US20030036197A1 - Recombinant constructs and their use in reducing gene expression - Google Patents

Recombinant constructs and their use in reducing gene expression Download PDF

Info

Publication number
US20030036197A1
US20030036197A1 US09/887,194 US88719401A US2003036197A1 US 20030036197 A1 US20030036197 A1 US 20030036197A1 US 88719401 A US88719401 A US 88719401A US 2003036197 A1 US2003036197 A1 US 2003036197A1
Authority
US
United States
Prior art keywords
rna
host
target mrna
mrna
substantially similar
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US09/887,194
Other languages
English (en)
Inventor
Kimberly Glassman
William Gordon-Kamm
Anthony Kinney
Keith Lowe
Scott Nichols
Kevin Stecca
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Pioneer Hi Bred International Inc
EIDP Inc
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to US09/887,194 priority Critical patent/US20030036197A1/en
Assigned to E.I. DU PONT DE NEMOURS AND COMPANY, PIONEER HI-BRED INTERNATIONAL, INC. reassignment E.I. DU PONT DE NEMOURS AND COMPANY ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: NICHOLS, SCOTT E., KINNEY, ANTHONY J., STECCA, KEVIN L., GLASSMAN, KIMBERLY F., GORDON-KAMM, WILLIAM J., LOWE, KEITH
Publication of US20030036197A1 publication Critical patent/US20030036197A1/en
Priority to US11/476,510 priority patent/US7456014B2/en
Priority to US12/256,721 priority patent/US7897383B2/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8245Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8245Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
    • C12N15/8246Non-starch polysaccharides, e.g. cellulose, fructans, levans
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8247Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified lipid metabolism, e.g. seed oil composition
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/825Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving pigment biosynthesis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8251Amino acid content, e.g. synthetic storage proteins, altering amino acid biosynthesis

Definitions

  • This invention relates to reducing gene expression and, in particular, to recombinant constructs useful for reducing the expression of endogenous mRNA and any substantially similar endogenous mRNA.
  • Cosuppression is also referred to as “gene silencing” or post-transcriptional gene silencing (PTGS) by plant biologists, “RNA interference” by those studying worms and flies (Montgomery and Fire (1998) TIG 14:255-258; Fire et al (1998) Nature 391:806-811; Hammond et al (2000) Nature 404:293-296; and PCT Application No. WO 99/32619 published Jul. 1, 1999), and “quelling” by researchers working with fungi (Romano and Macino (1992) Mol Microbiol 6:3343-3353).
  • PTGS is an ancient self-defense mechanism evolved to combat infection by viruses and transposons. It appears that this pathogen-derived resistance is triggered by the presence in the host's cells of double-stranded RNA (dsRNA) or some other aberrant nucleic acid, which are indicative of a viral assault.
  • dsRNA double-stranded RNA
  • mRNA messenger RNA
  • WO 99/53050 which published on Oct. 21, 1999, describes chimeric constructs encoding RNA molecules directed towards a target nucleic acid which are comprised of sense and antisense sequences, such that the expressed RNA is capable of forming an intramolecular double-stranded RNA structure.
  • the expression of these RNA in transgenic organisms results in gene silencing of the all homologous target nucleic acid sequences within the cell.
  • the present invention describes the use of suitable DNA sequences or RNA sequences derived therefrom, as is discussed below, in ways which here-to-fore have not been previously described. These sequences, and their reverse complements, can be used to reduce the expression of any endogenous genomic sequence that shares substantial similarity to nucleic acid fragment which is in proximity to the DNA sequence or RNA sequence derived therefrom. The details of this phenomenon are described herein.
  • This invention concerns a recombinant construct comprising a promoter operably linked to a DNA sequence which, when expressed by a host produces an RNA having:
  • RNA reduces the expression of the target mRNA or any substantially similar endogenous mRNA.
  • this invention concerns a recombinant construct comprising a promoter operably linked to a DNA sequence which, when expressed by a host, produces an RNA having:
  • RNA reduces the expression of the target mRNA or any substantially similar endogenous mRNA.
  • this invention concerns a recombinant construct comprising a promoter operably linked to a DNA sequence which, when expressed by a host, produces an RNA having:
  • RNA reduces the expression of the target mRNA or any substantially similar endogenous mRNA.
  • this invention concerns a recombinant construct comprising a promoter operably linked to a DNA sequence which, when expressed by a host, produces an RNA having:
  • RNA reduces the expression of the target mRNA or any substantially similar endogenous mRNA.
  • this invention concerns a recombinant construct comprising a promoter operably linked to a DNA sequence which, when expressed by a host, produces an RNA having:
  • RNA reduces the expression of the target mRNA or any substantially similar endogenous mRNA.
  • the RNA region or regions which are unrelated to any endogenous RNA in the host comprise a synthetic, non-naturally occurring RNA sequence.
  • RNA region or regions which are unrelated to any endogenous RNA in the host do not comprise plant viral RNA.
  • this invention concerns a method for reducing expression of a target mRNA or any substantially similar endogenous mRNA which comprises:
  • this invention concerns a recombinant construct comprising an RNA having:
  • RNA when introduced into the host, reduces the expression of the target mRNA or any substantially similar endogenous mRNA.
  • this invention concerns a recombinant construct comprising an RNA having:
  • RNA when introduced into the host, reduces the expression of the target mRNA or any substantially similar endogenous mRNA.
  • this invention concerns a recombinant construct comprising an RNA having:
  • RNA when introduced into the host, reduces the expression of the target mRNA or any substantially similar endogenous mRNA.
  • this invention concerns a recombinant construct comprising an RNA having:
  • RNA when introduced into the host, reduces the expression of the target mRNA or any substantially similar endogenous mRNA.
  • this invention concerns a recombinant construct comprising an RNA having:
  • RNA when introduced into the host, reduces the expression of the target mRNA or any substantially similar endogenous mRNA.
  • the RNA region or regions which are unrelated to any endogenous RNA in the host comprise a synthetic, non-naturally occurring RNA sequence.
  • RNA region or regions which are unrelated to any endogenous RNA in the host do not comprise plant viral RNA.
  • this invention concerns a method for reducing expression of a target mRNA or any substantially similar endogenous mRNA which comprises:
  • this invention concerns, a recombinant construct comprising a promoter operably linked to a DNA sequence which, when expressed by a host produces an RNA having:
  • RNA reduces the expression of the target mRNA or any substantially similar endogenous mRNA.
  • this invention concerns, a recombinant construct comprising a promoter operably linked to a DNA sequence which, when expressed by a host produces an RNA having:
  • RNA reduces the expression of the target mRNA or any substantially similar endogenous mRNA.
  • this invention concerns, a recombinant construct comprising a promoter operably linked to a DNA sequence which, when expressed by a host produces an RNA having:
  • RNA reduces the expression of the target mRNA or any substantially similar endogenous mRNA.
  • this invention concerns, a recombinant construct comprising a promoter operably linked to a DNA sequence which, when expressed by a host produces an RNA having:
  • RNA reduces the expression of the target mRNA or any substantially similar endogenous mRNA.
  • this invention concerns, a recombinant construct comprising a promoter operably linked to a DNA sequence which, when expressed by a host produces an RNA having:
  • RNA reduces the expression of the target mRNA or any substantially similar endogenous mRNA.
  • the RNA region or regions which are unrelated to any endogenous RNA in the host comprise a synthetic, non-naturally occurring RNA sequence.
  • RNA region or regions which are unrelated to any endogenous RNA in the host do not comprise plant viral RNA.
  • this invention concerns, a method for reducing expression of a target mRNA or any substantially similar endogenous mRNA which comprises:
  • this invention concerns an RNA comprising:
  • RNA when introduced into the host, reduces the expression of the target mRNA or any substantially similar endogenous mRNA.
  • this invention concerns an RNA comprising:
  • RNA when introduced into the host, reduces the expression of the target mRNA or any substantially similar endogenous mRNA.
  • this invention concerns an RNA comprising:
  • RNA when introduced into the host, reduces the expression of the target mRNA or any substantially similar endogenous mRNA.
  • this invention concerns an RNA comprising:
  • RNA when introduced into the host, reduces the expression of the target mRNA or any substantially similar endogenous mRNA.
  • this invention concerns an RNA comprising:
  • RNA when introduced into the host, reduces the expression of the target mRNA or any substantially similar endogenous mRNA.
  • RNA region or regions which are unrelated to any endogenous RNA in the host comprise a synthetic, non-naturally occurring RNA sequence.
  • RNA region or regions which are unrelated to any endogenous RNA in the host do not comprise plant viral RNA.
  • this invention concerns a method for reducing expression of a target mRNA or any substantially similar endogenous mRNA which comprises:
  • this invention concerns a method for identifying or screening an essential plant gene which comprises:
  • step (d) comparing the quantification of transformed plant cells selected from step (b) with the quantification of transformed plants cells selected from step (c) wherein the quantification of transformed plants cells selected from step (c) should substantially exceed the quantification of transformed plant cells selected from step (b).
  • this invention concerns a method for identifying or screening an essential plant gene which comprises:
  • step (d) comparing the quantification of transformed plant cells selected from step (b) with the quantification of transformed plants cells selected from step (c) wherein the quantification of transformed plants cells selected from step (c) should substantially exceed the quantification of transformed plant cells selected from step (b).
  • FIG. 1 depicts the results of chimerism in experiments on antisense, “classical co-suppression”, and complementary region reduction of expression for the soybean gene Fad2, a fatty acid desaturase.
  • Chimerism is a measure of the percentage of individuals isolated in individual transformed lines that exhibit the phenotype characteristic of the desired trait.
  • FIG. 2 shows total soybean sugars visualized after TLC separation.
  • the raffinose and stachyose sugars are the lowest band in each lane.
  • the “Low 4” lane is isolated from a soybean line known to have very low levels of raffinose/stachyose sugars.
  • the two “GAS-EL” lines both have lower levels of raffinose/stachyose than are found in the surrounding lines indicating that the GAS1/GAS2 fragments contained within the EL construct are suppressing galactinol synthase activity in these lines.
  • SEQ ID NO:1 is the sequence of an oligonucleotide primer used in a polymerase chain reaction (PCR) amplification of the soybean Fad2-1 gene for insertion into plasmid pKS67 to produce plasmid pKS91.
  • PCR polymerase chain reaction
  • SEQ ID NO:2 is the sequence of an oligonucleotide primer used in a PCR amplification of the soybean Fad2-1 gene for insertion into plasmid pKS67 to produce plasmid pKS91.
  • SEQ ID NO:3 is the sequence of an oligonucleotide primer used in a PCR amplification of the soybean Fad2-1 gene for insertion into plasmid pKS67 to produce plasmid pKS91.
  • SEQ ID NO:4 is the sequence of an oligonucleotide primer used in a PCR amplification of the soybean Fad2-1 gene for insertion into plasmid pKS67 to produce plasmid pKS91.
  • SEQ ID NO:5 is the sequence of an oligonucleotide primer used in a PCR amplification of the soybean Fad2-1 gene for insertion into plasmid pKS67 to produce plasmid pKS91.
  • SEQ ID NO:6 is the sequence of an oligonucleotide primer used in a PCR amplification of the soybean Fad2-1 gene for insertion into plasmid pKS67 to produce plasmid pKS91.
  • SEQ ID NO:7 is a linker oligonucleotide used to insert various restriction enzyme sites into the plasmid pKS17 to form the plasmid pKS102.
  • SEQ ID NO:8 is the sequence of an oligonucleotide primer used in a PCR amplification of the soybean Cer3 gene for insertion into plasmid pKS67 to form plasmid pKS100.
  • SEQ ID NO:9 is the sequence of an oligonucleotide primer used in a PCR amplification of the soybean Cer3 gene for insertion into plasmid pKS67 to form plasmid pKS100.
  • SEQ ID NO:10 is the sequence of an oligonucleotide primer used in a PCR amplification of the soybean Cer3 gene for insertion into plasmid pKS67 to form plasmid pKS100.
  • SEQ ID NO:11 is the sequence of an oligonucleotide primer used in a PCR amplification of the soybean Cer3 gene for insertion into plasmid pKS67 to form plasmid pKS100.
  • SEQ ID NO:12 represents the 1 ⁇ complementary repeat designated ELVISLIVES found in plasmids pKS106 and pKS124.
  • SEQ ID NO:13 represents the 2 ⁇ complementary repeat designated ELVISLIVES found in plasmids pKS133.
  • SEQ ID NO:14 is the sequence of an oligonucleotide primer used in a PCR amplification of the ELVISLIVES complementary region.
  • SEQ ID NO:15 is the sequence of an oligonucleotide primer used in a PCR amplification of the ELVISLIVES complementary region.
  • SEQ ID NO:16 is the sequence of an oligonucleotide primer used in a PCR amplification of the soybean Fad2-1 gene to produce the 599 nucleotide fragment inserted into plasmid pKS106 to produce the plasmid pKS111.
  • SEQ ID NO:17 is the sequence of an oligonucleotide primer used in a PCR amplification of the soybean Fad2-1 gene to produce the 599 nucleotide fragment inserted into plasmid pKS106 to produce the plasmid pKS111.
  • SEQ ID NO:18 is the sequence of the common 5′ oligonucleotide primer used in a PCR amplification of the soybean Fad2-1 gene for use in testing size requirements for target sequences.
  • SEQ ID NO:19 is the sequence of a 3′ oligonucleotide primer used in a PCR amplification of the soybean Fad2-1 gene for production of the 25 bp fragment.
  • SEQ ID NO:20 is the sequence of a 3′ oligonucleotide primer used in a PCR amplification of the soybean Fad2-1 gene for production of the 75 bp fragment.
  • SEQ ID NO:21 is the sequence of a 3′ oligonucleotide primer used in a PCR amplification of the soybean Fad2-1 gene for production of the 150 bp fragment.
  • SEQ ID NO:22 is the sequence of a 3′ oligonucleotide primer used in a PCR amplification of the soybean Fad2-1 gene for production of the 300 bp fragment.
  • SEQ ID NO:23 is the sequence of a 3′ oligonucleotide primer used in a PCR amplification of the soybean Fad2-1 gene for production of the 600 bp fragment.
  • SEQ ID NO:24 represents the 2 ⁇ ELVISLIVES complementary repeat region from pBS68 which contains 2 ⁇ ELVISLIVES complementary regions surrounding the 599 nucleotide Fad2-1 NotI fragment from pKS111 and a 969 nucleotide fragment from a soybean delta-9 desaturase.
  • SEQ ID NO:25 is the sequence of a 5′ oligonucleotide primer used in a PCR amplification of the Lea promoter.
  • SEQ ID NO:26 is the sequence of a 3′ oligonucleotide primer used in a PCR amplification of the Lea promoter.
  • SEQ ID NO:27 is the sequence of a 5′ oligonucleotide primer used in a PCR amplification of the phaseolin 3′-end.
  • SEQ ID NO:28 is the sequence of a 3′ oligonucleotide primer used in a PCR amplification of the phaseolin 3′-end.
  • SEQ ID NO:29 represents the 2 ⁇ ELVISLIVES complementary repeat region from pKS149 that contains fragments from two soybean galactinol synthase genes GAS1 and GAS2 (411 and 435 nucleotides, respectively). The region is functionally attached to a late-soybean-embryo promoter (LEA) and a phaseolin 3′ terminator region. This entire region is then cloned into the BamHI site of pKS136, which contains a 2 ⁇ ELVISLIVES complementary repeat region controlled by a soybean Kti promoter and terminator region.
  • LOA late-soybean-embryo promoter
  • SEQ ID NO:30 represents the DNA sequence of the soybean galactinol synthase gene GAS1.
  • SEQ ID NO:31 represents the putative translation product DNA sequence of SEQ ID NO:30 the soybean galactinol synthase gene GAS1.
  • SEQ ID NO:32 represents the DNA sequence of the soybean galactinol synthase gene GAS2.
  • SEQ ID NO:33 represents the putative translation product DNA sequence of SEQ ID NO:32 the soybean galactinol synthase gene GAS2.
  • SEQ ID NO:34 represents the complementary region SHH3 from plasmid PHP17962, used in the construction of plasmid PHP17894 containing the phytoene desaturase fragment.
  • the complementary regions are from 8-212 and 305-509, respectively. Restriction endonuclease sites for EcoRV, KpnI, KspI, SphI, and NcoI can be used as cloning sites between the complementary regions.
  • SEQ ID NO:35 represents the DNA sequence of the soybean acetolactate synthase (ALS) gene.
  • SEQ ID NO:36 is the sequence of a 3′ oligonucleotide primer used in a PCR amplification of the soybean Fad2-1 gene for production of the 50 bp fragment.
  • host refers to any organism, or cell thereof, whether human or non-human into which a recombinant construct can be stably or transiently introduced in order to reduce gene expression.
  • an “isolated nucleic acid fragment” is a polymer of RNA or DNA that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases.
  • An isolated nucleic acid fragment in the form of a polymer of DNA may be comprised of one or more segments of cDNA, genomic DNA or synthetic DNA.
  • Nucleotides are referred to by their single letter designation as follows: “A” for adenylate or deoxyadenylate (for RNA or DNA, respectively), “C” for cytidylate or deoxycytidylate, “G” for guanylate or deoxyguanylate, “U” for uridylate, “T” for deoxythymidylate, “R” for purines (A or G), “Y” for pyrimidines (C or T), “K” for g or T, “H” for A or C or T, “I” for inosine, and “N” for any nucleotide.
  • fragment that is functionally equivalent and “functionally equivalent subfragment” are used interchangeably herein. These terms refer to a portion or subsequence of an isolated nucleic acid fragment in which the ability to alter gene expression or produce a certain phenotype is retained whether or not the fragment or subfragment encodes an active enzyme.
  • the fragment or subfragment can be used in the design of chimeric genes to produce the desired phenotype in a transformed plant. Chimeric genes can be designed for use in co-suppression or antisense by linking a nucleic acid fragment or subfragment thereof, whether or not it encodes an active enzyme, in the appropriate orientation relative to a plant promoter sequence.
  • nucleic acid fragments wherein changes in one or more nucleotide bases does not affect the ability of the nucleic acid fragment to mediate gene expression or produce a certain phenotype.
  • modifications of the nucleic acid fragments of the instant invention such as deletion or insertion of one or more nucleotides that do not substantially alter the functional properties of the resulting nucleic acid fragment relative to the initial, unmodified fragment. It is therefore understood, as those skilled in the art will appreciate, that the invention encompasses more than the specific exemplary sequences.
  • substantially similar nucleic acid sequences encompassed by this invention are also defined by their ability to hybridize, under moderately stringent conditions (for example, 0.5 ⁇ SSC, 0.1% SDS, 60° C.) with the sequences exemplified herein, or to any portion of the nucleotide sequences reported herein and which are functionally equivalent to the promoter of the invention.
  • Stringency conditions can be adjusted to screen for moderately similar fragments, such as homologous sequences from distantly related organisms, to highly similar fragments, such as genes that duplicate functional enzymes from closely related organisms. Post-hybridization washes determine stringency conditions.
  • One set of preferred conditions involves a series of washes starting with 6 ⁇ SSC, 0.5% SDS at room temperature for 15 min, then repeated with 2 ⁇ SSC, 0.5% SDS at 45° C. for 30 min, and then repeated twice with 0.2 ⁇ SSC, 0.5% SDS at 50° C. for 30 min.
  • a more preferred set of stringent conditions involves the use of higher temperatures in which the washes are identical to those above except for the temperature of the final two 30 min washes in 0.2 ⁇ SSC, 0.5% SDS was increased to 60° C.
  • Another preferred set of highly stringent conditions involves the use of two final washes in 0.1 ⁇ SSC, 0.1% SDS at 65° C.
  • such sequences should be at least 25 nucleotides in length, preferably at least 50 nucleotides in length, more preferably at least 100 nucleotides in length, again more preferably at least 200 nucleotides in length, and most preferably at least 300 nucleotides in length; and should be at least 80% identical, preferably at least 85% identical, more preferably at least 90% identical, and most preferably at least 95% identical.
  • Gene refers to a nucleic acid fragment that expresses a specific protein, including regulatory sequences preceding (5′ non-coding sequences) and following (3′ non-coding sequences) the coding sequence.
  • “Native gene” refers to a gene as found in nature with its own regulatory sequences.
  • “Chimeric gene” refers any gene that is not a native gene, comprising regulatory and coding sequences that are not found together in nature. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature.
  • a “foreign” gene refers to a gene not normally found in the host organism, but that is introduced into the host organism by gene transfer. Foreign genes can comprise native genes inserted into a non-native organism, or chimeric genes.
  • a “transgene” is a gene that has been introduced into the genome by a transformation procedure.
  • essential plant genes refers to genes encoding a product that is required for normal plant growth, development, and/or viability.
  • examples of essential plant genes would include, but not be limited to, rate-limiting enzymes in amino acid, nucleic acid, or lipid biosynthesis. It is also believed that many genes with unknown function may be essential. Suppression of essential plant genes by chemical or genetic means will result in altered growth and/or development. If an essential gene is unique in the genome of the plant, suppression may lead to plant death, which is the basis of many plant herbicides.
  • Coding sequence refers to a DNA sequence that codes for a specific amino acid sequence.
  • Regulatory sequences refer to nucleotide sequences located upstream (5′ non-coding sequences), within, or downstream (3′ non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences.
  • Promoter refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA.
  • the promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers.
  • an “enhancer” is a DNA sequence which can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue-specificity of a promoter. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments.
  • promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as “constitutive promoters”. New promoters of various types useful in plant cells are constantly being discovered; numerous examples may be found in the compilation by Okamuro and Goldberg, (1989) Biochemistry of Plants 15:1-82. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of some variation may have identical promoter activity.
  • an “intron” is an intervening sequence in a gene that does not encode a portion of the protein sequence. Thus, such sequences are transcribed into RNA but are then excised and are not translated. The term is also used for the excised RNA sequences.
  • An “exon” is a portion of the sequence of a gene that is transcribed and is found in the mature messenger RNA derived from the gene, but is not necessarily a part of the sequence that encodes the final gene product.
  • the “translation leader sequence” refers to a DNA sequence located between the promoter sequence of a gene and the coding sequence.
  • the translation leader sequence is present in the fully processed mRNA upstream of the translation start sequence.
  • the translation leader sequence may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency. Examples of translation leader sequences have been described (Turner, R. and Foster, G. D. (1995) Molecular Biotechnology 3:225).
  • the “3′ non-coding sequences” refer to DNA sequences located downstream of a coding sequence and include polyadenylation recognition sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression.
  • the polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3′ end of the mRNA precursor.
  • the use of different 3′ non-coding sequences is exemplified by Ingelbrecht et al, (1989) Plant Cell 1:671-680.
  • RNA transcript refers to the product resulting from RNA polymerase-catalyzed transcription of a DNA sequence. When the RNA transcript is a perfect complementary copy of the DNA sequence, it is referred to as the primary transcript or it may be a RNA sequence derived from post-transcriptional processing of the primary transcript and is referred to as the mature RNA. “Messenger RNA (mRNA)” refers to the RNA that is without introns and that can be translated into protein by the cell. “cDNA” refers to a DNA that is complementary to and synthesized from a mRNA template using the enzyme reverse transcriptase.
  • RNA transcript that includes the mRNA and can be translated into protein within a cell or in vitro.
  • Antisense RNA refers to an RNA transcript that is complementary to all or part of a target primary transcript or mRNA and that blocks the expression of a target gene (U.S. Pat. No. 5,107,065). The complementarity of an antisense RNA may be with any part of the specific gene transcript, i.e., at the 5′ non-coding sequence, 3′ non-coding sequence, introns, or the coding sequence.
  • RNA refers to antisense RNA, ribozyme RNA, or other RNA that may not be translated but yet has an effect on cellular processes.
  • complement and “reverse complement” are used interchangeably herein with respect to mRNA transcripts, and are meant to define the antisense RNA of the message.
  • target mRNA refers to any mRNA whose expression in the host is to be reduced.
  • endogenous RNA refers to any RNA which is encoded by any nucleic acid sequence present in the genome of the host prior to transformation with the recombinant construct of the present invention, whether naturally-occurring or non-naturally occurring, i.e., introduced by recombinant means, mutagenesis, etc.
  • non-naturally occurring means artificial, not consistent with what is normally found in nature.
  • operably linked refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is regulated by the other.
  • a promoter is operably linked with a coding sequence when it is capable of regulating the expression of that coding sequence (i.e., that the coding sequence is under the transcriptional control of the promoter).
  • Coding sequences can be operably linked to regulatory sequences in a sense or antisense orientation.
  • the complementary RNA regions of the invention can be operably linked, either directly or indirectly, 5′ to the target mRNA, or 3′ to the target mRNA, or within the target mRNA, or a first complementary region is 5′ and its complement is 3′ to the target mRNA.
  • expression refers to the production of a functional end-product. Expression of a gene involves transcription of the gene and translation of the mRNA into a precursor or mature protein. “Antisense inhibition” refers to the production of antisense RNA transcripts capable of suppressing the expression of the target protein. “Co-suppression” refers to the production of sense RNA transcripts capable of suppressing the expression of identical or substantially similar foreign or endogenous genes (U.S. Pat. No. 5,231,020).
  • “Mature” protein refers to a post-translationally processed polypeptide; i.e., one from which any pre- or propeptides present in the primary translation product have been removed.
  • “Precursor” protein refers to the primary product of translation of mRNA; i.e., with pre- and propeptides still present. Pre- and propeptides may be but are not limited to intracellular localization signals.
  • “Stable transformation” refers to the transfer of a nucleic acid fragment into a genome of a host organism, including both nuclear and organellar genomes, resulting in genetically stable inheritance.
  • “transient transformation” refers to the transfer of a nucleic acid fragment into the nucleus, or DNA-containing organelle, of a host organism resulting in gene expression without integration or stable inheritance.
  • Host organisms containing the transformed nucleic acid fragments are referred to as “transgenic” organisms.
  • the preferred method of cell transformation of rice, corn and other monocots is the use of particle-accelerated or “gene gun” transformation technology (Klein et al, (1987) Nature (London) 327:70-73; U.S. Pat. No. 4,945,050), or an Agrobacterium-mediated method using an appropriate Ti plasmid containing the transgene (Ishida Y. et al, 1996, Nature Biotech. 14:745-750).
  • Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described more fully in Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989 (hereinafter “Sambrook”).
  • recombinant refers to an artificial combination of two otherwise separated segments of sequence, e.g., by chemical synthesis or by the manipulation of isolated segments of nucleic acids by genetic engineering techniques.
  • PCR or “Polymerase Chain Reaction” is a technique for the synthesis of large quantities of specific DNA segments, consists of a series of repetitive cycles (Perkin Elmer Cetus Instruments, Norwalk, Conn.). Typically, the double stranded DNA is heat denatured, the two primers complementary to the 3′ boundaries of the target segment are annealed at low temperature and then extended at an intermediate temperature. One set of these three consecutive steps is referred to as a cycle.
  • recombinant construct Such construct may be itself or may be used in conjunction with a vector. If a vector is used then the choice of vector is dependent upon the method that will be used to transform host plants as is well known to those skilled in the art. For example, a plasmid vector can be used. The skilled artisan is well aware of the genetic elements that must be present on the vector in order to successfully transform, select and propagate host cells comprising any of the isolated nucleic acid fragments of the invention. The skilled artisan will also recognize that different independent transformation events will result in different levels and patterns of expression (Jones et al, (1985) EMBO J.
  • Such screening may be accomplished by Southern analysis of DNA, Northern analysis of mRNA expression, Western analysis of protein expression, or phenotypic analysis.
  • suitable nucleic acid sequences and their reverse complement can be used to alter the expression of any homologous, endogenous RNA (i.e., the target RNA) which is in proximity to the suitable nucleic acid sequence and its reverse complement.
  • the suitable nucleic acid sequence and its reverse complement can be either unrelated to any endogenous RNA in the host or can be encoded by any nucleic acid sequence in the genome of the host provided that nucleic acid sequence does not encode any target mRNA or any sequence that is substantially similar to the target mRNA.
  • the present invention presents a very efficient and robust approach to achieving single, or multiple, gene co-suppression using single plasmid transformation.
  • the constructs are composed of promoters linked to mRNA(s) coding regions, or fragments thereof, that are targeted for suppression, and short complementary sequences that are unrelated to the targets.
  • the complementary sequences can be oriented both 5′, both 3′, or on either side of the target sequence.
  • the complementary sequences are preferred to be about 40-50 nucleotides in length, or more preferably 50-100 nucleotides in length, or most preferably at least or greater than 100-300 nucleotides.
  • the complementary sequences are unrelated to the target, but can come from any other source.
  • sequences include, but are not limited to, plant sequences, bacterial sequences, animal sequences, viral or phage sequences, or completely artificial, i.e. non-naturally occurring, sequences not known to occur in any organism (see “ELVISLIVES” below). All sequences can be compared to other known sequences, or each other, using any one of a number of sequence alignment programs as set forth below in Example 4.
  • high degree of frequency refers to the percentage of transformed lines that exhibit the target suppressed phenotype. High frequency percentages are expected to be in a range of at least 15-95% and any integer percentage found within the range. Preferred embodiments would include at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, and 95%.
  • the present invention concerns a recombinant construct comprising a promoter operably linked to a DNA sequence which, when expressed by a host produces an RNA having:
  • RNA reduces the expression of the target mRNA or any substantially similar endogenous mRNA.
  • the present invention concerns a recombinant construct comprising a promoter operably linked to a DNA sequence which, when expressed by a host produces an RNA having:
  • RNA reduces the expression of the target mRNA or any substantially similar endogenous mRNA.
  • Any promoter can be used to practice the invention.
  • a beta-conglycinin promoter a Kunitz soybean Trypsin Inhibitor (KSTI or Kti) promoter, a Gly m Bd 28K promoter, T7 promoter, a 35S promoter and a beta-phaseolin promoter.
  • the preferred promoter is that of the ⁇ ′-subunit of beta-conglycinin (referred to herein as the beta-conglycinin promoter).
  • Co-suppressed plants that contain recombinant expression constructs with the promoter of the ⁇ ′-subunit of beta-conglycinin will often exhibit suppression of both the ⁇ and ⁇ ′ subunits of beta-congylcinin (as described in PCT Publication No. WO 97/47731, published on Dec. 18, 1997, the disclosure of which is hereby incorporated by reference).
  • Particularly preferred promoters are those that allow seed-specific expression. This may be especially useful since seeds are the primary source consumable protein and oil, and also since seed-specific expression will avoid any potential deleterious effect in non-seed tissues.
  • seed-specific promoters include, but are not limited to, the promoters of seed storage proteins, which can represent up to 90% of total seed protein in many plants.
  • the seed storage proteins are strictly regulated, being expressed almost exclusively in seeds in a highly tissue-specific and stage-specific manner (Higgins et al, (1984) Ann. Rev. Plant Physiol. 35:191-221; Goldberg et al, (1989) Cell 56:149-160).
  • different seed storage proteins may be expressed at different stages of seed development.
  • soybean lectin Okamuro et al, (1986) Proc. Natl. Acad. Sci. USA 83: 8240-8244
  • soybean Kunitz trypsin inhibitor Perez-Grau et al, (1989) Plant Cell 1: 095-1109
  • soybean b-conglycinin Beachy et al, (1985) EMBO J. 4: 3047-3053; pea vicilin (Higgins et al, (1988) Plant Mol. Biol. 11:683-695), pea convicilin (Newbigin et al, (1990) Planta 180:461-470), pea legumin (Shirsat et al, (1989) Mol. Gen.
  • rapeseed napin (Radke et al, (1988) Theor. Appl. Genet. 75:685-694) as well as genes from monocotyledonous plants such as for maize 15 kD zein (Hoffman et al, (1987) EMBO J. 6:3213-3221), maize 18 kD oleosin (Lee at al., (1991) Proc. Natl. Acad. Sci. USA 88:6181-6185), barley ⁇ -hordein (Marris et al, (1988) Plant Mol. Biol. 10:359-366) and wheat glutenin (Colot et al, (1987) EMBO J.
  • promoters of seed-specific genes operably linked to heterologous coding sequences in chimeric gene constructs also maintain their temporal and spatial expression pattern in transgenic plants.
  • Such examples include use of Arabidopsis thaliana 2S seed storage protein gene promoter to express enkephalin peptides in Arabidopsis and Brassica napus seeds (Vandekerckhove et al, (1989) Bio/Technology 7:929-932), bean lectin and bean ⁇ -phaseolin promoters to express luciferase (Riggs et al, (1989) Plant Sci. 63:47-57), and wheat glutenin promoters to express chloramphenicol acetyl transferase (Colot et al, (1987) EMBO J. 6:3559-3564).
  • any type of promoter such as constitutive, tissue-preferred or inducible promoters can be used to practice the invention.
  • constitutive promoters include the cauliflower mosaivirus (CaMV) 35S transcription initiation region, the 1′- or 2′- promoter derived from T-DNA of Agrobacterium tumefaciens, the ubiquitin 1 promoter, the Smas promoter, the cinnamyl alcohol dehydrogenase promoter (U.S. Pat. No. 5,683,439), the Nos promoter, the pEmu promoter, the rubisco promoter, the GRP1-8 promoter and other transcription initiation regions from various plant genes known to those of skill.
  • CaMV cauliflower mosaivirus
  • 1′- or 2′- promoter derived from T-DNA of Agrobacterium tumefaciens
  • the ubiquitin 1 promoter the Smas promoter
  • the cinnamyl alcohol dehydrogenase promoter U.S.
  • inducible promoters examples include the Adh1 promoter which is inducible by hypoxia or cold stress, the Hsp70 promoter which is inducible by heat stress, and the PPDK promoter which is inducible by light. Also useful are promoters that are chemically inducible.
  • promoters under developmental control include promoters that initiate transcription preferentially in certain tissues, such as leaves, roots, fruit, seeds, or flowers.
  • An exemplary promoter is the anther specific promoter 5126 (U.S. Pat. Nos. 5,689,049 and 5,689,051).
  • seed-specific promoters include, but are not limited to, 27 kD gamma zein promoter and waxy promoter, Boronat, A., Martinez, M. C., Reina, M., Puigdomenech, P.
  • Either heterologous or non-heterologous (i.e., endogenous) promoters can be used to practice the invention.
  • the promoter is then operably linked using conventional means well known to those skilled in the art to a DNA sequence which, when expressed by a host produces an RNA meeting certain criteria.
  • the host can be any organism, or cell thereof, into which the recombinant construct of this invention can be stably or transiently introduced in order to alter gene expression.
  • suitable hosts include, but are not limited to, a plant, animal, protozoan, bacterium, virus or fungus.
  • the plant may be a monocot, dicot or gymnosperm; the animal may be a vertebrate or invertebrate.
  • Preferred microbes are those used in agriculture or by industry. Fungi include organisms in both the mold and yeast morphologies.
  • Plants include Arabidopsis; field crops (e.g., alfalfa, barley, bean, corn, cotton, flax, pea, rape, rice, rye, safflower, sorghum, soybean, sunflower, tobacco, and wheat); vegetable crops (e.g., asparagus, beet, broccoli, cabbage, carrot, cauliflower, celery, cucumber, eggplant, lettuce, onion, pepper, potato, pumpkin, radish, spinach, squash, taro, tomato, and zucchini); fruit and nut crops (e.g., almond, apple, apricot, banana, blackberry, blueberry, cacao, cherry, coconut, cranberry, date, fajoa, filbert, grape, grapefruit, guava, kiwi, lemon, lime, mango, melon, nectarine, orange, papaya, passion fruit, peach, peanut, pear, pineapple, pistachio, plum, raspberry, strawberry, tangerine, walnut, and watermelon); etc.
  • field crops
  • Examples of human or non-human vertebrate animals include mammals, fish, cattle, goat, pig, sheep, rodent, hamster, mouse, rat, guinea pigs, rabbits, and primate; invertebrate animals include nematodes, other worms, Drosophila, and other insects. Representative orders of insects include Coleoptera, Diptera, Lepidoptera, and Homoptera.
  • the complementary RNA regions may comprise any of the following:
  • RNA region or regions which are unrelated to any endogenous RNA in the host may comprise a synthetic, non-naturally occurring RNA sequence.
  • these RNA region or regions optionally, may or may not comprise plant viral RNA.
  • any nucleic acid sequence in the genome of the host which encodes the complementary regions provided that said sequence does not encode the target mRNA or any sequence that is substantially similar to the target mRNA this sequence comprises transcribed or non-transcribed nucleic acid sequences which may be present in the genome of the host, i.e., this sequence may or may not be expressed by the host.
  • the complementary RNA regions described herein are in proximity to the target mRNA.
  • the term “in proximity” means that the complementary regions are operably linked 5′ to the target mRNA, or 3′ to the target mRNA, or within the target mRNA, or 5′ and 3′ to the target mRNA, i.e., the complementary regions or sequences can be found on either end of the target mRNA.
  • the complementary RNA regions can be any size that is suitable for altering the expression of the target mRNA.
  • the complementary sequences are preferred to be about 40-50 nucleotides in length, or more preferably 50-100 nucleotides in length, or most preferably greater than 100-300 nucleotides. These complementary sequences can be synthesized using conventional means well known to those skilled in the art.
  • this invention concerns a method for reducing expression of a target mRNA or any substantially similar endogenous mRNA which comprises:
  • the target mRNA may be any mRNA whose expression in the host is to be altered. Typically, it should share homology with the RNA produced by the host transformed with a recombinant construct of the invention. The expression of more than one target mRNA may be reduced provided that these targets share homology with the RNA produced by the host transformed with a recombinant construct of the invention.
  • this invention concerns a recombinant construct comprising an RNA in lieu of a DNA sequence.
  • this RNA comprises:
  • RNA when introduced into the host, reduces the expression of the target mRNA or any substantially similar endogenous mRNA.
  • this invention concerns a recombinant construct comprising an RNA in lieu of a DNA sequence in which the RNA comprises:
  • RNA when introduced into the host, reduces the expression of the target mRNA or any substantially similar endogenous mRNA.
  • RNA regions may comprise any of the following:
  • RNA region or regions which are unrelated to any endogenous RNA in the host may comprise a synthetic, non-naturally occurring RNA sequence.
  • these RNA region or regions optionally, may or may not comprise plant viral RNA.
  • any nucleic acid sequence in the genome of the host which encodes the complementary regions provided that said sequence does not encode the target mRNA or any sequence that is substantially similar to the target mRNA this sequence comprises transcribed or non-transcribed nucleic acid sequences which may be present in the genome of the host.
  • the complementary RNA regions described herein are in proximity to the target mRNA.
  • the term “in proximity” means that the complementary regions are operably linked 5′ to the target mRNA, or 3′ to the target mRNA, or within the target mRNAS, or 5′ and 3′ to the target mRNA, i.e., the complementary regions or sequences can be found on either end of the target mRNA.
  • RNAs can be used in a method for reducing expression of a target mRNA or any substantially similar endogenous mRNA which comprises:
  • the present invention concerns a method for identifying or screening an essential plant gene which comprises:
  • step (d) comparing the quantification of transformed plant cells selected from step (b) with the quantification of transformed plants cells selected from step (c) wherein the quantification of transformed plants cells selected from step (c) should substantially exceed the quantification of transformed plant cells selected from step (b).
  • Any essential plant gene can be identified or screened using the method of the invention.
  • An important aspect of this method is the use of a constitutive promoter and a recombinant construct capable of reducing expression of an essential plant gene with a high degree of frequency.
  • Constitutive promoters are defined above.
  • the constitutive promoter is a high level or strong constitutive promoter wherein expression of the gene under the control of the promoter results in production of high levels of mRNA.
  • any recombinant construct comprising a constitutive promoter which is capable of reducing expression of an essential plant gene with a high degree of frequency can be used to practice the invention.
  • the recombinant construct can be any of the recombinant constructs of the invention comprising a promoter operably linked to a DNA sequence provided that the promoter is a constitutive promoter.
  • the term high degree of frequency is defined above.
  • the number of plant cells transformed with a recombinant construct comprising a constitutive promoter wherein the recombinant construct is designed to reduce expression of an essential plant gene is quantified and compared to the number of plant cells transformed using a control in which expression of the essential plant gene is not reduced. If the number of plant cells transformed with the control substantially exceeds the number of plant cells transformed with the recombinant construct designed to reduce expression of an essential plant gene, then an essential plant gene has been identified/screened.
  • substantially exceeds it is meant at least a five-fold difference and, preferably, a ten-fold difference. Also preferred would be a 4-fold, 6-fold, 7-fold, 8-fold, 9-fold, or greater than a 10-fold difference.
  • the number of plant cells transformed with the control should be at least five-fold greater than the number of plant cells transformed with the recombinant construct designed to reduce expression of an essential plant gene.
  • Soybean embryogenic suspension cultures are maintained in 35 ml liquid media (SB55 or SBP6) on a rotary shaker, 150 rpm, at 28° C. with mixed fluorescent and incandescent lights on a 16:8 h day/night schedule. Cultures are subcultured every four weeks by inoculating approximately 35 mg of tissue into 35 ml of liquid medium.
  • Soybean embryogenic suspension cultures are transformed with pTC3 by the method of particle gun bombardment (Klein et al (1987) Nature 327:70).
  • a DuPont Biolistic PDS1000/HE instrument helium retrofit is used for these transformations.
  • Approximately 300-400 mg of a four week old suspension culture is placed in an empty 60 ⁇ 15 mm petri dish and the residual liquid removed from the tissue with a pipette. For each transformation experiment, approximately 5-10 plates of tissue are normally bombarded. Membrane rupture pressure is set at 1000 psi and the chamber is evacuated to a vacuum of 28 inches of mercury. The tissue is placed approximately 3.5 inches away from the retaining screen and bombarded three times. Following bombardment, the tissue is placed back into liquid and cultured as described above.
  • any detectable phenotype, resulting from the co-suppression of a target gene can be screened at this stage. This would include, but not be limited to, alterations in protein content, carbohydrate content, growth rate, viability, or the ability to develop normally into a soybean plant.
  • Transformation of plasmid DNA in Hi-II strains of maize follows the standard Hi-II bombardment transformation protocol (Songstad D. D. et al, (1996) In Vitro Cell Dev. Biol. Plant 32:179-183). Cells are transformed by culturing maize immature embryos (approximately 1-1.5 mm in length) onto 560P medium containing N6 salts, Erikkson's vitamins, 0.69 g/l proline, 2 mg/l 2,4-D and 3% sucrose.
  • embryos are removed from 560P medium and cultured, scutellum up, onto 560Y medium which is equivalent to 560P but contains 12% sucrose. Embryos are allowed to acclimate to this medium for 3 h prior to transformation.
  • the scutellar surface of the immature embryos is targeted using particle bombardment with either a mixture containing UBI:moPAT:pinII+UBI:GUS:pinII plasmids, or with a combination of these two plasmids plus any one of the constructs of the present invention
  • UBI is the ubiquitin-1 promoter, Christensen et al (1989) Plant Mol Bio 12:619-632; moPAT refers to a “monocot-optimized phosphinothricin acyltransferase” gene conferring resistance to the herbicide glufosinate ammonium, referenced in PCT Application No. WO 98/30701 published on Jul.
  • Embryos are transformed using the PDS-1000 Helium Gun from Bio-Rad at one shot per sample using 650PSI rupture disks. DNA delivered per shot averages about 0.1667 ug. An equal number of embryos per ear are bombarded with either the control DNA (PAT/GUS) or the mixture of control with any one of the constructs of the present invention.
  • High type II callus is maintained by subculturing onto fresh 560P medium every two weeks. Healthy callus is pushed through a 0.77 mm 2 nylon mesh and resuspended in MS culture medium with 2 mg/l 2,4-D at a density of 3 grams of tissue/40 ml medium. The cell suspension are then pipetted in 4 ml aliquots (each containing approximately 300 mg of cells) onto glass filter papers for bombardment using a vacuum apparatus. These filters are then placed on 560P medium and cultured in the dark at 26° C. After 2-4 days the filters are removed from the culture medium and excess liquid is removed using a vacuum apparatus.
  • Filters with cells are then shot (using the DuPont Biolistics PDS1000/He gun) according to established methods (see example above) using 1 ⁇ m gold particles and 650 psi rupture disks. Immediately after bombardment filters are returned to 560P culture medium and cultured in the dark at 26° C. All DNA's are adjusted to obtain a final concentration of 1 ⁇ g/total DNA/particle prep tube (6 shots). The typical experiment is shot as follows:
  • the Phenotype of Transgenic Soybean Somatic Embryos is Predictive of Seed Phenotypes from Resultant Regenerated Plants
  • Mature somatic soybean embryos are a good model for zygotic embryos. While in the globular embryo state in liquid culture, somatic soybean embryos contain very low amounts of triacylglycerol or storage proteins typical of maturing, zygotic soybean embryos. At this developmental stage, the ratio of total triacylglyceride to total polar lipid (phospholipids and glycolipid) is about 1:4, as is typical of zygotic soybean embryos at the developmental stage from which the somatic embryo culture was initiated. At the globular stage as well, the mRNAs for the prominent seed proteins, ⁇ ′ subunit of ⁇ -conglycinin, kunitz trypsin inhibitor 3, and seed lectin are essentially absent.
  • the model system is also predictive of the fatty acid composition of seeds from plants derived from transgenic embryos. This is illustrated with two different antisense constructs in two different types of experiment that were constructed following the protocols set forth in the PCT Publication Nos. WO 93/11245 and WO 94/11516. Liquid culture globular embryos were transformed with a chimeric gene comprising a soybean microsomal ⁇ 15 desaturase as described in PCT Publication No. WO 93/11245 which was published on Jun. 10, 1993, the disclosure of which is hereby incorporated by reference (experiment 1,) or a soybean microsomal ⁇ 12 desaturase as described in PCT Publication No.
  • One set of embryos from each line was analyzed for fatty acid content and another set of embryos from that same line was regenerated into plants.
  • Fatty acid analysis of single embryos was determined either by direct trans-esterification of individual seeds in 0.5 mL of methanolic H 2 SO 4 (2.5%) or by hexane extraction of bulk seed samples followed by transesterification of an aliquot in 0.8 mL of 1% sodium methoxide in methanol.
  • Fatty acid methyl esters were extracted from the methanolic solutions into hexane after the addition of an equal volume of water.
  • plants with both wild type and transgenic phenotypes may be regenerated from a single, transgenic line, even if most of the embryos analyzed from that line had a transgenic phenotype.
  • An example of this is shown in Table 4, in which, of 5 plants regenerated from a single embryo line, 3 have a high oleic phenotype and two were wild type. In most cases, all the plants regenerated from a single transgenic line will have seeds containing the transgene.
  • an altered fatty acid phenotype observed in a transgenic, mature somatic embryo line is predictive of an altered fatty acid composition of seeds of plants derived from that line.
  • nucleic acid sequences comprising the target regions or the complementary regions by conducting BLAST (Basic Local Alignment Search Tool; Altschul et al (1993) J. Mol. Biol. 215:403-410; see also www.ncbi.nlm.nih.gov/BLAST/) searches for sequences contained in the BLAST “nr” database (comprising all non-redundant GenBank CDS translations, sequences derived from the 3-dimensional structure Brookhaven Protein Data Bank, the last major release of the SWISS-PROT protein sequence database, EMBL, and DDBJ databases).
  • BLAST Basic Local Alignment Search Tool
  • the nucleic sequences are analyzed for similarity to all publicly available DNA sequences contained in the “nr” database using the BLASTN algorithm provided by the National Center for Biotechnology Information (NCBI).
  • the DNA sequences can also be translated in all reading frames and compared for similarity to all publicly available protein sequences contained in the “nr” database using the BLASTX algorithm (Gish and States (1993) Nat. Genet. 3:266-272) provided by the NCBI.
  • BLASTX Gish and States (1993) Nat. Genet. 3:266-272
  • the P-value (probability) of observing a match of a cDNA sequence to a sequence contained in the searched databases merely by chance as calculated by BLAST are reported herein as “pLog” values, which represent the negative of the logarithm of the reported P-value. Accordingly, the greater the pLog value, the greater the likelihood that the cDNA sequence and the BLAST “hit” represent homologous proteins.
  • Fad2-1 is a gene locus encoding a ⁇ -12 desaturase from soybean that introduces a double bond into the oleic acid side-chain to form a polyunsaturated fatty acid. Reduction in the expression of Fad2-1 results in the accumulation of oleic acid (18:1, or an 18 carbon fatty acid tail with a single double bond) and a corresponding decrease in polyunsaturated fatty acid content.
  • the antisense constructs have all, or a portion, of the Fad2-1 coding region in a reverse orientation behind a strong promoter. It is believed that expression of the “antisense” RNA interferes with normal translation of the homologous endogenous gene via a hybridization event.
  • the “classical” co-suppression construct have all, or a portion, of Fad2-1 in the normal sense orientation behind a strong promoter. It is believed that the expression of the “co-suppressing” RNA activates an uncharacterized mechanism that results in the partial, or total, elimination of the introduced RNA, as well as all RNAs having substantially similar sequences.
  • the CRC construct used contains a portion of the Fad2-1 coding region (300 bp) duplicated in the reverse complement orientation, forming a complementary region specific for Fad2-1.
  • Plasmid pKS18HH thus contains the T7 promoter/HPT/T7 terminator cassette for expression of the HPT enzyme in certain strains of E.
  • Plasmid pKS18HH also contains the 35S/HPT/NOS cassette for constitutive expression of the HPT enzyme in plants, such as soybean. These two expression systems allow selection for growth in the presence of hygromycin to be used as a means of identifying cells that contain the plasmid in both bacterial and plant systems. pKS18HH also contains three unique restiction endonuclease sites suitable for the cloning other chimeric genes into this vector. Plasmid ZBL100 (PCT Application No. WO 00/11176 published on Mar.
  • Plasmid pKS67 is a ZBL100 derivative with the insertion of a beta-conglycinin promoter, in front of a NotI cloning site, followed by a phaseolin 3′ terminator (described in PCT Application No. WO 94/11516, published on May 26, 1994).
  • PKS91 is a derivative of pKS67 with a polymerase chain reaction (PCR) hairpin fragment of the soybean Fad2 gene inserted into the Not I site.
  • the products of the three reactions (A)+(B)+(A/AS) are ligated together, digested with the restriction enzyme Not I, and the 1.3 kb fragment is cloned into the Not I site of KS67.
  • the plasmid pKS91 was used in the experiments presented in this section.
  • the 2.5 kb plasmid pKS17 contains pSP72 (obtained from Promega Biosystems) and the T7 promoter/HPT/T7 3′ terminator region, and is the original vector into which the 3.2 kb BamHI-SalI fragment containing the 35S/HPT/NOS cassette was cloned to form pKS18HH.
  • the plasmid pKS102 is a pKS17 derivative that is digested with XhoI and SalI, treated with mung-bean nuclease to generate blunt ends, and ligated to insert the following linker:
  • the plasmid pKS83 has the 2.3 kb BamHI fragment of ML70 containing the Kti3 promoter/NotI/Kti3 3′ terminator region (described in PCT Application No. WO 94/11516, published on May 26, 1994) ligated into the BamHI site of pKS17.
  • the plasmid pKS103 is a derivative of pKS83 with the 1.3 kb NotI fragment of pKS91 (containing the Fad2 complementary sequence) ligated into the NotI site.
  • Fad6 is a gene encoding ⁇ -12 desaturase found in plastids (as opposed to Fad2 which is found in the microsomal compartment). It was believed that suppression of Fad2 and Fad6 simultaneously might give a stronger, or different, phenotype than Fad2 suppression alone. However, it has since been determined that Fad6 does not produce a phenotype, therefore the phenotypes obtained from antisense experiments with both Fad2 and Fad6 only reflect changes in Fad2-1 content.
  • Target and Complementary Sequences can Both Co-suppress Their Endogenous Homologs
  • cer3 soybean eceriferum3 locus.
  • Cer3 encodes one of 21 gene products known to be involved in wax biosynthesis in Arabidopsis thaliana (Hannoufa et al (1996) Plant J 10:459-67). The inhibition of a single cer3 gene has no visible phenotype in soybean. Also, cer3 is involved in a biosynthetic pathway that has no known interactions with the fatty acid metabolic pathway containing Fad2 activity.
  • the plasmid pKS100 is a derivative of pKS67.
  • PCR reactions are run with the following primers (5′-3′ orientations) and cer3 DNA: PCR(A + B) GAATTCGCGGCCGCGGCACGAGATTTGAGG SEQ ID NO:8 TTGCCCAATGTTTATGCATATGTAGAACTG SEQ ID NO:9 PCR(A/AS) CAGTTCTACATATGCATAAACATTGGGCAA SEQ ID NO:10 GAATTCGCGGCCGCGGCACGAGATTTGAGG SEQ ID NO:11
  • the plasmids pKS106, pKS124, and pKS133 exemplify this.
  • antibiotic selection genes such as, but not limited to, hygromycin phosphotransferase with promoters such as the T7 inducible promoter.
  • pKS106 uses the beta-conglycinin promoter while the pKS124 and 133 plasmids use the Kti promoter, both of these promoters exhibit strong tissue specific expression in the seeds of soybean.
  • pKS106 uses a 3′ termination region from the phaseolin gene, and pKS124 and 133 use a Kti 3′ termination region.
  • pKS106 and 124 have single copies of the 36 nucleotide EagI-ELVISLIVES sequence surrounding a NotI site (the amino acids given in parentheses are back-translated from the complementary strand): SEQ ID NO:12.
  • pKS133 has 2 ⁇ copies of ELVISLIVES surrounding the NotI site: SEQ ID NO:13 EagI E L V I S L I V E S EagI E L V I S SEQ ID NO:13 cggccggagctggtcatctcgctcatcgtcgagtcg gcggccg gagctggtcatctcg L I V E S NotI (S) (E (V) (I) (L) (S) (I) (V) (L) (E) EagI ctcatcgtcgagtcg gcggccgc cgactcgacgatgagcgagatgaccagctc cggccgc (S) (E) (V) (I) (L) (S) (I) (V) (L) (E) EagI cgactcgacgatgagcgagatgaccagctc c
  • SCR single EL linker
  • a series of vectors will cover the SCR lengths between 40 bp and the 300 bp.
  • target gene lengths are also under evaluation. It is believed that certain combinations of target lengths and complementary region lengths will give optimum suppression of the target, although preliminary results would indicate that the suppression phenomenon works well over a wide range of sizes and sequences. It is also believed that the lengths and ratios providing optimum suppression may vary somewhat given different target sequences and/or complementary regions.
  • the plasmid pKS106 is made by putting the EagI fragment of ELVISLIVES (SEQ ID NO:12) into the NotI site of pKS67.
  • the ELVISLIVES fragment is made by PCR using two primers and no other DNA: 5′-GAATTCCGGCCGGAGCTGGTCATCTCGCTCATCGTCGAGTCGGCGGCCGCC SEQ ID NO:14 GACTCGACGATGAGCGAGATGACCAGCTCCGGCCGGAATTC-3′ 5′-GAATTCCGGCCGGAG-3′ SEQ ID NO:15
  • the product of the PCR reaction is digested with EagI (5′-CGGCCG-3′) and then ligated into NotI digested pKS67.
  • the pKS111 is made by inserting a 599 nucleotide fragment from the delta-12 desaturase gene (Fad2, nucleotides 399-997), in an antisense orientation into the NotI site of pKS106.
  • the Fad2 fragment is made by PCR using the following primers and Fad2 DNA as a template:
  • the PCR product is digested with NotI (5′-GCGGCCGC-3′) and ligated into NotI digested pKS106.
  • the total length of complementary sequence is 47 nucleotides (with the 8 nucleotides from the NotI site and 3 additional flanking bases).
  • Co-suppression of Fad2 results in a decrease in the production of polyunsaturated fatty acids, and a corresponding increase in the accumulation of oleic acid (18:1) in soybeans. (see Example 3 above).
  • Oleic acid concentrations in 18 of the 22 lines transformed with pKS111 were 2-5 times that found for the vector only controls, indicating co-suppression in 82% of the recovered transgenic plants.
  • pKS121 contains the Kti3 promoter/NotI/Kti3 3′ terminator fragment analogous to pKS83 inserted into the BamHI-SalI digested pKS102.
  • the EagI digested ELVISLIVES cloning site made from SEQ ID NOs:14 and 15 is inserted into the NotI site of pKS121 to form pKS124.
  • the Fad2 fragment from pKS111 is ligated into NotI digested pKS124 to form pKS132.
  • the EagI digested EL PCR product can be ligated into NotI digested pKS124 to form the 2 ⁇ EL pKS133.
  • An additional 2 ⁇ EL vector, pKS151 is similar to pKS133 except for the addition of a second hygromycin phosphotransferase gene with a 35S-CaMV promoter. Any synthetic sequence, or naturally occurring sequence, can be used in an analogous manner.
  • the addition of the 599 bp soybean Fad2 fragment from pKS111 into a NotI digested pKS133 produces pKS136.
  • the length of the target was tested to determine the effect on the efficiency of suppression in an EL construct.
  • PCR reactions were performed using the primers shown in Table 7 to create 25, 50, 75, 150, 300, and 600 fragments of Fad2 to place between 2 ⁇ EL complementary regions.
  • the PCR products were cut with Not I and ligated into pBluescript and the sequence of the fragments was verified. Not I digested fragments were then ligated into the NotI of pKS151.
  • a construct was assembled to test whether multiple target sequences can be used between EL complementary sequences to achieve simultaneous suppression.
  • a 969 bp fragment from a soybean delta-9 desaturase was inserted into pKS136 next to the 599 bp Fad2 fragment to form pBS68. Both desaturase fragments were flanked by 2 ⁇ EL complementary regions (2 ⁇ EL-Fad2-Delta 9-2 ⁇ EL the sequence of which is shown in SEQ ID NO:24).
  • Delta-9 desaturase catalyzes the double-bond at the 9-position of 18-carbon fatty acids to form oleic acid (18:1) from stearic acid (18:0), analogous to the delta-12 Fad2 which catalyzes the 12-position double bond that converts oleic acid to linoleic acid (18:2).
  • Suppression of the unique Fad2 gene results in an accumulation of oleic acid at the expense of polyunsaturated fatty acids.
  • Suppression of delta-9 desaturases results in an accumulation of stearic acid at the expense of all unsaturated fatty acids.
  • there are several delta-9 desaturases in soybean (at least three) so it is unclear how the suppression of one member would affect oil composition. Transformation protocols and oil composition analyses were performed as previously outlined in Examples 1 and 3, respectively.
  • Transformation of soybean with pBS68 resulted in 113 hygromycin resistant lines. Of these 72 showed some oil phenotype (64%). The phenotypes of the 72 suppressed lines were: 18 were high stearate, 23 were high oleate, and 31 were both high oleate and high stearate. Therefore, multiple targets can be efficiently suppressed by a single EL construct.
  • Raffinose saccharides are a group of D-galactose-containing oligosaccharide derivatives of sucrose that are widely distributed in plants.
  • raffinose saccharides are an obstacle to the efficient utilization of some economically-important crop species.
  • Raffinose saccharides are not digested directly by animals, primarily because alpha-galactosidase is not present in the intestinal mucosa [Gitzelmann et al (1965) Pediatrics 36:231-236; Rutloffet al (1967) Agriculture 11:39-46].
  • microflora in the lower gut are readily able to ferment the raffinose saccharides resulting in an acidification of the gut and production of carbon dioxide, methane and hydrogen gases [Murphy et al (1972) J. Agr. Food. Chem.
  • galactinol synthase genes already known in the art include sequences disclosed in U.S. Pat. Nos. 5,773,699 and 5,648,210, Kerr et al, “Nucleotide Sequences of Galactinol Synthase from Zucchini and Soybean” and Sprenger and Keller (2000) Plant J 21:249-258. Presumably related sequences are also disclosed in PCT Publication No. WO 98/50553, Lightner, “Corn Glycogenin”. Two genes encoding soybean galactinol synthases have been previously identified (SEQ ID NOs:30 and 32, with the predicted translation products shown in SEQ ID NOs:31 and 33; presented in U.S. Pat No.
  • a plasmid construct was assembled containing fragments of two galactinol synthase soybean genes Gas1 (390 bp from 13-402 of SEQ ID NO:30) and Gas2 (399 bp, from 129-527 of SEQ ID NO:32) cloned in the NotI site of a 2 ⁇ EL cassette.
  • the promoter region was a late embryo promoter (Lea) from soybean.
  • the Lea promoter (Lee et al (1992) Plant Physiol 100:2121-2122; Genbank Accession No. M97285) was amplified from genomic A2872 soybean DNA with the following primers:
  • phaseolin 3′-end (amplified with primers shown in SEQ ID NOs:27 and 28) was added.
  • the entire Lea promoter-2 ⁇ EL-Gas1-Gas2-2 ⁇ EL -phaseolin 3′-end cassette was then cloned into the BamHI site of pKS136 to create the pKS149 vector (the sequence of the complete EL region of pKS149 is shown in SEQ ID NO:29).
  • pKS136 will inhibit both Fad2 (controlled by the Kti promoter) and Gas genes (controlled by the Lea promoter). Since the Kti promoter is active in embryos, it is possible to screen the embryos for high oleic phenotype, as described in the previous examples. Of the 119 lines isolated as hygromycin resistant 65% were found to have a high oleic phenotype.
  • These suppressed lines should also contain the Gas suppression cassette, allowing for the assay of raffinose sugars in the seedlings (Lea is not active during the early embryo stage).
  • Raffinose sugars galactinol, raffinose, stachyose, etc.
  • Plant samples are extracted with hexane then dried. The dried material is then resuspended in 80% methanol, incubated at room temperature for 1-2 hours, centrifuged, and 1-2 microliters of the supernatant is spotted onto a TLC plate (Kieselgel 60 CF, from EM Scientific, Gibbstown, N.J.; catalog no. 13749-6).
  • the TLC is run in ethylacetate:isopropanol:20% acetic acid (3:4:4) for 1-1.5 hours.
  • the air dried plates are sprayed with 2% sulfuric acid and heated until the charred sugars are detected.
  • the two lines labeled GAS-EL show reduced levels of raffinose sugars (lowest band) when compared to a control known to have very low raffinose sugars (Low 4). It is estimated that there is a 60% reduction of raffinose sugars in these lines when compared to wild-type soybean.
  • Acetolactate synthase also known as acetohydroxyacid synthase (AHAS)
  • AHAS acetohydroxyacid synthase
  • essential plant genes refers to genes encoding a product that is required for normal plant growth, development, and/or viability.
  • examples of essential plant genes would include, but not be limited to, rate-limiting enzymes in amino acid, nucleic acid, or lipid biosynthesis. It is also believed that many genes with unknown function may be essential.
  • KS161 the EL linker (SEQ ID NO:12) was cloned into the NotI site of pKS50 to produce pKS137 (a single EL complementary region with a 1 kb 35S CaMV promoter and a 700 bp nos 3′-end on a plasmid with 2 HPT genes one with a T7 promoter and the second with a 35S promoter).
  • pKS137 a single EL complementary region with a 1 kb 35S CaMV promoter and a 700 bp nos 3′-end on a plasmid with 2 HPT genes one with a T7 promoter and the second with a 35S promoter.
  • a 208 bp Hind III/EcoR I fragment from a soybean ALS gene (SEQ ID NO:35, fragment is from position 891-1114) was then cloned into the Hind III/EcoR I sites of pKS137 to produce pKS161.
  • KS163 To make pKS163 the EL linker (SEQ ID NO:12) was cloned into the NotI site of pKS127 to produce KS139 (a single EL complementary region with the Lea promoter and the phaseolin 3′-end from Example 10 on a plasmid with 2 HPT genes one with a T7 promoter and the second with a 35S promoter).
  • the 208 bp Hind III/EcoR I fragment from soybean ALS gene SEQ ID NO:35, the HindIII/EcoRI fragment is from position 896-1103) was then cloned into the Hind III/EcoR I sites of KS139 to produce KS 163.
  • KS161 and KS 163 were transformed into 821 tissue (Example 1).
  • the transformation efficiency for this tissue is normally in the range of 200-500 clones/gram of tissue.
  • the results of two separate transformation experiments with KS161 and KS163, 4 weeks after bombardment and transfer to hygromycin-containing medium are:
  • KS161 35S ALS EL 16 clones/gram tissue
  • KS163 (LEA ALS EL) 247 clones/gram tissue
  • KS161 35S ALS EL 43 clones/gram tissue
  • KS163 (LEA ALS EL) 467 clones/gram tissue
  • a typical screen consists of bombarding tissue with KS137 and KS139 as empty-vector controls, KS161 as a positive (ALS) control and various gene fragments, amplified by PCR to contain Hind III and EcoR I sites, cloned into the HindIII/EcoRI sites of KS137 and KS139.
  • the improved frequency of suppression achieved with the EL constructs allows for the possibility of a reliable screening method.
  • a significant percentage of the hygromycin recovered transformation events must be suppressed by the target sequence contained within pKS137 or pKS139 in order for there to be a statistically definitive difference between the two experiments.
  • the term “high degree of frequency” as used herein, with respect to the suppression efficiency, refers to the percentage of transformed lines that exhibit the target suppressed phenotype. High frequency percentages are expected to be in a range of at least 15-95% and any integer percentage found within the range. Preferred embodiments would include at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70 %,75%, 80%, 85%, 90%, and 95%.
  • Cellulose synthase genes encode a family of proteins involved in cellulose formation in plants (Pear, et al, Proc. Natl. Acad. Sci. (USA) 93, 12637-12642; Saxena, et al, (1990), Plant Molecular Biology 15, 673-684).
  • Several maize genes encoding cellulose synthases (cesA) have been recently cloned and characterized (PCT Publication No. WO 00/09706, published on Feb. 24, 2000). Fragments from four of these genes, cesA1, cesA4, cesA5, and cesA8, were used to test whether 1 ⁇ EL could direct the suppression of these genes in maize.
  • Results from maize transformation experiments with each of the constructs are shown in Table 9. Twenty-five lines were isolated for each of the four cesA gene constructs and 18 lines were isolated for the control. The height of the plants and stalk diameter were on average smaller in the lines containing the suppression constructs than in the control. Ear heights were shorter in the cesA1 and cesA5 containing lines. The average cellulose percentage of total dry matter is normally 46% in control plants. All of the cesA constructs had lines that were below 46% cellulose with cesA1>cesA5>cesA8>cesA4. The lines that exhibited low cellulose percentages were tested by DNA Southern blot analyses to determine which contained a single-copy transgene insertion.
  • All expression cassettes used in this example comprise a maize ubiquitin promoter (nt 1-899), a maize ubiquitin 5′ untranslated leader sequence (nt 900-982) and a maize ubiquitin intron 1 (nt 983-1992).
  • plasmid PHP7921 the coding sequence (nt 2015-2731) is GFP (green fluorescent protein) with codons optimized for expression in maize.
  • GFP green fluorescent protein
  • the coding sequence nt 2013-3821
  • Both cassettes include the polyadenylation signal sequences from the proteinase inhibitor II gene of S. tuberosum (PINII TERM, nt 2737-3047 in PHP7921 and nt 3883-4192 in PHP3953).
  • Plasmid PHP7921 was used to create a complementary region (CR) of a small portion of the GFP coding sequence as follows: plasmid DNA was digested with XhoI and treated with the Klenow fragment of DNA polymerase I to release a 244 bp blunt-ended fragment representing nt 2436-2675 near the 3′ end of the GFP coding sequence. This fragment was then inserted back into PHP7921 at the HpaI site (nt 2735) just downstream of the stop codon of GFP. A recombinant plasmid was identified that had the inserted fragment in the reverse orientation relative to the original sequence. This plasmid was designated PHP16391.
  • Expression cassettes for GUS containing a heterologous GFP-CR were constructed as follows: the entire GFP-CR of PHP16391 was isolated as a BsrGI fragment (nt 2464-2947, 483 bp). This fragment comprises sequences capable of forming a CR with a 214 bp stem and a 55 nt loop. The fragment was rendered blunt-ended as above using Klenow and inserted into the GUS expression cassette of PHP3953 at three different sites. Plasmid PHP16561 has the GFP-CR inserted in the BamHI site (filled in) of PHP3953 (nt 2006), just 5′ to the start codon.
  • Plasmid PHP16562 has the GFP-CR inserted in the PacI site (T4 polymerase-treated to render blunt) at nt 3919 of PHP3953 just 3′ to the stop codon. Similarly, plasmid PHP16563 has the GFP-CR inserted in the SnaBI site at nt 2398 of PHP3953 within the GUS coding sequence.
  • High type II callus was maintained by subculturing onto fresh 560P (N6 salts, Erikkson's vitamins, 0.69 g/l proline, 2 mg/l 2,4-D and 3% sucrose) medium every two weeks. Healthy callus was extruded through a 0.77 mm 2 nylon mesh, weighed, and resuspended in MS culture medium with 2 mg/l 2,4-D at a density of 3 grams of tissue/40 ml medium. Cells were uniformly suspended by pipetting the solution up-and-down through a large-bore pipette, and 4 ml aliquots (300 mg) were then collected on glass filter papers using a vacuum apparatus.
  • 560P N6 salts, Erikkson's vitamins, 0.69 g/l proline, 2 mg/l 2,4-D and 3% sucrose
  • the plates within a treatment were grouped into 5 pairs (each pair containing plates shot with different DNA preparations for the same plasmid treatment).
  • Two days after bombardment all the tissue from the two paired plates was combined and resuspended in 5 ml of culture medium. After mixing with a wide-bore pipette, a 1 ml aliquot was transferred into a 1.5 ml Eppendorf tube. The cells were centrifuged at 1000 RPMs for 2 minutes in a microfuge and the supernatant (culture medium) decanted.
  • GUS enzyme activity was determined as a rate measurement between 10 and 40 minutes after adding substrates, and data was expressed as pmol MU/min/ml/extract (slope).
  • Fluorometric GUS assays were performed on a LabSystems FLUOROSKAN Ascent FL according to the protocol of Rao and Flynn (Biotechniques 1990 8:38-40. Fluorometric analysis of luciferase activity collected using an Analytical Luminescence Laboratory Monolight 2010, following the manufacturer's instructions and the Promega protocol. Assessing both markers for each replicate provided an internal control (luciferase) against which relative GUS activity could be rated.
  • An additional suppression construct was created using a 205 bp HindIII-BstEII fragment from the soybean Kti promoter as the complementary region surrounding a multiple cloning site. Two copies of the Kti fragment were ligated in an inverted repeat arrangement and subsequently modified by PCR to remove inconvenient restriction sites and add cloning sites at both ends and in the region between the two complementary sequences to form the SHH3 cassette (see SEQ ID NO:34). The resulting plasmid (PHP17962) was used as a source of the SHH3 sequence.
  • the Kti sequence is not normally found in the maize genome, therefore no suppression of endogenous maize genes is expected from the SHH3 region alone. However, when a portion of an endogenous target sequence is inserted into the cloning sites between the complementary Kti sequences, the homologous endogenous gene transcript should be affected.
  • a 1385 bp NheI fragment representing about 80% of the coding sequence of the phytoene desaturase gene (PDS-1) of Z. mays (Pioneer EST cnlcz91R, Genbank Accession No. L39266) was treated with Klenow enzyme as previously described to render the ends blunt and then ligated into the EcoRV site of SHH3 to generate PHP17894.
  • the SHH3-PDS fragment was then moved as a 1865 bp HpaI fragment into an intermediate vector construct to place it under the control of the ubiquitin promoter: ubiquitin intron1 (U.S. Pat. No.
  • the engineered Agrobacterium tumefaciens LBA4404 was constructed as per U.S. Pat. No. 5,591,616 to contain the PDS gene suppressed by the complementary region shown in SEQ ID NO:34 and a selectable marker gene.
  • a selectable marker gene typically either BAR (D'Halluin et al (1992) Methods Enzymol. 216:415-426) or PAT (Wohlleben et al (1988) Gene 70:25-37) may be used as a selectable marker.
  • a master plate of single bacterial colonies was first prepared by inoculating the bacteria on minimal AB medium
  • minimal AB medium contains the following ingredients: 850.000 ml of deionized water; 50.000 ml of stock solution 800A; 9 g of Phytagar which is added after Q.S. to volume; 50.000 ml of stock solution 800B #; 5.000 g of glucose #; and 2.000 ml of spectinomycin 50/mg/ml stock #.
  • Directions are: dissolve ingredients in polished deionized water in sequence; Q.S. to volume with polished deionized water less 100 ml per liter; sterilize and cool to 60° C.
  • Stock solution 800A contains the following ingredients: 950.000 ml of deionized water; 60.000 g of potassium phosphate dibasic K2HPO4; and 20.000 g of sodium phos. monobasic, hydrous. Directions are: dissolve ingredients in polished deionized water in sequence; adjust pH to 7.0 with potassium hydroxide; Q.S. to volume with polished deionized water after adjusting pH; and sterilize and cool to 60° C.
  • Stock solution 800B contains the following ingredients: 950.000 ml of deionized water; 20.000 g of ammonium chloride; 6.000 g of magnesium sulfate 7-H2O, MgSO4, 7H2O; 3.000 g of potassium chloride; 0.200 g of calcium chloride (anhydrate); and 0.050 g of ferrous sulfate 7-hydrate.
  • Directions are: dissolve ingredients in polished deionized water in sequence; Q.S. to volume with polished deionized water; and sterilize and cool to 60° C.] and then incubating the bacteria plate inverted at 28° C. in darkness for about 3 days.
  • a working plate was then prepared by selecting a single colony from the plate of minimal A medium
  • minimal A medium contains the following ingredients: 950.000 ml of deionized water; 10.500 g of potassium phosphate dibasic K2HPO4; 4.500 g of potassium phosphate monobasic KH2PO4; 1.000 g of ammonium sulfate; 0.500 g of sodium citrate dihydrate; 10.000 ml of sucrose 20% solution #; and 1.000 ml of 1M magnesium sulfate #.
  • Directions are: dissolve ingredients in polished deionized water in sequence; Q.S. to volume with deionized water; sterilize and cool to 60° C.
  • YP medium contains the following ingredients: 950.000 ml of deionized water; 5.000 g of yeast extract (Difco); 10.000 g of peptone (Difco); 5.000 g of sodium chloride; 15.000 g of bacto-agar, which is added after Q.S. to volume; and 1.000 ml of spectinomycin 50 mg/ml stock #.
  • Directions are: dissolve ingredients in polished deionized water in sequence; adjust pH to 6.8 with potassium hydroxide; Q.S. to volume with polished deionized water after adjusting pH; sterilize and cool to 60° C.
  • Ingredients designated with a # are added after sterilizing and cooling to temperature].
  • the YP-medium bacterial plate was then incubated inverted at 28° C. in darkness for 1-2 days.
  • Agrobacterium for plant transfection and co-cultivation was prepared 1 day prior to transformation. Into 30 ml of minimal A medium in a flask was placed 50 ⁇ g/ml spectinomycin, 100 ⁇ M acetosyringone, and about a 1/8 loopful of Agrobacterium from a 1 to 2-day-old working plate. The Agrobacterium was then grown at 28° C. at 200 rpm in darkness overnight (about 14 hours). In mid-log phase, the Agrobacterium was harvested and resuspended at 3 to 5 ⁇ 10 8 CFU/ml in 561Q medium+100 ⁇ M acetosyringone using standard microbial techniques and standard curves.
  • medium 561 Q contains the following ingredients: 950.000 ml of D-I Water, Filtered; 4.000 g of Chu (N6) Basal Salts (Sigma C-1416); 1.000 ml of Eriksson's Vitamin Mix (1000 ⁇ Sigma-1511); 1.250 ml of Thiamine.HCL.4 mg/ml; 3.000 ml of 2, 4-D 0.5 mg/ml (No. 2A); 0.690 g of L-proline; 68.500 g of Sucrose; and 36.000 g of Glucose.
  • Directions are: dissolve ingredients in polished deionized water in sequence; adjust pH to 5.2 w/KOH; Q.S. to volume with polished deionized water after adjusting pH; and filter sterilize (do not autoclave)].
  • Holding solution was decanted from excised immature embryos and replaced with prepared Agrobacterium. Following gentle mixing and incubation for about 5 minutes, the Agrobacterium was decanted from the immature embryos. Immature embryos were then moved to a plate of 562P medium [medium 562 P contains the following ingredients: 950.000 ml of D-I Water, Filtered; 4.000 g of Chu (N6) Basal Salts (Sigma C-1416); 1.000 ml of Eriksson's Vitamin Mix (1000 ⁇ Sigma-1511); 1.250 ml of Thiamine.HCL.4 mg/ml; 4.000 ml of 2, 4-D 0.5 mg/ml; 0.690 g of L-proline; 30.000 g of Sucrose; 3.000 g of Gelrite, which is added after Q.S.
  • medium 562 P contains the following ingredients: 950.000 ml of D-I Water, Filtered; 4.000 g of Chu (N6) Basal Salts (Sigma C-1416); 1.000
  • 563O medium contains the following ingredients: 950.000 ml of D-I Water, Filtered; 4.000 g of Chu (N6) Basal Salts (Sigma C-1416); 1.000 ml of Eriksson's Vitamin Mix (1000 ⁇ Sigma-1511); 1.250 ml of Thiamine.HCL.4 mg/ml; 30.000 g of Sucrose; 3.000 ml of 2, 4-D 0.5 mg/ml (No. 2A); 0.690 g of L-proline; 0.500 g of Mes Buffer; 8.000 g of Agar (Sigma A-7049, Purified), which is added after Q.S.
  • the transforming DNA possesses a herbicide-resistance gene, in this example the BAR gene, which confers resistance to bialaphos. At 10 to 14-day intervals, embryos were transferred to 5630 medium. Actively growing putative transgenic embryogenic tissue were visible in 6-8 weeks.
  • Transgenic embryogenic tissue is transferred to 288W medium
  • medium 288 W contains the following ingredients: 950.000 ml of D-I H 2 O; 4.300 g of MS Salts; 0.100 g of Myo-Inositol; 5.000 ml of MS Vitamins Stock Solution (No. 36J); 1.000 ml of Zeatin.5 mg/ml; 60.000 g of Sucrose; 8.000 g of Agar (Sigma A-7049, Purified), which is added after Q.S.
  • medium 272 contains the following ingredients: 950.000 ml of deionized water; 4.300 g of MS Salts; 0.100 g of Myo-Inositol; 5.000 of MS Vitamins Stock Solution; 40.000 g of Sucrose; and 1.500 g of Gelrite, which is added after Q.S. to volume.
  • Directions are: dissolve ingredients in polished deionized water in sequence; adjust to pH 5.6; Q.S. to volume with polished deionized water after adjusting pH; and sterilize and cool to 60° C.] and incubated at 28° C. in the light. After shoots and roots emerge, individual plants are potted in soil and hardened-off using typical horticultural methods. Plants are then evaluated for the PDS-silenced phenotype.
  • Phytoene desaturase catalyzes a rate-limiting step in the biosynthesis of carotenoids in plants (Misawa, et al The Plant Journal (1993) 4(5):833-840). It is a known target of bleaching herbicides such as norflurazon. Cosuppression of the endogenous phytoene desaturase by the introduced SHH3-flanked PDS1 gives a similar bleached phenotype when young plants are incubated in the light (Thomas, et al (2001) The Plant Journal 25(4):417-425; Kumagi et al (1995) PNAS USA 92:1679-1683; Ruiz et al (1998) Plant Cell 10:937-946).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Nutrition Science (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
US09/887,194 2000-06-23 2001-06-22 Recombinant constructs and their use in reducing gene expression Abandoned US20030036197A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US09/887,194 US20030036197A1 (en) 2000-06-23 2001-06-22 Recombinant constructs and their use in reducing gene expression
US11/476,510 US7456014B2 (en) 2000-06-23 2006-06-28 Recombinant constructs and their use in reducing gene expression
US12/256,721 US7897383B2 (en) 2000-06-23 2008-10-23 Recombinant constructs and their use in reducing gene expression

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US21396100P 2000-06-23 2000-06-23
US09/887,194 US20030036197A1 (en) 2000-06-23 2001-06-22 Recombinant constructs and their use in reducing gene expression

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/476,510 Continuation US7456014B2 (en) 2000-06-23 2006-06-28 Recombinant constructs and their use in reducing gene expression

Publications (1)

Publication Number Publication Date
US20030036197A1 true US20030036197A1 (en) 2003-02-20

Family

ID=22797209

Family Applications (3)

Application Number Title Priority Date Filing Date
US09/887,194 Abandoned US20030036197A1 (en) 2000-06-23 2001-06-22 Recombinant constructs and their use in reducing gene expression
US11/476,510 Expired - Fee Related US7456014B2 (en) 2000-06-23 2006-06-28 Recombinant constructs and their use in reducing gene expression
US12/256,721 Expired - Fee Related US7897383B2 (en) 2000-06-23 2008-10-23 Recombinant constructs and their use in reducing gene expression

Family Applications After (2)

Application Number Title Priority Date Filing Date
US11/476,510 Expired - Fee Related US7456014B2 (en) 2000-06-23 2006-06-28 Recombinant constructs and their use in reducing gene expression
US12/256,721 Expired - Fee Related US7897383B2 (en) 2000-06-23 2008-10-23 Recombinant constructs and their use in reducing gene expression

Country Status (11)

Country Link
US (3) US20030036197A1 (https=)
EP (1) EP1297163B1 (https=)
JP (1) JP2004512020A (https=)
AT (1) ATE507300T1 (https=)
AU (1) AU2001272977A1 (https=)
BR (1) BR0111839A (https=)
CA (1) CA2408326A1 (https=)
DE (1) DE60144517D1 (https=)
HU (1) HUP0302320A3 (https=)
MX (1) MXPA02012733A (https=)
WO (1) WO2002000904A2 (https=)

Cited By (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020114784A1 (en) * 1999-01-28 2002-08-22 Medical College Of Georgia Research Institute, Inc. Composition and method for in vivo and in vitro attenuation of gene expression using double stranded RNA
US20030056235A1 (en) * 1997-12-23 2003-03-20 The Carnegie Institution Of Washington Genetic inhibition by double-stranded RNA
US20030159161A1 (en) * 1998-03-20 2003-08-21 Graham Michael Wayne Synthetic genes and genetic constructs comprising same I
US20030175783A1 (en) * 2002-03-14 2003-09-18 Peter Waterhouse Methods and means for monitoring and modulating gene silencing
US20030182672A1 (en) * 2000-03-17 2003-09-25 Graham Michael Wayne Genetic silencing
US20040152117A1 (en) * 2001-01-31 2004-08-05 Tony Giordano Use of post-transcriptional gene silencing for identifying nucleic acid sequences that modulate the function of a cell
EP1445321A1 (en) 2002-12-18 2004-08-11 Monsanto Technology LLC Maize embryo-specific promoter compositions and methods for use thereof
US20040198690A1 (en) * 1999-04-21 2004-10-07 Wyeth Methods and compositions for inhibiting the function of polynucleotide sequences
US20050059044A1 (en) * 2003-06-03 2005-03-17 Graham Michael Wayne Double-stranded nucleic acid
US20050176670A1 (en) * 2004-02-10 2005-08-11 Shihshieh Huang Recombinant DNA for gene suppression
WO2005077116A2 (en) 2004-02-10 2005-08-25 Mosanto Technology, Llc Recombinant dna for gene suppression
US20050278807A1 (en) * 2000-04-11 2005-12-15 Allen Stephen M Plant raffinose saccharide biosynthetic enzymes
US20060014715A1 (en) * 1998-03-20 2006-01-19 Benitec Australia Limited Control of gene expression
EP1621632A1 (en) 2004-07-31 2006-02-01 Monsanto Technology, LLC Genes and uses for plant improvement
US20060041957A1 (en) * 2004-06-09 2006-02-23 Mcgonigle Brian Recombinant constructs for use in reducing gene expression
US20060064772A1 (en) * 2004-02-10 2006-03-23 Kriz Alan L Maize seed with synergistically enhanced lysine content
US20060075515A1 (en) * 2004-08-11 2006-04-06 Luethy Michael H Enhanced zein reduction in transgenic corn seed
WO2006133983A1 (en) 2005-04-19 2006-12-21 Basf Plant Science Gmbh Starchy-endosperm and/or germinating embryo-specific expression in mono-cotyledonous plants
US20070219151A1 (en) * 1999-04-21 2007-09-20 Wyeth Methods and compositions for inhibiting the function of polynucleotide sequences
WO2008099013A1 (en) 2007-02-16 2008-08-21 Basf Plant Science Gmbh Nucleic acid sequences for regulation of embryo-specific expression in monocotyledonous plants
US7422853B1 (en) 2002-10-04 2008-09-09 Myriad Genetics, Inc. RNA interference using a universal target
US20080262408A1 (en) * 2005-03-11 2008-10-23 Martin Krauss Multi-Constituent Packaging with Applicator
EP2116606A1 (en) 2003-03-28 2009-11-11 Monsanto Technology, LLC Novel plant promoters for use in early seed development
EP2292773A1 (en) 2004-03-25 2011-03-09 Monsanto Technology LLC Genes and uses for plant improvement
US20110113514A1 (en) * 2005-10-03 2011-05-12 Malvar Thomas M Transgenic plant seed with increased lysine
US8183217B2 (en) 1999-08-13 2012-05-22 Commonwealth Scientific And Industrial Research Organisation Methods and means for obtaining modified phenotypes
EP2489726A2 (en) 2005-01-12 2012-08-22 Monsanto Technology LLC Genes and uses for plant improvement
WO2015066768A1 (en) 2013-11-07 2015-05-14 Ozgene Holdings Pty Ltd Compositions and methods for producing genetically modified animals

Families Citing this family (144)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10106586B2 (en) 2000-08-07 2018-10-23 Ceres, Inc. Sequence-determined DNA fragments encoding peptide transport proteins
US9085771B2 (en) 2001-01-03 2015-07-21 Ceres, Inc. Sequence-determined DNA fragments with regulatory functions
EP1311659B1 (en) * 2000-08-22 2006-03-08 E. I. du Pont de Nemours and Company Nucleotide sequences of a new class of diverged delta-9 stearoyl-acp desaturase genes
US9024004B2 (en) * 2000-08-31 2015-05-05 Ceres, Inc. Sequence-determined DNA fragments encoding acetohydroxyacid synthase proteins
CA2478904A1 (en) 2002-03-14 2003-09-18 Commonwealth Scientific And Industrial Research Organisation Modified gene-silencing rna and uses thereof
DE10212893A1 (de) * 2002-03-20 2003-10-16 Basf Plant Science Gmbh Verfahren zum Erhöhen des Ölgehaltes in Pflanzen
US7323621B2 (en) 2002-12-13 2008-01-29 E.I. Du Pont De Nemours And Company Method of decreasing liquiritigenin-derived isoflavones relative to total isoflavones in plants and plants producing reduced ratio of liquiritigenin-derived isoflavones relative to total isoflavones
US20040172682A1 (en) 2003-02-12 2004-09-02 Kinney Anthony J. Production of very long chain polyunsaturated fatty acids in oilseed plants
US7129089B2 (en) 2003-02-12 2006-10-31 E. I. Du Pont De Nemours And Company Annexin and P34 promoters and use in expression of transgenic genes in plants
AU2004290051A1 (en) 2003-11-12 2005-05-26 E.I. Dupont De Nemours And Company Delta-15 desaturases suitable for altering levels of polyunsaturated fatty acids in oilseed plants and oleaginous yeast
WO2005063988A1 (en) * 2003-12-23 2005-07-14 Pioneer Hi-Bred International, Inc. Alteration of oil traits in plants
US7294756B2 (en) 2004-06-22 2007-11-13 E.I. Du Pont De Nemours And Company Plant galactinol synthase homologs
EP1831376A1 (en) 2004-12-28 2007-09-12 Pioneer Hi-Bred International, Inc. Improved grain quality through altered expression of seed proteins
ATE530656T1 (de) 2005-02-23 2011-11-15 Univ North Carolina State Veränderung des alkaloidgehaltes in tabak durch modifikation spezifischer cytochrome p450 gene.
NZ564016A (en) 2005-05-25 2009-08-28 Pioneer Hi Bred Int Methods for improving crop plant architecture and yield by introducing recombinant expression cassette
US20070074311A1 (en) 2005-08-30 2007-03-29 Pioneer Hi-Bred International, Inc. Compositions and methods for modulating expression of gene products
CN101356279A (zh) 2005-11-10 2009-01-28 先锋高级育种国际公司 Dof(具有一指的dna结合)序列和使用方法
DK1951866T3 (da) 2005-11-23 2014-10-27 Du Pont Delta-9-elongaser og anvendelse heraf til fremstilling af flerumættede fedtsyrer
WO2007092704A2 (en) 2006-02-09 2007-08-16 Pioneer Hi-Bred International, Inc. Genes for enhancing nitrogen utilization efficiency in crop plants
AR060523A1 (es) 2006-04-19 2008-06-25 Pioneer Hi Bred Int Moleculas de polinucleotidos aislados que corresponden a alelos mutantes y tipo salvaje del gen de maiz d9 y metodos para usarlas
US7943823B2 (en) 2006-04-28 2011-05-17 E.I. Du Pont De Nemours And Company Delta-8 desaturase and its use in making polyunsaturated fatty acids
US20070271629A1 (en) 2006-05-17 2007-11-22 Pioneer Hi-Bred International, Inc. Artificial plant minichromosomes
US7678560B2 (en) 2006-05-17 2010-03-16 E.I. Du Pont De Nemours And Company Δ 5 desaturase and its use in making polyunsaturated fatty acids
US20110016581A1 (en) 2006-10-23 2011-01-20 E.I. Du Pont De Nemours And Company Delta-8 desaturases and their use in making polyunsaturated fatty acids
US8389808B2 (en) 2007-02-12 2013-03-05 E.I. Du Pont De Nemours And Company Production of arachidonic acid in oilseed plants
US8158858B2 (en) 2007-04-04 2012-04-17 E I Du Pont De Nemours And Company Soybean promoters and flower-preferred expression thereof in transgenic plants
US7794701B2 (en) 2007-04-16 2010-09-14 E.I. Du Pont De Nemours And Company Δ-9 elongases and their use in making polyunsaturated fatty acids
US8957280B2 (en) 2007-05-03 2015-02-17 E. I. Du Pont De Nemours And Company Delta-5 desaturases and their use in making polyunsaturated fatty acids
US20080295202A1 (en) 2007-05-17 2008-11-27 Zhongsen Li Soybean promoters SC194 and flower-preferred expression thereof in transgenic plants
US8759612B2 (en) 2007-05-17 2014-06-24 E. I. Du Pont De Nemours And Company Soybean promoters LTP2 and flower-preferred expression thereof in transgenic plants
EP2147109B1 (en) 2007-05-24 2014-03-19 E. I. Du Pont de Nemours and Company Dgat genes from yarrowia lipolytica for increased seed storage lipid production and altered fatty acid profiles in soybean
US20100154076A1 (en) 2007-05-25 2010-06-17 Cropdesign N.V. Yield Enhancement In Plants By Modulation of Maize Alfins
US8710206B2 (en) 2007-06-15 2014-04-29 E. I. Du Pont De Nemours And Company Soybean EF1A promoter and its use in constitutive expression of transgenic genes in plants
BRPI0818941A2 (pt) 2007-08-29 2014-10-07 Pioneer Hi Bred Int "planta, métodos de alteração da arquitetura de raízes em plantas, de avaliação da arquitetura de raízes em plantas, de determinação de alteração de uma característica agronômica em uma planta, de transformação de células, de produção de plantas, polinucleotídeo, vetor e reconstrução de dna recombinante"
WO2009064771A2 (en) 2007-11-12 2009-05-22 North Carolina State University Alteration of tobacco alkaloid content through modification of specific cytochrome p450 genes
CN101932712B (zh) 2007-11-20 2014-05-14 先锋国际良种公司 用于改善植物应激耐性的玉米乙烯信号转导基因及其调节
MX2010005578A (es) 2007-11-20 2010-06-02 Du Pont Plantas con alteraciones en la arquitectura radicular, constructos y metodos relacionados que requieren genes que codifican polipeptidos de cinasa rica en repeticiones de leucina y homologos de estos.
US8937217B2 (en) 2007-12-18 2015-01-20 E. I. Du Pont De Nemours And Company Down-regulation of gene expression using artificial microRNAs
US8367895B2 (en) 2008-01-17 2013-02-05 Pioneer Hi-Bred International, Inc. Compositions and methods for the suppression of target polynucleotides from the family aphididae
US8847013B2 (en) 2008-01-17 2014-09-30 Pioneer Hi Bred International Inc Compositions and methods for the suppression of target polynucleotides from lepidoptera
US8809625B2 (en) 2008-01-17 2014-08-19 Pioneer Hi-Bred International, Inc. Compositions and methods for the suppression of target polynucleotides from Lygus
US20090188008A1 (en) * 2008-01-17 2009-07-23 Pioneer Hi-Bred International, Inc. Compositions and methods for the suppression of target polynucleotides
EP2620501A3 (en) 2008-05-23 2013-10-02 E. I. du Pont de Nemours and Company DGAT genes from oleaginous organisms for increased seed storage lipid production and altered fatty acid profiles in oilseed plants
WO2009143397A2 (en) 2008-05-23 2009-11-26 E. I. Du Pont De Nemours And Company Novel dgat genes for increased seed storage lipid production and altered fatty acid profiles in oilseed plants
CA2741006A1 (en) 2008-10-30 2010-05-20 Pioneer Hi-Bred International, Inc. Manipulation of glutamine synthetases (gs) to improve nitrogen use efficiency and grain yield in higher plants
CA2743707A1 (en) 2008-12-04 2010-06-10 Pioneer Hi-Bred International, Inc. Methods and compositions for enhanced yield by targeted expression of knotted1
CA2749163A1 (en) 2009-01-14 2010-07-22 The Salk Institute For Biological Studies Methods for screening and compounds that protect against amyloid diseases
US8716553B2 (en) 2009-03-02 2014-05-06 Pioneer Hi Bred International Inc NAC transcriptional activators involved in abiotic stress tolerance
PL2414522T3 (pl) 2009-04-01 2015-02-27 Du Pont Zastosowanie swoistego dla nasion promotora do napędzania ekspresji ODP1 w krzyżowych roślinach oleistych dla zwiększenia zawartości oleju przy zachowaniu normalnego kiełkowania
CN102395674B (zh) 2009-04-14 2015-07-29 先锋国际良种公司 调节acc合酶改善低氮条件下的植物产量
MX2011011678A (es) 2009-05-04 2011-12-06 Pioneer Hi Bred Int Mejora de la produccion en plantas mediante la modulacion del factor de transcripcion ap2.
WO2010144276A1 (en) 2009-06-09 2010-12-16 E. I. Du Pont De Nemours And Company Drought tolerant plants and related constructs and methods involving genes encoding fatty acid desaturase family polypeptides
EP2456874A1 (en) 2009-07-24 2012-05-30 Pioneer Hi-Bred International Inc. The use of dimerization domain component stacks to modulate plant architecture
MX2012002189A (es) 2009-08-21 2012-03-16 Beeologics Inc Prevencion y cura de las enfermedades de los insectos beneficiosos a traves de moleculas.
EP3401404A1 (en) 2009-08-28 2018-11-14 E. I. du Pont de Nemours and Company Compositions and methods to control insect pests
AR078502A1 (es) 2009-10-02 2011-11-09 Pioneer Hi Bred Int Regulacion hacia abajo de acc (acido 1-aminociclopropano-1-carboxilico) sintasa para el rendimiento mejorado de plantas
AR078829A1 (es) 2009-10-30 2011-12-07 Du Pont Plantas y semillas con niveles alterados de compuesto de almacenamiento, construcciones relacionadas y metodos relacionados con genes que codifican proteinas similares a las aldolasas bacterianas de la clase ii del acido 2,4- dihidroxi-hept-2-eno-1,7-dioico
EP2516638A1 (en) 2009-12-24 2012-10-31 E.I. Du Pont De Nemours And Company Plant membrane bound o-acyl transferase (mboat) family protein sequences and their uses for altering fatty acid compositions
WO2011082310A2 (en) 2009-12-30 2011-07-07 Pioneer Hi-Bred International, Inc. Methods and compositions for targeted polynucleotide modification
AU2010339404B2 (en) 2009-12-30 2016-01-28 Pioneer Hi-Bred International, Inc. Methods and compositions for the introduction and regulated expression of genes in plants
MX2012007855A (es) 2010-01-06 2013-06-05 Du Pont Identificacion de ritmos diurnos en tejidos fotosinteticos del zea mays y uso en el mejoramiento de plantas de cultivo.
CA2788381A1 (en) 2010-02-02 2011-08-11 E.I. Du Pont De Nemours And Company Plants with altered root architecture, related constructs and methods involving genes encoding lectin protein kinase (lpk) polypeptides and homologs thereof
EP2865761A1 (en) 2010-03-03 2015-04-29 E. I. Du Pont de Nemours and Company Plant seeds with altered storage compound levels, related constructs and methods involving genes encoding oxidoreductase motif polypeptides
MX2012012672A (es) 2010-05-06 2012-12-17 Du Pont Gen y proteina acc sintasa 3 de maiz y sus usos.
US8872001B2 (en) 2010-06-04 2014-10-28 Pioneer Hi Bred International Inc Compositions and methods for insecticidal control of stinkbugs
CN103080320A (zh) 2010-07-01 2013-05-01 纳幕尔杜邦公司 涉及编码pae以及pae样多肽的基因并具有改变的贮藏化合物水平的植物种子、相关的构建体和的方法
EP2593468B1 (en) 2010-07-12 2020-06-10 The State of Israel, Ministry of Agriculture and Rural Development, Agricultural Research Organization, (A.R.O.), Volcani Center Isolated polynucleotides and methods and plants using same for regulating plant acidity
CA2805236A1 (en) 2010-07-14 2012-01-19 E. I. Du Pont De Nemours And Company Blended soy protein products with a combined pufa content having altered characteristics
WO2012142311A1 (en) 2011-04-15 2012-10-18 Pioneer Hi-Bred International, Inc. Self-reproducing hybrid plants
WO2012148835A1 (en) 2011-04-29 2012-11-01 Pioneer Hi-Bred International, Inc. Down-regulation of a homeodomain-leucine zipper i-class homeobox gene for improved plant performance
US9062317B2 (en) 2011-05-09 2015-06-23 E I Du Pont De Nemours And Company Methods and compositions for silencing gene families using artificial microRNAs
WO2012174139A2 (en) 2011-06-14 2012-12-20 Synthon Biopharmaceuticals B.V. Compositions and methods for making and b ioc ont aining auxotrophic transgenic plants
WO2013040213A1 (en) 2011-09-13 2013-03-21 E. I. Du Pont De Nemours And Company Soybean atps promoter and its use in constitutive expression of transgenic genes in plants
WO2013040259A1 (en) 2011-09-13 2013-03-21 E. I. Du Pont De Nemours And Company Soybean bbi3 promoter and its use in embryo-specific expression of transgenic genes in plants
US20150159166A1 (en) 2011-10-31 2015-06-11 Pioneer Hi Bred International Inc Plant drought tolerance and nitrogen use efficiency by reducing plant sensitivity to ethylene
UA116097C2 (uk) 2011-12-11 2018-02-12 Зе Стейт Оф Ізраел, Міністрі Оф Агрікалче Енд Руерал Девелопмент, Агрікалчерал Рісьоч Організейшн, (А.Р.О.), Волкані Сентре Спосіб модуляції провідності устячка рослини
CA2860220C (en) 2011-12-22 2021-07-13 E. I. Du Pont De Nemours And Company Use of the soybean or medicago truncatula sucrose synthase promoter to increase plant seed oil content
EP2806730A4 (en) 2012-01-23 2015-12-23 Linnaeus Plant Sciences Inc MODIFICATION OF THE FATTY ACID PROFILE OF CAMELINE OIL
BR112014018009A2 (pt) 2012-01-23 2018-06-26 Du Pont sequência de ácido nucleico isolada, construção recombinante, célula vegetal, método para reduzir a expressão de pelo menos um gene biossintético de ácido graxo vegetal, método para reduzir a expressão de dois ou mais genes biossintéticos de ácido graxo vegetal e planta ou semente transgênica
CN104703998B (zh) 2012-03-13 2020-08-21 先锋国际良种公司 植物中雄性育性的遗传减少
WO2013138309A1 (en) 2012-03-13 2013-09-19 Pioneer Hi-Bred International, Inc. Genetic reduction of male fertility in plants
RU2014151361A (ru) 2012-05-18 2016-07-10 Пайонир Хай-Бред Интернэшнл, Инк. Последовательности индуцируемого промотора для регулируемой экспрессии и способы применения
WO2014007832A1 (en) 2012-07-03 2014-01-09 E. I. Du Pont De Nemours And Company Environmentally sustainable frying oils
US9719100B2 (en) 2012-08-10 2017-08-01 E I Du Pont De Nemours And Company Soybean ADF1 promoter and its use in constitutive expression of transgenic genes in plants
US9719099B2 (en) 2012-08-10 2017-08-01 E I Du Pont De Nemours And Company Soybean CCP1 promoter and its use in constitutive expression of transgenic genes in plants
EP2885411B1 (en) 2012-08-16 2018-12-05 VIB vzw Means and methods for altering the lignin pathway in plants
CN104955947A (zh) 2013-01-29 2015-09-30 格拉斯哥大学董事会 用于增加植物中胁迫耐受性和生物量的方法和工具
WO2014164014A1 (en) 2013-03-11 2014-10-09 Pioneer Hi-Bred International, Inc. Genes for improving nutrient uptake and abiotic stress tolerance in plants
WO2014164775A1 (en) 2013-03-11 2014-10-09 Pioneer Hi-Bred International, Inc. Methods and compositions to improve the spread of chemical signals in plants
WO2014164116A1 (en) 2013-03-13 2014-10-09 Pioneer Hi-Bred International, Inc. Functional expression of bacterial major facilitator superfamily (sfm) gene in maize to improve agronomic traits and grain yield
WO2014164074A1 (en) 2013-03-13 2014-10-09 Pioneer Hi-Bred International, Inc. Enhanced nitrate uptake and nitrate translocation by over-expressing maize functional low-affinity nitrate transporters in transgenic maize
WO2014153254A2 (en) 2013-03-14 2014-09-25 Pioneer Hi-Bred International Inc. Compositions and methods to control insect pests
WO2014159477A1 (en) 2013-03-14 2014-10-02 E. I. Du Pont De Nemours And Company Soybean hrp1 promoter and its use in tissue-specific expression of transgenic genes in plants
US20160024513A1 (en) 2013-03-14 2016-01-28 Pioneer Hi-Bred International Inc. Maize stress related transcription factor 18 and uses thereof
CA2901316A1 (en) 2013-03-15 2014-09-25 Pioneer Hi-Bred International, Inc. Phi-4 polypeptides and methods for their use
WO2014150721A1 (en) 2013-03-15 2014-09-25 E. I. Du Pont De Nemours And Company Soybean agb1 promoter and its use in tissue-specific expression of transgenic genes in plants
WO2014143996A2 (en) 2013-03-15 2014-09-18 Pioneer Hi-Bred International, Inc. Compositions and methods of use of acc oxidase polynucleotides and polypeptides
CA2904817C (en) 2013-03-21 2022-10-18 Vib Vzw Means and methods for the reduction of photorespiration in crops
AU2014278519B2 (en) 2013-06-11 2020-09-10 Syngenta Crop Protection Ag Methods for generating transgenic plants
AU2014286296B2 (en) 2013-07-01 2020-04-09 Basf Se Methods and means for modulating flowering time in monocot plants
BR112016003225B1 (pt) 2013-08-16 2022-10-25 Pioneer Hi-Bred International, Inc. Polipeptídeo pip-47, polipeptídeo pip-47 quimérico, composição, proteína de fusão, método para controlar uma população de inseto-praga, método para inibir o crescimento ou matar um inseto-praga, construto de dna, polinucleotídeo isolado, cassete de expressão, método de obtenção de uma planta transgênica e método para controlar infestação de inseto
BR122020001770B1 (pt) 2013-09-13 2022-11-29 Pioneer Hi-Bred International, Inc Construto de dna, método de obtenção de planta transgênica, proteína de fusão, método para controlar uma população de praga de inseto, método para inibir o crescimento ou matar uma praga de inseto
MX380499B (es) 2013-09-24 2025-03-12 Bayer Cropscience Nv Hetero-transglicosilasa novedosa y usos de la misma.
US20160237445A1 (en) 2013-10-21 2016-08-18 E. I. Du Pont De Nemours And Company Soybean pip1 promoter and its use in constitutive expression of transgenic genes in plants
US20160249542A1 (en) 2013-10-29 2016-09-01 Pioneer Hi-Bred International Inc. Self-reproducing hybrid plants
US20170166920A1 (en) 2014-01-30 2017-06-15 Two Blades Foundation Plants with enhanced resistance to phytophthora
CN106536545B (zh) 2014-02-07 2026-03-03 先锋国际良种公司 杀昆虫蛋白及其使用方法
WO2015171603A1 (en) 2014-05-06 2015-11-12 Two Blades Foundation Methods for producing plants with enhanced resistance to oomycete pathogens
US20170159065A1 (en) 2014-07-08 2017-06-08 Vib Vzw Means and methods to increase plant yield
CN106661584B (zh) 2014-07-10 2020-08-11 本森希尔生物系统股份有限公司 用于增加植物生长和产量的方法和组合物
WO2016044092A1 (en) 2014-09-17 2016-03-24 Pioneer Hi Bred International Inc Compositions and methods to control insect pests
WO2016044090A1 (en) 2014-09-19 2016-03-24 E. I. Du Pont De Nemours And Company Soybean if5a promoter and its use in constitutive expression of transgenic genes in plants
WO2016050512A1 (en) 2014-10-03 2016-04-07 Bayer Cropscience Nv Methods and means for increasing stress tolerance and biomass in plants
CN113372421B (zh) 2014-10-16 2024-08-06 先锋国际良种公司 杀昆虫蛋白及其使用方法
US20170359965A1 (en) 2014-12-19 2017-12-21 E I Du Pont De Nemours And Company Polylactic acid compositions with accelerated degradation rate and increased heat stability
CN114075267B (zh) 2015-01-15 2025-03-18 先锋国际良种公司 杀昆虫蛋白及其使用方法
CA2977026A1 (en) 2015-03-11 2016-09-15 E.I. Du Pont De Nemours And Company Insecticidal combinations of pip-72 and methods of use
BR112017017260A2 (pt) 2015-03-27 2018-04-17 Du Pont construções de dna, vetor, célula, plantas, semente, método de expressão de rna e método de modificação de local alvo
EP3292205B1 (en) 2015-05-06 2023-08-02 Pioneer Hi-Bred International, Inc. Methods and compositions for the production of unreduced, non-recombined gametes and clonal offspring
CA2985198A1 (en) 2015-05-19 2016-11-24 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
EP3310803A1 (en) 2015-06-16 2018-04-25 Pioneer Hi-Bred International, Inc. Compositions and methods to control insect pests
BR112018002535A2 (pt) 2015-08-06 2018-09-25 Du Pont polipeptídeo inseticida recombinante, polinucleotídeo recombinante, construto de dna, planta transgênica ou célula de planta, composição, proteína de fusão, método para controlar uma praga, método para inibir crescimento ou para exterminar uma população de pragas ou uma praga e uso do polipeptídeo
WO2017062790A1 (en) 2015-10-09 2017-04-13 Two Blades Foundation Cold shock protein receptors and methods of use
WO2017070458A2 (en) 2015-10-23 2017-04-27 Donald Danforth Plant Science Center Genes encoding c4 transporter proteins for use in increasing crop plant yield
BR112018008705B1 (pt) 2015-10-30 2023-12-26 Pioneer Hi-Bred International, Inc Método para produzir uma planta transgênica
EP3371313B1 (en) 2015-11-06 2020-10-14 Pioneer Hi-Bred International, Inc. Methods and compositions of improved plant transformation
CN108575091A (zh) 2015-12-18 2018-09-25 先锋国际良种公司 杀昆虫蛋白及其使用方法
AU2017234920B2 (en) 2016-03-18 2023-08-17 E. I. Du Pont De Nemours And Company Methods and compositions for producing clonal, non-reduced, non-recombined gametes
CA3018384A1 (en) 2016-05-04 2017-11-09 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
CA3022858A1 (en) 2016-06-16 2017-12-21 Pioneer Hi-Bred International, Inc. Compositions and methods to control insect pests
EP3478052B1 (en) 2016-07-01 2021-08-25 Pioneer Hi-Bred International, Inc. Insecticidal proteins from plants and methods for their use
WO2018013333A1 (en) 2016-07-12 2018-01-18 Pioneer Hi-Bred International, Inc. Compositions and methods to control insect pests
WO2018148001A1 (en) 2017-02-08 2018-08-16 Pioneer Hi-Bred International Inc Insecticidal combinations of plant derived insecticidal proteins and methods for their use
WO2018160485A1 (en) 2017-03-03 2018-09-07 Pioneer Hi-Bred International, Inc. Non-destructive assay for soybean seeds using near infrared analysis
US20200165626A1 (en) 2017-10-13 2020-05-28 Pioneer Hi-Bred International, Inc. Virus-induced gene silencing technology for insect control in maize
US11332752B2 (en) 2018-03-12 2022-05-17 Pioneer Hi-Bred International, Inc. Use of morphogenic factors for the improvement of gene editing
CA3092078A1 (en) 2018-03-14 2019-09-19 Pioneer Hi-Bred International, Inc. Insecticidal proteins from plants and methods for their use
AU2019234562B2 (en) 2018-03-14 2024-08-01 Pioneer Hi-Bred International, Inc. Insecticidal proteins from plants and methods for their use
CA3097915A1 (en) 2018-06-28 2020-01-02 Pioneer Hi-Bred International, Inc. Methods for selecting transformed plants
US20210395758A1 (en) 2018-10-31 2021-12-23 Pioneer Hi-Bred International, Inc. Compositions and methods for ochrobactrum-mediated plant transformation
CA3148950A1 (en) 2019-07-30 2021-02-04 The State Of Israel, Ministry Of Agriculture & Rural Development, Agricultural Research Organization (A.R.O.), Volcani Center Methods of controlling cannabinoid synthesis in plants or cells and plants and cells produced thereby
BR112022027035A2 (pt) 2020-07-14 2023-04-11 Pioneer Hi Bred Int Proteínas inseticidas e métodos para uso das mesmas
US20250019717A1 (en) 2021-08-06 2025-01-16 Kws Vegetables B.V. Durable downy mildew resistance in spinach
EP4477069A1 (en) 2023-06-16 2024-12-18 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Unreduced clonal gamete formation and polyploid genome design in the solanaceae

Family Cites Families (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4945050A (en) * 1984-11-13 1990-07-31 Cornell Research Foundation, Inc. Method for transporting substances into living cells and tissues and apparatus therefor
NZ219472A (en) * 1986-03-28 1990-08-28 Calgene Inc Regulation of phenotype in plant cells using dsdna constructs
US5107065A (en) * 1986-03-28 1992-04-21 Calgene, Inc. Anti-sense regulation of gene expression in plant cells
ATE112314T1 (de) * 1988-05-17 1994-10-15 Lubrizol Genetics Inc Pflanzliches ubiquitinpromotorsystem.
US5231020A (en) * 1989-03-30 1993-07-27 Dna Plant Technology Corporation Genetic engineering of novel plant phenotypes
CA2114104C (en) * 1991-07-24 2003-10-14 Phillip S. Kerr Nucleotide sequences of galactinol synthase from zucchini and soybean
CA2124673C (en) 1991-12-04 2008-08-05 John Browse Fatty acid desaturase genes from plants
GB9210273D0 (en) 1992-05-13 1992-07-01 Ici Plc Dna
PL172710B1 (pl) * 1992-07-02 1997-11-28 Hybridon Inc Samostabilizujacy sie oligonukleotyd PL PL
ATE398679T1 (de) * 1992-07-07 2008-07-15 Japan Tobacco Inc Verfahren zur transformation einer monokotyledon pflanze
DK0668919T3 (da) 1992-11-17 2003-09-15 Du Pont Gener for mikorsomale delta-12-fedtsyredesaturaser og beslægtede enzymer fra planter
FR2703053B1 (fr) * 1993-03-26 1995-06-16 Genset Sa Oligonucleotides agrafes et semi-agrafes, procede de preparation et applications .
US5470353A (en) * 1993-10-20 1995-11-28 Hollister Incorporated Post-operative thermal blanket
JPH09509323A (ja) * 1994-02-23 1997-09-22 リボザイム・ファーマシューティカルズ・インコーポレーテッド 疾患関連遺伝子の発現を阻害するための方法および試薬
US5750868A (en) 1994-12-08 1998-05-12 Pioneer Hi-Bred International, Inc. Reversible nuclear genetic system for male sterility in transgenic plants
BR9709697A (pt) 1996-06-14 1999-10-05 Du Pont Método para reduzir a quantidade de proteìna de armazenamento em semente de soja, método para reduzir simultaneamente a expressão de dois genes de soja, planta de soja transgênica e sementes transgênicas.
US6096947A (en) 1997-01-14 2000-08-01 Pioneer Hi-Bred International, Inc. Methods for improving transformation efficiency
GB9703146D0 (en) 1997-02-14 1997-04-02 Innes John Centre Innov Ltd Methods and means for gene silencing in transgenic plants
EP0977863A1 (en) 1997-05-07 2000-02-09 E.I. Du Pont De Nemours & Company Incorporated Starch biosynthetic enzymes
GB9720148D0 (en) 1997-09-22 1997-11-26 Innes John Centre Innov Ltd Gene silencing materials and methods
US6506559B1 (en) 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
CN1202246C (zh) 1998-04-08 2005-05-18 联邦科学和工业研究组织 获得修饰表型的方法和措施
AR020078A1 (es) * 1998-05-26 2002-04-10 Syngenta Participations Ag Metodo para alterar la expresion de un gen objetivo en una celula de planta
CA2339483C (en) 1998-08-17 2006-01-31 Pioneer Hi-Bred International, Inc. Maize cellulose synthases and uses thereof
CA2839037A1 (en) 1998-08-20 2000-03-02 E.I. Du Pont De Nemours And Company Genes for plant fatty acid modifying enzymes associated with conjugated double bond formation
ATE309362T1 (de) 1998-08-20 2005-11-15 Pioneer Hi Bred Int Samen-bevorzugende promotoren
AU5788299A (en) 1998-08-28 2000-03-21 Pioneer Hi-Bred International, Inc. Seed-preferred promoters from (end) genes
CA2361201A1 (en) * 1999-01-28 2000-08-03 Medical College Of Georgia Research Institute, Inc. Composition and method for in vivo and in vitro attenuation of gene expression using double stranded rna
US6967262B2 (en) 2000-04-11 2005-11-22 E.I. Du Pont De Nemours And Company Plant raffinose saccharide biosynthetic enzymes
US7250557B2 (en) * 2000-07-17 2007-07-31 E. I. Du Pont De Nemours And Company Plastidic phosphoglucomutase genes
EP1311659B1 (en) * 2000-08-22 2006-03-08 E. I. du Pont de Nemours and Company Nucleotide sequences of a new class of diverged delta-9 stearoyl-acp desaturase genes

Cited By (76)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9102939B2 (en) 1997-12-23 2015-08-11 The Carnegie Institution Of Washington Genetic inhibition by double-stranded RNA
US20030056235A1 (en) * 1997-12-23 2003-03-20 The Carnegie Institution Of Washington Genetic inhibition by double-stranded RNA
US20080050342A1 (en) * 1997-12-23 2008-02-28 Carnegie Institution Of Washington Genetic inhibition by double-stranded RNA
US7538095B2 (en) 1997-12-23 2009-05-26 The Carnegie Institution Of Washington Genetic inhibition by double-stranded RNA
US8283329B2 (en) 1997-12-23 2012-10-09 The Carnegie Institution Of Washington Genetic inhibition of double-stranded RNA
US8580754B2 (en) 1997-12-23 2013-11-12 Carnegie Institution Of Washington Genetic inhibition by double-stranded RNA
US9029527B2 (en) 1998-03-20 2015-05-12 Commonwealth Scientific And Industrial Research Organisation Synthetic genes and genetic constructs
US20060014715A1 (en) * 1998-03-20 2006-01-19 Benitec Australia Limited Control of gene expression
US20040180439A1 (en) * 1998-03-20 2004-09-16 Benitec Australia Limited Synthetic genes and genetic constructs
US7754697B2 (en) 1998-03-20 2010-07-13 Commonwealth Scientific And Industrial Research Organisation Control of gene expression
US20040266005A1 (en) * 1998-03-20 2004-12-30 Benitec Australia Limited Synthetic genes and genetic constructs
US9963698B2 (en) 1998-03-20 2018-05-08 Commonwealth Scientific And Industrial Research Organisation Control of gene expression
US20030159161A1 (en) * 1998-03-20 2003-08-21 Graham Michael Wayne Synthetic genes and genetic constructs comprising same I
US8053419B2 (en) 1998-03-20 2011-11-08 Commonwealth Scientific And Industrial Research Organisation Synthetic genes and genetic constructs
US8431547B2 (en) 1998-03-20 2013-04-30 Commonwealth Scientific And Industrial Research Organisation Synthetic genes and genetic constructs
US8067383B2 (en) 1998-03-20 2011-11-29 Commonwealth Scientific And Industrial Research Organisation Synthetic genes and genetic constructs comprising same I
US8168774B2 (en) 1998-03-20 2012-05-01 Commonwealth Scientific And Industrial Research Organisation Control of gene expression
US8048670B2 (en) 1998-03-20 2011-11-01 Commonwealth Scientific And Industrial Research Organisation Synthetic genes and genetic constructs
US20090215880A1 (en) * 1999-01-28 2009-08-27 Med. College Of Georgia Research Institute, Inc. Composition and Method for IN VIVO and IN VITRO Attenuation of Gene Expression Using Double Stranded RNA
US7888325B2 (en) 1999-01-28 2011-02-15 Medical College Of Georgia Research Institute, Inc. Composition and method for in vivo and in vitro attenuation of gene expression using double stranded RNA
US8148345B2 (en) 1999-01-28 2012-04-03 Georgia Health Sciences University Research Institute, Inc. Composition and method for in vivo and in vitro attenuation of gene expression using double stranded RNA
US20020114784A1 (en) * 1999-01-28 2002-08-22 Medical College Of Georgia Research Institute, Inc. Composition and method for in vivo and in vitro attenuation of gene expression using double stranded RNA
US20040147475A1 (en) * 1999-01-28 2004-07-29 Medical College Of Georgia Research Institute, Inc. Composition and method for in vivo and in vitro attenuation of gene expression using double stranded RNA
US20090156520A1 (en) * 1999-01-28 2009-06-18 Med. College Of Georgia Research Institute, Inc. Composition and method for in vivo and in vitro attenuation of gene expression using double stranded RNA
US20080081792A1 (en) * 1999-04-21 2008-04-03 Wyeth Methods and compositions for inhibiting the function of polynucleotide sequences
US20070219151A1 (en) * 1999-04-21 2007-09-20 Wyeth Methods and compositions for inhibiting the function of polynucleotide sequences
US20040198690A1 (en) * 1999-04-21 2004-10-07 Wyeth Methods and compositions for inhibiting the function of polynucleotide sequences
US8183217B2 (en) 1999-08-13 2012-05-22 Commonwealth Scientific And Industrial Research Organisation Methods and means for obtaining modified phenotypes
US8334374B2 (en) 1999-08-13 2012-12-18 Commonwealth Scientific And Industrial Research Organisation Methods and means for obtaining modified phenotypes
US9708621B2 (en) 1999-08-13 2017-07-18 Commonwealth Scientific And Industrial Research Organisation Methods and means for obtaining modified phenotypes
US10190127B2 (en) 1999-08-13 2019-01-29 Commonwealth Scientific And Industrial Research Organisation Methods and means for obtaining modified phenotypes
US20030182672A1 (en) * 2000-03-17 2003-09-25 Graham Michael Wayne Genetic silencing
US20100043098A1 (en) * 2000-04-11 2010-02-18 E. I. Du Pont De Nemours And Company Plant raffinose saccharide biosynthetic enzymes
US8241910B2 (en) 2000-04-11 2012-08-14 E I Du Pont De Nemours And Company Plant raffinose saccharide biosynthetic enzymes
US20050278807A1 (en) * 2000-04-11 2005-12-15 Allen Stephen M Plant raffinose saccharide biosynthetic enzymes
US20040152117A1 (en) * 2001-01-31 2004-08-05 Tony Giordano Use of post-transcriptional gene silencing for identifying nucleic acid sequences that modulate the function of a cell
US9051566B2 (en) 2001-01-31 2015-06-09 Alnylam Pharmaceuticals, Inc. Post-transcriptional gene silencing using expressed double stranded RNA
US20030175783A1 (en) * 2002-03-14 2003-09-18 Peter Waterhouse Methods and means for monitoring and modulating gene silencing
US20140196160A1 (en) * 2002-03-14 2014-07-10 Commonwealth Scientific & Industrial Research Organisation Methods and Means for Monitoring and Modulating Gene Silencing
US20090048111A1 (en) * 2002-10-04 2009-02-19 Myriad Genetics, Incorporated Rna interference using a universal target
US7422853B1 (en) 2002-10-04 2008-09-09 Myriad Genetics, Inc. RNA interference using a universal target
EP1445321A1 (en) 2002-12-18 2004-08-11 Monsanto Technology LLC Maize embryo-specific promoter compositions and methods for use thereof
EP2116606A1 (en) 2003-03-28 2009-11-11 Monsanto Technology, LLC Novel plant promoters for use in early seed development
EP2116607A1 (en) 2003-03-28 2009-11-11 Monsanto Technology, LLC Novel plant promoters for use in early seed development
US20050059044A1 (en) * 2003-06-03 2005-03-17 Graham Michael Wayne Double-stranded nucleic acid
US20050176670A1 (en) * 2004-02-10 2005-08-11 Shihshieh Huang Recombinant DNA for gene suppression
WO2005077116A2 (en) 2004-02-10 2005-08-25 Mosanto Technology, Llc Recombinant dna for gene suppression
US10772276B2 (en) 2004-02-10 2020-09-15 Monsanto Technology Llc Enhanced zein reduction in transgenic corn seed
EP1713908A4 (en) * 2004-02-10 2008-08-20 Monsanto Technology Llc RECOMBINANT DNA FOR GENE UPPRESSION
US9976139B2 (en) 2004-02-10 2018-05-22 Monsanto Technology Llc Recombinant DNA for gene suppression
US7683237B2 (en) 2004-02-10 2010-03-23 Monsanto Technology Llc Maize seed with synergistically enhanced lysine content
US9913487B2 (en) 2004-02-10 2018-03-13 Monsanto Technology Llc Enhanced zein reduction in transgenic corn seed
US20060064772A1 (en) * 2004-02-10 2006-03-23 Kriz Alan L Maize seed with synergistically enhanced lysine content
US20110126321A1 (en) * 2004-02-10 2011-05-26 Shihshieh Huang Recombinant dna for gene suppression
EP3290516A1 (en) 2004-02-10 2018-03-07 Monsanto Technology LLC Recombinant dna for gene suppression
US7855323B2 (en) 2004-02-10 2010-12-21 Monsanto Technology Llc Recombinant DNA for gene suppression
US9006414B2 (en) 2004-02-10 2015-04-14 Monsanto Technology Llc Recombinant DNA for gene suppression
EP2365072A1 (en) 2004-02-10 2011-09-14 Monsanto Technology LLC Recombinant dna for gene suppression
EP2292773A1 (en) 2004-03-25 2011-03-09 Monsanto Technology LLC Genes and uses for plant improvement
US20080276333A1 (en) * 2004-06-09 2008-11-06 Mcgonigle Brian Recombinant Constructs for Use in Reducing Gene Expression
US20060041957A1 (en) * 2004-06-09 2006-02-23 Mcgonigle Brian Recombinant constructs for use in reducing gene expression
EP1621632A1 (en) 2004-07-31 2006-02-01 Monsanto Technology, LLC Genes and uses for plant improvement
EP2295582A2 (en) 2004-07-31 2011-03-16 Monsanto Technology LLC Genes and uses for plant improvement
US20090158463A1 (en) * 2004-08-11 2009-06-18 Luethy Michael H Enhanced zein reduction in transgenic corn seed
US8461418B2 (en) 2004-08-11 2013-06-11 Monsanto Technology Llc Enhanced zein reduction in transgenic corn seed
US20060075515A1 (en) * 2004-08-11 2006-04-06 Luethy Michael H Enhanced zein reduction in transgenic corn seed
EP2489726A2 (en) 2005-01-12 2012-08-22 Monsanto Technology LLC Genes and uses for plant improvement
EP2584033A1 (en) 2005-01-12 2013-04-24 Monsanto Technology LLC Genes and uses for plant improvement
EP3059306A1 (en) 2005-01-12 2016-08-24 Monsanto Technology LLC Genes and uses for plant improvement
WO2006099249A2 (en) 2005-03-10 2006-09-21 Monsanto Technology Llc Maize seed with synergistically enhanced lysine content
US20080262408A1 (en) * 2005-03-11 2008-10-23 Martin Krauss Multi-Constituent Packaging with Applicator
WO2006133983A1 (en) 2005-04-19 2006-12-21 Basf Plant Science Gmbh Starchy-endosperm and/or germinating embryo-specific expression in mono-cotyledonous plants
US20110113514A1 (en) * 2005-10-03 2011-05-12 Malvar Thomas M Transgenic plant seed with increased lysine
WO2008099013A1 (en) 2007-02-16 2008-08-21 Basf Plant Science Gmbh Nucleic acid sequences for regulation of embryo-specific expression in monocotyledonous plants
WO2015066768A1 (en) 2013-11-07 2015-05-14 Ozgene Holdings Pty Ltd Compositions and methods for producing genetically modified animals
EP4043575A1 (en) 2013-11-07 2022-08-17 Ozgene Holdings Pty Ltd Compositions and methods for producing genetically modified animals

Also Published As

Publication number Publication date
HUP0302320A3 (en) 2005-11-28
JP2004512020A (ja) 2004-04-22
DE60144517D1 (de) 2011-06-09
EP1297163A2 (en) 2003-04-02
US20090142829A1 (en) 2009-06-04
US7456014B2 (en) 2008-11-25
CA2408326A1 (en) 2002-01-03
EP1297163B1 (en) 2011-04-27
US7897383B2 (en) 2011-03-01
MXPA02012733A (es) 2003-05-14
WO2002000904A2 (en) 2002-01-03
BR0111839A (pt) 2003-09-16
US20060247202A1 (en) 2006-11-02
AU2001272977A1 (en) 2002-01-08
ATE507300T1 (de) 2011-05-15
WO2002000904A3 (en) 2003-01-23
HUP0302320A2 (hu) 2003-10-28

Similar Documents

Publication Publication Date Title
US7456014B2 (en) Recombinant constructs and their use in reducing gene expression
EP0616644B1 (en) Fatty acid desaturase genes from plants
EP2573180B1 (en) Down-regulation of gene expression using artificial microRNAs
JP2001512687A (ja) 植物に局在性遺伝子変化を生じさせるための混合二本鎖オリゴヌクレオチドの使用
WO1993011245A9 (en) Fatty acid desaturase genes from plants
AU5407594A (en) Genes for microsomal delta-12 fatty acid desaturases and related enzymes from plants
JPH10505237A (ja) カノラ及びダイズのパルミトイル−acpチオエステラーゼ遺伝子のヌクレオチド配列、並びにダイズ及びカノラ植物の油の脂肪酸量の調節におけるこれらの使用
EP2588617B1 (en) Plant seeds with altered storage compound levels, related constructs and methods involving genes encoding pae and pae-like polypeptides
JP4727043B2 (ja) 植物の農学的価値および栄養学的価値を改善するための方法
US20080276333A1 (en) Recombinant Constructs for Use in Reducing Gene Expression

Legal Events

Date Code Title Description
AS Assignment

Owner name: E.I. DU PONT DE NEMOURS AND COMPANY, DELAWARE

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:KINNEY, ANTHONY J.;STECCA, KEVIN L.;NICHOLS, SCOTT E.;AND OTHERS;REEL/FRAME:012796/0994;SIGNING DATES FROM 20020206 TO 20020304

Owner name: PIONEER HI-BRED INTERNATIONAL, INC., IOWA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:KINNEY, ANTHONY J.;STECCA, KEVIN L.;NICHOLS, SCOTT E.;AND OTHERS;REEL/FRAME:012796/0994;SIGNING DATES FROM 20020206 TO 20020304

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION