US20100291114A1 - Crystal structures and methods using same - Google Patents
Crystal structures and methods using same Download PDFInfo
- Publication number
- US20100291114A1 US20100291114A1 US12/661,852 US66185210A US2010291114A1 US 20100291114 A1 US20100291114 A1 US 20100291114A1 US 66185210 A US66185210 A US 66185210A US 2010291114 A1 US2010291114 A1 US 2010291114A1
- Authority
- US
- United States
- Prior art keywords
- fgfr3
- antibody
- seq
- hvr
- amino acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2863—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/39558—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/30—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
- C07K16/3038—Kidney, bladder
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/30—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
- C07K16/3061—Blood cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/52—Constant or Fc region; Isotype
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/55—Fab or Fab'
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/565—Complementarity determining region [CDR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/567—Framework region [FR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
- C07K2317/732—Antibody-dependent cellular cytotoxicity [ADCC]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/75—Agonist effect on antigen
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/77—Internalization into the cell
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
Definitions
- the present invention relates generally to the field of molecular biology. More specifically, the invention concerns anti-FGFR3 antibodies, and uses of same.
- Fibroblast growth factors and their receptors (FGFRs) play critical roles during embryonic development, tissue homeostasis and metabolism (1-3).
- FGFs Fibroblast growth factors
- FGFRs Fibroblast growth factors
- FGF1-14, FGF16-23 FGF1-14, FGF16-223
- FGF4 FGF receptors with tyrosine kinase domain
- FGFRs consist of an extracellular ligand binding region, with two or three immunoglobulin-like domains (IgD1-3), a single-pass transmembrane region, and a cytoplasmic, split tyrosine kinase domain.
- IgD1-3 immunoglobulin-like domains
- FGFR1, 2 and 3 each have two major alternatively spliced isoforms, designated IIIb and IIIc.
- IIIb isoforms differ by about 50 amino acids in the second half of IgD3, and have distinct tissue distribution and ligand specificity.
- IIIb isoform is found in epithelial cells, whereas IIIc is expressed in mesenchymal cells.
- FGF FGFR substrate 2 ⁇
- MAPK mitogen-activated protein kinase
- PI3K-AKT PI3K-AKT pathways
- FGFR3 Aberrantly activated FGFRs have been implicated in specific human malignancies (1, 5).
- the t(4;14) (p16.3;q32) chromosomal translocation occurs in about 15-20% of multiple myeloma patients, leading to overexpression of FGFR3 and correlates with shorter overall survival (6-9).
- FGFR3 is implicated also in conferring chemoresistance to myeloma cell lines in culture (10), consistent with the poor clinical response of t(4;14)+ patients to conventional chemotherapy (8).
- FGFR3 Overexpression of mutationally activated FGFR3 is sufficient to induce oncogenic transformation in hematopoietic cells and fibroblasts (11-14, 15), transgenic mouse models (16), and murine bone marrow transplantation models (16, 17). Accordingly, FGFR3 has been proposed as a potential therapeutic target in multiple myeloma. Indeed, several small-molecule inhibitors targeting FGFRs, although not selective for FGFR3 and having cross-inhibitory activity toward certain other kinases, have demonstrated cytotoxicity against FGFR3-positive myeloma cells in culture and in mouse models (18-22).
- FGFR3 overexpression has been documented also in a high fraction of bladder cancers (23, 24). Furthermore, somatic activating mutations in FGFR3 have been identified in 60-70% of papillary and 16-20% of muscle-invasive bladder carcinomas (24, 25). In cell culture experiments, RNA interference (11, 26) or an FGFR3 single-chain Fv antibody fragment inhibited bladder cancer cell proliferation (27).
- RNA interference 11, 26
- an FGFR3 single-chain Fv antibody fragment inhibited bladder cancer cell proliferation (27).
- a recent study demonstrated that an FGFR3 antibody-toxin conjugate attenuates xenograft growth of a bladder cancer cell line through FGFR3-mediated toxin delivery into tumors (28).
- FGFR3 signaling is indeed an oncogenic driver of in vivo growth of bladder tumors.
- the invention provides a crystal comprising an anti-FGFR3 antibody and an FGFR3, the crystal having, for example, the structural coordinates of Table 6.
- the invention provides a heavy atom derivative of a crystal of the invention.
- the invention provides a composition comprising a crystal of the invention.
- the invention provides a computer-implemented method, a computer system and machine-readable data storage medium comprising a data storage material encoded with machine-readable instructions for causing a display of a graphical three-dimensional representation of a structure of a portion of a crystal of anti-FGFR3 antibody (or structural homolog thereof) in complex with FGFR3 (or a structural homolog and/or portion thereof).
- the computer is programmed with instructions for transforming the structure coordinates into the graphical three-dimensional representation of the structure and/or displaying the graphical three-dimensional representation.
- the structure coordinates include the coordinates of the backbone atoms of the portion of the crystal and/or one or more of the contact residues between the anti-FGFR3 antibody and the FGFR3 in the complex (e.g., some or all of the coordinates shown in Table 6).
- amino acid residues that form a binding site for an inhibitor binding site on FGFR3 are identified and are useful, for example, in methods to model the structure of an FGFR3 binding site and to identify agents that can bind or fit into the binding site.
- This use includes the rational design of modulators of FGFR3 activity.
- these modulators include ligands that interact with FGFR3 and modulate FGFR/FGF activities.
- the crystals are formed from an FGFR3 sequence comprising sequence
- the crystals are formed from an FGFR3 sequence comprising sequence
- the anti-FGFR3 antibody comprises a light chain variable region comprising HVR-L1, HVR-L2, HVR-L3, wherein each, in order, comprises SEQ ID NO:4, 5, 6, and/or a heavy chain variable region comprising HVR-H1, HVR-H2, and HVR-H3, where each, in order, contains SEQ ID NO: 1, 2, 3.
- the anti-FGFR3 antibody comprises a light chain variable region comprising sequence
- the anti-FGFR3 antibody comprises:
- HVR hypervariable region
- HVR-L1 comprising sequence A1-A11, wherein A1-A11 is RASQDVDTSLA (SEQ ID NO:87),
- HVR-L2 comprising sequence B1-B7, wherein B1-B7 is SASFLYS (SEQ ID NO:88),
- HVR-L3 comprising sequence C1-C9, wherein C1-C9 is QQSTGHPQT (SEQ ID NO:89),
- HVR-H1 comprising sequence D1-D10, wherein D1-D10 is GFTFTSTGIS (SEQ ID NO:84),
- HVR-H2 comprising sequence E1-E18, wherein E1-E18 is GRIYPTSGSTNYADSVKG (SEQ ID NO:85), and
- HVR-H3 comprising sequence F1-F20, wherein F1-F20 is ARTYGIYDLYVDYTEYVMDY (SEQ ID NO:86); and
- variant HVR at least one variant HVR, where the variant HVR sequence comprises modification of at least one residue (at least two residues, at least three or more residues) of the sequence depicted in SEQ ID NOS:1-18, 48-131 and 140-145.
- the modification desirably is a substitution, insertion, or deletion.
- a HVR-L1 variant comprises 1-6 (1, 2, 3, 4, 5, or 6) substitutions in any combination of the following positions: A5 (V or D), A6 (V or I), A7 (D, E or S), A8 (T or I), A9 (A or S) and A10 (V or L).
- a HVR-L2 variant comprises 1-2 (1 or 2) substitutions in any combination of the following positions: B1 (S or G), B4 (F or S or T) and B6 (A or Y).
- a HVR-L3 variant comprises 1-6 (1, 2, 3, 4, 5, or 6) substitutions in any combination of the following positions: C3 (G or S or T), C4 (T or Y or A), C5 (G or S or T or A), C6 (A or H or D or T or N), C7 (Q or P or S), and C8 (S or Y or L or P or Q).
- a HVR-H1 variant comprises 1-3 (1, 2, or 3) substitutions in any combination of the following positions: D3 (S or T), D5 (W or Y or S or T), D6 (S or G or T).
- a HVR-H2 variant comprises 1-6 (1, 2, 3, 4, 5, or 6) substitutions in any combination of the following positions: E2 (R or S), E6 (Y or A or L or S or T), E7 (A or Q or D or G or Y or S or N or F), E8 (A or D or G), E9 (T or S), E10 (K or F or T or S), E11 (Y or H or N or I).
- the anti-FGFR3 antibody comprises:
- HVR hypervariable region
- HVR-L1 comprising sequence RASQX 1 X 2 X 3 X 4 X 5 X 6 A, wherein X 1 is V or D, X 2 is V or I, X 3 is D, E or S, X 4 is T or I, X 5 is A or S, and X 6 is V or L (SEQ ID NO:146),
- HVR-L2 comprising sequence X 1 ASFLX 2 S wherein X 1 is S or G and X 2 is A or Y (SEQ ID NO:147),
- HVR-L3 comprising sequence QQX 1 X 2 X 3 X 4 X 5 X 6 T, wherein X 1 is G, S or T, X 2 is T, Y or A, X 3 is G, S, T, or A, X 4 is A, H, D, T, or N, X 5 is Q, P or S, X 6 is S, Y, L, P or Q (SEQ ID NO:148),
- HVR-H1 comprising sequence GFX 1 FX 2 X 3 TGIS, wherein X 1 is S or T, X 2 is W, Y, S or T, X 3 is S, G, or T (SEQ ID NO:149),
- HVR-H2 comprising sequence GRIYPX 1 X 2 X 3 X 4 X 5 X 6 YADSVKG, wherein X 1 is Y, A, L, S, or T, X 2 is A, Q, D, G, Y, S, N or F, X 3 is A, D, or G, X 4 is T or S, X 5 is K, F, T, or S, X 6 is Y, H, N or I (SEQ ID NO:150), and
- HVR-H3 comprising sequence ARTYGIYDLYVDYTEYVMDY (SEQ ID NO:151).
- HVR-L1 comprises sequence RASQX 1 VX 2 X 3 X 4 VA, wherein X 1 is V or D, X 2 is D, E or S, X 3 is T or I, X 4 is A or S (SEQ ID NO:152).
- HVR-L3 comprises sequence QQX 1 X 2 X 3 X 4 X 5 X 6 T, wherein X 1 is S, G, or T, X 2 is Y, T, or A, X 3 is T or G, X 4 is T, H or N, X 5 is P or S, X 6 is P, Q, Y, or L (SEQ ID NO:153).
- HVR-H2 comprises sequence GRIYPX 1 X 2 GSTX 3 YADSVKG, wherein X 1 is T or L, X 2 is N, Y, S, G, A, or Q; X 3 is N or H (SEQ ID NO:154).
- an anti-FGFR3 antibody comprises a heavy chain variable region comprising HVR-H1, HVR-H2, HVR-H3, wherein each, in order, comprises SEQ ID NO:1, 2, 3, and/or a light chain variable region comprising HVR-L1, HVR-L2, and HVR-L3, where each, in order, contains SEQ ID NO: 4, 5, 6.
- an-anti-FGFR3 antibody comprises a heavy chain variable region comprising HVR-H1, HVR-H2, HVR-H3, wherein each, in order, comprises SEQ ID NO:7, 8, 9, and/or a light chain variable region comprising HVR-L1, HVR-L2, and HVR-L3, where each, in order, comprises SEQ ID NO: 10, 11, 12.
- an anti-FGFR3 antibody comprises a heavy chain variable region comprising HVR-H1, HVR-H2, HVR-H3, where each, in order, comprises SEQ ID NO:13, 14, 15, and/or a light chain variable region comprising HVR-L1, HVR-L2, and HVR-L3, where each, in order, comprises SEQ ID NO:16, 17, 18.
- an anti-FGFR3 antibody comprises a heavy chain variable region comprising HVR-H1, HVR-H2, HVR-H3, where each, in order, comprises SEQ ID NO: 48, 49, 50, and/or a light chain variable region HVR-L1, HVR-L2, and HVR-L3, where each, in order, comprises SEQ ID NO: 51, 52, 53.
- an anti-FGFR3 antibody comprises a heavy chain variable region comprising HVR-H1, HVR-H2, HVR-H3, where each, in order, comprises SEQ ID NO: 54, 55, 56, and/or a light chain variable region comprising HVR-L1, HVR-L2, and HVR-L3, where each, in order, comprises SEQ ID NO: 57, 58, 59.
- an anti-FGFR3 antibody comprises a heavy chain variable region comprising HVR-H1, HVR-H2, HVR-H3, where each, in order, comprises SEQ ID NO:60, 61, 62, 63, and/or a light chain variable region comprising HVR-L1, HVR-L2, and HVR-L3, where each, in order, comprises SEQ ID NO: 63, 64, 65.
- an anti-FGFR3 antibody comprises a heavy chain variable region comprising HVR-H1, HVR-H2, HVR-H3, where each, in order, comprises SEQ ID NO:66, 67, 68, and/or a light chain variable region comprising HVR-L1, HVR-L2, and HVR-L3, where each, in order, comprises SEQ ID NO: 69, 70, 71.
- an anti-FGFR3 antibody comprises a heavy chain variable region comprising HVR-H1, HVR-H2, HVR-H3, where each, in order, comprises SEQ ID NO:72, 73, 74, and/or a light chain variable region comprising HVR-L1, HVR-L2, and HVR-L3, where each, in order, comprises SEQ ID NO: 75, 76, 77.
- an anti-FGFR3 antibody comprises a heavy chain variable region comprising HVR-H1, HVR-H2, HVR-H3, where each, in order, comprises SEQ ID NO:78, 79 80, and/or a light chain variable region comprising HVR-L1, HVR-L2, and HVR-L3, where each, in order, comprises SEQ ID NO:81, 82, 83.
- an anti-FGFR3 antibody comprises a heavy chain variable region comprising HVR-H1, HVR-H2, HVR-H3, where each, in order, comprises SEQ ID NO: 84, 85, 86, and/or a light chain variable region comprising HVR-L1, HVR-L2, and HVR-L3, where each, in order, comprises SEQ ID NO:87, 88, 89.
- an anti-FGFR3 antibody comprises a heavy chain variable region comprising HVR-H1, HVR-H2, HVR-H3, where each, in order, comprises SEQ ID NO: 90, 91, 92, and/or a light chain variable region comprising HVR-L1, HVR-L2, and HVR-L3, where each, in order, comprises SEQ ID NO:93, 94, 95.
- an anti-FGFR3 antibody comprises a heavy chain variable region comprising HVR-H1, HVR-H2, HVR-H3, where each, in order, comprises SEQ ID NO: 96, 97, 98, and/or a light chain variable region comprising HVR-L1, HVR-L2, and HVR-L3, where each, in order, comprises SEQ ID NO: 99, 100, 101.
- an anti-FGFR3 antibody comprises a heavy chain variable region comprising HVR-H1, HVR-H2, HVR-H3, where each, in order, comprises SEQ ID NO: 102, 103, 104, and/or a light chain variable region comprising HVR-L1, HVR-L2, and HVR-L3, where each, in order, comprises SEQ ID NO: 105, 106, 107.
- an anti-FGFR3 antibody comprises a heavy chain variable region comprising HVR-H1, HVR-H2, HVR-H3, where each, in order, comprises SEQ ID NO:108, 109, 110, and/or a light chain variable region comprising HVR-L1, HVR-L2, and HVR-L3, where each, in order, comprises SEQ ID NO: 111, 112, 113.
- an anti-FGFR3 antibody comprises a heavy chain variable region comprising HVR-H1, HVR-H2, HVR-H3, where each, in order, comprises SEQ ID NO:114, 115, 116, and/or a light chain variable region comprising HVR-L1, HVR-L2, and HVR-L3, where each, in order, comprises SEQ ID NO:117, 118, 119.
- an anti-FGFR3 antibody comprises a heavy chain variable region comprising HVR-H1, HVR-H2, HVR-H3, where each, in order, comprises SEQ ID NO:120, 121, 122, and/or a light chain variable region comprising HVR-L1, HVR-L2, and HVR-L3, where each, in order, comprises SEQ ID NO: 123, 124, 125.
- an anti-FGFR3 antibody comprises a heavy chain variable region comprising HVR-H1, HVR-H2, HVR-H3, where each, in order, comprises SEQ ID NO:126, 127, 128, and/or a light chain variable region comprising HVR-L1, HVR-L2, and HVR-L3, where each, in order, comprises SEQ ID NO:129, 130, 131.
- an anti-FGFR3 antibody comprises a heavy chain variable region comprising HVR-H1, HVR-H2, HVR-H3, where each, in order, comprises SEQ ID NO:143, 144, 145, and/or a light chain variable region comprising HVR-L1, HVR-L2, and HVR-L3, where each, in order, comprises SEQ ID NO:140, 141, 142.
- amino acid sequences of SEQ ID NOs:1-18, 48-131 and 140-145 are numbered with respect to individual HVR (i.e., H1, H2 or H3) as indicated in FIG. 1 , the numbering being consistent with the Kabat numbering system as described below.
- the anti-FGFR3 antibody comprises a heavy chain variable region comprising SEQ ID NO:132 and a light chain variable region.
- the anti-FGFR3 antibody comprises a light chain variable region comprising SEQ ID NO: 133, and a heavy chain variable region.
- the anti-FGFR3 antibody comprises a heavy chain variable region comprising SEQ ID NO:132 and a light chain variable region comprising SEQ ID NO:133.
- the anti-FGFR3 antibody comprises a heavy chain variable region comprising SEQ ID NO:134 and a light chain variable region.
- the anti-FGFR3 antibody comprises a light chain variable region comprising SEQ ID NO: 135, and a heavy chain variable region.
- the anti-FGFR3 antibody comprises a light chain variable region comprising SEQ ID NO: 139, and a heavy chain variable region.
- the anti-FGFR3 antibody comprises a heavy chain variable region comprising SEQ ID NO:134 and a light chain variable region comprising SEQ ID NO:135.
- the anti-FGFR3 antibody comprises a heavy chain variable region comprising SEQ ID NO:136 and a light chain variable region.
- the anti-FGFR3 antibody comprises a light chain variable region comprising SEQ ID NO: 137, and a heavy chain variable region.
- the anti-FGFR3 antibody comprises a heavy chain variable region comprising SEQ ID NO:136 and a light chain variable region comprising SEQ ID NO:137.
- the anti-FGFR3 antibody comprises a heavy chain variable region comprising SEQ ID NO:138 and a light chain variable region.
- the anti-FGFR3 antibody comprises a light chain variable region comprising SEQ ID NO: 139, and a heavy chain variable region.
- the anti-FGFR3 antibody comprises a heavy chain variable region comprising SEQ ID NO:138 and a light chain variable region comprising SEQ ID NO:139.
- the anti-FGFR3 antibody comprises: at least one, two, three, four, five, and/or six hypervariable region (HVR) sequences selected from the group consisting of:
- HVR-L1 comprising sequence SASSSVSYMH (SEQ ID NO:155), SASSSVSYMH (SEQ ID NO:156) or LASQTIGTWLA (SEQ ID NO:157),
- HVR-L2 comprising sequence TWIYDTSILAS (SEQ ID NO:158), RWIYDTSKLAS (SEQ ID NO:159), or LLIYAATSLAD (SEQ ID NO:160),
- HVR-L3 comprising sequence QQWTSNPLT (SEQ ID NO:161), QQWSSYPPT (SEQ ID NO:162), or QQLYSPPWT (SEQ ID NO:163),
- HVR-H1 comprising sequence GYSFTDYNMY (SEQ ID NO:164), GYVFTHYNMY (SEQ ID NO:165), or GYAFTSYNMY (SEQ ID NO:166),
- HVR-H2 comprising sequence WIGYIEPYNGGTSYNQKFKG (SEQ ID NO:167), WIGYIEPYNGGTSYNQKFKG (SEQ ID NO:168), or WIGYIDPYIGGTSYNQKFKG (SEQ ID NO:169), and
- HVR-H3 comprising sequence ASPNYYDSSPFAY (SEQ ID NO:170), ARGQGPDFDV (SEQ ID NO:171), or ARWGDYDVGAMDY (SEQ ID NO:172).
- the anti-FGFR3 antibody comprises: at least one, two, three, four, five, and/or six hypervariable region (HVR) sequences selected from the group consisting of:
- HVR-L1 comprising sequence SASSSVSYMH (SEQ ID NO:155),
- HVR-L2 comprising sequence TWIYDTSILAS (SEQ ID NO:158),
- HVR-L3 comprising sequence QQWTSNPLT (SEQ ID NO:161),
- HVR-H1 comprising sequence GYSFTDYNMY (SEQ ID NO:164),
- HVR-H2 comprising sequence WIGYIEPYNGGTSYNQKFKG (SEQ ID NO:167), and
- HVR-H3 comprising sequence ASPNYYDSSPFAY (SEQ ID NO:170).
- the anti-FGFR3 antibody comprises: at least one, two, three, four, five, and/or six hypervariable region (HVR) sequences selected from the group consisting of:
- HVR-L1 comprising sequence SASSSVSYMH (SEQ ID NO:156),
- HVR-L2 Comprising sequence RWIYDTSKLAS (SEQ ID NO:159),
- HVR-L3 comprising sequence QQWSSYPPT (SEQ ID NO:162)
- HVR-H1 comprising sequence GYVFTHYNMY (SEQ ID NO:165),
- HVR-H2 comprising sequence WIGYIEPYNGGTSYNQKFKG (SEQ ID NO:168), and
- HVR-H3 comprising sequence ARGQGPDFDV (SEQ ID NO:171).
- the anti-FGFR3 antibody comprises: at least one, two, three, four, five, and/or six hypervariable region (HVR) sequences selected from the group consisting of:
- HVR-L1 comprising sequence LASQTIGTWLA (SEQ ID NO:157),
- HVR-L2 comprising sequence LLIYAATSLAD (SEQ ID NO:160),
- HVR-L3 comprising sequence QQLYSPPWT (SEQ ID NO:163),
- HVR-H1 comprising sequence GYAFTSYNMY (SEQ ID NO:166),
- HVR-H2 comprising sequence WIGYIDPYIGGTSYNQKFKG (SEQ ID NO:169), and
- HVR-H3 comprising sequence ARWGDYDVGAMDY (SEQ ID NO:172).
- the anti-FGFR3 antibody comprises (a) a light chain comprising (i) HVR-L1 comprising sequence SASSSVSYMH (SEQ ID NO:155); (ii) HVR-L2 comprising sequence TWIYDTSILAS (SEQ ID NO:158); and (iii) HVR-L3 comprising sequence QQWTSNPLT (SEQ ID NO:161); and/or (b) a heavy chain comprising (i) HVR-H1 comprising sequence GYSFTDYNMY (SEQ ID NO:164); (ii) HVR-H2 comprising sequence WIGYIEPYNGGTSYNQKFKG (SEQ ID NO:167); and (iii) HVR-H3 comprising sequence ASPNYYDSSPFAY (SEQ ID NO:170).
- the anti-FGFR3 antibody comprises (a) a light chain comprising (i) HVR-L1 comprising sequence SASSSVSYMH (SEQ ID NO:156); (ii) HVR-L2 comprising sequence RWIYDTSKLAS (SEQ ID NO:159); and (iii) HVR-L3 comprising sequence QQWSSYPPT (SEQ ID NO:162); and/or (b) a heavy chain comprising (i) HVR-H1 comprising sequence GYVFTHYNMY (SEQ ID NO:165); (ii) HVR-H2 comprising sequence WIGYIEPYNGGTSYNQKFKG (SEQ ID NO:168); and (iii) HVR-H3 comprising sequence ARGQGPDFDV (SEQ ID NO:171).
- the anti-FGFR3 antibody comprises (a) a light chain comprising (i) HVR-L1 comprising sequence LASQTIGTWLA (SEQ ID NO:157); (ii) HVR-L2 comprising sequence LLIYAATSLAD (SEQ ID NO:160); and (iii) HVR-L3 comprising sequence QQLYSPPWT (SEQ ID NO:163); and/or (b) a heavy chain comprising (i) HVR-H1 comprising sequence GYAFTSYNMY (SEQ ID NO:166); (ii) HVR-H2 comprising sequence WIGYIDPYIGGTSYNQKFKG (SEQ ID NO:169); and (iii) HVR-H3 comprising sequence ARWGDYDVGAMDY (SEQ ID NO:172).
- antibodies of the invention comprise a light chain variable domain of humanized 4D5 antibody (huMAb4D5-8) (HERCEPTIN®, Genentech, Inc., South San Francisco, Calif., USA) (also referred to in U.S. Pat. No. 6,407,213 and Lee et al., J. Mol. Biol. (2004), 340(5):1073-1093) as depicted in SEQ ID NO:173 below.
- huMAb4D5-8 humanized 4D5 antibody
- HERCEPTIN® Genentech, Inc., South San Francisco, Calif., USA
- the huMAb4D5-8 light chain variable domain sequence is modified at one or more of positions 30, 66, and 91 (Asn, Arg, and His as indicated in bold/italics above
- the modified huMAb4D5-8 sequence comprises Ser in position 30, Gly in position 66, and/or Ser in position 91.
- an antibody of the invention comprises a light chain variable domain comprising the sequence depicted in SEQ ID NO:174 below:
- Antibodies of the invention can comprise any suitable framework variable domain sequence, provided binding activity to FGFR3 is substantially retained.
- antibodies of the invention comprise a human subgroup III heavy chain framework consensus sequence.
- the framework consensus sequence comprises a substitution at position 71, 73, and/or 78.
- position 71 is A
- 73 is T
- /or 78 is A.
- these antibodies comprise heavy chain variable domain framework sequences of huMAb4D5-8 (HERCEPTIN®, Genentech, Inc., South San Francisco, Calif., USA) (also referred to in U.S. Pat. Nos. 6,407,213 & 5,821,337, and Lee et al., J.
- these antibodies further comprise a human ⁇ I light chain framework consensus sequence.
- these antibodies comprise light chain HVR sequences of huMAb4D5-8 as described in U.S. Pat. Nos. 6,407,213 & 5,821,337.)
- these antibodies comprise light chain variable domain sequences of huMAb4D5-8 (HERCEPTIN®, Genentech, Inc., South San Francisco, Calif., USA) (also referred to in U.S. Pat. Nos. 6,407,213 & 5,821,337, and Lee et al., J. Mol. Biol. (2004), 340(5):1073-1093).
- an antibody of the invention comprises a heavy chain variable domain, wherein the framework sequence comprises the sequence of SEQ ID NOS:19 and 203-205, 20 and 206-208, 21 and 209-211, 22 and 212-214, 23 and 215-217, 24 and 218-220, 25 and 221-223, 26 and 224-226, 27 and 227-229, 28 and 230-232, 29 and 233-235, 30 and 236-238, 31 and 239-241, 32 and 242-244, 33 and 245-247, 34 and 248-250, 35 and 251-253, 36 and 254-256, and/or 37 and 257-259, and HVR H1, H2, and H3 sequences are SEQ ID NOS:13, 14 and/or 15, respectively.
- the framework sequence comprises the sequence of SEQ ID NOS:19 and 203-205, 20 and 206-208, 21 and 209-211, 22 and 212-214, 23 and 215-217, 24 and 218-220, 25 and 221-223, 26 and 224-226, 27 and 227-229, 28
- the framework sequence comprises the sequence of SEQ ID NOS: 19 and 203-205, 20 and 206-208, 21 and 209-211, 22 and 212-214, 23 and 215-217, 24 and 218-220, 25 and 221-223, 26 and 224-226, 27 and 227-229, 28 and 230-232, 29 and 233-235, 30 and 236-238, 31 and 239-241, 32 and 242-244, 33 and 245-247, 34 and 248-250, 35 and 251-253, 36 and 254-256, and/or 37 and 257-259, and HVR H1, H2, and H3 sequences are SEQ ID NOS:48, 49 and/or 50, respectively.
- the framework sequence comprises the sequence of SEQ ID NOS: 19 and 203-205, 20 and 206-208, 21 and 209-211, 22 and 212-214, 23 and 215-217, 24 and 218-220, 25 and 221-223, 26 and 224-226, 27 and 227-229, 28 and 230-232, 29 and 233-235, 30 and 236-238, 31 and 239-241, 32 and 242-244, 33 and 245-247, 34 and 248-250, 35 and 251-253, 36 and 254-256, and/or 37 and 257-259, and HVR H1, H2, and H3 sequences are SEQ ID NOS:84, 85, and/or 86, respectively.
- the framework sequence comprises the sequence of SEQ ID NOS: 19 and 203-205, 20 and 206-208, 21 and 209-211, 22 and 212-214, 23 and 215-217, 24 and 218-220, 25 and 221-223, 26 and 224-226, 27 and 227-229, 28 and 230-232, 29 and 233-235, 30 and 236-238, 31 and 239-241, 32 and 242-244, 33 and 245-247, 34 and 248-250, 35 and 251-253, 36 and 254-256, and/or 37 and 257-259, and HVR H1, H2, and H3 sequences are SEQ ID NOS:108, 109, and/or 110, respectively.
- an antibody of the invention comprises a light chain variable domain, wherein the framework sequence comprises the sequence of SEQ ID NOS:38 and 260-262, 39 and 263-265, 40 and 266-268, and/or 41 and 269-271, and HVR L1, L2, and L3 sequences are SEQ ID NOS:16, 17, and/or 18, respectively.
- an antibody of the invention comprises a light chain variable domain, wherein the framework sequence comprises the sequence of SEQ ID NOS: 38 and 260-262, 39 and 263-265, 40 and 266-268, and/or 41 and 269-271, and HVR L1, L2, and L3 sequences are SEQ ID NOS:51, 52 and/or 53, respectively.
- an antibody of the invention comprises a light chain variable domain, wherein the framework sequence comprises the sequence of SEQ ID NOS: 38 and 260-262, 39 and 263-265, 40 and 266-268, and/or 41 and 269-271, and HVR L1, L2, and L3 sequences are SEQ ID NOS:87, 88 and/or 89, respectively.
- an antibody of the invention comprises a light chain variable domain, wherein the framework sequence comprises the sequence of SEQ ID NOS: 38 and 260-262, 39 and 263-265, 40 and 266-268, and/or 41 and 269-271, and HVR L1, L2, and L3 sequences are SEQ ID NOS:111, 112, and/or 113, respectively.
- an antibody of the invention comprises a heavy chain variable domain comprising the sequence of SEQ ID NO:132 and/or a light chain variable domain comprising the sequence of SEQ ID NO:133. In another aspect, an antibody of the invention comprises a heavy chain variable domain comprising the sequence of SEQ ID NO:134 and/or a light chain variable domain comprising the sequence of SEQ ID NO:135. In another aspect, an antibody of the invention comprises a heavy chain variable domain comprising the sequence of SEQ ID NO:136 and/or a light chain variable domain comprising the sequence of SEQ ID NO:137. In another aspect, an antibody of the invention comprises a heavy chain variable domain comprising the sequence of SEQ ID NO:138 and/or a light chain variable domain comprising the sequence of SEQ ID NO:139.
- the invention provides an anti-FGFR3 antibody that binds a polypeptide comprising, consisting essentially of or consisting of the following amino acid sequence: LAVPAANTVRFRCPA (SEQ ID NO:179) and/or SDVEFHCKVYSDAQP (SEQ ID NO:180).
- the antibody binds a polypeptide comprising, consisting essentially of or consisting of amino acid numbers 164-178 and/or 269-283 of human FGFR3.
- an anti-FGFR3 antibody of the invention specifically binds an amino acid sequence having at least 50%, 60%, 70%, 80%, 90%, 95%, 98% sequence identity or similarity with the sequence LAVPAANTVRFRCPA (SEQ ID NO:179) and/or SDVEFHCKVYSDAQP (SEQ ID NO:180).
- the anti-FGFR3 antibody of the present invention binds to at least one, two, three, four, or any number up to all of residues 154, 155, 158, 159, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 177, 202, 205, 207, 210, 212, 214, 216, 217, 241, 246, 247, 248, 278, 279, 280, 281, 282, 283, 314, 315, 316, 317 and/or 318 of FGFR3-IIIb polypeptide, or equivalent residues of FGFR3-IIIc polypeptide.
- One of ordinary skill in the art understands how to align FGFR3 sequences in order identify corresponding residues between respective FGFR3 sequences.
- Combinations of two or more residues can include any of residues 154, 155, 158, 159, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 177, 202, 205, 207, 210, 212, 214, 216, 217, 241, 246, 247, 248, 278, 279, 280, 281, 282, 283, 314, 315, 316, 317 and/or 318, or mixtures thereof, of FGFR3-IIIb polypeptide, or equivalent residues of FGFR3-IIIc polypeptide.
- the anti-FGFR3 antibody binds to at least one, two, three, four, or any number up to all of residues 158, 159, 169, 170, 171, 173, 175, 205, 207, and/or 315, or mixtures thereof, of FGFR3-IIIb polypeptide, or equivalent residues of FGFR3-IIIc polypeptide. In some embodiments, the anti-FGFR3 antibody binds to at least one, two three, four, or any number up to all of residues 158, 170, 171, 173, 175, and/or 315, or mixtures thereof, of FGFR3-IIIb polypeptide, or equivalent residues of FGFR3-IIIc polypeptide.
- the invention provides methods of screening for a candidate inhibitor substance that inhibits FGFR3 activity, said method comprising: detecting binding, if any, of the candidate substance to a FGFR3 binding site, wherein the candidate substance is identified by a method comprising comparing amount of FGFR3 activity in a sample with amount of FGFR3 activity in a reference sample comprising similar amounts of FGFR3 as the first sample but that has not been contacted with said candidate substance, whereby a decrease in amount of FGFR3 activity in the first sample compared to the reference sample indicates that the candidate substance is capable of inhibiting FGFR3 activity.
- the invention provides methods of screening for a candidate inhibitory substance that inhibits FGFR3 activation, the method comprising screening for a candidate inhibitory substance that binds FGFR3 binding site and inhibits FGFR3 activity.
- the methods comprising selecting for a substance that binds to at least one, two, three, four, or any number up to all of residues 158, 170, 171, 173, 175, and/or 315 of the sequence of FGFR3-IIIb polypeptide, or equivalent residues of FGFR3-IIIc polypeptide.
- the methods comprising selecting for a substance that binds to at least one, two, three, four, or any number up to all of residues 154, 155, 158, 159, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 177, 202, 205, 207, 210, 212, 214, 216, 217, 241, 246, 247, 248, 278, 279, 280, 281, 282, 283, 314, 315, 316, 317, 318 of the sequence of FGFR3-IIIb polypeptide, or equivalent residues of FGFR3-IIIc polypeptide.
- the sample comprises FGFR3 and FGFR3 ligand (such as FGF1 or FGF9).
- the sample comprises a mammalian cell expressing FGFR3.
- the FGFR3 is transgenically expressed.
- the sample comprises a Ba/FC cell expressing FGFR3.
- FGFR3 activity comprises FGF (such as FGF1 and/or FGF9) binding, FGFR3 downstream molecular signaling, FGFR3 phosphorylation, FGFR3 binding to a ligand (e.g., FGF1, FGF9), FGFR3 dimerization, promotion of formation of monomeric FGFR3, and/or treatment and/or prevention of a tumor, cell proliferative disorder or a cancer; and/or treatment or prevention of a disorder associated with FGFR3 expression and/or activity (such as increased FGFR3 expression and/or activity).
- FGF such as FGF1 and/or FGF9 binding
- FGFR3 downstream molecular signaling such as FGF1 and/or FGF9 binding to a ligand (e.g., FGF1, FGF9), FGFR3 dimerization
- FGF1, FGF9 FGFR3 dimerization
- promotion of formation of monomeric FGFR3 and/or treatment and/or prevention of a tumor, cell proliferative
- decrease in amount of FGFR3 activity is reduction or blocking of FGF (such as FGF1 and/or FGF9) binding to FGFR3, reduction or blocking of FGFR3 activation, reduction or blocking of FGFR3 downstream molecular signaling), reduction or blocking of FGFR3 dimerization and/or treatment and/or prevention of a tumor, cell proliferative disorder or a cancer; and/or treatment or prevention of a disorder associated with FGFR3 expression and/or activity (such as increased FGFR3 expression and/or activity).
- FGF such as FGF1 and/or FGF9
- the invention also provides an antagonist molecule that inhibits FGFR3, wherein the molecule binds to at least one, two, three, four, or any number up to all of residues 158, 170, 171, 173, 175, and/or 315 of the sequence of FGFR3-IIIb polypeptide, or equivalent residues of FGFR3-IIIc polypeptide.
- the antagonist molecule binds to at least one, two, three, four, or any number up to all of residues 154, 155, 158, 159, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 177, 202, 205, 207, 210, 212, 214, 216, 217, 241, 246, 247, 248, 278, 279, 280, 281, 282, 283, 314, 315, 316, 317, 318 of the sequence of FGFR3-IIIb polypeptide, or equivalent residues of FGFR3-IIIc polypeptide.
- the antagonist molecule comprises an antibody.
- the invention also provides methods using the antagonist molecules, including treatment and diagnostic methods.
- the disclosure includes FGFR3 polypeptides and polynucleotides encoding the polypeptides.
- the disclosure includes a polynucleotide encoding a polypeptide and/or a polypeptide having at least 90% sequence identity to the polypeptide comprising sequence of amino acids 154-318 of human FGFR3, not including the polypeptide having the amino acid sequence of human FGFR3.
- the disclosure includes a polynucleotide encoding a polypeptide and/or a polypeptide having at least 90% sequence identity to the polypeptide comprising any of amino acid residue 154 to amino acid residue 177, amino acid residue 202 to amino acid reside 217, amino acid residue 241 to amino acid residue 248, amino acid residue 278 to amino acid residue 283 and/or amino acid residue 314 to amino acid residue 318 FGFR3, not including the polypeptide comprising the amino acid sequence of FGFR3.
- the polypeptide binds a human FGFR3 ligand (such as FGF1 or FGF9).
- FIGS. 1A , 1 B and 1 C Heavy chain and light chain HVR loop sequences of anti-FGFR3 antibodies.
- the figures show the heavy chain HVR sequences, H1, H2, and H3, and light chain HVR sequences, L1, L2, and L3. Sequence numbering is as follows:
- Amino acid positions are numbered according to the Kabat numbering system as described below.
- FIGS. 2A and 2B depict (A) the amino acid sequences of the heavy chain variable regions and light chain variable regions of anti-FGFR3 antibodies 184.6.1.N54S, 184.6.58, and 184.6.62; and (B) the hypervariable regions of anti-FGFR3 antibodies 1G6, 6G1, and 15B2.
- FIGS. 3A , 3 B, and 4 depict exemplary acceptor human consensus framework sequences for use in practicing the instant invention with sequence identifiers as follows:
- VH Variable Heavy Consensus Frameworks
- human VH subgroup I consensus framework minus Kabat CDRs (SEQ ID NOS:19 and 203-205) human VH subgroup I consensus framework minus extended hypervariable regions (SEQ ID NOS:20 and 206-208, 21 and 209-211, 22 and 212-214) human VH subgroup II consensus framework minus Kabat CDRs (SEQ ID NOS:23 and 215-217) human VH subgroup II consensus framework minus extended hypervariable regions (SEQ ID NOS:24 and 218-220, 25 and 221-223, 26 and 224-226) human VH subgroup II consensus framework minus extended human VH subgroup III consensus framework minus Kabat CDRs (SEQ ID NOS:27 and 227-229) human VH subgroup III consensus framework minus extended hypervariable regions (SEQ ID NOS:28 and 230-232, 29 and 233-235, 30 and 236-238) human VH acceptor framework minus Kabat CDRs (SEQ ID NOS:31 and 239-241) human VH acceptor framework minus extended
- VL Variable Light
- human VL kappa subgroup I consensus framework (SEQ ID NO:38 and 260-262) human VL kappa subgroup II consensus framework (SEQ ID NO:39 and 263-265) human VL kappa subgroup III consensus framework (SEQ ID NO:40 and 266-268) human VL kappa subgroup IV consensus framework (SEQ ID NO:41 and 269-271)
- FIG. 5 depicts framework region sequences of huMAb4D5-8 light (SEQ ID NOS:42-45) and heavy chains (SEQ ID NOS:46, 47, 175, 176). Numbers in superscript/bold indicate amino acid positions according to Kabat.
- FIG. 6 depicts modified/variant framework region sequences of huMAb4D5-8 light (SEQ ID NOS:42, 43, 177, 45) and heavy chains (SEQ ID NOS:46, 47, 178, and 176). Numbers in superscript/bold indicate amino acid positions according to Kabat.
- FIG. 7 FGFR3 knockdown in bladder cancer cell RT112 inhibits proliferation and induces G1 cell cycle arrest in vitro, and suppresses tumor growth in vivo.
- Three different FGFR3 shRNAs were cloned into a Tet-inducible expression vector.
- RT112 cells stably expressing FGFR3 shRNAs or a control shRNA were established with puromycin selection.
- A Representative blots showing FGFR3 expression in selected clones treated with or without doxycycline (Dox, 0, 0.1 and 1 ⁇ g/ml, left to right).
- B [ 3 H]-thymidine incorporation by RT112 stable cells.
- RT112 stable clones were cultured with or without 1 ⁇ g/ml doxycycline for 3 days prior to 16 hour-incubation with [ 3 H]-thymidine (1 ⁇ Ci per well). Counts of incorporated [ 3 H]-thymidine were normalized to that from cells without doxycycline induction. Error bars represent SEM.
- C DNA fluorescence flow cytometry histograms of RT112 stable cells. RT112 clones expressing control shRNA or FGFR3 shRNA4 were cultured with or without 1 ⁇ g/ml doxycycline for 72 hours, and the nuclei were stained with propidium iodide (PI).
- PI propidium iodide
- FIG. 8 R3Mab blocks FGF/FGFR3 interaction.
- A Selective binding of human FGFR3 by R3Mab. Human FGFR1-4 Fc chimeric proteins were immobilized and incubated with increasing amount of R3Mab. Specific binding was detected using an anti-human Fab antibody.
- B-C Blocking of FGF1 binding to human FGFR3-IIIb (B) or IIIc (C) by R3Mab. Specific binding was detected by using a biotinylated FGF1-specific polyclonal antibody.
- D-E Blocking of FGF9 binding to human FGFR3-IIIb (D) or IIIc (E) by R3Mab. Specific binding was detected by using a biotinylated FGF9-specific polyclonal antibody. Error bars represent standard error of the mean (SEM) and are sometimes smaller than symbols.
- FIG. 9 R3Mab inhibits Ba/F3 cell proliferation driven by wild type and mutated FGFR3.
- A Inhibitory effect of R3Mab on the viability of Ba/F3 cells expressing wild type human FGFR3-IIIb.
- Cells were cultured in medium without FGF1 (no FGF1), or in the presence of 10 ng/ml FGF1 plus 10 ⁇ g/ml heparin alone (FGF1), or in combination with a control antibody (Control) or R3Mab. Cell viability was assessed with CellTiter-Glo (Promega) after 72 hr incubation with antibodies.
- TM transmembrane domain
- TK1 and TK2 tyrosine kinase domain 1 and 2.
- D-H Inhibitory effect of R3Mab on the viability of Ba/F3 cells expressing cancer-associated FGFR3 mutants.
- G372C is derived from IIIc isoform, and the rest are derived from IIIb isoform.
- FIG. 10 Epitope mapping for R3Mab and crystal structure of the complex between R3Mab Fab fragment and IgD2-D3 of human FGFR3-IIIb.
- A Epitope determined by the binding of 13 peptides spanning IgD2-D3 of human FGFR3 to R3Mab. Each biotinylated peptide was captured onto streptavidin-coated microtiter well and incubated with R3Mab. Specifically bound R3Mab was detected using a goat anti-human IgG antibody.
- C Structure of R3Mab Fab (shown in ribbon-helix, light chain grey, heavy chain black) in complex with human FGFR3 IgD2-D3 (shown in molecular surface, white). Receptor residues involved in ligand binding and dimerization are colored in grey/crosshatched and dark grey respectively based on Plotnikov et al (34).
- D The close-up of the crystal structure shows that CDR-H3 and -H2 from the Fab constitute the major interaction sites with IgD2 and IgD3 of FGFR3.
- E Superposition of FGFR3-IIIc-FGF1 complex (PDB code 1RY7) with FGFR3-IIIb-Fab complex.
- FGFR3-IIIc and FGF1 are colored in grey and dark grey respectively.
- FGFR3-IIIb is shown in white and the Fab is shown in light grey for light chain, dark grey for heavy chain.
- IgD2 was used as the anchor for superposition. Note the well-superposed IgD2 from both structures and the new conformation adopted by IgD3 of FGFR3-IIIb when bound by R3Mab.
- PDB code 1RY7 Another representation of the superposition of FGFR3-IIIc-FGF1 complex (PDB code 1RY7) with FGFR3-IIIb-Fab complex.
- FGFR3-IIIc and FGF1 are shown as molecular surfaces that are grey/mesh texture and dark grey/dotted texture, respectively.
- FGFR3-IIIb is shown in white and the Fab is shown in grey for light chain, black for heavy chain.
- IgD2 was used as the anchor for superposition. Note the well-superposed IgD2 from both structures and the new conformation adopted by IgD3 of FGFR3-IIIb when bound by R3Mab.
- FIG. 11 R3Mab inhibits proliferation, clonal growth and FGFR3 signaling in bladder cancer cells expressing wild type or mutated FGFR3 S249C .
- A Inhibition of [ 3 H]-thymidine incorporation by R3Mab in bladder cancer cell line RT112. Error bars represent SEM.
- B Blocking of FGF1-activated FGFR3 signaling by R3Mab (15 ⁇ g/ml) in bladder cancer cell line RT112 as compared to treatment medium alone (Mock) or a control antibody (Ctrl).
- FIG. 12 R3Mab decreases steady-state level of disulfide-linked FGFR3 S249C dimer by driving the dimer-monomer equilibrium toward monomeric state.
- A Effect of R3Mab on FGFR3 S249C dimer in UMUC-14 cells. Cells were incubated with R3Mab (15 ⁇ g/ml) or a control antibody (Ctrl) for 3 hours, and whole cell lysates were analyzed by immunoblot under non-reducing and reducing conditions.
- B Effect of free-sulfhydryl blocker DTNB on FGFR3 S249C dimer-monomer equilibrium in UMUC-14 cells.
- UMUC-14 cells were treated with increasing concentration of DTNB for 3 hours, and cell lysates were analyzed as in (A).
- C Effect of R3Mab on purified recombinant FGFR3 S249C dimer in vitro.
- FGFR3 S249C dimer composed of IgD2-D3 was purified through size-exclusion column, and incubated with PBS (Mock), a control antibody (Ctrl), or R3Mab at 37° C. Samples were collected at indicated time for immunoblot analysis under non-reducing conditions.
- FGFR3 dimer-monomer was detected using anti-FGFR3 hybridoma antibody 6G1 (A-C).
- FIG. 13 R3Mab inhibits xenograft growth of bladder cancer cells and allograft growth of Ba/F3-FGFR3 S249C .
- B Inhibition of FGFR3 signaling in RT112 tumor tissues by R3Mab.
- E Effect of R3Mab on FGFR3 S249C dimer and signaling in UMUC-14 tumor tissues.
- FGFR3 dimer-monomer was detected using an anti-FGFR3 rabbit polyclonal antibody sc9007 to avoid interference from mouse IgG in tumor lysates. Error bars represent SEM.
- FIG. 14 ADCC contributes to the anti-tumor efficacy of R3Mab in t(4;14) positive multiple myeloma models.
- C-F Cytolysis of myeloma cell lines OPM2 (C) and KMS11 (D), or bladder cancer cell lines RT112 (E) and UMUC-14 (F) induced by R3Mab in cell culture.
- Myeloma or bladder cancer cells were incubated with freshly isolated human PBMC in the presence of R3Mab or a control antibody. Cytotoxicity was determined by measuring LDH released in the supernatant.
- FIG. 15 Knockdown of FGFR3 with siRNA inhibits cell proliferation of bladder cancer cell lines.
- Six to seven different FGFR3 siRNAs and three non-specific control siRNAs were designed and synthesized in Genentech.
- Bladder cancer cell lines RT112 (A), SW780 (B), RT4 (C) and UMUC-14 (D) were plated into 96-well plate (3000 cells per well) and allowed to attach overnight, and transiently transfected with 25 nM siRNA in complex with RNAiMax (Invitrogen).
- 72 hr post-transfection, [ 3 H]-thymidine (1 ⁇ Ci per well) was added to the culture (A, C, and D) for another 16 hour incubation.
- FIG. 16 FGFR3 knockdown in bladder cancer cell line RT112 induces G1 cell cycle arrest in vitro, and suppresses tumor growth in vivo.
- Three different FGFR3 RNAs were designed and cloned into a Tet-inducible shRNA expression retroviral vector.
- RT112 stable clones expressing FGFR3 shRNAs or control shRNA were established with puromycin selection.
- PI propidium iodide
- FIG. 17 Effect of anti-FGFR3 hybridoma antibodies 16G, 6G1 and 15B2 on Ba/F3 cell proliferation driven by wild type and mutated FGFR3.
- Anti-FGFR3 hybridoma antibodies were generated by immunizing BALB/c mice with human FGFR3-IIIb/Fc or human FGFR3-IIIc/Fc chimera.
- Fused hybridoma cells were selected using hypoxanthin-aminopterin-thymidine selection in Medium D from the ClonaCell® hybridoma selection kit (StemCell Technologies, Inc., Vancouver, BC, Canada).
- Hybridoma antibodies were sequentially screened for their ability to bind to FGFR3-IIIb and FGFR3-IIIc by ELISA and to recognize cell surface FGFR3 by FACS. Selected hybridomas were then cloned by limiting dilution. 16G, 6G1 and 15B2 are clones used to assess the effect on the proliferation of Ba/F3 cells expressing wild type or mutated FGFR3 similarly as described in FIG. 9A . Error bars represent SEM.
- FIG. 18 Comparison of R3Mab epitopes determined by peptide mapping and crystal structure analysis.
- A Epitope revealed by the structure of the R3Mab Fab fragment in complex with the extracellular IgD2-D3 segment of human FGFR3.
- FGFR3 residues contacted by Fab heavy chain and light chain are colored in black and grey, respectively.
- B Location of peptides 3 and 11 on FGFR3.
- FIG. 19 R3Mab inhibits proliferation and FGFR3 signaling in bladder cancer cells containing wild type or mutated FGFR3 S249C .
- A Inhibition of cell viability by R3Mab in bladder cancer cell line RT4. Cell viability was assessed with CellTiter-Glo (Promega) after 96 hr incubation with the antibody. Error bars represent SEM.
- B Blocking of FGF1-activated FGFR3 signaling by R3Mab (15 ug/ml) in bladder cancer cell line RT4.
- C Inhibition of [ 3 H]-thymidine incorporation by R3Mab in bladder cancer cell line RCC-97-7 (containing FGFR3 S249C ).
- FIG. 20 Effect of endocytosis inhibitors on the internalization of R3Mab and FGFR3 S249C dimer in UMUC-14 cells.
- A Effect of endocytosis inhibitors on the internalization of R3Mab.
- Cells were fixed and stained with Alexa 488-labeled anti-human IgG. Image was taken using confocal microscopy.
- chlorpromazine inhibitor of clathrin-mediated endocytosis
- genistein pan-inhibitor of endocytosis
- FIG. 21 Detection sensitivity of different anti-FGFR3 antibodies toward monomeric and dimeric FGFR3 S249C under non-reducing conditions.
- UMUC-14 cells were lysed after treatment with R3Mab (Lane 1), a control IgG1 (Lane 2), or PBS (Lane 3) for 3 hours, and cell lysates were subject to immunoblot analyses under reducing or non-reducing conditions.
- 6G1 murine hybridoma antibody generated at Genentech
- sc9007 rabbit polyclonal antibody, Santa Cruz Biotechnology
- sc13121 murine hybridoma antibody, Santa Cruz Biotechnology
- FIG. 22 Effect of R3Mab on the proliferation of t(4;14)+ multiple myeloma cells.
- A Inhibitory effect of R3Mab on [ 3 H]-thymidine incorporation by UTMC-2 cells.
- UTMC-2 cells were grown in medium containing R3Mab or a control antibody in the presence of 25 ng/ml FGF9 and 5 ug/ml heparin or heparin alone (No FGF9). After 6 days incubation, [ 3 H]-thymidine was added for 16 hr incubation. Data were normalized to that from cells grown in the absence of FGF9 and antibody.
- FIG. 23 Cell surface expression levels of FGFR3 in myeloma and bladder cancer cells.
- A Cell surface FGFR3 expression in myeloma cells and bladder cancer cells assessed by FACS analysis. Cells were stained with phycoerythin-conjugated mouse mAb against human FGFR3 (FAB766P, R&D Systems) or phycoerythin-conjugated isotype control mouse IgG1 (BD Pharmingen).
- B Scatchard analysis of FGFR3 density in myeloma cells and'bladder cancer cells. R3Mab was radioiodinated, and incubated with cells in suspension with excess unlabeled antibody. After incubation at RT for 2 hours, cells were pelleted by centrifugation and washed twice. Specifically bound 125 I was determined. Receptor density and binding affinity (Kd) represent the mean from two binding experiments.
- FIG. 24 Effect of R3Mab or its DANA mutant on xenograft growth of bladder carcinoma cells.
- A Effect of R3Mab and its DANA mutant (50 mg/kg each) on the growth of pre-established RT112 tumors.
- B Effect of R3Mab and its DANA mutant (50 mg/kg each) on the growth of pre-established UMUC-14 tumors. Error bars represent SEM.
- binding site refers to a region of a molecule or molecular complex that, as a result of its shape, distribution of electrostatic charge, presentation of hydrogen-bond acceptors or hydrogen-bond donors, and/or distribution of nonpolar regions, favorably associates with a ligand.
- a binding site may include or consist of features such as cavities, surfaces, or interfaces between domains.
- Ligands that may associate with a binding site include, but are not limited to, cofactors, substrates, receptors, agonists, and antagonists.
- binding site includes a functional binding site and/or a structural binding site.
- a structural binding site can include “in contact” amino acid residues as determined from examination of a three-dimensional structure.
- Contact can be determined using Van der Waals radii of atoms or by proximity sufficient to exclude solvent, typically water, from the space between the ligand and the molecule or molecular complex.
- a FGFR3 residue in contact with an anti-FGFR3 antibody (e.g., YW184.6) or other substrate or inhibitor is a residue that has one atom within about 5 ⁇ of an anti-FGFR3 antibody residue.
- “in contact” residue may be those that have a loss of solvent accessible surface area of at least about 10 ⁇ and, more preferably at least about 50 ⁇ to about 300 ⁇ . Loss of solvent accessible surface can be determined by the method of Lee & Richards (J Mol Biol. 1971 Feb. 14; 55(3):379-400) and similar algorithms known to those skilled in the art, for instance as found in the SOLV module from C. Broger of F. Hoffman-La Roche in Basel Switzerland.
- a functional binding site includes amino acid residues that are identified as binding site residues based upon loss or gain of function, for example, loss of binding to ligand upon mutation of the residue.
- the amino acid residues of a functional binding site are a subset of the amino acid residues of the structural binding site.
- FGFR3 binding site refers to a region of FGFR3 that can favorably associate with a ligand.
- the FGFR3 binding site may comprise, consist essentially of, or consist of one or more of the amino acid residues 154, 155, 158, 159, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 177, 202, 205, 207, 210, 212, 214, 216, 217, 241, 246, 247, 248, 278, 279, 280, 281, 282, 283, 314, 315, 316, 317 and/or 318 of FGFR3-IIIb polypeptide (e.g., human FGFR3-IIIb disclosed in UniProKB/Swiss-Prot accession number P22607 — 2), and mixtures thereof, or equivalent residues of FGFR3-IIIc polypeptide (e.g.,
- the FGFR3 binding site may comprise, consist essentially of, or consist of one or more of the amino acid residues 158, 159, 169, 170, 171, 173, 175, 205, 207, and/or 315 of FGFR3-IIIb polypeptide, and mixtures thereof, or equivalent residues of FGFR3-IIIc polypeptide.
- the FGFR3 binding site may comprise, consist essentially of, or consist of one or more of the amino acid residues 158, 170, 171, 173, 175, and/or 315, or mixtures thereof, of FGFR3-IIIb polypeptide, or equivalent residues of FGFR3-IIIc polypeptide.
- a structurally equivalent ligand binding site is defined by a root mean square deviation from the structure coordinates of the backbone atoms of the amino acids that make up binding sites in FGFR3 for anti-FGFR3 antibody YW184.6 of at most about 0.70 ⁇ , preferably about 5 ⁇ .
- Crystal refers to one form of a solid state of matter in which atoms are arranged in a pattern that repeats periodically in three-dimensions, typically forming a lattice.
- “Complementary or complement” as used herein, means the fit or relationship between two molecules that permits interaction, including for example, space, charge, three-dimensional configuration, and the like.
- corresponding refers to an amino acid residue or amino acid sequence that is found at the same position or positions in a sequence when the amino acid position or sequences, are aligned with a reference sequence.
- the reference sequence is a human FGFR3-IIIb disclosed in UniProKB/Swiss-Prot accession number P22607 — 2) or a human FGFR3-IIIc disclosed in UniProKB/Swiss-Prot accession number P22607. It will be appreciated that when the amino acid position or sequence is aligned with the reference sequence the numbering of the amino acids may differ from that of the reference sequence.
- Heavy atom derivative means a derivative produced by chemically modifying a crystal with a heavy atom such as Hg, Au, or a halogen.
- “Structural homolog” of FGFR3 as used herein refers to a protein that contains one or more amino acid substitutions, deletions, additions, or rearrangements with respect to the amino acid sequence of FGFR3, but that, when folded into its native conformation, exhibits or is reasonably expected to exhibit at least a portion of the tertiary (three-dimensional) structure of the FGFR3.
- a portion of the three dimensional structure refers to structural domains of the FGFR3, including the an extracellular ligand binding region, with two or three immunoglobulin-like domains (IgD1-3), a single-pass transmembrane region, and a cytoplasmic, split tyrosine kinase domain.
- Homolog tertiary structure can be probed, measured, or confirmed by known analytic or diagnostic methods, for example, X-ray, NMR, circular dichroism, a panel of monoclonal antibodies that recognize native FGFR3, and like techniques.
- structurally homologous molecules can have substitutions, deletions or additions of one or more contiguous or noncontiguous amino acids, such as a loop or a domain.
- Structurally homologous molecules also include “modified” FGFR3 molecules that have been chemically or enzymatically derivatized at one or more constituent amino acid, including side chain modifications, backbone modifications, and N- and C-terminal modifications including acetylation, hydroxylation, methylation, amidation, and the attachment of carbohydrate or lipid moieties, cofactors, and like modifications.
- Molecular complex refers to a combination of bound substrate or ligand with polypeptide, such as an antibody bound to FGFR3, or a ligand bound to FGFR3.
- Machine-readable data storage medium means a data storage material encoded with machine-readable data, wherein a machine programmed with instructions for using such data and is capable of displaying data in the desired format, for example, a graphical three-dimensional representation of molecules or molecular complexes.
- Scalable means the increasing or decreasing of distances between coordinates (configuration of points) by a scalar factor while keeping the angles essentially the same.
- Space group symmetry means the whole symmetry of the crystal that combines the translational symmetry of a crystalline lattice with the point group symmetry.
- a space group is designated by a capital letter identifying the lattice type (P, A, F, etc.) followed by the point group symbol in which the rotation and reflection elements are extended to include screw axes and glide planes. Note that the point group symmetry for a given space group can be determined by removing the cell centering symbol of the space group and replacing all screw axes by similar rotation axes and replacing all glide planes with mirror planes. The point group symmetry for a space group describes the true symmetry of its reciprocal lattice.
- Unit cell means the atoms in a crystal that are arranged in a regular repeating pattern, in which the smallest repeating unit is called the unit cell.
- the entire structure can be reconstructed from knowledge of the unit cell, which is characterized by three lengths (a, b and c) and three angles ( ⁇ , ⁇ and ⁇ ).
- the quantities a and b are the lengths of the sides of the base of the cell and ⁇ is the angle between these two sides.
- the quantity c is the height of the unit cell.
- the angles ⁇ and ⁇ describe the angles between the base and the vertical sides of the unit cell.
- X-ray diffraction pattern means the pattern obtained from X-ray scattering of the periodic assembly of molecules or atoms in a crystal.
- X-ray crystallography is a technique that exploits the fact that X-rays are diffracted by crystals. X-rays have the proper wavelength (in the ⁇ ngström ( ⁇ ) range, approximately 10-8 cm) to be scattered by the electron cloud of an atom of comparable size.
- the electron density can be reconstructed. Additional phase information can be extracted either from the diffraction data or from supplementing diffraction experiments to complete the reconstruction (the phase problem in crystallography). A model is then progressively built into the experimental electron density, refined against the data to produce an accurate molecular structure.
- X-ray structure coordinates define a unique configuration of points in space.
- a set of structure coordinates for a protein or a protein/ligand complex, or a portion thereof define a relative set of points that, in turn, define a configuration in three dimensions.
- a similar or identical configuration can be defined by an entirely different set of coordinates, provided the distances and angles between coordinates remain essentially the same.
- a configuration of points can be defined by increasing or decreasing the distances between coordinates by a scalar factor, while keeping the angles essentially the same.
- Crystal structure generally refers to the three-dimensional or lattice spacing arrangement of repeating atomic or molecular units in a crystalline material.
- the crystal structure of a crystalline material can be determined by X-ray crystallographic methods, see for example, “Principles of Protein X-Ray Crystallography,” by Jan Drenth, Springer Advanced Texts in Chemistry, Springer Verlag; 2nd ed., February 1999, ISBN: 0387985875, and “Introduction to Macromolecular Crystallography,” by Alexander. McPherson, Wiley-Liss, Oct. 18, 2002, ISBN: 0471251224.
- variable domain residue numbering as in Kabat or “amino acid position numbering as in Kabat,” and variations thereof, refers to the numbering system used for heavy chain variable domains or light chain variable domains of the compilation of antibodies in Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991). Using this numbering system, the actual linear amino acid sequence may contain fewer or additional amino acids corresponding to a shortening of, or insertion into, a FR or CDR of the variable domain.
- a heavy chain variable domain may include a single amino acid insert (residue 52a according to Kabat) after residue 52 of H2 and inserted residues (e.g. residues 82a, 82b, and 82c, etc according to Kabat) after heavy chain FR residue 82.
- the Kabat numbering of residues may be determined for a given antibody by alignment at regions of homology of the sequence of the antibody with a “standard” Kabat numbered sequence.
- the phrase “substantially similar,” or “substantially the same,” as used herein, denotes a sufficiently high degree of similarity between two numeric values (generally one associated with an antibody of the invention and the other associated with a reference/comparator antibody) such that one of skill in the art would consider the difference between the two values to be of little or no biological and/or statistical significance within the context of the biological characteristic measured by said values (e.g., Kd values).
- the difference between said two values is preferably less than about 50%, preferably less than about 40%, preferably less than about 30%, preferably less than about 20%, preferably less than about 10% as a function of the value for the reference/comparator antibody.
- Binding affinity generally refers to the strength of the sum total of noncovalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Unless indicated otherwise, as used herein, “binding affinity” refers to intrinsic binding affinity which reflects a 1:1 interaction between members of a binding pair (e.g., antibody and antigen). The affinity of a molecule X for its partner Y can generally be represented by the dissociation constant (Kd).
- the Kd is 1 ⁇ 10 ⁇ 7 , 1 ⁇ 10 ⁇ 8 , 5 ⁇ 10 ⁇ 8 , 1 ⁇ 10 ⁇ 9 , 3 ⁇ 10 ⁇ 9 , 5 ⁇ 10 ⁇ 9 , or even 1 ⁇ 10 ⁇ 10 or stronger.
- Affinity can be measured by common methods known in the art, including those described herein. Low-affinity antibodies generally bind antigen slowly and tend to dissociate readily, whereas high-affinity antibodies generally bind antigen faster and tend to remain bound longer. A variety of methods of measuring binding affinity are known in the art, any of which can be used for purposes of the present invention. Specific illustrative embodiments are described in the following.
- the “Kd” or “Kd value” according to this invention is measured by a radiolabeled antigen binding assay (RIA) performed with the Fab version of an antibody of interest and its antigen as described by the following assay that measures solution binding affinity of Fabs for antigen by equilibrating Fab with a minimal concentration of ( 125 I)-labeled antigen in the presence of a titration series of unlabeled antigen, then capturing bound antigen with an anti-Fab antibody-coated plate (Chen, et al., (1999) J. Mol. Biol. 293:865-881).
- RIA radiolabeled antigen binding assay
- microtiter plates (Dynex) are coated overnight with 5 ⁇ g/ml of a capturing anti-Fab antibody (Cappel Labs) in 50 mM sodium carbonate (pH 9.6), and subsequently blocked with 2% (w/v) bovine serum albumin in PBS for two to five hours at room temperature (approximately 23° C.).
- a non-adsorbant plate (Nunc #269620) 100 pM or 26 pM [ 125 I]-antigen are mixed with serial dilutions of a Fab of interest (e.g., consistent with assessment of an anti-VEGF antibody, Fab-12, in Presta et al., (1997) Cancer Res.
- the Fab of interest is then incubated overnight; however, the incubation may continue for a longer period (e.g., 65 hours) to insure that equilibrium is reached. Thereafter, the mixtures are transferred to the capture plate for incubation at room temperature (e.g., for one hour). The solution is then removed and the plate washed eight times with 0.1% Tween-20 in PBS. When the plates have dried, 150 ⁇ l/well of scintillant (MicroScint-20; Packard) is added, and the plates are counted on a Topcount gamma counter (Packard) for ten minutes. Concentrations of each Fab that give less than or equal to 20% of maximal binding are chosen for use in competitive binding assays.
- the Kd or Kd value is measured by using surface plasmon resonance assays using a BIAcoreTM-2000 or a BIAcoreTM-3000 (BIAcore, Inc., Piscataway, N.J.) at 25° C. with immobilized antigen CM5 chips at ⁇ 10 response units (RU).
- CM5 carboxymethylated dextran biosensor chips
- EDC N-ethyl-N′-(3-dimethylaminopropyl)-carbodiimide hydrochloride
- NHS N-hydroxysuccinimide
- Antigen is diluted with 10 mM sodium acetate, pH 4.8, into 5 ⁇ g/ml ( ⁇ 0.2 ⁇ M) before injection at a flow rate of 5 ⁇ l/minute to achieve approximately 10 response units (RU) of coupled protein. Following the injection of antigen, 1M ethanolamine is injected to block unreacted groups. For kinetics measurements, two-fold serial dilutions of Fab (0.78 nM to 500 nM) are injected in PBS with 0.05% Tween 20 (PBST) at 25° C. at a flow rate of approximately 25 ⁇ l/min.
- PBST Tween 20
- the following modifications are used for the surface Plasmon resonance assay method: antibody is immobilized to CM5 biosensor chips to achieve approximately 400 RU, and for kinetic measurements, two-fold serial dilutions of target protein (e.g., FGFR3-IIIb or -IIIc) (starting from 67 nM) are injected in PBST buffer at 25° C. with a flow rate of about 30 ul/minute. Association rates (k on ) and dissociation rates (k off ) are calculated using a simple one-to-one Langmuir binding model (BIAcore Evaluation Software version 3.2) by simultaneous fitting the association and dissociation sensorgram.
- target protein e.g., FGFR3-IIIb or -IIIc
- Association rates (k on ) and dissociation rates (k off ) are calculated using a simple one-to-one Langmuir binding model (BIAcore Evaluation Software version 3.2) by simultaneous fitting the association and dissociation sensorgram.
- a 20 nM anti-antigen antibody (Fab form) in PBS, pH 7.2 in the presence of increasing concentrations of antigen as measured in a spectrometer, such as a stop-flow equipped spectrophometer (Aviv Instruments) or a 8000-series SLM-Aminco spectrophotometer (ThermoSpectronic) with a stir red cuvette.
- a spectrometer such as a stop-flow equipped spectrophometer (Aviv Instruments) or a 8000-series SLM-Aminco spectrophotometer (ThermoSpectronic) with a stir red cuvette.
- an “on-rate” or “rate of association” or “association rate” or “k on ” can also be determined with the same surface plasmon resonance technique described above using a BIAcoreTM-2000 or a BIAcoreTM-3000 (BIAcore, Inc., Piscataway, N.J.) at 25° C. with immobilized antigen CM5 chips at ⁇ 10 response units (RU). Briefly, carboxymethylated dextran biosensor chips (CM5, BIAcore Inc.) are activated with N-ethyl-N′-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS) according to the supplier's instructions.
- CM5 carboxymethylated dextran biosensor chips
- EDC N-ethyl-N′-(3-dimethylaminopropyl)-carbodiimide hydrochloride
- NHS N-hydroxysuccinimide
- Antigen is diluted with 10 mM sodium acetate, pH 4.8, into 5 ⁇ g/ml ( ⁇ 0.2 uM) before injection at a flow rate of 5 ⁇ l/minute to achieve approximately 10 response units (RU) of coupled protein. Following the injection of antigen, 1M ethanolamine is injected to block unreacted groups. For kinetics measurements, two-fold serial dilutions of Fab (0.78 nM to 500 nM) are injected in PBS with 0.05% Tween 20 (PBST) at 25° C. at a flow rate of approximately 25 ⁇ l/min.
- PBST Tween 20
- the following modifications are used for the surface Plasmon resonance assay method: antibody is immobilized to CM5 biosensor chips to achieve approximately 400 RU, and for kinetic measurements, two-fold serial dilutions of target protein (e.g., FGFR3-IIIb or -IIIc) (starting from 67 nM) are injected in PBST buffer at 25° C. with a flow rate of about 30 ul/minute. Association rates (k on ) and dissociation rates (k off ) are calculated using a simple one-to-one Langmuir binding model (BIAcore Evaluation Software version 3.2) by simultaneous fitting the association and dissociation sensorgram.
- target protein e.g., FGFR3-IIIb or -IIIc
- Association rates (k on ) and dissociation rates (k off ) are calculated using a simple one-to-one Langmuir binding model (BIAcore Evaluation Software version 3.2) by simultaneous fitting the association and dissociation sensorgram.
- a 20 nM anti-antigen antibody (Fab form) in PBS, pH 7.2 in the presence of increasing concentrations of antigen as measured in a spectrometer, such as a stop-flow equipped spectrophometer (Aviv Instruments) or a 8000-series SLM-Aminco spectrophotometer (ThermoSpectronic) with a stir red cuvette.
- a spectrometer such as a stop-flow equipped spectrophometer (Aviv Instruments) or a 8000-series SLM-Aminco spectrophotometer (ThermoSpectronic) with a stir red cuvette.
- Polynucleotide or “nucleic acid,” as used interchangeably herein, refer to polymers of nucleotides of any length, and include DNA and RNA.
- the nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and/or their analogs, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase, or by a synthetic reaction.
- a polynucleotide may comprise modified nucleotides, such as methylated nucleotides and their analogs. If present, modification to the nucleotide structure may be imparted before or after assembly of the polymer.
- the sequence of nucleotides may be interrupted by non-nucleotide components.
- a polynucleotide may be further modified after synthesis, such as by conjugation with a label.
- Other types of modifications include, for example, “caps,” substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.) and with charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), those containing pendant moieties, such as, for example, proteins (e.g., nucleases, toxins, antibodies, signal peptides, ply-L-lysine, etc.), those with intercalators (e.g., acridine, psoralen, etc.), those containing chelators (e.g., metals
- any of the hydroxyl groups ordinarily present in the sugars may be replaced, for example, by phosphonate groups, phosphate groups, protected by standard protecting groups, or activated to prepare additional linkages to additional nucleotides, or may be conjugated to solid or semi-solid supports.
- the 5′ and 3′ terminal OH can be phosphorylated or substituted with amines or organic capping group moieties of from 1 to 20 carbon atoms.
- Other hydroxyls may also be derivatized to standard protecting groups.
- Polynucleotides can also contain analogous forms of ribose or deoxyribose sugars that are generally known in the art, including, for example, 2′-O-methyl-, 2′-fluoro- or 2′-azido-ribose, carbocyclic sugar analogs, alpha-anomeric sugars, epimeric sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars, sedoheptuloses, acyclic analogs and a basic nucleoside analogs such as methyl riboside.
- One or more phosphodiester linkages may be replaced by alternative linking groups.
- linking groups include, but are not limited to, embodiments wherein phosphate is replaced by P(O)S (“thioate”), P(S)S (“dithioate”), (O)NR 2 (“amidate”), P(O)R, P(O)OR′, CO or CH 2 (“formacetal”), in which each R or R′ is independently H or substituted or unsubstituted alkyl (1-20 C) optionally containing an ether (—O—) linkage, aryl, alkenyl, cycloalkyl, cycloalkenyl or araldyl. Not all linkages in a polynucleotide need be identical. The preceding description applies to all polynucleotides referred to herein, including RNA and DNA.
- Percent (%) amino acid sequence identity with respect to a peptide or polypeptide sequence is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the specific peptide or polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.
- % amino acid sequence identity values are generated using the sequence comparison computer program ALIGN-2, wherein the complete source code for the ALIGN-2 program is provided in Table A below.
- the ALIGN-2 sequence comparison computer program was authored by Genentech, Inc. and the source code has been filed with user documentation in the U.S. Copyright Office, Washington D.C., 20559, where it is registered under U.S. Copyright Registration No. TXU510087.
- the ALIGN-2 program is publicly available through Genentech, Inc., South San Francisco, Calif. or may be compiled from the source code provided in, e.g., WO2007/001851.
- the ALIGN-2 program should be compiled for use on a UNIX operating system, preferably digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.
- % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B is calculated as follows:
- two or more amino acid sequences are at least 50%, 60%, 70%, 80%, or 90% identical. In some embodiments, two or more amino acid sequences are at least 95%, 97%, 98%, 99%, or even 100% identical. Unless specifically stated otherwise, all % amino acid sequence identity values used herein are obtained as described in the immediately preceding paragraph using the ALIGN-2 computer program.
- FGFR3 refers, unless specifically or contextually indicated otherwise, to any native or variant (whether native or synthetic) FGFR3 polypeptide (e.g., FGFR3-IIIb isoform or FGFR3-IIIc isoform).
- native sequence specifically encompasses naturally occurring truncated forms (e.g., an extracellular domain sequence or a transmembrane subunit sequence), naturally occurring variant forms (e.g., alternatively spliced forms) and naturally-occurring allelic variants.
- wild-type FGFR3 generally refers to a polypeptide comprising an amino acid sequence of a naturally occurring FGFR3 protein.
- wild type FGFR3 sequence generally refers to an amino acid sequence found in a naturally occurring FGFR3.
- Ligand refers to an agent or compound that associates with a binding site on a molecule, for example, FGFR3 binding sites, and may be an antagonist or agonist of FGFR3 activity.
- Ligands include molecules that mimic anti-FGFR3 antibody (e.g., R3Mab) binding to FGFR3.
- a ligand may be any native or variant (whether native or synthetic) FGFR3 ligand (for example, FGF1, FGF2, FGF4, FGF8, FGF9, FGF17, FGF18, FGF23) polypeptide.
- mutant sequence specifically encompasses naturally occurring truncated forms (e.g., an extracellular domain sequence or a transmembrane subunit sequence), naturally occurring variant forms (e.g., alternatively spliced forms) and naturally-occurring allelic variants.
- wild-type FGFR3 ligand generally refers to a polypeptide comprising an amino acid sequence of a naturally occurring FGFR3 ligand protein.
- wild type FGFR3 ligand sequence generally refers to an amino acid sequence found in a naturally occurring FGFR3 ligand.
- “Compound” refers to molecule that associates with FGFR3 or a pharmaceutically acceptable salt, ester, amide, prodrug, isomer, or metabolite, thereof.
- “Pharmaceutically acceptable salt” refers to a formulation of a compound that does not compromise the biological activity and properties of the compound.
- Pharmaceutical salts can be obtained by reacting a binding-active compound of the disclosure with inorganic or organic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid and the like.
- FGFR3 activation refers to activation, or phosphorylation, of the FGFR3 receptor. Generally, FGFR3 activation results in signal transduction (e.g. that caused by an intracellular kinase domain of a FGFR3 receptor phosphorylating tyrosine residues in FGFR3 or a substrate polypeptide). FGFR3 activation may be mediated by FGFR ligand binding to a FGFR3 receptor of interest.
- FGFR3 ligand e.g., such as FGF1 or FGF9 binding to FGFR3 may activate a kinase domain of FGFR3 and thereby result in phosphorylation of tyrosine residues in the FGFR3 and/or phosphorylation of tyrosine residues in additional substrate polypeptides(s).
- cognitive refers to continuous signaling activity of a receptor that is not dependent on the presence of a ligand or other activating molecules. Depending on the nature of the receptor, all of the activity may be constitutive or the activity of the receptor may be further activated by the binding of other molecules (e.g. ligands).
- ligands e.g. ligands
- Cellular events that lead to activation of receptors are well known among those of ordinary skill in the art. For example, activation may include oligomerization, e.g., dimerization, trimerization, etc., into higher order receptor complexes. Complexes may comprise a single species of protein, i.e., a homomeric complex.
- complexes may comprise at least two different protein species, i.e., a heteromeric complex.
- Complex formation may be caused by, for example, overexpression of normal or mutant forms of receptor on the surface of a cell.
- Complex formation may also be caused by a specific mutation or mutations in a receptor.
- ligand-independent refers to signaling activity that is not dependent on the presence of a ligand.
- a receptor having ligand-independent kinase activity will not necessarily preclude the binding of ligand to that receptor to produce additional activation of the kinase activity.
- ligand-dependent refers to signaling activity that is dependent on the presence of a ligand.
- mutation means a difference in the amino acid or nucleic acid sequence of a particular protein or nucleic acid (gene, RNA) relative to the wild-type protein or nucleic acid, respectively.
- a mutated protein or nucleic acid can be expressed from or found on one allele (heterozygous) or both alleles (homozygous) of a gene, and may be somatic or germ line. In the instant invention, mutations are generally somatic. Mutations include sequence rearrangements such as insertions, deletions, and point mutations (including single nucleotide/amino acid polymorphisms).
- To “inhibit” is to decrease or reduce an activity, function, and/or amount as compared to a reference.
- An agent possesses “agonist activity or function” when an agent mimics at least one of the functional activities of a polypeptide of interest (e.g., FGFR ligand, such as FGF1 or FGF9).
- a polypeptide of interest e.g., FGFR ligand, such as FGF1 or FGF9.
- an “agonist antibody”, as used herein, is an antibody which mimics at least one of the functional activities of a polypeptide of interest (e.g., FGFR ligand, such as FGF1 or FGF9).
- FGFR ligand such as FGF1 or FGF9
- Fc region generally refers to a dimer complex comprising the C-terminal polypeptide sequences of an immunoglobulin heavy chain, wherein a C-terminal polypeptide sequence is that which is obtainable by papain digestion of an intact antibody.
- the Fc region may comprise native or variant Fc sequences.
- the human IgG heavy chain Fc sequence is usually defined to stretch from an amino acid residue at about position Cys226, or from about position Pro230, to the carboxyl terminus of the Fc sequence.
- the Fc sequence of an immunoglobulin generally comprises two constant domains, a CH2 domain and a CH3 domain, and optionally comprises a CH4 domain.
- compositions comprising an antibody having an Fc region according to this invention can comprise an antibody with K447, with all K447 removed, or a mixture of antibodies with and without the K447 residue.
- Fc polypeptide herein is meant one of the polypeptides that make up an Fc region.
- An Fc polypeptide may be obtained from any suitable immunoglobulin, such as IgG 1 , IgG 2 , IgG 3 , or IgG 4 subtypes, IgA, IgE, IgD or IgM.
- an Fc polypeptide comprises part or all of a wild type hinge sequence (generally at its N terminus). In some embodiments, an Fc polypeptide does not comprise a functional or wild type hinge sequence.
- blocking antibody or an antibody “antagonist” is one which inhibits or reduces biological activity of the antigen it binds.
- Preferred blocking antibodies or antagonist antibodies completely inhibit the biological activity of the antigen.
- naked antibody is an antibody that is not conjugated to a heterologous molecule, such as a cytotoxic moiety or radiolabel.
- An antibody having a “biological characteristic” of a designated antibody is one which possesses one or more of the biological characteristics of that antibody which distinguish it from other antibodies that bind to the same antigen.
- a salvage receptor binding epitope to the antibody (especially an antibody fragment), as described, e.g., in U.S. Pat. No. 5,739,277.
- a nucleic acid molecule encoding the salvage receptor binding epitope can be linked in frame to a nucleic acid encoding a polypeptide sequence of this invention so that the fusion protein expressed by the engineered nucleic acid molecule comprises the salvage receptor binding epitope and a polypeptide sequence of this invention.
- the term “salvage receptor binding epitope” refers to an epitope of the Fc region of an IgG molecule (e.g., IgG 1 , IgG 2 , IgG 3 , or IgG 4 ) that is responsible for increasing the in vivo serum half-life of the IgG molecule (e.g., Ghetie et al., Ann. Rev. Immunol. 18:739-766 (2000), Table 1). Antibodies with substitutions in an Fc region thereof and increased serum half-lives are also described in WO00/42072, WO 02/060919; Shields et al., J. Biol. Chem.
- the serum half-life can also be increased, for example, by attaching other polypeptide sequences.
- antibodies or other polypeptides useful in the methods of the invention can be attached to serum albumin or a portion of serum albumin that binds to the FcRn receptor or a serum albumin binding peptide so that serum albumin binds to the antibody or polypeptide, e.g., such polypeptide sequences are disclosed in WO01/45746.
- the serum albumin peptide to be attached comprises an amino acid sequence of DICLPRWGCLW (SEQ ID NO:183).
- the half-life of a Fab is increased by these methods. See also, Dennis et al. J. Biol. Chem. 277:35035-35043 (2002) for serum albumin binding peptide sequences.
- fragment is meant a portion of a polypeptide or nucleic acid molecule that contains, preferably, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more of the entire length of the reference nucleic acid molecule or polypeptide.
- a fragment may contain 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100, 200, 300, 400, 500, 600, or more nucleotides or 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 190, 200 amino acids or more.
- the phrase “little to no agonist function” with respect to an antibody of the invention, as used herein, means the antibody does not elicit a biologically meaningful amount of agonist activity, e.g., upon administration to a subject.
- amount of an activity may be determined quantitatively or qualitatively, so long as a comparison between an antibody of the invention and a reference counterpart can be done.
- the activity can be measured or detected according to any assay or technique known in the art, including, e.g., those described herein.
- the amount of activity for an antibody of the invention and its reference counterpart can be determined in parallel or in separate runs.
- a bivalent antibody of the invention does not possess substantial agonist function.
- antibody and “immunoglobulin” are used interchangeably in the broadest sense and include monoclonal antibodies (e.g., full length or intact monoclonal antibodies), polyclonal antibodies, multivalent antibodies, multispecific antibodies (e.g., bispecific antibodies so long as they exhibit the desired biological activity) and may also include certain antibody fragments (as described in greater detail herein).
- An antibody can be human, humanized, and/or affinity matured.
- variable refers to the fact that certain portions of the variable domains differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular antigen. However, the variability is not evenly distributed throughout the variable domains of antibodies. It is concentrated in three segments called complementarity-determining regions (CDRs) or hypervariable regions both in the light-chain and the heavy-chain variable domains. The more highly conserved portions of variable domains are called the framework (FR).
- CDRs complementarity-determining regions
- FR framework
- the variable domains of native heavy and light chains each comprise four FR regions, largely adopting a ⁇ -sheet configuration, connected by three CDRs, which form loops connecting, and in some cases forming part of, the ⁇ -sheet structure.
- the CDRs in each chain are held together in close proximity by the FR regions and, with the CDRs from the other chain, contribute to the formation of the antigen-binding site of antibodies (see Kabat et al., Sequences of Proteins of Immunological Interest , Fifth Edition, National Institute of Health, Bethesda, Md. (1991)).
- the constant domains are not involved directly in binding an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody-dependent cellular toxicity.
- Papain digestion of antibodies produces two identical antigen-binding fragments, called “Fab” fragments, each with a single antigen-binding site, and a residual “Fc” fragment, whose name reflects its ability to crystallize readily. Pepsin treatment yields an F(ab′) 2 fragment that has two antigen-combining sites and is still capable of cross-linking antigen.
- “Fv” is the minimum antibody fragment which contains a complete antigen-recognition and -binding site. In a two-chain Fv species, this region consists of a dimer of one heavy- and one light-chain variable domain in tight, non-covalent association. In a single-chain Fv species, one heavy- and one light-chain variable domain can be covalently linked by a flexible peptide linker such that the light and heavy chains can associate in a “dimeric” structure analogous to that in a two-chain Fv species. It is in this configuration that the three CDRs of each variable domain interact to define an antigen-binding site on the surface of the VH-VL dimer. Collectively, the six CDRs confer antigen-binding specificity to the antibody. However, even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site.
- the Fab fragment also contains the constant domain of the light chain and the first constant domain (CH1) of the heavy chain.
- Fab′ fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH1 domain including one or more cysteines from the antibody hinge region.
- Fab′-SH is the designation herein for Fab′ in which the cysteine residue(s) of the constant domains bear a free thiol group.
- F(ab′) 2 antibody fragments originally were produced as pairs of Fab′ fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.
- the “light chains” of antibodies (immunoglobulins) from any vertebrate species can be assigned to one of two clearly distinct types, called kappa ( ⁇ ) and lambda ( ⁇ ), based on the amino acid sequences of their constant domains.
- immunoglobulins can be assigned to different classes. There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, and several of these can be further divided into subclasses (isotypes), e.g., IgG 1 , IgG 2 , IgG 3 , IgG 4 , IgA 1 , and IgA 2 .
- the heavy-chain constant domains that correspond to the different classes of immunoglobulins are called ⁇ , ⁇ , ⁇ , ⁇ , and ⁇ respectively.
- the subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known.
- Antibody fragments comprise only a portion of an intact antibody, wherein the portion preferably retains at least one, preferably most or all, of the functions normally associated with that portion when present in an intact antibody.
- antibody fragments include Fab, Fab′, F(ab′) 2 , and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules; and multispecific antibodies formed from antibody fragments.
- an antibody fragment comprises an antigen binding site of the intact antibody and thus retains the ability to bind antigen.
- an antibody fragment for example one that comprises the Fc region, retains at least one of the biological functions normally associated with the Fc region when present in an intact antibody, such as FcRn binding, antibody half life modulation, ADCC function and complement binding.
- an antibody fragment is a monovalent antibody that has an in vivo half life substantially similar to an intact antibody.
- such an antibody fragment may comprise on antigen binding arm linked to an Fc sequence capable of conferring in vivo stability to the fragment.
- hypervariable region when used herein refers to the regions of an antibody variable domain which are hypervariable in sequence and/or form structurally defined loops.
- antibodies comprise six hypervariable regions; three in the VH (H1, H2, H3), and three in the VL (L1, L2, L3).
- a number of hypervariable region delineations are in use and are encompassed herein.
- the Kabat Complementarity Determining Regions are based on sequence variability and are the most commonly used (Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991)).
- Chothia refers instead to the location of the structural loops (Chothia and Lesk, J. Mol. Biol. 196:901-917 (1987)).
- the AbM hypervariable regions represent a compromise between the Kabat CDRs and Chothia structural loops, and are used by Oxford Molecular's AbM antibody modeling software.
- the “contact” hypervariable regions are based on an analysis of the available complex crystal structures. The residues from each of these hypervariable regions are noted below.
- Hypervariable regions may comprise “extended hypervariable regions” as follows: 24-36 or 24-34 (L1), 46-56 or 50-56 (L2) and 89-97 (L3) in the VL and 26-35 (H1), 50-65 or 49-65 (H2) and 93-102, 94
- Framework or “FR” residues are those variable domain residues other than the hypervariable region residues as herein defined.
- “Humanized” forms of non-human (e.g., murine) antibodies are chimeric antibodies that contain minimal sequence derived from non-human immunoglobulin.
- humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a hypervariable region of the recipient are replaced by residues from a hypervariable region of a non-human species (donor antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity, and capacity.
- donor antibody such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity, and capacity.
- framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues.
- humanized antibodies may comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance.
- the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin and all or substantially all of the FRs are those of a human immunoglobulin sequence.
- the humanized antibody optionally will also comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin.
- Fc immunoglobulin constant region
- “Chimeric” antibodies have a portion of the heavy and/or light chain identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (U.S. Pat. No. 4,816,567; and Morrison et al., Proc. Natl. Acad. Sci. USA 81:6851-6855 (1984)).
- Humanized antibody as used herein is a subset of chimeric antibodies.
- Single-chain Fv or “scFv” antibody fragments comprise the VH and VL domains of antibody, wherein these domains are present in a single polypeptide chain.
- the scFv polypeptide further comprises a polypeptide linker between the VH and VL domains which enables the scFv to form the desired structure for antigen binding.
- an “antigen” is a predetermined antigen to which an antibody can selectively bind.
- the target antigen may be polypeptide, carbohydrate, nucleic acid, lipid, hapten or other naturally occurring or synthetic compound.
- the target antigen is a polypeptide.
- diabodies refers to small antibody fragments with two antigen-binding sites, which fragments comprise a heavy-chain variable domain (VH) connected to a light-chain variable domain (VL) in the same polypeptide chain (VH-VL).
- VH heavy-chain variable domain
- VL light-chain variable domain
- VH-VL polypeptide chain
- a “human antibody” is one which possesses an amino acid sequence which corresponds to that of an antibody produced by a human and/or has been made using any of the techniques for making human antibodies as disclosed herein. This definition of a human antibody specifically excludes a humanized antibody comprising non-human antigen-binding residues.
- affinity matured antibody is one with one or more alterations in one or more CDRs thereof which result in an improvement in the affinity of the antibody for antigen, compared to a parent antibody which does not possess those alteration(s).
- Preferred affinity matured antibodies will have nanomolar or even picomolar affinities for the target antigen.
- Affinity matured antibodies are produced by procedures known in the art. Marks et al. Bio/Technology 10:779-783 (1992) describes affinity maturation by VH and VL domain shuffling. Random mutagenesis of CDR and/or framework residues is described by: Barbas et al., Proc Nat. Acad.
- Antibody effector functions refer to those biological activities attributable to the Fc region (a native sequence Fc region or amino acid sequence variant Fc region) of an antibody, and vary with the antibody isotype. Examples of antibody effector functions include: C1q binding and complement dependent cytotoxicity; Fc receptor binding; antibody-dependent cell-mediated cytotoxicity (ADCC); phagocytosis; down regulation of cell surface receptors (e.g., B cell receptor); and B cell activation.
- ADCC antibody-dependent cell-mediated cytotoxicity
- FcRs Fc receptors
- cytotoxic cells e.g., Natural Killer (NK) cells, neutrophils, and macrophages
- NK cells Natural Killer cells
- neutrophils neutrophils
- macrophages cytotoxic cells
- the antibodies “arm” the cytotoxic cells and are absolutely required for such killing.
- the primary cells for mediating ADCC, NK cells express Fc ⁇ RIII only, whereas monocytes express Fc ⁇ RI, Fc ⁇ RII and Fc ⁇ RIII.
- ADCC activity of a molecule of interest is assessed in vivo, e.g., in a animal model such as that disclosed in Clynes et al., PNAS (USA) 95:652-656 (1998).
- Human effector cells are leukocytes which express one or more FcRs and perform effector functions. Preferably, the cells express at least Fc ⁇ RIII and perform ADCC effector function. Examples of human leukocytes which mediate ADCC include peripheral blood mononuclear cells (PBMC), natural killer (NK) cells, monocytes, cytotoxic T cells and neutrophils; with PBMCs and NK cells being preferred.
- PBMC peripheral blood mononuclear cells
- NK natural killer cells
- monocytes cytotoxic T cells and neutrophils
- the effector cells may be isolated from a native source, e.g., from blood.
- Fc receptor or “FcR” describes a receptor that binds to the Fc region of an antibody.
- the preferred FcR is a native sequence human FcR.
- a preferred FcR is one which binds an IgG antibody (a gamma receptor) and includes receptors of the Fc ⁇ RI, Fc ⁇ RII, and Fc ⁇ RIII subclasses, including allelic variants and alternatively spliced forms of these receptors.
- Fc ⁇ RII receptors include Fc ⁇ RIIA (an “activating receptor”) and Fc ⁇ RIIB (an “inhibiting receptor”), which have similar amino acid sequences that differ primarily in the cytoplasmic domains thereof.
- Activating receptor Fc ⁇ RIIA contains an immunoreceptor tyrosine-based activation motif (ITAM) in its cytoplasmic domain.
- Inhibiting receptor Fc ⁇ RIIB contains an immunoreceptor tyrosine-based inhibition motif (ITIM) in its cytoplasmic domain.
- ITAM immunoreceptor tyrosine-based activation motif
- ITIM immunoreceptor tyrosine-based inhibition motif
- FcR FcR
- the term also includes the neonatal receptor, FcRn, which is responsible for the transfer of maternal IgGs to the fetus (Guyer et al., J. Immunol. 117:587 (1976) and Kim et al., J. Immunol. 24:249 (1994)) and regulates homeostasis of immunoglobulins.
- WO 00/42072 (Presta) describes antibody variants with improved or diminished binding to FcRs. The content of that patent publication is specifically incorporated herein by reference. See, also, Shields et al., J. Biol. Chem. 9(2): 6591-6604 (2001).
- Binding to human FcRn in vivo and serum half life of human FcRn high affinity binding polypeptides can be assayed, e.g., in transgenic mice or transfected human cell lines expressing human FcRn, or in primates administered with the Fc variant polypeptides.
- “Complement dependent cytotoxicity” or “CDC” refers to the lysis of a target cell in the presence of complement. Activation of the classical complement pathway is initiated by the binding of the first component of the complement system (C1q) to antibodies (of the appropriate subclass) which are bound to their cognate antigen.
- C1q first component of the complement system
- a CDC assay e.g., as described in Gazzano-Santoro et al., J. Immunol. Methods 202:163 (1996), may be performed.
- Fc region-comprising polypeptide refers to a polypeptide, such as an antibody or immunoadhesin, which comprises an Fc region.
- the C-terminal lysine (residue 447 according to the EU numbering system) of the Fc region may be removed, for example, during purification of the polypeptide or by recombinant engineering the nucleic acid encoding the polypeptide.
- a composition comprising a polypeptide having an Fc region according to this invention can comprise polypeptides with K447, with all K447 removed, or a mixture of polypeptides with and without the K447 residue.
- acceptor human framework for the purposes herein is a framework comprising the amino acid sequence of a VL or VH framework derived from a human immunoglobulin framework, or from a human consensus framework.
- An acceptor human framework “derived from” a human immunoglobulin framework or human consensus framework may comprise the same amino acid sequence thereof, or may contain pre-existing amino acid sequence changes. Where pre-existing amino acid changes are present, preferably no more than 5 and preferably 4 or less, or 3 or less, pre-existing amino acid changes are present.
- VH preferably those changes are only at three, two, or one of positions 71H, 73H, and 78H; for instance, the amino acid residues at those positions may be 71A, 73T, and/or 78A.
- the VL acceptor human framework is identical in sequence to the VL human immunoglobulin framework sequence or human consensus framework sequence.
- a “human consensus framework” is a framework which represents the most commonly occurring amino acid residue in a selection of human immunoglobulin VL or VH framework sequences.
- the selection of human immunoglobulin VL or VH sequences is from a subgroup of variable domain sequences.
- the subgroup of sequences is a subgroup as in Kabat et al.
- the subgroup is subgroup kappa I as in Kabat et al.
- the subgroup III as in Kabat et al.
- VH subgroup III consensus framework comprises the consensus sequence obtained from the amino acid sequences in variable heavy subgroup III of Kabat et al.
- the VH subgroup III consensus framework amino acid sequence comprises at least a portion or all of each of the following sequences:
- VL subgroup I consensus framework comprises the consensus sequence obtained from the amino acid sequences in variable light kappa subgroup I of Kabat et al.
- the VH subgroup I consensus framework amino acid sequence comprises at least a portion or all of each of the following sequences:
- antibody mutant refers to an amino acid sequence variant of an antibody wherein one or more of the amino acid residues of the species-dependent antibody have been modified. Such mutants necessarily have less than 100% sequence identity or similarity with the species-dependent antibody.
- the antibody mutant will have an amino acid sequence having at least 75% amino acid sequence identity or similarity with the amino acid sequence of either the heavy or light chain variable domain of the species-dependent antibody, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, and most preferably at least 95%. Identity or similarity with respect to this sequence is defined herein as the percentage of amino acid residues in the candidate sequence that are identical (i.e. same residue) or similar (i.e.
- the present disclosure includes a crystalline form and a crystal structure of FGFR3 complexed with an anti-FGFR3 antibody, and methods of using the FGFR3:anti-FGFR3 antibody crystal structure and structural coordinates to identify homologous proteins and to design or identify agents that can modulate the function of FGFR3 or the FGFR3-anti-FGFR3 antibody complex.
- the present disclosure also includes the three-dimensional configuration of points derived from the structure coordinates of at least a portion of an FGFR3 molecule or molecular complex, as well as structurally equivalent configurations, as described below.
- the three-dimensional configuration includes points derived from structure coordinates of, e.g., the FGFR3:anti-FGFR3 antibody complex, representing the locations of a plurality of the amino acids defining the FGFR3-anti-FGFR3 antibody complex binding site.
- the three-dimensional configuration includes points derived from structure coordinates representing the locations of the backbone atoms of a plurality of amino acids defining the FGFR3-anti-FGFR3 antibody complex or the FGFR3 binding site of, e.g., the FGFR3:anti-FGFR3 antibody complex.
- the three-dimensional configuration includes points derived from structure coordinates representing the locations of the side chain and the backbone atoms (other than hydrogens) of a plurality of the amino acids defining the FGFR3-anti-FGFR3 antibody complex.
- the disclosure also includes the scalable three-dimensional configuration of points derived from structure coordinates of molecules or molecular complexes that are structurally homologous to FGFR3, anti-FGFR3 antibody, or FGFR3:anti-FGFR3 antibody complex, as well as structurally equivalent configurations.
- Structurally homologous molecules or molecular complexes are defined below.
- structurally homologous molecules can be identified using the structure coordinates of the FGFR3, anti-FGFR3 antibody, or FGFR3:anti-FGFR3 antibody complex or extracellular fragment(s) of FGFR3 according to a method of the disclosure.
- the configurations of points in space derived from structure coordinates according to the disclosure can be visualized as, for example, a holographic image, a stereodiagram, a model, or a computer-displayed image, and the disclosure thus includes such images, diagrams or models.
- the crystal structure and structural coordinates can be used in methods, for example, for obtaining structural information of a related molecule, and for identifying and designing agents that modulate FGFR3, or the FGFR3:anti-FGFR3 antibody complex.
- the FGFR3 binding site may comprise, consist essentially of, or consist of one or more of the amino acid residues 154, 155, 158, 159, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 177, 202, 205, 207, 210, 212, 214, 216, 217, 241, 246, 247, 248, 278, 279, 280, 281, 282, 283, 314, 315, 316, 317 and/or 318, or mixtures thereof, of FGFR3-IIIb polypeptide (e.g., human FGFR3-IIIb disclosed in (UniProKB/Swiss-Prot accession number P22607 — 2), or equivalent residues of FGFR3-IIIc polypeptide (e.g., human FGFR3-IIIc disclosed in UniProKB/Swiss-Prot accession number P22607).
- the FGFR3 binding site may comprise, consist essentially of, or consist of one or more of the amino acid residues 158, 159, 169, 170, 171, 173, 175, 205, 207, and/or 315, or mixtures thereof, of FGFR3-IIIb polypeptide, or equivalent residues of FGFR3-IIIc polypeptide.
- the FGFR3 binding site may comprise, consist essentially of, or consist of one or more of the amino acid residues 158, 170, 171, 173, 175, and/or 315, or mixtures thereof, of FGFR3-IIIb polypeptide, or equivalent residues of FGFR3-IIIc polypeptide.
- FGFR3 nucleic acid and amino acid sequences are known in the art. Nucleic acid sequence encoding the FGFR3 can be designed using the amino acid sequence of the desired region of FGFR3. As is well-known in the art, there are two major splice isoforms of FGFR3, FGFR3-IIIb and FGFR3-IIIc. FGFR3 sequences are well-known in the art and may include the sequence of UniProKB/Swiss-Prot accession number P22607 (FGFR3-IIIc) or P22607 — 2 (FGFR3-IIIb).
- FGFR3 mutations have been identified and are well-known in the art and include the following mutations (with reference to the sequences shown in UniProKB/Swiss-Prot accession number P22607 (FGFR3-IIIc) or P22607 — 2 (FGFR3-IIIb):
- the present disclosure also includes a polypeptides comprising, consisting essentially of, or consisting of a portion or fragment of the FGFR3, and polynucleotides encoding the polypeptides.
- An embodiment of a polypeptide fragment comprises, consists essentially of, or consists of any of amino acid residue starting from amino acid residue 154 to amino acid residue 164 and ending at amino acid residue 178 to amino acid 283 of human FGFR3 (e.g., human UniProKB/Swiss-Prot accession number P22607 — 2 (human FGFR3-IIIb)).
- An embodiment of a polypeptide fragment comprises, consists essentially of, or consists of any of amino acid residue 154 to amino acid residue 177, amino acid residue 202 to amino acid reside 217, amino acid residue 241 to amino acid residue 248, amino acid residue 278 to amino acid residue 283 and/or amino acid residue 314 to amino acid residue 318.
- polypeptide fragment comprises, consists essentially of, or consists of any of amino acid residue 164 to amino acid residue 164 to residue 178, residue 269 to residue 283 and/or residue 154 to residue 318.
- the polypeptide portion has the ability to bind to FGFR3 ligand.
- variants of FGFR3 include those polypeptides that have amino acid substitutions, deletions, and additions (such as at least 1, 2, 3, 4, 5, 6, 7, 8, 9 10, or more amino acid substitutions, deletions and additions).
- the variant comprises 1, 2, 3, 4, 5, 6, 7, 8, 9 10 or more conservative substitutions (relative to a reference sequence, such as a human FGFR3 reference sequence).
- Amino acid substitutions can be made for example to replace cysteines and eliminate formation of disulfide bonds. Amino acid substitutions can also be made to change proteolytic cleavage sites. Other variants can be made at the FGFR3 inhibitor binding site.
- the variants of the FGFR3 bind FGFR3 ligand with the same or higher affinity than the wild type FGFR3. In some embodiments, the variants of the FGFR3 bind an FGFR3 inhibitor (e.g. anti-FGFR3, antibody) with the same or higher affinity that the wild type FGFR3.
- an FGFR3 inhibitor e.g. anti-FGFR3, antibody
- FGFR3 polypeptides, variants, or structural homolog or portions thereof may be fused to a heterologous polypeptide or compound.
- the heterologous polypeptide is a polypeptide that has a different function than that of the FGFR3.
- heterologous polypeptide include polypeptides that may act as carriers, may extend half life, may act as epitope tags, may provide ways to detect or purify the fusion protein.
- Heterologous polypeptides include KLH, albumin, salvage receptor binding epitopes, immunoglobulin constant regions, and peptide tags.
- Peptide tags useful for detection or purification include FLAG, gD protein, polyhistidine tags, hemagluthinin from influenza virus, T7 tag, S tag, Strep tag, chloramiphenicol acetyl transferase, biotin, glutathione-S transferase, green fluorescent protein and maltose binding protein.
- Compounds that can be combined with the FGFR3, variants or structural homolog or portions thereof, include radioactive labels, protecting groups, and carbohydrate or lipid moieties.
- FGFR3, variants or fragments thereof can be prepared by introducing appropriate nucleotide changes into DNA encoding FGFR3, or by synthesis of the desired polypeptide variants.
- Polynucleotide sequences encoding the polypeptides described herein can be obtained using standard recombinant techniques. Desired polynucleotide sequences may be isolated and sequenced from appropriate source cells. Alternatively, polynucleotides can be synthesized using nucleotide synthesizer or PCR techniques. Once obtained, sequences encoding the polypeptides or variant polypeptides are inserted into a recombinant vector capable of replicating and expressing heterologous polynucleotides in a host cell. Many vectors that are available and known in the art can be used for the purpose of the present invention.
- Selection of an appropriate vector will depend mainly on the size of the nucleic acids to be inserted into the vector and the particular host cell to be transformed with the vector.
- Each vector contains various components, depending on its function (amplification or expression of heterologous polynucleotide, or both) and its compatibility with the particular host cell in which it resides.
- the vector components generally include, but are not limited to: an origin of replication (in particular when the vector is inserted into a prokaryotic cell), a selection marker gene, a promoter, a ribosome binding site (RBS), a signal sequence, the heterologous nucleic acid insert and a transcription termination sequence.
- plasmid vectors containing replicon and control sequences which are derived from a species compatible with the host cell are used in connection with these hosts.
- the vector ordinarily carries a replication site, as well as marking sequences, which are capable of providing phenotypic selection in transformed cells.
- E. coli is typically transformed using pBR322, a plasmid derived from an E. coli species.
- pBR322 contains genes encoding ampicillin (Amp) and tetracycline (Tet) resistance and thus provides easy means for identifying transformed cells.
- pBR322 its derivatives, or other microbial plasmids or bacteriophage may also contain, or be modified to contain, promoters which can be used by the microbial organism for expression of endogenous proteins.
- phage vectors containing replicon and control sequences that are compatible with the host microorganism can be used as transforming vectors in connection with these hosts.
- bacteriophage such as ⁇ GEM.TM.-11 may be utilized in making a recombinant vector which can be used to transform susceptible host cells such as E. coli LE392.
- Either constitutive or inducible promoters can be used in the present invention, in accordance with the needs of a particular situation, which can be ascertained by one skilled in the art.
- a large number of promoters recognized by a variety of potential host cells are well known.
- the selected promoter can be operably linked to cistron DNA encoding a polypeptide described herein by removing the promoter from the source DNA via restriction enzyme digestion and inserting the isolated promoter sequence into the vector of choice.
- Both the native promoter sequence and many heterologous promoters may be used to direct amplification and/or expression of the target genes. However, heterologous promoters are preferred, as they generally permit greater transcription and higher yields of expressed target gene as compared to the native target polypeptide promoter.
- Promoters suitable for use with prokaryotic hosts include the PhoA promoter, the ⁇ -galactamase and lactose promoter systems, a tryptophan (trp) promoter system and hybrid promoters such as the tac or the trc promoter.
- trp tryptophan
- other promoters that are functional in bacteria such as other known bacterial or phage promoters
- Their nucleotide sequences have been published, thereby enabling a skilled worker operably to ligate them to cistrons encoding the polypeptides or variant polypeptides (Siebenlist et al. (1980) Cell 20: 269) using linkers or adaptors to supply any required restriction sites.
- each cistron within a recombinant vector comprises a secretion signal sequence component that directs translocation of the expressed polypeptides across a membrane.
- the signal sequence may be a component of the vector, or it may be a part of the polypeptide encoding DNA that is inserted into the vector.
- the signal sequence selected for the purpose of this invention should be one that is recognized and processed (i.e. cleaved by a signal peptidase) by the host cell.
- the signal sequence is substituted by a prokaryotic signal sequence selected, for example, from the group consisting of the alkaline phosphatase, penicillinase, Ipp, or heat-stable enterotoxin II (STII) leaders, LamB, PhoE, PelB, OmpA and MBP.
- a prokaryotic signal sequence selected, for example, from the group consisting of the alkaline phosphatase, penicillinase, Ipp, or heat-stable enterotoxin II (STII) leaders, LamB, PhoE, PelB, OmpA and MBP.
- STII heat-stable enterotoxin II
- Prokaryotic host cells suitable for expressing polypeptides include Archaebacteria and Eubacteria, such as Gram-negative or Gram-positive organisms.
- useful bacteria include Escherichia (e.g., E. coli ), Bacilli (e.g., B. subtilis ), Enterobacteria, Pseudomonas species (e.g., P. aeruginosa ), Salmonella typhimurium, Serratia marcescans, Klebsiella, Proteus, Shigella, Rhizobia, Vitreoscilla , or Paracoccus .
- gram-negative cells are used.
- the host cell should secrete minimal amounts of proteolytic enzymes, and additional protease inhibitors may desirably be incorporated in the cell culture.
- eukaryotic host cell systems are also well established in the art.
- invertebrate cells include insect cells such as Drosophila . S2 and Spodoptera Sf9, as well as plants and plant cells.
- useful mammalian host cell lines include Chinese hamster ovary (CHO) and COS cells. More specific examples include monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); Chinese hamster ovary cells/ ⁇ DHFR (CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. USA, 77:4216 (1980)); mouse sertoli cells (TM4, Mather, Biol. Reprod., 23:243-251 (1980)); and mouse mammary tumor (MMT 060562, ATCC CCL51).
- Host cells are transformed or transfected with the above-described expression vectors and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences.
- Transfection refers to the taking up of an expression vector by a host cell whether or not any coding sequences are in fact expressed. Numerous methods of transfection are known to the ordinarily skilled artisan, for example, CaPO4 precipitation and electroporation. Successful transfection is generally recognized when any indication of the operation of this vector occurs within the host cell.
- Transformation means introducing DNA into the prokaryotic host so that the DNA is replicable, either as an extrachromosomal element or by chromosomal integrant.
- transformation is done using standard techniques appropriate to such cells.
- the calcium treatment employing calcium chloride is generally used for bacterial cells that contain substantial cell-wall barriers.
- Another method for transformation employs polyethylene glycol/DMSO.
- Yet another technique used is electroporation.
- Prokaryotic cells used to produce the polypeptides of the invention are grown in media known in the art and suitable for culture of the selected host cells.
- suitable media include luria broth (LB) plus necessary nutrient supplements.
- the media also contains a selection agent, chosen based on the construction of the expression vector, to selectively permit growth of prokaryotic cells containing the expression vector. For example, ampicillin is added to media for growth of cells expressing ampicillin resistant gene.
- any necessary supplements besides carbon, nitrogen, and inorganic phosphate sources may also be included at appropriate concentrations introduced alone or as a mixture with another supplement or medium such as a complex nitrogen source.
- the culture medium may contain one or more reducing agents selected from the group consisting of glutathione, cysteine, cystamine, thioglycollate, dithioerythritol and dithiothreitol.
- the prokaryotic host cells are cultured at suitable temperatures.
- the preferred temperature ranges from about 20° C. to about 39° C., more preferably from about 25° C. to about 37° C., even more preferably at about 30° C.
- the pH of the medium may be any pH ranging from about 5 to about 9, depending mainly on the host organism.
- the pH is preferably from about 6.8 to about 7.4, and more preferably about 7.0.
- an inducible promoter is used in the expression vector, protein expression is induced under conditions suitable for the activation of the promoter.
- a PhoA promoter is used for controlling transcription
- the transformed host cells may be cultured in a phosphate-limiting medium for induction.
- inducers may be used, according to the vector construct employed, as is known in the art.
- Eukaryotic host cells are cultured under conditions suitable for expression of the FGFR3 and/or KD polypeptides.
- the host cells used to produce the polypeptides may be cultured in a variety of media.
- Commercially available media such as Ham's F10 (Sigma), Minimal Essential Medium ((MEM), (Sigma), RPMI-1640 (Sigma), and Dulbecco's Modified Eagle's Medium ((DMEM), Sigma) are suitable for culturing the host cells.
- any of these media may be supplemented as necessary with hormones and/or other growth factors (such as insulin, transferrin, or epidermal growth factor), salts (such as sodium chloride, calcium, magnesium, and phosphate), buffers (such as HEPESTM), nucleotides (such as adenosine and thymidine), antibiotics (such as GENTAMYCINTM), trace elements (defined as inorganic compounds usually present at final concentrations in the micromolar range), and glucose or an equivalent energy source.
- growth factors such as insulin, transferrin, or epidermal growth factor
- salts such as sodium chloride, calcium, magnesium, and phosphate
- buffers such as HEPESTM
- nucleotides such as adenosine and thymidine
- antibiotics such as GENTAMYCINTM
- trace elements defined as inorganic compounds usually present at final concentrations in the micromolar range
- glucose or an equivalent energy source glucose or an equivalent energy source.
- Other supplements may also be included at
- Polypeptides described herein expressed in a host cell may be secreted into and/or recovered from the periplasm of the host cells. Protein recovery typically involves disrupting the microorganism, generally by such means as osmotic shock, sonication or lysis. Once cells are disrupted, cell debris or whole cells may be removed by centrifugation or filtration. The proteins may be further purified, for example, by affinity resin chromatography. Alternatively, proteins can be transported into the culture media and isolated there from. Cells may be removed from the culture and the culture supernatant being filtered and concentrated for further purification of the proteins produced.
- Protein recovery typically involves disrupting the microorganism, generally by such means as osmotic shock, sonication or lysis. Once cells are disrupted, cell debris or whole cells may be removed by centrifugation or filtration. The proteins may be further purified, for example, by affinity resin chromatography. Alternatively, proteins can be transported into the culture media and isolated there from. Cells may be removed from the culture and the
- the expressed polypeptides can be further isolated and identified using commonly known methods such as fractionation on immunoaffinity or ion-exchange columns; ethanol precipitation; reverse phase HPLC; chromatography on silica or on a cation exchange resin such as DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; gel filtration using, for example, Sephadex G-75; hydrophobic affinity resins, ligand affinity using a suitable antigen immobilized on a matrix and Western blot assay.
- Polypeptides that are produced may be purified to obtain preparations that are substantially homogeneous for further assays and uses.
- Standard protein purification methods known in the art can be employed. The following procedures are exemplary of suitable purification procedures: fractionation on immunoaffinity or ion-exchange columns, ethanol precipitation, reverse phase HPLC, chromatography on silica or on a cation-exchange resin such as DEAE, chromatofocusing, SDS-PAGE, ammonium sulfate precipitation, and gel filtration using, for example, Sephadex G-75.
- the nucleic acid encoding it is isolated and inserted into a replicable vector for further cloning (amplification of the DNA) or for expression.
- DNA encoding the antibody is readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of the antibody).
- Many vectors are available. The choice of vector depends in part on the host cell to be used. Generally, preferred host cells are of either prokaryotic or eukaryotic (generally mammalian) origin.
- Polynucleotide sequences encoding polypeptide components of the antibody of the invention can be obtained using standard recombinant techniques. Desired polynucleotide sequences may be isolated and sequenced from antibody producing cells such as hybridoma cells. Alternatively, polynucleotides can be synthesized using nucleotide synthesizer or PCR techniques. Once obtained, sequences encoding the polypeptides are inserted into a recombinant vector capable of replicating and expressing heterologous polynucleotides in prokaryotic hosts. Many vectors that are available and known in the art can be used for the purpose of the present invention.
- Selection of an appropriate vector will depend mainly on the size of the nucleic acids to be inserted into the vector and the particular host cell to be transformed with the vector.
- Each vector contains various components, depending on its function (amplification or expression of heterologous polynucleotide, or both) and its compatibility with the particular host cell in which it resides.
- the vector components generally include, but are not limited to: an origin of replication, a selection marker gene, a promoter, a ribosome binding site (RBS), a signal sequence, the heterologous nucleic acid insert and a transcription termination sequence.
- plasmid vectors containing replicon and control sequences which are derived from species compatible with the host cell are used in connection with these hosts.
- the vector ordinarily carries a replication site, as well as marking sequences which are capable of providing phenotypic selection in transformed cells.
- E. coli is typically transformed using pBR322, a plasmid derived from an E. coli species.
- pBR322 contains genes encoding ampicillin (Amp) and tetracycline (Tet) resistance and thus provides easy means for identifying transformed cells.
- pBR322 its derivatives, or other microbial plasmids or bacteriophage may also contain, or be modified to contain, promoters which can be used by the microbial organism for expression of endogenous proteins.
- promoters which can be used by the microbial organism for expression of endogenous proteins. Examples of pBR322 derivatives used for expression of particular antibodies are described in detail in Carter et al., U.S. Pat. No. 5,648,237.
- phage vectors containing replicon and control sequences that are compatible with the host microorganism can be used as transforming vectors in connection with these hosts.
- bacteriophage such as ⁇ GEM.TM.-11 may be utilized in making a recombinant vector which can be used to transform susceptible host cells such as E. coli LE392.
- the expression vector of the invention may comprise two or more promoter-cistron pairs, encoding each of the polypeptide components.
- a promoter is an untranslated regulatory sequence located upstream (5′) to a cistron that modulates its expression.
- Prokaryotic promoters typically fall into two classes, inducible and constitutive. Inducible promoter is a promoter that initiates increased levels of transcription of the cistron under its control in response to changes in the culture condition, e.g. the presence or absence of a nutrient or a change in temperature.
- the selected promoter can be operably linked to cistron DNA encoding the light or heavy chain by removing the promoter from the source DNA via restriction enzyme digestion and inserting the isolated promoter sequence into the vector of the invention.
- Both the native promoter sequence and many heterologous promoters may be used to direct amplification and/or expression of the target genes.
- heterologous promoters are utilized, as they generally permit greater transcription and higher yields of expressed target gene as compared to the native target polypeptide promoter.
- Promoters suitable for use with prokaryotic hosts include the PhoA promoter, the (3-galactamase and lactose promoter systems, a tryptophan (trp) promoter system and hybrid promoters such as the tac or the trc promoter.
- trp tryptophan
- other promoters that are functional in bacteria such as other known bacterial or phage promoters
- Their nucleotide sequences have been published, thereby enabling a skilled worker operably to ligate them to cistrons encoding the target light and heavy chains (Siebenlist et al. (1980) Cell 20: 269) using linkers or adaptors to supply any required restriction sites.
- each cistron within the recombinant vector comprises a secretion signal sequence component that directs translocation of the expressed polypeptides across a membrane.
- the signal sequence may be a component of the vector, or it may be a part of the target polypeptide DNA that is inserted into the vector.
- the signal sequence selected for the purpose of this invention should be one that is recognized and processed (i.e. cleaved by a signal peptidase) by the host cell.
- the signal sequence is substituted by a prokaryotic signal sequence selected, for example, from the group consisting of the alkaline phosphatase, penicillinase, Ipp, or heat-stable enterotoxin II (STII) leaders, LamB, PhoE, PelB, OmpA and MBP.
- STII heat-stable enterotoxin II
- LamB, PhoE, PelB, OmpA and MBP are STII signal sequences or variants thereof.
- the production of the immunoglobulins according to the invention can occur in the cytoplasm of the host cell, and therefore does not require the presence of secretion signal sequences within each cistron.
- immunoglobulin light and heavy chains are expressed, folded and assembled to form functional immunoglobulins within the cytoplasm.
- Certain host strains e.g., the E. coli trxB-strains
- the present invention provides an expression system in which the quantitative ratio of expressed polypeptide components can be modulated in order to maximize the yield of secreted and properly assembled antibodies of the invention. Such modulation is accomplished at least in part by simultaneously modulating translational strengths for the polypeptide components.
- TIR translational initiation region
- a series of amino acid or nucleic acid sequence variants can be created with a range of translational strengths, thereby providing a convenient means by which to adjust this factor for the desired expression level of the specific chain.
- TIR variants can be generated by conventional mutagenesis techniques that result in codon changes which can alter the amino acid sequence, although silent changes in the nucleotide sequence are preferred.
- Alterations in the TIR can include, for example, alterations in the number or spacing of Shine-Dalgarno sequences, along with alterations in the signal sequence.
- One method for generating mutant signal sequences is the generation of a “codon bank” at the beginning of a coding sequence that does not change the amino acid sequence of the signal sequence (i.e., the changes are silent). This can be accomplished by changing the third nucleotide position of each codon; additionally, some amino acids, such as leucine, serine, and arginine, have multiple first and second positions that can add complexity in making the bank. This method of mutagenesis is described in detail in Yansura et al. (1992) METHODS: A Companion to Methods in Enzymol. 4:151-158.
- a set of vectors is generated with a range of TIR strengths for each cistron therein.
- This limited set provides a comparison of expression levels of each chain as well as the yield of the desired antibody products under various TIR strength combinations.
- TIR strengths can be determined by quantifying the expression level of a reporter gene as described in detail in Simmons et al. U.S. Pat. No. 5,840,523. Based on the translational strength comparison, the desired individual TIRs are selected to be combined in the expression vector constructs of the invention.
- Prokaryotic host cells suitable for expressing antibodies of the invention include Archaebacteria and Eubacteria, such as Gram-negative or Gram-positive organisms.
- useful bacteria include Escherichia (e.g., E. coli ), Bacilli (e.g., B. subtilis ), Enterobacteria, Pseudomonas species (e.g., P. aeruginosa ), Salmonella typhimurium, Serratia marcescans, Klebsiella, Proteus, Shigella, Rhizobia, Vitreoscilla , or Paracoccus .
- gram-negative cells are used.
- E. coli cells are used as hosts for the invention. Examples of E.
- coli strains include strain W3110 (Bachmann, Cellular and Molecular Biology, vol. 2 (Washington, D.C.: American Society for Microbiology, 1987), pp. 1190-1219; ATCC Deposit No. 27,325) and derivatives thereof, including strain 33D3 having genotype W3110 ⁇ fhuA ( ⁇ tonA) ptr3 lac Iq lacL8 ⁇ ompT ⁇ (nmpc-fepE) degP41 kanR (U.S. Pat. No. 5,639,635).
- Other strains and derivatives thereof such as E. coli 294 (ATCC 31,446), E. coli B, E. coli, 1776 (ATCC 31,537) and E.
- coli RV308 (ATCC 31,608) are also suitable. These examples are illustrative rather than limiting. Methods for constructing derivatives of any of the above-mentioned bacteria having defined genotypes are known in the art and described in, for example, Bass et al., Proteins, 8:309-314 (1990). It is generally necessary to select the appropriate bacteria taking into consideration replicability of the replicon in the cells of a bacterium.
- E. coli, Serratia , or Salmonella species can be suitably used as the host when well known plasmids such as pBR322, pBR325, pACYC177, or pKN410 are used to supply the replicon.
- the host cell should secrete minimal amounts of proteolytic enzymes, and additional protease inhibitors may desirably be incorporated in the cell culture.
- Host cells are transformed with the above-described expression vectors and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences.
- Transformation means introducing DNA into the prokaryotic host so that the DNA is replicable, either as an extrachromosomal element or by chromosomal integrant.
- transformation is done using standard techniques appropriate to such cells.
- the calcium treatment employing calcium chloride is generally used for bacterial cells that contain substantial cell-wall barriers.
- Another method for transformation employs polyethylene glycol/DMSO.
- Yet another technique used is electroporation.
- Prokaryotic cells used to produce the polypeptides of the invention are grown in media known in the art and suitable for culture of the selected host cells.
- suitable media include luria broth (LB) plus necessary nutrient supplements.
- the media also contains a selection agent, chosen based on the construction of the expression vector, to selectively permit growth of prokaryotic cells containing the expression vector. For example, ampicillin is added to media for growth of cells expressing ampicillin resistant gene.
- any necessary supplements besides carbon, nitrogen, and inorganic phosphate sources may also be included at appropriate concentrations introduced alone or as a mixture with another supplement or medium such as a complex nitrogen source.
- the culture medium may contain one or more reducing agents selected from the group consisting of glutathione, cysteine, cystamine, thioglycollate, dithioerythritol and dithiothreitol.
- the prokaryotic host cells are cultured at suitable temperatures.
- the preferred temperature ranges from about 20° C. to about 39° C., more preferably from about 25° C. to about 37° C., even more preferably at about 30° C.
- the pH of the medium may be any pH ranging from about 5 to about 9, depending mainly on the host organism.
- the pH is preferably from about 6.8 to about 7.4, and more preferably about 7.0.
- an inducible promoter is used in the expression vector of the invention, protein expression is induced under conditions suitable for the activation of the promoter.
- PhoA promoters are used for controlling transcription of the polypeptides.
- the transformed host cells are cultured in a phosphate-limiting medium for induction.
- the phosphate-limiting medium is the C.R.A.P medium (see, for e.g., Simmons et al., J. Immunol. Methods (2002), 263:133-147).
- a variety of other inducers may be used, according to the vector construct employed, as is known in the art.
- the expressed polypeptides of the present invention are secreted into and recovered from the periplasm of the host cells.
- Protein recovery typically involves disrupting the microorganism, generally by such means as osmotic shock, sonication or lysis. Once cells are disrupted, cell debris or whole cells may be removed by centrifugation or filtration. The proteins may be further purified, for example, by affinity resin chromatography. Alternatively, proteins can be transported into the culture media and isolated therein. Cells may be removed from the culture and the culture supernatant being filtered and concentrated for further purification of the proteins produced. The expressed polypeptides can be further isolated and identified using commonly known methods such as polyacrylamide gel electrophoresis (PAGE) and Western blot assay.
- PAGE polyacrylamide gel electrophoresis
- antibody production is conducted in large quantity by a fermentation process.
- Various large-scale fed-batch fermentation procedures are available for production of recombinant proteins.
- Large-scale fermentations have at least 1000 liters of capacity, preferably about 1,000 to 100,000 liters of capacity. These fermentors use agitator impellers to distribute oxygen and nutrients, especially glucose (the preferred carbon/energy source).
- Small scale fermentation refers generally to fermentation in a fermentor that is no more than approximately 100 liters in volumetric capacity, and can range from about 1 liter to about 100 liters.
- induction of protein expression is typically initiated after the cells have been grown under suitable conditions to a desired density, e.g., an OD550 of about 180-220, at which stage the cells are in the early stationary phase.
- a desired density e.g., an OD550 of about 180-220
- inducers may be used, according to the vector construct employed, as is known in the art and described above. Cells may be grown for shorter periods prior to induction. Cells are usually induced for about 12-50 hours, although longer or shorter induction time may be used.
- various fermentation conditions can be modified.
- additional vectors overexpressing chaperone proteins such as Dsb proteins (DsbA, DsbB, DsbC, DsbD and or DsbG) or FkpA (a peptidylprolyl cis,trans-isomerase with chaperone activity) can be used to co-transform the host prokaryotic cells.
- the chaperone proteins have been demonstrated to facilitate the proper folding and solubility of heterologous proteins produced in bacterial host cells. Chen et al.
- certain host strains deficient for proteolytic enzymes can be used for the present invention.
- host cell strains may be modified to effect genetic mutation(s) in the genes encoding known bacterial proteases such as Protease III, OmpT, DegP, Tsp, Protease I, Protease Mi, Protease V, Protease VI and combinations thereof.
- E. coli protease-deficient strains are available and described in, for example, Joly et al. (1998), supra; Georgiou et al., U.S. Pat. No. 5,264,365; Georgiou et al., U.S. Pat. No. 5,508,192; Hara et al., Microbial Drug Resistance, 2:63-72 (1996).
- E. coli strains deficient for proteolytic enzymes and transformed with plasmids overexpressing one or more chaperone proteins are used as host cells in the expression system of the invention.
- the antibody protein produced herein is further purified to obtain preparations that are substantially homogeneous for further assays and uses.
- Standard protein purification methods known in the art can be employed. The following procedures are exemplary of suitable purification procedures: fractionation on immunoaffinity or ion-exchange columns, ethanol precipitation, reverse phase HPLC, chromatography on silica or on a cation-exchange resin such as DEAE, chromatofocusing, SDS-PAGE, ammonium sulfate precipitation, and gel filtration using, for example, Sephadex G-75.
- Protein A immobilized on a solid phase is used for immunoaffinity purification of the full length antibody products of the invention.
- Protein A is a 41 kD cell wall protein from Staphylococcus aureas which binds with a high affinity to the Fc region of antibodies. Lindmark et al (1983) J. Immunol. Meth. 62:1-13.
- the solid phase to which Protein A is immobilized is preferably a column comprising a glass or silica surface, more preferably a controlled pore glass column or a silicic acid column. In some applications, the column has been coated with a reagent, such as glycerol, in an attempt to prevent nonspecific adherence of contaminants.
- the preparation derived from the cell culture as described above is applied onto the Protein A immobilized solid phase to allow specific binding of the antibody of interest to Protein A.
- the solid phase is then washed to remove contaminants non-specifically bound to the solid phase.
- the antibody of interest is recovered from the solid phase by elution.
- the vector components generally include, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence.
- a vector for use in a eukaryotic host cell may also contain a signal sequence or other polypeptide having a specific cleavage site at the N-terminus of the mature protein or polypeptide of interest.
- the heterologous signal sequence selected preferably is one that is recognized and processed (i.e., cleaved by a signal peptidase) by the host cell.
- mammalian signal sequences as well as viral secretory leaders, for example, the herpes simplex gD signal are available.
- the DNA for such precursor region is ligated in reading frame to DNA encoding the antibody.
- an origin of replication component is not needed for mammalian expression vectors.
- the SV40 origin may typically be used only because it contains the early promoter.
- Selection genes may contain a selection gene, also termed a selectable marker.
- Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e.g., ampicillin, neomycin, methotrexate, or tetracycline, (b) complement auxotrophic deficiencies, where relevant, or (c) supply critical nutrients not available from complex media.
- One example of a selection scheme utilizes a drug to arrest growth of a host cell. Those cells that are successfully transformed with a heterologous gene produce a protein conferring drug resistance and thus survive the selection regimen. Examples of such dominant selection use the drugs neomycin, mycophenolic acid and hygromycin.
- Suitable selectable markers for mammalian cells are those that enable the identification of cells competent to take up the antibody nucleic acid, such as DHFR, thymidine kinase, metallothionein-I and -II, preferably primate metallothionein genes, adenosine deaminase, ornithine decarboxylase, etc.
- cells transformed with the DHFR selection gene are first identified by culturing all of the transformants in a culture medium that contains methotrexate (Mtx), a competitive antagonist of DHFR.
- Mtx methotrexate
- An appropriate host cell when wild-type DHFR is employed is the Chinese hamster ovary (CHO) cell line deficient in DHFR activity (e.g., ATCC CRL-9096).
- host cells transformed or co-transformed with DNA sequences encoding an antibody, wild-type DHFR protein, and another selectable marker such as aminoglycoside 3′-phosphotransferase (APH) can be selected by cell growth in medium containing a selection agent for the selectable marker such as an aminoglycosidic antibiotic, e.g., kanamycin, neomycin, or G418. See U.S. Pat. No. 4,965,199.
- APH aminoglycoside 3′-phosphotransferase
- Expression and cloning vectors usually contain a promoter that is recognized by the host organism and is operably linked to the antibody polypeptide nucleic acid.
- Promoter sequences are known for eukaryotes.
- Virtually alleukaryotic genes have an AT-rich region located approximately 25 to 30 bases upstream from the site where transcription is initiated.
- Another sequence found 70 to 80 bases upstream from the start of transcription of many genes is a CNCAAT region where N may be any nucleotide.
- N may be any nucleotide.
- AATAAA sequence At the 3′ end of most eukaryotic genes is an AATAAA sequence that may be the signal for addition of the poly A tail to the 3′ end of the coding sequence. All of these sequences are suitably inserted into eukaryotic expression vectors.
- Antibody polypeptide transcription from vectors in mammalian host cells is controlled, for example, by promoters obtained from the genomes of viruses such as polyoma virus, fowlpox virus, adenovirus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B virus and Simian Virus 40 (SV40), from heterologous mammalian promoters, e.g., the actin promoter or an immunoglobulin promoter, from heat-shock promoters, provided such promoters are compatible with the host cell systems.
- viruses such as polyoma virus, fowlpox virus, adenovirus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B virus and Simian Virus 40 (SV40), from hetero
- the early and late promoters of the SV40 virus are conveniently obtained as an SV40 restriction fragment that also contains the SV40 viral origin of replication.
- the immediate early promoter of the human cytomegalovirus is conveniently obtained as a HindIII E restriction fragment.
- a system for expressing DNA in mammalian hosts using the bovine papilloma virus as a vector is disclosed in U.S. Pat. No. 4,419,446. A modification of this system is described in U.S. Pat. No. 4,601,978. See also Reyes et al., Nature 297:598-601 (1982) on expression of human ⁇ -interferon cDNA in mouse cells under the control of a thymidine kinase promoter from herpes simplex virus. Alternatively, the Rous Sarcoma Virus long terminal repeat can be used as the promoter.
- Enhancer sequences are now known from mammalian genes (globin, elastase, albumin, ⁇ -fetoprotein, and insulin). Typically, however, one will use an enhancer from a eukaryotic cell virus. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
- the enhancer may be spliced into the vector at a position 5′ or 3′ to the antibody polypeptide-encoding sequence, but is preferably located at a site 5′ from the promoter.
- Expression vectors used in eukaryotic host cells will typically also contain sequences necessary for the termination of transcription and for stabilizing the mRNA. Such sequences are commonly available from the 5′ and, occasionally 3′, untranslated regions of eukaryotic or viral DNAs or cDNAs. These regions contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding an antibody.
- One useful transcription termination component is the bovine growth hormone polyadenylation region. See WO94/11026 and the expression vector disclosed therein.
- Suitable host cells for cloning or expressing the DNA in the vectors herein include higher eukaryote cells described herein, including vertebrate host cells. Propagation of vertebrate cells in culture (tissue culture) has become a routine procedure. Examples of useful mammalian host cell lines are monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen Virol. 36:59 (1977)); baby hamster kidney cells (BHK, ATCC CCL 10); Chinese hamster ovary cells/ ⁇ DHFR (CHO, Urlaub et al., Proc. Natl. Acad. Sci.
- COS-7 monkey kidney CV1 line transformed by SV40
- human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen Virol. 36:59 (1977)
- baby hamster kidney cells
- mice sertoli cells TM4, Mather, Biol. Reprod. 23:243-251 (1980)); monkey kidney cells (CV1 ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1587); human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51); TRI cells (Mather et al., Annals N.Y. Acad. Sci. 383:44-68 (1982)); MRC 5 cells; FS4 cells; and a human hepatoma line (Hep G2).
- Host cells are transformed with the above-described expression or cloning vectors for antibody production and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences.
- the host cells used to produce an antibody of this invention may be cultured in a variety of media.
- Commercially available media such as Ham's F10 (Sigma), Minimal Essential Medium ((MEM), (Sigma), RPMI-1640 (Sigma), and Dulbecco's Modified Eagle's Medium ((DMEM), Sigma) are suitable for culturing the host cells.
- any of these media may be supplemented as necessary with hormones and/or other growth factors (such as insulin, transferrin, or epidermal growth factor), salts (such as sodium chloride, calcium, magnesium, and phosphate), buffers (such as HEPES), nucleotides (such as adenosine and thymidine), antibiotics (such as GENTAMYCINTM drug), trace elements (defined as inorganic compounds usually present at final concentrations in the micromolar range), and glucose or an equivalent energy source. Any other necessary supplements may also be included at appropriate concentrations that would be known to those skilled in the art.
- the culture conditions such as temperature, pH, and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
- the antibody can be produced intracellularly, or directly secreted into the medium. If the antibody is produced intracellularly, as a first step, the particulate debris, either host cells or lysed fragments, are removed, for example, by centrifugation or ultrafiltration. Where the antibody is secreted into the medium, supernatants from such expression systems are generally first concentrated using a commercially available protein concentration filter, for example, an Amicon or Millipore Pellicon ultrafiltration unit. A protease inhibitor such as PMSF may be included in any of the foregoing steps to inhibit proteolysis and antibiotics may be included to prevent the growth of adventitious contaminants.
- a protease inhibitor such as PMSF may be included in any of the foregoing steps to inhibit proteolysis and antibiotics may be included to prevent the growth of adventitious contaminants.
- the antibody composition prepared from the cells can be purified using, for example, hydroxylapatite chromatography, gel electrophoresis, dialysis, and affinity chromatography, with affinity chromatography being the preferred purification technique.
- affinity chromatography is the preferred purification technique.
- the suitability of protein A as an affinity ligand depends on the species and isotype of any immunoglobulin Fc domain that is present in the antibody.
- Protein A can be used to purify antibodies that are based on human ⁇ 1, ⁇ 2, or ⁇ 4 heavy chains (Lindmark et al., J. Immunol. Meth. 62:1-13 (1983)).
- Protein G is recommended for all mouse isotypes and for human ⁇ 3 (Guss et al., EMBO J. 5:15671575 (1986)).
- the matrix to which the affinity ligand is attached is most often agarose, but other matrices are available. Mechanically stable matrices such as controlled pore glass or poly(styrenedivinyl)benzene allow for faster flow rates and shorter processing times than can be achieved with agarose. Where the antibody comprises a CH3 domain, the Bakerbond ABXTM resin (J. T. Baker, Phillipsburg, N.J.) is useful for purification.
- the mixture comprising the antibody of interest and contaminants may be subjected to low pH hydrophobic interaction chromatography using an elution buffer at a pH between about 2.5-4.5, preferably performed at low salt concentrations (e.g., from about 0-0.25M salt).
- the antibodies can be characterized for their physical/chemical properties and biological functions by various assays known in the art.
- the purified immunoglobulins can be further characterized by a series of assays including, but not limited to, N-terminal sequencing, amino acid analysis, non-denaturing size exclusion high pressure liquid chromatography (HPLC), mass spectrometry, ion exchange chromatography and papain digestion.
- assays including, but not limited to, N-terminal sequencing, amino acid analysis, non-denaturing size exclusion high pressure liquid chromatography (HPLC), mass spectrometry, ion exchange chromatography and papain digestion.
- the immunoglobulins produced herein are analyzed for their biological activity.
- the immunoglobulins of the present invention are tested for their antigen binding activity.
- the antigen binding assays that are known in the art and can be used herein include without limitation any direct or competitive binding assays using techniques such as western blots, radioimmunoassays, ELISA (enzyme linked immunosorbent assay), “sandwich” immunoassays, immunoprecipitation assays, fluorescent immunoassays, and protein A immunoassays.
- the present disclosure provides crystals of an FGFR3:anti-FGFR3 antibody complex as well as the crystal structure of FGFR3:anti-FGFR3 antibody as determined therefrom.
- the crystals are formed from an FGFR3 sequence comprising sequence
- the crystals are formed from an FGFR3 sequence comprising sequence
- the anti-FGFR3 antibody comprises a light chain variable region comprising HVR-L1, HVR-L2, HVR-L3, wherein each, in order, comprises SEQ ID NO:4, 5, 6, and/or a heavy chain variable region comprising HVR-H1, HVR-H2, and HVR-H3, where each, in order, contains SEQ ID NO: 1, 2, 3.
- the anti-FGFR3 antibody comprises a light chain variable region comprising sequence
- the anti-FGFR3 antibody comprises any antibody disclosed herein or disclosed in co-pending co-owned U.S. Ser. No. ______, filed Mar. 24, 2010 (attorney docket P4294R1).
- the structure of FGFR3 complexed with an anti-FGFR3 antibody was solved by molecular replacement with the program PHASER.
- the crystals are useful to provide the crystal structure and to provide a stable form of the molecule for storage.
- structure coordinates refers to Cartesian coordinates derived from mathematical equations related to the patterns obtained on diffraction of a monochromatic beam of X-rays by the atoms (scattering centers) of a FGFR3 and FGFR3:anti-FGFR3 antibody, in crystal form.
- the diffraction data are used to calculate an electron density map of the repeating unit of the crystal.
- the electron density maps are then used to establish the positions of the individual atoms of the FGFR3, anti-FGFR3 antibody and FGFR3:anti-FGFR3 antibody complex.
- Slight variations in structure coordinates can be generated by mathematically manipulating the FGFR3 and FGFR3:anti-FGFR3 antibody complex structure coordinates.
- the structure coordinates as set forth in Table 6 could be manipulated by crystallographic permutations of the structure coordinates, fractionalization of the structure coordinates, integer additions or subtractions to sets of the structure coordinates, inversion of the structure coordinates, or any combination of the above.
- modifications in the crystal structure due to mutations, additions, substitutions, deletions, and combinations thereof, of amino acids, or other changes in any of the components that make up the crystal could also yield variations in structure coordinates.
- Such slight variations in the individual coordinates will have little effect on overall shape. If such variations are within an acceptable standard error as compared to the original coordinates, the resulting three-dimensional shape is considered to be structurally equivalent. Structural equivalence is described in more detail below.
- the phrase “associating with” refers to a condition of proximity between a ligand, or portions thereof, and a FGFR3 molecule or portions thereof.
- the association may be non-covalent, wherein the juxtaposition is energetically favored by hydrogen bonding, van der Waals forces, and/or electrostatic interactions, or it may be covalent.
- FGFR3 residues that form a binding site for a modulator (e.g., an antagonist or agonist) of FGFR3 are described in the present application.
- the identification of a binding site for a modulator on FGFR3 can be used to design new classes of FGFR3 modulators, such as antagonists, agonists, and like agents, having therapeutic applications, such as, for treating cancer.
- Various computational analyses can be used to determine whether a molecule or portions of the molecule defining structure features are “structurally equivalent,” defined in terms of its three-dimensional structure, to all or part of an activated unbound FGFR3 or FGFR3 bound to an inhibitor, such as an anti-FGFR3 antibody, or FGFR3 present in FGFR3:anti-FGFR3 antibody complex.
- Such analyses may be carried out in current software applications, such as the Molecular Similarity application of QUANTA (Molecular Simulations Inc., San Diego, Calif.), Version 4.1, and as described in the accompanying User's Guide.
- the Molecular Similarity application permits comparisons between different structures, different conformations of the same structure, and different parts of the same structure.
- a procedure used in Molecular Similarity to compare structures comprises: 1) loading the structures to be compared; 2) defining the atom equivalences in these structures; 3) performing a fitting operation; and 4) analyzing the results.
- One structure is identified as the target (i.e., the fixed structure); all remaining structures are working structures (i.e., moving structures). Since atom equivalency within QUANTA is defined by user input, for the purpose of this disclosure equivalent atoms are defined as protein backbone atoms (N, C ⁇ , C, and O) for all conserved residues between the two structures being compared. A conserved residue is defined as a residue that is structurally or functionally equivalent. Only rigid fitting operations are considered.
- the working structure is translated and rotated to obtain an optimum fit with the target structure.
- the fitting operation uses an algorithm that computes the optimum translation and rotation to be applied to the moving structure, such that the root mean square difference of the fit over the specified pairs of equivalent atom is an absolute minimum. This number, given in Angstroms, is reported by QUANTA.
- Structurally equivalent crystal structures have portions of the two molecules that are substantially identical, within an acceptable margin of error.
- the margin of error can be calculated by methods known to those of skill in the art.
- structurally equivalent molecules or molecular complexes are those that are defined by the entire set of structure coordinates listed in Table 7 or 8 ⁇ a root mean square deviation from the conserved backbone atoms of those amino acids of not more than 0.70 ⁇ , preferably 0.5 ⁇ .
- root mean square deviation means the square root of the arithmetic mean of the squares of the deviations. It is a way to express the deviation or variation from a trend or object.
- the “root mean square deviation” defines the variation in the backbone of a protein from the backbone of FGFR3 complex (as defined by the structure coordinates of the complex as described herein) or a defining structural feature thereof.
- Structure coordinates can be used to aid in obtaining structural information about another crystallized molecule or molecular complex.
- the method of the disclosure allows determination of at least a portion of the three-dimensional structure of molecules or molecular complexes that contain one or more structural features that are similar to structural features of at least a portion of the FGFR3, anti-FGFR3 antibody, or FGFR3:anti-FGFR3 antibody complex. These molecules are referred to herein as “structurally homologous” to FGFR3, anti-FGFR3 antibody, or FGFR3:anti-FGFR3 antibody complex. Similar structural features can include, for example, regions of amino acid identity, conserved active site or binding site motifs, and similarly arranged secondary structural elements (for example, binding sites for FGFR3 ligand on FGFR3).
- structural homology is determined by aligning the residues of the two amino acid sequences to optimize the number of identical amino acids along the lengths of their sequences; gaps in either or both sequences are permitted in making the alignment in order to optimize the number of identical amino acids, although the amino acids in each sequence must nonetheless remain in their proper order.
- Two amino acid sequences are compared using the BLAST program, version 2.0.9, of the BLAST 2 search algorithm, as described by Tatusova et al., and available at http:www.ncbi.nlm.nih.gov/BLAST/.
- a structurally homologous molecule is a protein that has an amino acid sequence having at least 80% identity with a wild type or recombinant amino acid sequence of FGFR3, in some embodiments human FGFR3-IIIb or human FGFR3-IIIc.
- a protein that is structurally homologous to FGFR3 includes at least one contiguous stretch of at least 50 amino acids that has at least 80% amino acid sequence identity with the analogous portion of the wild type or recombinant FGFR3.
- Methods for generating structural information about the structurally homologous molecule or molecular complex are well known and include, for example, molecular replacement techniques.
- this disclosure provides a method of utilizing molecular replacement to obtain structural information about a molecule or molecular complex whose structure is unknown comprising:
- FGFR3, anti-FGFR3 antibody, or FGFR3:anti-FGFR3 antibody complex as provided by this disclosure can be used to determine the unsolved structure of a crystallized molecule or molecular complex more quickly and efficiently than attempting to determine such information ab initio.
- Coordinates of structural features of FGFR3 can be utilized including that of trypsin-like serine protease domain.
- Molecular replacement can provide an accurate estimation of the phases for an unknown or incompletely known structure. Phases are one factor in equations that are used to solve crystal structures, and this factor cannot be determined directly. Obtaining accurate values for the phases, by methods other than molecular replacement, can be a time-consuming process that involves iterative cycles of approximations and refinements and greatly hinders the solution of crystal structures. However, when the crystal structure of a protein containing at least a structurally homologous portion has been solved, molecular replacement using the known structure provide a useful estimate of the phases for the unknown or incompletely known structure.
- this method involves generating a preliminary model of a molecule or molecular complex whose structure coordinates are unknown, by orienting and positioning the relevant portion of the FGFR3, anti-FGFR3 antibody, or FGFR3:anti-FGFR3 antibody complex within the unit cell of the crystal of the unknown molecule or molecular complex. This orientation or positioning is conducted so as best to account for the observed X-ray diffraction pattern of the crystal of the molecule or molecular complex whose structure is unknown. Phases can then be calculated from this model and combined with the observed X-ray diffraction pattern amplitudes to generate an electron density map of the structure.
- This map in turn, can be subjected to established and well-known model building and structure refinement techniques to provide a final, accurate structure of the unknown crystallized molecule or molecular complex (see for example, Lattman, 1985. Methods in Enzymology 115:55-77).
- Structural information about a portion of any crystallized molecule or molecular complex that is sufficiently structurally homologous to a portion of FGFR3, anti-FGFR3 antibody, or FGFR3:anti-FGFR3 antibody complex can be solved by this method.
- a molecule that shares one or more structural features with the FGFR3, such as the extracellular ligand binding region, with two or three immunoglobulin-like domains (IgD1-3) and an acid box, and/or FGFR3, anti-FGFR3 antibody, or FGFR3:anti-FGFR3 antibody complex as described above a molecule that has similar bioactivity, such as the same ligand binding activity as FGFR3 and/or anti-FGFR3 antibody, may also be sufficiently structurally homologous to a portion of the FGFR3 and/or antiFGFR3 antibody to permit use of the structure coordinates of FGFR3:anti-FGFR3 antibody to solve its crystal structure or identify structural features that are similar to those identified in the FGFR3 described herein. It will be appreciated that amino acid residues in the structurally homologous molecule identified as corresponding to the FGFR3 structural feature may have different amino acid numbering.
- the method of molecular replacement is utilized to obtain structural information about a molecule or molecular complex, wherein the molecule or molecular complex includes at least one FGFR3, anti-FGFR3 antibody, or FGFR3:anti-FGFR3 antibody complex subunit or homolog.
- a “structural homolog” of the FGFR3, anti-FGFR3 antibody, or FGFR3:anti-FGFR3 antibody complex is a protein that contains one or more amino acid substitutions, deletions, additions, or rearrangements with respect to the amino acid sequence of FGFR3, anti-FGFR3 antibody, or FGFR3:anti-FGFR3 antibody complex but that, when folded into its native conformation, exhibits or is reasonably expected to exhibit at least a portion of the tertiary (three-dimensional) structure of at least a portion of FGFR3, anti-FGFR3 antibody, or FGFR3:anti-FGFR3 antibody complex.
- a portion of the FGFR3 includes the binding site for an FGFR3 inhibitor.
- a heavy atom derivative of FGFR3 is also included as a FGFR3 homolog.
- the term “heavy atom derivative” refers to derivatives of FGFR3, anti-FGFR3 antibody, or FGFR3:anti-FGFR3 antibody complex produced by chemically modifying a crystal of FGFR3 or both.
- a crystal is soaked in a solution containing heavy metal atom salts, or organometallic compounds, e.g., lead chloride, gold thiomalate, thiomersal or uranyl acetate, which can diffuse through the crystal and bind to the surface of the protein.
- the location(s) of the bound heavy metal atom(s) can be determined by X-ray diffraction analysis of the soaked crystal. This information, in turn, is used to generate the phase information used to construct three-dimensional structure of the protein (Blundell, et al., 1976, Protein Crystallography, Academic Press, San Diego, Calif.).
- Variants may be prepared, for example, by expression of FGFR3 cDNA previously altered in its coding sequence by oligonucleotide-directed mutagenesis as described herein. Variants may also be generated by site-specific incorporation of unnatural amino acids into FGFR3 proteins using known biosynthetic methods (Noren, et al., 1989, Science 244:182-88). In this method, the codon encoding the amino acid of interest in wild-type FGFR3 is replaced by a “blank” nonsense codon, TAG, using oligonucleotide-directed mutagenesis. A suppressor tRNA directed against this codon is then chemically aminoacylated in vitro with the desired unnatural amino acid. The aminoacylated tRNA is then added to an in vitro translation system to yield a mutant FGFR3 with the site-specific incorporated unnatural amino acid.
- structurally homologous molecules can contain deletions or additions of one or more contiguous or noncontiguous amino acids, such as a loop or a domain.
- Structurally homologous molecules also include “modified” FGFR3, anti-FGFR3 antibody, or FGFR3:anti-FGFR3 antibody complex that have been chemically or enzymatically derivatized at one or more constituent amino acid, including side chain modifications, backbone modifications, and N- and C-terminal modifications including acetylation, hydroxylation, methylation, amidation, and the attachment of carbohydrate or lipid moieties, cofactors, and like modifications.
- amino acid residues in the structurally homologous molecule identified as corresponding to activated FGFR3 or other structural feature of the FGFR3 may have different amino acid numbering.
- the structure coordinates of FGFR3 are also particularly useful to solve or model the structure of crystals of FGFR3, anti-FGFR3 antibody, or FGFR3:anti-FGFR3 antibody complex homologs, which are co-complexed with a variety of ligands (e.g., a ligand binding the antagonist binding site).
- ligands e.g., a ligand binding the antagonist binding site.
- This approach enables the determination of the optimal sites for interaction between ligand, including candidate FGFR3 ligands.
- Potential sites for modification within the various binding sites (such as an FGFR3 binding site) of the molecule can also be identified. This information provides an additional tool for determining more efficient binding interactions, for example, increased hydrophobic or polar interactions, between FGFR3 and a ligand.
- All of the complexes referred to above may be studied using well-known X-ray diffraction techniques and may be refined versus 1.5-3.5 ⁇ resolution X-ray data to an R-factor of about 0.30 or less using computer software, such as X-PLOR (Yale University, distributed by Molecular Simulations, Inc.) (see for example, Blundell, et al. 1976. Protein Crystallography, Academic Press, San Diego, Calif., and Methods in Enzymology, Vol. 114 & 115, H. W. Wyckoff et al., eds., Academic Press (1985)). This information may thus be used to optimize known FGFR3 modulators, and more importantly, to design new FGFR3 modulators.
- the disclosure also includes the unique three-dimensional configuration defined by a set of points defined by the structure coordinates for a molecule or molecular complex structurally homologous to FGFR3, anti-FGFR3 antibody, or FGFR3:anti-FGFR3 antibody complex as determined using the method of the present disclosure, structurally equivalent configurations, and magnetic storage media including such set of structure coordinates.
- a computer model of a homolog e.g., an FGFR3 homolog
- a preliminary model of the homolog is created by sequence alignment with FGFR3, anti-FGFR3 antibody, or FGFR3:anti-FGFR3 antibody complex secondary structure prediction, the screening of structural libraries, or any combination of those techniques.
- Computational software may be used to carry out the sequence alignments and the secondary structure predictions.
- Structural incoherences e.g., structural fragments around insertions and deletions, can be modeled by screening a structural library for peptides of the desired length and with a suitable conformation.
- a side chain rotamer library may be employed. If the homolog has been crystallized, the final homology model can be used to solve the crystal structure of the homolog by molecular replacement, as described above. Next, the preliminary model is subjected to energy minimization to yield an energy-minimized model.
- the energy-minimized model may contain regions where stereochemistry restraints are violated, in which case such regions are remodeled to obtain a final homology model.
- the homology model is positioned according to the results of molecular replacement, and subjected to further refinement including molecular dynamics calculations.
- Potent and selective ligands that modulate activity can be identified using the three-dimensional model of the FGFR3 using the coordinates of Table 6.
- the three-dimensional model of the binding site on FGFR3 and/or other structural features are produced using the coordinates of Table 6.
- candidate ligands that interact with the FGFR3, e.g., the FGFR3 binding site are assessed for the desired characteristics (e.g., interaction with FGFR3) by fitting against the model, and the result of the interactions is predicted.
- Agents predicted to be molecules capable of modulating the activity of FGFR3 can then be further screened or confirmed against known bioassays.
- the ability of an agent to inhibit the effects of FGFR3 can be measured using assays known in the art. Using the modeling information and the assays described, one can identify agents that possess FGFR3-modulating properties.
- Modulators of FGFR3 of the present disclosure can include compounds or agents having, for example, inhibitory activity.
- Ligands which can interact with FGFR3 can also be identified using commercially available modeling software, such as docking programs, in which the solved crystal structure coordinates of Table 6 can be computationally represented and screened against a large virtual library of small molecules or virtual fragment molecules for interaction with a site of interest, such as the FGFR3 binding site. Preferred small molecules or fragments identified in this way can be synthesized and contacted with the FGFR ⁇ tilde over (3) ⁇ . The resulting molecular complex or association can be further analyzed by, for example, NMR or X-ray co-crystallography, to optimize the FGFR3 ligand interaction and/or desired biological activity.
- Fragment-based drug discovery methods are known and computational tools for their use are commercially available, for example “SAR by NMR” (Shukers, S. B., et al., Science, 1996, 274, 1531-1534), “Fragments of Active Structures” (www.stromix.com; Nienaber, V. L., et al., Nat. Biotechnol., 2000, 18, 1105-1108), and “Dynamic Combinatorial X-ray Crystallography” (e.g., permitting self-selection by the protein molecule of self-assembling fragments; Congreve, M. S., et al., Angew. Chem., Int. Ed., 2003, 42, 4479-4482). Still other molecular modeling, and like methods are discussed below and in the Examples.
- a candidate modulator in another embodiment, can be identified using a biological assay such as binding to FGFR3, modulation (e.g., inhibition) of FGFR3 ligand activation of FGFR3, modulation (e.g., inhibition) of FGFR3 biological activity.
- the candidate modulator can then serve as a model to design similar agents and/or to modify the candidate modulator for example, to improve characteristics such as binding to FGFR3.
- Design or modification of candidate modulators can be accomplished using the crystal structure coordinates and available software.
- binding sites are of significant utility in fields such as drug discovery.
- the association of natural ligands or substrates with the binding sites of their corresponding receptors or enzymes is the basis of many biological mechanisms of action.
- many drugs exert their biological effects through association with the binding sites of receptors and enzymes.
- Such associations may occur with all or any part of the binding site.
- An understanding of such associations helps lead to the design of drugs having more favorable associations with their target, and thus improved biological effects. Therefore, this information is valuable in designing potential modulators of FGFR3 binding sites, as discussed in more detail below.
- the amino acid constituents of a FGFR3 binding site as defined herein are positioned in three dimensions.
- the structural coordinates of FGFR3 with a bound inhibitor are in Table 6.
- the structure coordinates defining a binding site of FGFR3 include structure coordinates of all atoms in the constituent amino acids; in another aspect, the structure coordinates of a binding site include structure coordinates of just the backbone atoms of the constituent atoms.
- FGFR3 that is bound to an inhibitor has a different conformation than when inhibitor is not bound. In the bound state, a number of amino acid residues form a pocket.
- the FGFR3 binding site may be defined by those amino acids whose backbone atoms are situated within about 5 ⁇ of one or more constituent atoms of a bound ligand.
- Computational techniques can be used to screen, identify, select, design ligands, and combinations thereof, capable of associating with FGFR3 or structurally homologous molecules.
- Candidate modulators of FGFR3 may be identified using functional assays, such as binding to FGFR3, and novel modulators designed based on the structure of the candidate molecules so identified.
- Knowledge of the structure coordinates for FGFR3 permits, for example, the design, the identification of synthetic compounds, and like processes, and the design, the identification of other molecules and like processes, that have a shape complementary to the conformation of the FGFR3 binding sites.
- computational techniques can be used to identify or design ligands, such as agonists and/or antagonists, that associate with a FGFR3 binding site.
- Antagonists may bind to or interfere with all or a portion of an active site of FGFR3, and can be competitive, non-competitive, or uncompetitive inhibitors. Once identified and screened for biological activity, these agonists, antagonists, and combinations thereof, may be used therapeutically and/or prophylactically, for example, to block FGFR3 activity and thus prevent the onset and/or further progression of diseases associated with FGFR3 activity. Structure-activity data for analogues of ligands that bind to or interfere with FGFR3 binding sites can also be obtained computationally.
- agonists or antagonists can be designed to include components that preserve and/or strengthen the interactions.
- Such antagonists or agonists would include components that are able to interact, for example, hydrogen bond with the charged amino acids found in, e.g., either an antagonist binding site of FGFR3 (activated or unactivated, bound to substrate or unbound to substrate) or FGFR3 bound to an inhibitor or both.
- antagonist or agonist molecules are designed or selected that can interact with at least one or all amino acid residues that comprise, consist essentially of, or consist of at least one amino acid residue corresponding to an amino acid residue in one or more of the binding site, or mixtures thereof.
- Data stored in a machine-readable storage medium that is capable of displaying a graphical three-dimensional representation of the structure of FGFR3 or a structurally homologous molecule or molecular complex, as identified herein, or portions thereof may thus be advantageously used for drug discovery.
- the structure coordinates of the ligand are used to generate a three-dimensional image that can be computationally fit to the three-dimensional image of FGFR3 and anti-FGFR3 antibody, or a structurally homologous molecule.
- the three-dimensional molecular structure encoded by the data in the data storage medium can then be computationally evaluated for its ability to associate with ligands.
- the protein structure can also be visually inspected for potential association with ligands.
- One embodiment of the method of drug design involves evaluating the potential association of a candidate ligand with FGFR3 or a structurally homologous molecule or homologous complex, particularly with at least one amino acid residue in a binding site (e.g., a binding site) of the FGFR3 or a portion of the binding site.
- the method of drug design thus includes computationally evaluating the potential of a selected ligand to associate with any of the molecules or molecular complexes set forth above.
- This method includes the steps of: (a) employing computational means, for example, such as a programmable computer including the appropriate software known in the art or as disclosed herein, to perform a fitting operation between the selected ligand and a ligand binding site or a subsite of the ligand binding site of the molecule or molecular complex; and (b) analyzing the results of the fitting operation to quantify the association between the ligand and the ligand binding site.
- the method further comprises analyzing the ability of the selected ligand to interact with amino acids in the FGFR3 binding site and/or subsite.
- the method may also further comprise optimizing the fit of the ligand for the binding site of FGFR3 as compared to other receptors.
- the selected ligand can be synthesized, cocrystallized with FGFR3, and further modifications to selected ligand can be made to enhance inhibitory activity or fit in the binding pocket.
- portions of anti-FGFR3 antibody that bind to FGFR3 can be modified and utilized in the method described herein.
- Other structural features of the FGFR3 and/or FGFR3:anti-FGFR3 antibody complex can also be analyzed in the same manner.
- the method of drug design involves computer-assisted design of ligand that associates with FGFR3, its homologs, or portions thereof.
- Ligands can be designed in a step-wise fashion, one fragment at a time, or may be designed as a whole or de novo.
- Ligands can be designed based on the structure of molecules that can modulate at least one biological function of FGFR3, such as anti-FGFR3 antibody and other naturally occurring inhibitors of FGFR3.
- the inhibitors can be modeled on other known inhibitors of receptors, such as FGFRs.
- the ligand identified or designed according to the method must be capable of structurally associating with at least part of a FGFR3 binding site (e.g., a FGFR3 binding site), and must be able, sterically and energetically, to assume a conformation that allows it to associate with the FGFR3 binding site.
- Non-covalent molecular interactions important in this association include hydrogen bonding, van der Waals interactions, hydrophobic interactions, and/or electrostatic interactions.
- an agent may contact at least one amino acid position in the FGFR3 binding site (e.g., a binding site) for an inhibitor, such as anti-FGFR3 antibody.
- Conformational considerations include the overall three-dimensional structure and orientation of the ligand in relation to the ligand binding site, and the spacing between various functional groups of a ligand that directly interact with the FGFR3 binding site or homologs thereof.
- the potential binding of a ligand to a FGFR3 binding site is analyzed using computer modeling techniques prior to the actual synthesis and testing of the ligand. If these computational experiments suggest insufficient interaction and association between it and the FGFR3 binding site, testing of the ligand is obviated. However, if computer modeling indicates a strong interaction, the molecule may then be synthesized and tested for its ability to bind to or interfere with a FGFR3 binding site. Binding assays to determine if a compound actually modulates FGFR3 activity can also be performed and are well known in the art.
- FGFR3 binding site e.g., an antagonist binding site
- This process may begin by visual inspection of, for example, a FGFR3 binding site on the computer screen based on the FGFR3 structure coordinates or other coordinates which define a similar shape generated from the machine-readable storage medium.
- Selected ligands may then be positioned in a variety of orientations, or docked, within the binding site. Docking may be accomplished using software such as QUANTA and SYBYL, followed by energy minimization and molecular dynamics with standard molecular mechanics force fields, such as CHARMM and AMBER.
- Specialized computer programs may also assist in the process of selecting ligands. Examples include GRID (Hubbard, S. 1999. Nature Struct. Biol. 6:711-4); MCSS (Miranker, et al. 1991. Proteins 11:29-34) available from Molecular Simulations, San Diego, Calif.; AUTODOCK (Goodsell, et al. 1990. Proteins 8:195-202) available from Scripps Research Institute, La Jolla, Calif.; and DOCK (Kuntz, et al. 1982. J. Mol. Biol. 161:269-88) available from University of California, San Francisco, Calif.
- FGFR3 binding ligands can be designed to fit a FGFR3 binding site, optionally as defined by the binding of a known modulator or one identified as modulating the activity of FGFR3.
- ligand design methods including, without limitation, LUDI (Bohm, 1992. J. Comput. Aided Molec. Design 6:61-78) available from Molecular Simulations Inc., San Diego, Calif.; LEGEND (Nishibata, Y., and Itai, A. 1993. J. Med. Chem. 36:2921-8) available from Molecular Simulations Inc., San Diego, Calif.; LeapFrog, available from Tripos Associates, St. Louis, Mo.; and SPROUT (Gillet, et al. 1993. J. Comput. Aided Mol. Design 7:127-53) available from the University of Leeds, UK.
- FGFR3 binding site ligands may interact with the binding site in more than one conformation that is similar in overall binding energy. In those cases, the deformation energy of binding is taken to be the difference between the free energy of the ligand and the average energy of the conformations observed when the ligand binds to the protein.
- a ligand designed or selected as binding to or interfering with a FGFR3 binding site may be further computationally optimized so that in its bound state it would preferably lack repulsive electrostatic interaction with the target enzyme and with the surrounding water molecules.
- Such non-complementary electrostatic interactions include repulsive charge-charge, dipole-dipole, and charge-dipole interactions.
- Another approach encompassed by this disclosure is the computational screening of small molecule databases for ligands or compounds that can bind in whole, or in part, to a FGFR3 binding site whether in bound or unbound conformation.
- the quality of fit of such ligands to the binding site may be judged either by shape complementarity or by estimated interaction energy (Meng, et al., 1992. J. Comp. Chem., 13:505-24).
- these small molecule databases can be screened for the ability to interact with the amino acids in the FGFR3 binding site as identified herein.
- a compound that is identified or designed as a result of any of these methods can be obtained (or synthesized) and tested for its biological activity, for example, binding and/or inhibition of FGFR3 activity.
- a method involves assessing agents that are antagonists or agonists of the FGFR3 receptor.
- a method comprises applying at least a portion of the crystallography coordinates of Table 6 to a computer algorithm that generates a three-dimensional model of a FGFR3:anti-FGFR3 antibody complex or the FGFR3 suitable for designing molecules that are antagonists or agonists and searching a molecular structure database to identify potential antagonists or agonists.
- a portion of the structural coordinates of Table 6 that define a structural feature for example, all or a portion of a binding site (e.g., an antagonist binding site) for an inhibitor on FGFR3.
- the method may further comprise synthesizing or obtaining the agonist or antagonist and contacting the agonist or antagonist with the FGFR3 and selecting the antagonist or agonist that modulates the FGFR3 activity compared to a control without the agonist or antagonists and/or selecting the antagonist or agonist that binds to the FGFR3.
- a compound that is identified or designed as a result of any of these methods can be obtained (or synthesized) and tested for its biological activity, for example, binding to FGFR3 and/or modulation of FGFR3 activity.
- the disclosure thus further provides a machine-readable storage medium including a data storage material encoded with machine-readable data wherein a machine programmed with instructions for using said data displays a graphical three-dimensional representation of any of the molecule or molecular complexes of this disclosure that have been described above.
- the machine-readable data storage medium includes a data storage material encoded with machine-readable data wherein a machine programmed with instructions for using the abovementioned data displays a graphical three-dimensional representation of a molecule or molecular complex including all or any parts of an unbound FGFR3, a FGFR3 ligand binding site for an inhibitor or pseudo substrate, or FGFR3-like ligand binding site, anti-FGFR3 antibody, FGFR3:anti-FGFR3 antibody complex as defined above.
- the machine-readable data storage medium includes a data storage material encoded with machine readable data wherein a machine programmed with instructions for using the data displays a graphical three-dimensional representation of a molecule or molecular complex ⁇ a root mean square deviation from the atoms of the amino acids of not more than 0.05 ⁇ .
- the machine-readable data storage medium includes a data storage material encoded with a first set of machine readable data which includes the Fourier transform of structure coordinates, and wherein a machine programmed with instructions for using the data is combined with a second set of machine readable data including the X-ray diffraction pattern of a molecule or molecular complex to determine at least a portion of the structure coordinates corresponding to the second set of machine readable data.
- a system for reading a data storage medium may include a computer including a central processing unit (“CPU”), a working memory which may be, for example, RAM (random access memory) or “core” memory, mass storage memory (such as one or more disk drives or CD-ROM drives), one or more display devices (e.g., cathode-ray tube (“CRT”) displays, light emitting diode (“LED”) displays, liquid crystal displays (“LCDs”), electroluminescent displays, vacuum fluorescent displays, field emission displays (“FEDs”), plasma displays, projection panels, etc.), one or more user input devices (e.g., keyboards, microphones, mice, track balls, touch pads, etc.), one or more input lines, and one or more output lines, all of which are interconnected by a conventional bidirectional system bus.
- CPU central processing unit
- working memory which may be, for example, RAM (random access memory) or “core” memory, mass storage memory (such as one or more disk drives or CD-ROM drives), one or more display devices (e.g.,
- the system may be a stand-alone computer, or may be networked (e.g., through local area networks, wide area networks, intranets, extranets, or the internet) to other systems (e.g., computers, hosts, servers, etc.).
- the system may also include additional computer controlled devices such as consumer electronics and appliances.
- Input hardware may be coupled to the computer by input lines and may be implemented in a variety of ways. Machine-readable data of this disclosure may be inputted via the use of a modem or modems connected by a telephone line or dedicated data line. Alternatively or additionally, the input hardware may include CD-ROM drives or disk drives. In conjunction with a display terminal, a keyboard may also be used as an input device.
- Output hardware may be coupled to the computer by output lines and may similarly be implemented by conventional devices.
- the output hardware may include a display device for displaying a graphical representation of a binding site of this disclosure using a program such as QUANTA as described herein.
- Output hardware might also include a printer, so that hard copy output may be produced, or a disk drive, to store system output for later use.
- a CPU coordinates the use of the various input and output devices, coordinates data accesses from mass storage devices, accesses to and from working memory, and determines the sequence of data processing steps.
- a number of programs may be used to process the machine-readable data of this disclosure. Such programs are discussed in reference to the computational methods of drug discovery as described herein. References to components of the hardware system are included as appropriate throughout the following description of the data storage medium.
- Machine-readable storage devices useful in the present disclosure include, but are not limited to, magnetic devices, electrical devices, optical devices, and combinations thereof.
- Examples of such data storage devices include, but are not limited to, hard disk devices, CD devices, digital video disk devices, floppy disk devices, removable hard disk devices, magneto-optic disk devices, magnetic tape devices, flash memory devices, bubble memory devices, holographic storage devices, and any other mass storage peripheral device.
- these storage devices include necessary hardware (e.g., drives, controllers, power supplies, etc.) as well as any necessary media (e.g., disks, flash cards, etc.) to enable the storage of data.
- FGFR3 modulator compounds obtained by methods of the invention are useful in a variety of therapeutic settings.
- FGFR3 antagonists designed or identified using the crystal structure of FGFR3 complex can be used to treat disorders or conditions where inhibition or prevention of FGFR3 binding or activity is indicated.
- FGFR3 agonists designed or identified using the binding site and/or crystal structures provided herein can be used to treat disorders or conditions where induction or stimulation of FGFR3 is indicated.
- An indication can be, for example, inhibition or stimulation of FGFR3 activation and the concomitant activation of a complex set of intracellular pathways that lead to cell growth in a variety of cell types. Yet another indication can be, for example, in inhibition or stimulation of the FGFR3 signaling pathway. Still yet another indication can be, for example, in inhibition or stimulation of invasive tumor growth and metastasis.
- the cell line RT4 was obtained from American Type Cell Culture Collection.
- Cell lines RT112, OPM2 and Ba/F3 were purchased from German Collection of Microorganisms and Cell Cultures (DSMZ, (Germany)).
- Multiple myeloma cell line KMS11 was kindly provided by Dr. Takemi Otsuki at Kawasaki Medical School (Japan).
- Bladder cancer cell line TCC-97-7 was a generous gift from Dr. Margaret Knowles at St James's University Hospital (Leeds, UK).
- UMUC-14 cell line was obtained from Dr. H. B. Grossman (currently at University of Texas M.D. Anderson Cancer Center, TX).
- the cells were maintained with RPMI medium supplemented with 10% fetal bovine serum (FBS) (Sigma), 100 U/ml penicillin, 0.1 mg/ml streptomycin and L-glutamine under conditions of 5% CO 2 at 37° C.
- FBS fetal bovine serum
- UMUC-14 cells were grown in cysteine-free medium, treated with R3Mab or DTNB for 3 hr, and cell lysates were subject to immunoblot analysis under reducing or non-reducing conditions.
- FGFR3-IIIb S249C (residues 143-374) was cloned into pAcGP67A vector and expressed in T.ni Pro cells. The recombinant protein was purified through Ni-NTA column followed by Superdex S200 column. Dimeric FGFR3 S249C was eluted in 25 mM Tris (pH 7.5) and 300 mM NaCl.
- R3Mab (1 ⁇ M) was incubated with FGFR3 S249C dimer (0.1 ⁇ M) at 37° C. under the following conditions: 100 mM KH 2 PO4 (pH 7.5), 25 ⁇ M DTT, 1 mM EDTA and 0.75 mg/ml BSA. Aliquots of the reaction were taken at indicated time points and the reaction was stopped by adding sample buffer without ⁇ -mercaptoethanol. Dimer-monomer was analyzed by immunoblot.
- mice or CB 17 severe combined immunodeficiency mice Female nu/nu mice or CB 17 severe combined immunodeficiency (SCID) mice, 6-8 weeks of age, were purchased from Charles River Laboratory (Hollister, Calif.). Female athymic nude mice were obtained from the National Cancer Institute-Frederick Cancer Center. Mice were maintained under specific pathogen-free conditions.
- RT112 shRNA stable cells (7 ⁇ 10 6 ), RT112 (7 ⁇ 10 6 ), Ba/F3-FGFR3 S249C (5 ⁇ 10 6 ), OPM2 (15 ⁇ 10 6 ), or KMS11 cells (20 ⁇ 10 6 ) were implanted subcutaneously into the flank of mice in a volume of 0.2 ml in HBSS/matrigel (1:1 v/v, BD Biosciences).
- mice were randomized into groups of 10 and were treated twice weekly with intraperitoneal (i.p) injection of R3Mab (0.3-50 mg/kg), or a control human IgG1 diluted in HBSS. Control animals were given vehicle (HBSS) alone.
- shRNA2 (SEQ ID NO: 192) 5′GATCCCCGCATCAAGCTGCGGCATCATTCAAGAGATGATGCCGCAG CTTGATGCTTTTTTGGAAA;
- shRNA4 (SEQ ID NO: 193) 5′-GATCCCCTGCACAACCTCGACTACTATTCAAGAGATAGTAGTCGA GGTTGTGCATTTTTTGGAAA-3′;
- shRNA6 (SEQ ID NO: 194) 5′-GATCCCCAACCTCGACTACTACAAGATTCAAGAGATCTTGTAGTAG TCGAGGTTTTTTTTGGAAA-3′. All constructs were confirmed by sequencing. EGFP control shRNA was described in our previous study (50).
- the shRNA containing retrovirus was produced by co-transfecting GP2-293 packaging cells (Clontech Laboratories, Mountain View, Calif.) with VSV-G (Clontech Laboratories) and pHUSH-FGFR3 shRNA constructs, and viral supernatants were harvested 72 hr after transfection, and cleared of cell debris by centrifugation for transduction experiment.
- RT112 cells were maintained in RPMI 1640 medium containing tetracycline-free FBS (Clontech Laboratories), and transduced with retroviral supernatant in the presence of 4 ⁇ g/ml polybrene. 72 hours after infection, 2 ⁇ g/ml puromycin (Clontech Laboratories) was added to the medium to select stable clones expressing shRNA. Stable cells were isolated, treated with 0.1 or 1 ⁇ g/ml doxycycline (Clontech Laboratories) for 4 days, and inducible knockdown of FGFR3 protein expression was assessed by Western blotting analysis. Cell cycle analyses were performed as described (51).
- Human phage antibody libraries with synthetic diversities in the selected complementary determining regions (H1, H2, H3, L3), mimicking the natural diversity of human IgG repertoire were used for panning.
- the Fab fragments were displayed bivalently on the surface of M13 bacteriophage particles (52). His-tagged IgD2-D3 of human FGFR3-IIIb and IIIc were used as antigens.
- 96-well MaxiSorp immunoplates (Nunc) were coated overnight at 4° C. with FGFR3-IIIb-His protein or FGFR3-IIIC-His protein (10 ⁇ g/ml) and blocked for 1 hour with PBST buffer (PBS with 0.05% Tween 20) supplemented with 1% BSA.
- the antibody phage libraries were added and incubated overnight at room temperature (RT). The plates were washed with PBST buffer and bound phage were eluted with 50 mM HCl and 500 mM NaCl for 30 minutes and neutralized with equal volume of 1M Tris base. Recovered phages were amplified in E. coli XL-1 blue cells. During subsequent selection rounds, the incubation time of the phage antibodies was decreased to 2 hours and the stringency of plate washing was gradually increased (53). Unique and specific phage antibodies that bind to both IIIb and IIIc isoforms of FGFR3 were identified by phage ELISA and DNA sequencing.
- phagemid displaying monovalent Fab on the surface of M13 bacteriophage served as the library template for grafting light chain (VL) and heavy chain (VH) variable domains of the phage Ab. Stop codons was incorporated in CDR-L3.
- a soft randomization strategy was adopted for affinity maturation as described (53). Two different combinations of CDR loops, H1/H2/L3, H3/L3, or L1/L2/L3 were selected for randomization.
- affinity-matured clones phage libraries were sorted against FGFR3-IIIb or IIIc-His protein, subjected to plate sorting for the first round and followed by four rounds of solution phase sorting as described (52).
- the increased inhibitory activity ranged from about 50-fold (clone 184.6.52) to about 100-fold (clones 184.6.1, 184.6.21, 184.6.49, 184.6.51, 184.6.58, 184.6.62 and 184.6.92) greater than parent clone 184.6, depending on the cell line assayed. Binding kinetics of clones 184.6.1, 184.6.58, and 184.6.62 to FGFR3-IIIb and FGFR3-IIIc were determined using BIAcore as follows:
- Clone 184.6.1 was selected.
- a sequence modification, N54S was introduced into HVR H2 at residue 54, to improve manufacturability, creating clone 184.6.1N54S.
- Clones 184.6.1 and 184.6.1N54S displayed comparable binding kinetics (measured in Biacore assays) and comparable activity in the Ba/F3 cell viability assay.
- Additional HVR H2 variants were generated: N54S was introduced in clone 184.6.58, and N54G, N54A, or N54Q were introduced in clone 184.6.1 and 184.6.58. These clones showed comparable activity in the Ba/F3 cell viability assay to parent clones 184.6.1 or 184.6.58.
- R3Mab refers to anti-FGFR3 antibody clones 184.6.1N54S, 184.6.1, or 184.6. Clone 184.6.1N54S was used in figures and experiments referencing “R3Mab”, except in the experiments leading to the results shown in the following figures (for which the antibody used is shown in parentheses): FIGS. 9B (clone 184.6.1), 10 (clone 184.6), 11 A and B (clone 184.6), 13 (clone 184.6.1), 14 A (clone 184.6.1), 14 B, G, and H (clone 184.6), 19 (clone 184.6.1), and 22 B and C (clone 184.6.1).
- Binding affinities of R3Mab to FGFR3 were measured by Biacore/SRP using a BIAcoreTM-3000 instrument as described (52) with the following modifications.
- R3Mab was directly coated on CM5 biosensor chips to achieve approximately 400 response units (RU).
- RU response units
- two-fold serial dilutions of FGFR3-IIIb or IIIc-His protein starting from 67 nM
- Association rates (Kon, per molls) and dissociation rates (Koff, per s) were calculated using a simple one-one Langmuir binding model (BIAcore Evaluation Software version 3.2).
- the equilibrium dissociation constant (Kd, per mol) was calculated as the ratio of Koff/Kon.
- Binding affinities of mouse hybridoma antibodies to FGFR3 were measured by Biacore/SRP as follows. Human FGFR3-IIIb or IIIc was coupled onto three different flow cells (FC), FC2, FC3 and FC4, of a BIACORETM CM5 sensor chip to achieve the response unit (RU) about 50 RU. Immobilization was achieved by random coupling through amino groups using a protocol provided by the manufacturer. Sensorgrams were recorded for binding of hybridoma-derived anti-FGFR3-murine IgG or the Fab fragment to these surfaces at 25° C. by injection of a series of solutions ranging from 250 nM to 0.48 nM in 2-fold increments at a flow rate of 30 ⁇ l/min.
- cDNAs encoding the extracellular domains (ECD) of human FGFR1-IIIb, IIIc, FGFR2-IIIb and IIIc, FGFR3-IIIb and IIIc, and FGFR4 were cloned into pRK-based vector to generate human FGFR-human Fc chimeric proteins.
- the recombinant proteins were produced by transiently transfecting Chinese hamster ovary (CHO) cells and purified via protein A affinity chromatography. To test binding of antibodies to human FGFRs, Maxisorp 96-well plates (Nunc) were coated overnight at 4° C. with 50 ⁇ l of 2 ⁇ g/ml of FGFR ECD-human Fc chimeric proteins.
- FGFR3 antibody After blocking with phosphate-buffered saline (PBS)/3% BSA, FGFR3 antibody was added and incubated at RT for 2 hours. Specifically bound FGFR3 antibody was detected using an HRP-conjugated anti-human Fab and the TMB peroxidase colorigenic substrate (KPL, Gaithersburg, Md.).
- PBS phosphate-buffered saline
- KPL TMB peroxidase colorigenic substrate
- FGFR3-Fc chimeric proteins were captured on Maxisorp plate coated with anti-human immunoglobulin Fc ⁇ fragment-specific antibody (Jackson Immunoresearch, West Grove, Pa.). After wash, increasing amount of FGFR3 antibody was added to the plate and incubated for 30 minutes. Then, FGF1 or FGF9 and heparin were added for incubation at RT for 2 hours.
- the plates were washed and incubated for 1 hour with biotinylated FGF1-specific polyclonal antibody (BAF232) or biotinylated FGF9 antibody (BAF273, R&D Systems), followed by detection with streptavidin-HRP and TMB.
- biotinylated FGF1-specific polyclonal antibody BAF232
- biotinylated FGF9 antibody BAF273, R&D Systems
- cDNA encoding full-length human FGFR3-IIIb or IIIc was cloned into pQCXIP vector (Clontech Laboratories, Mountain View, Calif.) to generate pQCXIP-FGFR3-IIIb or IIIc.
- pQCXIP vector Clontech Laboratories, Mountain View, Calif.
- Specific mutations i.e., R248C, S249C, G372C, Y375C and K652E, were introduced into the cDNA via QuickChange (Stratagene, La Jolla, Calif.).
- QuickChange Stratagene, La Jolla, Calif.
- various pQCXIP-FGFR3 constructs were co-transfected into packaging cells GP2-293 with VSV-G plasmid (Clontech Laboratories).
- cells expressing wild type or mutant FGFR3 were stained with Phycoerythrin-conjugated anti-human FGFR3 mAb (FAB766P, R&D Systems), and selected through fluorescence-activated cell sorting (FACS) for functional assays.
- FACS fluorescence-activated cell sorting
- RT112, RT4 and TCC-97-7 cells 3000 cells/well were seeded into 96-well micro-titer plate and were allowed to adhere overnight. The medium was then replaced with low serum medium (0.5% FBS) with control or R3Mab at concentrations indicated. Following 4 days incubation, l ⁇ Ci of [Methyl-3H] thymidine (PerkinElmer, Waltham, Mass.) was added to each well, and incubated for additional 16 hours. Cells were transferred to UniFilters using Packard Filtermate Harvester, and [ 3 H]-thymidine incorporated into the genomic DNA of growing cells was measured using TopCount (PerkinElmer). In some cases, cell viability was assessed with CellTiter-Glo (Promega) following incubation with antibodies for 4 days. Values are presented as means+/ ⁇ SE of quadruplets.
- R3Mab The effect of R3Mab on cell clonogenicity was assessed following a previously described protocol (50).
- 400 UMUC-14 cells were seeded into 6-well plate in DMEM medium supplemented with 10% fetal bovine serum to allow adhesion overnight.
- R3Mab or control antibody diluted in 0.1% BSA medium was added to a final concentration of 10 ⁇ g/ml.
- Equal volume of 0.1% BSA medium alone (Mock) was used as another control.
- FGFR3 was immunoprecipitated using a rabbit polyclonal antibody (sc-123, Santa Cruz Biotechnology, Santa Cruz, Calif.) and analyzed by sodium dodecyl-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot. Phosphorylated FGFR3 was assessed with a monoclonal antibody against phospho-tyrosine (4G10, Upstate). Total FGFR3 was probed with a monoclonal antibody against FGFR3 (sc-13121, Santa Cruz Biotechnology).
- FGFR3 signaling pathway Phosphorylation and activation of FGFR3 signaling pathway were probed using the following antibodies: anti-FGFR Y653/654 , anti-FRS2 ⁇ Y196 , anti-phospho-p44/42 MAPK T202/Y204 , anti-total p44/42 MAPK and anti-AKT S473 were obtained from Cell Signaling Technology (Danvers, Mass.); and anti-total FRS2 ⁇ (sc-8318) was purchased from Santa Cruz Biotechnology (Santa Cruz, Calif.). The blots were visualized using a chemiluminescent substrate (ECL Plus, Amersham Pharmacia Biotech, Piscataway, N.J.).
- ECL Plus chemiluminescent substrate
- R3Mab 13 overlapping peptides, each of 15 amino acids in length, were synthesized to cover the extracellular domain of human FGFR3 from residues 138 to 310.
- the peptides were biotinylated at the C-terminus, and captured on streptavidin plates (Pierce, Rockford, Ill.) overnight. After blocking with PBS/3% BSA, the plates were incubated with R3Mab and detected using an HRP-conjugated anti-human IgG (Jackson Immunoresearch) and the TMB peroxidase colorigenic substrate (KPL, Gaithersburg, Md.).
- Mouse anti-human FGFR3 hybridoma antibodies 1G6, 6G1, and 15B2 were tested in ELISA assay to identify their binding epitopes.
- 1G6, 6G1 and 15B2 bind to human FGFR3 IgD2-IgD3 (both IIIb and IIIc isoforms), whereas 5B8 only binds IgD2-IgD3 of human FGFR3-IIIb.
- 1G6, 6G1 and 15B2 competed with each other to bind human FGFR3, suggesting that 1G6, 6G1 and 15B2 have overlapping epitopes. None of the hybridoma antibodies competed with phage antibody 184.6, suggesting that the hybridoma antibodies have distinct epitope(s) from 184.6.
- mice were immunized 12 times with 2.0 ⁇ g of FGFR3-IIIb (rhFGFR3 (IIIB)/Fc Chimera, from R&D Systems, catalog #1264-FR, lot # CYH025011, or with 2.0 ⁇ g of FGFR3-IIIc (rhFGFR3 (IIIc)/Fc Chimera, from R&D Systems, catalog #766-FR, lot # CWZ055041, resuspended in monophosphoryl lipid A/trehalose dicorynomycolate adjuvant (Corixa, Hamilton, Mont.) into each hind footpad twice a week.
- FGFR3-IIIb rhFGFR3 (IIIB)/Fc Chimera
- Fused hybridoma cells were selected from unfused popliteal node or myeloma cells using hypoxanthin-aminopterin-thymidine (HAT) selection in Medium D from the ClonaCell® hybridoma selection kit (StemCell Technologies, Inc., Vancouver, BC, Canada).
- HAT hypoxanthin-aminopterin-thymidine
- Culture supernatants were initially screened for its ability to bind to FGFR3-IIIb and FGFR3-IIIc by ELISA, and hybridomas of interest were subsequently screened for its ability to stain by FACS on transfected FGFR3-IIIb Ba/F cells and control Ba/F, as well as antibody blocking activity. Selected hybridomas were then cloned by limiting dilution.
- the variable light (VL) and variable heavy (VH) domains were amplified using RT-PCR with the following degenerate primers:
- Light chain reverse (SEQ ID NO: 201) 5′-TTTDAKYTCCAGCTTGGTACC-3′ Heavy chain reverse: (SEQ ID NO: 202) 5′-ACAGTGGGCCCTTGGTGGAGGCTGMRGAGACDGTGASHRDRGT-3′.
- the forward primers were specific for the N-terminal amino acid sequence of the VL and VH region.
- the LC and HC reverse primers were designed to anneal to a region in the constant light (CL) and constant heavy domain 1 (CH1), respectively, which are highly conserved across species.
- Amplified VL was cloned into a pRK mammalian cell expression vector (Shields et al, (2000) J. Biol. Chem. 276:659) containing the human kappa constant domain. Amplified VH was inserted to a pRK mammalian cell expression vector encoding the full-length human IgG1 constant domain. The sequence of the heavy and light chains was determined using conventional methods.
- the human FGFR3-IIIb ECD (residues 143-374) was cloned into pAcGP67A vector (BD Bioscience, San Jose, Calif.), produced in T.ni Pro cells and purified using Ni-NTA column followed by size exclusion chromatography.
- the R3Mab Fab was expressed in E. coli and purified sequentially over a protein G affinity column, an SP sepharose column and a Superdex 75 column.
- the R3Mab Fab had the following sequence:
- Fab-FGFR3 complex was generated by incubating the Fab with an excess of FGFR3 ECD, and the complex was then deglycosylated and purified over a Superdex-200 sizing column in 20 mM TrisCl pH 7.5 and 200 mM NaCl buffer. The complex-containing fractions were pooled and concentrated to 20 mg/ml and used in crystallization trials. Crystals used in the structure determination were grown at 4° C. from the following condition: 0.1 M sodium cacodylate pH 6.5, 40% MPD and 5% PEG8000 using vapor diffusion method. Data was processed using HKL2000 and Scalepack (56).
- Human PBMCs were isolated by Ficoll gradient centrifugation of heparinized blood, and ADCC was measured using the multiple myeloma cell lines OPM2 or KMS11 or bladder cancer cell lines RT112 or UMUC-14 as target and PBMCs as effector cells at a 1:100 target:effector ratio.
- the target cells (10,000 cells/well) were treated with R3Mab or with control human IgG1 for 4 hours at 37° C. Cytotoxicity was determined by measuring LDH release using the CytoTox-ONE Homogeneous Membrane Integrity Assay following manufacturer's instructions (Promega, Madison, Wis.).
- Cytotoxicity (%) [(Experimental lysis ⁇ Experimental spontaneous lysis)/(Target maximum lysis ⁇ target spontaneous lysis)] ⁇ 100, where spontaneous lysis is the nonspecific cytolysis in the absence of antibody, and target maximum lysis is induced by 1% Triton X-100.
- FGFR3 knockdown in vitro As a prelude to assessing the importance of FGFR3 for bladder tumor growth in vivo, we examined the effect of FGFR3 knockdown in vitro.
- Several FGFR3 small interfering (si) RNAs effectively downregulated FGFR3 in bladder cancer cell lines expressing either WT (RT112, RT4, SW780) or mutant (UMUC-14, S249C mutation) FGFR3.
- FGFR3 knockdown in all four cell lines markedly suppressed proliferation in culture ( FIG. 15 ).
- FIG. 7A Induction of three independent FGFR3 shRNAs by doxycycline diminished FGFR3 expression, whereas induction of a control shRNA targeting EGFP had no effect ( FIG. 7A ).
- doxycycline treatment reduced [ 3 H]-thymidine incorporation by cells expressing different FGFR3 shRNAs, but not control shRNA ( FIG. 7B ), confirming that FGFR3 knockdown inhibits proliferation.
- Further analysis of exponentially growing RT112 cells revealed that FGFR3 knockdown over a 72 hr treatment with doxycycline markedly and specifically reduced the percentage of cells in the S and G2 phases of the cell cycle, with a concomitant increase of cells in G1 phase ( FIG. 7C ).
- FGFR3 knockdown substantially and specifically suppressed tumor growth ( FIG. 7D , top panels and FIG. 16B ).
- Analysis of day 45 tumor samples confirmed effective FGFR3 knockdown upon doxycycline induction of FGFR3 shRNA as compared to control shRNA ( FIG. 7D , bottom panels).
- R3Mab an antagonistic anti-FGFR3 monoclonal antibody
- a phage display approach We selected this particular antibody based on its ability to block both ligand binding and dimerization by FGFR3, and its unique capacity to inhibit not only WT FGFR3 but also the most prevalent cancer-associated mutants of this receptor (see below).
- R3Mab targets the extracellular IgD2 and IgD3 domains of FGFR3, which are necessary and sufficient for FGF binding (4).
- R3Mab bound both the IIIb and IIIc isoforms of human FGFR3, but showed no detectable binding to FGFR1, FGFR2 or FGFR4 ( FIG. 8A ).
- Biacore analysis indicated that R3Mab had similar apparent affinity to murine, cynomolgus monkey and human FGFR3-IIIc (data not shown).
- the affinity of R3Mab to human FGFR3 is shown in Table 2.
- R3Mab was tested the ability of R3Mab to block FGFR3 binding to FGF1 and FGF9.
- R3Mab strongly inhibited binding of FGF1 to FGFR3-IIIb and -IIIc, with half-maximal inhibitory concentrations (IC 50 ) of 0.3 nM and 1.7 nM, respectively (FIGS. 8 B,C).
- IC 50 half-maximal inhibitory concentrations
- R3Mab efficiently blocked FGF9 binding to FGFR3-IIIb and -IIIc, with an IC 50 of 1.1 nM and 1.3 nM, respectively (FIGS. 8 D,E).
- R3Mab Inhibits WT FGFR3 and its Most Prevalent Cancer-Associated Mutant Variants
- somatic activating mutations in FGFR3 cluster within the linker region between IgD2 and IgD3, the extracellular juxtamembrane domain, or the kinase domain ( FIG. 9C ).
- the extracellular missense substitutions most often give rise to an unpaired cysteine, leading to ligand-independent dimerization of FGFR3.
- These mutations cause markedly different levels of constitutive FGFR3 activation, possibly owing to a differential impact on the orientation of the cytoplasmic kinase domain (30, 31).
- the most frequent mutations are S249C, Y375C, R248C, G372C, and K652E, which together account for 98% of all FGFR3 mutations in bladder cancer (32).
- FIG. 9E the most frequent mutation, FGFR3 S249C , conferred ligand-independent proliferation.
- R3Mab suppressed constitutive proliferation driven by either mutant ( FIGS. 9 D,E).
- Cells expressing FGFR3 K652E showed weak ligand-independent proliferation and significant growth in response to FGF1 (33).
- R3Mab did not affect the weak basal activity of FGFR3 K652E (data not shown), but nearly abolished ligand-induced proliferation mediated by this mutant ( FIG. 9H ). Hence, R3Mab has a unique capacity to inhibit both WT and prevalent cancer-associated mutants of FGFR3. Moreover, R3Mab did not display detectable agonist activity.
- hybridoma antibodies showed agonist activity, strongly stimulating proliferation of cancer-linked FGFR3 mutants R248C and S249C, and showing some stimulation of proliferation of mutants Y375C and G370C.
- the hybridoma antibodies showed differential levels of antagonist and agonism, depending on the FGFR3 mutant tested, as follows:
- Mouse anti-human FGFR3 hybridoma antibodies were, further characterized as follows:
- antibodies 1G6, 6G1 and 15B2 were able to block binding of FGF1 to human FGFR3-IIIb and IIIc isoforms in a dose-dependent manner.
- antibodies 1G6, 6G1 and 15B2 blocked FGF1 binding to FGFR3-IIIb with IC50 values of 0.69, 0.87 and 0.72 nM.
- antibodies 1G6, 6G1 and 15B2 blocked FGF1 binding to FGFR3-IIIc with IC50 values of 0.57, 3.4 and 0.7 nM, respectively.
- antibodies 1G6, 6G1 and 15B2 efficiently-blocked binding of FGF1 to human FGFR3-IIIb and IIIc isoforms in a dose-dependent manner.
- antibodies 1G6, 6G1 and 15B2 blocked FGF9 binding to FGFR3-IIIb with IC50 values of 0.13, 0.16, and 0.07 nM, respectively.
- antibodies 1G6, 6G1 and 15B2 blocked FGF9 binding to FGFR3-IIIc with IC50 values of 0.13, 0.11, and 0.07 nM, respectively.
- antibodies 1G6, 6G1 and 15B2 were able to block Ba/F3 cell proliferation driven by human FGFR3-IIIb or IIIc in a dose-dependent manner.
- antibodies 1G6, 6G1 and 15B2 blocked Ba/F3 cell proliferation driven by FGFR3-IIIb with IC50 values of 3-5 nM, 3 nM, and 6-8 nM, respectively, and blocked Ba/F3 cell proliferation driven by FGFR3-IIIc with IC50 values of 10-35 nM, 24 nM, and 60 nM, respectively.
- amino acids (AAs) from CDR-H3 form two ⁇ -strands; which extend the ⁇ -sheet of IgD2 ( FIG. 10D ).
- the Fab interacts with AAs that constitute the FGF binding site of FGFR3 as well as residues that form the receptor dimerization interface, as previously identified in various dimeric FGF:FGFR complexes (e.g., PDB code 1CVS, (34); and FIG. 10C , areas in grey/crosshatched and dark grey).
- the interaction interfaces identified by crystallography were fully consistent with the peptide-based data ( FIGS. 18 A, B).
- ⁇ I> is the average intensity of symmetry related observations of a unique reflection.
- b Numbers in parentheses refer to the highest resolution shell.
- c R ⁇
- R free is calculated as R, but for 5% of the reflections excluded from all refinement.
- FIGS. 10E , 10 F We compared the R3Mab-FGFR3 structure with a previously published structure of FGFR3-IIIc in complex with FGF1 (4, 35) ( FIGS. 10E , 10 F). Superposition of the antibody-receptor and ligand-receptor complexes revealed that there are no major conformational differences within the individual receptor domains, except in the region that distinguishes FGFR3-IIIc from FGFR3-IIIb; however, the orientation of IgD3 relative to IgD2 was drastically different ( FIG. 10E , white and grey; FIG. 10F , white and grey-mesh). Since the relative positions of IgD2 and IgD3 are critical for ligand binding, the alternate conformation adopted by IgD3 upon R3Mab binding may provide an additional mechanism to prevent ligand interaction with FGFR3.
- R3Mab could suppress FGFR3 function in bladder cancer cells.
- RT112 and RT4 cell lines which express WT FGFR3.
- R3Mab strongly inhibited [ 3 H]-thymidine incorporation by RT112 cells ( FIG. 11A ) and exerted a significant, though more moderate suppression of RT4 cell proliferation ( FIG. 19A ).
- R3Mab's effect on FGFR3 activation we examined the phosphorylation of FGFR3 in RT112 cells. Consistent with the results in Ba/F3-FGFR3 cells ( FIG. 9B ), R3Mab markedly attenuated FGF1-induced FGFR3 phosphorylation ( FIG. 11B ).
- FGF1 strongly activated these molecules in RT112 cells, while R3Mab significantly diminished this activation ( FIG. 11B ).
- R3Mab suppressed FGF1-induced phosphorylation of FGFR3 and MAPK in RT4 cells ( FIG. 19B ).
- R3Mab could inhibit activation of endogenous mutant FGFR3 in human bladder cancer cells.
- S249C is the most frequent FGFR3 mutation in bladder cancer ( FIG. 9C ).
- R3Mab did not affect the exponential growth of UMUC-14 cells in culture (data not shown), it significantly reduced the clonal growth of these cells ( FIG. 11C ).
- R3Mab decreased the number of colonies larger than 120 ⁇ m in diameter approximately by 77% as compared with control antibody ( FIG. 11D ).
- R3Mab inhibited [ 3 H]-thymidine incorporation by TCC-97-7 cells in culture ( FIG. 19C ).
- the S249C mutation is reported to result in ligand-independent activation of FGFR3 (26, 30). Indeed, FGFR3 S249C was constitutively phosphorylated irrespective of FGF1 treatment in UMUC-14 cells and TCC-97-7 cells, while R3Mab reduced constitutive phosphorylation of FGFR3 S249C as compared with control antibody in both cell lines ( FIGS. 11E , 19 D).
- R3Mab decreases the FGFR3 S249C dimer levels in bladder cancer cells?
- One potential explanation is that it may disrupt the FGFR3 S249C dimer through antibody-induced FGFR3 internalization and trafficking through endosomes or lysosomes.
- R3Mab nonetheless decreased the amount of dimer in UMUC-14 cells pre-treated with various endocytosis inhibitors, despite substantial blockade of FGFR3 S249C internalization ( FIGS. 20 A, B).
- dimer disruption by R3Mab is independent of endocytosis.
- FGFR3 S249C may exist in a dynamic monomer-dimer equilibrium; accordingly, binding of R3Mab to monomeric FGFR3 S249C could prevent dimer formation and thereby shift the equilibrium toward the monomeric state.
- DTNB non-cell-permeating agent 5,5′Dithiobis 2-nitrobenzoic acid
- R3Mab significantly accelerated the appearance of a ⁇ 25 kDa band representing monomeric FGFR3 S249C at the expense of the ⁇ 50 kDa dimer, as compared with mock or antibody controls ( FIG.
- R3Mab does not Promote FGFR3 Down-Regulation
- R3Mab clone 184.6.1
- anti-FGFR3 hybridoma antibodies on FGFR3 downregulation by analyzing FGFR3 internalization and degradation in FGFR3 antibody-treated cells.
- Bladder cancer cell lines expressing wild type FGFR3 (RT112) or mutated FGFR3 (S249C in TCC97-7) were treated with R3Mab or hybridoma antibodies 1G6 or 6G1 for 4 to 24 hours, then cell lysates were harvested for western blot analysis of total FGFR3 levels.
- Treatment with R3Mab did not reduce FGFR3 levels, while treatment with hybridoma mabs 1G6 and 6G1 significantly reduced FGFR3 levels.
- R3Mab also significantly inhibited the phosphorylation and activation of MAPK in UMUC-14 tumors ( FIG. 13E ), suggesting that R3Mab inhibits the activity of FGFR3 S249C in vivo.
- R3Mab which binds with similar affinity to both human and murine FGFR3, did not exert any discernable toxicity in any organs, including bladder (data not shown). Together, these data indicate that multiple exposures to R3Mab are well tolerated in mouse.
- R3Mab might harbor therapeutic potential for multiple myeloma
- UTMC-2 cells carry WT FGFR3, while OPM2 and KMS11 harbor a K650E and Y373C substitution, respectively (7).
- R3Mab abrogated FGF9-induced proliferation of UTMC-2 cells completely ( FIG. 22A ).
- R3Mab modestly inhibited the growth of OPM2 cells, but had no apparent effect on the proliferation of KMS11 cells ( FIGS. 22 B, C).
- R3Mab may be capable of supporting Fc-mediated immune effector functions against these FGFR3-overexpressing tumors.
- Both cell lines express high levels of CD55 and CD59 (data not shown), two inhibitors of the complement pathway; accordingly, no complement-dependent cytotoxicity was observed (data not shown).
- ADCC occurs when an antibody binds to its antigen on a target cell, and via its Fc region, engages Fc ⁇ receptors (Fc ⁇ Rs) expressed on immune effector cells (38).
- D265A/N297A D265A/N297A
- This dual substitution in the Fc domain of an antibody abolishes its binding to Fc ⁇ Rs (39), preventing recruitment of immune effector cells.
- the DANA mutation did not alter R3Mab binding to FGFR3 or inhibition of FGFR3 activity in vitro, nor did it change the pharmacokinetics of R3Mab in mice (data not shown); however, it substantially abolished in vivo activity against OPM2 or KMS11 xenografts ( FIGS. 14 G, H).
- R3Mab (clone 184.6.1N54S) was further characterized as follows:
- FGFR3 mutations or overexpression have been identified in other solid tumor malignancies, including cervical carcinoma (40), hepatocellular carcinoma (41) and non-small cell lung cancer (42, 43), suggesting a potential contribution of FGFR3 to additional types of epithelial cancer.
- an optimal therapeutic antibody should be capable of blocking not only the WT but also the prevailing cancer-linked mutants of FGFR3. Furthermore, given that dimerization of FGFR3 is critical for its activation, an antibody that not only blocks ligand binding but also interferes with receptor dimerization could be superior. Additional desirable properties would include the ability to support Fc-mediated effector function and the long serum half-life conferred by the natural framework of a full-length antibody. We focused our screening and engineering efforts to identify an antibody molecule that combines all of these features, leading to the generation of R3Mab. Binding studies demonstrated the ability of R3Mab to compete with FGF ligands for interaction with both the IIIb and IIIc isoforms of FGFR3.
- FGFR3 mutations in bladder cancer represent one of the most frequent oncogenic alterations of a protein kinase in solid tumor malignancies, reminiscent of the common mutation of B-Raf in melanoma (45). Most of the activating mutations in FGFR3 give rise to an unpaired cysteine, leading to ligand-independent receptor dimerization and to various degrees of constitutive activation. A previous study using a monovalent anti-FGFR3Fab fragment indicated differential inhibitory activity against specific FGFR3 mutants (46); however, the molecular basis for this variable effect was not investigated.
- bivalent antibodies Compared with monovalent antibody fragments, bivalent antibodies have the capacity to induce the clustering of antigens, and in the case of receptor tyrosine kinases, may cause receptor oligomerization and activation.
- R3Mab displayed universal inhibition of WT FGFR3 and of a wide spectrum of FGFR3 mutants, including variants that are ligand-dependent (FGFR3 G372C , FGFR3 Y375C ), constitutively active (FGFR3 R248C , FGFR3 S249C ), or both (FGFR3 R652E ).
- R3Mab Based on sequence alignment with FGFR1, the peptide epitope recognized by R3Mab overlaps with FGFR3 residues involved in binding to ligand and heparin, as well as receptor dimerization. This conclusion was confirmed by crystallographic studies of the complex between R3Mab and the extracellular regions of FGFR3. The X-ray structure revealed that the antibody binds to regions of IgD2 and IgD3 that are critical for ligand-receptor interaction as well as receptor-receptor contact. Thus, R3Mab may block WT FGFR3 both by competing for ligand binding and by preventing receptor dimerization.
- R3Mab may employ a similar mechanism to inhibit FGFR3 K652E , which has low constitutive activity, but requires ligand for full activation. Furthermore, R3Mab binding changes the relative orientation of FGFR3 IgD3 with respect to IgD2. This finding raises the formal possibility that the antibody might also inhibit receptor activation by forcing a conformation that is not conducive to signal transduction—a notion that requires further study.
- R3Mab potent anti-tumor activity of R3Mab against the t(4;14)+ multiple myeloma cell lines OPM2 and KMS11 in vivo.
- R3Mab had modest to minimal impact on proliferation or survival of these cells in culture.
- OPM2 and KMS11 cells express relatively high cell surface levels of FGFR3 (5-6 fold higher than RT112 and UMUC-14 bladder carcinoma cells). These higher antigen densities may permit R3Mab to support efficient recruitment of Fc ⁇ R-bearing immune effector cells and activation of ADCC.
- R3Mab mediated cytolysis of OPM2 and KMS11 cells, but not RT112 or UMUC-14 bladder cancer cells.
- the DANA mutant version of R3Mab which is incapable of Fc ⁇ R binding, had no effect on KMS11 or OPM2 growth in vivo, but still suppressed growth of RT112 and UMUC-14 tumors similarly to R3Mab.
- R3Mab has a dual mechanism of anti-tumor activity: (a) In cells expressing lower surface levels of WT or mutant FGFR3, it blocks ligand-dependent or constitutive signaling; (b) In cells expressing relatively high surface FGFR3 levels, it induces ADCC.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Cell Biology (AREA)
- Endocrinology (AREA)
- Hematology (AREA)
- Biomedical Technology (AREA)
- Oncology (AREA)
- Urology & Nephrology (AREA)
- Physical Education & Sports Medicine (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US12/661,852 US20100291114A1 (en) | 2009-03-25 | 2010-03-24 | Crystal structures and methods using same |
| US13/572,557 US20120321606A1 (en) | 2009-03-25 | 2012-08-10 | Crystal structures and methods using same |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US16322209P | 2009-03-25 | 2009-03-25 | |
| US12/661,852 US20100291114A1 (en) | 2009-03-25 | 2010-03-24 | Crystal structures and methods using same |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/572,557 Continuation US20120321606A1 (en) | 2009-03-25 | 2012-08-10 | Crystal structures and methods using same |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| US20100291114A1 true US20100291114A1 (en) | 2010-11-18 |
Family
ID=42340706
Family Applications (10)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US12/661,852 Abandoned US20100291114A1 (en) | 2009-03-25 | 2010-03-24 | Crystal structures and methods using same |
| US12/731,100 Active 2030-12-26 US8410250B2 (en) | 2009-03-25 | 2010-03-24 | Anti-FGFR3 antibodies and methods using same |
| US13/572,557 Abandoned US20120321606A1 (en) | 2009-03-25 | 2012-08-10 | Crystal structures and methods using same |
| US13/653,293 Active US8710189B2 (en) | 2009-03-25 | 2012-10-16 | Anti-FGFR3 antibodies and methods using same |
| US13/762,252 Active 2030-07-29 US9161977B2 (en) | 2009-03-25 | 2013-02-07 | Anti-FGFR3 antibodies and methods using same |
| US14/197,072 Abandoned US20140187754A1 (en) | 2009-03-25 | 2014-03-04 | Anti-fgfr3 antibodies and methods using same |
| US14/887,042 Active US9499623B2 (en) | 2009-03-25 | 2015-10-19 | Anti-FGFR3 antibodies and methods using same |
| US15/266,105 Active US10000571B2 (en) | 2009-03-25 | 2016-09-15 | Anti-FGFR3 antibodies and methods using same |
| US15/356,483 Active US10287356B2 (en) | 2009-03-25 | 2016-11-18 | Anti-FGFR3 antibodies and methods using same |
| US16/380,865 Active US11401333B2 (en) | 2009-03-25 | 2019-04-10 | Anti-FGFR3 antibodies and methods using same |
Family Applications After (9)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US12/731,100 Active 2030-12-26 US8410250B2 (en) | 2009-03-25 | 2010-03-24 | Anti-FGFR3 antibodies and methods using same |
| US13/572,557 Abandoned US20120321606A1 (en) | 2009-03-25 | 2012-08-10 | Crystal structures and methods using same |
| US13/653,293 Active US8710189B2 (en) | 2009-03-25 | 2012-10-16 | Anti-FGFR3 antibodies and methods using same |
| US13/762,252 Active 2030-07-29 US9161977B2 (en) | 2009-03-25 | 2013-02-07 | Anti-FGFR3 antibodies and methods using same |
| US14/197,072 Abandoned US20140187754A1 (en) | 2009-03-25 | 2014-03-04 | Anti-fgfr3 antibodies and methods using same |
| US14/887,042 Active US9499623B2 (en) | 2009-03-25 | 2015-10-19 | Anti-FGFR3 antibodies and methods using same |
| US15/266,105 Active US10000571B2 (en) | 2009-03-25 | 2016-09-15 | Anti-FGFR3 antibodies and methods using same |
| US15/356,483 Active US10287356B2 (en) | 2009-03-25 | 2016-11-18 | Anti-FGFR3 antibodies and methods using same |
| US16/380,865 Active US11401333B2 (en) | 2009-03-25 | 2019-04-10 | Anti-FGFR3 antibodies and methods using same |
Country Status (28)
| Country | Link |
|---|---|
| US (10) | US20100291114A1 (https=) |
| EP (3) | EP2679600A1 (https=) |
| JP (1) | JP5757534B2 (https=) |
| KR (2) | KR101822663B1 (https=) |
| CN (2) | CN104788564A (https=) |
| AR (2) | AR075939A1 (https=) |
| AU (1) | AU2010229994B2 (https=) |
| BR (1) | BRPI1006448B1 (https=) |
| CA (1) | CA2754163C (https=) |
| CO (1) | CO6450665A2 (https=) |
| DK (2) | DK3702371T5 (https=) |
| EC (1) | ECSP11011417A (https=) |
| ES (2) | ES2932874T3 (https=) |
| HR (2) | HRP20150965T1 (https=) |
| HU (2) | HUE061117T2 (https=) |
| IL (2) | IL214433A (https=) |
| LT (1) | LT3702371T (https=) |
| MA (1) | MA33208B1 (https=) |
| MX (2) | MX2011009961A (https=) |
| NZ (1) | NZ594339A (https=) |
| PE (1) | PE20120553A1 (https=) |
| RU (1) | RU2568066C2 (https=) |
| SG (1) | SG174904A1 (https=) |
| SI (2) | SI2411414T1 (https=) |
| TW (1) | TWI507205B (https=) |
| UA (1) | UA104459C2 (https=) |
| WO (1) | WO2010111367A1 (https=) |
| ZA (1) | ZA201105574B (https=) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8410250B2 (en) | 2009-03-25 | 2013-04-02 | Genentech, Inc. | Anti-FGFR3 antibodies and methods using same |
| US10208120B2 (en) | 2014-11-05 | 2019-02-19 | Genentech, Inc. | Anti-FGFR2/3 antibodies and methods using same |
| US10294289B2 (en) | 2016-07-07 | 2019-05-21 | Therachon Sas | Soluble fibroblast growth factor receptor 3 (SFGFR3) polypeptides and uses thereof |
| US10724014B2 (en) | 2013-01-16 | 2020-07-28 | Institut National De La Sante Et De La Recherche Medicale | Soluble fibroblast growth factor receptor 3 (FGR3) polypeptide for use in the prevention or treatment of skeletal growth retardation disorders |
Families Citing this family (53)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2002329540A1 (en) * | 2001-06-20 | 2003-01-02 | Morphosys Ag | Antibodies that block receptor protein tyrosine kinase activation, methods of screening for and uses thereof |
| RS67768B1 (sr) | 2010-11-30 | 2026-03-31 | Chugai Pharmaceutical Co Ltd | Terapijski agens koji indukuje citotoksičnost |
| WO2013056148A2 (en) | 2011-10-15 | 2013-04-18 | Genentech, Inc. | Methods of using scd1 antagonists |
| WO2013088191A1 (en) | 2011-12-12 | 2013-06-20 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Antagonist of the fibroblast growth factor receptor 3 (fgfr3) for use in the treatment or the prevention of skeletal disorders linked with abnormal activation of fgfr3 |
| EP2837685B1 (en) | 2012-04-09 | 2020-09-09 | Daiichi Sankyo Company, Limited | Anti-fgfr2 antibody |
| CN104797936B (zh) * | 2012-07-24 | 2017-11-24 | 纽约市哥伦比亚大学理事会 | 融合蛋白及其方法 |
| US20150203589A1 (en) | 2012-07-24 | 2015-07-23 | The Trustees Of Columbia University In The City Of New York | Fusion proteins and methods thereof |
| CA2878183A1 (en) * | 2012-07-27 | 2014-01-30 | Genentech, Inc. | Methods of treating fgfr3 related conditions |
| PL3489261T3 (pl) | 2012-08-24 | 2021-08-16 | The Regents Of The University Of California | Przeciwciała i szczepionki do stosowania w leczeniu nowotworów z ekspresją ROR1 i w hamowaniu przerzutu |
| CA2886002C (en) | 2012-09-27 | 2020-06-09 | Chugai Seiyaku Kabushiki Kaisha | Fgfr3 fusion gene and pharmaceutical drug targeting same |
| BR112015012051A2 (pt) * | 2012-11-26 | 2017-12-12 | Roche Innovation Ct Copenhagen As | composições e métodos para modulação de expressão de fgfr3 |
| US20140154702A1 (en) * | 2012-11-30 | 2014-06-05 | Endocyte, Inc. | Methods For Treating Cancer Using Combination Therapies |
| SMT201900068T1 (it) * | 2012-12-21 | 2019-02-28 | Janssen Biotech Inc | Immunosaggio multiplex sensibile per recettori di fattore di crescita dei fibroblasti solubili |
| KR20150123250A (ko) | 2013-03-06 | 2015-11-03 | 제넨테크, 인크. | 암 약물 내성의 치료 및 예방 방법 |
| KR20220019839A (ko) * | 2013-10-08 | 2022-02-17 | 다이이찌 산쿄 가부시키가이샤 | 항 fgfr2 항체와 타제의 조합 |
| WO2015164723A1 (en) | 2014-04-25 | 2015-10-29 | The Trustees Of The University Of Pennsylvania | Methods and compositions for treating metastatic breast cancer and other cancers in the brain |
| PE20170261A1 (es) | 2014-05-13 | 2017-04-12 | Univ Pennsylvania | Composiciones que comprenden virus adenoasociado (aav) que expresa constructos de anticuerpos duales y sus usos |
| CN107073121A (zh) | 2014-06-13 | 2017-08-18 | 基因泰克公司 | 治疗及预防癌症药物抗性的方法 |
| EP3166970B1 (en) | 2014-07-10 | 2021-03-10 | BioArctic AB | Improved a-beta protofibril binding antibodies |
| WO2016105503A1 (en) | 2014-12-24 | 2016-06-30 | Genentech, Inc. | Therapeutic, diagnostic and prognostic methods for cancer of the bladder |
| JP6774421B2 (ja) * | 2015-02-19 | 2020-10-21 | フュージョン ファーマシューティカルズ インク. | がんの治療のための方法、組成物、及びキット |
| EP3265462A1 (en) | 2015-03-03 | 2018-01-10 | INSERM - Institut National de la Santé et de la Recherche Médicale | Fgfr3 antagonists |
| WO2016179568A1 (en) | 2015-05-06 | 2016-11-10 | Protomer Technologies, Inc. | Glucose responsive insulins |
| JP2018536682A (ja) | 2015-12-11 | 2018-12-13 | リジェネロン・ファーマシューティカルズ・インコーポレイテッドRegeneron Pharmaceuticals, Inc. | Egfr及び/またはerbb3遮断に耐性のある腫瘍の成長を低減または防止するための方法 |
| EP3432925A4 (en) | 2016-03-22 | 2019-11-06 | Bionomics Limited | ADMINISTRATION OF A MONOCLONAL ANTI-LGR5 ANTIBODY |
| JP2019513371A (ja) * | 2016-04-01 | 2019-05-30 | アビディティー バイオサイエンシーズ エルエルシー | 核酸ポリペプチド組成物とその使用 |
| IL299099B2 (en) | 2016-06-27 | 2025-07-01 | Univ California | Cancer treatment combinations |
| SG11201906249PA (en) * | 2017-02-06 | 2019-08-27 | Rainier Therapeutics Inc | Methods, compositions, and kits for treatment of cancer |
| US10722589B2 (en) | 2017-04-03 | 2020-07-28 | Covagen Ag | FGFR3 binding molecules |
| EP3634401A1 (en) * | 2017-06-07 | 2020-04-15 | Silverback Therapeutics, Inc. | Antibody construct conjugates |
| WO2019183093A1 (en) * | 2018-03-19 | 2019-09-26 | Abeome Corporation | High affinity neutralizing monoclonal antibodies to programmed death ligand 1 (pd-l1) and uses thereof |
| US20200277387A1 (en) * | 2019-03-01 | 2020-09-03 | Rainier Therapeutics, Inc. | Methods and compositions for treating cancer |
| CN110272900B (zh) * | 2019-04-19 | 2024-03-26 | 中国人民解放军陆军军医大学 | 用于制备骨骼发育异常猪模型的sgRNA及其应用 |
| JPWO2021010326A1 (https=) * | 2019-07-12 | 2021-01-21 | ||
| CN114786730A (zh) * | 2019-11-05 | 2022-07-22 | 再生元制药公司 | N-端scFv多特异性结合分子 |
| JP7779484B2 (ja) * | 2019-11-18 | 2025-12-03 | ボード オブ リージェンツ,ザ ユニバーシティ オブ テキサス システム | 抗b7-h3モノクローナル抗体およびその使用方法 |
| WO2021242883A1 (en) | 2020-05-26 | 2021-12-02 | University Of Massachusetts | Synthetic oligonucleotides having regions of block and cluster modifications |
| IL300623A (en) * | 2020-08-21 | 2023-04-01 | Genzyme Corp | Anti-FGFR3 antibodies and methods of use |
| AR124414A1 (es) | 2020-12-18 | 2023-03-22 | Century Therapeutics Inc | Sistema de receptor de antígeno quimérico con especificidad de receptor adaptable |
| CN114716548B (zh) * | 2021-01-05 | 2024-11-05 | (株)爱恩德生物 | 抗-fgfr3抗体及其用途 |
| WO2023113806A1 (en) | 2021-12-16 | 2023-06-22 | Affinia Therapeutics, Inc. | Recombinant aav for treatment of neural disease |
| US20230034817A1 (en) | 2021-04-12 | 2023-02-02 | Affinia Therapeutics Inc. | Recombinant aav for treatment of neural disease |
| CN117881786A (zh) | 2021-04-27 | 2024-04-12 | 世代生物公司 | 表达治疗性抗体的非病毒dna载体及其用途 |
| US11931420B2 (en) | 2021-04-30 | 2024-03-19 | Celgene Corporation | Combination therapies using an anti-BCMA antibody drug conjugate (ADC) in combination with a gamma secretase inhibitor (GSI) |
| WO2023177655A1 (en) | 2022-03-14 | 2023-09-21 | Generation Bio Co. | Heterologous prime boost vaccine compositions and methods of use |
| WO2023225534A1 (en) | 2022-05-18 | 2023-11-23 | Protomer Technologies Inc. | Aromatic boron-containing compounds and related insulin analogs |
| CN119630427A (zh) * | 2022-06-28 | 2025-03-14 | 启德医药科技(苏州)有限公司 | 抗fgfr3抗体缀合物及其医疗用途 |
| WO2024077095A1 (en) | 2022-10-05 | 2024-04-11 | Genentech, Inc. | Methods and compositions for classifying and treating bladder cancer |
| WO2024107759A2 (en) * | 2022-11-14 | 2024-05-23 | Regeneron Pharmaceuticals, Inc. | Anti-fgfr3 antibodies and antigen-binding fragments and methods of use thereof |
| EP4649092A1 (en) | 2023-01-13 | 2025-11-19 | Regeneron Pharmaceuticals, Inc. | Fgfr3 binding molecules and methods of use thereof |
| PE20260306A1 (es) | 2023-06-12 | 2026-02-11 | Amgen Inc | Proteinas de union a receptor de linfotoxina beta agonistas |
| WO2025149667A1 (en) | 2024-01-12 | 2025-07-17 | Pheon Therapeutics Ltd | Antibody drug conjugates and uses thereof |
| WO2025240335A1 (en) | 2024-05-13 | 2025-11-20 | Regeneron Pharmaceuticals, Inc. | Fgfr3 binding molecules and methods of use thereof |
Citations (92)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3773919A (en) * | 1969-10-23 | 1973-11-20 | Du Pont | Polylactide-drug mixtures |
| US3896111A (en) * | 1973-02-20 | 1975-07-22 | Research Corp | Ansa macrolides |
| US4137230A (en) * | 1977-11-14 | 1979-01-30 | Takeda Chemical Industries, Ltd. | Method for the production of maytansinoids |
| US4151042A (en) * | 1977-03-31 | 1979-04-24 | Takeda Chemical Industries, Ltd. | Method for producing maytansinol and its derivatives |
| US4248870A (en) * | 1978-10-27 | 1981-02-03 | Takeda Chemical Industries, Ltd. | Maytansinoids and use |
| US4256746A (en) * | 1978-11-14 | 1981-03-17 | Takeda Chemical Industries | Dechloromaytansinoids, their pharmaceutical compositions and method of use |
| US4260608A (en) * | 1978-11-14 | 1981-04-07 | Takeda Chemical Industries, Ltd. | Maytansinoids, pharmaceutical compositions thereof and methods of use thereof |
| US4265814A (en) * | 1978-03-24 | 1981-05-05 | Takeda Chemical Industries | Matansinol 3-n-hexadecanoate |
| US4294757A (en) * | 1979-01-31 | 1981-10-13 | Takeda Chemical Industries, Ltd | 20-O-Acylmaytansinoids |
| US4307016A (en) * | 1978-03-24 | 1981-12-22 | Takeda Chemical Industries, Ltd. | Demethyl maytansinoids |
| US4308268A (en) * | 1979-06-11 | 1981-12-29 | Takeda Chemical Industries, Ltd. | Maytansinoids, pharmaceutical compositions thereof and method of use thereof |
| US4308269A (en) * | 1979-06-11 | 1981-12-29 | Takeda Chemical Industries, Ltd. | Maytansinoids, pharmaceutical compositions thereof and method of use thereof |
| US4309428A (en) * | 1979-07-30 | 1982-01-05 | Takeda Chemical Industries, Ltd. | Maytansinoids |
| US4313946A (en) * | 1981-01-27 | 1982-02-02 | The United States Of America As Represented By The Secretary Of Agriculture | Chemotherapeutically active maytansinoids from Trewia nudiflora |
| US4313929A (en) * | 1978-02-16 | 1982-02-02 | Mitsubishi Chemical Industries Limited | Method of measurement of antigens and antibodies |
| US4317821A (en) * | 1979-06-08 | 1982-03-02 | Takeda Chemical Industries, Ltd. | Maytansinoids, their use and pharmaceutical compositions thereof |
| US4322348A (en) * | 1979-06-05 | 1982-03-30 | Takeda Chemical Industries, Ltd. | Maytansinoids |
| US4331598A (en) * | 1979-09-19 | 1982-05-25 | Takeda Chemical Industries, Ltd. | Maytansinoids |
| USRE30985E (en) * | 1978-01-01 | 1982-06-29 | Serum-free cell culture media | |
| US4362663A (en) * | 1979-09-21 | 1982-12-07 | Takeda Chemical Industries, Ltd. | Maytansinoid compound |
| US4364866A (en) * | 1979-09-21 | 1982-12-21 | Takeda Chemical Industries, Ltd. | Maytansinoids |
| US4371533A (en) * | 1980-10-08 | 1983-02-01 | Takeda Chemical Industries, Ltd. | 4,5-Deoxymaytansinoids, their use and pharmaceutical compositions thereof |
| US4419446A (en) * | 1980-12-31 | 1983-12-06 | The United States Of America As Represented By The Department Of Health And Human Services | Recombinant DNA process utilizing a papilloma virus DNA as a vector |
| US4424219A (en) * | 1981-05-20 | 1984-01-03 | Takeda Chemical Industries, Ltd. | 9-Thiomaytansinoids and their pharmaceutical compositions and use |
| US4450254A (en) * | 1980-11-03 | 1984-05-22 | Standard Oil Company | Impact improvement of high nitrile resins |
| US4560655A (en) * | 1982-12-16 | 1985-12-24 | Immunex Corporation | Serum-free cell culture medium and process for making same |
| US4601978A (en) * | 1982-11-24 | 1986-07-22 | The Regents Of The University Of California | Mammalian metallothionein promoter system |
| US4657866A (en) * | 1982-12-21 | 1987-04-14 | Sudhir Kumar | Serum-free, synthetic, completely chemically defined tissue culture media |
| US4676980A (en) * | 1985-09-23 | 1987-06-30 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Target specific cross-linked heteroantibodies |
| US4683203A (en) * | 1984-04-14 | 1987-07-28 | Redco N.V. | Immobilized enzymes, processes for preparing same, and use thereof |
| US4683195A (en) * | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| US4767704A (en) * | 1983-10-07 | 1988-08-30 | Columbia University In The City Of New York | Protein-free culture medium |
| US4816567A (en) * | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| US4927762A (en) * | 1986-04-01 | 1990-05-22 | Cell Enterprises, Inc. | Cell culture medium with antioxidant |
| US4965199A (en) * | 1984-04-20 | 1990-10-23 | Genentech, Inc. | Preparation of functional human factor VIII in mammalian cells using methotrexate based selection |
| US4970198A (en) * | 1985-10-17 | 1990-11-13 | American Cyanamid Company | Antitumor antibiotics (LL-E33288 complex) |
| US4975278A (en) * | 1988-02-26 | 1990-12-04 | Bristol-Myers Company | Antibody-enzyme conjugates in combination with prodrugs for the delivery of cytotoxic agents to tumor cells |
| US5053394A (en) * | 1988-09-21 | 1991-10-01 | American Cyanamid Company | Targeted forms of methyltrithio antitumor agents |
| US5079233A (en) * | 1987-01-30 | 1992-01-07 | American Cyanamid Company | N-acyl derivatives of the LL-E33288 antitumor antibiotics, composition and methods for using the same |
| US5122469A (en) * | 1990-10-03 | 1992-06-16 | Genentech, Inc. | Method for culturing Chinese hamster ovary cells to improve production of recombinant proteins |
| US5208020A (en) * | 1989-10-25 | 1993-05-04 | Immunogen Inc. | Cytotoxic agents comprising maytansinoids and their therapeutic use |
| US5264365A (en) * | 1990-11-09 | 1993-11-23 | Board Of Regents, The University Of Texas System | Protease-deficient bacterial strains for production of proteolytically sensitive polypeptides |
| US5362852A (en) * | 1991-09-27 | 1994-11-08 | Pfizer Inc. | Modified peptide derivatives conjugated at 2-hydroxyethylamine moieties |
| US5500362A (en) * | 1987-01-08 | 1996-03-19 | Xoma Corporation | Chimeric antibody with specificity to human B cell surface antigen |
| US5508192A (en) * | 1990-11-09 | 1996-04-16 | Board Of Regents, The University Of Texas System | Bacterial host strains for producing proteolytically sensitive polypeptides |
| US5571894A (en) * | 1991-02-05 | 1996-11-05 | Ciba-Geigy Corporation | Recombinant antibodies specific for a growth factor receptor |
| US5585089A (en) * | 1988-12-28 | 1996-12-17 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| US5587458A (en) * | 1991-10-07 | 1996-12-24 | Aronex Pharmaceuticals, Inc. | Anti-erbB-2 antibodies, combinations thereof, and therapeutic and diagnostic uses thereof |
| US5606040A (en) * | 1987-10-30 | 1997-02-25 | American Cyanamid Company | Antitumor and antibacterial substituted disulfide derivatives prepared from compounds possessing a methyl-trithio group |
| US5624821A (en) * | 1987-03-18 | 1997-04-29 | Scotgen Biopharmaceuticals Incorporated | Antibodies with altered effector functions |
| US5635483A (en) * | 1992-12-03 | 1997-06-03 | Arizona Board Of Regents Acting On Behalf Of Arizona State University | Tumor inhibiting tetrapeptide bearing modified phenethyl amides |
| US5639635A (en) * | 1994-11-03 | 1997-06-17 | Genentech, Inc. | Process for bacterial production of polypeptides |
| US5641870A (en) * | 1995-04-20 | 1997-06-24 | Genentech, Inc. | Low pH hydrophobic interaction chromatography for antibody purification |
| US5648237A (en) * | 1991-09-19 | 1997-07-15 | Genentech, Inc. | Expression of functional antibody fragments |
| US5663149A (en) * | 1994-12-13 | 1997-09-02 | Arizona Board Of Regents Acting On Behalf Of Arizona State University | Human cancer inhibitory pentapeptide heterocyclic and halophenyl amides |
| US5707632A (en) * | 1989-07-06 | 1998-01-13 | The Regents Of The University Of Ca | Receptors for fibroblast growth factors |
| US5712374A (en) * | 1995-06-07 | 1998-01-27 | American Cyanamid Company | Method for the preparation of substantiallly monomeric calicheamicin derivative/carrier conjugates |
| US5714586A (en) * | 1995-06-07 | 1998-02-03 | American Cyanamid Company | Methods for the preparation of monomeric calicheamicin derivative/carrier conjugates |
| US5739116A (en) * | 1994-06-03 | 1998-04-14 | American Cyanamid Company | Enediyne derivatives useful for the synthesis of conjugates of methyltrithio antitumor agents |
| US5770701A (en) * | 1987-10-30 | 1998-06-23 | American Cyanamid Company | Process for preparing targeted forms of methyltrithio antitumor agents |
| US5780588A (en) * | 1993-01-26 | 1998-07-14 | Arizona Board Of Regents | Elucidation and synthesis of selected pentapeptides |
| US5821337A (en) * | 1991-06-14 | 1998-10-13 | Genentech, Inc. | Immunoglobulin variants |
| US5869046A (en) * | 1995-04-14 | 1999-02-09 | Genentech, Inc. | Altered polypeptides with increased half-life |
| US5869245A (en) * | 1996-06-05 | 1999-02-09 | Fox Chase Cancer Center | Mismatch endonuclease and its use in identifying mutations in targeted polynucleotide strands |
| US6027888A (en) * | 1996-04-05 | 2000-02-22 | Board Of Regents, The University Of Texas System | Methods for producing soluble, biologically-active disulfide-bond containing eukaryotic proteins in bacterial cells |
| US6083715A (en) * | 1997-06-09 | 2000-07-04 | Board Of Regents, The University Of Texas System | Methods for producing heterologous disulfide bond-containing polypeptides in bacterial cells |
| US6194551B1 (en) * | 1998-04-02 | 2001-02-27 | Genentech, Inc. | Polypeptide variants |
| US6306591B1 (en) * | 1997-06-18 | 2001-10-23 | Utah State University | Screening for the molecular defect causing spider lamb syndrome in sheep |
| US20020164328A1 (en) * | 2000-10-06 | 2002-11-07 | Toyohide Shinkawa | Process for purifying antibody |
| US20030115614A1 (en) * | 2000-10-06 | 2003-06-19 | Yutaka Kanda | Antibody composition-producing cell |
| US20030157108A1 (en) * | 2001-10-25 | 2003-08-21 | Genentech, Inc. | Glycoprotein compositions |
| US20040014024A1 (en) * | 1999-02-04 | 2004-01-22 | Avner Yayon | Screening assay for antagonists of FGFR-mediated malignant cell transformation and tumor formation |
| US20040093621A1 (en) * | 2001-12-25 | 2004-05-13 | Kyowa Hakko Kogyo Co., Ltd | Antibody composition which specifically binds to CD20 |
| US6737056B1 (en) * | 1999-01-15 | 2004-05-18 | Genentech, Inc. | Polypeptide variants with altered effector function |
| US20040110704A1 (en) * | 2002-04-09 | 2004-06-10 | Kyowa Hakko Kogyo Co., Ltd. | Cells of which genome is modified |
| US20040110282A1 (en) * | 2002-04-09 | 2004-06-10 | Kyowa Hakko Kogyo Co., Ltd. | Cells in which activity of the protein involved in transportation of GDP-fucose is reduced or lost |
| US20040109865A1 (en) * | 2002-04-09 | 2004-06-10 | Kyowa Hakko Kogyo Co., Ltd. | Antibody composition-containing medicament |
| US20040116330A1 (en) * | 2001-04-27 | 2004-06-17 | Kenichiro Naito | Preventive/therapeutic method for cancer |
| US20040132140A1 (en) * | 2002-04-09 | 2004-07-08 | Kyowa Hakko Kogyo Co., Ltd. | Production process for antibody composition |
| US20050014934A1 (en) * | 2002-10-15 | 2005-01-20 | Hinton Paul R. | Alteration of FcRn binding affinities or serum half-lives of antibodies by mutagenesis |
| US6849255B2 (en) * | 1998-08-18 | 2005-02-01 | Yissum Research Development Company Of The Hebrew University Of Jerusalem | Methods and compositions for enhancing cartilage repair |
| US20050123546A1 (en) * | 2003-11-05 | 2005-06-09 | Glycart Biotechnology Ag | Antigen binding molecules with increased Fc receptor binding affinity and effector function |
| US20050147612A1 (en) * | 2001-06-20 | 2005-07-07 | Avner Yayon | Antibodies that block receptor protein tyrosine kinase activation, methods of screening for and uses thereof |
| US20050169933A1 (en) * | 2003-10-10 | 2005-08-04 | Immunogen, Inc. | Method of targeting specific cell populations using cell-binding agent maytansinoid conjugates linked via a non-cleavable linker, said conjugates, and methods of making said conjugates |
| US7135311B1 (en) * | 1999-05-05 | 2006-11-14 | Institut Curie | Means for detecting and treating pathologies linked to FGFR3 |
| US20070092878A1 (en) * | 2003-03-26 | 2007-04-26 | Progenika Biopharma, S.A. | In vitro method to detect bladder transitional cell carcinoma |
| US7288406B2 (en) * | 2000-10-31 | 2007-10-30 | Prochon Biotech Ltd. | Active variants of FGF with improved specificity |
| US7498298B2 (en) * | 2003-11-06 | 2009-03-03 | Seattle Genetics, Inc. | Monomethylvaline compounds capable of conjugation to ligands |
| US20100003258A1 (en) * | 2008-07-01 | 2010-01-07 | Zhigang Weng | Fibroblast growth factor receptor 3 (fgfr3) binding proteins |
| US20100047251A1 (en) * | 2006-06-15 | 2010-02-25 | Avner Yayon | Antibodies blocking fibroblast growth factor receptor activation and methods of use thereof |
| US20100098696A1 (en) * | 2008-10-20 | 2010-04-22 | Haijun Sun | Fibroblast growth factor receptor-3 (fgfr-3) inhibitors and methods of treatment |
| US20100247531A1 (en) * | 2009-03-25 | 2010-09-30 | Genentech, Inc. | Anti-fgfr3 antibodies and methods using same |
Family Cites Families (73)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US510087A (en) | 1893-12-05 | Method of securing suspension-loops to the ends of hammock-bodies | ||
| FR2413974A1 (fr) | 1978-01-06 | 1979-08-03 | David Bernard | Sechoir pour feuilles imprimees par serigraphie |
| US4315929A (en) | 1981-01-27 | 1982-02-16 | The United States Of America As Represented By The Secretary Of Agriculture | Method of controlling the European corn borer with trewiasine |
| US4675187A (en) | 1983-05-16 | 1987-06-23 | Bristol-Myers Company | BBM-1675, a new antibiotic complex |
| GB8426467D0 (en) | 1984-10-19 | 1984-11-28 | Technology Licence Co Ltd | Monoclonal antibodies |
| GB8516415D0 (en) | 1985-06-28 | 1985-07-31 | Celltech Ltd | Culture of animal cells |
| IE61148B1 (en) | 1988-03-10 | 1994-10-05 | Ici Plc | Method of detecting nucleotide sequences |
| US20030232010A2 (en) * | 1988-03-29 | 2003-12-18 | Immunomedics, Inc. | Improved cytotoxic therapy |
| AU632065B2 (en) | 1988-09-23 | 1992-12-17 | Novartis Vaccines And Diagnostics, Inc. | Cell culture medium for enhanced cell growth, culture longevity and product expression |
| DE3920358A1 (de) | 1989-06-22 | 1991-01-17 | Behringwerke Ag | Bispezifische und oligospezifische, mono- und oligovalente antikoerperkonstrukte, ihre herstellung und verwendung |
| ES2096590T3 (es) | 1989-06-29 | 1997-03-16 | Medarex Inc | Reactivos biespecificos para la terapia del sida. |
| CA2026147C (en) | 1989-10-25 | 2006-02-07 | Ravi J. Chari | Cytotoxic agents comprising maytansinoids and their therapeutic use |
| DE69132709T2 (de) | 1990-06-29 | 2002-06-20 | Large Scale Biology Corp., Vacaville | Melaninproduktion durch transformierte mikroorganismen |
| CA2405246A1 (en) | 1990-12-03 | 1992-06-11 | Genentech, Inc. | Enrichment method for variant proteins with alterred binding properties |
| CN1068652A (zh) | 1991-06-10 | 1993-02-03 | 基斯通国际集团公司 | 监测再循环控制系统性能的方法和设备 |
| AU665025B2 (en) | 1991-09-23 | 1995-12-14 | Cambridge Antibody Technology Limited | Production of chimeric antibodies - a combinatorial approach |
| WO1993008829A1 (en) | 1991-11-04 | 1993-05-13 | The Regents Of The University Of California | Compositions that mediate killing of hiv-infected cells |
| DE69232137T2 (de) | 1991-11-25 | 2002-05-29 | Enzon Inc | Multivalente antigen-bindende proteine |
| IL100219A0 (en) | 1991-12-02 | 1992-09-06 | Yeda Res & Dev | Variable region within fibroblast growth factor receptors that confers ligand specificity |
| US5667988A (en) | 1992-01-27 | 1997-09-16 | The Scripps Research Institute | Methods for producing antibody libraries using universal or randomized immunoglobulin light chains |
| AU675929B2 (en) | 1992-02-06 | 1997-02-27 | Curis, Inc. | Biosynthetic binding protein for cancer marker |
| ZA932522B (en) | 1992-04-10 | 1993-12-20 | Res Dev Foundation | Immunotoxins directed against c-erbB-2(HER/neu) related surface antigens |
| EP0656064B1 (en) | 1992-08-17 | 1997-03-05 | Genentech, Inc. | Bispecific immunoadhesins |
| MD1367C2 (ro) | 1992-11-13 | 2000-11-30 | Idec Pharmaceuticals Corporation | Metode de tratament al limfomului celulelor B, anticorpi anti-CD20, hibridom. |
| AU6446194A (en) | 1993-03-17 | 1994-10-11 | Whittier Institute For Diabetes And Endocrinology, The | Monoclonal antibodies specific for fibroblast growth factor receptors, immunotoxins, and use thereof |
| AU691811B2 (en) | 1993-06-16 | 1998-05-28 | Celltech Therapeutics Limited | Antibodies |
| US5910486A (en) | 1994-09-06 | 1999-06-08 | Uab Research Foundation | Methods for modulating protein function in cells using, intracellular antibody homologues |
| US5739277A (en) | 1995-04-14 | 1998-04-14 | Genentech Inc. | Altered polypeptides with increased half-life |
| DE69619526T2 (de) | 1995-06-12 | 2002-10-31 | Yeda Research And Development Co., Ltd. | Fgf9 als spezifischer ligand für fgfr3 |
| GB9603256D0 (en) | 1996-02-16 | 1996-04-17 | Wellcome Found | Antibodies |
| US5994071A (en) | 1997-04-04 | 1999-11-30 | Albany Medical College | Assessment of prostate cancer |
| ATE296315T1 (de) | 1997-06-24 | 2005-06-15 | Genentech Inc | Galactosylierte glykoproteine enthaltende zusammensetzungen und verfahren zur deren herstellung |
| WO1999022764A1 (en) | 1997-10-31 | 1999-05-14 | Genentech, Inc. | Methods and compositions comprising glycoprotein glycoforms |
| ES2292236T3 (es) | 1998-04-02 | 2008-03-01 | Genentech, Inc. | Variantes de anticuerpos y sus fragmentos. |
| ES2434961T5 (es) | 1998-04-20 | 2018-01-18 | Roche Glycart Ag | Ingeniería de glicosilación de anticuerpos para mejorar la citotoxicidad celular dependiente del anticuerpo |
| HU230769B1 (hu) | 1999-01-15 | 2018-03-28 | Genentech Inc. | Módosított effektor-funkciójú polipeptid-változatok |
| EP1176195B1 (en) | 1999-04-09 | 2013-05-22 | Kyowa Hakko Kirin Co., Ltd. | Method for controlling the activity of immunologically functional molecule |
| CA2388245C (en) | 1999-10-19 | 2012-01-10 | Kyowa Kirin Co., Ltd. | The use of serum-free adapted rat cells for producing heterologous polypeptides |
| EP2180054A1 (en) | 1999-12-24 | 2010-04-28 | Genentech, Inc. | Methods and compositions for prolonging elimination half-times of bioactive compounds |
| PT1355919E (pt) | 2000-12-12 | 2011-03-02 | Medimmune Llc | Moléculas com semivida longa, composições que as contêm e suas utilizações |
| CA2432257A1 (en) | 2000-12-18 | 2002-06-27 | Gene Logic, Inc. | Treatment of bone disorders by modulation of fgfr3 |
| US6884869B2 (en) | 2001-04-30 | 2005-04-26 | Seattle Genetics, Inc. | Pentapeptide compounds and uses related thereto |
| EP2180044A1 (en) | 2001-08-03 | 2010-04-28 | GlycArt Biotechnology AG | Antibody glycosylation variants having increased anti-body-dependent cellular cytotoxicity |
| US20040259150A1 (en) | 2002-04-09 | 2004-12-23 | Kyowa Hakko Kogyo Co., Ltd. | Method of enhancing of binding activity of antibody composition to Fcgamma receptor IIIa |
| JP4832719B2 (ja) | 2002-04-09 | 2011-12-07 | 協和発酵キリン株式会社 | FcγRIIIa多型患者に適応する抗体組成物含有医薬 |
| EP1391213A1 (en) | 2002-08-21 | 2004-02-25 | Boehringer Ingelheim International GmbH | Compositions and methods for treating cancer using maytansinoid CD44 antibody immunoconjugates and chemotherapeutic agents |
| EP3263596A1 (en) | 2002-12-16 | 2018-01-03 | Genentech, Inc. | Immunoglobulin variants and uses thereof |
| IL156495A0 (en) | 2003-06-17 | 2004-01-04 | Prochon Biotech Ltd | Use of fgfr3 antagonists for treating t cell mediated diseases |
| US20080241884A1 (en) | 2003-10-08 | 2008-10-02 | Kenya Shitara | Fused Protein Composition |
| JPWO2005035778A1 (ja) | 2003-10-09 | 2006-12-21 | 協和醗酵工業株式会社 | α1,6−フコシルトランスフェラーゼの機能を抑制するRNAを用いた抗体組成物の製造法 |
| WO2005053742A1 (ja) | 2003-12-04 | 2005-06-16 | Kyowa Hakko Kogyo Co., Ltd. | 抗体組成物を含有する医薬 |
| CA2550245A1 (en) * | 2003-12-19 | 2005-07-21 | Five Prime Therapeutics, Inc. | Fibroblast growth factor receptors 1, 2, 3, and 4 as targets for therapeutic intervention |
| EP1773885B1 (en) | 2004-08-05 | 2010-04-21 | Genentech, Inc. | Humanized anti-cmet antagonists |
| WO2006048877A2 (en) | 2004-11-04 | 2006-05-11 | Fibron Limited | Treatment of b-cell malignancies with fgfr3 inhibitors |
| TW200902555A (en) * | 2005-01-03 | 2009-01-16 | Hoffmann La Roche | Antibodies against IL-13 receptor alpha 1 and uses thereof |
| NZ563370A (en) | 2005-06-20 | 2010-10-29 | Genentech Inc | Compositions and methods for the diagnosis and treatment of tumor |
| BRPI0617863A2 (pt) | 2005-10-28 | 2011-08-09 | Irm Llc | compostos e composições como inibidores da proteìna quinase |
| AU2007248444B2 (en) | 2006-01-05 | 2012-10-25 | Genentech, Inc. | Anti-EphB4 antibodies and methods using same |
| US8153764B2 (en) | 2007-03-15 | 2012-04-10 | Reverse Proteomics Research Institute Co., Ltd. | Biomarker specific to brain/nerve or specific to neuronal differentiation |
| AU2008323206B2 (en) | 2007-11-12 | 2014-08-14 | U3 Pharma Gmbh | AXL antibodies |
| UY31800A (es) | 2008-05-05 | 2009-11-10 | Smithkline Beckman Corp | Metodo de tratamiento de cancer usando un inhibidor de cmet y axl y un inhibidor de erbb |
| WO2010098788A2 (en) | 2008-08-25 | 2010-09-02 | Amplimmune, Inc. | Pd-i antagonists and methods for treating infectious disease |
| WO2011066342A2 (en) | 2009-11-24 | 2011-06-03 | Amplimmune, Inc. | Simultaneous inhibition of pd-l1/pd-l2 |
| US8754114B2 (en) | 2010-12-22 | 2014-06-17 | Incyte Corporation | Substituted imidazopyridazines and benzimidazoles as inhibitors of FGFR3 |
| AR091649A1 (es) | 2012-07-02 | 2015-02-18 | Bristol Myers Squibb Co | Optimizacion de anticuerpos que se fijan al gen de activacion de linfocitos 3 (lag-3) y sus usos |
| CA2878183A1 (en) | 2012-07-27 | 2014-01-30 | Genentech, Inc. | Methods of treating fgfr3 related conditions |
| EP2743657B1 (en) | 2012-12-13 | 2016-03-02 | Thomson Licensing | Method for controlling an image display device to allow an observer to perceive colours as another observer |
| CA2916681A1 (en) | 2013-07-16 | 2015-01-22 | Genentech, Inc. | Methods of treating cancer using pd-1 axis binding antagonists and tigit inhibitors |
| TWI541022B (zh) | 2013-12-18 | 2016-07-11 | 應克隆公司 | 針對纖維母細胞生長因子受體-3(fgfr3)之化合物及治療方法 |
| JP6774421B2 (ja) | 2015-02-19 | 2020-10-21 | フュージョン ファーマシューティカルズ インク. | がんの治療のための方法、組成物、及びキット |
| US10983340B2 (en) | 2016-02-04 | 2021-04-20 | Digilens Inc. | Holographic waveguide optical tracker |
| SG11201906249PA (en) | 2017-02-06 | 2019-08-27 | Rainier Therapeutics Inc | Methods, compositions, and kits for treatment of cancer |
| US20200277387A1 (en) | 2019-03-01 | 2020-09-03 | Rainier Therapeutics, Inc. | Methods and compositions for treating cancer |
-
2010
- 2010-03-24 TW TW099108751A patent/TWI507205B/zh active
- 2010-03-24 CA CA2754163A patent/CA2754163C/en active Active
- 2010-03-24 HR HRP20150965TT patent/HRP20150965T1/hr unknown
- 2010-03-24 KR KR1020117025047A patent/KR101822663B1/ko active Active
- 2010-03-24 RU RU2011142905/10A patent/RU2568066C2/ru active
- 2010-03-24 NZ NZ594339A patent/NZ594339A/xx unknown
- 2010-03-24 MX MX2011009961A patent/MX2011009961A/es active IP Right Grant
- 2010-03-24 LT LTEP19175988.5T patent/LT3702371T/lt unknown
- 2010-03-24 EP EP20130183384 patent/EP2679600A1/en not_active Ceased
- 2010-03-24 EP EP19175988.5A patent/EP3702371B1/en active Active
- 2010-03-24 PE PE2011001694A patent/PE20120553A1/es not_active Application Discontinuation
- 2010-03-24 US US12/661,852 patent/US20100291114A1/en not_active Abandoned
- 2010-03-24 SG SG2011068897A patent/SG174904A1/en unknown
- 2010-03-24 EP EP10722819.9A patent/EP2411414B1/en active Active
- 2010-03-24 DK DK19175988.5T patent/DK3702371T5/da active
- 2010-03-24 ES ES19175988T patent/ES2932874T3/es active Active
- 2010-03-24 HR HRP20221471TT patent/HRP20221471T1/hr unknown
- 2010-03-24 AU AU2010229994A patent/AU2010229994B2/en not_active Ceased
- 2010-03-24 KR KR1020167032334A patent/KR101830024B1/ko active Active
- 2010-03-24 ES ES10722819.9T patent/ES2549769T3/es active Active
- 2010-03-24 SI SI201031035T patent/SI2411414T1/sl unknown
- 2010-03-24 JP JP2012502202A patent/JP5757534B2/ja active Active
- 2010-03-24 BR BRPI1006448-6A patent/BRPI1006448B1/pt active IP Right Grant
- 2010-03-24 CN CN201510080510.9A patent/CN104788564A/zh active Pending
- 2010-03-24 WO PCT/US2010/028470 patent/WO2010111367A1/en not_active Ceased
- 2010-03-24 DK DK10722819.9T patent/DK2411414T3/en active
- 2010-03-24 UA UAA201112490A patent/UA104459C2/uk unknown
- 2010-03-24 SI SI201032125T patent/SI3702371T1/sl unknown
- 2010-03-24 MA MA34269A patent/MA33208B1/fr unknown
- 2010-03-24 HU HUE19175988A patent/HUE061117T2/hu unknown
- 2010-03-24 MX MX2014012836A patent/MX345909B/es unknown
- 2010-03-24 US US12/731,100 patent/US8410250B2/en active Active
- 2010-03-24 CN CN201080013816.8A patent/CN102378767B/zh active Active
- 2010-03-24 HU HUE10722819A patent/HUE025726T2/en unknown
- 2010-03-25 AR ARP100100947A patent/AR075939A1/es active IP Right Grant
-
2011
- 2011-07-28 ZA ZA2011/05574A patent/ZA201105574B/en unknown
- 2011-08-03 IL IL214433A patent/IL214433A/en active IP Right Grant
- 2011-08-28 EC EC2011011417A patent/ECSP11011417A/es unknown
- 2011-09-01 CO CO11112595A patent/CO6450665A2/es active IP Right Grant
-
2012
- 2012-08-10 US US13/572,557 patent/US20120321606A1/en not_active Abandoned
- 2012-10-16 US US13/653,293 patent/US8710189B2/en active Active
-
2013
- 2013-02-07 US US13/762,252 patent/US9161977B2/en active Active
-
2014
- 2014-03-04 US US14/197,072 patent/US20140187754A1/en not_active Abandoned
-
2015
- 2015-10-19 US US14/887,042 patent/US9499623B2/en active Active
-
2016
- 2016-09-15 US US15/266,105 patent/US10000571B2/en active Active
- 2016-11-18 US US15/356,483 patent/US10287356B2/en active Active
-
2017
- 2017-02-15 IL IL250624A patent/IL250624B/en active IP Right Grant
-
2019
- 2019-04-10 US US16/380,865 patent/US11401333B2/en active Active
-
2020
- 2020-08-12 AR ARP200102285A patent/AR119754A2/es unknown
Patent Citations (100)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3773919A (en) * | 1969-10-23 | 1973-11-20 | Du Pont | Polylactide-drug mixtures |
| US3896111A (en) * | 1973-02-20 | 1975-07-22 | Research Corp | Ansa macrolides |
| US4151042A (en) * | 1977-03-31 | 1979-04-24 | Takeda Chemical Industries, Ltd. | Method for producing maytansinol and its derivatives |
| US4137230A (en) * | 1977-11-14 | 1979-01-30 | Takeda Chemical Industries, Ltd. | Method for the production of maytansinoids |
| USRE30985E (en) * | 1978-01-01 | 1982-06-29 | Serum-free cell culture media | |
| US4313929A (en) * | 1978-02-16 | 1982-02-02 | Mitsubishi Chemical Industries Limited | Method of measurement of antigens and antibodies |
| US4307016A (en) * | 1978-03-24 | 1981-12-22 | Takeda Chemical Industries, Ltd. | Demethyl maytansinoids |
| US4265814A (en) * | 1978-03-24 | 1981-05-05 | Takeda Chemical Industries | Matansinol 3-n-hexadecanoate |
| US4361650A (en) * | 1978-03-24 | 1982-11-30 | Takeda Chemical Industries, Ltd. | Fermentation process of preparing demethyl maytansinoids |
| US4248870A (en) * | 1978-10-27 | 1981-02-03 | Takeda Chemical Industries, Ltd. | Maytansinoids and use |
| US4260608A (en) * | 1978-11-14 | 1981-04-07 | Takeda Chemical Industries, Ltd. | Maytansinoids, pharmaceutical compositions thereof and methods of use thereof |
| US4256746A (en) * | 1978-11-14 | 1981-03-17 | Takeda Chemical Industries | Dechloromaytansinoids, their pharmaceutical compositions and method of use |
| US4294757A (en) * | 1979-01-31 | 1981-10-13 | Takeda Chemical Industries, Ltd | 20-O-Acylmaytansinoids |
| US4322348A (en) * | 1979-06-05 | 1982-03-30 | Takeda Chemical Industries, Ltd. | Maytansinoids |
| US4317821A (en) * | 1979-06-08 | 1982-03-02 | Takeda Chemical Industries, Ltd. | Maytansinoids, their use and pharmaceutical compositions thereof |
| US4308269A (en) * | 1979-06-11 | 1981-12-29 | Takeda Chemical Industries, Ltd. | Maytansinoids, pharmaceutical compositions thereof and method of use thereof |
| US4308268A (en) * | 1979-06-11 | 1981-12-29 | Takeda Chemical Industries, Ltd. | Maytansinoids, pharmaceutical compositions thereof and method of use thereof |
| US4309428A (en) * | 1979-07-30 | 1982-01-05 | Takeda Chemical Industries, Ltd. | Maytansinoids |
| US4331598A (en) * | 1979-09-19 | 1982-05-25 | Takeda Chemical Industries, Ltd. | Maytansinoids |
| US4364866A (en) * | 1979-09-21 | 1982-12-21 | Takeda Chemical Industries, Ltd. | Maytansinoids |
| US4362663A (en) * | 1979-09-21 | 1982-12-07 | Takeda Chemical Industries, Ltd. | Maytansinoid compound |
| US4371533A (en) * | 1980-10-08 | 1983-02-01 | Takeda Chemical Industries, Ltd. | 4,5-Deoxymaytansinoids, their use and pharmaceutical compositions thereof |
| US4450254A (en) * | 1980-11-03 | 1984-05-22 | Standard Oil Company | Impact improvement of high nitrile resins |
| US4419446A (en) * | 1980-12-31 | 1983-12-06 | The United States Of America As Represented By The Department Of Health And Human Services | Recombinant DNA process utilizing a papilloma virus DNA as a vector |
| US4313946A (en) * | 1981-01-27 | 1982-02-02 | The United States Of America As Represented By The Secretary Of Agriculture | Chemotherapeutically active maytansinoids from Trewia nudiflora |
| US4424219A (en) * | 1981-05-20 | 1984-01-03 | Takeda Chemical Industries, Ltd. | 9-Thiomaytansinoids and their pharmaceutical compositions and use |
| US4601978A (en) * | 1982-11-24 | 1986-07-22 | The Regents Of The University Of California | Mammalian metallothionein promoter system |
| US4560655A (en) * | 1982-12-16 | 1985-12-24 | Immunex Corporation | Serum-free cell culture medium and process for making same |
| US4657866A (en) * | 1982-12-21 | 1987-04-14 | Sudhir Kumar | Serum-free, synthetic, completely chemically defined tissue culture media |
| US4816567A (en) * | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| US4767704A (en) * | 1983-10-07 | 1988-08-30 | Columbia University In The City Of New York | Protein-free culture medium |
| US4683203A (en) * | 1984-04-14 | 1987-07-28 | Redco N.V. | Immobilized enzymes, processes for preparing same, and use thereof |
| US4965199A (en) * | 1984-04-20 | 1990-10-23 | Genentech, Inc. | Preparation of functional human factor VIII in mammalian cells using methotrexate based selection |
| US4676980A (en) * | 1985-09-23 | 1987-06-30 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Target specific cross-linked heteroantibodies |
| US4970198A (en) * | 1985-10-17 | 1990-11-13 | American Cyanamid Company | Antitumor antibiotics (LL-E33288 complex) |
| US4683195A (en) * | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| US4683195B1 (https=) * | 1986-01-30 | 1990-11-27 | Cetus Corp | |
| US4927762A (en) * | 1986-04-01 | 1990-05-22 | Cell Enterprises, Inc. | Cell culture medium with antioxidant |
| US5500362A (en) * | 1987-01-08 | 1996-03-19 | Xoma Corporation | Chimeric antibody with specificity to human B cell surface antigen |
| US5079233A (en) * | 1987-01-30 | 1992-01-07 | American Cyanamid Company | N-acyl derivatives of the LL-E33288 antitumor antibiotics, composition and methods for using the same |
| US5648260A (en) * | 1987-03-18 | 1997-07-15 | Scotgen Biopharmaceuticals Incorporated | DNA encoding antibodies with altered effector functions |
| US5624821A (en) * | 1987-03-18 | 1997-04-29 | Scotgen Biopharmaceuticals Incorporated | Antibodies with altered effector functions |
| US5770701A (en) * | 1987-10-30 | 1998-06-23 | American Cyanamid Company | Process for preparing targeted forms of methyltrithio antitumor agents |
| US5770710A (en) * | 1987-10-30 | 1998-06-23 | American Cyanamid Company | Antitumor and antibacterial substituted disulfide derivatives prepared from compounds possessing a methlytrithio group |
| US5606040A (en) * | 1987-10-30 | 1997-02-25 | American Cyanamid Company | Antitumor and antibacterial substituted disulfide derivatives prepared from compounds possessing a methyl-trithio group |
| US4975278A (en) * | 1988-02-26 | 1990-12-04 | Bristol-Myers Company | Antibody-enzyme conjugates in combination with prodrugs for the delivery of cytotoxic agents to tumor cells |
| US5053394A (en) * | 1988-09-21 | 1991-10-01 | American Cyanamid Company | Targeted forms of methyltrithio antitumor agents |
| US5585089A (en) * | 1988-12-28 | 1996-12-17 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| US5707632A (en) * | 1989-07-06 | 1998-01-13 | The Regents Of The University Of Ca | Receptors for fibroblast growth factors |
| US5208020A (en) * | 1989-10-25 | 1993-05-04 | Immunogen Inc. | Cytotoxic agents comprising maytansinoids and their therapeutic use |
| US5416064A (en) * | 1989-10-25 | 1995-05-16 | Immunogen, Inc. | Cytotoxic agents comprising maytansinoids and their therapeutic use |
| US5122469A (en) * | 1990-10-03 | 1992-06-16 | Genentech, Inc. | Method for culturing Chinese hamster ovary cells to improve production of recombinant proteins |
| US5508192A (en) * | 1990-11-09 | 1996-04-16 | Board Of Regents, The University Of Texas System | Bacterial host strains for producing proteolytically sensitive polypeptides |
| US5264365A (en) * | 1990-11-09 | 1993-11-23 | Board Of Regents, The University Of Texas System | Protease-deficient bacterial strains for production of proteolytically sensitive polypeptides |
| US5571894A (en) * | 1991-02-05 | 1996-11-05 | Ciba-Geigy Corporation | Recombinant antibodies specific for a growth factor receptor |
| US5821337A (en) * | 1991-06-14 | 1998-10-13 | Genentech, Inc. | Immunoglobulin variants |
| US5648237A (en) * | 1991-09-19 | 1997-07-15 | Genentech, Inc. | Expression of functional antibody fragments |
| US5362852A (en) * | 1991-09-27 | 1994-11-08 | Pfizer Inc. | Modified peptide derivatives conjugated at 2-hydroxyethylamine moieties |
| US5587458A (en) * | 1991-10-07 | 1996-12-24 | Aronex Pharmaceuticals, Inc. | Anti-erbB-2 antibodies, combinations thereof, and therapeutic and diagnostic uses thereof |
| US5635483A (en) * | 1992-12-03 | 1997-06-03 | Arizona Board Of Regents Acting On Behalf Of Arizona State University | Tumor inhibiting tetrapeptide bearing modified phenethyl amides |
| US5780588A (en) * | 1993-01-26 | 1998-07-14 | Arizona Board Of Regents | Elucidation and synthesis of selected pentapeptides |
| US5877296A (en) * | 1994-06-03 | 1999-03-02 | American Cyanamid Company | Process for preparing conjugates of methyltrithio antitumor agents |
| US5773001A (en) * | 1994-06-03 | 1998-06-30 | American Cyanamid Company | Conjugates of methyltrithio antitumor agents and intermediates for their synthesis |
| US5739116A (en) * | 1994-06-03 | 1998-04-14 | American Cyanamid Company | Enediyne derivatives useful for the synthesis of conjugates of methyltrithio antitumor agents |
| US5767285A (en) * | 1994-06-03 | 1998-06-16 | American Cyanamid Company | Linkers useful for the synthesis of conjugates of methyltrithio antitumor agents |
| US5639635A (en) * | 1994-11-03 | 1997-06-17 | Genentech, Inc. | Process for bacterial production of polypeptides |
| US5663149A (en) * | 1994-12-13 | 1997-09-02 | Arizona Board Of Regents Acting On Behalf Of Arizona State University | Human cancer inhibitory pentapeptide heterocyclic and halophenyl amides |
| US5869046A (en) * | 1995-04-14 | 1999-02-09 | Genentech, Inc. | Altered polypeptides with increased half-life |
| US5641870A (en) * | 1995-04-20 | 1997-06-24 | Genentech, Inc. | Low pH hydrophobic interaction chromatography for antibody purification |
| US5714586A (en) * | 1995-06-07 | 1998-02-03 | American Cyanamid Company | Methods for the preparation of monomeric calicheamicin derivative/carrier conjugates |
| US5712374A (en) * | 1995-06-07 | 1998-01-27 | American Cyanamid Company | Method for the preparation of substantiallly monomeric calicheamicin derivative/carrier conjugates |
| US6027888A (en) * | 1996-04-05 | 2000-02-22 | Board Of Regents, The University Of Texas System | Methods for producing soluble, biologically-active disulfide-bond containing eukaryotic proteins in bacterial cells |
| US5869245A (en) * | 1996-06-05 | 1999-02-09 | Fox Chase Cancer Center | Mismatch endonuclease and its use in identifying mutations in targeted polynucleotide strands |
| US6083715A (en) * | 1997-06-09 | 2000-07-04 | Board Of Regents, The University Of Texas System | Methods for producing heterologous disulfide bond-containing polypeptides in bacterial cells |
| US6306591B1 (en) * | 1997-06-18 | 2001-10-23 | Utah State University | Screening for the molecular defect causing spider lamb syndrome in sheep |
| US6194551B1 (en) * | 1998-04-02 | 2001-02-27 | Genentech, Inc. | Polypeptide variants |
| US6849255B2 (en) * | 1998-08-18 | 2005-02-01 | Yissum Research Development Company Of The Hebrew University Of Jerusalem | Methods and compositions for enhancing cartilage repair |
| US6737056B1 (en) * | 1999-01-15 | 2004-05-18 | Genentech, Inc. | Polypeptide variants with altered effector function |
| US20040014024A1 (en) * | 1999-02-04 | 2004-01-22 | Avner Yayon | Screening assay for antagonists of FGFR-mediated malignant cell transformation and tumor formation |
| US7135311B1 (en) * | 1999-05-05 | 2006-11-14 | Institut Curie | Means for detecting and treating pathologies linked to FGFR3 |
| US20030115614A1 (en) * | 2000-10-06 | 2003-06-19 | Yutaka Kanda | Antibody composition-producing cell |
| US20020164328A1 (en) * | 2000-10-06 | 2002-11-07 | Toyohide Shinkawa | Process for purifying antibody |
| US7288406B2 (en) * | 2000-10-31 | 2007-10-30 | Prochon Biotech Ltd. | Active variants of FGF with improved specificity |
| US20040116330A1 (en) * | 2001-04-27 | 2004-06-17 | Kenichiro Naito | Preventive/therapeutic method for cancer |
| US20050147612A1 (en) * | 2001-06-20 | 2005-07-07 | Avner Yayon | Antibodies that block receptor protein tyrosine kinase activation, methods of screening for and uses thereof |
| US20030157108A1 (en) * | 2001-10-25 | 2003-08-21 | Genentech, Inc. | Glycoprotein compositions |
| US20040093621A1 (en) * | 2001-12-25 | 2004-05-13 | Kyowa Hakko Kogyo Co., Ltd | Antibody composition which specifically binds to CD20 |
| US20040110704A1 (en) * | 2002-04-09 | 2004-06-10 | Kyowa Hakko Kogyo Co., Ltd. | Cells of which genome is modified |
| US20040110282A1 (en) * | 2002-04-09 | 2004-06-10 | Kyowa Hakko Kogyo Co., Ltd. | Cells in which activity of the protein involved in transportation of GDP-fucose is reduced or lost |
| US20040109865A1 (en) * | 2002-04-09 | 2004-06-10 | Kyowa Hakko Kogyo Co., Ltd. | Antibody composition-containing medicament |
| US20040132140A1 (en) * | 2002-04-09 | 2004-07-08 | Kyowa Hakko Kogyo Co., Ltd. | Production process for antibody composition |
| US20050014934A1 (en) * | 2002-10-15 | 2005-01-20 | Hinton Paul R. | Alteration of FcRn binding affinities or serum half-lives of antibodies by mutagenesis |
| US20070092878A1 (en) * | 2003-03-26 | 2007-04-26 | Progenika Biopharma, S.A. | In vitro method to detect bladder transitional cell carcinoma |
| US20050169933A1 (en) * | 2003-10-10 | 2005-08-04 | Immunogen, Inc. | Method of targeting specific cell populations using cell-binding agent maytansinoid conjugates linked via a non-cleavable linker, said conjugates, and methods of making said conjugates |
| US20050123546A1 (en) * | 2003-11-05 | 2005-06-09 | Glycart Biotechnology Ag | Antigen binding molecules with increased Fc receptor binding affinity and effector function |
| US7498298B2 (en) * | 2003-11-06 | 2009-03-03 | Seattle Genetics, Inc. | Monomethylvaline compounds capable of conjugation to ligands |
| US20100047251A1 (en) * | 2006-06-15 | 2010-02-25 | Avner Yayon | Antibodies blocking fibroblast growth factor receptor activation and methods of use thereof |
| US20100003258A1 (en) * | 2008-07-01 | 2010-01-07 | Zhigang Weng | Fibroblast growth factor receptor 3 (fgfr3) binding proteins |
| US20100098696A1 (en) * | 2008-10-20 | 2010-04-22 | Haijun Sun | Fibroblast growth factor receptor-3 (fgfr-3) inhibitors and methods of treatment |
| US20100247531A1 (en) * | 2009-03-25 | 2010-09-30 | Genentech, Inc. | Anti-fgfr3 antibodies and methods using same |
Non-Patent Citations (5)
| Title |
|---|
| Benevenuti et al., Crystallization of Soluble Proteins in Vapor Diffusion for X-ray Crystallography, Nature Protocols, published on-line 28 June 2007, 2(7):1633-1651. * |
| Cudney R. Protein Crystallization and Dumb Luck. The Rigaku Journal. 1999. Vol. 16, No. 1, pp. 1-7. * |
| Drenth, "Principles of Protein X-Ray Crystallography", 2nd Edition, 1999 Springer-Verlag New York Inc., Chapter 1, p. 1-21. * |
| Kundrot, C.E. Which Strategy for a Protein Crystallization Project? Cellular Molecular Life Science. 2004. Vol., 61, pp. 525-536. * |
| McPherson, A. Current Approaches to Macromolecular Crystallization. European Journal of Biochemistry. 1990. Vol. 189, pp. 1-23. * |
Cited By (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10287356B2 (en) | 2009-03-25 | 2019-05-14 | Genentech, Inc. | Anti-FGFR3 antibodies and methods using same |
| US11401333B2 (en) | 2009-03-25 | 2022-08-02 | Genentech, Inc. | Anti-FGFR3 antibodies and methods using same |
| US9161977B2 (en) | 2009-03-25 | 2015-10-20 | F. Hoffmann-La Roche Ag | Anti-FGFR3 antibodies and methods using same |
| US9499623B2 (en) | 2009-03-25 | 2016-11-22 | Genentech, Inc. | Anti-FGFR3 antibodies and methods using same |
| US10000571B2 (en) | 2009-03-25 | 2018-06-19 | Genentech, Inc. | Anti-FGFR3 antibodies and methods using same |
| US8410250B2 (en) | 2009-03-25 | 2013-04-02 | Genentech, Inc. | Anti-FGFR3 antibodies and methods using same |
| US8710189B2 (en) | 2009-03-25 | 2014-04-29 | Genentech, Inc. | Anti-FGFR3 antibodies and methods using same |
| US11702642B2 (en) | 2013-01-16 | 2023-07-18 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Soluble fibroblast growth factor receptor 3 (FGR3) polypeptide for use in the prevention or treatment of skeletal growth retardation disorders |
| US10724014B2 (en) | 2013-01-16 | 2020-07-28 | Institut National De La Sante Et De La Recherche Medicale | Soluble fibroblast growth factor receptor 3 (FGR3) polypeptide for use in the prevention or treatment of skeletal growth retardation disorders |
| US11814654B2 (en) | 2013-01-16 | 2023-11-14 | Institut National De La Sante Et De La Recherche Medicale | Soluble fibroblast growth factor receptor 3 (FGR3) polypeptide for use in the prevention or treatment of skeletal growth retardation disorders |
| US10208120B2 (en) | 2014-11-05 | 2019-02-19 | Genentech, Inc. | Anti-FGFR2/3 antibodies and methods using same |
| US11021528B2 (en) | 2016-07-07 | 2021-06-01 | INSERM (Institut National de la Santé et de la Recherche Médicale | Soluble fibroblast growth factor receptor 3 (SFGFR3) polypeptides and uses thereof |
| US11697678B2 (en) | 2016-07-07 | 2023-07-11 | Pfizer Inc. | Soluble fibroblast growth factor receptor 3 (SFGFR3) polypeptides and uses thereof |
| US10294289B2 (en) | 2016-07-07 | 2019-05-21 | Therachon Sas | Soluble fibroblast growth factor receptor 3 (SFGFR3) polypeptides and uses thereof |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20100291114A1 (en) | Crystal structures and methods using same | |
| JP6877350B2 (ja) | 抗fgfr2/3抗体及びその使用方法 | |
| JP2012521759A5 (https=) | ||
| AU2013205318B2 (en) | Anti-FGFR3 antibodies and methods using same | |
| HK40037257A (en) | Anti-fgfr3 antibodies and methods using same | |
| HK40037257B (en) | Anti-fgfr3 antibodies and methods using same | |
| HK1167666B (en) | Anti-fgfr3 antibodies and methods using same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AS | Assignment |
Owner name: GENENTECH, INC., CALIFORNIA Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:WIESMANN, CHRISTIAN;REEL/FRAME:024756/0384 Effective date: 20100617 |
|
| AS | Assignment |
Owner name: F. HOFFMANN-LA ROCHE AG, SWITZERLAND Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:GENENTECH, INC.;REEL/FRAME:025635/0307 Effective date: 20101119 |
|
| STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION |