US20140065613A1 - Multiplex Y-STR Analysis - Google Patents

Multiplex Y-STR Analysis Download PDF

Info

Publication number
US20140065613A1
US20140065613A1 US13/828,443 US201313828443A US2014065613A1 US 20140065613 A1 US20140065613 A1 US 20140065613A1 US 201313828443 A US201313828443 A US 201313828443A US 2014065613 A1 US2014065613 A1 US 2014065613A1
Authority
US
United States
Prior art keywords
amplification
primers
str markers
str
markers
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US13/828,443
Other languages
English (en)
Inventor
Christina BORMANN CHUNG
Julio J. Mulero
Lori K. Hennessy
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Life Technologies Corp
Original Assignee
Life Technologies Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Life Technologies Corp filed Critical Life Technologies Corp
Priority to US13/828,443 priority Critical patent/US20140065613A1/en
Assigned to Life Technologies Corporation reassignment Life Technologies Corporation ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: HENNESSY, LORI, CHUNG, CHRISTINA BORMANN, MULERO, JULIO
Publication of US20140065613A1 publication Critical patent/US20140065613A1/en
Priority to US14/727,442 priority patent/US10597707B2/en
Priority to US16/799,810 priority patent/US20200255892A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6879—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for sex determination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Definitions

  • the disclosed invention relates to the determination of the identity of short tandem repeat (STR) alleles on the Y chromosome of a human using a multiplex analysis process.
  • STR short tandem repeat
  • a multiplex analysis that includes increased numbers of loci that can provide increased discrimination and sensitivity may accurately genotype a wider range of individuals.
  • DNA typing involves the analysis of select regions of genomic DNA, commonly referred to as “markers.” Most typing methods in use today are specifically designed to detect and analyze differences in the length and/or sequence of one or more regions of DNA markers known to appear in at least two different forms in a population. Such length and/or sequence variation is referred to as “polymorphism.” Any region (i.e., “locus”) of DNA in which such a variation occurs is referred to as a “polymorphic locus.”
  • STRs polymorphic short tandem repeats
  • Y-STR analysis is a valuable tool in a number of applications. Forensic applications include use in investigation of sexual assault cases where male DNA may be present in a sample that also contains an excess of female DNA. Y-STR analysis can be critical in excluding individuals from further inquiries. In another forensic application, a sample may include DNA from multiple male contributors. Y-STR analysis can be used to trace family relationship among males, either in forensic or other inheritance analyses, and can be used in missing person investigations. Additionally, Y-STR analysis can be used in paternity testing, including scenarios where the alleged father is not available for direct comparison.
  • U.S. Y-STR Database a searchable listing of 11- to 23-locus Y-STR haplotypes, and is found at: (hypertext transfer protocol://www.usystrdatabase.org/newdefault.aspx).
  • NCFS National Center for Forensic Science
  • the U.S. Y-STR Database is a population database only and is intended for use in estimating Y-STR haplotype population frequencies for forensic case work purposes.
  • haplotype databases are used to establish the frequency of a haplotype in specific populations, haplotype resolution (HR) of kits may vary across populations (Vermeulen et al., (2009) FSIG 3:205-213).
  • HR haplotype resolution
  • a male relative of a suspected individual may not be excluded. Relatives separated by up to 20 generations may have Y-STR profiles indistinguishable from each other, according to current analyses (Ballantyne et al. (2010): Am J Hum Genet 87:341-353).
  • adventitious matches increase as more male profiles are added to Y-STR frequency databases. Therefore, there exists a need in the art, to improve Y-STR multiplex analysis systems, assays, kits, and methods.
  • the invention provides a set of amplification primers including primers for the amplification of at least 11 Y-STR markers where the primers are configured to provide each set of amplicons of the at least 11 Y-STR markers having a base pair size less than about 220 base pairs.
  • detection of amplicon base pair size may be performed by a fluorescence detection technique.
  • detection of amplicon base pair size may be performed by a mobility-dependent analytical technique.
  • the mobility-dependent analytical technique may be capillary electrophoresis.
  • detection of the amplicon base pair size may be performed by a sequencing technique using no fluorescent dye labels.
  • the set of amplification primers may further include primers for the amplification of at least 5 additional Y-STR markers where the primers are configured to provide each set of amplicons of the at least 5 additional Y-STR markers having a base pair size greater than about 220 base pairs.
  • the set of amplification primers may be configured to provide all of the sets of amplicons of the more than 11 Y-STR markers having a base pair size less than about 410 base pairs.
  • the set of amplification primers when the set of amplification primers amplify more than 11 Y-STR markers, then the set of amplification primers may be configured to provide all of the sets of amplicons of the more than 11 Y-STR markers having a base pair size less than about 420 base pairs. In some embodiments, when the set of amplification primers amplify more than 11 Y-STR markers, then the amplification primer set may include primers for 25 Y-STR markers. In some embodiments, when the amplification primer set includes primers for 25 Y-STR markers, the set of amplification primers may include primers for at least two double copy markers. In some embodiments, the set of amplification primers may be labeled with one of at least 5 fluorescent dyes.
  • the set of amplification primers may be configured to provide each set of the amplicons of the at least 11 Y-STR markers labeled with one of at least 5 fluorescent dyes.
  • the at least 5 fluorescent dyes used to label the primers and/or the amplicons may be configured to be spectrally distinct.
  • the set of amplification primers may further include at least one amplification primer that includes a mobility modifier.
  • the set of amplification primers for the amplification of at least 11 Y-STR markers may be configured to provide at least one set of amplicons of the Y-STR markers including a mobility modifier.
  • the set of amplification primers amplifying at least 11 Y-STR markers may amplify DYS576, DYS389I, DYS460, DYS458, DYS19, DYS456, DYS390, DYS570, DYS437, DYS393, and DYS439.
  • the set of amplification primers amplifying the at least 11 Y-STR markers configured to provide each set of amplicons of the at least 11 Y-STR markers having a base pair size less than about 220 base pairs, may amplify at least 5 Y-STR markers which are rapidly mutating loci.
  • the at least 5 rapidly mutating Y-STR markers may include DYF387S1ab, DYS449, DYS570, DYS576, and DYS627. In other embodiments, the at least 5 rapidly mutating Y-STR markers may further include DYS518.
  • the set of primers for the amplification of at least 11 Y-STR markers may be a set of primers for the amplification of DYF387S1ab, DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS460, DYS437, DYS438, DYS439, DYS448, DYS449, DYS456, DYS458, DYS481, DYS518, DYS533, DYS570, DYS576, DYS627, DYS635, and Y-GATA-H4.
  • the set of primers for the amplification of at least 11 Y-STR markers may be a set of primers for the amplification of DYF387S1ab, DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS460, DYS437, DYS438, DYS439, DYS448, DYS449, DYS456, DYS458, DYS481, DYS533, DYS570, DYS576, DYS627, DYS635, DYS643, and Y-GATA-H4.
  • a kit for co-amplifying a set of loci of at least one DNA sample including primers for the amplification of at least 11 Y-STR markers where the primers are configured to provide each set of amplicons of the at least 11 Y-STR markers having a base pair size less than about 220 base pairs; and optionally, a size standard.
  • the kit may further include primers for the amplification of at least 5 Y-STR markers where the primers are configured to provide each set of amplicons of the at least 5 Y-STR markers having a base pair size greater than about 220 base pairs.
  • the kit may include an amplification primer set for 25 Y-STR markers.
  • the set of amplification primers when the set of amplification primers amplify more than 11 Y-STR markers, then the set of amplification primers may be configured to provide all of the sets of amplicons of the more than 11 Y-STR markers having a base pair size less than about 410 base pairs. In various embodiments, when the set of amplification primers amplify more than 11 Y-STR markers, then the set of amplification primers may be configured to provide all of the sets of amplicons of the more than 11 Y-STR markers having a base pair size less than about 420 base pairs. In some embodiments, the kit may include a set of amplification primers labeled with one of at least 5 fluorescent dyes.
  • the at least 5 fluorescent dyes used to label the primers of the kit may be configured to be spectrally distinct.
  • the kit may further include at least one amplification primer that includes a mobility modifier.
  • the kit including a set of amplification primers amplifying at least 11 Y-STR markers may amplify DYS576, DYS389I, DYS460, DYS458, DYS19, DYS456, DYS390, DYS570, DYS437, DYS393, and DYS439.
  • the kit including a set of amplification primers amplifying the at least 11 Y-STR markers, where the primers are configured to provide each set of amplicons of the at least 11 Y-STR markers having a base pair size less than about 220 base pairs may amplify at least 5 Y-STR markers which are rapidly mutating loci.
  • the at least 5 rapidly mutating Y-STR markers may include DYF387S1ab, DYS449, DYS570, DYS576, and DYS627.
  • the at least 5 rapidly mutating Y-STR markers may further include DYS518.
  • the kit including a set of primers for the amplification of at least 11 Y-STR markers may be a set of primers for the amplification of DYF387S1ab, DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS460, DYS437, DYS438, DYS439, DYS448, DYS449, DYS456, DYS458, DYS481, DYS518, DYS533, DYS570, DYS576, DYS627, DYS635, and Y-GATA-H4.
  • the kit including a set of primers for the amplification of at least 11 Y-STR markers may be a set of primers for the amplification of DYF387S1ab, DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS460, DYS437, DYS438, DYS439, DYS448, DYS449, DYS456, DYS458, DYS481, DYS533, DYS570, DYS576, DYS627, DYS635, DYS643, and Y-GATA-H4.
  • the kit when the kit includes a size standard, the kit further includes an allelic ladder.
  • a method to amplify alleles of Y-STR markers of a human male including the steps of: contacting a sample suspected to contain a DNA sample of a human male with a set of amplification primers including primers for the amplification of the alleles of at least 11 Y-STR markers; and amplifying the sample thereby forming a plurality of sets of amplicons of the at least 11 Y-STR markers where each set of the amplicons has a base pair size less than about 220 base pairs.
  • the method may further include the step of detecting each set of amplicons whereby the alleles of the at least 11 Y-STR markers are identified.
  • the detecting step is performed by separating the plurality of sets of amplicons using a mobility dependent analysis, where the plurality of sets of amplicons is fluorescently labeled. In other embodiments, the detecting step does not detect fluorescence. In embodiments, when the detecting step does not detect fluorescence, the detecting step may include ion semiconductor detection, pyrophosphate release detection, or mass spectrometry detection. In various embodiments of the method, the set of amplification primers may further include primers for the amplification of at least 5 additional Y-STR markers where the primers may be configured to provide each set of amplicons of the at least 5 additional Y-STR markers having a base pair size greater than about 220 base pairs.
  • the set of primers when the set of amplification primers amplifies more than 11 Y-STR markers, then the set of primers may be configured to provide all of the sets of amplicons of the more than 11 Y-STR markers having a base pair size less than about 410 base pairs. In various embodiments of the method, when the set of amplification primers amplifies more than 11 Y-STR markers, then the set of primers may be configured to provide all of the sets of amplicons of the more than 11 Y-STR markers having a base pair size less than about 420 base pairs. In some embodiments of the method, the amplification primer set may include 25 Y-STR markers.
  • the set of amplification primers may be labeled with one of at least 5 fluorescent dyes.
  • each set of the amplicons of the at least 11 Y-STR markers may be labeled with one of at least 5 fluorescent dyes.
  • the at least 5 fluorescent dyes used to label the primers and/or the amplicons may be configured to be spectrally distinct.
  • the set of amplification primers used in the method may further include at least one amplification primer that includes a mobility modifier.
  • the at least one set of amplicons may include a mobility modifier.
  • the set of amplification primers amplifying at least 11 Y-STR markers may amplify DYS576, DYS389I, DYS460, DYS458, DYS19, DYS456, DYS390, DYS570, DYS437, DYS393, and DYS439.
  • the set of amplification primers amplifying the at least 11 Y-STR markers may amplify at least 5 Y-STR markers which are rapidly mutating loci.
  • the at least 5 rapidly mutating Y-STR markers may include DYF387S1ab, DYS449, DYS570, DYS576, and DYS627. In other embodiments, the at least 5 rapidly mutating Y-STR markers may further include DYS518.
  • the set of primers for the amplification of at least 11 Y-STR markers may be a set of primers for the amplification of DYF387S1ab, DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS460, DYS437, DYS438, DYS439, DYS448, DYS449, DYS456, DYS458, DYS481, DYS518, DYS533, DYS570, DYS576, DYS627, DYS635, and Y-GATA-H4.
  • the set of primers for the amplification of at least 11 Y-STR markers may be a set of primers for the amplification of DYF387S1ab, DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS460, DYS437, DYS438, DYS439, DYS448, DYS449, DYS456, DYS458, DYS481, DYS533, DYS570, DYS576, DYS627, DYS635, DYS643, and Y-GATA-H4.
  • the method includes a set of amplification primers for the amplification of the alleles of 27 Y-STR markers.
  • the invention provides a set of amplification primers including primers for the amplification of at least 22 Y-STR markers where at least 5 of the Y-STR markers are rapidly mutating loci.
  • the at least 5 rapidly mutating Y-STR markers include DYF387S1ab, DYS449, DYS570, DYS576, and DYS627.
  • the at least 5 rapidly mutating Y-STR markers include DYS518.
  • the set of amplification primers configured to amplify the at least 22 Y-STR markers may be further configured to provide each set of amplicons of at least 11 Y-STR markers having a base pair size less than about 220 base pairs.
  • the set of amplification primers for the amplification of at least 22 Y-STR markers may be configured to provide sets of amplicons for the at least 22 Y-STR markers each having a base pair size of less than about 410 base pairs.
  • the set of amplification primers for the amplification of at least 22 Y-STR markers may be configured to provide sets of amplicons for the at least 22 Y-STR markers each having a base pair size of less than about 420 base pairs.
  • detection of amplicon base pair size may be performed by fluorescence detection. In some embodiments, detection of amplicon base pair size may be performed by a mobility-dependent analytical technique. The mobility-dependent analytical technique may be capillary electrophoresis. In some other embodiments, detection of the amplicon base pair size may be performed by a sequencing technique using no detection of fluorescent dye labels.
  • the amplification primer set may include 25 Y-STR markers. In some embodiments, the set of amplification primers is labeled with one of at least 5 fluorescent dyes. In some embodiments, each set of the amplicons of the at least 22 Y-STR markers is labeled with one of at least 5 fluorescent dyes.
  • the at least 5 fluorescent dyes used to label the primers and/or the amplicons may be configured to be spectrally distinct.
  • the set of amplification primers may further include at least one amplification primer that includes a mobility modifier.
  • the set of amplification primers for the amplification of at least 22 Y-STR markers may be configured to provide at least one set of amplicons of the Y-STR markers where the at least one set of amplicons includes a mobility modifier.
  • the at least 22 Y-STR markers may include DYF387S1ab, DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS437, DYS438, DYS439, DYS448, DYS449, DYS456, DYS458, DYS570, DYS576, DYS627, DYS635, and Y-GATA-H4.
  • the at least 22 Y-STR markers may include DYF387S1ab, DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS437, DYS438, DYS439, DYS448, DYS449, DYS456, DYS458, DYS518, DYS570, DYS576, DYS627, DYS635, and Y-GATA-H4.
  • a kit for co-amplifying a set of loci of at least one DNA sample may be provided, including a set of amplification primers for the amplification of at least 22 Y-STR markers where at least 5 of the Y-STR markers are rapidly mutating loci; and optionally, a size standard.
  • the size standard is an allelic ladder.
  • a method to amplify alleles of Y-STR markers of a human male including the steps of: contacting a sample which may contain a DNA sample of a human male with a set of amplification primers including primers for the amplification of the alleles of at least 22 Y-STR markers, wherein at least 5 of the Y-STR markers are rapidly mutating loci; and amplifying the sample thereby forming a plurality of sets of amplicons of the at least 22Y-STR markers.
  • a set of amplification primers of the alleles of at least 23 Y-STR markers are provided, wherein at least 5 of the Y-STR markers are rapidly mutating loci.
  • a set of amplification primers of the alleles of 27 Y-STR markers are provided, wherein at least 5 of the Y-STR markers are rapidly mutating loci.
  • the 27 Y-STR markers include 2 Y-STR markers having double copy markers contributing to the total number of Y-STR markers.
  • each set of the amplicons of at least 11 of the at least 22 Y-STR markers has a base pair size less than about 220 base pairs.
  • each set of the amplicons of at least 11 of at least 23 Y-STR markers has a base pair size less than about 220 base pairs.
  • each set of the amplicons of at least 11 of 27 Y-STR markers has a base pair size less than about 220 base pairs.
  • a set of amplification primers including primers for the amplification of the alleles of at least 22 Y-STR markers are provided, wherein at least 6 of the Y-STR markers are rapidly mutating loci.
  • a set of amplification primers including primers for the amplification of the alleles of at least 22 Y-STR markers are provided, wherein at least 7 of the Y-STR markers are rapidly mutating loci.
  • the method may further include the step of detecting each set of amplicons whereby the alleles of at least 22 Y-STR markers are identified. In some embodiments, the alleles of at least 23 Y-STR markers are identified. In yet other embodiments, the alleles of 27 Y-STR markers are identified.
  • the detecting step is a fluorescence detection step. In some embodiments, the detecting step is performed by separating the plurality of sets of amplicons using a mobility dependent analysis, where the plurality of sets of amplicons is fluorescently labeled. In other embodiments, the detecting step does not detect fluorescence.
  • the detecting step may include ion semiconductor detection, pyrophosphate release detection, or mass spectrometry detection.
  • the at least 11 Y-STR markers having amplicons having a base pair size of less than about 220 base pairs are DYS576, DYS389I, DYS460, DYS458, DYS19, DYS456, DYS390, DYS570, DYS437, DYS393, and DYS439.
  • the at least 5 rapidly mutating Y-STR markers are selected from the group consisting of DYF387S1ab, DYS449, DYS518, DYS570, DYS576, and DYS627. In other embodiments, the at least 5 rapidly mutating Y-STR markers are 6 rapidly mutating Y-STR markers.
  • a method of male individual identification including the steps of: contacting a sample containing a nucleic acid of a human male with a set of amplification primers including primers for the amplification of the alleles of at least 11 Y-STR markers; and amplifying the sample thereby forming a plurality of sets of amplicons of the at least 11 Y-STR markers where each set of the amplicons has a base pair size less than about 220 base pairs; and detecting each set of amplicons whereby the alleles of the male individual are identified.
  • the set of amplification primers amplifying at least 11 Y-STR markers may amplify DYS576, DYS389I, DYS460, DYS458, DYS19, DYS456, DYS390, DYS570, DYS437, DYS393, and DYS439.
  • the step of amplifying the at least 11 Y-STR markers may include amplifying at least 5 Y-STR markers which are rapidly mutating loci.
  • the at least 5 rapidly mutating Y-STR markers may include DYF387S1ab, DYS449, DYS570, DYS576, and DYS627.
  • the at least 5 rapidly mutating Y-STR markers may further include DYS518.
  • the set of primers for the amplification of at least 11 Y-STR markers may be a set of primers for the amplification of DYF387S1ab, DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS460, DYS437, DYS438, DYS439, DYS448, DYS449, DYS456, DYS458, DYS481, DYS518, DYS533, DYS570, DYS576, DYS627, DYS635, and Y-GATA-H4.
  • the set of primers for the amplification of at least 11 Y-STR markers may be a set of primers for the amplification of DYF387S1ab, DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS460, DYS437, DYS438, DYS439, DYS448, DYS449, DYS456, DYS458, DYS481, DYS533, DYS570, DYS576, DYS627, DYS635, DYS643, and Y-GATA-H4.
  • the method includes a set of amplification primers for the amplification of the alleles of more than 11Y-STR markers.
  • the plurality of sets of amplicons of the more than 11 Y-STR markers where the plurality of sets of the amplicons has a base pair size less than about 410 base pairs.
  • the detecting step is a fluorescence detection step.
  • the method further includes the step of comparing the alleles identified for a first male individual to the alleles identified for a second male individual, whereby the first male individual is differentiable from the second male individual.
  • the first male individual has a similar paternal genetic lineage as the second male individual.
  • FIG. 1 is a graphical representation of selected Y-STR markers, where Gene Diversity values are graphed on the x axis and mutation rate is mapped along the y axis.
  • FIG. 2 is a schematic representation of one embodiment of a Y-STR multiplex assay panel, Panel 1.
  • FIG. 3 is a schematic representation of an embodiment of a Y-STR multiplex assay panel, Panel 2.
  • FIG. 4 is a schematic representation of another embodiment of a Y-STR multiplex assay panel, Panel 3.
  • FIG. 5 is a schematic representation of a further embodiment of a Y-STR multiplex assay panel, Panel 4.
  • FIG. 6 is a schematic representation of yet another embodiment of a Y-STR multiplex assay panel, Panel 5.
  • FIG. 7 is a schematic representation of yet another embodiment of a Y-STR multiplex assay panel, Panel 6.
  • FIG. 8 is a graphical representation of an electrophoretic run for the Y-STR panel of FIG. 7 (Panel 6), color separated. The 6 th dye standard channel is not shown.
  • FIG. 9 is a table comparing selected Y-STR marker panels from various sources to Panel 6 and includes the number of alleles for each panel.
  • FIG. 10 is a schematic representation of another embodiment of a Y-STR multiplex assay panel, Panel 7.
  • FIG. 11 is a graphical representation of an electrophoretic run for the Y-STR panel of FIG. 10 (Panel 7), color separated. The 6 th dye standard channel is not shown
  • FIG. 12 is a table comparing selected Y-STR marker panels from various sources to Panel 7 and includes the number of alleles for each panel.
  • FIG. 13 is a graphical representation comparing the alleles of the Yfiler® multiplex assay and the expanded alleles of Panels 1-7 for DYS438 marker.
  • FIG. 14 is a graphical representation of the effect of primer length for DYS456 marker when amplifying selected male/female DNA mixtures.
  • FIG. 15A-E is a graphical representation of one embodiment of an allelic ladder for the multiplex panel of FIG. 10 (Panel 7).
  • FIG. 15F is a graphical representation of another embodiment of an allelic ladder for the multiplex panel of FIG. 10 (Panel 7).
  • FIG. 16 is a graphical representation comparing the number of alleles recovered from PCR amplifications using Y-STR Panel 6 and Yfiler®, as decreasing amounts of target DNA are used.
  • FIG. 17 is a graphical representation comparing the number of alleles recovered from PCR amplifications using Y-STR Panel 7 and Yfiler®, as decreasing amounts of target DNA are used.
  • FIG. 18 is a graphical representation comparing the percentage of alleles identified using the Y-STR Panel 6 and Yfiler® multiplexes as the ratio of male to female DNA decreases, using a constant concentration of female DNA.
  • FIG. 19 is a graphical representation comparing the percentage of alleles identified using the Y-STR Panel 7 and Yfiler® multiplexes as the ratio of male to female DNA decreases, using a constant concentration of female DNA.
  • FIG. 20 is a graphical representation comparing the percentage of alleles identified using the Y-STR Panel 6 and Yfiler® multiplexes as the ratio of male to female DNA decreases, using an increasing concentration of female DNA.
  • FIG. 21 is a graphical representation of the comparison of the intracolor balance when using Panel 6 multiplex or the Yfiler® multiplex.
  • FIG. 22 is a graphical representation of the comparison of the intracolor balance when using Panel 7 multiplex or the Yfiler® multiplex, at two different ratios of male: female DNA.
  • FIG. 23 is a graphical representation of the comparison of the average percentage of alleles identified using the Y-STR Panel 6 or Yfiler® multiplexes when amplifying target DNA in the presence of increasing amounts of humic acid.
  • FIG. 24 is a graphical representation of the comparison of the average percentage of alleles identified using the Y-STR Panel 6 or Yfiler® multiplexes when amplifying target DNA in the presence of increasing amounts of Hematin.
  • FIG. 25 is a graphical representation of the comparison of the average percentage of alleles identified using the Y-STR Panel 7 or Yfiler® multiplexes when amplifying target DNA in the presence of increasing amounts of Hematin or Humic acid.
  • FIG. 26 is a graphical representation of the comparison of the intracolor balance for Panel 7 or Yfiler® multiplexes when analysis is performed in the presence of two different concentrations of hematin or humic acid.
  • FIG. 27 is a graphical representation of an electropherogram showing the resolution of a Male/Male mixture using the Y-STR Panel 6 multiplex.
  • FIG. 28 is a graphical representation of the intracolor balance of electrophoretic signals provided by direct amplification of biological samples on selected substrates using the Panel 7 multiplex.
  • FIG. 29 is a graphical representation of an electropherogram of the amplification results of one of the directly amplified samples of FIG. 28 .
  • X and/or Y can mean “X” or “Y” or “X and Y”.
  • the use of “comprise,” “comprises,” “comprising,” “include,” “includes,” and “including” are interchangeable and not intended to be limiting.
  • the description of one or more embodiments uses the term “comprising,” those skilled in the art would understand that, in some specific instances, the embodiment or embodiments can be alternatively described using the language “consisting essentially of” and/or “consisting of”.
  • the term “and/or” means one or all of the listed elements or a combination of any two or more of the listed element.
  • the practice of the present invention may employ conventional techniques and descriptions of organic chemistry, polymer technology, molecular biology (including recombinant techniques), cell biology, biochemistry, and immunology, which are within the skill of the art.
  • Such conventional techniques include oligonucleotide synthesis, hybridization, extension reaction, and detection of hybridization using a label.
  • Specific illustrations of suitable techniques can be had by reference to the example herein below. However, other equivalent conventional procedures can, of course, also be used.
  • Such conventional techniques and descriptions can be found in standard laboratory manuals such as Genome Analysis: A Laboratory Manual Series (Vols.
  • allele refers to a genetic variation associated with a gene or a segment of DNA, i.e., one of two or more alternate forms of a DNA sequence occupying the same locus.
  • an allele within a locus encompasses a nucleic acid molecule having a polymorphic tandemly repeated base pair motif. It is the variation in the number of repeat units in tandem that distinguish alleles within a locus.
  • wild type allele or “predominant allele” are used interchangeably herein and as used herein refer to the most frequently occurring allele found in a given species, genus, family, segment, tribe, ethnicity, or racial population.
  • the wild type allele can be considered the most common allele.
  • variable allele refers to a variation from the most frequently occurring allele. It can also refer to, at one or more nucleic acid positions, a change in the nucleic acid sequence at one or more positions resulting in one or more differences when compared to the most common allele at one or more nucleic acid positions as found in the allele for a given species, genus, family, segment, tribe, ethnicity, or racial population.
  • allelic ladder refers to a nucleic acid size standard that encompasses size standards for one or more alleles for a particular STR marker.
  • the allelic ladder serves as a reference standard and nucleic acid size marker for the amplified allele(s) from the STR marker.
  • amplification primer and “oligonucleotide primer” are used interchangeably and refer to an oligonucleotide, capable of annealing to an RNA or DNA region adjacent a target sequence, and serving as an initiation primer for DNA synthesis under suitable conditions well known in the art.
  • a PCR reaction employs an “amplification primer pair” also referred to as an “oligonucleotide primer pair” including an “upstream” or “forward” primer and a “downstream” or “reverse” primer, which delimit a region of the RNA or DNA to be amplified.
  • a first primer and a second primer may be either a forward or reverse primer and are used interchangeably herein and are not to be limiting.
  • amplify refers to the process of enzymatically increasing the amount of a specific nucleotide sequence. This amplification is not limited to but is generally accomplished by PCR.
  • denaturation refers to the separation of two complementary nucleotide strands from an annealed state. Denaturation can be induced by a number of factors, such as, for example, ionic strength of the buffer, temperature, or chemicals that disrupt base pairing interactions.
  • annealing refers to the specific interaction between strands of nucleotides wherein the strands bind to one another substantially based on complementarity between the strands as determined by Watson-Crick base pairing.
  • extension refers to the amplification cycle after the primer oligonucleotide and target nucleic acid have annealed to one another, wherein the polymerase enzyme catalyzes primer extension, thereby enabling amplification, using the target nucleic acid as a replication template.
  • amplicon refers to a broad range of techniques for increasing polynucleotide sequences, either linearly or exponentially and can be the product of an amplification reaction.
  • An amplicon can be double-stranded or single-stranded, and can include the separated component strands obtained by denaturing a double-stranded amplification product.
  • the amplicon of one amplification cycle can serve as a template in a subsequent amplification cycle.
  • Exemplary amplification techniques include, but are not limited to, PCR or any other method employing a primer extension step.
  • amplification examples include, but are not limited to, ligase detection reaction (LDR) and ligase chain reaction (LCR). Amplification methods can include thermal-cycling or can be performed isothermally. In various embodiments, the term “amplification product” and “amplified sequence” includes products from any number of cycles of amplification reactions.
  • LDR ligase detection reaction
  • LCR ligase chain reaction
  • base pair motif refers to the nucleobase sequence configuration including, but not limited to, a repetitive sequence, a sequence with a biological significance, a tandem repeat sequence, and so on.
  • comparing broadly refers to differences between two or more nucleic acid sequences. The similarity or differences can be determined by a variety of methods, including but not limited to: nucleic acid sequencing, alignment of sequencing reads, gel electrophoresis, restriction enzyme digests, single strand conformational polymorphism, and so on.
  • detecting may include quantitating a detectable signal from the nucleic acid, including without limitation, a real-time detection method, such as quantitative PCR (“Q-PCR”).
  • detecting may include determining the sequence of a sequencing product or a family of sequencing products generated using an amplification product as the template; in some embodiments, such detecting may include obtaining the sequence of a family of sequencing products. In other embodiments detecting can be achieved through measuring the size of a nucleic acid amplification product.
  • DNA refers to deoxyribonucleic acid in its various forms as understood in the art, such as genomic DNA, cDNA, isolated nucleic acid molecules, vector DNA, and chromosomal DNA.
  • Nucleic acid refers to DNA or RNA in any form. Examples of isolated nucleic acid molecules include, but are not limited to, recombinant DNA molecules contained in a vector, recombinant DNA molecules maintained in a heterologous host cell, partially or substantially purified nucleic acid molecules, and synthetic DNA molecules.
  • an “isolated” nucleic acid is free of sequences which naturally flank the nucleic acid (i.e., sequences located at the 5′ and 3′ ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived.
  • an “isolated” nucleic acid molecule such as a cDNA molecule, is generally substantially free of other cellular material or culture medium when produced by recombinant techniques, or free of chemical precursors or other chemicals when chemically synthesized.
  • flanking sequence broadly refers to nucleic acid sequence 5′ and/or 3′ of a target nucleic acid sequence, including, but not limited to, a short tandem repeat sequence.
  • the flanking sequence can be within an amplification product or outside, i.e., flanking, the amplification product.
  • Amplification primers can be selected to hybridize to sequences flanking the variable portion of an STR marker so as to produce amplicons of a size indicative of a specific allele of the STR marker.
  • STR loci refers to regions of a genome which contains short, repetitive sequence elements of 2 to 7 base pairs in length. Each sequence element is repeated at least once within an STR and is referred to herein as a “repeat unit.”
  • the term STR also encompasses a region of genomic DNA wherein more than a single repeat unit is repeated in tandem or with intervening bases, provided that at least one of the sequences is repeated at least two times in tandem.
  • STRs include but are not limited to, a triplet repeat, e.g., ATC in tandem, e.g., ATCATCATCATCAACATCATC (SEQ ID NO: 1); a 4-peat (tetra-repeat), e.g., GATA in tandem, e.g., GATAGATAGATACATAGATA (SEQ ID NO: 2); and a 5-peat (penta-repeat), e.g., ATTGC in tandem, e.g., ATTGCATTGCATTGC (SEQ ID NO: 3) and so on.
  • Information about specific STRs that can be used as genetic markers can be found in, among other places, the STRbase at worldwide web.cstl.nist.gov/strbase.
  • the terms “imperfect repeat”, “incomplete repeat”, and “variant repeat” refer to a tandem repeat within which the repeat unit, though in tandem, has sequence interruptions (additions or deletions) between one or more repeat units, e.g., ATCG ATCG AACG ATCG ATCG (SEQ ID NO:4), where the third repeat unit is not identical to the other repeat units and so an imperfect repeat; an incomplete repeat can be seen as a tandem repeat in which the number of base pairs in a repeat unit is an incomplete repeat, e.g., allele 9 of the TH01 locus contains nine 4-peat repeat units ([AATG] 9 for the complete repeat “AATG” for the TH01 locus), but the 9.3 allele contains the nine “AATG” repeats and one incomplete repeat, “ATG” of three nucleotides, an incomplete repeat, i.e., [AATG] 6 ATG[AATG] 3 ; while a variant repeat has variation(s) within the repeat unit, e.g., ATCC
  • polymorphic short tandem repeat loci refers to STR loci in which the number of repetitive sequence elements (and net length of the sequence) in a particular region of genomic DNA varies from allele to allele, and from individual to individual.
  • Genetic markers are generally alleles of genomic DNA loci with characteristics of interest for analysis, such as DNA typing, in which individuals are differentiated based on variations in their DNA. Most DNA typing methods are designed to detect and analyze differences in the length and/or sequence of one or more regions of DNA markers known to appear in at least two different forms, or alleles, in a population. Such variation is referred to as “polymorphism,” and any region of DNA in which such a variation occurs is referred to as a “polymorphic locus.”
  • One possible method of performing DNA typing involves the joining of PCR amplification technology (K B Mullis, U.S. Pat. No. 4,683,202) with the analysis of length variation polymorphisms.
  • PCR traditionally could only be used to amplify relatively small DNA segments reliably; i.e., only amplifying DNA segments under 3,000 bases in length (M. Ponce and L. Micol (1992), NAR 20(3):623; R. Decorte et al. (1990), DNA CELL BIOL. 9(6):461 469).
  • Short tandem repeats (STRs), minisatellites and variable number of tandem repeats (VNTRs) are some examples of length variation polymorphisms. DNA segments containing minisatellites or VNTRs are generally too long to be amplified reliably by PCR.
  • STRs containing repeat units of approximately three to seven nucleotides, are short enough to be useful as genetic markers in PCR applications, because amplification protocols can be designed to produce smaller products than are possible from the other variable length regions of DNA.
  • haplotype is a selected group of alleles on a Y— chromosome that are transmitted together.
  • locus refers to a specific physical position on a chromosome or a nucleic acid molecule. Alleles of a locus are located at identical sites on homologous chromosomes. “Loci” the plural of “locus” as used herein refers to a specific physical position on either the same or a different chromosome as well as either the same or a different specific physical position on the nucleic acid molecule.
  • nucleic acid sample refers to nucleic acid found in biological samples according to the present invention including, but not limited to, for example, hair, feces, blood, tissue, urine, saliva, cheek cells, vaginal cells, skin, for example skin cells contained in fingerprints, bone, tooth, buccal sample, amniotic fluid containing placental cells, and amniotic fluid containing fetal cells and semen. It is contemplated that samples may be collected invasively or noninvasively. The sample can be on, in, within, from or found in conjunction with a fiber, fabric, cigarette, chewing gum, adhesive material, soil or inanimate objects.
  • sample as used herein, is used in its broadest sense and refers to a sample suspected of containing a nucleic acid and may entail a cell, chromosomes isolated from a cell (e.g., a spread of metaphase chromosomes), genomic DNA, RNA, cDNA and the like. Samples can be of animal or vegetable origins encompassing any organism containing nucleic acid, including, but not limited to, bacteria, viruses, plants, livestock, household pets, and human samples.
  • the “polymerase chain reaction” or PCR is a an amplification of nucleic acid consisting of an initial denaturation step which separates the strands of a double stranded nucleic acid sample, followed by repetition of (i) an annealing step, which allows amplification primers to anneal specifically to positions flanking a target sequence; (ii) an extension step which extends the primers in a 5′ to 3′ direction thereby forming an amplicon polynucleotide complementary to the target sequence, and (iii) a denaturation step which causes the separation of the amplicon from the target sequence (Mullis et al., eds, The Polymerase Chain Reaction, BirkHauser, Boston, Mass.
  • RNA samples can be converted to DNA/RNA heteroduplexes or to duplex cDNA by methods known to one of skill in the art.
  • the PCR method also includes reverse transcriptase-PCR and other reactions that follow principles of PCR.
  • polynucleotide As used herein, the terms “polynucleotide”, “oligonucleotide”, and “nucleic acid” are used interchangeably herein and refer to single-stranded and double-stranded polymers of nucleotide monomers, including without limitation 2′-deoxyribonucleotides (DNA) and ribonucleotides (RNA) linked by internucleotide phosphodiester bond linkages, or internucleotide analogs, and associated counter ions, e.g., H + , NH 4 + , trialkylammonium, Mg 2+ , Na + , and the like.
  • DNA 2′-deoxyribonucleotides
  • RNA ribonucleotides linked by internucleotide phosphodiester bond linkages
  • counter ions e.g., H + , NH 4 + , trialkylammonium, Mg 2+ , Na + , and the like
  • a polynucleotide may be composed entirely of deoxyribonucleotides, entirely of ribonucleotides, or chimeric mixtures thereof and can include nucleotide analogs.
  • the nucleotide monomer units may include any nucleotide or nucleotide analog.
  • Polynucleotides typically range in size from a few monomeric units, e.g. 5-40 when they are sometimes referred to in the art as oligonucleotides, to several thousands of monomeric nucleotide units.
  • nucleotides are in 5′ to 3′ order from left to right and that “A” denotes deoxyadenosine, “C” denotes deoxycytosine, “G” denotes deoxyguanosine, “T” denotes thymidine, and “U” denotes deoxyuridine, unless otherwise noted.
  • primer refers to a polynucleotide (oligonucleotide) and analogs thereof that is capable of selectively hybridizing to a target nucleic acid or “template,” a target region flanking sequence or to a corresponding primer-binding site of an amplification product; and allows the synthesis of a sequence complementary to the corresponding polynucleotide template, flanking sequence or amplification product from the primer's 3′ end.
  • a primer can be between about 10 to 100 nucleotides in length and can provide a point of initiation for template-directed synthesis of a polynucleotide complementary to the template, which can take place in the presence of appropriate enzyme(s), cofactors, substrates such as nucleotides (dNTPs) and the like.
  • primer-binding site refers to a region of a polynucleotide sequence, typically a sequence flanking a target region and/or an amplicon that can serve directly, or by virtue of its complement, as the template upon which a primer can anneal for any suitable primer extension reaction known in the art, for example, but not limited to, PCR. It will be appreciated by those of skill in the art that when two primer-binding sites are present on a double-stranded polynucleotide, the orientation of the two primer-binding sites is generally different.
  • one primer of a primer pair is complementary to and can hybridize with the first primer-binding site, while the corresponding primer of the primer pair is designed to hybridize with the complement of the second primer-binding site.
  • the first primer-binding site can be in a sense orientation
  • the second primer-binding site can be in an antisense orientation.
  • a primer-binding site of an amplicon may, but need not, encompass the same sequence as or at least some of the sequence of the target flanking sequence or its complement.
  • primer-binding site is synthesized in the complementary amplicon or the complementary strand of the amplicon.
  • complement of a primer-binding site is expressly included within the intended meaning of the term primer-binding site, as used herein.
  • tandem repeat refers to a repetitive sequence occurring in sequential succession.
  • tandem repeat locus refers to a locus containing tandem repeats.
  • target polynucleotide As used herein, the terms “target polynucleotide,” “nucleic acid target” and “target nucleic acid” are used interchangeably herein and refer to a particular nucleic acid sequence of interest.
  • the “target” can be a polynucleotide sequence that is sought to be amplified and can exist in the presence of other nucleic acid molecules or within a larger nucleic acid molecule.
  • the target polynucleotide can be obtained from any source, and can include any number of different compositional components.
  • the target can be nucleic acid (e.g. DNA or RNA).
  • the target can be methylated, non-methylated, or both.
  • target polynucleotide can refer to the target polynucleotide itself, as well as surrogates thereof, for example amplification products, and native sequences.
  • the target polynucleotide is a short DNA molecule derived from a degraded source, such as can be found in, for example, but not limited to, forensics samples (see for example Butler, 2001, Forensic DNA Typing: Biology and Technology Behind STR Markers).
  • the target polynucleotides of the present teachings can be derived from any of a number of sources.
  • target polynucleotides can be isolated from samples using any of a variety of procedures known in the art, for example the PrepSEQTM Kits (from Applied Biosystems), Boom et al., and U.S. Pat. No. 5,234,809, etc. It will be appreciated that target polynucleotides can be cut or sheared prior to analysis, including the use of such procedures as mechanical force, sonication, restriction endonuclease cleavage, or any method known in the art.
  • STR loci refer to the names assigned to these loci as they are known in the art.
  • the loci are identified, for example, in the various references and by the various accession numbers in the list that follows, all of which are incorporated herein by reference in their entirety.
  • the list of references that follows is merely intended to be exemplary of sources of locus information.
  • GenBank® National Center for Biotechnology Information, Bethesda, Md.
  • New Y-STR multiplex analysis panels are described here, which provide surprising improvements in the ability to provide haplotype resolution (HR) variation across more diverse populations, ability to exclude a male relative of a suspected individual, and/or ability to resolve adventitious matches in more highly populated Y-STR frequency databases.
  • HR haplotype resolution
  • AmpFlSTR® Yfiler multiplex analysis has a HR in European populations of 0.989, but only a HR of 0.905 globally (Vermeulen, Forensic Science International Genetics 3 (2009) 205-213).
  • the Y-STR multiplex panels described here provide better overall balance of the multiplex analysis identifying more robustly minor contributor alleles in a mixture, thus providing either better male/male resolution and/or better identification of male alleles in male/female mixtures with high female background, compared to commercially available kits. Further, the Y-STR multiplex panels provide: improved resistance to inhibitors of PCR providing higher recovery of alleles; higher sensitivity, providing higher number of alleles identified when amplifying small amounts of input DNA; and shorter analysis times compared to the currently available commercial kits.
  • the Y-STR markers currently used in the Yfiler® multiplex panel have also been included because existing Y-STR databases are already populated with profiles containing this information.
  • the use of additional Y-STR markers has been evaluated.
  • a large number of Y-STR loci have been identified but not all Y-STR loci are necessarily suitable for inclusion in a multiplex panel for a number of reasons.
  • Multicopy markers may be challenging when interpreting data, especially in samples having several DNA sources or potential contaminants. For example, markers with more than two copies (non-limiting examples include DYF399S1abs and DYF403S1 1abc/II) may not be considered for inclusion in some embodiments of the invention.
  • markers with a high mutation rate may be beneficial.
  • markers with high mutation rates may complicate analysis; including additional markers with lower mutation rates may aid in lineage differentiation. Balancing those factors may provide a multiplex panel with the broadest applicability.
  • Newly added Y-STR markers provide improvements beyond the capability of currently commercialized Y-STR multiplex assays, including features such as (1) the use of mini-STRs which can facilitate analysis of degraded DNA, (2) the inclusion of highly discriminating markers which may better differentiate paternal lineages in populations with low Y-chromosome diversity and (3) the use of rapidly mutating markers to increase the ability to distinguish between close relatives. Additionally selecting markers having a maximum of two copies per marker (e.g. DYS385ab) may simplify analysis.
  • Y-STR loci for improved multiplex analysis
  • factors contributing to selection of Y-STR loci for improved multiplex analysis include primer compatibility within the multiplex, strict male specificity for the associated primers, and potential for use as a mini-STR.
  • Another advantage of including mini-STRs is the potential for shortening the time for the electrophoretic separations used to identify the alleles that are amplified in the multiplex, as greater numbers of STR markers may be included in an electrophoretic separation of about 410 bp.
  • Adding a sixth dye channel also permits an increase in the number of Y-STR loci examined while maintaining a shorter electrophoretic separation.
  • GD gene diversity
  • MR individual mutation rates
  • a rapidly mutating Y-STR marker may have a mutation rate greater than about 10 ⁇ 2 .
  • Table 1 shows the mutation rate for each of the Y-STR markers considered for inclusion in the multiplex panels.
  • FIG. 1 shows Y-STR markers mapped for Gene Diversity on the x axis vs. mutation rate on the y axis.
  • Diamonds represent Y-STR marker loci presently in the commercially Yfiler® multiplex analysis kit.
  • Triangles represent Y-STR markers not part of the Yfiler® kit.
  • Y-STR markers to be considered for inclusion in the multiplex panel described here may be selected for a combination of gene diversity and mutation rate properties, amongst other characteristics.
  • multiplex design can take advantage of a number of differentiable fluorescent dye channels, and differing fragment size to place detection of each individual allele region for a marker at a selected portion of the electrophoretic run, permitting the detection of labeled amplicons for all of the multiplexed loci without overlapping signals.
  • Available “space” within the multiplex, when incorporating all the Yfiler® markers, can result in severe constraint in adding additional Y-STR markers to the panel. This constraint may be reflected in primer design consideration.
  • the primer design and placement may also need to provide for a separation of 1 or 2 base pairs between alleles of different Y-STR markers.
  • alleles of different Y-STR markers are separated by a 2 base pair “space” in the electrophoretic analysis, permitting more accurate allele and marker identification.
  • mini-STRs which produce amplicons of less than about 220 bp, also permit increased plexy while also permitting amplification and thus detection of degraded DNA.
  • STR marker can be adapted for use as a mini-STR. If the repeat sequence plus necessary flanking bases add up to too many bases or if the flanking sequence doesn't allow for specific primer design, the STR marker may be unsuitable for mini-STR use.
  • the Y-STR markers that are unsuitable as mini-STR markers are limited in placement within the assay panel to a region reserved for larger amplicon fragment detection. For example, some primers designed to place DYF404S1 and DYF387S1 at about 200 base pairs did not provide satisfactory results, and those markers may be more successfully placed in a multiplex panel at a larger amplicon size range.
  • Y-STR markers for inclusion within the multiplex panels described here are discussed further in the section describing primer design, and include evaluation for specificity (i.e., only the target nucleic acid is amplified); sensitivity (i.e., even a small amount of a target nucleic acid within a mixed forensic sample can be accurately amplified), and for potential undesirable interactions within the multiplex.
  • Some Y-STR markers may not yield the highest probability of successful incorporation into a multiplex assay panel, based upon initial studies. For example, 3 different primer pairs were tested for DYS626. Two of the primer pairs showed additional peaks in samples with 1:500 male/female DNA, while the third primer pair showed interactions with Yfiler® markers DYS392 and DYS439. In another example, two different primer pairs for DYF404S1 were tested. Both had only 1 ⁇ 3 of their original peak height when used in 1:500 male/female DNA samples. This may lead to a drop out problem in casework samples.
  • DYS612 which due to the nature of its trinucleotide repeat, may provide amplified products which include significant percentages of stutter.
  • Stutter is an artifact seen when amplifying short tandem repeats and may occur at one repeat unit shorter in length than the parent allele.
  • stutter complicates the analysis of DNA profiles from multiple contributors, so a marker with pronounced tendency for stutter may not be as desirable for use in multiplex forensic panels used for samples having mixed sources, potentially at significantly varying ratios. It may be used successfully, however, in analysis for resolution of individual male identity/relatedness.
  • the primers for the current Y-filer® markers may be altered to remove interactions with the newly added Y-STR markers of the various panels.
  • FIG. 2 shows a schematic representation of Panel 1, a 35 plex Y-STR multiplex assay panel.
  • Six dyes are used, including a size standard/allelic ladder labeled with a sixth differentiable fluorescent dye (not shown). Thirteen markers are mini-STRs and the entire panel is captured in an electrophoretic run of about 450 base pairs.
  • FIG. 3 shows a schematic representation of Panel 2, a 27-plex Y-STR multiplex assay panel that includes all Yfiler® STR markers and 10 additional Y-STR markers (including a double copy marker) having a Gene Diversity value greater than 0.75, where the multiplex includes 7 rapidly mutating Y-STR markers.
  • Six dyes are used, including a size standard/allelic ladder labeled with a sixth differentiable fluorescent dye (not shown). Twelve markers are mini Y-STR markers, and the entire panel is captured in an electrophoretic run of about 370 base pairs.
  • FIG. 4 shows a schematic representation of Panel 3, a 30-plex Y-STR multiplex assay panel that includes all Yfiler® STR markers, and 9 additional (10, including the double marker) Y-STR markers having a Gene Diversity value greater than 0.75.
  • Six dyes are used, including a size standard/allelic ladder labeled with a sixth differentiable fluorescent dye (not shown). Twelve markers are mini-STR markers, and the entire panel is captured in an electrophoretic run of about 420 base pairs.
  • FIG. 5 shows a schematic representation of Panel 4, a 27-plex Y-STR multiplex containing all Yfiler® Y-STR markers, the three best markers based on average Gene Diversity value, and six additional markers.
  • Six dyes are used, including a size standard/allelic ladder labeled with a sixth differentiable fluorescent dye (not shown). Twelve markers are mini-STR markers, and the entire panel is captured in an electrophoretic run of about 370 base pairs.
  • FIG. 6 shows a schematic representation of Panel 5, a 27-plex Y-STR multiplex containing all Yfiler® Y-STR markers, and 12 other Y-STR markers.
  • Six dyes are used, including a size standard/allelic ladder labeled with a sixth differentiable fluorescent dye (not shown). Twelve markers are mini-STR markers, and the entire panel is captured in an electrophoretic run of about 410 base pairs.
  • FIG. 7 shows a schematic representation of Panel 6, a 27-plex Y-STR multiplex containing all Yfiler® Y-STR markers and ten additional markers.
  • Two of the twenty seven markers are double copy markers (DYS385 ab and DYF387S1ab), and eleven markers are mini-markers of less than about 220 base pairs.
  • the at least 11 Y-STR markers having a size of less than about 220 base pairs may be DYS576, DYS389I, DYS460, DYS458, DYS19, DYS456, DYS390, DYS570, DYS437, DYS393, and DYS439.
  • the rapidly mutating Y-STR markers may be DYF387S1ab, DYS449, DYS570, DYS576, and DYS627.
  • DYS446 was not included in this panel because its proximity to the DYS393 marker (present in the Yfiler® multiplex) may cause artifacts from amplification through both markers.
  • the entire panel is captured in a range of about 76-400 base pairs upon electrophoretic separation.
  • FIG. 9 shows allele ranges for Panel 6 in comparison to database and other Y-STR panels.
  • FIG. 8 shows a graphical representation of an electrophoretic separation using the 27-plex Y-STR marker panel of FIG. 7 (Panel 6), showing each differentiable dye channel in a separate lane and not showing the size standard dye channel using the sixth dye.
  • entries 1-18 and 20-26 describe the individual markers, the repeat sequences, the repeat types, and the chromosomal location of the Y-STR markers of Panel 6.
  • Panel 6 is a multiplex assay for the amplification of a set of primers for the amplification of DYF387S1ab, DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, and DYS460, DYS437, DYS438, DYS439, DYS448, DYS449, DYS456, DYS458, DYS481, DYS533, DYS570, DYS576, DYS627, DYS635, DYS643, and Y-GATA-H4.
  • FIG. 10 shows a schematic representation of Panel 7, a 27-plex Y-STR multiplex containing all Yfiler® Y-STR markers and ten additional markers.
  • Two of the twenty seven markers are double copy markers (DYS385ab and DYF387S1ab), and eleven markers are mini-markers of less than about 220 base pairs.
  • the at least 11 Y-STR markers having a size of less than about 220 base pairs may be DYS576, DYS389I, DYS460, DYS458, DYS19, DYS456, DYS390, DYS570, DYS437, DYS393, and DYS439.
  • the rapidly mutating Y-STR markers may be DYF387S1ab, DYS449, DYS518, DYS570, DYS576, and DYS627.
  • the entire panel may be captured in a range of about 68 to about 406 base pairs upon electrophoretic separation.
  • FIG. 12 shows allele ranges for Panel 7 in comparison to database and other Y-STR panels.
  • FIG. 11 shows a graphical representation of an electrophoretic separation using the 27-plex Y-STR marker panel of FIG. 10 (Panel 7), showing each differentiable dye channel in a separate lane and not showing the size standard dye channel using the sixth dye.
  • entries 1-24 and 26 describe the individual markers, the repeat sequences, the repeat types, and the chromosomal location of the Y-STR markers of Panel 7.
  • Panel 7 is a multiplex assay for the amplification of DYF387S1ab, DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS460, DYS437, DYS438, DYS439, DYS448, DYS449, DYS456, DYS458, DYS481, DYS518, DYS533, DYS570, DYS576, DYS627, DYS635, and Y-GATA-H4.
  • FIG. 9 shows the alleles for each marker for Panel 6, in comparison to other panels.
  • FIG. 12 shows the alleles for each marker of Panel 7. Both panels contain expanded allele ranges for selected markers. The allelic ladder for Panels 6 and 7 incorporate these new alleles. For example the expanded allele ranges are shown in FIG. 13 for marker DYS438.
  • the upper lane shows the alleles from the Yfiler® kit (8-13 for a total of 6) while the lower lane shows the expanded 6-16 repeat range for the Y-STR Panels 1-7, which also includes virtual alleles 5, 8.2 (identified in the schematic as 8), and 17.
  • Oligonucleotide primers may be added to the reaction mix and serve to demarcate the 5′ and 3′ ends of an amplified DNA fragment.
  • One oligonucleotide primer anneals to the sense (+) strand of the denatured template DNA, and the other oligonucleotide primer anneals to the antisense ( ⁇ ) strand of the denatured template DNA.
  • oligonucleotide primers may be approximately 12-25 nucleotides in length, but their size may vary considerably depending on such parameters as, for example, the base composition of the template sequence to be amplified, amplification reaction conditions, etc. Oligonucleotide primers can be designed to anneal to specific portions of DNA that flank a locus of interest, to specifically amplify the portion of DNA between the primer-complementary sites. The length of the primer may need to be modified in order to be more specific and prevent amplification of non-target nucleic acid.
  • Oligonucleotide primers may include adenosine, thymidine, guanosine, and cytidine, as well as uracil, nucleoside analogs (for example, but not limited to, inosine, locked nucleic acids (LNA), non-nucleotide linkers, peptide nucleic acids (PNA) and phosphoramidites) and nucleosides containing or conjugated to chemical moieties such as radionuclides (e.g., 32 P and 35 S), fluorescent molecules, minor groove binders (MGBs), or any other nucleoside conjugates known in the art.
  • nucleoside analogs for example, but not limited to, inosine, locked nucleic acids (LNA), non-nucleotide linkers, peptide nucleic acids (PNA) and phosphoramidites
  • nucleosides containing or conjugated to chemical moieties such as radionuclides (e.g.
  • oligonucleotide primers can be chemically synthesized. Care should be taken in selecting the primer sequences used in the multiplex reaction. Inappropriate selection of primers may produce undesirable effects such as a lack of amplification, amplification at one site or multiple sites besides the intended target locus, primer-dimer formation, undesirable interactions between primers for different loci, production of amplicons from alleles of one locus which overlap (e.g., in size) with alleles from another locus, or the need for amplification conditions or protocols particularly suited for each of the different loci, which conditions/protocols are incompatible in a single multiplex system.
  • Primers can be developed and selected for use in the multiplex systems of this teaching by, for example, employing a re-iterative process of multiplex optimization that is well familiar to one of ordinary skill in the art: selecting primer sequences, mixing the primers for co-amplification of the selected loci, co-amplifying the loci, then separating and detecting the amplified products to determine effectiveness of the primers in amplification.
  • Primers can be selected by the use of any of various software programs available and known in the art for developing amplification and/or multiplex systems. See, e.g., Primer Express® software (Applied Biosystems, Foster City, Calif.). In the example of the use of software programs, sequence information from the region of the locus of interest can be imported into the software. The software then uses various algorithms to select primers that best meet the user's specifications.
  • this primer selection process may produce any of the undesirable effects in amplification described above, or an imbalance of amplification product, with greater product yield for some loci than for others because of greater binding strength between some primers and their respective targets than other primers, for example resulting in preferred annealing and amplification for some loci.
  • the primers may generate amplification products which do not represent the target loci alleles themselves; i.e., non-specific amplification product may be generated.
  • These extraneous products resulting from poor primer design may be due, for example, to annealing of the primer with non-target regions of sample DNA, or even with other primers, followed by amplification subsequent to annealing.
  • individual primers can be taken from the total multiplex set and used in amplification with primers from the same or other loci to identify which primers contribute to the amplification imbalance or artifacts. Once two primers which generate one or more of the artifacts or imbalance are identified, one or both contributors can be modified and retested, either alone in a pair, or in the multiplex system (or a subset of the multiplex system). This process may be repeated until product evaluation results in amplified alleles with no amplification artifacts or an acceptable level of amplification artifacts in the multiplex system.
  • primer concentration optimization can be performed either before or after determination of the final primer sequences, but most often may be performed after primer selection.
  • increasing the concentration of primers for any particular locus increases the amount of product generated for that locus.
  • primer concentration optimization is also a re-iterative process because, for example, increasing product yield from one locus may decrease the yield from another locus or other loci.
  • primers may interact with each other, which may directly affect the yield of amplification product from various loci.
  • a linear increase in concentration of a specific primer set may not necessarily equate with a linear increase in amplification product yield for the corresponding locus.
  • Locus-to-locus amplification product balance in a multiplex reaction may also be affected by a number of parameters of the amplification protocol, such as, for example, the amount of template (sample DNA) input, the number of amplification cycles used, the annealing temperature of the thermal cycling protocol, and the inclusion or exclusion of an extra extension step at the end of the cycling process.
  • amplification protocol such as, for example, the amount of template (sample DNA) input, the number of amplification cycles used, the annealing temperature of the thermal cycling protocol, and the inclusion or exclusion of an extra extension step at the end of the cycling process.
  • the electrophoretic mobility of the amplification product i.e., amplicon containing the STR for a given locus
  • the electrophoretic mobility of the amplification product can be adjusted to avoid overlapping with the electrophoretic mobility range of another, different STR locus amplicon. This can be done in at least two different approaches that may be used in isolation or in combination with one another.
  • the position of the primers is adjusted to create either a smaller or larger amplification product to avoid overlapping the molecular weight size of another locus during electrophoresis.
  • mobility modifier moieties including, but not limited to, for example, polyethyleneoxide repeat subunits optionally interrupted by phosphodiester or phosphotriester subunits may be incorporated as a non-nucleotide linker between a fluorescent dye at the 5′-end of the primer and the primer sequence.
  • the polyethyleneoxide repeat subunits may be triethyleneoxide, tetraethyleneoxide, pentaethyleneoxide, hexaethyleneoxide (HEO), heptaethyleneoxide, or octaethyleneoxide subunits.
  • the polyethylene repeat subunit may be repeated once, twice, three, four, five, six, seven, eight, nine, ten, eleven or twelve times.
  • the mobility modifier moiety may be attached to the 5′-end of the primer sequence via a phosphodiester moiety. See, for example, U.S. Pat. Nos. 5,470,705; 5,514,543; 5,580,732; 5,624,800; 5,703,222; 5,777,096; 5,807,682; 5,989,871; 6,395,486; 6,734,296; 6,756,204; 6,743,905; 7,074,569; 7,115,376; 7,129,050; and 7,897,338, each of which is incorporated by reference herein in its entirety.
  • the amplification primers may contain additional nucleotides (at the 5′ end) that do not hybridize to the locus, but are added to create the desired mobility of the amplicon for the detection method employed, e.g., electrophoresis or mass spectroscopy.
  • the resulting PCR amplification product (of the larger of the two PCR products) contains the mobility modifier molecules, increasing the molecular weight of the PCR product and thus a perceived shift in the molecular weight of the larger PCR product to an even larger size.
  • each of the amplicons of at least 11 Y-STR markers has a base pair size of less than about 220 base pairs.
  • each of the amplicons of at least one of at least 11 Y-STR markers having an effective base pair size of less than about 220 base pairs also includes a mobility modifier moiety.
  • the at least 11 mini Y-STR markers may include DYS576, DYS389I, DYS460, DYS458, DYS19, DYS456, DYS390, DYS570, DYS437, DYS393, and DYS439.
  • the at least 11 mini Y-STR markers may include DYS19, DYS458, DYS456, DYS505, DYS481, DYS460, DYS437, DYS389I, DYS576, DYS390, DYS570, DYS391, and DYS393.
  • the at least 11 mini Y-STR markers may include DYS19, DYS458, DYS456, DYS439, DYS481, DYS437, DYS389I, DYS576, DYS390, DYS570, DYS391, and DYS393.
  • at least 11 mini Y-STR markers may include DYS19, DYS458, DYS456, DYS439, DYS481, DYS437, DYS389I, DYS576, DYS390, DYS570, DYS391, and DYS393.
  • the at least 11 mini Y-STR markers are selected from DYS576, DYS389I, DYS460, DYS458, DYS19, DYS456, DYS390, DYS570, DYS437, DYS393, DYS439, DYS505, DYS481, and DYS391.
  • more than 11 mini-STR markers are selected from DYS576, DYS389I, DYS460, DYS458, DYS19, DYS456, DYS390, DYS570, DYS437, DYS393, DYS439, DYS505, DYS481, and DYS391.
  • the amplification primer for more than one Y-STR marker has a mobility modifier moiety incorporated therein.
  • the structure of the mobility modifier moiety of the amplification primer for each different Y-STR marker may be selected independently.
  • more than 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 Y-STR markers have mobility modified amplification primers.
  • mobility modified amplification primers may be selected for amplifying Y-STR markers from the group including DYS627, DYS389II, DYS635, DYS389I, DYS391, DYS448, Y-GATA-H4, DYS19, DYS438, DYS390, and DYS449, in any combination or subcombination.
  • a set of amplification primers including primers for the amplification of at least 11 Y-STR markers where the primers are configured to provide each set of amplicons of the at least 11 Y-STR markers having a base pair size less than about 220 base pairs.
  • detection of amplicon base pair size may be performed by a fluorescence detection technique.
  • detection of amplicon base pair size may be performed by a mobility-dependent analytical technique.
  • the mobility-dependent analytical technique may be capillary electrophoresis.
  • detection of the amplicon base pair size may be performed by a sequencing technique using no fluorescent dye labels.
  • the set of amplification primers may further include primers for the amplification of at least 5 additional Y-STR markers where the primers are configured to provide each set of amplicons of the at least 5 additional Y-STR markers having a base pair size greater than about 220 base pairs.
  • the set of amplification primers may be configured to provide all of the sets of amplicons of the more than 11 Y-STR markers having a base pair size less than about 410 base pairs.
  • the set of amplification primers when the set of amplification primers amplify more than 11 Y-STR markers, then the set of amplification primers may be configured to provide all of the sets of amplicons of the more than 11 Y-STR markers having a base pair size less than about 420 base pairs.
  • the amplification primer set may include 25 Y-STR markers.
  • the set of amplification primers is labeled with one of at least 5 fluorescent dyes.
  • the set of amplification primers may be configured to provide each set of the amplicons of the at least 11 Y-STR markers labeled with one of at least 5 fluorescent dyes.
  • the at least 5 fluorescent dyes used to label the primers and/or the amplicons may be configured to be spectrally distinct.
  • the set of amplification primers may further include at least one amplification primer that includes a mobility modifier.
  • the set of amplification primers for the amplification of at least 11 Y-STR markers may be configured to provide at least one set of amplicons of the Y-STR markers including a mobility modifier.
  • the set of amplification primers amplifying at least 11 Y-STR markers may amplify DYS576, DYS389I, DYS460, DYS458, DYS19, DYS456, DYS390, DYS570, DYS437, DYS393, and DYS439.
  • the set of amplification primers amplifying the at least 11 Y-STR markers configured to provide each set of amplicons of the at least 11 Y-STR markers having a base pair size less than about 220 base pairs, may amplify at least 5 Y-STR markers which are rapidly mutating loci.
  • the at least 5 rapidly mutating Y-STR markers may include DYF387S1ab, DYS449, DYS570, DYS576, and DYS627. In other embodiments, the at least 5 rapidly mutating Y-STR markers may further include DYS518.
  • the set of primers for the amplification of at least 11 Y-STR markers may be a set of primers for the amplification of DYF387S1ab, DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS460, DYS437, DYS438, DYS439, DYS448, DYS449, DYS456, DYS458, DYS481, DYS518, DYS533, DYS570, DYS576, DYS627, DYS635, and Y-GATA-H4.
  • the set of primers for the amplification of at least 11 Y-STR markers may be a set of primers for the amplification of DYF387S1ab, DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS460, DYS437, DYS438, DYS439, DYS448, DYS449, DYS456, DYS458, DYS481, DYS533, DYS570, DYS576, DYS627, DYS635, DYS643, and Y-GATA-H4.
  • the primers when primers for the amplification of more than the 11 Y-STR markers are provided, then the primers are configured to provide sets of amplicons of the more than 11 Y-STR markers having a base pair size less than about 400 base pairs. In some embodiments, when primers for the amplification of more than the 11 Y-STR markers are provided, then the primers are configured to provide sets of amplicons of the more than 11 Y-STR markers having a base pair size less than about 405 base pairs. In some embodiments, when primers for the amplification of more than the 11 Y-STR markers are provided, then the primers are configured to provide sets of amplicons of the more than 11 Y-STR markers having a base pair size less than about 410 base pairs.
  • the primers when primers for the amplification of more than the 11 Y-STR markers are provided, then the primers are configured to provide sets of amplicons of the more than 11 Y-STR markers having a base pair size less than about 415 base pairs. In some embodiments, when primers for the amplification of more than the 11 Y-STR markers are provided, then the primers are configured to provide sets of amplicons of the more than 11 Y-STR markers having a base pair size less than about 420 base pairs. In some embodiments, when primers for the amplification of more than the 11 Y-STR markers are provided, then the primers are configured to provide all sets of amplicons of the more than 11 Y-STR markers having a base pair size less than about 405 base pairs.
  • the primers when primers for the amplification of more than the 11 Y-STR markers are provided, then the primers are configured to provide all sets of amplicons of the more than 11 Y-STR markers having a base pair size less than about 410 base pairs. In some embodiments, when primers for the amplification of more than the 11 Y-STR markers are provided, then the primers are configured to provide all sets of amplicons of the more than 11 Y-STR markers having a base pair size less than about 415 base pairs. In some embodiments, when primers for the amplification of more than the 11 Y-STR markers are provided, then the primers are configured to provide all sets of amplicons of the more than 11 Y-STR markers having a base pair size less than about 425 base pairs.
  • primers for the amplification of more than the 11 Y-STR markers are provided wherein each of the amplicons of at least 11 Y-STR markers has a base pair size of less than about 220 base pairs, and wherein the primers are configured to provide all sets of amplicons of the more than 11 Y-STR markers having a base pair size less than about 400 base pairs.
  • primers for the amplification of more than the 11 Y-STR markers are provided wherein each of the amplicons of at least 11 Y-STR markers has a base pair size of less than about 220 base pairs, and wherein the primers are configured to provide all sets of amplicons of the more than 11 Y-STR markers having a base pair size less than about 410 base pairs.
  • primers for the amplification of more than the 11 Y-STR markers are provided wherein each of the amplicons of at least 11 Y-STR markers has a base pair size of less than about 220 base pairs, and wherein the primers are configured to provide all sets of amplicons of the more than 11 Y-STR markers having a base pair size less than about 415 base pairs.
  • primers for the amplification of more than the 11 Y-STR markers are provided wherein each of the amplicons of at least 11 Y-STR markers has a base pair size of less than about 220 base pairs, and wherein the primers are configured to provide all sets of amplicons of the more than 11 Y-STR markers having a base pair size less than about 420 base pairs.
  • a set of amplification primers including primers for the amplification of at least 22 Y-STR markers where at least 5 of the Y-STR markers are rapidly mutating loci.
  • the at least 5 rapidly mutating Y-STR markers include DYF387S1ab, DYS449, DYS570, DYS576, and DYS627.
  • the at least 5 rapidly mutating Y-STR markers include DYS518.
  • the set of amplification primers configured to amplify the at least 22 Y-STR markers may be further configured to provide each set of amplicons of at least 11 Y-STR markers having a base pair size less than about 220 base pairs.
  • the set of amplification primers for the amplification of at least 22 Y-STR markers may be configured to provide sets of amplicons for the at least 22 Y-STR markers each having a base pair size of less than about 410 base pairs.
  • the set of amplification primers for the amplification of at least 22 Y-STR markers may be configured to provide sets of amplicons for the at least 22 Y-STR markers each having a base pair size of less than about 420 base pairs.
  • detection of amplicon base pair size may be performed by fluorescence detection. In some embodiments, detection of amplicon base pair size may be performed by a mobility-dependent analytical technique. The mobility-dependent analytical technique may be capillary electrophoresis. In some other embodiments, detection of the amplicon base pair size may be performed by a sequencing technique using no detection of fluorescent dye labels.
  • the amplification primer set may include 25 Y-STR markers. In some embodiments, the set of amplification primers is labeled with one of at least 5 fluorescent dyes. In some embodiments, each set of the amplicons of the at least 22 Y-STR markers is labeled with one of at least 5 fluorescent dyes.
  • the at least 5 fluorescent dyes used to label the primers and/or the amplicons may be configured to be spectrally distinct.
  • the set of amplification primers may further include at least one amplification primer that includes a mobility modifier.
  • the set of amplification primers for the amplification of at least 22 Y-STR markers may be configured to provide at least one set of amplicons of the Y-STR markers where the at least one set of amplicons includes a mobility modifier.
  • the at least 22 Y-STR markers may include DYF387S1ab, DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS437, DYS438, DYS439, DYS448, DYS449, DYS456, DYS458, DYS570, DYS576, DYS627, DYS635, and Y-GATA-H4.
  • the at least 22 Y-STR markers may include DYF387S1ab, DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS437, DYS438, DYS439, DYS448, DYS449, DYS456, DYS458, DYS518, DYS570, DYS576, DYS627, DYS635, and Y-GATA-H4.
  • a fluorophore can be used to label at least one primer of the multiplex amplification, e.g. by being covalently bound to the primer, thus creating a fluorescent labeled primer.
  • primers for different target loci in a multiplex can be labeled with different fluorophores, each fluorophore producing a different colored product depending on the emission wavelength of the fluorophore.
  • These variously labeled primers can be used in the same multiplex reaction, and their respective amplification products subsequently analyzed together. Either the forward or reverse primer of the pair that amplifies a specific locus can be labeled, although the forward may more often be labeled.
  • the 5′ end of the forward primer may be labeled with a fluorophore.
  • the primer When the primer is labeled at the 5′ end, it may be fluorescently labeled through a linker to the 5′ phosphate. In other embodiments, when is labeled at the 5′ end, it may be fluorescently labeled via a linker to the nucleobase.
  • fluorophores well known in the art and suitable for use in the present teachings.
  • the list is intended to be exemplary and is by no means exhaustive.
  • fluorophores include: fluorescein (FL), which absorbs maximally at 492 nm and emits maximally at 520 nm; N,N,N′,N′-tetramethyl-6-carboxyrhodamine (TAMRATM), which absorbs maximally at 555 nm and emits maximally at 580 nm; 5-carboxyfluorescein (5-FAMTM), which absorbs maximally at 495 nm and emits maximally at 525 nm; 2′,7′-dimethoxy-4′,5′-dichloro-6-carboxyfluorescein (JOETM), which absorbs maximally at 525 nm and emits maximally at 555 nm; 6-carboxy-X-rhodamine (ROXTM), which absorbs maximally at 585 nm and emit
  • the multiplex panel may encompass a single multiplex dye system including at least five different dyes.
  • the set of amplification primers may be labeled with one of the at least five different dyes.
  • the at least 5 different fluorescent dyes may be spectrally distinct. These at least five dyes may include any five of the above-listed dyes, or any other five dyes known in the art, or 6-FAMTM, VIC®, NEDTM, PET®, and LIZTM dyes.
  • Other embodiments may include a single multiplex system comprising at least six different dyes.
  • the dyes may include any six of the above-listed dyes, or any other six dyes known in the art, 6-FAMTM, VIC®, NEDTM, TAZTM, SIDTM, and LIZTM dyes with the TAZ dye having a maximum emission at approximately 600 nm, and the SID dye having a maximum emission at approximately 620 nm (LIZTM dye was used to label the size standards).
  • the dyes may be energy transfer dyes.
  • An energy transfer dye has a donor dye which absorbs excitation energy and transfers energy to excite an acceptor dye.
  • the energy transfer dye may be configured to efficiently transfer energy from the donor dye to the acceptor dye.
  • a multiplex energy transfer dye system having more than 1 dye may have the same dye as a donor dye for each of the energy transfer dye set member, while having different, spectrally distinct acceptor dyes for each member of the dye set.
  • the allelic ladder serving as a reference standard and nucleic acid size marker for the amplified allele(s) from one or more STR markers of the multiplex panel may have one of many possible compositions.
  • the allelic ladder may include all known alleles for the STR markers in the analysis.
  • the allelic ladder may not include all known alleles; additional alleles can be identified by size comparison with the existing allelic ladder components.
  • the allelic ladder can incorporate size standards for the alleles of different STRs, including a subset of all the STR markers in a multiplex analysis.
  • the allelic ladder may include size standards for the alleles of all the STR markers in a multiplex analysis.
  • the allelic ladder for a multiplex analysis may be a combination of allelic ladders.
  • the allelic ladder can be DNA.
  • the allelic ladder can include non-naturally occurring nucleic acid analogs, which may further include nucleotide analogs.
  • the allelic ladder may include both naturally occurring nucleotides and nucleotide analogs.
  • the allelic ladder may include non-nucleotide moieties.
  • the different individual size standards within an allelic ladder can, in some embodiments, be labeled with a detectable label, e.g., a fluorophore.
  • the allelic ladder components are labeled with the same fluorophore.
  • the allelic ladder components are labeled with different fluorophores.
  • the different fluorophores may be spectrally distinct.
  • the size standards can be selected to serve as reference for a specific pair (or pairs) of oligonucleotide primers. For example if a first set of primers for marker X with a tetranucleotide repeat produces a 150 base pair amplicon corresponding to allele 7, a corresponding first allelic ladder component will serve as a size standard for the 150 base amplicons.
  • the first set of primers for marker X may also produces a 154 base pair amplicon corresponding to allele 8 of marker X, and a corresponding second allelic ladder component will serve as a size standard for the 154 base amplicons.
  • the size standard for a given amplicon derived from a given allele may have a nucleic acid base sequence that is the same or different from the nucleic acid base sequence of the amplicon or allele from which the amplicon is derived.
  • the ladders may be electrophoresed at the same time as the amplification products. Alternatively, the ladders may be electrophoresed separately after a preselected number of analysis runs for comparison to the analysis results.
  • the size standard can be selected to have the same electrophoretic mobility as the amplicon of interest.
  • Equivalent electrophoretic mobility of the size standard and the amplicon or the allele from which the amplicon is derived may be achieved by including non-nucleotide moieties in either the standard or the amplicon.
  • the size standard can be selected to have a different electrophoretic mobility than the amplicon of interest.
  • the identity of the amplicon may be determined.
  • the size standard weight/charge ratio, not electrophoretic mobility
  • the size standard (weight/charge ratio, not electrophoretic mobility) can be selected to have different separation properties from the amplicon of interest. Similarly given an understanding of the predicable nature of weight/charge difference, the identity of the amplicon may be determined.
  • the individual size standard components of the allelic ladder may be produced by expression, synthesis or semi-synthesis.
  • the range (from the smallest allele to the largest allele) of allelic size standards for each STR marker in the panel may be separated by a two base pair difference from the preceding and following ranges of allele size standards for the corresponding adjacent STR markers in the multiplex panel.
  • the range for each STR marker may also include a virtual bin at the smallest end and the largest end of the range of alleles for future use. Additionally, software processing the electrophoretic separation results may further be configured to assign virtual bins for microvarient alleles, for example, wherein only a partial repeat of the tandem repeat has occurred in the target nucleic acid.
  • the allelic ladder shown in FIG. 15A may be used to identify the alleles for the multiplex Panel 7.
  • the first dye channel is shown in the top panel where the first marker is DYS576 with alleles 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 and 25 detected in a region from about 70 bp to about 135 bp;
  • the second marker is DYS389I with alleles 9, 10, 11, 12, 13, 14, and 15 detected in a range from about 145 bp to about 175 bp;
  • the third marker is DYS635 with alleles 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30 detected in a range from about 190 bp to about 250 bp;
  • the fourth marker is DYS389II with alleles 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, and 34 detected in a range from about 260 bp to about 300 bp;
  • the fifth marker is DYS627 with alleles 12, 13,
  • the second dye channel is shown in the second panel from the top of FIG. 15A where the first marker is DYS460 with alleles 7, 8, 9, 10, 11, 13, and 14 detected in a range from about 75 bp to about 110 bp; the second marker is DYS458 with alleles 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, and 24 detected in a range from about 115 bp to about 170 bp; the third marker is DYS19 with alleles 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 and 19 detected in a range from about 180 bp to about 220 bp; the fourth marker is GATA-H4 with alleles 8, 9, 10, 11, 12, 13, 14, and 15 detected in a range from about 220 bp to about 260 bp; the fifth marker is DYS448 with alleles 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, and 24 detected in a range from about 275 bp to about 335 bp; and the sixth marker is DYS391 with alleles 5, 6, 7, 8, 9,
  • the third dye channel is shown in the third panel from the top of FIG. 15A where the first marker is DYS456 with alleles 12, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, and 24 detected in a range from about 75 bp to about 135 bp; the second marker is DYS390 with alleles 17, 18, 19, 21, 22, 23, 24, 25, 26, 27, 28 and 29 detected in a range from about 140 bp to about 195 bp; the third marker is DYS438 with alleles 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, and 16 detected in a range from about 200 bp to about 255 bp; the fourth marker is DYS392 with alleles 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19, and 20 detected in a range from about 265 bp to about 305 bp; and the fifth marker is DYS518 with alleles 35, 36, 37, 38, 39, 40, 41, 42, 43 and 45 detected in a range from about 340 bp to about 380 b
  • the fourth dye channel is shown in the fourth panel from the top of FIG. 15A , where the first marker is DYS570 with alleles 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, and 26 are detected in a range from about 95 bp to about 165 bp; the second marker is DYS437 with alleles 10, 11, 12, 13, 14, 15, 16, 17 and 18 detected in a range from about 175 bp to about 205 bp; the third marker is DYS385ab with alleles 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, and 28 detected in a range from about 225 bp to about 305 bp; and the fourth marker is DYS449 with alleles 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 37, 38, 40, and 41 detected in a range from about 325 bp to about 400 bp.
  • the fifth dye channel is shown in the fifth panel from the top of FIG. 15A , where the first marker is DYS393 with alleles 7, 8, 9, 11, 12, 13, 14, 15, 16, and 18 detected in a range from about 90 bp to about 135 bp; the second marker is DYS439 with alleles 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 and 17 detected in a range from about 150 bp to about 195 bp; the third marker is DYS481 with alleles 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, and 32 detected in a range from about 205 bp to about 255 bp; the fourth marker is DYF387S1ab with alleles 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, and 44 detected in a range from about 265 bp to about 320 bp; and the fifth marker is DYS533 with alleles 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, and 17 detected in a
  • the allelic ladder is as above, with an additional allele 10, for DYS456, to provide a range for DYS456 with alleles 10, 12, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, and 24 detected in a range from about 70 bp to about 135 bp.
  • the additional range for DYS456 is shown specifically in FIG. 15B .
  • allelic ladder is as described for the allelic ladder of FIG. 15B , with the addition of allele 12 for DYS392.
  • the invention provides for an allelic ladder, where the allelic ladder includes at least one size standard for at least one allele of at least 11 Y-STR markers, wherein the at least one size standard for the at least one allele of the at least 11 Y-STR markers has a base pair size of less than about 220 base pairs.
  • the allelic ladder may include a size standard for each of more than one allele of the at least 11 Y-STR markers, wherein each of the size standards has a base pair size of less than about 220 base pairs.
  • the allelic ladder may include a size standard for one or more alleles of the at least 11 Y-STR markers where the at least 11 Y-STR markers include DYS576, DYS389I, DYS460, DYS458, DYS19, DYS456, DYS390, DYS570, DYS437, DYS393, and DYS439.
  • the allelic ladder may further include at least one size standard for at least one allele for at least five rapidly mutating Y-STR markers.
  • the allelic ladder may include a size standard for each of more than one allele of the at least five rapidly mutating Y-STR markers.
  • the allelic ladder may include a size standard for each of more than one allele of the at least five rapidly mutating Y-STR markers where the at least five rapidly mutating Y-STR markers include DYF387S1ab, DYS449, DYS570, DYS576, and DYS627.
  • the allelic ladder may include a size standard for each of more than one allele of the at least five rapidly mutating Y-STR markers where the at least five rapidly mutating Y-STR marker further include DYS518.
  • the allelic ladder may include a size standard for each of more than one allele of the at least 11 Y-STR markers where the at least 11 Y-STR markers include DYF387S1ab, DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS460, DYS437, DYS438, DYS439, DYS448, DYS449, DYS456, DYS458, DYS481, DYS518, DYS533, DYS570, DYS576, DYS627, DYS635, and Y-GATA-H4.
  • the allelic ladder may include a size standard for each of more than one allele of the at least 11 Y-STR markers where the at least 11 Y-STR markers include DYF387S1ab, DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, and DYS460, DYS437, DYS438, DYS439, DYS448, DYS449, DYS456, DYS458, DYS481, DYS533, DYS570, DYS576, DYS627, DYS635, DYS643, and Y-GATA-H4.
  • the allelic ladder may include at least one size standard for the at least one allele of the at least 11 Y-STR markers, where the at least one size standard is fluorescently labeled.
  • the allelic ladder may include a size standard for each of one or more alleles of the at least 11 Y-STR markers, where a plurality of size standards for the one or more alleles of each of the at least 11 Y-STR markers is labeled with one of five spectrally distinct fluorescent dyes.
  • the allelic ladder may further include a size standard labeled with a sixth dye, where the size standard provides a measure of base pair size.
  • the sample encompassing the target nucleic acid being analyzed is from one or more of hair, feces, blood, tissue, urine, saliva, cheek cells, vaginal cells, skin, bone, tooth, buccal sample, amniotic fluid containing placental cells, and amniotic fluid containing fetal cells and semen.
  • the sample may originate from a crime scene, a sample associated with a crime scene, a sample taken from a suspect, a reference sample or a sample taken from a human under consideration.
  • the sample may be an archeological sample, a maternity sample, a paternity sample, a missing person sample.
  • the present teachings relate to methods for detecting and identifying alleles of a short tandem repeat (STR) sequence in a target nucleic acid.
  • the method for detecting and identifying alleles of a STR sequence includes amplifying at least one short tandem repeat sequence from a target nucleic acid by polymerase chain reaction (PCR) using locus-specific oligonucleotide primers. Following amplification, the amplification product's resulting amplified short tandem repeat sequence is compared with the amplified allelic ladder to call the allele based on matching the sample's amplification product to the allele standard found within the allelic ladder.
  • PCR polymerase chain reaction
  • the method for detecting and identifying alleles of a short tandem repeat sequence uses PCR amplification of the target nucleic acid and employs oligonucleotide primer pairs.
  • the methods include workflows suitable for analysis of extracted DNA, which may be used for casework samples, as well as direct amplification, which may be used for single source samples.
  • Methods for analyzing nucleic acids are well known to one of skill in the art as are methods for amplification by PCR.
  • the analyses of the PCR amplification product, i.e., amplicon includes, but is not limited to, detection, identification and in some instances, sequencing the amplification product, methods well established and known to one of skill in the art.
  • the method for detecting and identifying alleles of a short tandem repeat sequence involves comparing the amplified short tandem repeat amplification sequence to the corresponding allelic ladder by electrophoresis.
  • electrophoresis methods for the separation of alleles are known to one of skill in the art and include, but are not limited to, denaturing and non-denaturing gel electrophoresis, capillary electrophoresis, and the like.
  • Methods for sequencing the amplification product e.g., Sanger sequencing are well established and known to one of skill in the art.
  • methods are provided wherein one or more samples are analyzed for the determination of STR alleles present in the sample.
  • the method includes isolating nucleic acid from the sample and PCR amplifying the nucleic acid to generate an amplification product.
  • the amplification product is then compared to an allelic ladder mixture including one or more alleles per marker.
  • allelic ladder mixture including one or more alleles per marker.
  • Various embodiments of the present teachings relate to newly expanded groups of alleles of selected Y-STR loci.
  • Embodiments of the claimed inventions include allelic ladders for the detection of these novel alleles of the selected Y-STR loci.
  • Samples of genomic DNA can be prepared for use in the methods of the present teaching using any procedures for sample preparation that are compatible with the subsequent amplification of DNA. Many such procedures are known by those skilled in the art. Some examples are DNA purification by phenol extraction (J. Sambrook et al. (1989), in M OLECULAR C LONING : A L ABORATORY M ANUAL , S ECOND E DITION , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., pp. 9.14-9.19), and partial purification by salt precipitation (S. Miller et al. (1988), N UCL . A CIDS R ES. 16:1215) or chelex (P S Walsh et al.
  • the target loci can be co-amplified in the multiplex amplification step of the present teaching.
  • the sample containing genomic DNA may be directly amplified from a substrate that the sample was collected upon, including but not limited to paper, fabric or fiber substrates.
  • amplification methods can be used to amplify the loci, such as, for example, PCR (R K Saiki et al. (1985), S CIENCE 230: 1350-1354), transcription based amplification (D Y Kwoh and T J Kwoh (1990), A MERICAN B IOTECHNOLOGY L ABORATORY , October, 1990) and strand displacement amplification (SDA) (G T Walker et al. (1992), P ROC . N ATL . A CAD . S CI ., U.S.A. 89: 392-396).
  • multiplex amplification can be effected via PCR, in which the DNA sample is subjected to amplification using primer pairs specific to each locus in the multiplex.
  • the chemical components of a standard PCR generally include a solvent, DNA polymerase, deoxyribonucleoside triphosphates (“dNTPs”), oligonucleotide primers, a divalent metal ion, and a DNA sample expected to contain the target(s) for PCR amplification.
  • Water can generally be used as the solvent for PCR, typically including a buffering agent and non-buffering salts such as KCl.
  • the buffering agent can be any buffer known in the art, such as, but not limited to, Tris-HCl, and can be varied by routine experimentation to optimize PCR results. Persons of ordinary skill in the art are readily able to determine optimal buffering conditions.
  • PCR buffers can be optimized depending on the particular enzyme used for amplification.
  • Divalent metal ions can often be advantageous to allow the polymerase to function efficiently.
  • the magnesium ion is one which allows certain DNA polymerases to function effectively.
  • MgCl 2 or MgSO 4 can be added to reaction buffers to supply the optimum magnesium ion concentration.
  • the magnesium ion concentration required for optimal PCR amplification may depend on the specific set of primers and template used. Thus, the amount of magnesium salt added to achieve optimal amplification is often determined empirically, and is a routine practice in the art. Generally, the concentration of magnesium ion for optimal PCR can vary between about 1 and about 10 mM.
  • a typical range of magnesium ion concentration in PCR can be between about 1.0 and about 4.0 mM, varying around a midpoint of about 2.5 mM.
  • the divalent ion manganese can be used, for example in the form of manganese dioxide (MnO 2 ), titrated to a concentration appropriate for optimal polymerase activity, easily determined by one of skill in the art using standard laboratory procedures.
  • the dNTPs which are the building blocks used in amplifying nucleic acid molecules, can typically be supplied in standard PCR at a concentration of, for example, about 40-200 ⁇ M each of deoxyadenosine triphosphate (“dATP”), deoxyguanosine triphosphate (“dGTP”), deoxycytidine triphosphate (“dCTP”), and deoxythymidine triphosphate (“dTTP”).
  • dATP deoxyadenosine triphosphate
  • dGTP deoxyguanosine triphosphate
  • dCTP deoxycytidine triphosphate
  • dTTP deoxythymidine triphosphate
  • Other dNTPs such as deoxyuridine triphosphate (“dUTP”), dNTP analogs (e.g., inosine), and conjugated dNTPs can also be used, and are encompassed by the term “dNTPs” as used herein.
  • concentrations of dNTPs higher than about 200 ⁇ M each could be advantageous.
  • the concentration of each dNTP is generally at least about 500 ⁇ M and can be up to about 2 mM.
  • concentration of each dNTP may range from about 0.5 mM to about 1 mM. Specific dNTP concentrations used for any multiplex amplification can vary depending on multiplex conditions, and can be determined empirically by one of skill in the art using standard laboratory procedures.
  • the enzyme that polymerizes the nucleotide triphosphates into the amplified products in PCR can be any DNA polymerase.
  • the DNA polymerase can be, for example, any heat-resistant polymerase known in the art.
  • Examples of some polymerases that can be used in this teaching are DNA polymerases from organisms such as Thermus aquaticus, Thermus thermophilus, Thermococcus litoralis, Bacillus stearothermophilus, Thermotoga maritima and Pyrococcus sp.
  • the enzyme can be acquired by any of several possible methods; for example, isolated from the source bacteria, produced by recombinant DNA technology or purchased from commercial sources.
  • DNA polymerases include AmpliTaq Gold® DNA polymerase; AmpliTaq Platinum® DNA polymerase; AmpliTaq® DNA Polymerase; AmpliTaq® DNA Polymerase Stoffel Fragment; rTth DNA Polymerase; and rTth DNA Polymerase, XL (all manufactured by Applied Biosystems, Foster City, Calif.).
  • suitable polymerases include Tne, Bst DNA polymerase large fragment from Bacillus stearothermophilus , Vent and Vent Exo—from Thermococcus litoralis , Tma from Thermotoga maritima , Deep Vent and Deep Vent Exo- and Pfu from Pyrococcus sp., and mutants, variants and derivatives of the foregoing.
  • PCR RNA binders
  • detergents e.g., Triton X-100, Nonidet P-40 (NP-40), Tween-20
  • agents that disrupt mismatching of nucleotide pairs such as, for example, dimethylsulfoxide (DMSO), and tetramethylammonium chloride (TMAC), and uracil N-glycosylase or other agents which act to prevent amplicon contamination of the PCR and/or unwanted generation of product during incubation or preparation of the PCR, before the PCR procedure begins.
  • DMSO dimethylsulfoxide
  • TMAC tetramethylammonium chloride
  • uracil N-glycosylase or other agents which act to prevent amplicon contamination of the PCR and/or unwanted generation of product during incubation or preparation of the PCR, before the PCR procedure begins.
  • PCR cycle temperatures the number of cycles and their durations can be varied to optimize a particular reaction, as a matter of routine experimentation. Those of ordinary skill in the art will recognize the following as guidance in determining the various parameters for PCR, and will also recognize that variation of one or more conditions is within the scope of the present teachings. Temperatures and cycle times are determined for three stages in PCR: denaturation, annealing and extension. One round of denaturation, annealing and extension is referred to as a “cycle.” Denaturation can generally be conducted at a temperature high enough to permit the strands of DNA to separate, yet not so high as to destroy polymerase activity.
  • thermoresistant polymerases can be used in the reaction, which do not denature but retain some level of activity at elevated temperatures. However, heat-labile polymerases can be used if they are replenished after each denaturation step of the PCR.
  • denaturation can be conducted above about 90° C. and below about 100° C. In some embodiments, denaturation can be conducted at a temperature of about 94-95° C.
  • Denaturation of DNA can generally be conducted for at least about 1 to about 30 seconds. In some embodiments, denaturation can be conducted for about 1 to about 15 seconds. In other embodiments, denaturation can be conducted for up to about 1 minute or more.
  • incubation at the denaturation temperature also can serve to activate the enzyme. Therefore, it can be advantageous to allow the first denaturation step of the PCR to be longer than subsequent denaturation steps when these polymerases are used.
  • oligonucleotide primers anneal to the target DNA in their regions of complementarity and are substantially extended by the DNA polymerase, once the latter has bound to the primer-template duplex.
  • the annealing temperature can typically be at or below the melting point (T m ) of the least stable primer-template duplex, where T m can be estimated by any of several theoretical methods well known to practitioners of the art. For example, T m can be determined by the formula:
  • T m (4° C. X number of G and C bases)+(2° C. X number of A and T bases).
  • the annealing temperature can be about 5-10° C. below the estimated T m of the least stable primer-template duplex.
  • the annealing time can be between about 30 seconds and about 2 minutes.
  • the annealing phase is typically followed by an extension phase. Extension can be conducted for a sufficient amount of time to allow the polymerase enzyme to complete primer extension into the appropriately sized amplification products.
  • the number of cycles in the PCR determines the extent of amplification and the subsequent amount of amplification product. PCR results in an exponential amplification of DNA molecules. Thus, theoretically, after each cycle of PCR, there is twice the number of products that were present in the previous cycle, until PCR reagents are exhausted and a plateau is reached at which no further amplification products are generated. Typically, about 20-30 cycles of PCR may be performed to reach this plateau. More typically, about 25-30 cycles may be performed, although cycle number is not particularly limited. The number of cycles used may depend on the nature of the input sample. In some cases, an extracted DNA sample may require 30 cycles, while a directly amplified DNA sample may only require 26 cycles. One of skill may adjust both cycle numbers and specific details of temperature and time intervals in order to optimize the reaction conditions.
  • a prolonged extension phase can be selected.
  • an incubation at a low temperature e.g., about 4° C.
  • Various methods can be used to evaluate the products of the amplified alleles in the mixture of amplification products obtained from the multiplex reaction including, for example, detection of fluorescent labeled products, detection of ions released during each extension reaction (ion semiconductor sequencing), detection of pyrophosphate release during each extension reaction, detection of radioisotope labeled products, silver staining of the amplification products, or the use of DNA intercalator dyes such as ethidium bromide (EtBr) and SYBR green cyanine dye to visualize double-stranded amplification products.
  • DNA intercalator dyes such as ethidium bromide (EtBr) and SYBR green cyanine dye to visualize double-stranded amplification products.
  • Fluorescent labels suitable for attachment to primers for use in the present teachings are numerous, commercially available, and well-known in the art.
  • At least one fluorescent labeled primer can be used for the amplification of each locus.
  • Fluorescent detection may be desirable over radioactive methods of labeling and product detection, for example, because fluorescent detection does not require the use of radioactive materials, and thus avoids the regulatory and safety problems that accompany the use of radioactive materials.
  • Fluorescent detection with labeled primers may also be selected over other non-radioactive methods of detection, such as silver staining and DNA intercalators, because fluorescent methods of detection generally reveal fewer amplification artifacts than do silver staining and DNA intercalators.
  • EtBr is a known mutagen; SYBR, although less of a mutagen than EtBr, is generally suspended in DMSO, which can rapidly pass through skin.
  • Fluorescence detection may also be useful in sequencing by synthesis methods, where each nucleotide extension reaction releases a fluorescent signal that is differentiable for each of the four natural nucleotides.
  • Detection of the amplified alleles is not limited, however, to fluorescence detection and may be conveniently detected via pyrosequencing or ionic semiconductor sequencing techniques.
  • the selection of core loci in combination with additional loci selected for gene diversity and/or high mutational rate makes the multiplex assays described herein equally useful for those detection methodologies.
  • the Panel 6 and Panel 7 multiplex experimental results demonstrate the increased sensitivity, robustness, and discriminatory power of the multiplex assay panels designed and performed as described here. As shown in Examples 1 and 2, both Panel 6 and Panel 7 provide higher proportions of complete Y-STR profiles even at very low levels of input DNA. Examples 3, 4, and 5 show that the primer sets of Panel 6 and Panel 7 permit higher proportion of complete Y-STR profiles for decreasing amounts of male DNA in the presence of increasing amounts of female DNA, relative to a commercially available panel. Thus the primers of Panel 6 and Panel 7 offer higher specificity for male DNA compared to the Y®filer panel. Examples 6 and 7 demonstrate that the primer sets of Panel 6 and Panel 7 provide improved intracolor peak balance overall and also in the presence of increasing amounts of female DNA in the input sample.
  • Intracolor balance is defined below, but represents a measure of robust and equivalent amplification across all alleles for which the primers are labeled with the same fluorescent dye. This measure is another mark of the specificity of the primers with respect to the desired target male DNA vs hybridization or association with inhibitors or with female DNA. Examples 8, 9, and 10 demonstrate that the primer sets and chemistry used for Panel 6 and 7 provide more significantly robust amplification of target male DNA in the presence of varying concentrations of PCR inhibitors such as humic acid or hematin, compared to the amplification seen with the Y®filer panel. These results are particularly important for forensic or crime scene samples.
  • Example 11 shows the improved results possible using the more robust intracolor balance characteristics of Panel 6 or 7, in order to identify minor male contributor to a mixed male input DNA sample.
  • Panel 7 demonstrates increased ability to differentiate between a father and son, compared to other commercially available multiplex Y-STR panels. This improved differentiation (alternatively, ability to discriminate between a father and son) affords a greater possibility of identifying a male individual specifically than previously possible. This improved discrimination also affords the ability to more positively exclude a male individual from consideration as a potential lead in criminal, forensic or other evidentiary scenarios.
  • Example 14 demonstrates the increased ability to resolve haplotypes using Panel 7 multiplex relative to the use of Y®filer, including groups having greater ethnic variety, i.e., in more groups of non-European lineage. Therefore, the multiplex panels of primers, and the methods of use thereof, offer surprisingly robust, sensitive, and specific Y-STR profile results. These improvements are badly needed in the field of forensics, human identification and justice.
  • a method is provided to amplify alleles of Y-STR markers of a human male including the steps of: contacting a sample suspected to contain a DNA sample of a human male with a set of amplification primers including primers for the amplification of the alleles of at least 11 Y-STR markers; and amplifying the sample thereby forming a plurality of sets of amplicons of the at least 11 Y-STR markers where each set of the amplicons has a base pair size less than about 220 base pairs.
  • the method may further include the step of detecting each set of amplicons whereby the alleles of the at least 11 Y-STR markers are identified.
  • the detecting step is a fluorescence detection step.
  • the detecting step is performed by separating the plurality of sets of amplicons using a mobility dependent analysis, where the plurality of sets of amplicons is fluorescently labeled. In other embodiments, the detecting step does not detect fluorescence. In embodiments, when the detecting step does not detect fluorescence, the detecting step may include ion semiconductor detection, pyrophosphate release detection, or mass spectrometry detection. In various embodiments of the method, the set of amplification primers may further include primers for the amplification of at least 5 Y-STR markers where the primers may be configured to provide each set of amplicons of the at least 5 Y-STR markers having a base pair size greater than about 220 base pairs.
  • the set of primers when the set of amplification primers amplifies more than 11 Y-STR markers, then the set of primers may be configured to provide all of the sets of amplicons of the more than 11 Y-STR markers having a base pair size less than about 400 base pairs. In various embodiments of the method, when the set of amplification primers amplifies more than 11 Y-STR markers, then the set of primers may be configured to provide all of the sets of amplicons of the more than 11 Y-STR markers having a base pair size less than about 410 base pairs.
  • the set of primers when the set of amplification primers amplifies more than 11 Y-STR markers, then the set of primers may be configured to provide all of the sets of amplicons of the more than 11 Y-STR markers having a base pair size less than about 420 base pairs.
  • the primer set when the amplification primer set amplifies more than 11 Y-STR markers, then the primer set may include primers for the amplification of 25 Y-STR markers.
  • the primer set for the amplification of 25 Y-STR markers includes at least two double copy markers.
  • the set of amplification primers may be labeled with one of at least 5 fluorescent dyes.
  • each set of the amplicons of the at least 11 Y-STR markers may be labeled with one of at least 5 fluorescent dyes.
  • the at least 5 fluorescent dyes used to label the primers and/or the amplicons may be configured to be spectrally distinct.
  • the set of amplification primers used in the method may further include at least one amplification primer that includes a mobility modifier.
  • the at least one set of amplicons may include a mobility modifier.
  • the set of amplification primers amplifying at least 11 Y-STR markers may amplify DYS576, DYS389I, DYS460, DYS458, DYS19, DYS456, DYS390, DYS570, DYS437, DYS393, and DYS439.
  • the set of amplification primers amplifying the at least 11 Y-STR markers may amplify at least 5 Y-STR markers which are rapidly mutating loci.
  • the at least 5 rapidly mutating Y-STR markers may include DYF387S1ab, DYS449, DYS570, DYS576, and DYS627. In other embodiments, the at least 5 rapidly mutating Y-STR markers may further include DYS518.
  • the set of primers for the amplification of at least 11 Y-STR markers may be a set of primers for the amplification of DYF387S1ab, DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS460, DYS437, DYS438, DYS439, DYS448, DYS449, DYS456, DYS458, DYS481, DYS518, DYS533, DYS570, DYS576, DYS627, DYS635, and Y-GATA-H4.
  • the set of primers for the amplification of at least 11 Y-STR markers may be a set of primers for the amplification of DYF387S1ab, DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS460, DYS437, DYS438, DYS439, DYS448, DYS449, DYS456, DYS458, DYS481, DYS533, DYS570, DYS576, DYS627, DYS635, DYS643, and Y-GATA-H4.
  • the method includes a set of amplification primers for the amplification of the alleles of 27 Y-STR markers.
  • a method to amplify alleles of Y-STR markers of a human male including the steps of: contacting a sample suspected to contain a DNA sample of a human male with a set of amplification primers including primers for the amplification of the alleles of at least 22 Y-STR markers, wherein at least 5 of the Y-STR markers are rapidly mutating loci; and amplifying the sample thereby forming a plurality of sets of amplicons of the at least 22Y-STR markers.
  • a set of amplification primers of the alleles of at least 23 Y-STR markers are provided, wherein at least 5 of the Y-STR markers are rapidly mutating loci.
  • a set of amplification primers of the alleles of 27 Y-STR markers are provided, wherein at least 5 of the Y-STR markers are rapidly mutating loci.
  • the 27 Y-STR markers include 2 Y-STR markers having double copy markers contributing to the total number of Y-STR markers.
  • each set of the amplicons of at least 11 of the at least 22 Y-STR markers has a base pair size less than about 220 base pairs.
  • each set of the amplicons of at least 11 of at least 23 Y-STR markers has a base pair size less than about 220 base pairs.
  • each set of the amplicons of at least 11 of 27 Y-STR markers has a base pair size less than about 220 base pairs.
  • a set of amplification primers including primers for the amplification of the alleles of at least 22 Y-STR markers are provided, wherein at least 6 of the Y-STR markers are rapidly mutating loci.
  • a set of amplification primers including primers for the amplification of the alleles of at least 22 Y-STR markers are provided, wherein at least 7 of the Y-STR markers are rapidly mutating loci.
  • the method may further include the step of detecting each set of amplicons whereby the alleles of at least 22 Y-STR markers are identified. In some embodiments, the alleles of at least 23 Y-STR markers are identified. In yet other embodiments, the alleles of 27 Y-STR markers are identified.
  • the detecting step is a fluorescence detection step. In some embodiments, the detecting step is performed by separating the plurality of sets of amplicons using a mobility dependent analysis, where the plurality of sets of amplicons is fluorescently labeled. In other embodiments, the detecting step does not detect fluorescence.
  • the detecting step may include ion semiconductor detection, pyrophosphate release detection, or mass spectrometry detection.
  • the at least 11 Y-STR markers having amplicons having a base pair size of less than about 220 base pairs are DYS576, DYS389I, DYS460, DYS458, DYS19, DYS456, DYS390, DYS570, DYS437, DYS393, and DYS439.
  • the at least 5 rapidly mutating Y-STR markers are selected from the group consisting of DYF387S1ab, DYS449, DYS518, DYS570, DYS576, and DYS627. In other embodiments, the at least 5 rapidly mutating Y-STR markers are 6 rapidly mutating Y-STR markers.
  • a method of male individual identification including the steps of: contacting a sample containing a nucleic acid of a human male with a set of amplification primers including primers for the amplification of the alleles of at least 11 Y-STR markers; and amplifying the sample thereby forming a plurality of sets of amplicons of the at least 11 Y-STR markers where each set of the amplicons has a base pair size less than about 220 base pairs; and detecting each set of amplicons whereby the alleles of the male individual are identified.
  • the set of amplification primers amplifying at least 11 Y-STR markers may amplify DYS576, DYS389I, DYS460, DYS458, DYS19, DYS456, DYS390, DYS570, DYS437, DYS393, and DYS439.
  • the step of amplifying the at least 11 Y-STR markers may include amplifying at least 5 Y-STR markers which are rapidly mutating loci.
  • the at least 5 rapidly mutating Y-STR markers may include DYF387S1ab, DYS449, DYS570, DYS576, and DYS627.
  • the at least 5 rapidly mutating Y-STR markers may further include DYS518.
  • the set of primers for the amplification of at least 11 Y-STR markers may be a set of primers for the amplification of DYF387S1ab, DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS460, DYS437, DYS438, DYS439, DYS448, DYS449, DYS456, DYS458, DYS481, DYS518, DYS533, DYS570, DYS576, DYS627, DYS635, and Y-GATA-H4.
  • the set of primers for the amplification of at least 11 Y-STR markers may be a set of primers for the amplification of DYF387S1ab, DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS460, DYS437, DYS438, DYS439, DYS448, DYS449, DYS456, DYS458, DYS481, DYS533, DYS570, DYS576, DYS627, DYS635, DYS643, and Y-GATA-H4.
  • the method includes a set of amplification primers for the amplification of the alleles of more than 11 Y-STR markers.
  • the plurality of sets of amplicons of the more than 11 Y-STR markers where the plurality of sets of the amplicons has a base pair size less than about 410 base pairs.
  • the detecting step is a fluorescence detection step.
  • the method further includes the step of comparing the alleles identified for a first male individual to the alleles identified for a second male individual, whereby the first male individual is differentiable from the second male individual.
  • the first male individual has a similar paternal genetic lineage as the second male individual.
  • kits for analyzing a short tandem repeat sequence from a nucleic acid sample that utilize the methods described above.
  • a kit for analyzing a short tandem repeat sequence in a nucleic acid sample includes at least one receptacle containing a set of primers configured to hybridize to Y-STR markers.
  • the kit may include primers for the amplification of at least 11 Y-STR markers where the primers are configured to provide each set of amplicons of the at least 11 Y-STR markers having a base pair size less than about 220 base pairs; and optionally, a size standard.
  • the kit may further include primers for the amplification of at least 5 Y-STR markers where the primers are configured to provide each set of amplicons of the at least 5 Y-STR markers having a base pair size greater than about 220 base pairs.
  • the kit may include an amplification primer set for 25 Y-STR markers.
  • the set of amplification primers when the set of amplification primers amplify more than 11 Y-STR markers, then the set of amplification primers may be configured to provide all of the sets of amplicons of the more than 11 Y-STR markers having a base pair size less than about 410 base pairs.
  • the set of amplification primers when the set of amplification primers amplify more than 11 Y-STR markers, then the set of amplification primers may be configured to provide all of the sets of amplicons of the more than 11 Y-STR markers having a base pair size less than about 420 base pairs.
  • the kit may include a set of amplification primers labeled with one of at least 5 fluorescent dyes. The at least 5 fluorescent dyes used to label the primers of the kit may be configured to be spectrally distinct.
  • the kit may further include at least one amplification primer that includes a mobility modifier.
  • the kit including a set of amplification primers amplifying at least 11 Y-STR markers may amplify DYS576, DYS389I, DYS460, DYS458, DYS19, DYS456, DYS390, DYS570, DYS437, DYS393, and DYS439.
  • the kit including a set of amplification primers amplifying the at least 11 Y-STR markers, where the primers are configured to provide each set of amplicons of the at least 11 Y-STR markers having a base pair size less than about 220 base pairs may amplify at least 5 Y-STR markers which are rapidly mutating loci.
  • the at least 5 rapidly mutating Y-STR markers may include DYF387S1ab, DYS449, DYS570, DYS576, and DYS627. In other embodiments, the at least 5 rapidly mutating Y-STR markers may further include DYS518.
  • the kit including a set of primers for the amplification of at least 11 Y-STR markers may be a set of primers for the amplification of DYF387S1ab, DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS460, DYS437, DYS438, DYS439, DYS448, DYS449, DYS456, DYS458, DYS481, DYS518, DYS533, DYS570, DYS576, DYS627, DYS635, and Y-GATA-H4.
  • the kit including a set of primers for the amplification of at least 11 Y-STR markers may be a set of primers for the amplification of DYF387S1ab, DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS460, DYS437, DYS438, DYS439, DYS448, DYS449, DYS456, DYS458, DYS481, DYS533, DYS570, DYS576, DYS627, DYS635, DYS643, and Y-GATA-H4.
  • the kit includes a size standard.
  • the kit further includes an allelic ladder.
  • a kit for co-amplifying a set of loci of at least one DNA sample including a set of amplification primers for the amplification of at least 22 Y-STR markers where at least 5 of the Y-STR markers are rapidly mutating loci; and optionally, a size standard.
  • the size standard is an allelic ladder.
  • the at least 5 rapidly mutating Y-STR markers of the kit include DYF387S1ab, DYS449, DYS570, DYS576, and DYS627.
  • the at least 5 rapidly mutating Y-STR markers include DYS518.
  • the set of amplification primers is labeled with one of at least 5 fluorescent dyes.
  • the set of amplification primers of the kit for the amplification of at least 22 Y-STR markers may be configured to provide at least one set of amplicons of the Y-STR markers where the at least one set of amplicons includes a mobility modifier.
  • the at least 22 Y-STR markers may include DYF387S1ab, DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS437, DYS438, DYS439, DYS448, DYS449, DYS456, DYS458, DYS570, DYS576, DYS627, DYS635, and Y-GATA-H4.
  • the at least 22 Y-STR markers may include DYF387S1ab, DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS437, DYS438, DYS439, DYS448, DYS449, DYS456, DYS458, DYS518, DYS570, DYS576, DYS627, DYS635, and Y-GATA-H4.
  • a sufficient quantity of enzyme for amplification, amplification buffer to facilitate the amplification, a divalent cation solution to facilitate enzyme activity, dNTPs for strand extension during amplification, loading solution for preparation of the amplified material for electrophoresis, genomic DNA as a template control, a size marker to insure that materials migrate as anticipated in the separation medium, and a protocol and manual to educate the user and limit error in use may be included in the kits of the invention in any combination or selection.
  • the amounts of the various reagents in the kits also can be varied depending upon a number of factors, such as the optimum sensitivity of the process.
  • test kits for use in manual applications or test kits for use with automated sample preparation, reaction set-up, detectors or analyzers.
  • detection techniques employed are generally not limiting. Rather, a wide variety of detection means are within the scope of the disclosed methods and kits, provided that they allow the presence or absence of an amplicon to be determined.
  • the following procedures are representative of reagents and procedures that can be employed for the isolation and amplification of a target nucleic acid in a sample and the detection, identification and analysis of short tandem repeat sequences on the Y chromosome.
  • the primer sets of Panels 1-7 are prepared as described above and dye—labeled and unlabeled primers in buffer (low EDTA buffer containing 10 mM Tris-HCL, pH 8.0, and 0.1 mM EDTA, pH 8.0) are amplified in PCR reactions as follows:
  • 1 ng input DNA typically, is used.
  • the amplified samples are analyzed by methods that resolve amplification product size and/or sequence differences as would be known to one of skill in the art.
  • capillary electrophoresis can be used following the instrument manufactures directions. Briefly, 0.5 ⁇ L GeneScanTM-600 LIZTM Size Standard and 9.5 ⁇ L of Hi-DiTM Formamide are mixed for each sample to be analyzed. 10.0 ⁇ L of the Formamide/GeneScan-600 LIZ solution is dispensed into each well of a MicroAmp® Optical 96-well reaction plate to which a 1.00 ⁇ L aliquot of the PCR amplified sample or allelic ladder is added and the plate is covered. The plate is briefly centrifuged to mix the contents and collect them at the bottom of the plate. The plate is heated at 95° C. for 3 min to heat-denature the samples and then quenched immediately by placing on ice for 3 min.
  • Capillary electrophoresis was performed on current Applied Biosystems instruments: the Applied Biosystems 3500 ⁇ l Genetic Analyzer using the specified J6 variable binning module as described in the instrument's User's Guide.
  • the 3500 ⁇ 1 Genetic Analyzer's parameters were: sample injection for 24 sec at 1.2 kV and electrophoresis at 15 kV for 1550 sec in Performance Optimized Polymer (POP-4TM polymer) with a run temperature of 60° C. as indicated in the HID36_POP4 ⁇ 1_G5_NT3200 protocol. Variations in instrument parameters, e.g.
  • each sample is injected and analyzed by appropriate software, e.g., GeneMapper® ID-X v1.2 software with the standard analysis settings.
  • appropriate software e.g., GeneMapper® ID-X v1.2 software with the standard analysis settings.
  • a peak amplitude of 175 RFU (relative fluorescence units) was used as the peak detection threshold.
  • Sensitivity study The effect of decreasing target male DNA is compared, using the Panel 6 multiplex or the Yfiler® multiplex, as shown in FIG. 16 .
  • the Y filer multiplex begins to suffer allelic dropout at 63 pg. While there are some losses using the Panel 6 multiplex, the overall robustness of identification is higher because Panel 6 has 27 alleles vs. Yfiler®'s 17. More reliable identification is possible using Panel 6 multiplex at lower concentrations of target male DNA.
  • Sensitivity study The effect of decreasing target male DNA is compared, using the Panel 7 multiplex or the Yfiler® multiplex, as shown in FIG. 17 .
  • the data shown is collected from four different test sites, each performing N-4 replications.
  • the DNA input is varied from 1 ng, 500 pg, 250 pg, 62.5 pg, and 32.25 pg.
  • the average number of alleles identified at each concentration for each multiplex is indicated by the crosshatched circle symbol.
  • the Y filer multiplex begins to suffer allelic dropout at 63 pg. While there are some losses using the Panel 7 multiplex, the overall robustness of identification is higher because Panel 7 has 27 alleles vs. Yfiler®'s 17. More reliable identification is possible using Panel 7 multiplex at lower concentrations of target male DNA.
  • the effect of using male/female DNA mixtures as input DNA is compared, using the Panel 6 multiplex or the Yfiler® multiplex, as shown in FIG. 18 .
  • the Panel 6 multiplex recovers a higher percentage of alleles than the Yfiler® multiplex recovers. Even at 31 pg of male target DNA, over 70% of alleles of the Panel 6 multiplex are identified.
  • the effect of using male/female DNA mixtures as input DNA is compared, using the Panel 7 multiplex or the Yfiler® multiplex, as shown in FIG. 19 .
  • the left panel shows the results for the 1 ng M007/1 ug F9947 and the right panel shows the results for 0.5 ng/1 ug F9947 for both Panel 7 and Yfiler® multiplexes, with averages for each multiples shown by a crosshatched circle.
  • the Panel 7 multiplex recovers a higher percentage of alleles than the Yfiler® multiplex recovers. Even at a 1:2000 ratio of male:female, all alleles of the Panel 7 multiplex are identified.
  • male/female DNA mixtures as input DNA is compared, using the Panel 6 multiplex or the Yfiler® multiplex, as shown in FIG. 20 .
  • male target DNA input is held constant at 500 pg
  • Intracolor balance in male/female mixtures is compared, using the Panel 6 multiplex or Yfiler® multiplex, as shown in FIG. 21 .
  • Intracolor peak balance (ICB) is calculated by dividing the lowest peak height by the highest peak height within a color, i.e., all the markers labeled with the same fluorophore and detectable in the same wavelength region.
  • An ICB value of 1 would mean that all the alleles labeled with the same fluorophore have completely uniform peak heights, and any improvement of the ICB ratio towards a value of 1 may offer higher accuracy in identifying the presence of a particular allele.
  • Panel 6 multiplex is significantly less affected than the Yfiler® multiplex by the presence of female DNA, having ICB values consistently greater than about 0.50. Additionally, all five dye channels behave more similarly to each other than that of the Yfiler® multiplex.
  • Intracolor balance in male/female mixtures is compared, using the Panel 7 multiplex or Yfiler® multiplex, as shown in FIG. 22 .
  • Intracolor peak balance (ICB) is calculated and defined as described in Example 6. As shown in FIG. 22 , Panel 6 multiplex is significantly less affected than the Yfiler® multiplex by the presence of female DNA.
  • FIG. 26 shows the intracolor balance for each of the five dye channels (circle, square, diamond, ⁇ , and ) of this data. As can be seen for each of the two differing concentrations of hematin and humic acid, respectively, use of the Panel 7 multiplex provides more consistent results across all dye channels.
  • FIG. 27 The ability to identify a minor male contributor in a mixture of 2 male contributor target DNA samples is shown in FIG. 27 .
  • An 8:1 ratio of 437 pg:63 pg major: minor contributor is shown in the segment of the electropherogram shown.
  • the upper trace shows the mixture, with arrows pointing to the alleles belonging to the minor male contributor. This is compared to the minor male contributor profile shown in the lower panel of FIG. 27 , which was obtained without the presence of any other male DNA sample.
  • the improved intracolor balance provided by the primers used in Panel 6 or Panel 7 yields improved uniformity of peak heights across an allele range, thus allowing improved identification of minor contributor alleles.
  • the primers directed to multiplex Panel 7 are used to directly amplify unprocessed biological samples.
  • the primers used for loci in Panel 7 that are also present in Panel 6 have identical sequences, and therefore have equivalent performance.
  • the Mastermix used for amplification is adapted for universal application.
  • FIG. 28 shows the comparison of intracolor balance for each of the replicates of the three different sample/substrate types. The results show that the minimally required signal threshold of greater than 0.40 is achieved across all three sample/substrate types for direct amplification.
  • FIG. 29 shows an electropherogram of the resulting Y-STR profile of one of the blood on FTA samples. For each color panel, full scale is 10,000 Rfus. It is shown that complete and unambiguous profiles are obtained with the direct

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
US13/828,443 2012-09-06 2013-03-14 Multiplex Y-STR Analysis Abandoned US20140065613A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US13/828,443 US20140065613A1 (en) 2012-09-06 2013-03-14 Multiplex Y-STR Analysis
US14/727,442 US10597707B2 (en) 2012-09-06 2015-06-01 Multiplex Y-STR analysis
US16/799,810 US20200255892A1 (en) 2012-09-06 2020-02-24 Multiplex y-str analysis

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US201261697742P 2012-09-06 2012-09-06
US201261720949P 2012-10-31 2012-10-31
US201361761152P 2013-02-05 2013-02-05
US201361765323P 2013-02-15 2013-02-15
US13/828,443 US20140065613A1 (en) 2012-09-06 2013-03-14 Multiplex Y-STR Analysis

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US14/727,442 Division US10597707B2 (en) 2012-09-06 2015-06-01 Multiplex Y-STR analysis

Publications (1)

Publication Number Publication Date
US20140065613A1 true US20140065613A1 (en) 2014-03-06

Family

ID=48014352

Family Applications (3)

Application Number Title Priority Date Filing Date
US13/828,443 Abandoned US20140065613A1 (en) 2012-09-06 2013-03-14 Multiplex Y-STR Analysis
US14/727,442 Active 2034-08-22 US10597707B2 (en) 2012-09-06 2015-06-01 Multiplex Y-STR analysis
US16/799,810 Pending US20200255892A1 (en) 2012-09-06 2020-02-24 Multiplex y-str analysis

Family Applications After (2)

Application Number Title Priority Date Filing Date
US14/727,442 Active 2034-08-22 US10597707B2 (en) 2012-09-06 2015-06-01 Multiplex Y-STR analysis
US16/799,810 Pending US20200255892A1 (en) 2012-09-06 2020-02-24 Multiplex y-str analysis

Country Status (4)

Country Link
US (3) US20140065613A1 (zh)
EP (2) EP2893035B1 (zh)
CN (1) CN104755632B (zh)
WO (1) WO2014039092A1 (zh)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104131072A (zh) * 2014-05-23 2014-11-05 公安部物证鉴定中心 一种对未知检材进行个体识别和亲权鉴定的方法和系统
WO2016044233A1 (en) * 2014-09-18 2016-03-24 Illumina, Inc. Methods and systems for analyzing nucleic acid sequencing data
WO2016172632A3 (en) * 2015-04-24 2017-01-12 Atila Biosystems, Inc Amplification with primers of limited nucleotide composition
CN108220413A (zh) * 2018-02-05 2018-06-29 浙江省公安物证鉴定中心 联合检测人Y染色体STR和Indel基因座的荧光复合扩增试剂盒及其应用
US10253352B2 (en) 2015-11-17 2019-04-09 Omniome, Inc. Methods for determining sequence profiles
CN110777211A (zh) * 2019-11-19 2020-02-11 公安部物证鉴定中心 一种基于Y-STR基因座和Y-indel基因座的复合扩增体系及其使用的引物组合
CN112176067A (zh) * 2019-07-02 2021-01-05 公安部物证鉴定中心 一种基于Y-STR基因座和Y-Indels基因座的复合扩增体系及其使用的引物组合
CN112786107A (zh) * 2021-01-20 2021-05-11 深圳百人科技有限公司 一种针对复合扩增str数据的分析方法
US11739375B2 (en) 2017-08-11 2023-08-29 Atila Biosystems Incorporated Digital amplification with primers of limited nucleotide composition

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MX2016007826A (es) 2013-12-16 2017-03-31 Genentech Inc Compuestos peptidomimeticos y sus conjugados de anticuerpo-farmaco.
WO2016205176A1 (en) 2015-06-15 2016-12-22 Genentech, Inc. Antibodies and immunoconjugates
CN105018623B (zh) * 2015-08-06 2018-04-20 无锡中德美联生物技术有限公司 同时扩增人常染色体和y染色体str基因座的荧光标记复合扩增试剂盒及其应用
CN107881245B (zh) * 2017-11-14 2021-05-25 苏州阅微基因技术有限公司 29个y染色体str基因座的荧光复合扩增体系、试剂盒及其应用
CN109839417B (zh) * 2017-11-28 2021-08-27 中国科学院大连化学物理研究所 一种基于微流控芯片的人常染色体str基因位点分型方法
CN108060233B (zh) * 2017-12-13 2021-04-30 苏州阅微基因技术有限公司 30个y染色体str基因座的荧光复合扩增体系、试剂盒及应用
KR102151657B1 (ko) * 2018-12-27 2020-09-04 주식회사 엔젠바이오 멀티플렉스 시스템을 이용한 인간 객체의 y str 유전좌위 분석방법 및 이를 이용한 분석 키트
CN111454945B (zh) * 2020-04-13 2021-08-10 公安部物证鉴定中心 利用扩增产物进行法医序列多态str分型的方法及引物组合

Family Cites Families (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US5234809A (en) 1989-03-23 1993-08-10 Akzo N.V. Process for isolating nucleic acid
US5192659A (en) 1989-08-25 1993-03-09 Genetype Ag Intron sequence analysis method for detection of adjacent and remote locus alleles as haplotypes
US5470705A (en) 1992-04-03 1995-11-28 Applied Biosystems, Inc. Probe composition containing a binding domain and polymer chain and methods of use
JP2775346B2 (ja) 1992-04-03 1998-07-16 アプライド バイオシステムズ，インコーポレイテッド プローブ構成物および方法
WO2000055368A2 (en) 1999-03-15 2000-09-21 Pe Corporation (Ny) Probe/mobility modifier complexes for multiplex nucleic acid detection
KR100376770B1 (ko) 2000-05-12 2003-03-19 김욱 유전자의 변이 분석 키트
US6743905B2 (en) 2001-04-16 2004-06-01 Applera Corporation Mobility-modified nucleobase polymers and methods of using same
US6780588B2 (en) 2001-05-07 2004-08-24 Applera Corporation Methods for the reduction of stutter in microsatellite amplification
US20030224372A1 (en) 2002-05-31 2003-12-04 Denise Syndercombe-Court Method for determining ethnic origin by means of STR profile
WO2005116257A2 (en) * 2004-05-17 2005-12-08 The Ohio State University Research Foundation Unique short tandem repeats and methods of their use
WO2006047536A2 (en) * 2004-10-22 2006-05-04 Promega Corporation Methods and kits for detecting mutations
TW200930818A (en) * 2007-10-30 2009-07-16 Applied Biosystems Method and kits for multiplex amplification of short tandem repeat loci
CN101225386A (zh) * 2008-01-22 2008-07-23 西安交通大学 一种新的10个y染色体短串联重复序列位点及其分型方法
US20130137589A2 (en) 2009-09-11 2013-05-30 Life Technologies Corporation Analysis of y-chromosome str markers
CN103298954A (zh) * 2010-11-15 2013-09-11 生命技术公司 用于多重扩增短串联重复基因座的方法和试剂盒

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Ballantyne et al. A new future of forensic Y-chromosome analysis: rapidly mutating Y-STRs for differentiating male relatives and paternal lineages. For Sci Int: Genetics 2012;6:208-18. *
Decker et al. Evaluation of additional Y-STR loci to resolve common haplotypes. Promega Meeting: 2006 Oct 10-12; Nashville (TN). *
Mulero et al. Development and validation of the AmpFlSTR® Yfiler(TM) PCR amplification kit: a male specific, single amplification 17 Y-STR multiplex system. J Forensic Sci 2006;51(1):64-75. *

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104131072A (zh) * 2014-05-23 2014-11-05 公安部物证鉴定中心 一种对未知检材进行个体识别和亲权鉴定的方法和系统
WO2016044233A1 (en) * 2014-09-18 2016-03-24 Illumina, Inc. Methods and systems for analyzing nucleic acid sequencing data
KR20170056682A (ko) * 2014-09-18 2017-05-23 일루미나, 인코포레이티드 핵산 서열결정 데이터를 분석하기 위한 방법 및 시스템
KR102538753B1 (ko) * 2014-09-18 2023-05-31 일루미나, 인코포레이티드 핵산 서열결정 데이터를 분석하기 위한 방법 및 시스템
US11091799B2 (en) 2015-04-24 2021-08-17 Atila Biosystems Incorporated Amplification with primers of limited nucleotide composition
WO2016172632A3 (en) * 2015-04-24 2017-01-12 Atila Biosystems, Inc Amplification with primers of limited nucleotide composition
CN107849603A (zh) * 2015-04-24 2018-03-27 阿提拉生物系统公司 利用有限核苷酸组成的引物扩增
US10253352B2 (en) 2015-11-17 2019-04-09 Omniome, Inc. Methods for determining sequence profiles
US11739375B2 (en) 2017-08-11 2023-08-29 Atila Biosystems Incorporated Digital amplification with primers of limited nucleotide composition
CN108220413A (zh) * 2018-02-05 2018-06-29 浙江省公安物证鉴定中心 联合检测人Y染色体STR和Indel基因座的荧光复合扩增试剂盒及其应用
CN112176067A (zh) * 2019-07-02 2021-01-05 公安部物证鉴定中心 一种基于Y-STR基因座和Y-Indels基因座的复合扩增体系及其使用的引物组合
CN112176067B (zh) * 2019-07-02 2022-12-02 公安部物证鉴定中心 一种基于Y-STR基因座和Y-Indels基因座的复合扩增体系及其使用的引物组合
CN110777211A (zh) * 2019-11-19 2020-02-11 公安部物证鉴定中心 一种基于Y-STR基因座和Y-indel基因座的复合扩增体系及其使用的引物组合
CN112786107A (zh) * 2021-01-20 2021-05-11 深圳百人科技有限公司 一种针对复合扩增str数据的分析方法

Also Published As

Publication number Publication date
EP2893035B1 (en) 2018-05-02
WO2014039092A1 (en) 2014-03-13
EP2893035A1 (en) 2015-07-15
CN104755632A (zh) 2015-07-01
EP3418395A1 (en) 2018-12-26
US20200255892A1 (en) 2020-08-13
US20160053311A1 (en) 2016-02-25
US10597707B2 (en) 2020-03-24
CN104755632B (zh) 2017-10-03

Similar Documents

Publication Publication Date Title
US20200255892A1 (en) Multiplex y-str analysis
EP2055787B1 (en) Methods and kits for multiplex amplification of short tandem repeat loci
US20150037791A1 (en) Methods and kits for multiplex amplification of short tandem repeat loci
JP5509075B2 (ja) 核酸増幅のコントロールの検出方法およびその用途
US20170335377A1 (en) Se33 mutations impacting genotype concordance
US20110306505A1 (en) X-STR multiplex PCR amplification system
US20110183857A1 (en) Novel human single nucleotide polymorphisms
WO2011020075A2 (en) Amelogenin snp on chromosome x
WO2017178587A9 (en) Method for universal detection and quantification of mycoplasma (mollicutes) 16s rdna by quantitative polymerase chain reaction amplifying a 1.5 kilobase fragment
US9315871B2 (en) Mutation detection probe, mutation detection method, method of evaluating drug efficacy, and mutation detection kit
JPWO2011077990A1 (ja) ｃ−ｋｉｔ遺伝子の多型検出用プローブおよびその用途
US9169518B2 (en) Primer set for detecting EGFR exon 21 polymorphism and application thereof
RU2631615C2 (ru) Способ и набор реагентов для выявления полиморфизмов в генах LINGO1, LINGO2 и SLC1A2, определяющих генетическую ассоциацию с эссенциальным тремором

Legal Events

Date Code Title Description
AS Assignment

Owner name: LIFE TECHNOLOGIES CORPORATION, CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:CHUNG, CHRISTINA BORMANN;MULERO, JULIO;HENNESSY, LORI;SIGNING DATES FROM 20130520 TO 20130525;REEL/FRAME:030577/0235

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION