US20130209608A1 - Asparaginase from basidiomycetes - Google Patents

Asparaginase from basidiomycetes Download PDF

Info

Publication number
US20130209608A1
US20130209608A1 US13/810,134 US201113810134A US2013209608A1 US 20130209608 A1 US20130209608 A1 US 20130209608A1 US 201113810134 A US201113810134 A US 201113810134A US 2013209608 A1 US2013209608 A1 US 2013209608A1
Authority
US
United States
Prior art keywords
asparagine
enzyme
asparaginase
asparaginase enzyme
substance
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US13/810,134
Other languages
English (en)
Inventor
Pieter Berends
Swen Rabe
Ralf Gunter Berger
Diana Linke
Nadine Eisele
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nestec SA
Original Assignee
Nestec SA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nestec SA filed Critical Nestec SA
Assigned to NESTEC S.A. reassignment NESTEC S.A. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: BERGER, RALF GUNTER, EISELE, NADINE, LINKE, DIANA, BERENDS, PIETER, RABE, SWEN
Publication of US20130209608A1 publication Critical patent/US20130209608A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C12N9/80—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in linear amides (3.5.1)
    • C12N9/82—Asparaginase (3.5.1.1)
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K10/00—Animal feeding-stuffs
    • A23K10/10—Animal feeding-stuffs obtained by microbiological or biochemical processes
    • A23L1/0153—
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L5/00—Preparation or treatment of foods or foodstuffs, in general; Food or foodstuffs obtained thereby; Materials therefor
    • A23L5/20—Removal of unwanted matter, e.g. deodorisation or detoxification
    • A23L5/25—Removal of unwanted matter, e.g. deodorisation or detoxification using enzymes
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs

Definitions

  • the field of the present invention relates to an asparaginase enzyme obtainable from the fungi Basidiomycetes, esp. Basidiomycetes Flammulina velutipes .
  • a method for the hydrolysis of L-asparagine and L-glutamine are also disclosed.
  • a method for reducing the formation of acrylamide in a substance comprising L-asparagine is also disclosed.
  • the thermal treatment of the food is indispensible for a quality of the food.
  • the browning (Maillard) reaction in the food forms the typical flavours, colours, and antioxidants in the food.
  • microbial safety and extended shelf-life of the food are achieved due to the thermal treatment of the food.
  • Enzymes are ideal selective tools to modify a food constituent without affecting other food constituents.
  • a catalytic action of enzymes on the food is distinguished by a high substrate plus reaction specificity and by gentle physical conditions of enzyme action.
  • the enzyme action on the food is more environmentally friendly as no organic solvents or heavy metals are involved (“green chemistry”; “white biotechnology”).
  • Enzymes used to modify the food constituent allow changing a single food constituent whilst avoiding any side-reactions which could eventually result in the formation of toxic compounds in the food.
  • hydrolyse e.g. free and mobile asparagine in the food to aspartic acid.
  • the asparagine cannot then serve as a precursor molecule for acrylamide formation when the food is thermally treated.
  • Asparaginase (EC 3.5.1.1; L-asparagine amidohydrolases) is an enzyme that catalyses the hydrolysis of L-asparagine to aspartic acid with the liberation of ammonia.
  • asparaginase enzymes act on a nitrogen-carbon bond in linear amides, but not on peptide bonds of the L-asparagine.
  • L-asparagine was the first amino acid detected (1806 in the juice of Asparagus officinalis ) and L-asparagine is ubiquitous in all living cells. Accordingly, asparaginase enzymes occur abundantly in nature from prokaryotic microorganisms to vertebrates; see Halpern, Y. S. and Grossowicz, N., Hydrolysis of amides by extracts from mycobacteria, Biochem. J. 65: 716-720 (1957); Ho, P. P. K., Frank, B. H. and Burck, P. J., Crystalline L-asparaginase from Escherichia coli B., Science 165: 510-512 (1969); Suld, H. M.
  • L-asparaginase is used as a cytostaticum in cancer therapy to fight leukemia cells and mast cell tumors (Herbert F. Oettgen, L-Asparaginase: Ein not Prinzip in der Chemotherapie maligner Neoplasien, Annals of Hematology, 1969, 19(6), 351-356).
  • a Glutaminase enzyme is related to the asparaginase enzyme.
  • the glutaminase enzyme is typically derived from either lactic acid bacteria as they, for example, occur in the chicken intestinal flora (Thongsanit et al. 2008; Lactobacillus rhamnosus , Weingand-Ziade et al. 2003), or from yeasts ( Zygosaccharomyces rouxii , Iyer and Singhal 2010), or from marine fungi ( Beauveria bassiana , Sabu et al. 2002), or again from Aspergillus molds (Prasanth et al. 2009).
  • DSM PreventAse
  • a concerted use of the asparaginase enzyme in food technology is rather recent.
  • PreventAse (DSM) enzyme was introduced on the European market.
  • the PreventAse (DSM) enzyme is produced by a recombinant mold, Aspergillus niger .
  • a competing asparaginase enzyme, called Acrylaway (Novozymes) has been obtained from a related mold species, Aspergillus oryzea by using submerged feed-batch fermentation of a genetically modified strain carrying a gene coding for an asparaginase enzyme from Aspergillus oryzae .
  • Both Aspergilli Aspergillus niger and Aspergillus oryzae
  • are described as having a long history of safe industrial use being widely distributed in nature and being commonly used for production of food-grade enzymes.
  • the asparaginase enzyme is typically mixed with the dough before the thermal treatment of the food (for example baking) to eliminate acrylamide formation.
  • the thermal treatment of the food for example baking
  • the dipping or spraying of potato pieces in or with a solution of the asparaginase enzyme solution may be used.
  • Such a treatment may be very efficient.
  • Corrigan (2008) reported a decrease of acrylamide levels in the finished product from 1688 ⁇ g/kg down to 60 ⁇ g/kg in comparison to untreated potato chips. A reduction of the formation of acrylamide by >99.9% was supposed to be feasible (Elder et al. 2004).
  • oxidoreductases are lignin peroxidase, manganese peroxidase, versatile peroxidase, H 2 O 2 producing oxidases such as glucose oxidase, and phenol-oxidases of the Laccase type. Glycosidases, such as cellulases, are also found and help to degrade the cellulose portion of wood.
  • Flammulina velutipes from the Basidiomycetes are also known as known as Enokitake, golden needle mushroom or velvet foot.
  • the Flammulina velutipes form long, thin white fruiting bodies are used in Asian cuisines as versatile mushrooms.
  • the mushroom is traditionally used fresh, canned for soups, salads and other dishes.
  • the mushroom can be refrigerated for about one week.
  • An object of the present invention is to provide an asparaginase enzyme with a high activity and a high operational stability.
  • a further object of the present invention is to reduce the formation of acrylamide in a food product by use of the asparaginase enzyme.
  • the invention relates to an asparaginase enzyme obtainable from Basidiomycete.
  • Basidiomycete Flammulina velutipes.
  • the present invention relates to a method for hydrolysing at least one of L-asparagine or L-glutamine.
  • the method comprises treating a substance comprising at least one of L-asparagine or L-glutamine with the asparaginase enzyme obtainable from Basidiomycete.
  • the present invention relates to a method for reducing acrylamide formation in a substance that comprises L-asparagine.
  • the method comprises applying to the substance that comprises the L-asparagine the asparaginase enzyme obtainable from Basidiomycete.
  • the method then comprises heating the substance comprising the L-asparagine.
  • the substance comprising at least one of L-asparagine or L-glutamine can be a food product.
  • the invention further relates to the products obtained by the methods of the present invention.
  • FIG. 1 shows a time course of intracellular formation of asparaginase enzyme of Flammulina velutipes grown in a submerged culture.
  • FIG. 2 shows a time course of extracellular formation of the asparaginase enzyme of Flammulina velutipes grown in submerged culture.
  • FIG. 3 shows a genomic (A) and coding (B) nucleotide sequences and the amino acid sequence (C) of the asparaginase enzyme of Flammulina velutipes .
  • the first 19 amino acids were identified as signal sequence.
  • FIG. 4 shows a salt tolerance of the asparaginase enzyme from Flammulina velutipes , expressed in E. coli as a heterologous host and used as a crude enzyme.
  • FIG. 5 shows a pH stability of the asparaginase enzyme of Flammulina velutipes , expressed in E. coli as a heterologous host and used as a crude enzyme.
  • FIG. 6 shows a pH-optimum of the asparaginase enzyme of Flammulina velutipes.
  • FIG. 7 shows a temperature stability of the asparaginase enzyme of Flammulina velutipes , expressed in E. coli as a heterologous host and used as a crude enzyme.
  • FIG. 8 shows a) activity stained native polyacrylamide gel electrophoresis (PAGE) and b) denaturing-PAGE separations of asparaginase enzyme of Flammulina velutipes.
  • FIG. 9 shows a temperature optimum of the asparaginase enzyme of Flammulina velutipes.
  • asparaginase enzyme is used to refer to an enzyme that is capable of hydrolysing both L-asparagine and L-glutamine.
  • An aim of the present invention is to significantly reduce the formation of carcinogenic acrylamide in thermally treated food by a concerted enzymatic hydrolysis of the acrylamide precursor, L-asparagine with the asparaginase enzyme.
  • a method for the manufacture of the asparaginase enzyme is disclosed.
  • the asparaginase enzyme possesses operational stability and is obtained from mycelium of the Basidiomycetes Flammulina velutipes.
  • a strain of the Flammulina velutipes is commercially available through culture collections, such as the DSMZ (Deutsche Sammlung für Mikroorganismen and Zellkulturen GmbH, Braunschweig, Germany) or the CBS (Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands).
  • DSMZ Deutsche Sammlung für Mikroorganismen and Zellkulturen GmbH, Braunschweig, Germany
  • CBS Carriereau voor Schimmelcultures, Utrecht, The Netherlands.
  • the fungus of the Basidiomycetes Flammulina velutipes can be easily grown in a submerged culture with minimum demands for medium supplements.
  • An organic carbon source, a nitrogen source, and a phosphorous source have to be present; these sources are typically provided by natural mixtures such as a yeast extract or glucose plus inorganic ammonium and phosphate salts.
  • a mixture of minor and trace elements, are recommended in all nutrient media of micro-organisms, is added.
  • the cultivation of the Basidiomycetes Flammulina velutipes is preferably carried out in a submerged culture for 3 to 20 days, preferably for 6 to 15 days.
  • a temperature during cultivation of the Basidiomycetes Flammulina velutipes is typically in a range from 10 to 35° C., preferably from 20 to 30° C.
  • a pH of about 4 to 8 is typical, with a pH of about 5 to 7 being preferred.
  • conditions of low light are typical of the method.
  • the method of biomass and asparaginase enzyme production operates under mild conditions and is environmentally friendly in contrast to the methods of the prior art.
  • the asparaginase enzyme activity is first accumulated intra-cellularly as shown in FIG. 1 and then secreted into a nutrient medium as shown in FIG. 2 .
  • the nutrient medium facilitates a handling of the method as well as asparaginase enzyme isolation and enrichment using techniques known in the art.
  • the techniques can be ultra-filtration, precipitation or adsorption.
  • a cell-free, concentrated culture supernatant of asparaginase enzyme may thus be obtained and further used for technical hydrolysis.
  • the asparaginase enzymes may be isolated by techniques known in the art, it is not necessary to do so, and a crude mixture of the asparaginase enzyme obtained may also be further used in the present method.
  • activity staining on a native poly-acrylamide gel confirmed the catalytic specificity and showed active bands of the purified enzyme at 13 and 74 kDa indicating the presence of an oligomer form besides the monomer.
  • a recombinant product from Bacillus subtilis may be used.
  • the full amino acid sequence of the asparaginase enzyme needs to be known.
  • the full amino acid sequence of the asparaginase enzyme is shown in FIG. 3 which shows the full sequence with all 123 amino acid moieties, as deduced from the full 372 base pair sequence of the structural gene. An 18 base pair signal sequence precedes the coding region.
  • the asparaginase enzyme is added to a substrate.
  • a substrate By adding the asparaginase enzyme to the substrate it is intended that the asparaginase enzyme contacts the substrate. This can include for example spraying, dipping or coating the substrate with the asparaginase enzyme.
  • the substrate is preferably a food material that comprises any one of L-asparagine or L-glutamine.
  • the asparaginase enzyme is usually applied to the substrate at concentrations at a total level of 1 to 200 millimolar, preferably 10 to 20 millimolar depending on the specific activity.
  • the asparaginase enzyme can be added as the pure protein.
  • the asparaginase enzyme can be tailored according to the intended use by adding ingredients to the asparaginase enzyme, such as lactose, glycerol or albumin to facilitate dosage.
  • the manufactured asparaginase enzyme or the tailored asparaginase enzyme can be in the form of, an enzyme tablet, a granulate, a stabilized liquid or a paste-like preparation.
  • a hydrolysis of the substrate is performed to obtain the substrate with a significantly lower levels of asparagine or glutamine as compared to the substrate prior to treatment.
  • the conditions which may be used for the hydrolysis are standard, and can be easily determined by a person of skill in the art.
  • the substrate to be treated may be, for example:
  • the substrate is any item consumable by a human or an animal.
  • the degree of hydrolysis of the asparagine in the substrate can be either assessed by measuring asparagine decrease, aspartic acid or ammonia increase or, after processing the food, by measuring a level of any residual acrylamide.
  • the advantage provided by the invention is that the resulting novel asparaginase enzyme has a distinct affinity and improved efficacy for the hydrolysis of L-asparagine.
  • the novel asparaginase enzyme possesses good pH stability and a broad pH-optimum between pH 5.5 and 9, see FIGS. 5 and 6 .
  • the pH of most foods is found in this range.
  • An operational stability of the asparaginase enzyme is not decreased even at temperatures as high as 55° C., see FIG. 7 .
  • An iso-electric point of the asparaginase enzyme monomer and oligomer is near 5.2, as determined by isoelectric focussing gel electrophoresis.
  • the molecular masses of the asparaginase enzyme monomer and oligomer are 12.8, as deduced from the full sequence and around 74 for the aggregated form, as deduced from native polyacrylamide gel electrophoresis (PAGE), see FIG. 8 .
  • the unique sequence of the asparaginase enzyme as shown in FIG. 3 was determined by ESI-MS analysis. The best homologies of the initially found peptides were found to a carboxylase/metallo-peptidase (E-value >30), a lipase/esterase/deacetylase (E-value >100), and to a pepsin-like aspartic/glycoside hydrolase (E-value >14). The generally inhomogeneous results and poor E-values indicate that this asparaginase enzyme is without precedent and novel indeed. This is explained by the unique source, the basidiomycete species.
  • Flammulina velutipes was maintained on standard agar plates (30.0 g L ⁇ 1 glucose-monohydrate; 4.5 g L ⁇ 1 asparagine-monohydrate; 1.5 g L ⁇ 1 KH 2 PO 4 ; 0.5 g L ⁇ 1 MgSO 4 ; 3.0 g L ⁇ 1 yeast extract; 15.0 g L ⁇ 1 agar agar; 1.0 mL L ⁇ 1 trace metal solution containing 0.005 g L ⁇ 1 CuSO 4 .5H 2 O, 0.08 g L ⁇ 1 FeCl 3 .
  • Precultures were prepared by homogenisation of a 10 ⁇ 10 mm agar plug with mycelium of Flammulina velutipes in 100 mL of sterile standard nutrition solution using an Ultra Turrax (Miccra D-9, Art, Müllheim, Germany). Submerged cultures were maintained at 24° C. and 150 rpm. After cultivation for 5 days, 50 ml preculture were transferred into 250 ml main culture medium consisting of minimal medium (1.5 g L ⁇ 1 KH 2 PO 4 ; 0.5 g L ⁇ 1 MgSO 4 ; 1.0 ml L ⁇ 1 trace metal solution) and 40 g L ⁇ 1 gluten or 10 mM glutamine, respectively.
  • minimal medium 1.5 g L ⁇ 1 KH 2 PO 4 ; 0.5 g L ⁇ 1 MgSO 4 ; 1.0 ml L ⁇ 1 trace metal solution
  • 40 g L ⁇ 1 gluten or 10 mM glutamine respectively.
  • the culture was filtrated and the extracellular asparaginase enzyme-containing supernatant (200 mL) was reversed foamed [1].
  • the retentate was concentrated using ultra-filtration with a MWCO of 10,000 kDa (Millipore, Bedford, Mass.) and separated via size exclusion chromatography at a Superose 6 with 200 mM Tris/HCl pH 7.5.
  • HPLC was performed using a C18 Nucleodur Pyramid, 5 ⁇ m, 4 mm ID column, methanol as eluent A, 0.1 M sodium acetate plus 0.044% triethylamine (pH adjusted to 6.5 with HCl) as the eluent B, o-phthaldialdehyde as the derivatisation reagent, and a fluorescence detector.
  • the protein concentration in the hydrolysis supernatant was estimated according to the Lowry-method using bovine serum albumin as a standard.
  • the determination of the temperature and pH optima of the asparaginase enzyme was performed with enzyme solutions harvested during the cultivation, or after the recombinant protein was available in a soluble form.
  • the pH optimum was examined in the range of pH 4 to 9 (0.1 M sodium acetate pH 4, 5; 0.1 M potassium phosphate pH 6, 7, 8; 0.1 M sodium carbonate pH 9) at 37° C.
  • the optimal temperature determination ranged from 20 to 70° C. at optimal pH.
  • peptidase bands were excised from SDS polyacrylamide gels, dried, and digested with trypsin. The resulting peptides were extracted and purified according to standard protocols.
  • a Qtof II mass spectrometer (Micromass, U.K) equipped with a nanospray ion source and gold-coated capillaries was used for electrospray ionisation (ESI) MS of peptides.
  • ESI electrospray ionisation
  • Peptide mass fingerprints obtained from ESI-Tandem MS analysis were used for cross-species protein identification in public protein primary sequence databases.
  • SDS-PAGE analyses were performed on a 12% polyacrylamide separation gel.
  • Samples were prepared by mixing 20 ⁇ L of asparaginase enzyme solution and 20 ⁇ L of loading buffer [0.1 M Tris/HCl (pH 6.8), 0.2 M DTT, 4% SDS, 20% glycerol, 0.2% bromophenol blue] and boiling for 15 min. After electrophoresis at 20 mA per gel, the gels were stained with silver or Coomassie Brilliant Blue. For molecular determinations, marker proteins from 250 to 10 kDa (BioRad, Germany) were used.
  • the glutaminase-staining solution contained 15 mM L-glutamine, 0.5 g mL ⁇ 1 bovine liver glutamate dehydrogenase, 0.1 M potassium phosphate pH 7, 2 mg mL ⁇ 1 NAD, 0.04 mg mL ⁇ 1 phenazine methosulfate, and 2 mg mL ⁇ 1 nitroblue tetrazolium. Enzyme activity appeared after incubation at 37° C. as violet bands.
  • IEF polyacrylamide gel electrophoresis was performed on a Multiphor II system (Pharmacia LKB, Sweden) using ServalytTM PrecotesTM precast gels with an immobilised pH gradient from 3 to 10 (Serva, Germany) for 3500 V h (2000 V, 6 mA, 12 W).
  • the isoelectric points of asparaginase were estimated to be 5 using a protein test mixture from pI 3.5 to 10.7 (Serva, Germany). Gels were Coomassie, silver or activity stained as described above.
  • RNA was prepared from 500 mg mycelium stored in RNALater® (Invitrogen) using the NucleoSpin® RNA Plant Kit (Macherey-Nagel, Duren, Germany).
  • RNA 5 ⁇ g total RNA were mixed with 25 pmol 3′PCR (ATTCTAGAGGCCGAGGCGGCCGACATG 30*T VN) and filled up to 11 ⁇ l with DEPC-treated H 2 O. The mixture was incubated at 70° C. for 5 min and then chilled on ice for 2 min. 4 ⁇ l 5 ⁇ reaction buffer, 2 ⁇ l dNTP mix (10 mM ea.), 0.5 ⁇ l RiboLockTM and 20 pmol SMART IIA (AAGCAGTGGTATCAACGCAGAGTACGCGGG) were added, mixed and incubated at 37° C. for 5 min. After the addition of 200 U RevertAidTM H Minus M-MuLV Reverse Transcriptase the mixture was incubated at 42° C. for 60 min. Termination was carried out by heating at 70° C. for 5 min.
  • Second strand synthesis was carried out by mixing 2.5 ⁇ l 10 ⁇ Long PCR buffer, 2 ⁇ l dNTP mix (2.5 mM ea.), 25 pmol 5′PCR (AAGCAGTGGTATCAACGCAGAGT), 25 pmol 3′PCR, 1 ⁇ l DMSO, 1 U Long PCR Enzyme Mix, 3 ⁇ l ss cDNA and ddH 2 O to 25 ⁇ l.
  • reaction mixture was incubated at 94° C. for 5 min, followed by 30 cycles at 94° C. for 20 s and 68° C. for 6 min, final elongation was carried out at 68° C. for 20 min.
  • Enzymes and reagents were purchased from Fermentas, St. Leon-Rot, Germany. Oligonucleotides were synthesized by Eurofins MWG Operon, Ebersberg, Germany.
  • Degenerated primers were deduced from peptide sequences. PCRs were performed by mixing 2.5 ⁇ l 10 ⁇ TrueStartTM Taq-buffer, 2 ⁇ l dNTP mix (2.5 mM ea.), 2 ⁇ l 25 mM MgCl 2 , 25 pmol forward primer, 25 pmol reverse primer, 0.8 ⁇ l DMSO, 0.625 U TrueStartTM Taq DNA Polymerase, 1 ⁇ l ds cDNA and ddH 2 O to 25 ⁇ l.
  • Touchdown PCR [2] was performed by incubating the reaction mixture at 95° C. for 5 min, then for 12 cycles at 95° C. for 30 s, (72° C. ⁇ 1° C./cycle) for 60 s and 72° C. for 90 s. Another 25 cycles were carried out at 60° C. annealing temperature. Final elongation was performed at 72° C. for 20 min.
  • PCRs were analyzed by agarose gel electrophoresis (1% agarose (Serva, Heidelberg, Germany) cooked in TAE-buffer (40 mM Tris, 20 mM acetic acid, 1 mM EDTA pH 8). For detection of DNA 0.05% SYBRSafeTM (Invitrogen) was added to the solution after it cooled down to about 50° C.
  • DNA fragments were ligated into the pCR2.1® TA-Vector (Invitrogen) by mixing 1 ⁇ l vector, 1 ⁇ l 10 ⁇ T4 DNA Ligase-buffer, 5 U T4 DNA Ligase, 0.5 ⁇ l 5 mM ATP and 6.5 ⁇ l Insert-DNA. The reaction mixture was incubated at 25° C. for two hours.
  • the reaction mixture was composed as stated above but primers M13 uni ( ⁇ 21) (TGTAAAACGACGGCCAGT) and M13 rev ( ⁇ 29) (CAGGAAACAGCTATGACC) were used. Template was added by resuspending white colony material in the reaction mixture.
  • reaction mixture was incubated at 95° C. for 5 min, followed by 40 cycles at 95° C. for 30 s, 55° C. for 1 min and 72° C. for 1 min/kb. Final elongation was performed at 72° C. for 20 min.
  • Plasmid DNA was isolated with the NucleoSpin Plasmid DNA Kit (Macherey-Nagel). Sequencing was performed by Eurofins MWG Operon (Ebersberg, Germany).
  • primers were derived from identified asparaginase DNA fragments and paired with primers 5′PCR or 3′PCR, respectively. PCRs were carried out as stated above with an annealing temperature of 55° C. and an elongation step of 1 min at 72° C.
  • genomic DNA was prepared from mycelium by using the Genomic DNA Purification Kit (Fermentas). The complete asparaginase sequence was amplified and sequenced.
  • the gene was amplified from the plasmid DNA by PCR with flanking restriction sites EcoRI and BamHI using the primers FvNase_EcoRI (ATAGAATTCATGAAATCTTTTGCCCTCTTC) and FvNase_BamHI (ATAGGATCCTCAAGCAAAGTCGATGAA).
  • the gene cassette was digested and ligated into X-Zyme's pCTP2 expression vector to yield the expression construct pCTP2-Aspa.
  • the E. coli strains DH5alpha and JM105 transformed with pCTP2-Aspa were grown in LB-medium at 37° C.
  • the secretion of proteins from bacteria is an ATP-dependent process which involves the translocation of a pre-protein and the subsequent proteolytic cleavage of the pre-protein on the outside surface of the membrane, into the mature enzyme.
  • a signal sequence contains all of the information necessary to target the protein to the membrane for translocation.
  • Flammulina velutipes was maintained on standard agar plates (30.0 g L ⁇ 1 glucose-monohydrate; 4.5 g L ⁇ 1 asparagine-monohydrate; 1.5 g L ⁇ 1 KH 2 PO 4 ; 0.5 g L ⁇ 1 MgSO 4 ; 3.0 g L ⁇ 1 yeast extract; 15.0 g L ⁇ 1 agar agar; 1.0 mL L ⁇ 1 trace metal solution containing 0.005 g L 1 CuSO 4 .5H 2 O, 0.08 g L ⁇ 1 FeCl 3 .6H 2 O, 0.09 g L ⁇ 1 ZnSO 4 .7H 2 O, 0.03 g L ⁇ 1 MnSO 4 H 2 O and 0.4 g L ⁇ 1 EDTA.
  • Precultures were prepared by homogenisation of a 10 ⁇ 10 mm agar plug with mycelium of Flammulina velutipes in 100 mL of sterile standard nutrition solution using an Ultra Turrax (Miccra D-9, Art, Müllheim, Germany). Submerged cultures were maintained at 24° C. and 150 rpm.
  • the culture was filtrated and the extracellular enzyme-containing supernatant (200 mL) was reverse-foamed, the asparaginase and another protein being the only proteins left in the supernatant.
  • the remaining liquid was concentrated using ultra-filtration (MWCO 10,000), and both proteins were separated via size exclusion chromatography at a Superose 6.
  • the analytical evidence indicates a fast enzymatic hydrolysis of the substrate L-asparagine.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Microbiology (AREA)
  • Polymers & Plastics (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Husbandry (AREA)
  • Physiology (AREA)
  • Nutrition Science (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Fodder In General (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • General Preparation And Processing Of Foods (AREA)
  • Seeds, Soups, And Other Foods (AREA)
  • Feed For Specific Animals (AREA)
US13/810,134 2010-07-14 2011-04-06 Asparaginase from basidiomycetes Abandoned US20130209608A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
EP10169405.7 2010-07-14
EP10169405 2010-07-14
PCT/EP2011/055375 WO2012007192A1 (en) 2010-07-14 2011-04-06 Asparaginase from basidiomycetes

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2011/055375 A-371-Of-International WO2012007192A1 (en) 2010-07-14 2011-04-06 Asparaginase from basidiomycetes

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US14/477,448 Division US9410138B2 (en) 2010-07-14 2014-09-04 Asparaginase from basidiomycetes

Publications (1)

Publication Number Publication Date
US20130209608A1 true US20130209608A1 (en) 2013-08-15

Family

ID=44275917

Family Applications (2)

Application Number Title Priority Date Filing Date
US13/810,134 Abandoned US20130209608A1 (en) 2010-07-14 2011-04-06 Asparaginase from basidiomycetes
US14/477,448 Expired - Fee Related US9410138B2 (en) 2010-07-14 2014-09-04 Asparaginase from basidiomycetes

Family Applications After (1)

Application Number Title Priority Date Filing Date
US14/477,448 Expired - Fee Related US9410138B2 (en) 2010-07-14 2014-09-04 Asparaginase from basidiomycetes

Country Status (18)

Country Link
US (2) US20130209608A1 (es)
EP (1) EP2593473B1 (es)
JP (1) JP2013539358A (es)
CN (1) CN103003297B (es)
AU (1) AU2011278657B2 (es)
BR (1) BR112013000768A2 (es)
CA (1) CA2802126A1 (es)
CL (1) CL2012003490A1 (es)
DK (1) DK2593473T3 (es)
ES (1) ES2585280T3 (es)
IL (1) IL223085A (es)
MX (1) MX340937B (es)
NZ (1) NZ603773A (es)
PL (1) PL2593473T3 (es)
RU (1) RU2560597C2 (es)
UA (1) UA113391C2 (es)
WO (1) WO2012007192A1 (es)
ZA (1) ZA201301160B (es)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015033344A1 (en) 2013-09-05 2015-03-12 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Methods and kits for inhibiting pathogenicity of group a streptococcus (gas) or group g streptococcus (ggs)
US9068171B2 (en) 2012-09-06 2015-06-30 Mycotechnology, Inc. Method for myceliating coffee
US9427008B2 (en) 2012-09-06 2016-08-30 Mycotechnology, Inc. Method of myceliation of agricultural substates for producing functional foods and nutraceuticals
US9572364B2 (en) 2014-08-26 2017-02-21 Mycotechnology, Inc. Methods for the production and use of mycelial liquid tissue culture
US9572363B2 (en) 2014-08-26 2017-02-21 Mycotechnology, Inc. Methods for the production and use of mycelial liquid tissue culture
US10010103B2 (en) 2016-04-14 2018-07-03 Mycotechnology, Inc. Methods for the production and use of myceliated high protein food compositions
US10231469B2 (en) 2014-03-15 2019-03-19 Mycotechnology, Inc. Myceliated products and methods for making myceliated products from cacao and other agricultural substrates
US10709157B2 (en) 2014-08-26 2020-07-14 Mycotechnology, Inc. Methods for the production and use of mycelial liquid tissue culture
US10806101B2 (en) 2016-04-14 2020-10-20 Mycotechnology, Inc. Methods for the production and use of myceliated high protein food compositions
US10980257B2 (en) 2015-02-26 2021-04-20 Myco Technology, Inc. Methods for lowering gluten content using fungal cultures
US11058137B2 (en) 2018-09-20 2021-07-13 The Better Meat Co. Enhanced aerobic fermentation methods for producing edible fungal mycelium blended meats and meat analogue compositions
US11166477B2 (en) 2016-04-14 2021-11-09 Mycotechnology, Inc. Myceliated vegetable protein and food compositions comprising same

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109750069A (zh) * 2017-11-01 2019-05-14 北京中科伊品生物科技有限公司 生产l-赖氨酸的重组菌、其构建方法以及l-赖氨酸的生产方法

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070026511A1 (en) * 2005-07-13 2007-02-01 Morrissey Edward S Methods for the administration of fv and related compositions

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS5638192B2 (es) * 1973-01-26 1981-09-04
JPS6212720A (ja) * 1985-07-10 1987-01-21 Yasahiro Morita アロエ霊芝の製造法
JPS6360915A (ja) * 1986-09-01 1988-03-17 Masao Nashiro 脱毛防止兼育毛剤
JP3819540B2 (ja) * 1996-06-07 2006-09-13 株式会社林原生物化学研究所 Ｌ−アスパラギナーゼ活性を有する哺乳類由来のポリペプチド
RU2221868C2 (ru) * 2001-08-22 2004-01-20 Эльдаров Михаил Анатольевич Ген l-аспарагиназы erwinia carotovora и штамм escherichia coli вкпм № в-8174 - продуцент l-аспарагиназы erwinia carotovora
US7037540B2 (en) 2002-09-19 2006-05-02 Frito-Lay North America, Inc. Method for reducing acrylamide formation in thermally processed foods
JP2004283062A (ja) * 2003-03-20 2004-10-14 Riken Vitamin Co Ltd 加熱調理された加工食品
CA2680273C (en) * 2007-03-09 2017-02-28 Novozymes A/S Thermostable asparaginases
ES2524343T3 (es) * 2007-04-20 2014-12-05 Dsm Ip Assets B.V. Variantes de la enzima asparaginasa y sus usos
EA017305B1 (ru) * 2007-04-20 2012-11-30 ДСМ АйПи АССЕТС Б.В. Новые аспарагиназы и их применение

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070026511A1 (en) * 2005-07-13 2007-02-01 Morrissey Edward S Methods for the administration of fv and related compositions

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Eisele N et al. The first characterized asparaginase from a basidiomycete, Flammulina velutipes. 2010. Bioresource Tehcnology. 102:1316-3321. *
Smiderle FR et al. Structural characterization of a polysaccharide and a b-glucan isolated from the edible mushroom Flammulina velutipes. 2006. Phytochemistry 67 pp. 2189-2196. *

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9068171B2 (en) 2012-09-06 2015-06-30 Mycotechnology, Inc. Method for myceliating coffee
US9427008B2 (en) 2012-09-06 2016-08-30 Mycotechnology, Inc. Method of myceliation of agricultural substates for producing functional foods and nutraceuticals
WO2015033344A1 (en) 2013-09-05 2015-03-12 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Methods and kits for inhibiting pathogenicity of group a streptococcus (gas) or group g streptococcus (ggs)
US11992025B2 (en) 2014-03-15 2024-05-28 Mycotechnology, Inc. Myceliated products and methods for making myceliated products from cacao and other agricultural substrates
US10231469B2 (en) 2014-03-15 2019-03-19 Mycotechnology, Inc. Myceliated products and methods for making myceliated products from cacao and other agricultural substrates
US9572364B2 (en) 2014-08-26 2017-02-21 Mycotechnology, Inc. Methods for the production and use of mycelial liquid tissue culture
US9572363B2 (en) 2014-08-26 2017-02-21 Mycotechnology, Inc. Methods for the production and use of mycelial liquid tissue culture
US10709157B2 (en) 2014-08-26 2020-07-14 Mycotechnology, Inc. Methods for the production and use of mycelial liquid tissue culture
US10980257B2 (en) 2015-02-26 2021-04-20 Myco Technology, Inc. Methods for lowering gluten content using fungal cultures
US10806101B2 (en) 2016-04-14 2020-10-20 Mycotechnology, Inc. Methods for the production and use of myceliated high protein food compositions
US11166477B2 (en) 2016-04-14 2021-11-09 Mycotechnology, Inc. Myceliated vegetable protein and food compositions comprising same
US11343978B2 (en) 2016-04-14 2022-05-31 Mycotechnology, Inc. Methods for the production and use of myceliated high protein food compositions
US11950607B2 (en) 2016-04-14 2024-04-09 Mycotechnology, Inc. Myceliated vegetable protein and food compositions comprising same
US10010103B2 (en) 2016-04-14 2018-07-03 Mycotechnology, Inc. Methods for the production and use of myceliated high protein food compositions
US11058137B2 (en) 2018-09-20 2021-07-13 The Better Meat Co. Enhanced aerobic fermentation methods for producing edible fungal mycelium blended meats and meat analogue compositions
US11432574B2 (en) 2018-09-20 2022-09-06 The Better Meat Co. Enhanced aerobic fermentation methods for producing edible fungal mycelium blended meats and meat analogue compositions
US11470871B2 (en) 2018-09-20 2022-10-18 The Better Meat Co. Enhanced aerobic fermentation methods for producing edible fungal mycelium blended meats and meat analogue compositions
US11478006B2 (en) 2018-09-20 2022-10-25 The Better Meat Co. Enhanced aerobic fermentation methods for producing edible fungal mycelium blended meats and meat analogue compositions

Also Published As

Publication number Publication date
CN103003297B (zh) 2016-06-01
IL223085A0 (en) 2013-02-03
ZA201301160B (en) 2014-07-30
US20150093472A1 (en) 2015-04-02
EP2593473A1 (en) 2013-05-22
AU2011278657A1 (en) 2012-12-06
US9410138B2 (en) 2016-08-09
CL2012003490A1 (es) 2014-02-14
CA2802126A1 (en) 2012-01-19
RU2013106310A (ru) 2014-08-20
RU2560597C2 (ru) 2015-08-20
CN103003297A (zh) 2013-03-27
MX2012014701A (es) 2013-01-28
BR112013000768A2 (pt) 2016-05-24
DK2593473T3 (en) 2016-08-01
ES2585280T3 (es) 2016-10-04
EP2593473B1 (en) 2016-05-25
IL223085A (en) 2016-09-29
JP2013539358A (ja) 2013-10-24
AU2011278657B2 (en) 2015-05-14
WO2012007192A1 (en) 2012-01-19
NZ603773A (en) 2014-05-30
PL2593473T3 (pl) 2016-11-30
UA113391C2 (uk) 2017-01-25
MX340937B (es) 2016-08-01

Similar Documents

Publication Publication Date Title
US9410138B2 (en) Asparaginase from basidiomycetes
AU2020203904B2 (en) Polypeptide for the hydrolytic cleavage of zearalenone and/or zearalenone derivatives, isolated polynucleotide thereof, and additive containing polypeptide, use of said polypeptide and method
Eisele et al. The first characterized asparaginase from a basidiomycete, Flammulina velutipes
US10941390B2 (en) Protein deamidase
Yao et al. Characterization of a fibrinolytic enzyme secreted by Bacillus velezensis BS2 isolated from sea squirt jeotgal
Kim et al. Characterization of a 27 kDa fibrinolytic enzyme from Bacillus amyloliquefaciens CH51 isolated from cheonggukjang
US11278045B2 (en) Method for producing nucleic acid seasoning
WO2022270590A1 (ja) ラッカーゼ
DK2139996T3 (en) Peptidases FROM Basidiomycetes
US20230416718A1 (en) Thermotolerant protein glutaminase
WO2024071388A1 (ja) 酵素剤及びその応用
NZ717021B2 (en) Polypeptide for hydrolytic cleavage of zearalenone and/or zearalenone derivatives, isolated polynucleotide thereof as well as a polypeptide containing an additive, use of same as well as a process

Legal Events

Date Code Title Description
AS Assignment

Owner name: NESTEC S.A., SWITZERLAND

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:BERENDS, PIETER;RABE, SWEN;BERGER, RALF GUNTER;AND OTHERS;SIGNING DATES FROM 20110126 TO 20110214;REEL/FRAME:029651/0885

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION