3%) to about 5%, from about 3% to about 4.5%, from about 3% to about 4%, from about 3%) to about 3.5%), from about 4% to about 7.5%, from about 4% to about 7%, from about 4% to about 6.5%), from about 4% to about 6%, from about 4% to about 5.5%, from about 4% to about 5%), from about 4% to about 4.5%, from about 5% to about 7.5%, from about 5% to about 7%, from about 5% to about 6.5%, from about 5% to about 6%, from about 5% to about 5.5%, from about 6% to about 7.5%, from about 6% to about 7%, from about 6% to about 6.5%>, or from about 7%) to about 7.5% deoR+ bacteria within the total bacteria sample. In some cases, an individual comprising a low percentage of health-associated bacteria comprises about 0%, about 0.5%, about 1%, about 1.5%, about 2%, about 2.5%, about 3%, about 3.5%, about 4%, about 4.5%), about 5%), about 5.5%, about 6%, about 6.5%, about 7%, or about 7.5% deoR+ bacteria within the total bacteria sample. In some cases, an individual comprising a low percentage of health-associated bacteria comprises from about 0% to about 5%, from about 0% to about 4.5%, from about 0% to about 4%, from about 0% to about 3.5%, from about 0% to about 3%, from about 0%) to about 2.5%, from about 0% to about 2%, from about 0% to about 1.5%, from about 0%) to about 1%), from about 0% to about 0.5%, from about 1% to about 5%, from about 1% to about 4.5%), from about 1% to about 4%, from about 1% to about 3.5%, from about 1% to about 3%), from about 1% to about 2.5%, from about 1% to about 2%, from about 1% to about 1.5%, from about 2% to about 5%, from about 2% to about 4.5%, from about 2% to about 4%, from about 2% to about 3.5%, from about 2% to about 3%, from about 2% to about 2.5%, from about 3%) to about 5%), from about 3% to about 4.5%, from about 3% to about 4%, from about 3% to about 3.5%), from about 4% to about 5%, or from about 4% to about 4.5% Cas5+ bacteria within the total bacteria sample. In some cases, an individual comprising a low percentage of health- associated bacteria comprises about 0%, about 0.5%, about 1%, about 1.5%, about 2%, about 2.5%), about 3%), about 3.5%, about 4%, about 4.5%, or about 5% Cas5+ bacteria within the total bacteria sample.

[00141] Further provided herein are methods for evaluating engraftment of a health-associated bacteria onto an individual. Such methods may also be useful for evaluating efficacy of various probiotic formulations.

[00142] In certain embodiments, described herein are methods for evaluating an effect of a treatment formulation on a skin of an individual. In some instances, the treatment formulation comprises glycerol. In certain embodiments, described herein, are methods for evaluating an effect of a treatment protocol on a skin of an individual.

[00143] In some embodiments, the treatment formulation described herein is administered for therapeutic applications. In some embodiments, the treatment formulation is administered once per day, twice per day, three times per day or more. The treatment formulation is administered daily, every day, every alternate day, five days a week, once a week, every other week, two weeks per month, three weeks per month, once a month, twice a month, three times per month, or more. The treatment formulation is administered for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 2 years, 3 years, or more.

[00144] In some embodiments, one or more treatment formulations are administered

simultaneously, sequentially, or at an interval period of time. In some embodiments, one or more treatment formulations are administered simultaneously. In some cases, one or more treatment formulations are administered sequentially. In additional cases, one or more treatment formulations are administered at an interval period of time (e.g., the first administration of a first treatment formulation is on day one followed by an interval of at least 1, 2, 3, 4, 5, or more days prior to the administration of at least a second treatment formulation).

[00145] In some embodiments, two or more different treatment formulations are coadministered. In some instances, the two or more different treatment formulations are coadministered simultaneously. In some cases, the two or more different treatment formulations are co-administered sequentially without a gap of time between administrations. In other cases, the two or more different treatment formulations are co-administered sequentially with a gap of about 0.5 hour, 1 hour, 2 hour, 3 hour, 12 hours, 1 day, 2 days, or more between administrations.

[00146] In the case wherein the patient's status does improve, upon the doctor's discretion the administration of the formulation is given continuously; alternatively, the dose of the formulation being administered is temporarily reduced or temporarily suspended for a certain length of time. In some instances, the length of time wherein the dose of the formulation is reduced varies between 2 days and 1 year, including by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, 35 days, 50 days, 70 days, 100 days, 120 days, 150 days, 180 days, 200 days, 250 days, 280 days, 300 days, 320 days, 350 days, or 365 days. The dose reduction is from 10%-100%, including, by way of example only, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.

[00147] Once improvement of the patient's conditions has occurred, a maintenance treatment formulation is administered if necessary. Subsequently, the dosage or the frequency of administration, or both, can be reduced, as a function of the symptoms, to a level at which the improved disease, disorder or condition is retained.

[00148] In some embodiments, the amount of a given treatment formulation varies depending upon factors such as the particular compound, the severity of the disease, the identity of the subject or host in need of treatment, but nevertheless is routinely determined in a manner known in the art according to the particular circumstances surrounding the case, including, e.g., the specific treatment formulation being administered, the route of administration, and the subject or host being treated. In some instances, the treatment formulation is conveniently presented in a single dose or as divided doses administered simultaneously (or over a short period of time) or at appropriate intervals, for example as two, three, four or more sub-doses per day.

[00149] Further provided herein are methods for evaluating a probiotic formulation. For example, the identity of a probiotic formulation is determined using a method provided herein. Such methods may be useful, for example, for quality control measurements and/or production standards. For example, the purity of a probiotic formulation may be assessed using the described methods.

[00150] Further provided herein are methods of evaluating the microbiome of the skin when the treatment is not with a probiotic, but may affect the population of bacteria within the individual. Such treatments include treatment with active agents and placebos.

Microbiome Profiling

[00151] Described herein are methods for determining a microbiome profile of a sample in an individual. In some embodiments, a microbiome profile comprises a percentage of a particular target molecule and/or bacteria within a total amount of bacteria in the sample. An exemplary method for determining the total amount of bacteria in the sample comprises measuring the amount of 23 S rRNA. In some cases, the sample is from human face, and the 23 S rRNA is from the bacteria found on the human face. FIG. 2 shows a portion of 23 S rRNA that may be exploited in these methods. Exemplary primers for determining total 23 S rRNA have SEQ ID NOS: 7 and 8. An exemplary probe for determining total 23S rRNA has SEQ ID NO: 9. These exemplary sequences are suitable for use in a TaqMan™ assay, but may also be utilized in other amplification or qPCR methods.

[00152] In some instances, methods for determining the microbiome profile comprises quantifying a percentage of the detected bacterial population comprising at least one of deoR, a CRISPR-associated protein, pF PLE, Type I lipase, Type II lipase, alanine dehydrogenase, ABC transporter, DNA-binding response regulator, phosphoglycerate kinase, dermatan-sulfate adhesin, hyaluronidase, and transposase 2, or combinations thereof in a sample. For example, methods for determining the microbiome profile comprises quantifying a percentage of P. acnes within the sample that do not comprise deoR, do not comprise a CRISPR-associated protein, comprise Type I lipase, comprise pEVIPLE, or a combination thereof. In some instances, microbiome profiling comprises quantifying a percentage of P. acnes within the sample that comprise deoR, comprise Type II lipase, comprise CRISPR-associated protein, or a combination thereof. In some instances, the CRISPR-associated protein is Cas5. [00153] Other methods involve determining the percentage of a particular target molecule in the sample. Exemplary target molecules include deoR and Cas5. In some cases, the percentage of deoR positive bacteria is calculated by dividing the number of copies of deoR by the number of copies of 23S(e.g, as measured using a PANBAC assay). In some cases, the percentage of Cas5 is calculated by dividing the number of clones having Cas5 over the total number of clones in the sample (e.g., as measured using a PANBAC assay).

[00154] Other methods involve determining the percentage of a particular ribotypes of P. acnes in the sample. Exemplary ribotypes include RTl, RT2 and RT6. In some cases, the percentage of RTl is calculated by dividing the number of clones having RTl over the total number of clones in the sample (e.g., as measured using a PANBAC assay). In some cases, the percentage of RT2 is calculated by dividing the number of clones having RT2 over the total number of clones in the sample (e.g., as measured using a PANBAC assay). In some cases, the percentage of RT6 is calculated by dividing the number of clones having RT6 over the total number of clones in the sample (e.g., as measured using a PANBAC assay).

[00155] In some instances, microbiome profiling occurs prior to a treatment, during a treatment, and/or after a treatment. In some instances, microbiome profiling occurs at one or more time points prior to a treatment, during a treatment, or after a treatment. Time points for the monitoring and response-to-treatment methods provided herein include any interval of time. In some embodiments, the time points are 1 day, 2 days, 3 days, 4 days, 5 days 6 days, 1 week, 2 weeks, 3, weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years or longer apart. In some embodiments, samples are obtained at any number of time points, including 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more time points.

[00156] In some embodiments, microbiome profiling is used to determine and/or monitor progression of a specific treatment for a disease (e.g., acne or other skin related diseases). In some embodiments, a biological sample is a first biological sample obtained from the subject at a first time point. In some embodiments, the method further comprises determining the microbiome profile by determining the presence or absence of at least one of deoR, Cas5, pIMPLE, Type I lipase, Type II lipase, alanine dehydrogenase, ABC transporter, DNA-binding response regulator, phosphoglycerate kinase, dermatan-sulfate adhesin, hyaluronidase, and transposase 2 from a second biological sample obtained from the subject having acne or other skin related disease at a second time point; comparing the microbiome profile from the first time point to the second time point. In some instances, the method comprises determining the percentage of pEVIPLE in the sample. In some embodiments, the method further comprises administering a treatment depending on the microbiome profile compared at the first time point to the second time point. In some instances, the expression level of at least one of deoR, Cas5, pIMPLE, Type I lipase, Type II lipase, alanine dehydrogenase, ABC transporter, DNA-binding response regulator, phosphoglycerate kinase, dermatan-sulfate adhesin, hyaluronidase, and transposase 2 is indicative of a subject's likelihood for responding to a treatment.

[00157] Enrichment of lipid pillar samples comprising a target molecule

[00158] In some instances, methods disclosed herein comprise identifying a population of heterogeneous samples comprising a target molecule. The methods may comprise providing a plurality of the heterogeneous samples, provided that two or more of the heterogeneous samples are obtained from different pilosebaceous units of the skin of a subject and comprise a microbe. The methods may comprise determining the presence or absence of the target molecule in the two or more heterogeneous samples, thereby identifying the population of heterogeneous samples comprising the target molecule. A non-limiting example of identifying such a population of heterogeneous samples is provided herein in Example 11. Two or more heterogeneous samples may be obtained from different pilosebaceous units. In some instances, each heterogeneous sample is obtained from different pilosebaceous unit. Non-limiting examples of target molecules are Cas5, deoR, CRISPR related sequences, and other target molecules disclosed herein.

[00159] In some instances, methods disclosed herein comprise identifying a population of heterogeneous samples comprising a target molecule, wherein the target molecule is present or expressed by bacteria, a virus, a fungus, or a combination thereof. In some cases, the target molecule is part of the microbe's genotype, e.g., the target molecule is a nucleic acid. In some cases, the target molecule is expressed by the microbe, e.g., the target molecule is a protein. The microbe may be endogenous to the subject. The microbe may be a microbe previously administered to the subject. The microbe may be health-associated bacteria. The microbe may be acne-associated bacteria. The microbe may be bacteria associated with a skin disorder disclosed herein. The bacteria may comprise P. acnes. The bacteria may comprise a health-associated strain of P. acnes. The health-associated strain of P. acnes may have a ribotype selected from RT1, RT2, RT3, and RT6. A non-limiting example of a health-associated strain of P. acnes is HP4G1.

[00160] In some instances, methods of identifying a population of heterogeneous samples comprise culturing microbes of the heterogeneous samples. In some instances, culturing comprises maintaining viability of the microbes for at least 24 hours. In some instances, culturing comprises growing at least one microbe. In some instances growing comprises replication of the at least one microbe. In some instances, culturing comprises contacting a microbe from a pilosebaceous unit with a solution, e.g., a cell culture media. By way of non -limiting example, the microbe may be P. acnes and the cell culture media may be Reinforced Clostridial Media (RCM). The microbe and solution may be plated on an agar plate to generate colonies of the microbe. In some instances, the solution comprises a detergent. A non-limiting example of a suitable detergent for ⁵, acnes is Tween 80. In some instances, it is advantageous to isolating bacteria in Tween 80 (e.g., for directly plating for cloning). Methods using Tween 80 and plating may provide a more accurate representation of the bacterial community relative to liquid culture, wherein the population is likely to be distorted by unequal growth rates. For example, bacteria that grow well in culture media can easily outgrow other bacteria and distort relative populations. In some cases, a bacterial sample isolated from a lipid pillar with Tween 80 is compatible with an assay utilized for detecting the presence or absence of a target molecule in the bacterial sample. As a non-limiting example, the Tween 80 concentration in the bacterial sample is compatible with a qPCR method such as TaqMan™. Exemplary Tween 80 concentrations for bacteria isolation include, but are not limited to, about 0.05% to about 0.5% Tween 80, e.g., about 0.1% or about 0.2% Tween 80. Other detergents useful for isolating bacteria from lipid pillars include Tween 20, Triton X-100 and SDS.

[00161] In some instances, methods of identifying a population of heterogeneous samples do not comprise culturing microbes of the heterogeneous sample. In some instances, the methods comprise analyzing a dead microbe in the heterogeneous sample. The microbe may be a health- associated microbe. The microbe may be a disease-associated microbe.

[00162] In some instances, methods of identifying a population of heterogeneous samples comprises obtaining between about 2 and about 100 samples. Methods may comprise obtaining between about 2 and about 80 samples. Methods may comprise obtaining between about 2 and about 60 samples. Methods may comprise obtaining between about 2 and about 40 samples. Methods may comprise obtaining between about 2 and about 20 samples. Methods may comprise obtaining between about 15 and about 40 samples. Methods may comprise obtaining at least two samples. Methods may comprise obtaining at least three samples. Methods may comprise obtaining at least five samples. Methods may comprise obtaining not more than 15 samples.

[00163] In some instances, methods of identifying a population of heterogeneous samples comprise obtaining one or more lipid pillars extracted from one of the different pilosebaceous units from the skin of the subject. The heterogeneity may be within a single lipid pillar and/or between different lipid pillars. In some cases, a plurality of samples are obtained from a plurality of lipid pillars, where each of the plurality of samples comprise a different microbial population. Obtaining the lipid pillar may comprise application of an adhesive strip to the skin of the subject. Application may occur in a manner that allows for adhesive of the adhesive strip to contact a lipid pillar from a pilosebaceous unit, and removal of the adhesive strip in a manner that retains the lipid pillar on the adhesive strip. The adhesive strip comprising the lipid pillar may be stored at a temperature less than or equal to about 8 °C. The adhesive strip comprising the lipid pillar may be stored at a temperature less than or equal to about 4 °C. The adhesive strip comprising the lipid pillar may be stored at a temperature less than room temperature (e.g., 25 °C). The adhesive strip comprising the lipid pillar may be stored at a temperature less than 20 °C. The adhesive strip comprising the lipid pillar may be stored at a temperature less than 15 °C. The adhesive strip comprising the lipid pillar may be stored at a temperature less than 10 °C. The adhesive strip comprising the lipid pillar may be stored at a temperature greater than 0 °C. The adhesive strip comprising the lipid pillar may be stored at a temperature greater than -20 °C. In some instances, the adhesive strip is frozen. The adhesive strip comprising the lipid pillar may be stored at a temperature of about -20 °C or less. The adhesive strip comprising the lipid pillar may be stored at a temperature of about -80 °C. The adhesive strip comprising the lipid pillar may be stored in a liquid nitrogen tank.

[00164] In general, methods of identifying a population of heterogeneous samples comprise analyzing at least one nucleic acid sequence in at least one microbe of a sample of the population. The methods may comprise determining the presence or absence of a target molecule in the at least one microbe. The methods may comprise determining the presence or absence of a nucleic acid sequence in the at least one microbe. The nucleic acid sequence may comprise DNA. The nucleic acid sequence may comprise RNA. In some instances determining comprises performing sequencing of the nucleic acid sequence. In some instances determining comprises performing a PCR method on the nucleic acid sequence. The PCR method may be a qPCR method. The PCR method may comprise multiplex PCR. In some instances determining comprises performing sequencing of the nucleic acid sequence. Non-limiting examples of the target molecule are Cas5, deoR, transposase 2, or an encoding nucleic acid sequence thereof. The methods may comprise a PanBac assay, as further described herein (see Example 8). The methods may comprise determining quantity of a target molecule in the at least one sample. The methods may comprise determining quantity of a reference molecule (e.g., rRNA sequence) in the at least one sample. The reference molecule may serve as normalization for target molecule quantities.

[00165] In some instances, methods of identifying a population of heterogeneous samples comprise culturing the microbe from a sample of the population of heterogeneous samples having the presence of the target molecule to obtain a clonal population of the microbe. Methods may comprise growing one or more clonal populations in a culture medium. Methods may comprise growing one or more clonal populations on an agar-based plate. Methods may comprise screening the one or more clonal populations for the presence of the target molecule. In some instances, the one or more clonal population is screened at a different time or different place other than a location of the obtaining. Cultures of the microbe may be grown on an agar plate and tested directly, e.g., using colony PCR, or tested after growth in a liquid culture. The agar plate and/or liquid culture may be stored prior to analysis at about 4 °C. In some cases, a sample from the agar plate and/or liquid culture is stored prior to analysis at a temperature of less than about - 10 °C, -20 °C, -50 °C, or -80 °C.

[00166] In some instances, methods disclosed herein comprise identifying a population of heterogeneous samples, wherein the subject has been administered with a bacterial composition. In some instances the methods comprise administering the bacterial composition to the subject. The bacterial composition may comprise health-associated bacteria. The health-associated bacteria may comprise a strain of P. acnes. The strain of P. acnes may have a ribotype selected from RT1, RT2, RT3, and RT6. The strain of P. acnes may be HP4G1. In some instances the methods comprise administering the bacterial composition to the subject after identifying the population. In some instances the methods comprise administering the bacterial composition to the subject b identifying the population. In some instances, methods disclosed herein may comprise adjusting a treatment of the subjected based on identification of a microbe in the population of heterogeneous samples.

[00167] In some instances, methods of identifying a population of heterogeneous samples comprise profiling heterogeneous microbial samples from the skin of a subject. Profiling heterogeneous microbial samples may comprise providing a plurality of the heterogeneous microbial samples, each microbial sample obtained from a different pilosebaceous unit of the skin, and performing a separate genetic analysis on each of the microbial samples to determine the microbial profile of each sample.

[00168] Methods disclosed herein may also comprise characterizing a population of heterogeneous samples for research purposes. Methods may comprise providing a plurality of the heterogeneous samples, provided that two or more samples are obtained from different pilosebaceous units of the skin of the subject, and the two or more samples each comprise at least one microbe; and performing an assay on each of the two or more samples. The assay may comprise nucleic acid analysis. Non-limiting examples of nucleic acid analysis may include nucleic acid sequencing, microarray analysis, a PCR method, a qPCR method, a multiplex PCR method, or a combination thereof. The assay may comprise protein analysis. Non-limiting examples of protein analysis include PAGE, ELISA, FISH, mass spectrometry, fluorescence microscopy, FACS analysis, an immunoprecipitation.

[00169] In some instances, methods disclosed herein and throughout comprise analyzing the bacterial profile of skin from a subject, the methods comprising: providing a plurality of samples comprising bacteria from the skin of the subject, each of the plurality of samples obtained from a pilosebaceous unit of the skin, determining the presence or absence of a target molecule in at least one of the plurality of samples, selecting a subpopulation of the plurality of samples determined to have the presence of the target molecule, and performing a genetic analysis on at least one member of the subpopulation to determine the presence or absence of a bacteria of interest within at least one of the plurality of samples. Providing the plurality of samples may comprise applying an adhesive strip to the skin and removing the adhesive strip from the skin in a manner that adheres the bacterial sample to the adhesive strip. In some instances, the methods comprise washing the skin before application of the adhesive strip to both minimize

contamination from material on the surface of the skin (bacteria and dead cells) and aid in wetting the adhesive strip. The adhesive strip may be cooled and or stored as described herein.

[00170] In some instances, methods disclosed herein comprise identifying a population of heterogeneous samples comprising a target molecule, wherein the heterogeneous samples are obtained from the gut of a subject. This may be useful for implementing suitable microbial and immunological based therapies for cancer, IBD, and autoimmune disorders. For instance, the gut microbiome may enable or inhibit therapies such as checkpoint inhibitors. Methods may comprise supplementing a subject's gut microbiome to enable such therapies. Methods may comprise testing a subject's microbiome to determine if supplementation would be advantageous or as a prognostic to predict efficacy of such a therapy. Methods disclosed herein comprising a qPCR assay may directly determine the presence or absence of a bacterial gene of interest. In some instances, methods may be faster, cheaper, and more definitive than either 16S sequencing or Metagenomic sequencing.

[00171] In some instances, methods disclosed herein are utilized to discover a heterogeneity within different samples obtained from a subject. In some instances, methods disclosed herein are utilized to discover a correlation between such heterogeneity and a particular phenotype. As a non-limiting example, heterogeneity between samples from different pilosebaceous units may correlate to a phenotype such as inflammation.

Treatments Useful with the Provided Detection Methods

[00172] In some instances, the treatment comprises administering to the individual a health- associated microbe. In some instances, treating or preventing a skin disorder using a health- associated microbe inhibits or out competes pathogenic or disease associated bacteria. In certain embodiments, the skin disorder is selected from at least one of acne vulgaris (acne), eczema, seborrheic dermatitis, psoriasis, or rosacea. In some embodiments, the skin disorder is acne. In certain embodiments, the treatment is performed with any health-associated bacteria. In certain embodiments, the microbe is an isolated and purified species or strain of bacteria. In certain embodiments, the isolated and purified strain of bacteria is part of a composition that can be applied topically. In certain embodiments, the isolated and purified strain of bacteria is part of a composition that comprises an excipient or stabilizer further provided and described herein. In certain embodiments, the microbe is an isolated and purified species or strain of P. acnes. In certain embodiments, the isolated and purified species or strain of P. acnes, is an RT1, RT2, RT3, RT6 strain, or any combination thereof. In certain embodiments, the composition comprises a mixture of 2, 3, 4, 5, 6, 7,8, 9, 10 or more isolated and purified P. acnes strains, phylotypes, or ribotypes.

[00173] In certain embodiments, health-associated bacteria disclosed herein are associated with desirable health, optimal health or improved health relative to the health of a subject with a disease, disorder or condition disclosed herein. Desirable health, optimal health or improved health may be characterized as free of a condition, disorder or disease. Desirable health, optimal health or improved health may be characterized as free of one or more symptoms of a condition, disorder or disease. Desirable health, optimal health or improved health may be characterized as free of all symptoms of a condition, disorder or disease. Desirable health, optimal health or improved health may be characterized as improved health relative to health with a disease, disorder or condition. In certain embodiments, the health-associated microbe is associated with optimal, desirable or improved skin health. In certain embodiments, the health-associated microbe is associated with optimal, desirable or improved oral health. In certain embodiments, the health-associated microbe is associated with optimal, desirable or improved digestive health. In certain embodiments, the health-associated microbe is a P. acnes strain associated with skin health, oral health, digestive health, or any combination thereof, that is optimal, desirable or improved relative to respective health associated with a condition, disorder or disease.

[00174] In certain embodiments, there is a statistically significant increase in the presence of the health-associated bacteria on the skin of a disease-free individual when compared to an individual with the given disease. In certain embodiments, there is a 2-fold increase in the presence of the health-associated bacteria on the skin of a disease-free individual when compared to an individual with the given disease. In certain embodiments, there is a 3 -fold increase in the presence of the health-associated bacteria on the skin of a disease-free individual when compared to an individual with the given disease. In certain embodiments, there is a 5-fold increase in the presence of the health-associated bacteria on the skin of a disease-free individual when compared to an individual with the given disease. In certain embodiments, there is a 10-fold increase in the presence of the health-associated bacteria on the skin of a disease-free individual when compared to an individual with the given disease.

[00175] The bacteria may be a strain of a given bacteria. For example, even though P. acnes is associated with acne, some strains may be health-associated while some may be disease- associated. These P. acnes strains can be differentiated at the genetic level by using any nucleic acid sequence determination method using methods described herein such as PCR, restriction mapping, Sanger sequencing, or next-generation sequencing. Health-associated bacteria may be disease specific. For example, a health-associated bacteria may be a health-associated bacteria only for acne, but not for eczema and psoriasis. A health-associated bacteria may be a health- associated bacteria only for eczema, but not for acne and psoriasis. A health-associated bacteria may be a health-associated bacteria only for psoriasis, but not for acne and eczema. The health- associated bacteria may be associated with oral health or gastrointestinal health.

[00176] In certain embodiments, the health-associated bacteria is a P. acnes strain associated with skin health, oral health, digestive health, or any combination thereof. In certain

embodiments, the P. acnes strain comprises a health-associated phylotype. In certain

embodiments, the phylotype comprises Type I, Type II, or Type III, or any combination thereof. In certain embodiments, the Type I phylotype comprises IA, IB, or IC. In certain embodiments, the Type IA phylotype comprises IAi or IA₂.

[00177] In certain embodiments, the P. acnes strain is defined by its ribotype. In certain embodiments, the P. acnes ribotype comprises one or more of the following RT1, RT2, RT3, RT4, RT5, RT6, RT7, RT8, RT9, RT10. In certain embodiments, the P. acnes ribotype is a health-associated ribotype comprising RT1, RT2, RT3, RT6, or any combination thereof. In certain embodiments, the P. acnes ribotype is a health-associated ribotype comprising RT1. In certain embodiments, the P. acnes ribotype is a health-associated ribotype comprising RT2. In certain embodiments, the P. acnes ribotype is a health-associated ribotype comprising RT6. In certain embodiments, the P. acnes ribotype is a health-associated ribotype comprising RT3.

[00178] In certain embodiments, the health-associated bacteria is a plurality of microbes of different ribotypes. In certain embodiments, the plurality of microbes is a mixture of two or more health-associated P. acnes strains of different ribotypes. In certain embodiments, the plurality of microbes is a mixture of two or more purified and isolated health-associated P. acnes strains of different ribotypes. In certain embodiments, the mixture comprises health-associated RT1 and RT2. In certain embodiments, the mixture comprises health-associated RTl and RT6. In certain embodiments, the mixture comprises health-associated RT2 and RT6. In certain embodiments, the mixture consists essentially of health-associated RTl and RT2. In certain embodiments, the mixture consists essentially of health-associated RTl and RT6. In certain embodiments, the mixture consists essentially of health-associated RT2 and RT6. In certain embodiments, the mixture comprises health-associated RTl and RT3. In certain embodiments, the mixture comprises health-associated RT2 and RT3. In certain embodiments, the mixture comprises health-associated RT3 and RT6. In certain embodiments, the mixture is part of a composition that comprises an excipient or stabilizer described herein. In certain embodiments, the mixture is formulated for topical administration.

[00179] In certain embodiments, the health-associated microbe is a plurality of microbes of different ribotypes. In certain embodiments, the plurality of microbes is a mixture of three or more health-associated P. acnes strains of different ribotypes. In certain embodiments, the plurality of microbes is a mixture of three or more purified and isolated health-associated P. acnes strains of different ribotypes. In certain embodiments, the mixture comprises health- associated RTl, RT2, RT3, and RT6. In certain embodiments, the mixture consists essentially of health-associated RTl, RT2, RT3, and RT6. In certain embodiments, the mixture is part of a composition that comprises an excipient or stabilizer described herein. In certain embodiments, the mixture is formulated for topical administration.

[00180] Additional Active Agents

[00181] Treatments useful with the methods described herein include additional active agents that may be used in combination with a health-associated bacteria and/or probiotic treatment. In other cases, the additional active agent is part of a treatment that is not used in combination with the health-associated bacteria and/or bacteria. In some embodiments, the active agent is configured to alter the amount of a health-associated bacteria on a subject after treatment of the subject with the active agent.

[00182] In certain embodiments, the active agent comprises at least one non-living, non- microbial constituent. By way of non-limiting example, the non-living, non-microbial constituent is selected from a small molecule, a fatty acid, an antibiotic, a metabolite, an antioxidant, and a retinoid. Non-limiting examples of antioxidants include vitamin C and vitamin E. Non-limiting examples of a retinoid include tretinoin, tazarotene, adapalene, and retinol. In some

embodiments, the non-living, non-microbial constituent is vitamin D, which may be in the form of calciptotriene. In some embodiments, the additional active ingredient is an agent that has antiinflammatory activity. In some embodiments, the active agent comprises salicylic acid, glycolic acid, azaleic acid, live phage therapy, synthetic phage contractile nanotubes, laser, dapsone, benzoyl peroxide, benzoyl peroxide/resveratrol combinations, and any combination thereof.

[00183] In certain embodiments, the active agent comprises an antibiotic. Non-limiting examples of an antibiotic include a macrolide, tetracycline, β-lactam, aminoglycoside, cephalosporin, carbapenem, quinolone/fluoroquinolone, and sulfonamide. In some embodiments, the antibiotic is selected from clindamycin, doxycycline, erythromycin, and tetracycline. In some cases, the antibiotic is formulated for topical administration. In some embodiments, the antibiotic is selected from erythromycin, tetracycline, doxycycline and minocycline. In some cases, the antibiotic is formulated for oral administration.

[00184] In certain embodiments, a composition disclosed herein comprises a topical anti-acne medication such as benzoyl peroxide or salicylic acid. The concentration of benzoyl peroxide or salicylic acid included in a composition for treatment may be lower than that commonly included in a single formulation (e.g., a formulation that does not comprise a health-associated bacteria or probiotic). In some embodiments, the concentration of the anti-acne medication is between about 0.1% and about 3%. In some embodiments, the concentration of the anti-acne medication is between about 0.1% and about 2.5%. In some embodiments, the concentration of the anti-acne medication is between about 0.5% and about 2.5%. In some embodiments, the concentration of the anti-acne medication is between about 1% and about 2.5%. In some embodiments, the concentration of the anti-acne medication is less than about 2.5%. In some embodiments, the concentration of the anti-acne medication is less than about 2%. In some embodiments, the concentration of the anti-acne medication is less than about 1.5%. In some embodiments, the concentration of the anti-acne medication is less than about 1%. In some embodiments, the concentration of the anti-acne medication is less than about 0.5%. In some embodiments, the concentration of the anti-acne medication is less than about 0.1%.

[00185] In certain embodiments, compositions disclosed herein comprise a topical anti-acne medication such as a retinoid. Non-limiting examples of topical retinoid compounds include retinoic acid, tretinoin, adapalene, and tazarotene. In certain embodiments, compositions disclosed herein comprise resveratrol and/or trans-resveratrol. In some embodiments, the concentration of the retinoid or resveratrol in the composition is less than about 10%. In some embodiments, the concentration of the retinoid or resveratrol in the composition is less than about 5%. In some embodiments, the concentration of the retinoid or resveratrol in the composition is less than about 2.5%. In some embodiments, the concentration of the retinoid or resveratrol in the composition is less than about 1%. In some embodiments, the concentration of the retinoid or resveratrol in the composition is less than about 0.5%. In some embodiments, the concentration of the retinoid or resveratrol in the composition is between about 0.5% and about 10%. In some embodiments, the concentration of the retinoid or resveratrol in the composition is between about 1% and about 10%. In some embodiments, the concentration of the retinoid or resveratrol in the composition is between about 0.5% and about 2.5%.

[00186] In some embodiments, compositions disclosed herein comprise at least one omega-3 fatty acid. Non-limiting examples of omega-3 fatty acids include hexadecatrienoic acid (HTA), a-Linolenic acid (ALA), stearidonic acid (SDA), eicosatrienoic acid (ETE), eicosatetraenoic acid (ETA), eicosapentaenoic acid (EPA), heneicosapentaenoic acid (HP A), docosapentaenoic acid (DP A), clupanodonic acid, docosahexaenoic acid (DHA), tetracosapentaenoic acid,

tetracosahexaenoic acid (nisinic acid), and phytosphingosine.

[00187] In some embodiments, compositions disclosed herein comprise an acid selected from glycolic acid, azaelic acid, and trichloroacetic acid. In some embodiments, compositions disclosed herein comprise a natural extract, such as tea tree oil or green tea extract.

[00188] In some embodiments, the additional active agent comprises a drug that targets at least one strain of P. acnes. In some cases, the drug targeting at least one strain of P. acnes is a small molecule drug. In some cases, the drug targeting at least one strain of P. acnes is a small molecule inhibitor of an enzyme expressed by P. acnes. For instance, the enzyme expressed by P. acnes is required for ⁵, acnes growth or P. acnes energy metabolism. In some cases, the drug targeting at least one strain of P. acnes is a biologic. In some cases, the biologic comprises a peptide. In some cases, the biologic comprises an antibody or antigen binding fragment. In some cases, the biologic comprises an antibody-small molecule conjugate. In some cases, the biologic comprises an antibody-drug conjugate. In some cases, the biologic comprises a nucleic acid. For instance, the nucleic acid comprises an antisense nucleic acid molecule, wherein the antisense nucleic acid molecule inhibits an enzyme expressed by P. acnes. In some cases, the enzyme expressed by P. acnes is required for ⁵, acnes growth or P. acnes energy metabolism. In some cases, the antisense nucleic acid molecule comprises siRNA. In some cases, the antisense nucleic acid molecule comprises a shRNA. In some cases, the antisense nucleic acid molecule comprises a guide RNA to be used with a CRISPR-associated protease. In some embodiments, the additional active ingredient {e.g., guide RNA and CRISPR-associated protease) targets a genomic element specific for strains of P. acnes associated with acne.

Additional Methods

[00189] The methods of the present disclosure allow for the identification or genotyping of a sample in a manner that may be cost effective, not labor intensive, and/or faster than traditional methods. Such benefits may be the result of the sample preparation and/or sample analysis methods detailed herein. For example, sample preparation may not require isolation or purification of genetic material prior to analysis. In addition, samples may not require refrigerated storage. As another example, the sample may be analyzed for a particular target molecule, and therefore may not require lengthy and costly DNA sequencing. For instance, the sample is analyzed using qPCR with probes specific for the particular target nucleic acid sequence.

[00190] Further provided herein are methods of detecting genetic material from a sample that is not genetic material from a bacteria. For example, the genetic material is from a seed or food product. As used herein, all methods that are applicable for detecting and/or quantifying a target molecule and/or bacteria are also applicable for testing genetic material that is not bacterial in origin.

[00191] Also provided herein are methods of genotyping bacteria lab strains without using sequencing. Some such methods may be used for quality control or when the identity of a particular strain is desirable.

[00192] The methods may also be useful for screening bacterial colonies for a target molecule of a bacteria of interest as a screening tool prior to DNA sequencing.

[00193] Sample Preparation and qPCR

[00194] The methods provided herein for determining the presence and/or quantity of a target molecule within a bacterial sample may be performed using colony qPCR. In an exemplary method, bacteria from the sample are cultured and/or plated on a growth media, e.g., Luria broth (LB), Reinforced Clostridial Media (RCM). Stabs from single colonies are suspended in water to prepare samples for qPCR. In some cases, the qPCR samples are prepared without DNA purification or isolation. The prepared sample is combined with primers and probes specific for a target molecule that may or may not be present in the sample, and a DNA polymerase. An amplification reaction is performed with a thermal cycler that heats and cools the sample for nucleic acid amplification, and illuminates the sample at a specific wavelength to excite a fluorophore on the probe and detect the emitted fluorescence. For TaqMan™ methods, the probe may be a hydrolysable probe comprising a fluorophore and quencher that is hydrolyzed by DNA polymerase when hybridized to a target nucleic acid sequence. In some cases, the presence of a target nucleic acid sequence is determined when the number of amplification cycles to reach a threshold value is less than 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, or 20 cycles.

[00195] Further provided are methods of determining the presence and/or quantity of a target nucleic acid molecule within a bacterial sample obtained from pilosebaceous units of a subject. An exemplary method comprises applying an adhesive strip to the skin of the subject such that the adhesive bonds to lipid pillars from the subject. Upon removal of the adhesive strip, the adherent lipid pillars are retained on the adhesive strip. An exemplary adhesive strip is a Biore® Strip, or the like. Some methods comprise incubating the adhesive strip at -20 °C. Removal of the lipid pillars may be achieved by plucking the pillars from the strip. In some cases, the cells from the removed lipid pillars are lysed in a lysis buffer, e.g., Lysis Buffer from a ThermoFisher DNA Extract All Reagents Kit. In some cases, the lysed sample is stabilized with addition of a stabilization buffer, e.g., Stabilization Buffer from ThermoFisher. The lysed material may then be an input for a target nucleic acid assay, such as a qPCR assay described herein.

Kits

[00196] The disclosure also provides kits for identifying a target molecule and/or bacteria of interest, such as P. acnes. In some instances, kits are provided for identifying deoR. In some instances, kits are provided for identifying Cas5. In some instances, the kits are used to identify pEVIPLE. In some instances, kits are provided for identifying Type I lipase. In some instances, kits are provided for identifying Type II lipase. In some instances, kits are provided for identifying alanine dehydrogenase. In some instances, kits are provided for identifying 23 S. In some instances, kits are provided for identifying ABC transporter. In some instances, kits are provided for identifying DNA-binding response regulator. In some instances, kits are provided for identifying phosphoglycerate kinase. In some instances, the kits comprise primer pairs for identifying at least one of deoR, Cas5, pEVIPLE, Type I lipase, Type II lipase, alanine

dehydrogenase, ABC transporter, DNA-binding response regulator, phosphoglycerate kinase, dermatan-sulfate adhesin, hyaluronidase, transposase 2, and a 23 S rRNA. In some embodiments, the kit includes nucleic acid or polypeptide isolation reagents.

[00197] In some embodiments, the kit includes one or more detection reagents, for example probes and/or primers for amplification of, or hybridization to, a target nucleic acid sequence related to a disease or condition, such as acne. In some embodiments, the kit includes primers and probes for control genes, such as housekeeping genes. In some embodiments, the primers and probes for control genes are used, for example, in AC_t calculations. In some embodiments, the probes or primers are labeled with an enzymatic, fl orescent, or radionuclide label.

[00198] In some instances, kits comprise primers for identifying at least one of deoR, Cas5, pEVIPLE, Type I lipase, Type II lipase, alanine dehydrogenase, ABC transporter, DNA-binding response regulator, phosphoglycerate kinase, dermatan-sulfate adhesin, hyaluronidase, transposase 2, and 23 S rRNA. In some instances, kits comprise a first primer pair for identifying deoR and a second primer pair for identifying Cas5. In some embodiments, kits comprises a first primer pair for identifying deoR, a second primer pair for identifying Cas5, and a third primer pair for identifying a universal target such as 23 S rRNA (e.g., to quantitation total bacteria within a sample and thus allow for calculation of %deoR, %Cas5). In some instances, the first primer pair comprises SEQ ID NO: 1 or 2. In some instances, the first primer pair comprises SEQ ID NOs: 1 and 2. In some instances, the first primer pair comprises at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 1. In some instances, the first primer pair comprises at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 2. In some instances, the second primer pair comprises SEQ ID NO: 4 or 5. In some instances, the second primer pair comprises SEQ ID NOs: 4 and 5. In some instances, the second primer pair comprises at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 4. In some instances, the second primer pair comprises at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 5. In some instances, the third primer pair comprises SEQ ID NO: 8. In some instances, the third primer pair comprises SEQ ID NO: 9. In some instances, the third primer pair comprises SEQ ID NO: 8 and 9. In some instances, the third primer pair comprises a sequence having at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 8. In some instances, the third primer pair comprises a sequence having at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 9.

[00199] In some instances, kits described herein further comprise a probe. In some instances, the probe hybridizes to deoR repressor. In some instances, the probe comprises SEQ ID NO: 3. In some instances, the probe comprises at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 3. In some instances, the probe hybridizes to Cas5. In some instances, the probe comprises SEQ ID NO: 6. In some instances, the probe comprises at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 6. In some instances, the probe hybridizes to 23 S ribosome. In some instances, the probe comprises SEQ ID NO: 9. In some instances, the probe comprises at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 9.

[00200] Kits described herein may be used for identifying P. acnes. In some instances, the kits are used to amplify nucleic acid material comprising or suspected of comprising deoR nucleic acid sequence. In some instances, the kits are used to amplify nucleic acid material comprising or suspected of comprising Cas5 nucleic acid sequence. In some instances, the kits are used to amplify nucleic acid material comprising or suspected of comprising pIMPLE nucleic acid sequence. In some instances, the kits are used to amplify nucleic acid material comprising or suspected of comprising Type I lipase nucleic acid sequence. In some instances, the kits are used to amplify nucleic acid material comprising or suspected of comprising Type II lipase nucleic acid sequence. In some instances, the kits are used to amplify nucleic acid material comprising or suspected of comprising alanine dehydrogenase nucleic acid sequence. In some instances, the kits are used to amplify nucleic acid material comprising or suspected of comprising ABC transporter nucleic acid sequence. In some instances, the kits are used to amplify nucleic acid material comprising or suspected of comprising DNA-binding response regulator nucleic acid sequence. In some instances, the kits are used to amplify nucleic acid material comprising or suspected of comprising phosphoglycerate kinase nucleic acid sequence. In some instances, the kits are used to amplify nucleic acid material comprising or suspected of comprising dermatan- sulfate adhesin nucleic acid sequence. In some instances, the kits are used to amplify nucleic acid material comprising or suspected of comprising hyaluronidase nucleic acid sequence. In some instances, the kits are used to amplify nucleic acid material comprising or suspected of comprising transposase 2 nucleic acid sequence. In some instances, the kits are used to determine total bacteria load in a sample by detecting 23 S nucleic acid sequence, e.g., for determining percentages of target molecules or bacteria within the sample. In some instances, the kits are used to determine the presence or absence of at least one of deoR, Cas5, pIMPLE, Type I lipase, Type II lipase, alanine dehydrogenase, ABC transporter, DNA-binding response regulator, phosphoglycerate kinase, dermatan-sulfate adhesin, hyaluronidase, transposase 2, and a 23 S rRNA.

[00201] Described herein are kits for identifying at least one of an acne-associated P. acnes bacteria and a health-associated P. acnes bacteria. In certain embodiments, the acne-associated strain of P. acnes comprises at least one of RTl, RT3, RT 4, RT5, RT8, RT16, and RT532. In some instances, the health-associated strain of P. acnes comprises at least one of RTl, RT2, RT3, and RT6.

[00202] In some embodiments, the kits are useful for monitoring the progression of a treatment. In some embodiments, the kits are useful for monitoring engraftment of health-associated bacteria in an individual treated with the health-associated bacteria. In some embodiments, the kits are useful for evaluating the purity of a bacterial sample, e.g., a probiotic sample. In some embodiments, the kits are useful for identifying a bacteria within a sample bacterial clone.

Furthermore, the kits are useful for any other method described herein, or any method that comprises identification of a target molecule within a sample. [00203] In some embodiments, kits include a carrier, package, or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the container(s) including one of the separate elements to be used in a method described herein. Suitable containers include, for example, bottles, vials, syringes, and test tubes. In other embodiments, the containers are formed from a variety of materials such as glass or plastic.

[00204] In some embodiments, a kit includes one or more additional containers, each with one or more of various materials (such as reagents, optionally in concentrated form, and/or devices) desirable from a commercial and user standpoint for use of described herein. Non-limiting examples of such materials include, but not limited to, buffers, primers, enzymes, diluents, filters, carrier, package, container, vial and/or tube labels listing contents and/or instructions for use and package inserts with instructions for use. A set of instructions is optionally included. In a further embodiment, a label is on or associated with the container. In yet a further embodiment, a label is on a container when letters, numbers or other characters forming the label are attached, molded or etched into the container itself; a label is associated with a container when it is present within a receptacle or carrier that also holds the container, e.g., as a package insert. In other embodiments a label is used to indicate that the contents are to be used for a specific therapeutic application. In yet another embodiment, a label also indicates directions for use of the contents, such as in the methods described herein.

[00205] Some kits described herein comprise components that do not require refrigeration, for example, they may be stored at temperatures greater than about 4 °C. Storage includes time periods greater than about 1 week, 1 month, 2 months, 3 months, 6 months, 1 year, 2 years, or 5 years. Storage also includes shipment, such that the kits may be shipped at temperatures above 4 °C. Such exemplary kit components include sample collection devices, lyophilized nucleic acid materials such as primers and probes, and the like. In some cases, kits described herein comprise components such as enzymes, primers, and/or probes that require storage at temperatures at or less than about 4 °C.

[00206] Some kits described herein provide components that allow for the removal of a bacterial sample from a surface. An exemplary component is a swab that is applied or swiped across the surface to collect the bacterial sample. After the bacterial sample is obtained on the swab, it may be stored without refrigeration, for example, at temperatures greater than about 4 °C. In some cases, such bacterial swabs could be stored for at least about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months or longer, prior to bacterial removal for subsequent analysis. [00207] In some cases, the kit comprises a sample collection device. In some cases, the sample collection device is a swab. In some cases, the swab comprises cotton. In some cases, the swab comprises polyester flock. In some cases, the swab is produced in a DNA controlled

environment to minimize contamination with extraneous genetic material. In some cases, the swab is a FAB SWAB from Puritan® Medical Products. In addition, the collection device or swab may be used to collect non-biological samples containing a target molecule to be assayed using a method described herein. An additional example of a sample collection device is an adhesive strip configured to adhere to a sample comprising genetic material. In some cases, the adhesive strip is a Biore® Strip. In some cases, the sample is a lipid pillar.

[00208] Disclosed herein are kits for at-home use or point of care. The kits may comprise: an adhesive strip configured for application to and removal from skin of a subject, whereby adhesive of the adhesive strip binds to and removes a bacterial sample from the skin after application and removal; a sample collection device for storing the adhesive strip and bacterial sample from the skin; and instructions for storing the adhesive strip comprising the bacterial sample at a temperature below room temperature. The kits may comprise: an adhesive strip configured for application to an removal from skin of a subject, whereby adhesive of the adhesive strip binds to and removes a lipid pillar from the pilosebaceous unit of the skin, wherein the lipid pillar comprises a bacterial sample; and instructions for storing the adhesive strip comprising the lipid pillar at a temperature below room temperature. Room temperature is generally about 25 °C. The temperature may be less than about 10 °C. The temperature may be less than about 8 °C. The temperature may be about 4 °C. The temperature may be about 0 °C to about 10 °C. Adhesive strips are described herein and throughout. The kit may also include an insulated mailer (e.g., Styrofoam box or insulated envelope), a re-freezable ice packs, or a combination thereof.

EXAMPLES

[00209] While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention.

Example 1: Identification of health-associated strains

[00210] Characteristics that may predispose a particular microbe to be a health-associated microbe can be determined using samples from healthy and disease afflicted volunteers, culturing the microbes from each, and performing a comparative genomic analysis. In the present example, samples were collected from volunteers afflicted with (disease samples) or not afflicted with (healthy samples) acne vulgaris in order to identify markers of health-associated P. acnes strains.

[00211] Microcomedone or swab samples were collected from consenting adult subjects. Clonal samples were isolated by limited dilution on plates, and then grown in 200 μΙ_, of liquid culture. Microbial DNA was isolated from 96 individual cultures. DNA was isolated using

QIAgen's DNeasy Blood & Tissue kit, following the manufacturer's instructions. Paired-end DNA sequencing (2 x 300bp) was done on an Illumina MiSeq using reagent kit v3, following the manufacturer's instructions, yielding 200,000 to 600,000 reads for each of the 96 samples. Initial analysis was performed in Illumina' s Basespace Sequence Hub, and all reads from each sample were aligned with a BWA Aligner to:

a. deoR;

b. Propionibacterium acnes ATCC 11828 (accession CP003084); or

c. pIMPLE and other reference genomes.

Alignments were interrogated with the Broad Institute's Integrative Genomics Viewer and confirmed using Biomatter's Geneious version 9.1. All 96 samples were analyzed for the presence or absence of the deoR sequence, Type I lipase or Type II lipase sequence, and presence or absence of pIMPLE plasmid. Sequence alignments were performed between sequences of P. acnes from healthy volunteers and the deoR gene. Analysis revealed that approximately half of all healthy clones were positive for deoR (greater than 0.4% of reads mapping to deoR locus). Sequence alignments were also performed between P. acnes of healthy volunteers and the lipase gene locus to determine the percentage of P. acnes clones that were positive for Type I lipase and/or for Type II lipase. With regard to the pIMPLE plasmid, sequence alignments of reads from healthy volunteers performed against pIMPLE-HL096PAl (GenBank: CP003294.1) revealed that P. acnes from healthy volunteers are free of pIMPLE plasmid.

[00212] FIG. 1 shows that a greater percentage of the total reads from healthy volunteers align to RT1 than align to RT2, as indicated by the position of each data point above the diagonal where RT1=RT2. As shown in Table 4, the distribution of genotypes of 370 P. acnes clones collected from healthy subjects indicates that some RT1 strains are deoR positive and Type II lipase positive. This data collectively shows that some RT1 strains may be considered a health- associated P. acnes. Table 4. Summary of sequencing data for the P. acnes isolated from healthy volunteers

Example 2: Identification of health-associated strains having genes encoding for

hyaluronidase

[00213] Select health-associated P. acnes clones were further examined for presence of a gene encoding hyaluronidase. Unexpectedly, most health-associated strains that were positive for Type II lipase also possessed a hyaluronidase gene, as shown in Table 5.

Table 5. Presence of a gene encoding hyaluronidase in health-associated P. acnes strains that are positive for Type II lipase

Example 3. Genotyping of P. acnes by quantitative Polymerase Chain Reaction (qPCR)

[00214] P. acnes was genotyped by quantitative polymerase chain reaction (qPCR) using primers specific to deoR and the gene encoding for CRISPR-associated protein Cas5 from P. acnes (ATCC 11828, GenBank: AER05233.1). [00215] Genomic DNA was purified from 4 samples (listed in Table 6 below). The DNA concentration was determined. 8 sample dilutions were prepared: 1 ng and 10 ng of DNA of HP5G4, HL043PA1(RT5), HP3B4, and HP3G1 diluted in molecular grade water. From the sample dilutions, 11.25 [iL of each sample was aliquoted into a well of a PCR plate. A mixture comprising deoR primers (20X) (SEQ ID NOS: 1, 2) and TaqMan master mix (2X) was prepared, and 13.75 μΤ of the mixture added to half of the wells comprising DNA. A second mixture comprising Cas5 primers (20X) (SEQ ID NOS: 3, 4) and TaqMan master mix (2X) was prepared, and 13.75 μΤ of the mixture was added to the other half of the well comprising DNA. The plate set up can be seen in Table 7 below.

[00216] qPCR was performed for 40 cycles. The reporter dye was FAM, and the quenching dye was MGB-NFQ.

[00217] Table 7 shows the number of cycles required to reach the cycle threshold (Ct), with Ct values below 30 cycles indicating a strong positive for the presence of the target (deoR or Cas5). Ct values that are less than 30 are indicated in the table with a bold underline. As shown in

Tables 6 and 7, HP3B4, HP3G1, and HP5G4 were positive for deoR. 10 ng of sample had a lower cycle threshold (Ct) value than 1 ng. HL043PA1 does not contain deoR and did not cross the threshold before 30 cycles. Only HP5G4 (RT2) was positive for Cas5. In each case, the 10 ng had a lower Ct value than the 1 ng sample. All other samples did not contain Cas5 and thus did not cross the threshold before 30 cycles.

Table 6. P. acnes samples genotyped for the presence of deoR and Cas5.

Table 7. Threshold cycle numbers for P. acnes samples amplified for target genes.

Amount of

Well Position Sample Name DNA (ng) Target Name Ct Ct threshold

Bl HP3B4 1 Cas5 Undetermined .14

B2 HP3G10 1 Cas5 Undetermined .14

B3 HP5G4 1 Cas5 18 .14

B4 HL043PA1 1 Cas5 33 .14

B5 HP3B4 10 Cas5 38 .14

B6 HP3G10 10 Cas5 34 .14

B7 HP5G4 10 Cas5 15 .14

B8 HL043PA1 10 Cas5 30 .14

BIO HP5G4 31 Cas5 14 .14

Bl l Blank 0 Cas5 Undetermined .14

Example 4. Genotyping of P. acnes HP4G1, HP5G1 and HP5G5 using colony qPCR

[00218] Colonies of P. acnes HP4G1, HP5G1 and HP5G5 were genotyped by quantitative polymerase chain reaction (qPCR) using primers to deoR and the gene encoding for CRISPR- associated protein Cas5.

[00219] Stabs from single colonies of HP4G1, HP5G1, and HP5G5 were suspended in 100 uL of water. The positive control was genomic HP5G4 DNA; 1 ng and 10 ng of HP5G4 DNA was diluted in water and 11 μΐ, was aliquoted to each well. The negative control was DNA-free water (W). For each of HP4G1, HP5G1, and HP5G5, 1 μΐ_^ and 10 μΙ_, of sample was aliquoted to each well, and molecular grade water was added to bring the total volume in each well to 11 μυ A mixture comprising deoR primers (20X) and TaqMan master mix (2X) was prepared, and 13.75 μΐ, of the mixture was added to half of the wells comprising DNA. A second mixture comprising Cas5 primers (20X) and TaqMan master mix (2X) was prepared, and 13.75 μΙ_, of the mixture was added to the other half of the well comprising DNA. The plate set up and results are shown in Table 8 below.

Table 8. Reaction set-up for P. acnes amplification.

[00220] qPCR was performed for 40 cycles and the cycle threshold (Ct) was recorded for each sample. A Ct less than 30 is a strong positive for the presence of the target (deoR or Cas5); all samples were positive, and in each case the 10 μΐ sample had a lower Ct than the 1 μΐ sample. Zero DNA (water) samples reported an 'Undetermined' (UD) Ct and thus were negative for both sequences.

Example 5. Determination of the percentage of pIMPLE plasmid in P. acnes strains

[00221] The percentage of pIMPLE plasmid in P. acnes strains HP3A11, HP5G4, HP4G1, HL045PA1, HL043PA1, HL 11 OP A3 and HL110PA4 was determined.

[00222] Biological samples were collected and grown in 200 μΐ. of liquid culture. DNA was isolated using QIAgen's DNeasy Blood & Tissue kit, following the manufacturer's instructions. Paired-end DNA sequencing (2 x 300bp) was done on an Ulumina MiSeq using reagent kit v3, following the manufacturer's instructions, yielding 200,000 to 600,000 reads for each sample. Initial analysis was performed in Illumina's Basespace Sequence Hub, and all reads from each sample were aligned with a BWA Aligner to pIMPLE. Alignments were interrogated with the Broad Institute's Integrative Genomics Viewer and confirmed using Biomatter's Geneious version 9.1.

[00223] The percentage of pIMPLE was determined by the percentage of total sequencing reads that aligned to pIMPLE plasmid from HL096PA1. The percentage of pIMPLE was also calculated as the coverage * copy number. Using these methods, the percentage of pIMPLE in the different ribotypes was determined, as shown in Table 9.

Table 9. Presence of pIMPLE plasmid in different P. acnes strains.

Example 6. Characterization of P. acnes RT6

[00224] Biological samples of P. acnes RT6 were collected and grown in 200 μΐ. of liquid culture. DNA was isolated using QIAgen's DNeasy Blood & Tissue kit, following the manufacturer's instructions. The genome of HL110PA4 (RT6) was sequenced using paired-end DNA sequencing (2 x 300bp) on an Illumina MiSeq using reagent kit v3, following the manufacturer's instructions, yielding 200,000 to 600,000 reads. Alignments were interrogated with the Broad Institute's Integrative Genomics Viewer and confirmed using Biomatter's Geneious version 9.1.

[00225] Alignments of HL110PA4 (RT6) and HL 11 OP A3 (RT6) with ATCC 11828 (RT2), (data available), show that both of the RT6 strains are missing an alanine dehydrogenase at 885292...886404 kb of ATCC 11828 and as such, in some cases this is exploited to distinguish between RT6 and RT2 of P. acnes.

Example 7. Identification of P. acnes RT6

[00226] In an effort to isolate and purify health-associated strains of P. acnes, {e.g., strains not associated with acne) it may be useful to identify undesirable strains of P. acnes in a sample {e.g., strains found on skin of subjects with acne). For instance, in some cases, P. acnes of ribotype RT6 is undesirable. To this end, genes can be identified that are specific to strains of interest. The following example demonstrates how this can be performed.

[00227] Identities of genes that distinguish P. acnes of ribotype RT6 from healthy strains were confirmed. Genes encoding DNA binding response regulator and phosphoglycerate kinase were identified in P. acnes of ribotype RT6, but not RTl, RT2, RT3, RT4 and RT5. In addition, a gene encoding ABC transporter is absent in RT6, but present in RTl, RT2, RT3, RT4 and RT5.

Sequences for these genes are provided as SEQ ID NOS: 16 (ABC transporter), 17 (DNA binding response regulator), and 18 (phosphoglycerate kinase).

[00228] The presence or absence of these genes was confirmed by sequence alignment using BLAST, Megablast, (a registered trademark of the National Library of Medicine) with either the whole complete genome or all of the scaffolds of a completed genome against each of these three gene sequences. The results are shown in Table 10. "Y" is a perfect match for the entire sequence OR > 60bp continuous perfect sequence alignment. "N" means there is < 60bp perfect alignment. The best match of a "N" was 26 base pairs (bp). Table 10. Genetic characterization of P. acnes strains

Example 8. PanBacterial (PANBAC) assay to characterize skin microbiome

[00229] Robust quantitative characterization of the skin microbiome was performed using a PANBAC assay. This assay can be performed with or without the use of preservatives, is compatible with qPCR methods, and does not require DNA purification. In this example, TaqMan qPCR assays were performed to quantitate most of the bacteria collected from the face. Performance was confirmed with two different bacterial phyla, all Propionibacterium and Staphylococcus. This method required the assessment of only a single locus to recognize most bacteria commonly found on the face (P. acnes strains and Staphylococcus), whereas current methods in the field use multiple primer pairs to achieve similar coverage. The diversity of the bacteria on the skin of a subject's face is shown in Table 11.

Table 11. Bacteria on Human Facial Skin

[00230] A portion of a 23 S sequence from bacteria commonly found on the human face was aligned with known sequences, see FIG. 2, and SEQ ID NOs: 33 to 43. It was surprising to locate a genomic sequence that is both amenable to a robust TaqMan assay and ubiquitous across different phyla; note how multiple single nucleotide polymorphisms are avoided by careful placement of the probe sequence between the two primers as shown in Fig 2. Despite two Single Nucleotide Polymorphisms at this loci (denoted by bold and underlined letters), careful placement of primers (gray and black) and TaqMan reporter (white) enable quantification of widely diverse bacteria from both Actinobacteria and Firmicutes.

[00231] To validate the performance of the assay to measure the percentage of health-associated P. acnes in a mixed population of bacteria, FIG. 3 was generated. A standard curve for all assays (deoR, Cas5, and PANBAC) was generated with healthy P. acnes genomic DNA.

Percentages of health-associated P. acnes were measured and quantitated with the above standard curve for a dilution series of the healthy P. acnes with either S. epidermidis (shown in FIG. 3) or a pathogenic P. acnes. Percentages for each sample were determined by dividing the number of deoR+ or Cas5+ bacteria by total bacteria as determined using the PANBAC assay. FIG. 3 shows that while the total number of bacteria (PANBAC #) remained constant, the percentage of healthy went from 0% to 100%.

[00232] The PANBAC assay may be used in a variety of applications, where it is useful to identify the percentage of a particular bacteria of interest in a total sample of bacteria. For example, the assay may be utilized to assess bacterial populations in biological, environmental, and/or industrial samples. For instance, this assay has been used to assess the stability of bacteria in a sample, e.g., when a sample of bacteria such as a probiotic is stored. In another example, this assay has been utilized to validate the purity and composition of a probiotic.

Example 9. Measuring the microbiome of the human face

[00233] Robust measurement of the percentage health-associated P. acnes on a human subject's face or hair follicle has significant utility both as a diagnostic and monitoring tool. As shown in FIG. 5, over the period of 4 months the faces of two healthy subjects and two subjects with acne vulgaris were sampled with swabs, the bacteria extracted and TaqMan assays for deoR, Cas5 and PANBAC were run to quantitate percentage of deoR positive bacteria (% deoR, deoR/PANBAC) and percentage of Cas5 positive bacteria (%Cas5, Cas5/PANBAC) bacteria. Characterization of the bacteria in hair follicles has been performed by collection with pore strips and yields similar data.

Example 10. Analysis of bacterial population from pilosebaceous units

[00234] The bacterial population of a pilosebaceous unit from a subject is analyzed. Briefly, an adhesive strip, in this example, a Biore® Strip, is applied to the skin of the subject such that the adhesive of the strip adheres to lipid pillars from the subject. The adhesive strip is removed with the adherent lipid pillars. The adhesive strip is frozen at -20 °C for at least 20 minutes. Lipid pillars are plucked from the strip, placed in Lysis Buffer from ThermoFisher® DNA Extract All Reagents Kit, and incubated for at least 10 minutes at 95 °C. The sample is then stabilized with an equal volume of Stabilization Buffer. The stabilized sample may be analyzed using, e.g., a qPCR method described herein to determine the population of bacteria within the sample comprising a target nucleic acid, such as deoR and/or Cas5.

Example 11. Identification of the heterogeneity of bacterial communities in different hair follicles and recovery of desired genotypes.

[00235] Functional engraftment of a desired bacterial strain to skin is thought to entail the presence of viable samples of the desired bacterial from within the pilosebaceous gland. In this example lipid pillars were collected from the skin of a subject as described in Example 10 and fifteen (15) individual pillars were aseptically isolated, in this case using fine forceps, and placed in a compatible liquid media. In this case individual lipid pillars were grown in 200μ1 of

Reinforced Clostridial Media (RCM), and the resident communities grown anaerobically at 37 degrees C in the dark. After several days of growth, samples were taken from each liquid culture and two negative controls, and genotyped by qPCR for health associated (deoR and Cas5) and disease associated (TPase2) loci. Unexpected heterogeneity of healthy and disease genotypes was found in pilosebaceous units from the same individual (see FIG. 6). Four genotypic-ally distinct populations were found: dominated by deoR (sample 1), by deoR+Cas5 (samples 3,9,10, 15 and 17) by transposase 2 (samples 4,7,8 and 11) and those containing none of the tested genotypes (sample 13). Sample 13 contained significant bacteria and could be either a different P. acnes strain or different species such as S. aureus.

[00236] To further characterize the strains containing both deoR and Cas5 present in a single pilosebaceous unit, the bacteria from samples 9, 15 and 17 (see FIG. 6) were plated at a sufficient dilution to enable the isolation of clonal populations and grown anaerobically at 37 deg. C. Colonies that looked like P. acnes were plucked and genotyped as above (see FIG. 7, sorted by Cas5/PB). Approximately half of the isolates appear health-associated (containing both deoR and Cas5) and there were several disease-associated strains dominated by TPase2.

Example 12. Identification of viable HP4Glfrom individual hair follicles

[00237] Engraftment of a therapeutic probiotic (desired bacterial strain) is best demonstrated with a higher resolution genotyping of clones recovered by methods such as in Example 11. Since many health-associated strains of P. acnes contain both deoR and Cas5, the genomic DNA encoding the CRISPR region was directly sequenced. Using primers (see Table 12) designed to span the entire region (see FIG. 8, black arrows labeled "F" and "R") amplicons were generated containing all repetitive and spacer sequences. The entire sequence for each isolated clone was read using Sanger sequencing.

Table 12. Primers spanning CRISPR region in health-associated strains of P. acnes

[00238] Shown in FIG 9. are four easily distinguishable P. acnes strains that all contain both deoR and Cas5 and lack transposase 2. B01 is HP4G1, ATCC 11828 a publicly available RT2 strain, P. acnes variant is a clone from Example 11 and P. acnes variant #2 was collected from an IRB-approved trial. Note for these strains all repeat sequences (gray blocks) are identical. Some spacer sequences (numbered white blocks) are shared and thus labeled with the same number; NB01 has 7 unique spacer sequences, the most in this set.

[00239] While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention.

Claims

CLAIMS WHAT IS CLAIMED IS:

1. A method for determining a quantity of bacteria within a sample, the method comprising quantifying the presence of a ribosomal ribonucleic acid (rRNA) sequence within the sample, thereby determining the quantity of bacteria within the sample, wherein the quantifying comprises quantitative polymerase chain reaction (qPCR).

2. The method of claim 1, provided that the rRNA sequence comprises a sequence at least about 90% or 95% identical to any one of SEQ ID NOS: 33-43.

3. The method of claim 1, provided that the rRNA sequence comprises a sequence at least about 10 nucleotides in length and 90% or 95% identical to a sequence between SEQ ID NO: 7 and SEQ ID NO: 8 within a bacterial rRNA.

4. The method of claim 1, provided that the sample is obtained from the skin of a human face.

5. The method of claim 1, provided that the sample is obtained from a pilosebaceous unit from an individual.

6. A method of determining the percentage of bacteria containing a target molecule within the total bacteria of the sample, comprising quantifying the amount of target molecule within the sample, and dividing the amount of target molecule by the quantity of bacteria within the sample as determined in claim 1.

7. The method of claim 6, provided that the target molecule comprises deoR.

8. The method of claim 6, provided that the target molecule comprises Cas5.

9. The method claim 1, comprising selecting a colony of bacteria grown from the sample,

diluting the colony in water to provide a template for a nucleic acid amplification reaction, and quantifying the rRNA sequence from the colony.

10. A method of determining the quantity of bacteria comprising a target molecule within a

bacterial sample, the method comprising (a) determining a quantity of copies of the target molecule in the sample, and (b) determining a quantity of copies of a reference nucleic acid sequence present in a plurality of different bacteria in the sample, and relating the value of (a) to (b), thereby determining the quantity of bacteria comprising the target molecule within the bacterial sample, wherein determining the quantity of copies of the target molecule and the reference nucleic acid sequence comprises quantitative polymerase chain reaction.

11. The method of claim 10, provided that relating the value of (a) to (b) comprises dividing (a) by (b) to generate a percentage of bacteria within the bacterial sample comprising the target molecule.

12. The method of claim 10, provided that the reference nucleic acid sequence comprises a 23S rRNA sequence.

13. The method of claim 12, provided that the 23S rRNA sequence comprises a sequence at least about 90% or 95% identical to any one of SEQ ID NOS: 33-43.

14. The method of claim 10, comprising obtaining the bacterial sample from the face of the

human subject.

15. The method of claim 10, comprising obtaining the bacterial sample from a pilosebaceous unit of the human subject.

16. The method of claim 10, provided that the bacterial sample is a probiotic sample for

administration to a subject.

17. The method of claim 10, provided that the bacterial sample is obtained during manufacture or production of a food, drug, probiotic, vaccine, insecticide, enzyme, fuel, solvent, bacterial starter culture, or a combination thereof.

18. The method of claim 10, provided that the bacterial sample is obtained during manufacture or production of an antibiotic.

19. The method of claim 10, provided that the target molecule comprises deoR.

20. The method of claim 10, provided that the target molecule comprises Cas5.

21. The method of claim 10, wherein the bacterial sample is from a subject, and wherein the method comprises monitoring the efficacy of a treatment configured to alter the percentage of bacteria comprising the target molecule in a subject.

22. The method of claim 21, wherein the treatment is administration of a probiotic.

23. The method of claim 21, comprising obtaining the sample after treatment.

24. The method of claim 21, comprising determining the percentage of deoR in the sample is greater than about 20% and that engraftment of the probiotic to the subject has been achieved.

25. The method of claim 21, comprising determining the percentage of Cas5 in the sample is greater than about 20% and that engraftment of the probiotic to the subject has been achieved.

26. The method of claim 21, further comprising at least one of increasing the treatment, reducing the treatment, ceasing treatment, and continuing treatment.

27. The method of claim 22, provided that the probiotic comprises a health-associated bacteria.

28. The method of claim 27, provided that the treatment further comprises administering to the subject an active agent configured to alter the amount of a health-associated bacteria within the sample.

29. The method of claim 27, provided that the sample is obtained from a subject administered a probiotic comprising a deoR+ bacteria

30. The method of claim 27, provided that the sample is obtained from a subject administered a probiotic comprising a Cas5+ bacteria.

31. The method of claim 27, provided that the health-associated bacteria comprises P. acnes.

32. The method of claim 27, provided that the health-associated bacteria comprises one or more P. acnes bacteria, each P. acnes bacteria having a ribotype selected from RT1, RT2, RT3, and RT6.

33. A method of treating a subject with a health-associated bacteria, provided that a sample from the subject comprises less than about 10% of deoR/23S rRNA, as measured in claim 19.

34. A method of treating a subject with a health-associated bacteria, provided that a sample from the subject comprises less than about 10% of Cas5/23S rRNA, as measured in claim 20.

35. The method of claim 10, provided that the presence and/or quantity of the target molecule is indicative of the presence of one or more bacteria of interest in the sample.

36. The method of claim 35, provided that the one or more bacteria of interest comprise one or more P. acnes bacteria.

37. A method of determining the efficacy of a treatment configured to alter the quantity of bacteria comprising the target molecule in a subject, the method comprising determining the quantity of bacteria comprising the target molecule within the bacterial sample as claimed in claim 10, provided that the bacterial sample is obtained from the subject prior to, during, and/or after the treatment.

38. A method of determining the purity of a probiotic, comprising measuring the quantity of bacteria comprising a target molecule within a sample of the probiotic, as claimed in claim 10.

39. A method of determining the identity of a bacteria within the bacterial sample prior to

performing a sequencing reaction, comprising measuring the quantity of bacteria comprising a target molecule within the bacterial sample as claimed in claim 10.

40. A method for determining the genomic stability of a bacteria of interest within a sample, the method comprising measuring the quantity of a target molecule present in the bacteria of interest within the sample, as claimed in claim 10.

41. A kit comprising: a first primer pair specific for hybridizing to and amplifying a nucleic acid sequence comprising at least about 20 contiguous nucleotides of deoR in a nucleic acid amplification reaction, and a second primer pair specific for hybridizing to and amplifying a nucleic acid sequence comprising at least about 20 contiguous nucleotides of a reference nucleic acid in a nucleic acid amplification reaction, provided that the reference nucleic acid is a nucleic acid present in a plurality of bacteria present on the human face.

42. The kit of claim 41, provided that the reference nucleic acid sequence comprises a 23 S rRNA sequence.

43. The kit of any of claim 41, comprising a sample collection device.

44. The kit of claim 43, provided that the sample collection device does not require storage at temperatures lower than 20 °C.

45. A kit comprising: a first primer pair specific for hybridizing to and amplifying a nucleic acid sequence comprising at least about 20 contiguous nucleotides of Cas5 in a nucleic acid amplification reaction, and a second primer pair specific for hybridizing to and amplifying a nucleic acid sequence comprising at least about 20 contiguous nucleotides of a reference nucleic acid in a nucleic acid amplification reaction, provided that the reference nucleic acid is a nucleic acid present in a plurality of bacteria present on the human face.

46. The kit of claim 45, provided that the reference nucleic acid sequence comprises a 23 S rRNA sequence.

47. A sample collection device comprising a sample of bacteria obtained from the skin of a

subject retained on a polyester fiber of the sample collection device.

48. A method of analyzing the bacteria in a total bacterial sample removed from the sample

collection device of claim 47, comprising quantifying the amount of bacteria within the total bacterial sample comprising a target nucleic , provided that the target nucleic acid comprises: deoR, Cas5, transposase 2, dermatan-sulfate adhesin, DNA binding response regulator, phosphoglycerate kinase, ABC transporter, alanine hydrogenase, or a combination thereof.

49. A method of identifying the presence or absence of a target molecule within a sample, the method comprising obtaining genomic material from a sample without purification or isolation of the genomic material from the sample, diluting the sample in water, and performing a nucleic acid amplification reaction comprising contacting the genomic material with a probe capable of hybridizing to the target molecule or an amplification product thereof.

50. A method of determining the quantity of bacteria comprising a target molecule within a

bacterial sample, the method comprising (a) providing a plurality of clonal populations obtained from the bacterial sample and (b) determining the presence or absence of the target molecule in each clonal population, wherein the proportion of clonal populations comprising the presence of the target molecule is indicative of the quantity of bacteria comprising the target molecule within the bacterial sample, and wherein the target molecule is selected from deoR, Cas5, dermatan-sulfate adhesin, hyaluronidase, and transposase 2.

51. The method of claim 50, comprising monitoring the efficacy of a probiotic treatment

configured to alter the percentage of bacteria comprising the target molecule in a subject.

52. The method of claim 51, provided that the probiotic treatment comprises P. acnes.

53. The method of claim 52, provided that the P. acnes bacteria have a ribotype selected from RT1, RT2, RT3, and RT6.

54. A method of treating a subject with a health-associated bacteria, provided that the bacterial sample from the subject comprises less than about 10% of deoR+ clonal populations or less than about 10% of Cas5+ clonal populations, as measured by the method of claim 50.

55. The method of claim 54, provided that a low quantity of bacteria comprising the target

molecule within the bacterial sample is indicative of a propensity for developing disease skin disorder in the subject.

56. The method of claim 55, comprising treating the subject with P. acnes.

57. A method of characterizing a population of heterogeneous samples comprising a target

molecule, the method comprising:

a) providing a plurality of the heterogeneous samples, provided that two or more of the heterogeneous samples are obtained from different pilosebaceous units of the skin of a subject, and the two or more heterogeneous samples comprise a microbe, and

b) determining the presence or absence of the target molecule in the two or more heterogeneous samples, thereby characterizing the population of heterogeneous samples comprising the target molecule.

58. A method for analyzing the bacterial profile of skin from a subject, the method comprising:

a) providing a plurality of samples comprising bacteria from the skin of the subject, each of the plurality of samples obtained from a pilosebaceous unit of the skin, b) determining the presence or absence of a target molecule in at least one of the plurality of samples,

c) selecting a subpopulation of the plurality of samples determined to have the

presence of the target molecule, and

d) performing a genetic analysis on at least one member of the subpopulation to determine the presence or absence of a bacteria of interest within at least one of the plurality of samples.

59. The method of claim 1 for use in evaluating efficacy of an antimicrobial or an antifungal treatment.

60. The method of claim 1 for use in evaluating efficacy of an antimicrobial or an antifungal treatment prior to administration of a probiotic formulation or composition.