US20040247562A1 - Diagnostic method for cancer characterized in the detection of the deletion of g-csf exon 3 - Google Patents

Diagnostic method for cancer characterized in the detection of the deletion of g-csf exon 3 Download PDF

Info

Publication number
US20040247562A1
US20040247562A1 US10/490,502 US49050204A US2004247562A1 US 20040247562 A1 US20040247562 A1 US 20040247562A1 US 49050204 A US49050204 A US 49050204A US 2004247562 A1 US2004247562 A1 US 2004247562A1
Authority
US
United States
Prior art keywords
csf
exon
seq
cancer
deletion
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/490,502
Other languages
English (en)
Inventor
Sang Yup Lee
Nae Yoo
So Yoo
Hyun Chung
Ki Keum
Won Yoo
Ki Jeong
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Medigenes Co Ltd
Original Assignee
Medigenes Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Medigenes Co Ltd filed Critical Medigenes Co Ltd
Assigned to MEDIGENES reassignment MEDIGENES ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: CHUNG, HYUN CHEOL, JEONG, KI JUN, KEUM, KI CHANG, LEE, SANG YUP, YOO, NAE CHOON, YOO, SO YOUNG, YOO, WON MIN
Publication of US20040247562A1 publication Critical patent/US20040247562A1/en
Priority to US11/059,222 priority Critical patent/US20050266430A1/en
Priority to US11/058,976 priority patent/US8324363B2/en
Priority to US11/059,192 priority patent/US20050170416A1/en
Priority to US11/059,127 priority patent/US20050158810A1/en
Priority to US11/059,268 priority patent/US20050170417A1/en
Priority to US12/830,085 priority patent/US20100286381A1/en
Priority to US13/546,975 priority patent/US20140005365A1/en
Priority to US13/546,972 priority patent/US20120322684A1/en
Priority to US13/546,966 priority patent/US20120329078A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/24Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
    • C07K16/243Colony Stimulating Factors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Definitions

  • the present invention relates to a method of diagnosing cancer based on modified features in granulocyte colony stimulating factor (G-CSF) mRNA or protein. More particularly, the present invention relates to a diagnostic and prognostic method for cancer based on skipping of the exon 3 region of the G-CSF gene at mRNA or protein levels, wherein skipping of G-CSF exon 3 is used as a diagnostic cancer marker.
  • G-CSF granulocyte colony stimulating factor
  • Cancer is a leading cause of death in developed countries. For this reason, a major interest in cancer therapy is to develop methods for early diagnosis and treatment of cancer. Typically, late-stage cancer is almost incurable, whereas, at the early stage, cancer can be more effectively treated and therapeutic methods for early-stage cancer are simpler. Therefore, there is an urgent need for development of methods for accurately and quickly diagnosing cancer.
  • cancer diagnosis is generally achieved by morphological analysis using microscopes such as an optical microscope or electron microscope, immunohistochemical assays which detect proteins specifically expressed in caner tissues (Iran. Biomed. J. 3 (3 & 4): 99-101, 1999; and Lancet 2:483-6, 1986), or molecular analysis of abnormal biomolecules found in cancer tissues, such as mutated genes.
  • microscopes such as an optical microscope or electron microscope
  • immunohistochemical assays which detect proteins specifically expressed in caner tissues (Iran. Biomed. J. 3 (3 & 4): 99-101, 1999; and Lancet 2:483-6, 1986)
  • molecular analysis of abnormal biomolecules found in cancer tissues such as mutated genes.
  • the morphological and immunohistochemical diagnosis requires much longer time and higher cost. Because of comprising a relatively simple procedure and yielding results in a short time, the molecular diagnosis methods are a focus for developing novel diagnostic methods for cancer. Recently, a protein chip system for diagnosing various cancers has been developed by Health Digit Inc
  • the conventional cancer biomarkers are unable to detect all kinds of cancer, as follows.
  • the known cancer biomarkers which have low organ specificity such as CEA, BFP, TPA and IAP, also, have low sensitivity, thus generating false positive data.
  • the biomarkers which have high organ specificity exemplified by AFP, PIVKA II, Esterase I, CA19-9, CA50, Span-1 antigen, CA15-3 and BCA 225, are useful only for target organs. Therefore, for accurate, economical and simple diagnosis of cancer, there is an urgent need for development of new markers capable of diagnosing a variety of cancers.
  • a mutated G-CSF mRNA fragment having a deletion of an exon 3 region for use as a diagnostic cancer marker.
  • a mutated G-CSF protein having a deletion of an amino acid sequence corresponding to an exon 3 region for use as a cancer diagnostic marker.
  • a microarray or membrane for diagnosis of cancer comprising (a) a DNA fragment corresponding to exon 3 of a G-CSF gene, and (b) at least one of DNA fragments corresponding to exons 1, 2, 4 and 5 of said G-CSF gene.
  • a diagnostic agent for cancer comprising an antibody against a mutated G-CSF protein having a deletion of an amino acid sequence corresponding to an exon 3 region of said G-CSF protein.
  • a diagnostic kit for cancer comprising an antibody against a mutated G-CSF protein having a deletion of an amino acid sequence corresponding to an exon 3 region of said G-CSF protein.
  • a microarray or membrane for diagnosis of cancer comprising an antibody against a mutated G-CSF protein having a deletion of an amino acid sequence corresponding to the exon 3 region.
  • a diagnostic method for cancer comprising the steps of: (a) obtaining a G-CSF nucleic acid sample from mammalian tissues or cells; (b) amplifying G-CSF region from the nucleic acid sample obtained; (c) detecting a deletion of exon 3 of said G-CSF gene in the amplified sample.
  • a diagnostic method for cancer comprising the steps of: (a) obtaining a G-CSF protein sample from mammalian tissues or cells; and (b) detecting a deletion of an amino acid sequence corresponding to exon 3 of G-CSF gene in the G-CSF protein sample.
  • primers for use in amplification of G-CSF gene in a G-CSF nucleic acid sample obtained from mammalian tissues or cells are provided.
  • FIG. 1 is a process for normal transcription, splicing and translation of the human G-CSF gene
  • FIG. 2 shows positions of primers used in PCR on a structural map of human G-CSF gene comprising five exons
  • FIG. 3A is a photograph showing PCR1 products separated on an agarose gel (M: size marker, lane 1: normal cell line, lane 2: YCC-7, lane 3: AGS, lane 4: SNU-1, lane 5: MDA-MB-231, lane 6: MCF-7, lane 7: SK-BR-3, lane 8: HT-1080, lane 9: HCT-116, and lane 10: COLO205);
  • FIG. 3B is a photograph showing PCR1 products separated on an agarose gel (M: size marker, lane 1: normal cell line, lane 2: DLD-1, lane 3: HT-29, lane 4: A549, lane 5: NCI-H460, lane 6: HeLa, lane 7: C-33A, lane 8: B16, lane 9: U-87MG);
  • FIG. 4 shows a result of nucleotide sequence analysis of human G-CSF gene derived from normal cells
  • FIG. 5 shows a result of nucleotide sequence analysis of human G-CSF gene derived from tumor cells
  • FIG. 6A is a photograph showing PCR2 products separated on an agarose gel (each lane is the same cell line as in FIG. 3A);
  • FIG. 6B is a photograph showing PCR2 products separated on an agarose gel (each lane is the same cell line as in FIG. 3B);
  • FIG. 7A is a photograph showing PCR3 products separated on an agarose gel (each lane is the same cell line as in FIG. 3A);
  • FIG. 7B is a photograph showing PCR3 products separated on an agarose gel (each lane is the same cell line as in FIG. 3B);
  • FIG. 8 shows a result of hybridization of exon 2 DNA and exon 3 DNA bound to a nylon membrane with targets derived from tumor cells (A: YCC-7, B: AGC, C: HT-29, D: A549, E: MCF-7, and F: U-87MG);
  • FIG. 9 shows a result of analysis of deletion of exon 3 of G-CSF gene by a DNA chip
  • FIG. 10 shows a result of SDS-PAGE of a purified recombinant mutated G-CSF protein having a deletion of an amino acid sequence corresponding to the exon 3 region;
  • FIG. 11 is a graph showing levels of a mutated G-CSF protein having a deletion of an amino acid sequence corresponding to the exon 3 region in normal humans and cancer patients, which are measured using an antibody to the mutated G-CSF protein;
  • FIG. 12 is a process for construction of plasmid p19CSF.
  • FIG. 13 is a process for construction of recombinant plasmid pED-CSF4BLIIE expressing a mutated G-CSF protein having a deletion of the amino acid sequence corresponding to exon 3.
  • the present invention is generally directed to a method for diagnosis and prognosis of cancer by analyzing the presence or absence of exon 3 skipping of G-CSF gene at RNA or protein levels, wherein the G-CSF exon 3 skipping is used as a diagnostic cancer marker.
  • Colony stimulating factor produced in macrophages, T cells and fibroblasts, is widely distributed in a normal body. CSF is largely classified into granulocyte colony-stimulating factor (G-CSF), macrophage colony-stimulating factor (M-CSF) and granulocyte-macrophage colony-stimulating factor (GM-CSF). Of them, G-CSF plays an important role in production of several blood cells during proliferation and differentiation of hemopoietic stem cells. The major role of G-CSF is to increase the number of granulocytes, especially, neutrophils functioning to protect the body against foreign pathogens.
  • G-CSF granulocyte colony-stimulating factor
  • M-CSF macrophage colony-stimulating factor
  • GM-CSF granulocyte-macrophage colony-stimulating factor
  • G-CSF is known to be effective in stimulating neutrophil proliferation and thus protecting and treating infectious diseases.
  • Nagata et al. reported the nucleotide sequence of human G-CSF gene and its expression in COS cells (Nagata et al., Nature 319:415-418, 1986).
  • Human G-CSF is a glycoprotein comprising a secretory signal peptide consisting of 30 amino acids and 174 amino acids, and contains five cystein residues. Four of the five cysteins, forming two disulfide bonds (Cys36-Cys42, Cys64-Cys74), play an important role in folding and biological activity of hG-CSF protein (Hill et al., Proc. Natl. Acad. Sci. USA 90:5167-5171, 1993). With reference to FIG. 1, hG-CSF gene consists of five exons and four introns.
  • a mature hG-CSF mRNA is produced by removing four introns from an hG-CSF mRNA transcript transcribed from genomic DNA through splicing.
  • the mature hG-CSF mRNA is translated into an hG-CSF precursor protein consisting of 204 amino acids, and a secretory signal peptide of 30 amino acids at the N-terminus is removed from the precursor protein, thereby generating a biologically active hG-CSF protein consisting of 174 amino acids (Nagata et al., EMBO J. 5:575-581, 1986; Hill et al., Proc. Natl. Acad. Sci. USA 90:5167-5171, 1993).
  • G-CSF cDNA derived from tumor cells has a deletion of the entire exon 3 region (108 bp).
  • deletion of specific exons has been reported in a variety of genes not including G-CSF gene, such deletion in hG-CSF gene has been unknown until now.
  • the hG-CSF protein is known to be present in a form having or not having three amino acids corresponding to the 3′ end of exon 2, while being biologically active in both of the two forms (Nagata et al., EMBO J. 5:575-581, 1986).
  • a method of diagnosing cancer based deletion of exon 3 of G-CSF gene may be applied to all subtypes of G-CSF according to an identical principle.
  • other mammalian-derived G-CSF proteins are known to have almost identical biological activity to the hG-CSF protein, it will be understood by those skilled in the art that a method of diagnosing cancer based on detection of deletion of exon 3 of G-CSF gene according to the present invention can be applied to other mammalian-derived G-CSF proteins according to an identical principle.
  • a G-CSF gene or protein sample should first be obtained from tissue specimens or cells. Since a DNA sample for a specific gene is typically obtained from normal tissues or cells at a very small amount, the specific gene should be amplified by PCR, and, for such amplification, suitable primers should be designed. In the present invention, to amplify a part or an entire region of exon 3 of G-CSF gene, nucleic acid fragments to be used as primers in PCR for detection of deletion of exon 3 are necessary.
  • the primers refer to oligonucleotides capable of amplifying a nucleotide sequence of G-CSF gene, comprising a part or an entire region of exon 3.
  • the primers include oligonucleotides designated as SEQ ID NOs.
  • oligonucleotides designated as SEQ ID NOs. 3 and 5 which are capable of amplifying a region (Ile24-Leu71) ranging from a part of exon 2 to exon 3 of hG-CSF gene
  • oligonucleotides designated as SEQ ID NOs. 4 and 6 which are capable of amplifying a region (Cys36-Ser80) ranging from exon 3 to a part of exon 4 of hG-CSF gene.
  • the present inventors investigated the presence or absence of G-CSF gene and exon 3 in the G-CSF gene in mRNA and cDNA samples obtained from 8 normal tissues and 17 tumor cell lines.
  • nucleic acid fragments for use as primer sets in detecting deletion of exon 3 through amplification of the exon 3 region of G-CSF gene which include, but are not limited to, the following sets, each of which consists of a sense primer and an antisense primer: sense: 5′-ACCCCCCTGGGCCCTGCC-3′ (SEQ ID NO. 1) and antisense: 5′-TCAGGGCTGGGCAAGGTG-3′; (SEQ ID NO. 2) sense: 5′-ACCCCCCTGGGCCCTGCC-3′ (SEQ ID NO. 1) and antisense: 5′-CAGCTGCAGGGCCTGGCT-3′; (SEQ ID NO.
  • the nucleic acid fragments include oligonucleotides capable of detecting deletion of exon 3 of G-CSF gene in spite of not containing a nucleotide sequence corresponding to the exon 3 region, wherein the oligonucleotides may contain a nucleotide sequence corresponding to exon 2 or exon 4 of G-CSF gene.
  • a gene microarray or membrane to which a DNA fragment comprising a part or an entire region of exon 3 of the G-CSF gene is immobilized which is useful for diagnosis of cancer.
  • the gene microarray includes DNA chips effective for detection of a gene corresponding to a probe by hybridization including applying an oligonucleotide probe on the surface of a slide glass treated with a specific chemical reagent.
  • Non-limiting examples of the membrane, which can be used instead of the slide glass in hybridization include all membranes capable of immobilizing DNA fragments, and preferably, nylon and nitrocellulose membranes.
  • a nucleic acid fragment corresponding to exon 3 of the G-CSF gene is attached on the surface of the microarray according to the present invention, along with one or more nucleic acid fragments selected from the group consisting of nucleic acid fragments corresponding to exons 1, 2, 4 and 5 of the G-CSF gene, wherein each of the nucleic acid fragments used as probes may contain a part or an entire region of its corresponding exon.
  • nucleic acid fragment corresponding to the exon 3 region, used as a probe in the present invention include oligonucleotides having a nucleotide sequence designated as SEQ ID NO.
  • nucleic acid fragments corresponding to exons 1, 2, 4 and/or 5, which are used as control probes include oligonucleotides having a nucleotide sequence designated as SEQ ID NO. 10: CTGCAGCTGCTGCTGTGGCAC, a nucleotide sequence designated as SEQ ID NO.
  • composition for diagnosis of cancer comprising a DNA fragment containing a part or an entire region of the exon 3 region of G-CSF gene and a diagnostically acceptable carrier.
  • a method of diagnosing cancer employing a mutated G-CSF protein having a deletion of an amino acid sequence corresponding to the exon 3 region of the G-CSF gene, and a polyclonal or monoclonal antibody to the mutated G-CSF protein.
  • a mutated G-CSF protein having a deletion of an amino acid sequence corresponding to the exon 3 region of G-CSF gene refers to a mutated G-CSF protein produced by a deletion in a region ranging from exons 1 to 5 during expression of G-CSF gene, essentially containing a deletion in exon 3.
  • a diagnostic kit comprising a DNA fragment containing a part or an entire region of exon 3 of the G-CSF gene and a DNA microarray using the DNA fragment.
  • a diagnostic kit comprising a mutated G-CSF protein having a deletion of an amino acid sequence corresponding to the exon 3 region of the G-CSF gene, and a protein microarray using a polyclonal or monoclonal antibody to the mutated G-CSF protein.
  • the mutated G-CSF protein having a deletion of an amino acid sequence corresponding to the exon 3 region of the G-CSF gene, and the polyclonal or monoclonal antibody to the mutated G-CSF protein, according to the present invention may be produced by the conventional method common in the art (Harlow, E. and Lane, D., Antibodies. A Laboratory Manual. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory, 1988; and Wilson, L. and Matsudaira, P. eds. Antibodies in Cell Biology (Methods in Cell Biology, Vol.37). New York: Academic Press, 1933).
  • the exon 3 region when amplifying the exon 3 region of G-CSF gene in mRNA and cDNA samples obtained from 17 tumor cell lines and analyzing the nucleotide sequence of the products, the exon 3 region (108 bp) was found to be deleted in hG-CSF cDNA derived from various tumor cell lines, including stomach cancer cells, breast cancer cells, sarcoma cells, intestinal cancer cells, lung cancer cells, cervical cancer cells and malignant melanoma cells (see, FIGS. 2 and 3).
  • PCR products derived from 16 tumor cell lines are smaller in size than those from a normal cell line, and, as identified by nucleotide sequence analysis of the PCR products, have a deletion of the exon 3 region, among five exons of the normal G-CSF gene.
  • the deletion of the exon 3 region in G-CSF cDNA can be detected by hybridization. For example, after obtaining a DNA fragment corresponding to exon 3 and a DNA fragment corresponding to exon 2 by performing PCR using normal hG-CSF gene as a template, and immobilizing the two DNA fragments on a nylon membrane, the nylon membrane is hybridized with a cDNA target, derived from a tumor cell line, and deletion of the exon 3 region is determined by detecting binding of the probe with the exon 3 DNA fragment immobilized on the membrane.
  • the deletion of the exon 3 region in G-CSF cDNA can be detected using a DNA chip, by immobilizing oligonucleotides corresponding to each exon of the G-CSF gene on a slide glass, preparing probes by PCR using exons of the hG-CSF gene as templates, and then reacting the probes with the oligonucleoties.
  • deletion of the exon 3 region of G-CSF may be easily detected by preparing a recombinant G-CSF protein using a mutated G-CSF nucleotide sequence having a deletion of the exon 3 region, preparing a polyclonal or monoclonal antibody to the recombinant mutated G-CSF protein, and comparing the mutated G-CSF protein levels in normal individuals and cancer patients by ELISA using the antibody.
  • the present invention includes an immunochromatographic assay.
  • the representative example of the assay is the lateral flow immunoassay.
  • a diagnostic kit for lateral flow immunoassay comprises a sample pad to which a specimen is loaded, a releasing pad coated with an antibody as a probe, a membrane (mainly, nitrocellulose) or strip for development of the sample, in which the specimen migrates and is separated and antibody-antigen reaction occurs, and an absorption pad for driving continuous migration of the specimen.
  • the antibody used as a probe is labeled by being immobilized on, for example, colloidal gold particles. Instead of the colloidal gold particles, latex beads or carbon particles are available.
  • the diagnostic kit for lateral flow immunoassay is typically designed to detect an analyte in a sandwich form.
  • the analyte contained in the specimen is applied to the sample pad, migrates and reacts with the antibody coated on the releasing pad, forming antigen-antibody complexes.
  • the formed complexes further migrate and are captured by an additional antibody immobilized on the membrane for development, generating triplexes of sandwich form. That is, since the additional antibody is immobilized on the membrane for development, the triplexes are accumulated on the surface of the membrane, on which the additional antibody is immobilized. Since proteins are not visible to the naked eye, formation of triplexes and their amount are determined by amount of gold particles conjugated to the antibody contained in the triplexes.
  • diagnosis of cancer may be achieved by obtaining a nucleic acid sample from animal tissues or cells, and detecting deletion of the exon 3 region of G-CSF gene in the nucleic acid sample using a molecular method.
  • Human tissues or cells as a source of the nucleic acid sample include biological fluid samples, biopsy specimens, solid phase tissue samples such as tissue culture or the tissue-derived cells, and offsprings of the cells.
  • the sample sources include chemical reagent-treated, solubilized samples, cultured cells, cell culture supernants, and cell lysates.
  • the human tissues or cells include tumor tissues or tissues considered to be neoplastic, and may be obtained by conventional methods common in the art, such as surgical resection, biopsies or suction. From the human tissues or cells, a nucleic acid sample may be obtained by the conventional method known in the art.
  • the method of diagnosing cancer based on detection of deletion of exon 3 of G-CSF gene according to the present invention may be, as described above, achieved by nucleotide sequence analysis of the G-CSF gene, as well as by using a specific probe to a region corresponding to the exon 3 region of the G-CSF gene, for example, by employing an antibody specific to a mutated G-CSF protein having a deletion of an amino acid sequence corresponding to the exon 3 region.
  • the method of diagnosing cancer of the present invention may be used in diagnosis of various cancers, including stomach cancer, breast cancer, sarcoma, intestinal cancer, lung cancer, cervical cancer, liver cancer, prostate cancer, tongue cancer, laryngeal cancer, pharyngeal cancer, oral cancer, thyroid cancer, colorectal cancer, esophageal cancer, and testicular cancer.
  • various cancers including stomach cancer, breast cancer, sarcoma, intestinal cancer, lung cancer, cervical cancer, liver cancer, prostate cancer, tongue cancer, laryngeal cancer, pharyngeal cancer, oral cancer, thyroid cancer, colorectal cancer, esophageal cancer, and testicular cancer.
  • mRNA and cDNA samples were prepared from 8 normal cell lines and tissues, and 17 tumor cell lines.
  • the normal cell lines and tumor cell lines used in Examples of the present invention are given in Table 1, below.
  • TABLE 1 Normal and tumor cell lines used in the present invention Cell types Cell collection centers Tumor cell YCC-7 Stomach cancer cell line Cancer metastasis research center, College of Medicine, lines Yonsei University AGS Stomach cancer cell line ATCC CRL-1739 SNU-1 Stomach cancer cell line Korean Cell Line Research Foundation (KCLRF), Seoul National University MDA-MB- Breast cancer cell line ATCC HTB-26 231 MCF-7 Breast cancer cell line ATCC HTB-22 SK-BR-3 Breast cancer cell line ATCC HTB-30 HT-1080 Sarcoma cell line ATCC CCL-121 HCT-116 Colon cancer cell line ATCC CCL-247 C0L0205 Colon cancer cell line ATCC CCL-222 DLD-1 Colon cancer cell line ATCC CCL-221 HT-29 Colon cancer cell line ATCC HTB-38 A549
  • the tumor cell lines listed in Table 1 can be obtained from the cell collection centers listed in Table 1.
  • human normal cell lines, lymphocytes, monocytes, epidermis, dermis, hair pollicles, fat cells and muscle cells can be easily obtained from the cancer metastasis research center at College of Medicine, Yonsei University.
  • the tumor cell line YCC-7 obtained from the cancer metastasis research center, was prepared as follows. Ascitic fluid was aseptically obtained from advanced cancer patients, and supplemented with heparin in an amount of 10 units per ml to prevent clumping of cells. After centrifugation at 400 ⁇ g for 10 min, the precipitated cells were cultured in a culture flask of 25 cm 3 .
  • Ficoll-hypaque density gradient centrifugation at 800 ⁇ g was performed to separate mononuclear cells from erythrocytes, and the obtained mononuclear cell phase was incubated at 37° C. under 5% CO 2 . After incubation for 16-18 hrs, the culture medium was centrifuged at 400 ⁇ g for 10 min, and the precipitated cells were cultured in a new culture flask of 25 cm 3 . During culturing, cells were observed under a phase contrast microscope, and the culture medium was replaced twice or three times per week.
  • the tumor cell clusters were obtained by treatment with trypsin-EDTA or by using scrapers, and the fluid containing tumor cells was centrifuged to remove normal cells. The resulting pure tumor cells were stored at frozen states according to their passages.
  • Tri-Reagent Gibco-BRL, USA
  • RNA pellet was dissolved in RNase-free water.
  • RT-PCR was performed as follows. 2 ⁇ g of total RNA was mixed with 1 ⁇ l of an oligo(dT) 16 -primer, and RNase-free water was added up to a final volum of 11 ⁇ l. This mixture was heated at 90° C. for 5 min, and placed on ice, immediately after completion of the heating.
  • RNA mixture was added to the pre-mixture tube, followed by incubation at room temperature for 10 min.
  • the reaction mixture was incubated at 42° C. for 90 min, and then at 95° C. for 15 min. Immediately after the incubation at 95° C., the mixture was placed on ice to terminate reaction, thus yielding a cDNA sample.
  • PCR was carried out using cDNA prepared in Example 1 as a template. As shown in FIG. 2, PCR reactions were divided into three types according to their amplified products, as follows: PCR 1 for amplification of a region (Thr1-Pro174) ranging from a part of exon 2 to exon 5 of hG-CSF gene; PCR 2 for amplification of a region (Ile24-Leu71) ranging from a part of exon 2 to exon 3 of hG-CSF gene; and PCR 3 for amplification of a region (Cys36-Ser80) ranging from exon 3 to a part of exon 4 of hG-CSF gene.
  • PCR 1 for amplification of a region (Thr1-Pro174) ranging from a part of exon 2 to exon 5 of hG-CSF gene
  • PCR 2 for amplification of a region (Ile24-Leu71) ranging from a part of exon 2 to exon 3 of hG
  • PCR 1 was carried out using a cDNA sample from each tumor cell line as a template, and a primer set of a sense primer designated SEQ ID NO.: 1 (5′-ACCCCCCTGGGCCCTGCC-3′) and an antisense primer designated SEQ ID NO.: 2 (5′-TCAGGGCTGGGCAAGGTG-3′).
  • PCR 2 was carried out using a cDNA sample from each tumor cell line as a template, and a primer set of a sense primer designated SEQ ID NO.: 3 (5′-ATCCAGGGCGATGGCGCAGCG-3′) and an antisense primer designated SEQ ID NO.: 5 (5′-CAGCTGCAGGGCCTGGCT-3′).
  • PCR 3 was carried out using a cDNA sample from each tumor cell line as a template, and a primer set of a sense primer designated SEQ ID NO.: 4 (5′-TGTGCCACCTACAAGCTGTGC-3′) and an antisense primer designated SEQ ID NO.: 6 (5′-CGCTATGGAGTTGGCTCAAGC-3′).
  • PCR was performed using a high fidelity PCR system (Boehringer Mannheim Co., Germany) under the following condition. PCR conditions included denaturation at 94° C. for 7 min, and 30 cycles of denaturation at 94° C. for 40 sec, annealing at 56° C. for 40 sec and extension at 72° C. for 1 min, followed by final extension at 72° C. for 7 min.
  • PCR products were separated on an agarose gel.
  • PCR1 PCR products from tumor cell lines were found to be smaller in size than a normal G-CSF gene, except that a PCR product from U-87MG has a size equal to that of normal G-CSF gene (see, FIG. 3A in which M: size marker, lane 1: normal cell line, lane 2: YCC-7, lane 3: AGS, lane 4: SNU-1, lane 5: MDA-MB-231, lane 6: MCF-7, lane 7: SK-BR-3, lane 8: HT-1080, lane 9: HCT-116, and lane 10: COLO205; and FIG.
  • lane 3B in which M: size marker, lane 1: normal cell line, lane 2: DLD-1, lane 3: HT-29, lane 4: A549, lane 5: NCI-H460, lane 6: HeLa, lane 7: C-33A, lane 8: B16, and lane 9: U-87MG).
  • a PCR product was generated only from U-87MG cells, while PCR products were not obtained in other tumor cell lines (see, FIGS. 6 and 7).
  • the PCR product of U-87MG cells, produced in PCR2 and PCR3 was found to have a size equal to that of the PCR product of normal cells.
  • Nucleotide sequences of PCR1 products were analyzed using an automatic DNA sequencer (ABI Prism model 377, Perkin Elmer Co., USA). As a result of nucleotide sequence analysis, the PCR product obtained from U-87MG cells was found to have a nucleotide sequence (SEQ ID NO.: 7) identical to that of G-CSF gene of normal cells. In contrast, PCR products obtained from other tumor cell lines, compared with the nucleotide sequence of G-CSF of normal cells, was found to have a nucleotide sequence (SEQ ID NO.: 8) having a deletion of 108 bp (see, FIGS. 4 and 5). When comparing the deleted 108 bp with the nucleotide sequence of G-CSF, the deleted 108 bp was found to correspond to the exon 3 region among five exons.
  • G-CSF protein expressed from G-CSF cDNA having a deletion of exon 3 is highly likely to have lost active site function and to have a different conformation from the normal G-CSF protein. Therefore, it is believed that G-CSF protein expressed in tumor cells does not exhibit normal function.
  • PCR was carried out using G-CSF gene derived from a normal cell line as a template, and a primer set of a sense primer designated SEQ ID NO.: 4 (5′-TGTGCCACCTACAAGCTGTGC-3′) and an antisense primer designated SEQ ID NO.: 5 (5′-CAGCTGCAGGGCCTGGCT-3′).
  • SEQ ID NO.: 4 a primer set of a sense primer designated SEQ ID NO.: 4
  • an antisense primer designated SEQ ID NO.: 5 5′-CAGCTGCAGGGCCTGGCT-3′.
  • PCR was carried out using G-CSF gene derived from the normal cell line as a template, and a primer set of a sense primer designated SEQ ID NO.: 1 (5′-ACCCCCCTGGGCCCTGCC-3′) and an antisense primer designated SEQ ID NO.: 9 (5′-CAGCTTCTCCTGGAGCGC-3′).
  • SEQ ID NO.: 1 5′-ACCCCCCTGGGCCCTGCC-3′
  • SEQ ID NO.: 9 5′-CAGCTTCTCCTGGAGCGC-3′
  • each of the DNA fragments (50 ng/ ⁇ l) was spotted on a nylon membrane (Boehringer Mannheim, Germany), and incubated at 80° C. for 2 hrs to immobilize it onto the membrane.
  • Target probes for hybridization of the DNA fragments corresponding to exon 2 and exon 3, immobilized on the membrane were prepared by RT-PCR.
  • RT-PCR was performed as follows. First, a reaction mixture A (2 ⁇ g of total RNA, 1 ⁇ l of an oligo(dT) 16 -primer, total volume: 15 ⁇ l) was incubated at 94° C. for 2 min to denature RNA, and then slowly cooled to 42° C. over about 20 min.
  • reaction mixture B (333 ⁇ M of each of dATP, dGTP and dCTP, 1 ⁇ reverse transcriptase buffer, 20 ⁇ Ci of [ ⁇ - 32 P] dCTP (2,000-3,000 Ci/mmol), 50 U of AMV reverse transcriptase, total volume: 30 ⁇ l) was added to the mixture A, and reverse trascription was carried out at 42° C. for 2 hrs. Thereafter, dNTP, including [ ⁇ - 32 P] dCTP, not participating in polymerization were removed using a QIAquick Nucleotide Removal Kit (Qiagen, USA).
  • a denatured cDNA probe prepared by mixing 10 ⁇ l of the cDNA probe with 0.5 ml of the hybridization solution and then boiling the mixture for 10 min, was added to the hybridization solution in which the membranes were immersed, followed by incubatin at 65° C. for 18 hrs to allow hybridization. Thereafter, the membranes were washed three times with a washing solution (0.5 ⁇ SSPE, 0.2% SDS) at 65° C. for 30 min. Radioactivity was detected by exposing the membranes or X-ray film and developing the film.
  • one probe corresponding to a region continuously ranging from a part of exon 2 to a part of exon 3 one probe corresponding to a region continuously ranging from a part of exon 3 to a part of exon 4 and one probe corresponding to a region continuously ranging from a part of exon 2 to a part of exon 4 were designed to have 8 nucleotides of each exon.
  • the probes were arranged at intervals of 275 ⁇ m on the glass at an amount of 100 ⁇ M, thus producing a microarray.
  • a gene fragment as a probe, to be immobilized on a glass was prepared by asymmetric PCR using G-CSF gene extracted from each cell line, and a primer set of a sense primer designated SEQ ID NO.:10 (5′-CTGCAGCTGCTGCTGTGGCAC-3′) and an antisense primer designated SEQ ID NO.:11 (5′-FITC-CTGCTGCCAGATGGTGGT-3′) in a ratio of 1:5, wherein the gene fragment was obtained by performing PCR once.
  • Information on probes immobilized on the slide glass is given in Table 2, below. TABLE 2 Corresponding regions SEQ ID Nucleotide sequences on hG-CSF gene NOs.
  • CTGCAGCTGCTGCTGTGGCAC Exon 2 10 AGAAGCTGTGGTGCCAC Exons 2 to 3 (hG-CSFa) 12 TGAGTGAGTGTGCCAC Exons 2 to 3 (hG-CSFb) 13 TGTGCCACCTACAAGCTGTG Exon 3 14 GAGCTGGTGCTGCTCGGACA Exon 3 15 GGACACTCTCTGGGCATCCC Exon 3 16 CTGAGCAGCTGCCCCAGCCA Exon 3 17 GCAGGCTGCTTGAGCCAA Exon 4 18 AGAAGCTGGCAGGCTG Exons 2 to 4 (hG-CSFa) 19 TGAGTGAGGCAGGCTG Exons 2 to 4 (hG-CSFb) 20
  • Asymmetric PCR was carried out under the conditions of denaturation at 94° C. for 5 min, 10 cycles of denaturation at 94° C. for 1 min, annealing at 56° C. for 1 min and extension at 72° C. for 30 sec, and 30 cycles of denaturation at 94° C. for 1 min, annealing at 58° C. for 1 min and extension at 72° C. for 30 sec, followed by final extension at 72° C. for 7 min.
  • PCR products were separated on an agarose gel. From the result of electrophoresis, double stranded DNA and single stranded DNA fragments were produced in each PCR sample. After amplifying G-CSF gene by asymmetric PCR using a plasmid carrying exon 3-deleted G-CSF gene and another plasmid carrying G-CSF having no deletion of exon 3, the two amplified products were analyzed using a DNA chip. A hybridization solution (6 ⁇ SSPE, 20% (v/v) formamide) was added to 15 ⁇ l of the amplified product up to a final volume of 200 ⁇ l.
  • the mixture was applied on a slide glass having an immobilized probe, and the glass was covered with a probe-clip press-seal incubation chamber (Sigma Co., St. Louis, Mo.), followed by incubation in a shaking incubator at 30° C. for 6 hrs to induce binding of the probe to the amplified product.
  • a probe-clip press-seal incubation chamber Sigma Co., St. Louis, Mo.
  • the glass was washed over 5 min with 3 ⁇ SSPE (0.45M NaCl, 15mM C 6 H 5 Na 3 O 7 , pH 7.0), 2 ⁇ SSPE (0.3M NaCl, 10 mM C 6 H 5 Na 3 O 7 , pH 7.0), and then 1 ⁇ SSPE (0.15M NaCl, 5mM C 6 H 5 Na 3 O 7 , pH 7.0), and scanned using scanarray 5000 (GSI Lumonics Inc., Bedford, Mass.).
  • 3 ⁇ SSPE 0.45M NaCl, 15mM C 6 H 5 Na 3 O 7 , pH 7.0
  • 2 ⁇ SSPE 0.3M NaCl, 10 mM C 6 H 5 Na 3 O 7 , pH 7.0
  • 1 ⁇ SSPE 0.15M NaCl, 5mM C 6 H 5 Na 3 O 7 , pH 7.0
  • scanarray 5000 GSI Lumonics Inc., Bedford, Mass.
  • pED-CSF4BLUE plasmid was prepared by cloning a nucleotide sequence corresponding to a mutated G-CSF protein having a deletion of the exon 3 region into a plasmid pET21c (Novagen Inc., USA), as follows.
  • primer 1 forward primer
  • primer 2 reverse primer
  • a PCR product was treated with EcoRI and BamHI, and cloned into pUC19 (Stratagene, USA), thus giving a plasmid p19CSF (see, FIG. 12).
  • the G-CSF gene cloned into pUC19 does not contain the exon 3 region.
  • primer set of primer 4 forward primer: 5′-GCGAATTCATATGACCCCCCTGGGCCCTGCCA GC-3′ and primer 2 (reverse primer): 5′-GCGGATCCITATTAGGGCTGGGCAAGGTGGCG-3′.
  • a PCR product was treated with NdeI and BamHI, and cloned into plasmid pET21c.
  • PCR was carried out again using as the forward primer a primer: 5′-GCGAATTCATATGACTCCGTTAGGTCCAGCCAGC-3′ instead of the primer 4: 5′-GCGAATTCATATGACCCCCCTGGGCCCTGCCAGC-3′ the produced DNA fragment was treated with NdeI and BamHI, and cloned into a plasmid pET21c, thus giving a plasmid pED-CSF4BLIIE (see, FIG. 13).
  • Nutrients and additional substances, used for fed-batch fermentation are given in Table 3, below. TABLE 3 Culture medium Additionally supplied solution Nutrients Conc. (g/L) Substances Conc. (g/L) (NH 2 ) 2 HPO 4 3.0 Glucose 700.0 KH 2 PO 4 7.0 MgSO 4 .7H 2 O 15.0 MgSO 4 .7H 2 O 1.0 Yeast extract 50.0 Citric acid 0.8 Yeast extract 2.0 Glucose 20.0 Trace metal solution 3 (ml)
  • E. coli BL21(DE3) cells transformed with the plasmid pED-CSF4BLIIE were incubated in a 250 ml flask with agitation at 37° C. for 8 hrs. 200 ml of the culture was inoculated into 1.8 L of a culture medium contained in a 5 L fermentor (NBS fermentor), and cultured at 37° C., where pH of the medium was constantly maintained at 6.8. pH was maintained using a 28% NH 4 OH solution. Pure oxygen was optionally supplied. Supply of additional substances was controlled by a pH-stat.
  • Normal mature G-CSF protein has a molecular weight of about 18.7 kDa
  • the mutated G-CSF protein translated from the exon 3-deleted G-CSF cDNA has a molecular weight of about 13 kDa.
  • a polyclonal antibody specific to the mutated G-CSF protein was prepared as follows. After emulsifying 400 ⁇ l of the purified mutated hG-CSF protein dissolved in a phosphate buffer in a concentration of 1 mg/ml with an equal volume of Freund's adjuvant (BRL), the emulsion was intramuscularly injected four times into rabbits (10 weeks old) in intervals of 11 days. 10 days after the fourth injection, blood was collected from the immunized rabbits by heart puncture. The collected blood was incubated at room temperature for 30 min, and then at 4° C.
  • BBL Freund's adjuvant
  • splenocytes were obtained from the immunized mice, and mixed with SP2/0-Ag14 myeloma cells at a ratio of 10:1, and fusion was induced by adding a 50% polyethyleneglycol 1500 solution to the cell mixture, followed by incubation for 3 min. After centrifugation at 1,200 rpm for 8 min, the cell pellet was suspended in a HAT RPMI-1640 medium containing 10% fetal calf serum (FCS) at a density of 3.5 ⁇ 10 6 cells/ml. 0.1 ml of the cell suspension was then put into each well of a 96-well plate, and incubated in a 5% CO 2 incubator at 37° C.
  • FCS fetal calf serum
  • HAT RPMI-1640 medium containing 10% FCS was added to each well of the plate, and half of the medium was replaced with a new medium every fourth day (Amyx, H. L, JAVMA 191:1287-1289, 1987; Akerstrom, B. et al., J Immunol 135:2589-2592, 1985; and Anon, Vet Health Inspectorate 6 pp. Rijswijk, The Netherlands, 1989).
  • the fused cells were screened for production of an anti-mutant G-CSF protein antibody by ELISA, as follows.
  • the mutated hG-CSF protein used in the immunization of mice was diluted in 0.01 M carbonate-bicarbonate buffer (pH 9.6) in a concentration of 0.1 ⁇ g/ml, and 50 ⁇ l of the resulting dilution was added to each well of the plate, followed by incubation at 4° C. overnight to allow binding of the protein to the bottom of each well.
  • the plate was washed four times with PBST (phosphate buffer saline, 137 mM NaCl, 2.7 mM KCl, 10 mM Na 2 HPO 4 , 2 mM KH 2 PO 4 , 0.15% Tween 20), and blocked with albumin by incubation at 37° C. for 30 min. Thereafter, 50 ⁇ l of the cell culture supernant was added to each well, and the plate was incubated at room temperature for 2 hrs, followed by washing four times with PBST.
  • PBST phosphate buffer saline, 137 mM NaCl, 2.7 mM KCl, 10 mM Na 2 HPO 4 , 2 mM KH 2 PO 4 , 0.15% Tween 20
  • TMB tetra-methylbenzidine
  • 2N sulfate After terminating the reaction with 2N sulfate, optical density was measured at 450 nm using an ELISA reader.
  • Cells obtained from ELISA-positive wells were subcloned three times by limiting dilutions, in which the cells were diluted to 0.3 cell per well, to obtain hydridoma cells producing an anti-mutant hG-CSF protein monoclonal antibody.
  • An anti-mutant hG-CSF protein monoclonal antibody was obtained from the stable hybridoma cells (Amyx, H.
  • mutated hG-CSF protein levels were found to be much higher in cancer patients than that in normal individuals.
  • breast cancer patients showed the highest level of the mutated hG-CSF protein.
  • diagnosis of cancer may be easily performed by detecting deletion of exon 3 of G-CSF by PCR or using DNA chips, or by detecting a mutated G-CSF protein by ELISA.
  • the conventional cancer biomarkers are unable to detect all kinds of cancer, as follows.
  • the known cancer biomarkers having low organ specificity such as CEA, BFP, TPA and IAP, have low sensitivity, thus generating false positive data.
  • the biomarkers having high organs specificity which are exemplified as AFP, PIVKA II, Esterase I, CA19-9, CA50, Span-1 antigen, CA15-3 and BCA 225, are useful only for target organs.
  • the diagnostic cancer marker based on deletion of the exon 3 region of G-CSF, discovered by the present inventors, may be used to easily diagnose cancer by immunochemical methods and molecular methods. Development and use of such a cancer marker may facilitate early discovery of cancer, thus largely contributing to effective treatment of cancer.
  • the present invention provides a method of diagnosing cancer based on detection of deletion of the exon 3 region of G-CSF gene.
  • the method of diagnosing cancer may be applied for diagnosis of a broad range of cancers, not only a specific cancer, and has effectiveness in easily diagnosing cancer by molecular methods, such as PCR, hybridization or use of DNA chips, or relatively simple immunochemical assays such as ELISA.
  • a DNA chip for detection of deletion of the exon 3 region of G-CSF is advantageous in terms of enabling diagnosis of all kinds of cancer, in a simpler, quicker and more accurate manner than the conventional methods for diagnosis of cancer, and dealing with a large number of clinical specimens at one time, thereby leading to development and advance of human medicine and improvement of the public good, as well as largely contributing to development of DNA-chip technologies.
  • the mutated G-CSF protein having a deletion of an amino acid sequence corresponding to the exon 3 region, and an antibody to the mutated G-CSF protein, invented by the present inventors may facilitate distinction of normal individuals and cancer patients. This fact indicates that detection of only G-CSF mutants allows accurate diagnosis of cancer and application of a large number of clinical specimes, thus largely contributing to development of protein-chip technologies.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Analytical Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Magnetic Resonance Imaging Apparatus (AREA)
US10/490,502 2001-09-28 2002-01-18 Diagnostic method for cancer characterized in the detection of the deletion of g-csf exon 3 Abandoned US20040247562A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
US11/059,222 US20050266430A1 (en) 2001-09-28 2005-02-16 Diagnostic method for cancer characterized in the detection of the deletion of G-CSF exon 3
US11/058,976 US8324363B2 (en) 2001-09-28 2005-02-16 Microarray for detection of the deletion of exon 3 of the G-CSF gene
US11/059,192 US20050170416A1 (en) 2001-09-28 2005-02-16 Diagnostic method for cancer characterized in the detection of the deletion of G-CSF exon 3
US11/059,127 US20050158810A1 (en) 2001-09-28 2005-02-16 Diagnostic method for cancer characterized in the detection of the deletion of G-CSF exon 3
US11/059,268 US20050170417A1 (en) 2001-09-28 2005-02-16 Diagnostic method for cancer characterized in the detection of the deletion of G-CSF exon 3
US12/830,085 US20100286381A1 (en) 2001-09-28 2010-07-02 Diagnostic method for cancer characterized in the detection of the deletion of g-csf exon 3
US13/546,966 US20120329078A1 (en) 2001-09-28 2012-07-11 Method of diagnosing cancer using g-csf protein having a deletion of an amino acid sequence corresponding to exon 3 as a diagnostic cancer marker
US13/546,972 US20120322684A1 (en) 2001-09-28 2012-07-11 G-csf protein having a deletion of an amino acid sequence corresponding to exon 3 for use as a diagnostic cancer marker
US13/546,975 US20140005365A1 (en) 2001-09-28 2012-07-11 Antibody to a mutant g-csf for diagnosis of cancer

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
KR2001-0060826 2001-09-28
KR20010060826 2001-09-28
PCT/KR2002/001825 WO2003027288A1 (fr) 2001-09-28 2002-09-28 Procede de diagnostic de cancer cacracterise par la detection de la deletion du 3eme exon de g-csf

Related Child Applications (5)

Application Number Title Priority Date Filing Date
US11/059,127 Division US20050158810A1 (en) 2001-09-28 2005-02-16 Diagnostic method for cancer characterized in the detection of the deletion of G-CSF exon 3
US11/058,976 Division US8324363B2 (en) 2001-09-28 2005-02-16 Microarray for detection of the deletion of exon 3 of the G-CSF gene
US11/059,222 Division US20050266430A1 (en) 2001-09-28 2005-02-16 Diagnostic method for cancer characterized in the detection of the deletion of G-CSF exon 3
US11/059,192 Division US20050170416A1 (en) 2001-09-28 2005-02-16 Diagnostic method for cancer characterized in the detection of the deletion of G-CSF exon 3
US11/059,268 Division US20050170417A1 (en) 2001-09-28 2005-02-16 Diagnostic method for cancer characterized in the detection of the deletion of G-CSF exon 3

Publications (1)

Publication Number Publication Date
US20040247562A1 true US20040247562A1 (en) 2004-12-09

Family

ID=19714831

Family Applications (10)

Application Number Title Priority Date Filing Date
US10/490,502 Abandoned US20040247562A1 (en) 2001-09-28 2002-01-18 Diagnostic method for cancer characterized in the detection of the deletion of g-csf exon 3
US11/058,976 Expired - Fee Related US8324363B2 (en) 2001-09-28 2005-02-16 Microarray for detection of the deletion of exon 3 of the G-CSF gene
US11/059,127 Abandoned US20050158810A1 (en) 2001-09-28 2005-02-16 Diagnostic method for cancer characterized in the detection of the deletion of G-CSF exon 3
US11/059,222 Abandoned US20050266430A1 (en) 2001-09-28 2005-02-16 Diagnostic method for cancer characterized in the detection of the deletion of G-CSF exon 3
US11/059,268 Abandoned US20050170417A1 (en) 2001-09-28 2005-02-16 Diagnostic method for cancer characterized in the detection of the deletion of G-CSF exon 3
US11/059,192 Abandoned US20050170416A1 (en) 2001-09-28 2005-02-16 Diagnostic method for cancer characterized in the detection of the deletion of G-CSF exon 3
US12/830,085 Abandoned US20100286381A1 (en) 2001-09-28 2010-07-02 Diagnostic method for cancer characterized in the detection of the deletion of g-csf exon 3
US13/546,972 Abandoned US20120322684A1 (en) 2001-09-28 2012-07-11 G-csf protein having a deletion of an amino acid sequence corresponding to exon 3 for use as a diagnostic cancer marker
US13/546,966 Abandoned US20120329078A1 (en) 2001-09-28 2012-07-11 Method of diagnosing cancer using g-csf protein having a deletion of an amino acid sequence corresponding to exon 3 as a diagnostic cancer marker
US13/546,975 Abandoned US20140005365A1 (en) 2001-09-28 2012-07-11 Antibody to a mutant g-csf for diagnosis of cancer

Family Applications After (9)

Application Number Title Priority Date Filing Date
US11/058,976 Expired - Fee Related US8324363B2 (en) 2001-09-28 2005-02-16 Microarray for detection of the deletion of exon 3 of the G-CSF gene
US11/059,127 Abandoned US20050158810A1 (en) 2001-09-28 2005-02-16 Diagnostic method for cancer characterized in the detection of the deletion of G-CSF exon 3
US11/059,222 Abandoned US20050266430A1 (en) 2001-09-28 2005-02-16 Diagnostic method for cancer characterized in the detection of the deletion of G-CSF exon 3
US11/059,268 Abandoned US20050170417A1 (en) 2001-09-28 2005-02-16 Diagnostic method for cancer characterized in the detection of the deletion of G-CSF exon 3
US11/059,192 Abandoned US20050170416A1 (en) 2001-09-28 2005-02-16 Diagnostic method for cancer characterized in the detection of the deletion of G-CSF exon 3
US12/830,085 Abandoned US20100286381A1 (en) 2001-09-28 2010-07-02 Diagnostic method for cancer characterized in the detection of the deletion of g-csf exon 3
US13/546,972 Abandoned US20120322684A1 (en) 2001-09-28 2012-07-11 G-csf protein having a deletion of an amino acid sequence corresponding to exon 3 for use as a diagnostic cancer marker
US13/546,966 Abandoned US20120329078A1 (en) 2001-09-28 2012-07-11 Method of diagnosing cancer using g-csf protein having a deletion of an amino acid sequence corresponding to exon 3 as a diagnostic cancer marker
US13/546,975 Abandoned US20140005365A1 (en) 2001-09-28 2012-07-11 Antibody to a mutant g-csf for diagnosis of cancer

Country Status (9)

Country Link
US (10) US20040247562A1 (fr)
EP (1) EP1446485B1 (fr)
JP (1) JP4413611B2 (fr)
KR (2) KR100523328B1 (fr)
CN (1) CN100491527C (fr)
AT (1) ATE459646T1 (fr)
AU (1) AU2002343900B2 (fr)
DE (1) DE60235568D1 (fr)
WO (1) WO2003027288A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006067170A1 (fr) * 2004-12-23 2006-06-29 Laboratoires Serono S.A. Polypeptides g-csf et leurs utilisations
WO2007083929A1 (fr) * 2006-01-20 2007-07-26 Medigenes Co., Ltd Marqueur et méthode permettant de diagnostiquer un cancer
US20110192721A1 (en) * 2006-05-04 2011-08-11 Nipro Diagnostics, Inc. System and methods for automatically recognizing a control solution

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9187543B2 (en) 2010-03-04 2015-11-17 Pfenex Inc. Method for producing soluble recombinant interferon protein without denaturing
AU2011235210B2 (en) 2010-04-01 2015-07-16 Pfenex Inc. Methods for G-CSF production in a Pseudomonas host cell

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6004548A (en) * 1985-08-23 1999-12-21 Amgen, Inc. Analogs of pluripotent granulocyte colony-stimulating factor

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5581476A (en) * 1993-01-28 1996-12-03 Amgen Inc. Computer-based methods and articles of manufacture for preparing G-CSF analogs
WO1995023862A1 (fr) * 1994-03-04 1995-09-08 Ludwig Institute For Cancer Research Animaux a rupture genique ciblee
US6303301B1 (en) * 1997-01-13 2001-10-16 Affymetrix, Inc. Expression monitoring for gene function identification
KR100365482B1 (ko) 1999-12-28 2002-12-26 철 근 김 종양 억제 유전자의 프라이머쌍을 포함하는 암 진단용 벡터

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6004548A (en) * 1985-08-23 1999-12-21 Amgen, Inc. Analogs of pluripotent granulocyte colony-stimulating factor

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006067170A1 (fr) * 2004-12-23 2006-06-29 Laboratoires Serono S.A. Polypeptides g-csf et leurs utilisations
US7790174B2 (en) 2004-12-23 2010-09-07 Merck Serono Sa G-CSF polypeptides and uses thereof
US7863016B2 (en) 2004-12-23 2011-01-04 Merck Serono S.A. G-CSF polypeptides and uses thereof
US7863018B2 (en) 2004-12-23 2011-01-04 Merck Serono Sa G-CSF polypeptides and uses thereof
WO2007083929A1 (fr) * 2006-01-20 2007-07-26 Medigenes Co., Ltd Marqueur et méthode permettant de diagnostiquer un cancer
US20090269750A1 (en) * 2006-01-20 2009-10-29 Medigenes Co., Ltd. Marker and method for cancer diagnosis
US20110192721A1 (en) * 2006-05-04 2011-08-11 Nipro Diagnostics, Inc. System and methods for automatically recognizing a control solution
US8647487B2 (en) * 2006-05-04 2014-02-11 Nipro Diagnostics, Inc. System and methods for automatically recognizing a control solution

Also Published As

Publication number Publication date
US20050170416A1 (en) 2005-08-04
ATE459646T1 (de) 2010-03-15
US20050266430A1 (en) 2005-12-01
KR100523328B1 (ko) 2005-10-24
CN100491527C (zh) 2009-05-27
EP1446485A1 (fr) 2004-08-18
US20050170417A1 (en) 2005-08-04
EP1446485B1 (fr) 2010-03-03
DE60235568D1 (de) 2010-04-15
US20120322684A1 (en) 2012-12-20
KR20030027870A (ko) 2003-04-07
US20050158810A1 (en) 2005-07-21
WO2003027288A1 (fr) 2003-04-03
AU2002343900B2 (en) 2007-04-26
CN1561395A (zh) 2005-01-05
US8324363B2 (en) 2012-12-04
JP4413611B2 (ja) 2010-02-10
WO2003027288A9 (fr) 2003-06-05
US20140005365A1 (en) 2014-01-02
US20100286381A1 (en) 2010-11-11
JP2005503810A (ja) 2005-02-10
KR100716014B1 (ko) 2007-05-08
EP1446485A4 (fr) 2005-05-25
US20050244856A1 (en) 2005-11-03
KR20050098821A (ko) 2005-10-12
US20120329078A1 (en) 2012-12-27

Similar Documents

Publication Publication Date Title
JP4216720B2 (ja) 抗体処置応答を評価するための方法および組成物
WO2014017491A1 (fr) Gène de fusion formé par le gène cep55 et le gène ret
EP0854923A2 (fr) Molecules isolees d'acides nucleiques utiles comme marqueurs de la leucemie et pour pronostiquer un cancer du sein
US20140005365A1 (en) Antibody to a mutant g-csf for diagnosis of cancer
EP0904405A2 (fr) Biomarqueurs servant a effectuer la detection, le diagnostic et le pronostic du cancer de la prostate
US20090136939A1 (en) Methods for diagnosis and therapy for pancreatic cancer and composition useful therein
TWI292824B (en) Agent for detecting metastatic potential of cancer cell
AU2003281975B2 (en) Methods and kits for diagnosing and treating B-cell chronic lymphocytic leukemia (B-CLL)
EP2492356A1 (fr) Procédé de détection de l'ADN méthylé dans un échantillon
KR20050098811A (ko) G-csf의 액손3 영역이 결실된 단백질 및 이에 특이적인항체 및 이들의 제조방법
Kurosu et al. Monoclonality of B‐cell lineage in primary pulmonary lymphoma demonstrated by immunoglobulin heavy chain gene sequence analysis of histologically non‐definitive transbronchial biopsy specimens
WO2006013474A2 (fr) Udp-n-acetyl-d-galactosamine: polypeptide n-acetylgalactosaminyltransferase 6 (ppgainac-t6) arnm ou un peptide utilise en tant que nouveau marqueur pour la detection de cellules cancereuses
WO1992020820A1 (fr) Methode de determination du potentiel metastatique des cellules tumorales
JP2006513135A5 (fr)
JP4098236B2 (ja) 肝芽腫と正常肝で発現差がある核酸
JP2006508645A (ja) 抗癌剤の開発および癌の診断のための、腫瘍の発生に関与することが同定されたマウスゲノム領域の使用
Tripputi et al. Immunoglobulin gene rearrangements and in vitro growth of stromal cells are prognostic indexes in B-chronic lymphocytic leukemia
KR20070019524A (ko) 암 진단 마커 및 방법
JP2006238757A (ja) 癌を検出するためのマーカー
JP2004049122A (ja) 各種病型癌において病型特異的に発現変化を示す遺伝子およびその利用
JP2008259424A (ja) 前癌状態から癌への悪性化の過程で発現量が変化する遺伝子の利用
AU2007216790A1 (en) Methods and kits for diagnosing and treating B-cell chronic lymphocytic leukemia (B-CLL)

Legal Events

Date Code Title Description
AS Assignment

Owner name: MEDIGENES, KOREA, REPUBLIC OF

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:LEE, SANG YUP;YOO, NAE CHOON;YOO, SO YOUNG;AND OTHERS;REEL/FRAME:015598/0668

Effective date: 20040309

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION