TW587078B - 4,4-disubstituted-3,4-dihydro-2(1H)-quinazolinones useful as HIV reverse transcriptase inhibitors - Google Patents

Abstract

The present invention relates to 4,4-disubstituted-3,4-dihydro-2(1H)-quinazolines of formula I, or stereoisomeric forms, stereoisomeric mixtures, or pharmaceutically acceptable salt forms thereof, which are useful as inhibitors of HIV reverse transcriptase, and to pharmaceutical compositions and diagnostic kits comprising the same, and methods of using the same for treating viral infection or as an assay standard or reagent.

Description

587078 A7 B7 printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (1) Field of the invention The present invention relates to 4,4-disubstituted-3,4-dihydro-2 (4) which can be used as a reverse transcriptase inhibitor. 1 Hydrogen) -quinazolinone, a pharmaceutical composition and a diagnostic kit containing these substances, a method of using these substances to treat a viral infection or as an analytical standard or reagent, and preparation of intermediates and steps of these substances. BACKGROUND OF THE INVENTION It is now known that two different types of human immunodeficiency virus (type-1 HI V and type-2 HI V) are responsible for acquired immune deficiency disease (AIDS). Although HIV-seropositive individuals have no symptoms at the beginning, they will develop AIDS-related complications (ARC) after suffering from AIDS, and the immune system of the infected individual will be severely suppressed, which will lead to physical weakness and eventually fatal opportunism. infection. AIDS is caused by the complex life history of the HIV-1 or HIV-2 virus. The life history of the virus begins when the virus binds to human host T-4 lymphocyte immune cells. _ Protein is bound to the CD4 glycoprotein on lymphocytes). Once bonded, the virus particles de-glyze the outer membrane of the glycoprotein, penetrate the cell membrane of the host cell, and envelop its RN A. The enzyme of the diseased mother particle-reverse green enzyme-will turn the RNA into green single-stranded DNA ’and then the viral RNA is degraded to generate a second strand of DNA. The resulting double-stranded DNA can be inserted into genes in human cells, and these positive genes can be used for virus replication. At this time, the RNA polymerase transcribes the incoming DNA into viral RNA, and the viral RNA is then translated into the precursor of the gag-ροΐ fusion glycoprotein, after which the HIV protease excises the cool protein to produce a mature viral protein. Therefore, this paper size is applicable to China National Standards (CNs) A4 (210X297 mm) (Please read the precautions on the back before filling out this page.)-·,? Τ 587078 Μ Β7 Staff Consumer Cooperatives, Central Standards Bureau, Ministry of Economic Affairs Printing 5. Description of the invention (2) HIV proteinase is responsible for regulating the maturation of virus particles to become infectious virus during protein removal process. Because the virus kills the T cells of the immune system after virus infection, the main human immune system is responsible for killing the invading virus particles. The reaction load is heavy. In addition (except for the virus reverse transcriptase used to make new virus particles and It is not very specific, which often causes the error of greening, which leads to the continuous change of glycoproteins on the surface of the protective membrane of the virus. The lack of specificity of reverse transcriptase reduces the immune efficiency of the human body because antibodies are specific. It is produced against one vinegar protein and is ineffective against another glycoprotein. Therefore, it can be used to reduce the number of anti-virus antibodies, the virus continues to reproduce, and the immune 2 gradually retreats. Finally, the HIV is completely To control the body's immune system, antiviral drugs, immune regulators (or inferior infections have died without administration.) At least three important periods in the life history of the virus have been proven to be the target of anti-disease: prions The particles initially bind to τ_4 lymphocytes or: "field cell sites" (2) transcription of viral RNA into viral DNA (reverse transcriptase, and ⑴mv protease excision of gag_p〇1 ΟϊΓΛϊ Inhibition of the virus (ie, viral RNA transcription into viral reproduction steps) in an important period has provided many of the current treatments for AIDS. The virus particle RNA Φ M has undergone such a greenish turn, because the virus's gene encodes the drug I. The host cell can only recognize the ship, and it can block the formation of disease 4 DNA by blocking the reverse transcriptase f. Therefore, it can stop the reversion of ΗΠΜ. Nowadays, various compounds that interfere with the replication of the virus have been developed to treat Aca, I- nnn i -^ 又 m I d (Please read the notes on the back before filling this page)

, 1T 1 I- I-

This paper is applicable in the standard (CNS) A4 specification 587078 ΑΊ B7 V. Description of the invention (3) 'For example, nuclear analogues such as 3, _azido_3, deoxythymidine nuclear pyrene (AZT), 2' , 3'-dideoxycytosine riboside (ddc), 2 ,, 3, _ 'dideoxythymidine ribosome (d4T), 2', 3, _dideoxymuscle (ddI), and 2,3, · dideoxy-3'-thiocytosine nuclear tritium (3TC) and others have been shown to have the effect of blocking HIV replication during the reverse transcriptase (rt) period. …… Now is actively developing research on non-HIV reverse transcriptase inhibitors, for example, 'It has now been found that certain benzophenazine and 4 oxalinam can inhibit HIV reverse green enzyme' to prevent or treat HIV infection and can Treatment of AIDS. U.S. Patent No. 5,519,021 reveals the reversal of 'benzylidene p pionone' green enzyme inhibitor with the following formula: ‘clothing-(Please read the precautions on the back before filling this page]

Order · where X is Nansu and Z is oxygen. , European Patent Nos. 0,53,994, and WO93 / 〇4〇47 disclose HIV reverse transcriptase inhibitors of the formula (A) quinazolinone:

587078 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs Β7. V. Description of the Invention (4) ^ where G is various groups, R3 and R4 »are hydrogen, / is oxygen, and R2 is an unsubstituted alkyl group. Substituted fluorenyl, unsubstituted alkyne ', unsubstituted cycloalkyl, unsubstituted heterocyclyl, and optionally substituted aromatic, and R1 is a group of various formulas, including Substituted alkyl. W095 / l2583 also discloses the HIV reverse transcriptase p, preparation and agent of formula A. In this document, G is a group of various formulas, r3 and R4 are hydrogen, z is oxygen, and R2 is substituted Alkenyl or substituted alkynyl, and R1 is cycloalkyl, alkynyl, alkenyl, or cyano. WO 95/13 273 discloses a compound of WO 95 / 125,83 ((S)-(_)-6_gas-4-cyclopropyl_3,4-dihydro · 4 ((2 · pyridine tomb) Asymmetric synthesis of ethyl) -2 (1hydro) -oxazolone. The synthetic steps for preparing the above quinazolinone are detailed in the following references: Houpis et al., Tetr. Lett. 1994, 35 (37), 6811-6814; Tucker et al., J Med. Chem. 1994, 37, 2437-2444: and Huffman et al., J. Org. Chem. 1995, 60, 1590-1594. DE 4,32,347, describes a zomolone with the following formula:

Where R is phenyl, carbocyclic, or heterocyclic. The present invention does not consider such compounds. Even today's reverse transcriptase inhibitors have been quite successful, but it is still found that the size of this paper applies to the Chinese National Standard (CNS) A4 specification (210X297 mm) (Please read the precautions on the back before filling this page)

587078 A7 Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs

J «/ 〇78: H £ 'Invention note (6

Crb 'ΚΛ〇] is defined as 8 below, and its stereoisomeric preparation J,' form < mixture, or its pharmaceutically acceptable salts are effective reverse transcriptases Inhibitor. Detailed description of the examples, [1] Therefore, in the first specific example, the present invention provides a novel compound of formula ϊ: (Please read the precautions on the back before filling this page) -iti Γ R1 R2

Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs, or its stereoisomers or pharmaceutically acceptable salts, where: R1 is a Cl-3 alkyl substituted with 1-7 odontins; R2 is selected from R4 substituted Cl_5 alkyl groups, 1-2 R4 substituted C 2-5 fluorenyl groups, and 1 R 4 substituted C 2 _ 5 alkynyl groups; R3 (in each case) is independently selected In (^ _4 alkyl, OH, Cb4 alkoxy, F, Cl, Br, I ,, NR5R5a, N02, CN, C (0) R6, NHC (0) R7, and NHC (0) NR5R5a, ... In one case, if there are two R3 groups and the adjacent carbon source -9 is attached-this paper size applies the Chinese National Standard (CNS) A4 specification (210 X 297 mm) printed by the Employees' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 587078 kl ____ B7_ V. Description of the invention (7) --- can be combined to form -0CH20-; R4 is selected from 0.2 substituted by 3 R3 (: 3_5 cycloalkyl, substituted by 0_5 R3 Phenyl, and a 5-6 membered heterocyclic system substituted with 0-2 R3 (which contains 1-3 heteroatoms selected from oxygen, nitrogen, and sulfur); R5 and R5a are independently selected from hydrogen and Cw Alkyl; R6 is selected from hydrogen, hydroxy, Cm alkyl, Cm alkoxy, NR5R5a; R7 is selected from Cm alkyl, and Cu alkoxy; R8 is selected from hydrogen, C3.5-cycloalkyl, and C1-3 alkyl; and η is selected from 0,1,2,3, and 4. [2] In a preferred embodiment, the present invention provides a novel compound of formula j, wherein: R1 is a Cu alkyl substituted with 1-7 halogens; R 2 is selected from ci substituted with 1 R4 5 bases, C2-5 fluorenyl substituted with 1 R4, and C2_5 alkynyl substituted with 1 R4; R3 (in each case) is independently selected from Cb4 alkyl, hydroxyl, Cl_4 alkoxy , F, Cl, Br, I, NR5R5a, N02, CN, C (0) R6, NHC (0) R7, and NHC (0) NR5R5a; In the other case, if there are 2 R3 groups, and attached Next to its adjacent carbon atoms, they can be combined together to form _〇CH20-; R4 is selected from C3_5 cycloalkyl substituted with 0-2 R3, phenyl substituted with 0-2 R3, and 5-6 member heterocyclic ring system substituted by R3 (containing 1-3 heteroatoms selected from oxygen, nitrogen, and sulfur); R5 and R5a are independently selected from hydrogen, CH3 and C2H5; -10-this paper is applicable to countries Standard (CNS) A4 (210x297 mm) (Please read the notes on the back before filling in this ) Order 587078 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs. 5. Description of the invention (8 R is selected from hydrogen, hydroxyl, CH3, C2H5, ocu3, 0CU3, OC2H5, and NR5R5a; R is selected from ch3, C2H5, OCH3, and 〇 c2H5: R8 is selected from hydrazone, cyclopropyl, ch3 and c2h5; and n is selected from 0, 1, 2, and 3. [3] In a more specific embodiment, the present invention provides a novel compound of formula j, wherein: R1 is selected from cf3 and c2f5; R is selected from ci_3 tiger group substituted with 1 R4, and substituted with 1 R4 Pan C 2-3 fluorenyl, and C 2 · 3 block substituted with 1 R 4; R 3 (in each case) is independently selected from Cb 3 alkyl, hydroxyl, Ci 3 cadaveryloxy, F, Cl, Br, I, NR5R5a, N02, CN, C (0) R6, NHC (0) R7, and NHC (0) NR5R5a: Another way is, if there are two R3s and they are attached to Zheng Jinzi, they can be common Composition -0CH20-; and R4 is selected from C3_5 cycloalkyl substituted with 0-2 R3, phenyl substituted with 0-2, and 5-6 membered heterocyclic ring substituted with 0-1 R3 (It includes 1-3 heteroatoms selected from oxygen, nitrogen, and sulfur): R5 and R5a are independently selected from hydrogen, CH3 and C2H5; R6 is selected from hydrogen, hydroxyl, CH3, C2H5, OCH3, oc2i ^ NR5R5a , And C, please read and read the notes on the back and fill in this page)-· R7 is selected from CH3, C2H5, OCH3, 0〇2 and R8 is selected from hydrogen, CH3 and C2H5: and n is selected from 0, 1, and 2 . -11-This paper size applies Chinese National Standard (CNS) A4 (210X 297mm) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 587078 5. Description of the invention (9) [4] In a better specific example, The present invention provides a compound of formula I, wherein: R1 is CF3; R2 is selected from the group consisting of C1 · 3 alkyl substituted with 1 R4, C2_3 alkenyl substituted with 1 R4, and 1 substituted with R4 C2-3 alkynyl; R3 (in each case) is independently selected from Ci-3 alkyl, hydroxy, c1-3 alkoxy, F, Cl, Br, I, NR5R5a, no2, CN, C ( 0) R6, NHC (0) R7, and NHC (0) NR5R5a; Another case is that if there are two R3 and adjacent carbon atoms are attached, they can be composed together · 0 (: Η20 ·; R 4 Selected from cyclopropyl substituted with 0 to 1 R3, phenyl substituted with 0 to 2 R3, and 5-6 membered heterocyclic ring systems substituted with 0_1 to R3 (including 1 to 3 selected from oxygen , Nitrogen and sulfur heteroatoms), in which the heterocyclic system is selected from 2-rhodido, 4-diodonyl, 2-octanoyl, 3-succinyl, 2-pyrimyl, 3-pyrimyl , 2-oxazolyl, 2-oxazolyl, 4-isothiazolyl, and 2-imidazolyl; R5 and R5a are independent Selected from hydrogen, CH3 and C2H5; R6 selected from hydrogen, hydroxy, Ch3, c2H5, och3, oc2h5, and NR5R5a; R7 selected from CH3, C2H5, OCH3, and OC2H5; R8 selected from hydrogen, CH3 and C2H5; and n selected Since 1 and 2. [5] In another preferred specific example, the compound has the formula I & -12- This paper size applies the Zhongguanjia standard (T ^ s) A4 specification (210X 297 mm) '' *--(Please read the precautions on the back before filling out this page), 11 587078 Α7 Β7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs V. Invention Description (10)

la.

[6] In another preferred embodiment, the compound is really lb ··-

Work b.

[7] In another preferred embodiment, the compound of formula I is selected from: (+/-)-6-gas-4-cyclopropylethynyl-4-trifluoromethyl-3,4-di Hydrogen-2 (1 hydrogen) -p Kuijun 17 Lin Stong; (+ /-)-6 • chloro-4- (2-ρ than yodoyl) ethyl block-4_digasmethyl-3,4 -Diazine-2 (1 hydrogen) -p-quinazolinone; (+/-) _ 6-Ga-4-phenylethyl-4-digasmethyl-3,4-dichloro-2 (1 (Hydrogen) -p quinone ττ linone; (+/-) _ 4-cyclopropylethyl-6-methoxy-4-difluoromethyl-3,4_dichloro-2 (1 hydrogen) _ p-quinone ketone; (+ /-) _6 -methoxy_4_ (2-p than ydoyl) ethyl block: yl-4-difluorofluorenyl-3,4_ dihydro · 2 (1 hydrogen)- Quinazolinone; (+ /-)-6-methoxy-4-phenylethyl block-4 -difluoro ^ methyl · 3,4 -dirat--13-This paper size applies to Chinese national standards (CNS) Α4 specification (210X297 mm) (Please read the notes on the back before filling out this page) 587078 Printed by the Consumers Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Invention Description (11) 2 (1H) Azolinone; (+ /-)-4-cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2 (1 hydrogen) -Kou Kuijun Ketone; (+ / _) _ 5,6-difluoro-4_ (2- (Pyridyl) ethynyl_4-trifluoromethyl-3,4-dihydro-2 (1hydro) -quinazolinone; (+/-) _ 5,6_digas-4-phenylethoxyl _4_Digasmethyl-3,4-dichloro-2 (1hydro) -quinazolinone; (+ /-)-4-cyclopropylethyl block-6-said 4-digas -3,4 -diaza-2 (1 hydrogen) -4 TT Linone; (+ /-) _6_ gas-4_ (2-ρ than ydenyl) ethyl block-4-trifluoromethyl- 3,4_dichloro-2 (1 hydrogen) -p-quinone 4 ketone; (+ /-) -6-speak-4 -phenylethyl-4-difluoromethyl-3,4-diazine -2 (1 hydrogen) -0 quatridone; (+ /-)-6-gas-4_ (2'_2-p than ydoyl) ethyl_ 4 -digasmethyl-3,4 _ dihydro -2 (1hydro) -oxazolinone; (+ /-)-6 -fluoro-4_phenylethyl_4_trifluoromethyl-3,4_dihydro-2 (1hydro) -η Kui Junlin Ketone; (-)-6-Ga-4-cyclopropylethyl 4-methyl-4-difluoro ^ methyl-3,4-dichloro_2 (1 hydrogen) -p Ketulol ττ Linone: (+)-6 • Gas_4_cyclopropylethenyl_4_digasmethyl-3,4-diazine_2 (1 hydrogen) · 4 Junlinone; (+)-4-cyclopropane -Ethylethenyl-5,6-digas-4-digasmethyl-3,4-dichloro · 2 (1hydro) · quinazolinone; (-)-4 -cyclopropylethyl- 5,6 · Diqi-4-diazimidyl-3,4-dirat--14- Applicable for this paper size National Standard (CNS) A4 (2l0X297 mm) (Please read the precautions on the back before filling out this page) 587078 A7 B7 V. Description of the invention (12 2 (1 hydrogen) -quinazolinone; (+) · 4 · ε. Cyclopropenylvinyl. 5,6_mmethyl_3,4_dihydro-2 (1hydro) quinolone; (-) _ 6-chloro-4-E-cyclopropylethylenyl 4_trifluoromethyl_3 4_dihydro-2 (1 hydrogen). Junjunlinone; or its pharmaceutically acceptable salts. : M in the second concrete example], the present invention provides a novel compound of < π: '

(Please read the precautions on the back before filling out this page) •-^ 11 Clothing. Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economy or its stereoisomers or its pharmaceutically acceptable salts, where: R2 is CeC-R "R3 is selected from the group consisting of C-4 alkyl, hydroxy, Ci-4 alkyloxy, F, Cl, Br, I, NR5R5a, No2, CN, C (0) R6, NHC (0) R7 , And; NHC (0) NR5R5a; "selected from fluorenyl, ethyl, n-propyl, iso-propyl, iso-butyl, tert-butyl, and iso-pentyl; R5 and R5a are independent It is selected from hydrogen and Ci-3 alkyl; R6 is selected from hydrogen, hydroxyl, Ci_4 alkyl, Cb4 alkoxy, and NR5R5a; R7 is selected from Cu alkyl and Cy alkoxy; -15 This paper size applies to Chinese national standards (CNS) A4 specification (210X297 mm) 587078 A7 B7 V. Description of the invention (13) R8 is selected from hydrogen, c3.5 cycloalkyl, and Ci 3 alkyl; and η is selected from 0'1,2,3, And 4. [9] In another preferred embodiment, the present invention provides a novel compound of formula π, wherein: R2 is CEC-R4a ~ R is selected from the group consisting of Ch4, hydroxyl, Ci 4 alkoxy, F, C1, Br ,, 1, NR R a, N02, CN, C (0) R6 and NHC (C)) R7: R is selected from methyl'ethyl, n-propyl, isopropyl, iso-butyl, and second- Butyl, and isopentyl; 'R5 and 1153 are independently selected from hydrogen, CH3 and C2H5; R is selected from hydrogen, hydroxyl, ch3, c2h5, och3, OC2H5, and NR5R5a; ^ R7 is selected from CH3, C2H5, OCH3, And oC2H5; R8 is selected from hydrogen, cyclopropyl, CH3 and C2H5; and n is selected from 0, 1, and 2. [10] In another preferred embodiment, the compound has the formula n a (please read the note ^^ on the back before filling this page).

Printed by 1T Consumer Cooperatives, Central Standards Bureau, Ministry of Economic Affairs

[11] In another preferred embodiment, the compound has the formula nb -16- The paper size is applicable to the Chinese National Standard (CNS) A4 specification (210X mm) 587078 A7 B7 V. Description of the invention (14)

lib. Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs [12] In another preferred embodiment, the compound of formula II is selected from: (+ /-)-6-chloro-4_isopropylethynyl-4 -Trifluoromethyl-3,4-dihydro_i (l hydrogen) -η quinoxalenone; (+ /-)-6-Ga-4 -ethylethyl block_4_trigasmethyl- 3,4 · ^^ chloro-2 (1 hydrogen) -π-quizonlinone; '(+ /-)-4-isopropylethyl-6-fluorenyloxy · 4-trifluoromethyl-3 , 4 -dichloro-2 (1hydro) _ρ kujunlinone; (+ /-)-5,6 -difluoro-4 · isopropylethyl-4-trifluoromethyl-3,4- Dihydro • 2 (1hydro) -quinazolinone; (+ /-)-5,6 -bis-a-4 -ethylethyl block Qin-4-trifluoromethyl_3,4 -dichloro- 2 (1 hydrogen) -p quinjunlinone; (+ /-)-5,6 difluoro-4 · isoamyl-4 · trifluoro, methyl_3,4 · dihydro-2 (1 hydrogen) · P-quinone ketone; (+ /-)-6-Ga-4-isopropylethyl block-4_diamidino-3,4-diaza-2 (1 hydrogen) -ρ quinone Ketones; (+ /-)-6 -fluoro-4 -ethylethynyl-4-trifluoromethyl-3,4 · dihydro-2 (1 hydrogen)-quinazone; (-)-5, 6_difluoro_4_isopropylethynyl-4-trifluoromethyl-3,4-dihydro · 2 (1 氲) _quinazolinone; (+)-5,6-difluoro-4 -different Ethyl block-4-trimethyl-3,4_dihydro--17- This paper size applies to China National Standard (CNS) A4 (210X 297 mm) (Please read the precautions on the back before filling This page) 587078 Μ B7 V. Description of the invention (15) (2 (1 hydrogen) · quinazolinone; (-)-5,6 • digas_4_ethylethyl block-4 -trifluoro ^ A -3,4 -dichloro-2 (1 hydrogen) · p-quinone plinone; (+)-5,6-diazine-4_ethylethyl block-4_diazylmethyl-3, 4-Dimur-2 (1 hydrogen) p-quinone 4 ketone; or a pharmaceutically acceptable salt thereof. In a third specific example, the present invention provides a novel pharmaceutical composition, including medicine A carrier and a therapeutically effective amount of a compound of formula I or II, or a pharmaceutically acceptable salt thereof. In a fourth specific example, the present invention provides a novel method for treating HIV infection, which includes the need for The host of such treatment administers a therapeutically effective amount of a compound of Formula I or II or a pharmaceutically acceptable salt thereof. In a fifth specific example, the present invention provides a novel method for treating HIV infection, which includes the need for The place for this treatment Therapeutically effective amount of co-administered comprising: or II (a) of formula I; and (b) at least one compound selected from HIV reverse transcriptase inhibitors and HIV protease inhibitors. Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs (please read the notes on the back before filling this page) In another preferred specific example, the reverse transcriptase inhibitor is selected from AZT, 3TC, ddl, ddC, d4T, (Da Le Fan Ding) delavirdine TIBO derivative, BI-RG-587, (Na Fan Le Ping) nevirapine, L_697,661, LY 73497, Rol 8,893, (Luo Fan Li) loviride, (Ke Fanding) trovirdine, MKC-442, And HBY 097, and the protease inhibitor is selected from (Sekfan) saquinavir, (ritnavir) ritonavir, (Indina-18- This paper size applies Chinese National Standard (CNS) A4 specification (210X297 mm) 587078 A7 B7 V. Description of the invention (16 Fans) indinavir, VX_478, (Nafnafan) nelfinavir, KNI-272, CGP-61755, U-140690, and ABT-378. In another better specific example, the inverse Transcriptase is selected from Αζτ and 3TC, and protease inhibitor is selected from (Secfan), (Litnavan) ritonavir, (Nafnavan) nelfinavir, and (Indinavan) indiavir 〇 In another best Specific example The agent is Ατ. In another preferred embodiment, the protease inhibitor is (indinavir) indinavir. In a sixth embodiment, the present invention provides a pharmaceutical kit for treating mv infection < In one or more sterile containers, it comprises a therapeutically effective amount of: (a) a compound of formula I or II; and (b) at least one selected from the group consisting of HIV reversal green enzyme inhibitors and mv protease inhibitors. In a seventh specific example The present invention provides a novel method for inhibiting HIV stored in body fluid samples, which includes treating body fluid samples with the therapeutic content formula! Or η compounds. Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back first) (Fill in this page) In an eighth specific example, the present invention provides a novel kit or container for the poor, including a compound of formula I or II that is used as a standard or an effective amount of a reagent for testing or analysis, To determine the potential medical ability to inhibit HIV's reversal of green enzymes, guess the long (or both). The terms used in this manual and their legal meanings 1 1 I am as follows, what you need to know is -19- 587078 Description of the invention (17 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs, the compound of the invention contains an asymmetric carbon atom, so it is divided into a form or a racemic form. How to prepare light / formula is well known in the art. Formal disintegration, or synthetically initiated from optical activity. Unless specific isomeric forms or isomeric forms are specifically indicated, all palmar centers, nonstereomeric forms, racemic forms, and all geometric isomers of the structure are included. " The method for completing the present invention is at least a few grams scale, a kilogram scale, a few kilogram scale, or an industrial scale. A few grams scale is preferred in this specification, and the starting material used is at least 1G grams or more than 1G. Grams, more preferably at least 50 grams or more than 5G grams, and most preferably at least gram or more than iG. The scale of several kilograms in this specification means that at least one of the starting materials used is more than one kilogram. The industrial scale used in this specification means the scale outside the laboratory, which can be sufficient for clinical testing or the general consumer to supply sufficient products . "Alkyl" as used in the present invention means including aliphatic hydrocarbon groups having a specific number of carbon atoms and which may be branched or linear saturated. Examples of alkyl groups include, but are not limited to, methyl'ethyl , N-propyl, iso-propyl, n-butyl, second-butyl, third-butyl, n-pentyl, and second-pentyl. "Haloalkyl" means a branched or straight-chain saturated aliphatic hydrocarbon group (e.g., _ CvFw, where v = 1 to 3 and w -1 to (2 v + 1)) 'Examples of halogenated alkyl groups include, but are not limited to, trifluoromethyl, trifluoromethyl, pentafluoromethyl, and pentafluoromethyl. "Alkoxy ,, The definition is as defined for alkynyl, and the carbon atom referred to is bonded with oxygen as a bridge. Examples of alkoxy include (but are not limited to) methoxy, ethoxy, n-propoxy, iso- Propoxy, n-butoxy, second-butoxy, third-butoxy, n- (Please read the notes on the back before filling out this page) Order-20- This paper size applies to Chinese national standards (CNS) A4 specifications (21〇 < 297 issued) A7 B7 V. Description of the invention (18) ^ foxy, and second pentyloxy. ,, cycloalkyl, is meant to contain a saturated ring, such as propyl, cyclobutyl, or cyclopentyl. ,, alkenyl, means having one or more unsaturated carbon-carbon double bonds at any stable bond on a straight or branched chain structure, such as ethylene, propionate and the like. "Alkynyl" means one or more unsaturated carbon-carbon triple bonds at any stable bond on a straight or branched chain structure, such as acetylene, propyl block, and the like. As used in this specification Tooth element means fluorine, gas, bromine and iodine. The relative ion used in the present invention means a small, negatively charged ion, such as chloride, bromide, hydroxyl ion, acetate ion, sulfate Ionic and similarly used in the present invention, "aryl group, or," aryl group residue "means an aromatic moiety having a specific number of carbon atoms, such as phenyl or fluorenyl. As used herein, "carbocyclic ring" or "carbocyclic residue" means any 3- to 5-membered stable monocyclic structure, which may be saturated or unsaturated. Examples of such carbocyclic rings include (but are not limited to) Yu) Cyclopropyl'cyclopentyl, cyclohexyl, phenyl, bisphenyl, Fanyl " fluorenyl, adamantyl, or tetrahydronaphthyl (tetrahydronaphthyl). Consumer Cooperatives, Central Standards Bureau, Ministry of Economic Affairs For the printing of the present invention, a heterocyclic ring, or a heterocyclic ring system, means a 5- to 6-membered stable single heterocyclic ring, which may be saturated, partially unsaturated, or unsaturated (aromatic), It consists of carbon atoms and 1 to 3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and nitrogen and sulfur heteroatoms can be oxidized as appropriate. Any heteroatom or carbon atom on the heterocycle can be bonded to its subsidiary group If the compound produced is stable, the carbon or nitrogen atom of the heterocyclic ring system described in this specification may be substituted. If specifically mentioned, the nitrogen atom on the heterocyclic ring may be four as the case may be. Hierarchy. The total number of sulfur and oxygen atoms in the heterocycle exceeds 丨, and these heterogens

This paper size applies to China National Standards (CNS) A4 specifications (21〇 &^; ^^^ y 587078 Μ B7) Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 5. The invention description (19) Preferably, the total number of sulfur and oxygen atoms on the heterocyclic ring does not exceed 1. As used in this specification, the aromatic heterocyclic ring system means any stable 5- to 6-monoheteroaromatic ring, which is composed of Carbon atoms and i to 3 are independently selected from the group consisting of nitrogen, oxygen, and thiagen T, and it is preferred that the total number of sulfur and oxygen atoms in the fragrant heterocyclic ring does not exceed 1. & Examples of heterocyclic rings include (but not Limited to) 2-pyrrolidinone, 2-hydropyrrolidinyl, 4-pyridone, 6-hydro-i, 2,% pyrimidinyl, 2 hydrogen, 6-hydropyridinyl , Furyl, furfuryl, tetrahydroimidazolyl, imidazolinyl, imidazolyl, isoroxazolyl, morpholinyl, oxadiazolyl, diazolyl, 1,2,4 υ,% pyridazolyl, ^, laridine di & yl ', methyl, hexafluoromethyl, hexamethylpyridyl, < pyridyl, hexahydropyridone, 4-hexahydropyridone , Pyridinyl, purinyl, piperidine , Pyrimidinyl, pyrazolyl, pyrazolinyl, pyrazolyl, targonyl, pyridinyl, pyridyl, pyrimidinyl, pyrrolidinyl, pyrrolinyl, pyrrolyl, tetrahydrofuranyl, 6Η · 1,2,5_Sulfuric acid base, sulfuric acid base, 1,2,4-sulfuric acid fertilization base, sulfuric acid fertilization base, ^, sulfuric acid fertilization base, thiazolyl, fluorenyl, fluorenyl Pyrimazolyl, phenphenazolyl, phenphenimidazolyl, phenphenyl, triazolyl, triazolyl, u2,4 • triazolyl'1,2,5-trisyl, and nrtrisyl Preferred heterocycles include, but are not limited to, pyridyl, furyl, pyrenyl, pyrrolyl, pyrazolyl, imidazolyl, and oxazolyl, as well as fusion rings and spin compounds containing the aforementioned heterocycles. The term "HIV reversal green enzyme inhibitor" used in this specification means the replacement and non-reversion inhibitors of mv reversal green enzyme (RT). Examples of nuclear reversion inhibitors include -22- This paper applies Chinese national standards (CNS) Α4 specifications (210 ^ 97 ^ (Please read the precautions on the back before filling out this page) • Clothing ·

1T 587078 A7 B7 printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (20) (but not limited to) AZT, ddC, ddl, dT4 and 3TC, non-nucleoside RT inhibitors include (but not limited to) ) Delavirdine (Famasia and Puqiang U90152S), TIBO derivative, BI-RG-587, nevirapine (Berlin Geinjihan), L-697,661, LY73497, Ro 18,893 , 10 viride (Jeshen), trovirdine (Lilly), MKC-442 (Teinger), and HB Y 097 (Hurst). As used herein, `` HIV protease inhibitor, '' means a compound capable of inhibiting HIV protease. Examples include, but are not limited to, saquinavir (Roche, R03 1-8959). Ritonavir (Abbott, ABT-538), Indinavir (Merck, MK-639), VX-478 (Fordtex / Grossell Wilcon), Naffna Nelfnavir (Agron, AG-1343), KNI-272 (Engenji, Japan), CGP-61755 (Siba-Gig), U-140690 (Famacia Jeep Strong), and ABT- 3 78. Other examples including cyclic protease inhibitors are disclosed in WO 93/07128, WO 94/19329, WO 94/22840, and PCT patent document US 96/03426. "Pharmaceutically acceptable salts" as used in this specification means derivatives of the disclosed compounds, which are modified from the parent compound to its acid or base addition salt. Pharmaceutically acceptable salts Examples of classes include, but are not limited to, mineral or organic acid salts of basic residues (such as amines), basic or organic, salts of acidic residues (such as carboxylic acids); and the like. Pharmaceutically acceptable salts include, for example, customary non-toxic salts or quaternary ammonium salts of parent compounds formed from non-toxic inorganic or organic acids, such as such customary non-toxic salts including -23-this paper standard applies China National Standard (CNS) A4 specification (210x297 mm) (Please read the notes on the back before filling this page), τ 587078 Μ 5. Description of the invention (21 Derived from inorganic acids such as hydrogen acid, hydrobromic acid, Sulfuric acid, sulfamic acid, phosphoric acid, nitric acid and the like; those derived from organic acids include acetic acid, propionic acid, succinic acid, glycolic acid, stearic acid, lactic acid, malic acid, tartaric acid, citric acid, ascorbic acid, Parma Acid maleic acid Maleic acid, phenylacetic acid, pivalic acid, benzoic acid, salicylic acid, sulfanilic acid, 2-acetamoxybenzoic acid, fumaric acid, toluenesulfonic acid, methanesulfonic acid, ethanesulfonic acid, ethanesulfonic acid, oxalic acid , 2-isethionate, and the like. The pharmaceutically acceptable salts of the present invention can be synthesized from the parent compound containing a basic or acidic portion by conventional chemical methods. Generally, in water or in organic These salts can be prepared by reacting the free acid or base form of these compounds with a suitable base or acid in a stoichiometric amount in a solvent, or a mixture of the two; usually, non-aqueous substrates, such as ether, acetic acid Ethyl esters, ethanol, isopropanol, or acetonitrile are preferred. Suitable salts are listed in Remington, s Pharmaceutical Sciences, 17th Edition, Mike Publishing, Easton, PA, 1985, p. 1418, as disclosed in this document. Incorporated herein by reference. The term "pharmaceutically acceptable," as used in this specification, means that the compounds, substances, compositions, and / or dosage forms used in safe medicinal use are suitable for use with humans and Contacted by animals, and Can produce excessive toxicity, printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling out this page), 1T stimulation, allergic reactions, or other problems or complications with reasonable benefits / risks 0 "Prodrug" is meant to include a compound according to formula (I) or another chemical formula or a compound of the present invention, which is a prodrug of a compound of the present invention ( For example, formula (I)) is a functional group stored on a modified compound, so it can be removed after being applied in general or in vivo. • 24-587078 Printed by A7, Consumer Cooperative of the Central Standards Bureau, Ministry of Economic Affairs. Description of the invention (22) A decorated parent compound, the compounds of the present invention include prodrugs. When a mammal administers a prodrug, the hydroxyl or amine group bonded to any group will be cut off to form a free hydroxyl or Free amine group. Examples of prodrugs include, but are not limited to, acetic acid, formic acid and benzoic acid derivatives of alcohols and amine functional groups on compounds of the present invention, and the like. "Stable compound" and "stable structure" mean that the compound is sufficiently purified robustly from the reaction complex to an effective level, and is formulated into a therapeutically effective preparation. The present invention prepares only stable compounds. Substitution means that when the normal valence of the atom used does not exceed, one or more hydrogens on the indicated structure are replaced by the selected group, and the substitution results in a stable compound. When substituted When the group is a keto group (that is, = 0), two hydrogen atoms are substituted. "Therapeutic content" means the content of the compound of the present invention or the content of a compound of a combination formula which can effectively inhibit the infection of HIV or treat the symptoms of host infection. The compound of a combination formula is a preferred multiplicative combination mode, and a multiplicative example As described in Chou and Talalay AdvEnzyme Re㈣ 22: 2 ^ -55 (1984), the effect when a combination compound is administered (in this case, the inhibition of HIV replication) is greater than that when a single agent is administered The addition effect of the compound is good. Generally, the multiplicative effect is the most obvious when the compound is administered below the highest concentration. From another perspective, the multiplicative effect means that the cytotoxicity is low and the antiviral effect is increased. Combined benefits of various other ingredients. Synthetic effect Those skilled in organic synthesis techniques can prepare the compounds of the present invention in several known ways, which can be combined with those known in organic synthesis techniques by the methods described below -25 mi ί ϋ ί I (Please read the precautions on the back before filling this page) The size of the paper used in this edition is applicable to China ’s national standard TiSs. Α4 specification (210X297 public celebration) " Ming (23 :: The method known to the person who synthesizes the present invention < The listed references are limited to) The following materials method, with 1 process 1 0

R

/ C〇〇H hn (ch3) 〇ch], Gu: ^-~

'N .OCH3 CM,

Nib.THSCl, RxMgX,

Printing process 1 of the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs illustrates the preparation of keto_aniline with suitable substituted 2-aminobenzoic acid, and this acid is converted into N_methoxy-N · methylamidine derivatives, and thereafter Then it is substituted into R1-substituted ketone, and keto-aniline can be used as an intermediate substance of the compounds in the scope of the present patent application. ^, Flow 2

I2, NaIIC〇3

Nib

I Me3CCOCl NaIIC03 --- Bu nh2 n ~ Bu Li

cf3 〇〆 〇 Λ 6N-HC1 CF3C02Et

NH

I Nil 〇〆cf3 nh2 -26 This paper size is applicable to Chinese National Standard (CNS) A4 (21〇X 297 mm) 587078 / ΚΊ Β7 5. Description of the invention (24 Scheme 2 illustrates another method for preparing keto-aniline, This is based on the synthesis of suitable substituted lignans. After basalization and amine protection, ketones such as trifluoromethyl are incorporated into the structure using strong testing and ethyl difluoroacetate, and ketones can be obtained after deprotection- Aniline. Other methods for the preparation of ketones and anilines are well known in the art. How Bis et al., Tetr Lett 1994, 3 5 (3 7), 6811-6 ^ 14, the content of this document is incorporated into this description. Reference in the book., Flow 3

COOH HN (CH3) OCH: nh:

con (〇cn3) ch3

TrBrr DIPEA ------ ^

CON (OCH3) CH3 N (H) Tr CH2C12

oxidation

Reduction CH0N (Η) Tr Q, CF3 N (H) Tr Another method for preparing 2-trifluoroacetanilide by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs is listed in Scheme 3, after the formation of protective aniline , Reducing amidine and adding trifluoromethyl, and oxidizing with an oxidant (such as an oxidized bell) to produce a usable intermediate. Flow 4

R Oil a) TMSNCO DMAP / THF b) TBAF / TI ^ F

4 Eight molecular sieves NH sieves ~ -------- 〇 〇

R1 27 587078 A7 B7 V. Description of the invention (25)

a · n-BuLi / HCCRVTHF b. BF3〇Et2,

Pd / C R4

H, S, (Please read the precautions on the back before 4-writing this page) Using the detailed general method described in Scheme 4, we can prepare the compound of the present invention in an anhydrous tetrahydrofuran solution containing dimethylaminopyridine The ketone-aniline prepared in the method described in Schemes 1 and 2 is reacted with trimethyl monosilyl isocyanate 'and then treated with tetrabutylammonium fluoride to obtain hydroxy · urine L, which is refluxed in toluene Or in xylene, dehydrate the hydroxyl-urine 2_ with a dehydrating agent (such as 4 a molecular sieve) to produce ketimine L. Use linear lithium (this is in a different container. (Prepared after reaction with n-butyl butyl bell in anhydrous tetrahydrocran). After treatment of ketimine ^ __, the addition of substituted acetylenic R2 group can obtain 4,4_disubstituted 3,4- Dihydro-2 (1hydro)-, kulinglinone, which is a compound of formula I. Reduction of the bulk bond of compound 4_ (such as by using tritiated action) can produce the corresponding fluorenyl group (not listed) or saturated compound 5. In the presence or absence of a Lewis acid catalyst (such as PF3), the direct reaction of the imine 2__ with R2Li or the Grignard reagent R2MgX can incorporate other R2 groups. Refer to Huffman et al., J. Org. Chem · 1995,60,1590_1594, this article-28- This paper size applies to China National Standard (CNS) A4 specification (210X297 mm)

， 1T Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs 587078 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economics. In some examples, the mirror image isomer of a compound of formula I or Π has better activity than other isomers. When necessary, it is demonstrated by HPLC using Examples 27-34 (Scheme 4) The separation of racemic materials on the stem column 'or using a dissociating agent (such as galactone acid gas, such as Thomas J Turke, et al., J. Med. Chem. 1994, 37, 2437-2444) to dissociate Separation of racemic material. It is also possible to synthesize the palmity of compounds of formula I directly using palmity catalysts or palmate ligands, such as Mark A. Huffman, et al., J. Org. Chem. 1995, 60, 1590 -1594. The specific examples described in the following examples can illustrate other characteristics of the present invention, and the specific examples described are used to illustrate the present invention, and the present invention is not limited thereto. The meanings of the abbreviations used in the examples are as follows: ,,,, means Celsius, "d" means double, "dd" means two doubles, "eq" means equivalent or equivalent, "g" means gram, " “mg” means milligram, “mL” means milliliter, “H” means hydrogen, “hr” means hour, and “m” means multiple times, “M” means mole, “min” means minute, and “MHz” Means millions of hertz, "MS" means mass spectrometer, "nmr" or "NMR" means nuclear magnetic resonance mass spectrometer, "t" means three times, "TLC" means thin layer chromatography, and "EDAC" means 1_ (3.2 Fluorenylaminopropyl) -3 -ethylcarbodiimide hydrochloride, "DIPEA" means diisopropylethylamine, "TBAF" means tetrabutylamine fluoride, "LAH" means lithium aluminum hydride, And "TEA" means triethylamine. Example 1 -29-This paper size applies Chinese National Standard (CNS) A4 specification (210 × 297 mm) — (Please read the precautions on the back before filling this page), 1T 587078 A7 B7 V. Description of the invention (27) Preparation (+ /-) _6 · qi_4_cyclopropylethoxy-4_trifluoromethyl_3,4_digas_2 (1 hydrogen) -4 isorone (r4 = cyclopropyl),

cf3 I a f

a) THSNCO ΟΜΛΡ / THF b) TBAF / TIIF

Phcil3 Ti, mol, fractionation sieve R4

ΙΙΙ-ί

• O

-------- 4! (Please read the notes on the back before writing this page) Step 1. Synthesis of II-a from I_a Dimethylaminopyridine (0.25 g, 2.02 mmol) and Trimethyl isocyanate (6.05 g, 7.11 ml, 52.5 mmol) was added to a solution of anhydrous THF (40 ml) containing a compound of formula Ia (4.5 5 g, 20.2 mmol), and The mixture was stirred for about 16 hours at room temperature, then tetrabutylammonium fluoride (dissolved in THF, 1 M solution, 21 ml) was added, the viscous mixture was diluted with additional THF (20 ml), and Stir at room temperature for 0.5 hours, remove the THF under reduced pressure, and dissolve the residue in EtOAc (100 mL), and then sequentially with 1 N HC1 (70 mL), saturated NaHC03 (70 mL) aqueous solution and saturated NaCl aqueous solution (50 ml) was washed, and the organic phase was dried with MgSO4, filtered and the filtrate was concentrated under reduced pressure, so as to produce a pale yellow solid substance. The solid was triturated with hexane to remove the yellow color to obtain a white solid. Ila (5.09 g, 94%): 4 NMR (300 MHz, acetone-d6) d ^ 1. Printed by the Consumers' Cooperative of the Central Standards Bureau, Ministry of Economic Affairs-30- Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 587078 A7 B7 V. Description of Invention (28) 9.06 (br s, 1H), 7.48 (s, 1H), 7.40 (br s, 1H), 7.34 (dd,

J = 8.8, 2 · 6Ηζ, 1H), 6.97 (d, J = 8.8Hz, 1H); 19F NMR (282MHz, acetone d-6) d -86.33, -86.35; IR (KBr Shen Dianwu) 1 724, 1 678, 1 3 98, 1198, 1174 cm1; MS (Cl) m / e266 (MH + 100) 〇 Step 2. Synthesis of III-a from ΙΙ-a III-a containing molecular sieve (about 100 mg) (5 · 09 g, 19.1 mol) Toluene (150 ml) suspension was heated under reflux for 16 hours, the resulting yellow clear solution was cooled to room temperature, and the precipitated solid was dissolved in acetone and removed by air filtration It was sieved, and the filtrate was concentrated under reduced pressure, and triturated with hexane to obtain III-a (4.25 g, 89%) as a yellow solid: 4 NMR (300 MHz acetone-d6) d 7.86-7.82 (m , 2H), 7.61 (d, J = 8.8Hz, 1H);% NMR (282 MHz acetone-d6) d-67.88. Step 3. Synthesize iv-a with Ilia. Cool the solution containing cyclopropylacetylene (13.0 ml of 30% by weight toluene / Thf / hexane solution, 59.0 mmol) in anhydrous THF (118 ml) to 78 C. 'Re-treatment with n-BuLi (32.8 ml of a 1.6M hexane solution, 52.4 mmol), put the temperature back to 0 t in an ice bath, and let it stand for 0 5 hours at -78 ° C. Lithium acetylide was added to a solution of III-a (3 12 g, a 6 mM) in THF (66 ml) (addition time was approximately 10 minutes), and then boron trifluoride etherate (0.89 G, 0.80 ml, 6.28 mol), remove the ice bath. The reaction was allowed to warm to room temperature, stirred at room temperature for 4 hours, and then stopped with 1M citric acid (100 ml). In (Please read the notes on the back before filling out this page)-.

1T 31-587078 A7 B7 V. Description of the invention (29) The mixture was concentrated under reduced pressure to 1/2 of the original volume, diluted with EtOAc (200 ml), the aqueous phase was removed, and a saturated NaHC03 aqueous solution (100 ml) was sequentially used. And saturated NaCl aqueous solution (100 ml), and dried with MgS04 organic

JT phase, filtration and concentration of the filtrate under reduced pressure. After purification of the crude material by flash chromatography (3% MeOH / CH2Cl2), a dark yellow oil was obtained, whereby white solid crystal IV-a (R4 = Cyclopropyl) (3.85 g, 97%): m · ρ · 86.6-88 ° C;! H NMR (300 MHz, acetone 8.95 (br s, 1H), 7.51 (br s, 1Η), 7 · 43 (br s, 1Η), 7.40 (dd, J = 8.8, 2.4Ηζ, 1H), 7.02 (d, J = 8.8Hz, 1H), 1.49-1.41 (m, 1H), 0.93-0.82 (m, 1H), 0.77-0.74 (m, 1H); 19F NMR (282MHz acetone-d6) d -82.96; IR (KBr precipitate) 1696, 1172 cm-1; MS (CI) m / e from C14H10ClF3N2O: 315.051201, Found 315.051626; 315 (MH +, 51), 332 (M + NH4 +, 100); calculated and analyzed C14H10N2ClF3O. 0.25H20: C, 52.68; H, 3.32; N, 8.78; found: C, 52.61; H, 3.35; N , 8.28 〇 Example 2 Preparation of (+/-)-6-chloro-4-isopropylethynyl-4-trifluoromethyl-3,4 · dihydro • 2 (1hydro) -quinazolinone (R4 = Isopropyl) Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs (please read the note on the back * Matters before writing this page). Lithium-treated nl-a (50 mg, 0.201 mmol) solution from 3-methyl-1 -butanium block (62 mg, 93 ml, 0.905 mmol), using flash chromatography ( After purification of the obtained crude material (35.0 / 0 EtOAc / hexane), 26 mg (41%) of the desired product was produced: 1h NMR (300 MHzH 9.08 (br s, 1H), 7.59 (br s, 1H), 7.53 ( br s, 1H), 7.40 (dd, J = 8.4, 2.2Hz, 1H), 7.02 (d, -32-) This paper size applies to China National Standard (CNS) A4 (210X297 mm) 587078 Central Bureau of Standards, Ministry of Economic Affairs Printed by employees' consumer cooperatives A7 B7 V. Description of invention (30) J = 8.8Hz, 1H), 2.81 — 2.68 (m, 1H), 1.20 (dd, J = 6.6Hz, 6H); 19F NMR (282MHz acetone -d6) Θ -83.05; C14H12C1F3N20 calculated MS (CI) m / e: 317.066851, found 317.069433; 317 (MH +, 43), 334 (M + NH4 +, 100). Example 3 Preparation of (+ / _) _ 6 -Gas-4- (2 -b-b-based) Ethyl-4 · -trifluoromethyl-3,4-dihydro-2 (1 hydrogen) -p Kui Jun Linone (r4 = p ratio) Based on the method in step 3 of Example 1, treated with lithium aluminized ma (100 mg, 0.402 mmol) derived from 2 ethynylpyridine (0.19 g, 1.81 mmol) Mol) solution, and the crude material obtained was purified by HPLC (2.5% MeOH / CH2Cl2) to obtain 85 mg (60%) of the desired product: mp 105 ° C; 4 NMR (300 MHz, acetone-d6) e 9.14 (br s, 1H), 8.64-8.61 (m, 1H), 7.89-7.84 (m, 2H), 7.70-7.66 (m, 2Η), 7.48-7 · 43 (m, 2H), 7.09 (d , J = 8.8Hz, 1H); 19F NMR (282MHz acetone-d6) ^ -82.48; IR (KBr precipitate) 1704, 1430, 1186 cm · 1; C16H10ClF3N3O MS (CI) m / e: 352.046450, Found 352.046956; 352 (MH +, 100); Computational analysis C16H9C1F3N30 · 0.125 H20: C, 54.3; H, 2.56; N, 11.9; Found: C, 54.71; H, 3.03; N, 11.3. Example 4 Preparation (+ / ·) · 6-Gas · 4 · Ethylethynyl · 4-trifluoromethyl · 3,4-dihydro_2 (1 Hydroquinone ρ Linone (r4 = ethyl) according to Method of Step 3 of Example 1 to treat ιπ-a (100 mg, 0.402 mmol) with lithium acetylide derived from 1-butyne (109 mg, 2.01 mmol) -33- This paper is for China National Standard (CNS) A4 specification (21〇X 297mm) (Please read the note on the back-matters before writing this page), 1T 587078 A7 B7 V. Description of the invention (31) Solution, using HPLC (2.5% MeOH / CH2Cl2) After purification of the obtained crude material, 79 mg (65%) of the desired product can be obtained: b NMR (300 MHz acetone-d6) d 9.05 (br s, 1H), 7.54 (br s, 2H), 7.41-7.39 (m, 1H), 7.02 (d, J = 8.4Hz, 1H), 2.36-2.32 (m, 2H), 2.18-1.13 (m, 3H): 19F NMR (282MHz acetone-d6) d -82.99; C13H1 ( ) MS (CI) m / e calculated by C1F3N20: 303.051201, found 303.0051882; 303 (MH +, 55), 320 (M + NH4 +, 100). Example 5 Preparation of (+ /-)-6-Ga-4 · benzene Ethynyl-4_trifluoromethyl-3,4 · dihydro · 2 (1hydro) -quinazolinone (R4 = phenyl)

A solution of III_a (100 mg, 0.402 mmol) from phenylacetylene (185 mg, 1.81 mmol) was treated according to the method of Step 3 in Example 1, and purified by HPLC (2.5% MeOH / CH2Cl2) After the obtained crude material, 54 mg (38%) of the desired product was obtained: 4 NMR (300 MHz acetone-d6) d 9.07 (br s, 1H), 7.74 (br s, 1H), 7.67 (br s, 1H ), 7.62-7.58 (m, 2H), 7.48_7 · 40 (m, 4H), 7.08 (d, J = 8.4Hz, 1H); 19F NMR (282 MHz acetone-d6) β-82.67; IR Ministry of Economy Printed by the Consumer Standards Cooperative of the Central Bureau of Standards (please read the precautions on the back before filling this page) (anti-31 * sediment) 1696, 1186〇111-1; (: 171111 (: 1? 3) ^ 20 Calculated MS (CI) m / e: 351.051201, found 351.051704; 351 (MH +, 51), 368 (M + NH4 +, 100); calculated and analyzed Ci7H10ClF3N2O · 0.25H2O: C, 57.48; H, 2.98; N, 7.89; found: C, 57.00: H, 3.03; N, 7.48. Example 6 Preparation of (+ / ·) -4 · cyclopropylethyl-6-methoxy-4-trifluoromethyl-3,4- -34-benzyl Paper size applies to China National Standard (CNS) A4 specification (210X297 mm) 587078 A7 B7 V. Description of the invention (32) Dihydro-2 (1 hydrogen) -zozolone (R 4 = cyclopropyl)

(Please read the notes on the back before filling this page) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economy

After treating Va (0.50 g, 2.28 millipods) solution with dimethylaminopyridine and trimethyl monosilyl isocyanate by the method described in Example 1, Step 1, 0.58 g (97%) was obtained. ) Desired product: 4 NMR (300MHz acetone-d6) d 8.81 (br s, 1H), 7.17 (br s, 1H), 7.11 (br s, 1H), 7.00-6.92 (m, 2H), 6.83 (s, 1H), 3.76 (s, 3H); 19F NMR (282 MHz acetone-d6) d-85.99. Step 2. Synthesis of Vll_a from vi-a According to the method described in step 2 of Example 1, the solution of VI_a (0.58 g, 2.21 mmol) was heated under reflux in toluene to obtain 〇 ·. 50 g (93%) of the desired product: NMR (300 MHz acetone-d6) β 7.52 (br s, 2H), 7.27 (s, 1H), 3.90 (s, 3H); 19F NMR (282 MHz propane) -d6) d -68.08 〇 Step 3. Synthesize VIn-a -35 from VII-a-This paper size applies Chinese National Standard (CNS) M specification (210X297 mm) 587078 A7 B7 V. Description of the invention (33) According to the example 1 The method of step 3, treating VII-a (100 mg, 0.410 mmol) with lithium acetylide derived from cyclopropylacetylene (30% by weight of toluene / THF / ethyl block, 1.85 mmol) ) Solution, the crude material obtained was purified by HPLC (2.5% MeOH / CH2Cl2) to obtain 103 mg (81%) of the desired product: iNMRpOOMHz acetone-d6) ci 8.77 (br s, 1H), 7.29 (br s, 1H), 7.06 (br s, 1H), 6.99-6.90 (m, 2H), 3.77 (m, 3H), 1.46-1.38 (m, 1Η), 0.91-0.85 (m, 2H), 0.79-0.72 (m, 2H); 19F NMR (282 MHz acetone-d6) ci-82.61; C15H14C1F3N202 calculation The obtained MS (CI) m / e: 311.100738, found 311.099970; 311 (MH +, 100). Example 7 Preparation of (+ / _)-4_isopropylethynyl-6_fluorenyloxy-4-trifluoromethyl_3,4-difluorenyl_2 (1hydro) · quinazolinone (R4 = Isopropyl) Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs (please read the precautions on the back before filling this page), according to the method in step 1 of Example 1, derived from 3-fluorenyl_1-butyl block (126 mg , 0.19 ml, 1.85 mmoles) of lithium VII_a (100 mg, 0.410 mmoles) solution, purified by flash chromatography (2.5% MeOH / CH2Cl2) to produce 30 mg (24%) Desired product: mp 228-229 ° C; 1HNMR (300 MHz) d 8.72 (br s, 1H), 7.27 (br s, 1H), 7.10 (br s, 1H), 7.00-6.91 (m , 2H), 3.77 (s, 3H), 2.73-2.67 (m, 1H), 1.20 (dd, J = 7 · 0, 丄 · 5 Hz, 6H); 19F NMR (282 MHz acetone-d6) β -82.71 ; IR (KBr precipitate) 1696, 1428, 1190, 1176 cm-1; Calculated MS (Cl) m / e: 313.1 16388, C15H16C1F3N202, found 3 13.1 15871; 313 (MH +, 100), 330 (M + NH4 +, 15); C15H15F3N202 Calculation analysis: C, -36-This paper size is applicable to China National Standard (CNS) A4 specification (2 1GX297 mm) 587078 A7 B7 V. Description of the invention (35) The crude material obtained after purification by flash chromatography (2.5% MeOH / CHbCh) can produce 34 mg (24%) of the desired product: 'mp 206.2-207.7 ° C; 4 NMR (300 MHz acetone-d6) d 8.85 (br s, 1H), 7.60-7.57 (m, 3H), 7.49-7.39 (m, 3H), 7.21 (br s, 1H ), 7 · 05 · 6 · 96 (m, 2H), 3.79 (s, 3H); 19F NMR (282 MH, z, acetone-d6) d-82.32; IR (KBr precipitate) 1696, 1516, 1430, 12s36, 1204, 1184, 1128 cm · 1; C18H14F3N202 Calculated MS (Cl) m / e: 347.100738, found 347.101482; 347 (MH +, 100), 364 (M + NH4 +, 48); C18H13F3N2 02 Calculation analysis: C , 62.43; Ή, 3.78; N, 8.10; found: C, 62 · 35; Η; 3.58; N, 7.83. Example 10 Preparation of (+ /-)-4-cyclopropylethyl block_5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2 (1 hydrogen) · 4 Junlinone ( R4 = Cyclopropyl) (Read the precautions on the back before filling out this page} " 口

IX-a

^ 1. Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs

: i.o rvi / r Η 2 (1 a 丨: m) EtOII / l-l: 0Ac 〆 Nil

XIII -38-This paper size applies Chinese National Standard (CNS) A4 specification (210X 297 mm) 587078 A7 B7 V. Description of the invention (36) Step 1. Synthesis of Xa from IX-a Use the method described in Example 1 Step 1 The solution of IX_a (6.46 g, 28.7 mmol) was treated with dimethylaminopyridine and trimethyl monosilyl isocyanate to obtain 6.74 g (88%) of the desired product: 4 NMR (300 MHz, acetone-d6) e 9.13 (br s, 1H), 7.45-7.32 (m, 2H), 7.18 (br s, 1H), 6.85-6.80 (m, 1H); 19F NMR (282 MHz acetone-d6) d -86.6 (d, 17 · 2, 3), -137.52-137.68 (m, 1), 148.47- 148.59 (m, 1) 〇 Step 2, Synthesize Xl-a from Xa as described in Step 2 of Example 1 Method (xylene instead of toluene), the solution of Xία (6.74 g, 25.1 mmol) was heated under reflux in xylene to obtain 6.3 g (100%) of the desired product: 4 NMR (300 MHz, acetone-d6) ά 7.92-7.83 (m, 1H), 7.46-7.44 (m, 1H); 19F NMR (282 MHz, acetone-d6) d -70.7 (d, 38.7, 3), -136.72 (s, 1), -146.47 -146.57 (m, 1) 〇 Step 3. Synthesize XII-a with XI_a. Printed by the cooperative (please read the notes on the back before filling out this page) according to the method of step 3 in Example 1, derived from cyclopropylacetylene (30% by weight toluene / THF / hexane, 24.9ml, 0.113 mole) The solution of XI_a (6.28 g, 25.1 mmol) was processed by the lithium block, and the obtained crude yellow oily substance was dissolved in acetone and concentrated under reduced pressure to produce a yellow solid substance, which was 5.98 after crystallization from acetone. G (75%) of the desired product · mp 86.5-88.5 ° C; 4 NMR (300 MHz, acetone-d6) d 9.01 (br s, 1H), 7.46 (br s, 1H), 7.44-7.35 (m, 1H), 6.86 · 6 · 81 (m, 1H), 1.41-1.37 (m, 1H), 0.90-0.83 (m, 1H), 0.74-0.69 (m, -39-) This paper size applies Chinese national standards (CNS) A4 specification (21 OX 297 mm) " 一 '587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Invention Description (37) 1H); 19F NMR (282 MHz, acetone-d6) d -83.3 (d, J = 12.9, 1), -136.04-136.23 (m, 1), -148.14-148.26 (m, 1); IR (KBr precipitate) 1706, 1516, 1442, 1246, 1214, 1196 cnT1 ; C14H1 () F5N20 Calculated MS (Cl) m / e: 317.071329, found 317.070836; 317 (MH +, 100), 334 (M + NH4 +, 62); calculated and analyzed C14H9F5N20: C, 53.17; H, 2.88; N, 8.87; Discovery · C, 53.30; H, 3.16; N, 8.53 〇 Example 1 1 Preparation of (+ /-) -5,6 · difluoro-4 · isopropylethynyl-4-trifluoromethyl-3,4 -Dihydro (1 hydrogen) -quinazolinone (R4 = isopropyl) According to the method of step 3 of Example 1 to derive from 3-methyl-1 -butyl block (8.87 g, 13.3 ml, 0.130 mol) After treatment of XI-a (7.24 g of '2 8 · 9 Emole) solution' with lithium acetylide, the obtained crude material was purified by flash chromatography (2.5% MeOH / CH2Cl2) to obtain a yellow oily substance. 6.77 g (74%) of the desired product can be produced after crystallization from acetone: mp 79-80 Ό; 4 NMR (300 MHz acetone-d6) d 9.02 (br s, 1H), 7.50 (br s, 1H), 7.44- 7.35 (m, 1H), 6.87-6.82 (m, 1H), 2.69-2.65 (m, 1H), 1.17 (dd, J = 7.0 Hz, 6H); 19F NMR (282 MHz, acetone-d6) d-83.4 (d, J = 12.9, l), 135.79-135.94 (m, l), -148.14- 148.26 (m, 1); C14H12F5N20 Calculated MS (Cl) m / e · 319.086979, found 319 .087376; 319 (MH +, 100), 336 (M + NH4 +, 76) 〇 Example 12 Preparation of (+ /)-5,6-difluoro · 4- (2-pyridyl) ethynyl_4-tri Fluoromethyl--40- This paper size is applicable to Chinese National Standard (CNS) A4 (210X 297mm) (Please read the precautions on the back before 4-writing this page)

1.1T printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs. A solution of XI-a (100 mg, 0.400 mmol) was treated with lithium acetylide derived from 2-acetylenepyridine (0.19 g, 1.80 mmol) according to the method of Step 3 of Example 1, and flash chromatography ( 4% MeOH / CH2Cl2) after purification of the crude material, 83 mg (59%) of the desired product was produced: mp 219-220 ° C; NMR (300 MHz, acetone-d6)) d 9.15 (br s, 1H), 8.61 (d, J = 4.4 Hz, 1H), 7.88-7.82 (m, 2H), 7.63 (dd, J = 7.0, 1.1Hz, 1H) 7.47-7.42 (m, 2H), 6.94-6.88 (m, 1H ), 19F NMR (282 MHz, acetone-d6) d-82.8 (d, J = 12.9, 3), -135.78-135.93 (m, 1), • 147.86-147.98 (m, 1); IR (KBr precipitate ) 1 712, 1470, 1450, 1430, 1416, 1264, 1238, 1226, 1198, 1186 cm · 1; C16H9F5N30 calculated MS (Cl) m / e: 354.066578, found 354.067821; 354 (MH +, 100). Example 13 Preparation of (+ /-)-5,6-difluoro-4 -ethylethyl block-4-trifluoromethyl-3,4-dihydro (1 hydrogen) benone (R4 = 2-ethyl Based on the method of Step 3 of Example 1, a solution of XI_a (100 mg, 0.400 mmol) was treated with lithium alkynide derived from 1-butyne (97 mg, 1.80 mmol) using HPLC (2.5% MeOH / CH2Cl2) After purification of the obtained crude material, 69 mg (57%) of the desired product was obtained: mp 191-194X:; ijj NMR (300 MHz, acetone-d6) ci 9.03 (br s, 1H), 7.50 (br s, 1H), 7.45-7.35 (m, 1H), 6.87-6.82 (m, 1H), 2.34-2.27 (m, 2H), 1.20-1.15 (m, 3H); 19F NMR (282 MHz, acetone -d6) d -83.3 (d, J = 12.9, 3), -135 · 79-135 · 98 (m, 1), -148.16-148.29 (m, 1); -41-This paper size applies to Chinese national standards (CNS) A4 size (210X297 mm) ^ (Please read the precautions on the back before writing this page)

、 1T .__ 587078 Μ ____ Β7 _ 5. Description of the invention (39) IR (KBr precipitate) 1704, 1686, 1518, 1444, 1244, 1210, 1192, 1172 cm1; C13H10F5N2O Calculated MS (Cl) m / e : 305.071329, found 305.071146; 305 (MH +, 100); C13H9F5N20 calculation analysis: C, 51.33; Η, 2.98; Ν, 9.22; found: C, 51.00; Η, 2.79; Ν, 8.99. Example 14 Preparation of (+ / _) · 5,6_difluoro_4-phenylethyl 4-trifluoromethyl_3,4 · dihydro (1hydro) -4peaklinone (R4 = benzene Based on the method of Step 3 of Example 1, XI-a (100 mg, 0.400 mmol) was treated with lithium block derived from phenylethyl block (0.88 g, 0.20 ml, 1.80 mmol). The solution was purified by HPLC (2.5% MeOH / CH2Cl2) to obtain 92 mg (6 5%) of the desired product: ifj NMR (300 mhz, acetone 9.14 (br s, 1H), 7.80 (br s , 1H), 7.57-7.54 (m, 2H), 7.49-7.40 (m, 4H), 6.92-6.87 (m, 1H); 19F NMR (282 MHz, acetone- (16) 6-83.0 ((1, > 12.9,3), -136.08-136.27 (m, 1), · 147 · 87 · 148.00 (ιη, 1);; MS (Cl) m / e calculated by C17H10F5N2O: 353.071329, found 353.071716; 353 (MH +, 42), 370 (M + NH4 +, 100) 〇 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before writing this page) 、-口 Example 15 Preparation (+ /-)-5, 6_Difluoro-4-isopentyl-4-trifluoromethyl_3,4-dihydro (1 hydrogen) quinazolinone (R4 = isopropyl) Synthesized from XΙΙ-a a Treatment with ethanol containing XIII-a (R4 = isopropyl) (26 mg, 82 mmol) in H2 (l atm) with pd on 10% carbon (35 mg) -42-

Printed by the Consumers' Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs 587078 A7 B7 V. Description of the invention (40) and EtO Ac (0.5 ml) solution for 16 hours, the catalyst was removed by diatomite Celite filtration using air filtration, and EtAOc was used to clean the filter After the solid obtained after concentration of the filtrate under reduced pressure, 26 mg (100%) of the desired product was obtained without further purification: 1H NMR (300 MHz, propane-d6) ci 8.88 (br s, 1Η) , 7.41-7.31 (m, 1Η), 6.89-6.81 (m, 2Η), 2.55_2.50 (m, 1H), 1.64-1.45 (m, 2H), 1.06_1 · 02 (m, 1H), 0.89 (dd, J = 6.6, 2.2Hz, 6H); 19F NMR (282 MHz acetone-d6) d-83.22 (d, J = 12.1, 3), -138.97-139.13 (m, l), -148.46-148.58 (m, 1); IR (KBr precipitate) 1700, 1678, 1518, 1438, 1252, 1 188, 1 172 cnT1; C14H16F5N20 MS (Cl) m / e: 323.118280, found: 323.116703; 323 (MH + , 100), 340 (M + NH /, 57) 〇 Example 16 Preparation of (+ /-) 4-butyl-5,6-difluoro-4-trifluorofluorenyl-3,4-dihydro (1 Chlorine) · Junjun T? Lin Ying (R4 = ethyl) According to the procedure of Example 15, under H2, treat with 10% carbon on Pd A solution containing XIII-a (R4 = ethyl) (20 mg, 66 mmol) in ethanol (1 ml) and EtOAc (0.5 ml) was purified by HPLC (2.5% MeOH / CH2Cl2) to obtain 12 mg ( 56%) desired product: 4 NMR (300 MHz, acetone-d6) d 8.89 (br s, 1H), 7.41-7.32 (m, 1H), 6.86 · 6 · 81 (m, 2Η), 2.57- 2.47 (m, 1Η), 1.56-1 · 15 (m, 5Η), 0.88 (t, J = 7.3 Hz, 3H); 19F NMR (282 MHz, acetone-d6) -83.19-83.24 (m, 1 ), 139.14 (s, 1), -148.49-148.62 (m, 1); MS (Cl) m / e calculated by C13H14F5N20: 309.102629, found: 309.103555; -43- This paper standard applies to Chinese National Standard (CNS) A4 size (210X 297mm) (Please read the precautions on the back before filling this page) Order 587078

XIV- A7 B7 V. Description of the invention (41) 309 (MH +, 100), 326 (M + NH /, 62) 〇 Example 17 7. Preparation of (+/-) _ 4-cyclopropylethyl-6-fluoro -4-Trifluoromethyl-3,4-dihydro-2 (1-Hydroxylinone (R4 = cyclopropyl) (Please read the precautions on the back before filling this page)

TMF / CHtCCR ^ n-BuLi / 0 ° C 1 0 7; Pd / C Μ 2 (1 a tin) EtOH / EtOAc: PV:

NU rr, 0 XVIII-a

XV- XV11 R ^ 1

XIX- Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economy XVI -r

Step 1. Synthesis of XV from XIV_a After treating the solution of XIII-a (3.Q7 g, 14.8 mmol) with dimethylaminopyridine and monosilyl isocyanate by the method described in Example 1, Step 1 , Can obtain 2.81 g (76%) of the desired product. Step 2. Synthesize XVI-a -44 from XV-a. This paper size is applicable to Chinese National Standard (CNS) A4 (210X 297 mm). Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs. 587078 A7 B7 5. Description of the invention ( 42) Using the method described in step 2 of Example 1, the xv-a (6.74 g, 25.1 mmol) solution was heated under reflux in toluene to obtain 0.73 g (94%) of the desired product. Step 3. Synthesis of XVII-a from XVI-a According to the method in step 3 of Example 1, the lithium acetylide derived from cyclopropyl ethyl block (1.43 ml of 30% toluene / THF / hexane, 1.94 mmol) was treated. XVI_a (100 mg, 0.431 mmol) was purified by HPLC (2.5% MeOH / CH2Cl2) to obtain 44 mg (34%) of the desired product: mp 155 ° C; 4 NMR (300 MHz Acetone-d6) d 8.86 (brs, lH), 7.36 (brs, lH), 7.30-7.27 (m, lH), 7.22-7.15 (m, 1H), 7.04-6.99 (m, 1H), 1.47-1.42 ( m, 1H), 0.90-0.87 (m, 2H), 0.776 · 0.75 (m, 2H); 19F NMR (282 MHz, acetone • d6) d-82.86, -123.36-123.44; C14HnF4N20 Calculated MS (Cl) m / e: 299.080751, found 299.079976; 299 (MH +, 100). Example 1 8 Preparation of (+/-)-6-fluoro-4-isopropylethynyl-4-trifluoromethyl · 3 , 4-dihydro_2 (1 hydroquinone (R4 = isopropyl)) According to the method of step 3 of Example 1 to derive from 3-methyl-1 -butyne (0.13 g, 0.20 ml, 1.94 millimolars) of a solution of XVI-a (100 mg, 0.431 millimolars) treated with lithium acetylide and purified by HPLC (2.5% MeOH / CH2Cl2) After preparing the substance, 24 mg (18%) of the desired product can be obtained: mpl58 ° C; WNMRpOO MHz, acetone_d6) d 9.07 (br s, 1H), 7.60 (br s, 1H)? 7.32-7.30 (m, 1H), 7.24- -45- This paper size is applicable to China National Standard (CNS) A4 (210X297mm) (Please read the precautions on the back before writing this page)

1T 587078 A7 V. Description of the invention (43) 7.16 (m, 1H), 7.05-6.99 (m, 1H), 2.77-2.67 (m, 1H), 1.20 (dd, J = 7.0, 2.6 Hz, 6H ); 19F NMR (282 MHz, acetone-d6) d -82.95, -123.41-123.49; Ci4H13F4N20 calculated MS (Cl) m / e: 301.096401, found 301.096235; 301 (MH +, 100). Example 19 Preparation of (+ /-) _ 6 -fluoro_4_ (2-pyridyl) ethynyl · 4-trifluorofluorenyl-3,4_dihydro · 2 (1hydro) -quinazolinone (R4 = 2- Pyridyl) A solution of XVI-a (100 mg, 0.431 mmol) was treated with lithium agglomerate derived from 2-acetylenepyridine (0.20 g, 1.94 mmol) according to the method of Step 3 of Example 1, using HPLC (2.5 % MeOH / CH2Cl2) After purification of the obtained crude material, 65 mg (45%) of the desired product was produced: mp 155 ° C; 4 NMR (300 MHz, acetone-d6)) β 9.02 (br s, 1H), 8.60 ( d, J = 4.0Hz, 1H), 7.87-7.78 (m, 2H), 7.66 (d, J = 7.7 Hz, 1H), 7.45 · 7 · 41 (m, 2H), 7.26-7.20 (m, 1H), 7.09-7.05 (m, 1H); 19F NMR (282 MHz, acetone-d6) d -82.36, -122.94-123.02; C16H1 () F4N30 MS (Cl) m / e: 336.076000, found 336.074156; 336 (MH +, 25). Example 2 0 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs (please read the precautions on the back first and then write this page) Preparation (+ Λ) _6_fluoro-4 -ethylethyl block-4-trifluoromethyl -3,4_dihydro_ 2 (1 hydrogen) · ρ Kui Junlin (r4 = ethyl) According to the method of step 3 of Example 1, derived from 1-butyne (0.10 g, 1.94 mmol) ) Treatment of XVI_a (100 mg, 0.431 mmol) with lithium acetylide, and purification of the crude material by HPLC (2.5% MeOH / CH2Cl2), can produce 40 mg (33%) of the desired product: mp 190 X :; 4 -46-This paper size applies Chinese National Standard (CNS) A4 (210X297 mm) " Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 587078 A7 B7 V. Description of the invention (44) NMR (300 MHz, acetone- d6)) d 8.86 (br s, 1H), 7.38 (br s, 1H), 7.34-7.31 (m, 1H), 7.22-7.16 (m, 1H), 7.05-7.00 (m, 1H), 2.04-2.01 (m, 2H), 1.19-1.14 (m, 3H); 19F NMR (282 MHz, acetone-d6) d-75.392, -123.42-123.50; C13HuF4N20 MS (Cl) m / e: 287.080751, found 287.080740; 287 (MH +, 100) 〇 Example 2 1 system (+ / _) _ 6 -Fluoro-4-phenylethynyl-4_trifluoromethyl-3,4-dihydro-2 (1hydro) · Nastilone (R4 = phenyl) Follow the procedure in Example 1 3 method, treating a solution of XVI-a (100 mg, 0.431 mmol) with lithium lumines derived from phenylacetylene (0.20 g, 0.21 ml, 1.94 mmol) using HPLC (2.5% MeOH / CH2Cl2) after purification of the crude material, 41 mg (28%) of the desired product was produced: mp 107 ° C; 4 NMR (300 MHz, acetone-d6) d 9.00 (br s, 1H), 7.69 (br s, 1H ), 7.63-7.59 (m, 2H), 7.50-7.40 (m, 4H), 7.27-7.20 (m, 1H), 7.10-7.05 (m, 1H); 19F NMR (282 MHz, acetone-d6) d- 82.56, -122.99-123.07; MS (Cl) m / e calculated by CnHuFdlSbO: 335.080751, found 335.082057; 335 (MH +, 74), 352 (MH +, 100). Example 2 2 Preparation of (+ /-) · 6 · fluoro · 4-isopentyl · 4 · trifluoromethyl-3,4 · dihydro-2 (1 hydrogen) -4 zolinone (R 4 = isopropyl Base) Synthesis of XVIII-a from XVII-a According to the procedure of Example 15, under Η 2 with P d at 10% carbon, the content is included. -47- This paper size applies Chinese National Standard (CNS) A4 specification (210X297 (Mm) (Please read the notes on the back before 4-writing this page)

, 1T 587078 A7 B7 V. Description of the invention (45) XVII-a (R4 = isopropyl) (26 mg, 87 mmol) in ethanol (1 ml) and EtOAc (0.5 ml) solution, can get 1 5 mg (58%) of the desired product 'without further purification: mp 179 C; H NMR (300 MHz, acetone-d6) d 7.02-6.97 (m, 2H), 6.80-6.76 (m, 1H), 2.18- 2.09 (m, 2H), 1.92-1.82 (m, 2H), 1.52-1.45 (m, 1H), 0.88-0.79 (m, 6H); 19F NMR (282 MHz, acetone-d6) d 82.60, -123.72, -123.84; C14H17F4N20 MS (Cl) m / e: 305.127707, found: 305.126790; 305 (MH +, 100). Example 2 Preparation of (+/-)-6-fluoro_4- (2, -2-pyridyl) ethyl block_4_trifluoromethyl-3,4-dihydro · 2 (1hydro) -quinazole Porphyrinone (R4 = 2-pyridyl) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before dining and writing this page). Follow the steps in Example 15 under Η 2 and use 1 〇 A solution of XVII-a (R4 = 2-pyridyl) (33 mg, 99 mmol) in ethanol (1 ml) and EtOAc (0.5 ml) was treated with P d on% carbon to obtain 10 gram (30 %) Desired product without further purification: mp 88 ° C; NMR (300 MHz acetone-d6) d 8.35 (d, J = 4.4 Hz, 1H), 7.63 (dt, J = 7.7, 1.5 Hz, 1H) , 7.20-7.13 (m, 3H), 7.04-6.98 (m, 1H), 6.83-6.79 (m, 1H), 2.84-2.78 (m, 1H), 2.68-2.48 (m, 2H), 2.27-2.06 ( m, 1H); 19F NMR (282 MHz, acetone 46) 6-82.58, -1 23.26, -123.34; C16H14F4N30 MS (Cl) m / e: 340.107300, found: 340.107719; 340 (MH +, 100). Example 24_ Preparation of (+ /-)-4-butyl-6-gas-4-digas methyl_3,4 · mononitro_2 (1 hydrogen) -τί Kui Junlin_ (R4 = ethyl)- 48- This paper size applies Chinese national standard ^ Can 丨 with specifications "丨 ⑼mm" Printed by the Staff Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs 587078 A7 B7 V. Description of the invention (46) According to the steps of Example 1 5 'in Η2 Next, a solution of XVII-a (R4 =: ethyl) (24 mg, 84 mmol) in ethanol (1 ml) and EtOAc (0.5 ml) was treated with P d on 10% carbon. 24 mg (100%) of the desired product were obtained without further purification: mP I98 ° C; 4 NMR (300 MHz, acetone- (16) 4 7.03-6.97 (m, 2H), 6.80 · 6 · 76 ( m, 1H), 2.18-2.11 (m, 1H), 1.90-1.81 (m, 1H), 1.30-1.19 (m, 3H), 0.97-0.80 (m, 4H); 19F NMR (282 MHz, acetone-d6) ) β -82.692, -123.78 -123.86; MS (Cl) m / e calculated from C13H15F4N20: 291.112051, found: 291.1 12227; 291 (MH +, 100). Example 2 5 Preparation (+ / ·) -6-fluoro- 4-Phenylethyl-4-trifluoromethyl-3,4-difluorene-2 (1 hydrogen) · p Cujunlin (R 4 = phenyl) according to Example 15 In step 112, a solution of XVII_a (R4 = phenyl) (30 mg, 90 mmol) in ethanol (1 ml) and EtOAc (0.5 ml) containing Pd on 10% carbon was used to obtain 20 mg ( 67%) of the desired product without further purification: tnp 98 ° C; 4 NMR (300 MHz, acetone-d6) ci 7.18-6.99 (m, 7H), 6.84-6.79 (m, 1H), 2.68-2.60 ( m, 1H), 2.48-2.12 (m, 3H); 19F NMR (282 MHz, acetone-d6) d-82.67, -123.24-123.32; C17H15F4N20 MS (Cl) m / e: 339.1 12051, found: 339.110781; 339 (MH +, 100). Example 2 6 Preparation of (+ /-) · 6-fluoro-4 -methylpropynyl-4-trifluoromethyl-3,4-dihydro-2 (1 nitrogen) -ρ 奎 峰 ρ 林 嗣 (R4 = methyl) Synthesized from XVI-a XIX-a -49- This paper size applies to China National Standard (CNS) A4 specification (210X297 mm) (Please read the precautions on the back before (Written on this page), 1T 587078 Μ Β7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (48) R! Compound r! R! Chemical House Test 6-C1 IV-a 6-Cl IV-b 6 -Cl IV-c 6-MeO vm-a 6-MeO vm-b 6-MeO vm-c 5,6-diF ΧΠ-a 5,6-diF ΧΠ-b 5,6-d iF xn-c 6-F χΥΠ-a 6-F xvn ^ b 6-F xvn-c Example 2 7 and j 8 Preparation of (-)-6_chloro_4_cyclopropylethyl-4-trifluoro Methyl · 3,4_dihydro-2 (1H) -junjunone (Example 27) and (+)-6 · Ga-4-cyclopropylethoxy-4-trifluoromethyl_ 3,4-Dihydro-2 (1 hydrogen) · quinazolinone (Example 2 8) Separation of IV-b from IV-a (R4 = cyclopropyl), c using Chiral cel OD column '3% isopropyl Alcohol, 5% CH2C12 and 92% hexane in normal palm HPLC at room temperature, with a flow rate of 1.0 ml / min and a detection wavelength of 250 μm, can separate mirror isomers higher than 99% and 99.4% 1 \ ^-1) and 1 \ ^-(:, 1 \ ^ 1): 111 卩 106-109. (3; [a] D25-60.34〇 (c = 0.274, MeOH). IV-c: mp 105-107 ° C; [a] D25 + 58.330 (c = 0.288, MeOH). Example 2 9 and 30 Preparation (+) _ 4-Cyclopropylethynyl-5,6-difluorotrifluoromethyl_3,4_dihydro-2 (1hydro) -quinazolinone (Example 2 9) and (-)-4 · Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2 (1hydro) -quinazolinone (, Example 30) from XII-a (R4 = Cyclopropyl) Separation XII-b, c using Chiralpak AD column, 5% water and 95% methanol HPLC at room temperature -51-This paper size applies to China National Standard (CNS) A4 (210X297 mm) (Read the notes on the back and fill in this page)

、 1T 587078 Μ ______ Β7 ______ 5. In the description of the invention (49), at a flow rate of 0.8 ml / min and a detection wavelength of 250 micrometers, the isomeric isomers can be separated by 100% and 99% respectively. -b and XII-c, XII_b: mpl87 ° C; [a] D25 + 1.46o (c = 0.274, MeOH) ° XII_c: mp 187.5-188.8 ° C; [a] D25-1.45 ° (c = 0.278, MeOH) 〇 Example 3 1 and 3 2 Preparation of (-)-5,6-difluoro-4 · isopropylethyl block · 4-trifluoromethyl · 3,4-dihydro (1 hydrogen) -4jun Leaching_ (Example 31) and (+) _ 5,6_difluoro-4 · isopropylethynyl-4-trifluoromethyl_3,4 · dihydro (1hydro) -quinazolinone (Example 3 2) Separation of XII-b from XII_a (R4 = isopropyl), c using a Chiralpak AD column, 5% water and 95% methanol HPLC at room temperature at a flow rate of 0.5 ml / min and 250 micromm Detection wavelength, can separate the image isomers higher than 100% and 99% of XΠ-b and XII-c, XII-b: mpl55〇C; [a] D25-2.14o (c = 0.280, MeOH) 〇ΧΙΙ-c: mp 98 ° C; [a] D25 + 4.45 ° (c = 0.292, MeOH) 〇 Example 3 3 and 3 4 Preparation of (_) _ 5,6-difluoro-4 -ethylethynyl-4 -Trifluoromethyl-3,4-dihydro (1 氲) Kui Jun _ (Example 3 3) and (+) 5,6 -difluoro-4 -ethylethyl block-4 trifluoromethyl-3,4-dihydro (1 hydrogen) _ p-Quinlinone (Example 3 4) Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs (please read the precautions on the back before writing this page). Separation of XII-b from XII-a (R4 = ethyl), c Using AS column, 20% Ethanol and 80 hexane HPLC at room temperature can separate the mirror isomers higher than 100% and 99.4% of χπ-b at a flow rate of 1.0 ml / min and a detection wavelength of 250 μm at room temperature. And XII-c, XII_b: mp 165-167 ° C 0 XII-c: mp 157- ° C 159. Example 3 5 and 3 6 -52- This paper size applies Chinese National Standard (CNS) A4 specification (210X297 mm) 587078 A7 B7 V. Description of the invention (50) Preparation of 5,6 · difluoro_4_ (2_ 经 基Ethyl) ethynyl-4_trifluoromethyl · 3,4 · dihydro (1 hydrogen) -junjunone (Example 35) and 5,6-di, fluoro-4- (1 • Ethylethyl ) Ethyl-4 -trifluoromethyl-3,4 · dihydro (1 hydrogen) -sotriazolinone (Example 30) (Please read the precautions on the back before writing this page)

Compound Example 35 CH2CH2OH Example 36 CH (OH) CH3, 1T

«36 CM (OTBS) CM: i

R Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs at -78 ° C 'Sequentially pre-cooled (0. 0) mono-silane-protected lithium alkyne (5.40 moll) and BF3.〇Et2 (0 · 60 mmol) was added to a viscous solution containing ketimine (300 mg, 1.20 mmol) in anhydrous THF (11 ml), and the resulting mixture was stirred overnight at room temperature. The reaction was stopped by adding i M citric acid 'And diluted with EtOAc, separated phases, water, saturated NaHC〇3 water-soluble -53-^ paper size applies Chinese National Standard (CNS) grid (21〇 > < 一 ^^ ----- 587078 A7 _B7 V. Description of the invention (54) Analytical results: C, 52.84; H3, 3.48; N, 8.80; Discovery: C, 53.02; H3, 3.48; N, 8.61. 'Example 3 8 Preparation of (-)-6-chlorine -4-E-cyclopropylethyl-4-4 trifluoromethyl-3,4-dihydro-2 (1hydro) -4junlinone, the title compound was prepared according to the method described in Example 37 (from IV -b, start), except that it was purified using a Chirlcel OD column with 0.5% EtOH / 20% CH2Cl2 / 79.5% hexane (flow rate 15 ml / min). Mp 87-89 ° C; 4 NMR (300 MHz, acetone _d6; U 9 · 08 (br s, 1H), 7.40-7: 25 (m, 2H), 7.04-6.90 (m, 2H), 6.28-6.18 (m, 1H), 5.64-5.52 (m, 1H), 1.68-1.55 (m, 1H), 0.83-0.71 (m, 2H) , 0.53-0.41 (m, 2H); 19F NMR (282 MHz, acetone-d6) $ _81%. C14h13cif3n2o Calculated ms (ci): m / z 317 066851, found 317.065857; 317 (MH +, 100); [ a] D2〇-6 81〇 (c == 〇382,

MeOH); C14H12C1F3N20 · 0.27C3H60 Calculated and analyzed: c 53.52; H, 4.13; N, 8.43; Found: C5 53.90; H, 4 〇 7 '8.80 〇' Table 1 * (Please read the precautions on the back and then 4 -Write this page),-= A moderate ruler printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economy

Ns

587078

AB V. Description of the invention (55) Example of printing by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs. # R3 R1 R2 R8 mp (° C) Mass spectrometer 1 6-C1 cf3 C = C-cycPr H 86.6-88 332 (M + NH4 +) 2 6_C1 cf3 C ^ C-iPr H 180 334 (M + NH4 +) 3 6-C1 cf3 C = C-2-pyridyl H 105 352 (^) 4 6-C1 cf3 C ^ C-Et H 217- 219 303 (ΜΗ ") 5 6_C1 cf3 C ^ C-Ph H 104-107 368 (M + NH4 +) 6 6-MeO cf3 C = C-cycPr H 208 311 (ΜΗ ") 7 6-MeO cf3 C ^ C- iPr H 228-229 3l3 (MFt) 8 6-MeO cf3 C Ξ C-2_pyridylH 97-98 348 (1 ^) 9 6_MeO cf3 C e 〇Ph H 206.2-207.7 347 (ΜΗ ") 10 5, 6-diF cf3 C = C-cycPr H lOldec 317 (MH ") 11 5,6-diF cf3 C ^ C-iPr H 79-80 319 (ΜΗΓ) 12 5,6-diF cf3 C e C-2-pyridine Base H 219-220 354 (ΜΗ ") 13 5,6-diF cf3 C = C-Et H 191-194 305 (ΜΗ ") 14 5,6-diF cf3 C = C-Ph H 215-217 370 (M + NH4 +) 15 5,6-diF cf3 CH2CH2CH (CH3) 2 H 192-193 323 (ΜΗ ") 16 5,6-diF cf3 CH2CH2CH2CH3 H 309 (ΜΗΓ) 17 6-F cf3 C = C-cycPr H 155 299 (ΜΗ ") 18 6-F cf3 C ^ C-iPr H 158 301 (1 ^) 19 6-F cf3 C e C-2-pyridyl H 155 336 (ΜΗΓ) 20 6-F cf3 C = C-Et H 190 287 (ΜΗ ") 21 6-F cf3 C = C-Ph H 107 352 (Μ + ΝΗ4 +) 22 6-F cf3 CH2CH2CH (CH3) 2 H 179 305 (ΜΗ ") -58- This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) (Please read the note on the back first and write this page in the spring) 587078

7 B V. Description of the invention (56) 23 6-F cf3 CH2CH2-2-pyridyl H 88 340 (ΜΗ ") 24 6-F cf3 ch2ch2ch2ch3 H 198 291 (MHT) 25 6-F cf3 CH2CH2Ph H 98 339 (^ ) 26 6-F cf3 ch2c Triple c- ch3 H 181 304 (M + NH4 +) 27㈠ 6-C1 cf3 C = C-cycPr H 106-109 313 (M) 28 (+) 6-C1 cf3 C = C-cycPr H 105-107 313 (M) 29㈩ 5,6-diF cf3 C = C-cycPr H 187 315 (M ·) 3〇㈠ 5,6-diF cf3 C = C-cycPr H 188-189 315 (MT) 31㈠ 5,6-diF cf3 C = C-iPr H 155 317 (M ·) 32㈩ 5,6-diF cf3 C ^ C-iPr H 98 317 () Vr) 33㈠ 5,6-diF cf3 C ^ C-Et H 165-167 303 (MT) 34 (+) 5,6-diF cf3 C ^ C-Et H 157-159 303 (M) 35 5,6-diF cf3 C e cch2ch2oh H 190-192 321 (ΜΗΓ) 36 5 , 6-diF cf3 C e C-CH (OH) Me H 190-191 338 (M + NH4 +) 37㈩ 5,6-diF cf3 C = C-cycPr (E) H 80-83 319 (ΜΗ ") 38 ( -) 6-C1 cf3 C = C-cycPr (E) H 87-89 317 (ΜΚΓ) * Unless specifically mentioned, the stereochemistry is (+ / ·). : _ #II (Please read the precautions on the back before painting this page) ——- Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economy-59- This paper size applies to the Chinese National Standard (CNS) A4 specification (210X297 mm ) 587078 1 A? B7 V. Description of the invention (57) Table 2 *

Printed by the Staff Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs

Example # R3 R1 R2 R8 1 6-C1 cf3 C ^ CCH2CH2OH H 2 6-C1 cf3 C ^ C-CH (OH) Me H 3 6-C1 cf3 C ^ C- (2-Cl) Ph H 4 6-C1 cf3 C ^ C- (3-Cl) Ph H 5 6-C1 cf3 ^ C ^ C- (4-Cl) Ph H 6 6_C1 cf3 C ^ C- (2-F) Ph H 7 6-C1 cf3 C = C- (3-F) Ph H 8 6-C1 cf3 C ^ C- (4-F) Ph H 9 6-C1 cf3 C ^ C- (2-OH) Ph H 10 6 · α cf3 C = C- (3-OH) Ph H 11 6-C1 cf3 C ^ C- (4-OH) Ph H 12 6-C1 cf3 C = C- (2-OMe) Ph H 13 6-C1 cf3 C ^ C- (3 -OMe) Ph H 14 6-C1 cf3 C ^ C- (4-OMe) Ph H 15 6-C1 cf3 C ^ C- (2-CN) Ph H 16 6-C1 cf3 C ^ C- (3-CN ) Ph H 17 6_C1 cf3 C ^ C- (4-CN) Ph H 18 6-C1 cf3 C = C- (2-N02) Ph H 19 6-C1 cf3 C ^ C- (3-N02) Ph H 20 6_C1 cf3 C ^ C- (4-N02) Ph H 21 6_C1 cf3 C ^ C- (2-NH2) Ph H 22 6-C1 cf3 C = C- (3-NH2) Ph H 23 6-C1 cf3 C ^ C- (4-NH2) Ph H (Please read the notes on the back before dining and writing this page) ίΛ. -60- This paper size is applicable to China National Standard (CNS) A4 specification (210 '乂 297mm') 587078 Printed by the Consumer Standards Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs A7 V. Invention Description (58)

24 6-C1 cf3 C ^ C- (2-NMe2) Ph H 25 6-C1 cf3 C ^ C- (3-NMe2) Ph H 26 6-C1 cf3 C ^ C- (4-NMe2) Ph H 27 6 -C1 cf3 C Ξ C-3-p specific group H 28 6-C1 cf3 CeC-4 · pyridyl H 29 6-C1 cf3 C Ξ C-2-ylanyl H 30 6-C1 cf3 C Ξ C- 3-anilyl H 31 6-C1 cf3 C ^ C-2-fluorenyl H 32 6_C1 cf3 C ^ C-3-pyriminyl H 33 6-C1 cf3 Ce〇2-oxazolyl H 34 6- C1 cf3 C ^ C-2-pyrimidyl H 35 6-C1 cf3 〇C-4-isohumidyl H 36 6-C1 cf3 Ce〇2-imidazolyl H 37 6-C1 cf3 C = CCH2CH2OH H 38 6 -C1 cf3 C = C-CH (OH) Me H 39 6-C1 cf3 C = C- (2-Cl) Ph H 40 6_C1 cf3 C = C- (3-Cl) Ph H 41 6-C1 cf3 C = C_ (4-Cl) Ph H 42 6-C1 cf3 C = C- (2-F) Ph H 43 6-C1 cf3 C = C- (3-F) Ph H 44 6-C1 cf3 C = C- ( 4-F) Ph H 45 6-C1 cf3 C = C- (2-OH) Ph H 46 6-C1 cf3 C = C_ (3_OH) Ph H 47 6-C1 cf3 C = C- (4-OH) Ph H 48 6-C1 cf3 C = C- (2-OMe) Ph H 49 6-C1 cf3 C = C- (3-OMe) Ph H 50 6-C1 cf3 C = C- (4-OMe) Ph H 51 6_C1 cf3 C = C- (2-CN) Ph H 52 6-C1 cf3 C = C- (3-CN) Ph H 53 6-C1 cf3 〇C- (4-CN) Ph H (Please read the back Please note this page to write this page) _.61 This paper size applies to China National Standard (CNS) A4 Grid (2lOX 297 mm) 587078 A7 B7 V. invention is described in (59) Ministry of Economic Affairs Bureau of Standards employees consumer cooperatives printed ____k

54 6-C1 cf3 C = C- (2-N02) Ph H 55 6-C1 cf3 C = C- (3-N02) Ph H 56 6-C1 cf3 C = C_ (4_N02) Ph H 57 6-C1 cf3 C = C- (2-NH2) Ph H 58 6_C1 cf3 C = C- (3-NH2) Ph H 59 6-C1 cf3 C = C- (4-NH2) Ph H 60 6_C1 cf3 C = C- (2 -NMe2) Ph H 61 6_C1 cf3 C = C- (3-NMe2) Ph H 62 6-C1 cf3 C = C- (4-NMe2) Ph H 63 6-C1 cf3 C = C-3-pyridyl H 64 6_C1 cf3 OC-4-pyridyl H 65 6-C1 cf3 C = C-2-furanyl H 66 6_C1 cf3 〇C-3-furanyl H 67 6-C1 cf3 C = C-2-fluorenyl H 68 6-C1 cf3 C = C-3-p sedenyl H 69 6-C1 cf3 C = C-2-pyrazolyl H 70 6_C1 cf3 C = C-2 ^ sedazolyl H 71 6-C1 cf3 C = C-4. Isoxazolyl H 72 6-C1 cf3 C = C-2-imidazolyl H 73 6_C1 cf3 CH2CH2-cycPr H 74 6_C1 cf3 CH2CH2CH2CH2OH H 75 6-C1 cf3 CH2CH2-CH (OH) Me H 76 6 -C1 cf3 CH2CH2-Ph H 77 6-C1 cf3 CH2CH2- (2-Cl) Ph H 78 6-C1 cf3 CH2CH2- (3-Cl) Ph H 79 6-C1 cf3 CH2CH2- (4-Cl) Ph H 80 6-C1 cf3 CH2CHr (2-F) Ph H 81 6_C1 cf3 CH2CH2- (3-F) Ph H 82 6-C1 cf3 CH2CH2- (4-F) Ph H 83 6-C1 cf3 CH2CHr (2-OH) Ph H -62- This paper size applies to China National Standard (CNS) A4 (210X 297mm) (Please read first Please fill in this page before filling in this page) Order 587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 _15. Invention Description () 84 6-C1 cf3 CH2CH2- (3-〇H) Ph H 85 6-C1 cf3 CH2CHr (4-OH) Ph H 86 6-C1 cf3 CH2CHr (2-OMe) Ph H 87 6-C1 cf3 CH2CH2_ (3-OMe) Ph H 88 6_C1 cf3 CH2CH2- (4-OMe) Ph H 89 6- C1 cf3 CH2CHr (2-CN) Ph H 90 6-C1 cf3 CH2CHr (3_CN) Ph H 91 6-C1 cf3 CH2CH2- (4-CN) Ph H 92 6_C1 cf3 CH2CH2- (2-N02) Ph H 93 6- C1 cf3 CH2CH2- (3-N02) Ph H 94 6-C1 cf3 CH2CHr (4_N02) Ph H 95 6-C1 cf3 CH2CH2- (2-NH2) Ph H 96 6-C1 cf3 CH2CH2- (3-NH2) Ph H 97 6-C1 cf3 CH2CH2- (4-NH2) Ph H 98 6-C1 cf3 CH2CH2- (2-NMe2) Ph H 99 6-C1 cf3 CH2CHr (3-NMe2) Ph H 100 6-C1 cf3 CH2CH2- (4 -NMe2) Ph H 101 6-C1 cf3 CH2CH2-2-pyridyl H 102 6-C1 cf3 CH2CHr3-pyridyl H 103 6-C1 cf3 CH2CH2-4-pyridyl H 104 6-C1 cf3 CH2CHr2-furyl H 105 6_C1 cf3 CH2CH2-3 · furanyl H 106 6-C1 cf3 CH2CH2-4 · furanyl H 107 6 · α cf3 CH2CH2-3 · pyriminyl H 108 6-C1 cf3 CH2CHr2-oxazolyl H 109 6-C1 cf3 CH2CH2-2-oxazolyl H 110 6-C1 cf3 CH2CH2-4 · Isoniazolyl H 111 6-C1 cf3 CH2CHr2-imidazolyl H 112 6-C1 cf3 C = C-cycPr ch3 113 6-C1 cf3 C ^ C-Ph ch3 -63-This paper is for China National Standard (CNS) A4 specification (210 X 297 mm) 587078 A7 B7 V. Description of invention (61) Printed by the Consumers' Cooperative of the China Standards Bureau of the Ministry of Economic Affairs __I __- k 114 6_C1 cf3 CeC_2-pyridyl ch3 115 6 -C1 cf3 C Ξ C-3-Hydro-based ch3 116 6-C1 cf3 C = C-4-p than Yodo-based ch3 117 6-C1 cf3 C Ξ C-2 · Branyl ch3 118 6-C1 cf3 C ^ C_3-furyl ch3 119 6-C1 cf3 C Ξ C-2-ρ sedenyl ch3 120 6-C1 cf3 C Ξ C-3-p sedenyl ch3 121 6-C1 cf3 C = C-cycPr ch3 122 6-C1 cf3 C = C-Ph ch3 123 6-C1 cf3 C = C-2-pyridyl ch3 124 6-C1 cf3 specific group ch3 125 6-C1 cf3 C = C-4-p ratio yodo group ch3 126 6-C1 cf3 C = C-2-furyl ch3 127 6-C1 cf3 C = C-3-pyranyl ch3 128 6-C1 cf3 C = C-2-pyrimyl ch3 129 6-C1 cf3 C = C_3-4 phenyl ch3 130 6-C1 cf3 CH2CH2-cycPr ch3 131 6_C1 cf3 CH2CH2-Ph ch3 132 6_C1 cf3 CH2CH2-2-p than pyridyl ch3 133 6-C1 cf3 CH2CH2-3-pyridyl ch3 134 6_C1 cf3 CH2C H2-4-pyridyl ch3 135 6-C1 cf3 CH2CHr2-furyl ch3 136 6-C1 cf3 CH2CH2-3 · furyl ch3 137 6-C1 cf3 CH2CHr2-pyrimyl ch3 138 6_C1 cf3 CH2CH2-3-fluorenyl ch3 139 6-C1 cf3 C = C-cycPr ch2ch3 140 6-C1 cf3 C ^ C-Ph CH2CH3 141 6-C1 cf3 CeC-2-pyridyl ch2ch3 142 6-C1 cf3 CeC_3-Cyclopyridyl CH2CH3 143 6- C1 cf3 C three C-4-port ratio lake base ch2ch3 -64- This paper size applies Chinese National Standard (CNS) A4 specification (210X297 mm) (Please read the precautions on the back before filling this page) 587078 A7 B7 Economy Printed by the Consumer Cooperatives of the Ministry of Standards of the People's Republic of China V. Invention Description (62) 1 1 I 144 6-C1 cf3 C Ξ C-2-Branyl CH2CH3 1 1 1 145 6-C1 cf3 C = C-3_ Base CH2CH3 1 1 146 6_C1 cf3 C ^ C-2-fluorenyl CH2CH3 〆 ^ v 1 please 147 6-C1 cf3 C = C-3-fluorenyl CH2CH3 first 1 read 1 148 6-C1 cf3 C = C- cycPr CH2CH3 read back-1 jr · 149 6-C1 cf3 C = C-Ph CH2CH3 150 on the surface 6 · α cf3 1% ~ 1 151 6-C1 cf3 C = C-3-pyridyl ch2ch3 thing 1 The term I 1 152 6 · α cf3 C = C-4-p is more than Yodo base ch2ch3 and then 1 -J write Xia 7 pages 1 N ^ I 153 6-C1 cf3 C = C-2-furyl CH2CH3 154 6-C1 cf3 C = C_3-furyl CH2CH3 155 6-C1 cf3 C = C-2-fluorenyl CH2CH3 1 156 6 -C1 cf3 C = C-3-p sephenyl CH2CH3 1 I 157 6-C1 cf3 CH2CH2-cycPr CH2CH3 1 | 158 6-C1 cf3 CH2CH2-Ph CH2CH3 159 6-C1 cf3 CH2CH2-2-pyridyl CH2CH3 1 160 6-C1 cf3 CH2CH2-3-pyridyl CH2CH3 1 I 161 6-C1 cf3 CH2CHr4-pyridyl CH2CH3 1 1 162 6-C1 cf3 CH2CH2_2-furyl CH2CH3 1 163 6-C1 cf3 CH2CH2-3_furylCH2CH3 1 if .1 164 6-C1 cf3 CH2CHr2-fluorenyl ch2ch3 165 6-C1 cf3 CH2CHr3-pyriminyl ch2ch3 166 6-MeO cf3 C = CCH2CH2OH H 167 6-MeO cf3 C = C-CH (OH) Me H 1 168 6-MeO cf3 C ^ C- (2-Cl) Ph H 1 1 169 6-MeO cf3 C ^ C- (3-Cl) Ph H 170 6-MeO cf3 C ^ C- (4-Cl) Ph H 1 1 171 6-MeO cf3 C = C- (2-F) Ph H 1 172 6-MeO cf3 C = C- (3-F) Ph H 1 1 173 6-MeO cf3 C ^ C- (4-F ) Ph-65- H 1 1 1 1 1 This paper size is applicable to the Chinese National Standard (CNS) A4 (210X297 mm) 587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Invention Description (63)

174 6-MeO cf3 C ^ C- (2-OH) Ph H 175 6_MeO cf3 C ^ C- (3-OH) Ph H 176 6-MeO cf3 C «4-OH) Ph H 177 6-MeO cf3 C ^ C- (2-OMe) Ph H 178 6-MeO cf3 C ^ C- (3-OMe) Ph H 179 6-MeO cf3 C «4-OMe) Ph H 180 6-MeO cf3 C ^ C- (2- CN) Ph H 181 6-MeO cf3 C ^ C- (3-CN) Ph H 182 6_MeO cf3 CEC_ (4-CN) Ph H 183 6-MeO cf3 C ^ C- (2-N02) Ph H 184 6- MeO cf3 C tri-C- (3-N02) Ph H 185 6-MeO cf3 C ^ C- (4-N02) Ph H 186 6-MeO cf3 C tri-C- (2-NH2) Ph H 187 6-MeO cf3 C = C- (3-NH2) Ph H 188 6-MeO cf3 C ^ C- (4-NH2) Ph H 189 6-MeO cf3 C ^ C- (2-NMe2) Ph H 190 6-MeO cf3 C ^ C- (3-NMe2) Ph H 191 6-MeO cf3 C = C- (4-NMe2) Ph H 192 6_MeO cf3 C = C-3-pyridylH 193 6-MeO cf3 CeC-4-p H 194 6-MeO cf3 C Ξ C-2-octanoyl H 195 6-MeO CFa C tri-C-3-ananyl H 196 6_MeO cf3 C Ξ C_2-p sephenyl H 197 6-MeO cf3 C = C-3-pyrimylyl H 198 6-MeO cf3 C = C-2-oxazolyl H 199 6-MeO cf3 C ^ C-2-pyrimidyl H 200 6-MeO cf3 C ^ C-4-iso Oxazolyl H 201 6-MeO cf3 C = C-2-imidazolyl H 202 6-MeO cf3 C = CCH2CH2OH H 203 6_MeO cf3 C = C-CH (OH) Me H (Please read the note on the back first r item 4- then write this page)

、 1T -66-This paper size is applicable to Chinese National Standard (CNS) A4 (210X 297mm) 587078 Printed by A7 B7 64, Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention () 204 6-MeO cf3 C = C- (2-Cl) Ph Η 205 6_MeO cf3 C = C- (3-Cl) Ph Η 206 6-MeO cf3 C = C_ (4-Cl) Ph Η 207 6-MeO cf3 C = C- (2- F) Ph 208 208 6-MeO cf3 C = C- (3-F) Ph Η 209 6-MeO cf3 C = C- (4_F) Ph Η 210 6-MeO cf3 C = C- (2-OH) Ph Η 211 6-MeO cf3 C = C- (3_OH) Ph Η 212 6-MeO cf3 C = C- (4_OH) Ph Η 213 6-MeO cf3 C = C- (2-OMe) Ph Η 214 6-MeO cf3 C = C- (3-OMe) Ph Η 215 6-MeO cf3 OC_ (4-OMe) Ph Η 216 6-MeO cf3 C = C- (2-CN) Ph Η 217 6-MeO cf3 C = C- (3 -CN) Ph Η 218 6-MeO cf3 C = C- (4-CN) Ph Η 219 6-MeO cf3 C = C- (2_N02) Ph Η 220 6-MeO cf3 C = C- (3-N02) Ph Η 221 6-MeO cf3 C = C- (4-N02) Ph 222 222 6-MeO cf3 C = C- (2-NH2) Ph Η 223 6-MeO cf3 C = C- (3-NH2) Ph Η 224 6-MeO cf3 C = C- (4-NH2) Ph Η 225 6_MeO cf3 C = C- (2-NMe2) Ph Η 226 6-MeO cf3 C = C- (3-NMe2) Ph Η 227 6-MeO cf3 C = C- (4-NMe2) Ph Η 228 6-MeO cf3 C = C-3-'^ 比 淀 基 Η 229 6-MeO cf3 C = C-4-p 比比Base Η 230 6-MeO cf3 C = C-2-pyranyl Η 231 6-MeO cf3 0 = C-3- 咬 thioyl Η 232 6_MeO cf3 C = C-2-p sephenylΗ 233 6-MeO cf3 C = C-3-pyrimidinyl hydrazone -67- This paper size is applicable to China National Standard (CNS) A4 (210X297 mm) 587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Invention Description (65 )

234 6-MeO cf3 C = C-2-humidazolyl H 235 6-MeO cf3 C = C-2_oxazolyl H 236 6-MeO cf3 C = C-4-isohumazolyl H 237 6-MeO cf3 C = C-2-imidazolyl H 238 6-MeO cf3 CH2CH2-cycPr H 239 6-MeO cf3 CH2CH2CH2CH2〇HH 240 6-MeO cf3 CH2CH2-CH (OH) Me H 241 6-MeO cf3 CH2CH2-Ph H 242 6-MeO cf3 CH2CH2- (2-Cl) Ph H 243 6-MeO cf3 CH2CH2- (3-Cl) Ph H 244 6-MeO cf3 CH2CH2- (4-Cl) Ph H 245 6-MeO cf3 CH2CH2- (2 -F) Ph H 246 6-MeO cf3 CH2CH2- (3-F) Ph H 247 6-MeO cf3 CH2CH2- (4-F) Ph H 248 6-MeO cf3 CH2CHr (2-OH) Ph H 249 6-MeO cf3 CH2CH2- (3-〇H) Ph H 250 6-MeO cf3 CH2CH2- (4-OH) Ph H 251 6-MeO cf3 CH2CH2- (2-OMe) Ph H 252 6_MeO cf3 CH2CH2- (3-OMe) Ph H 253 6-MeO cf3 CH2CH2- (4-OMe) Ph H 254 6_MeO cf3 CH2CH2- (2-CN) Ph H 255 6-MeO cf3 CH2CH2- (3-CN) Ph H 256 6-MeO cf3 CH2CHr (4- CN) Ph H 257 6-MeO cf3 CH2CHr (2_N02) Ph H 258 6-MeO cf3 CH2CH2- (3-N02) Ph H 259 6-MeO cf3 CH2CH2- (4-N02) Ph H 260 6-MeO cf3 CH2CH2- (2-NH2) Ph H 261 6-MeO cf3 CH2CH2- (3-NH2) Ph H 262 6_MeO cf3 CH2CH2- (4-NH2) Ph H 263 6-MeO cf3 CH2CHr (2_NMe2) Ph H ----:- - --Refer to ------- 1T ------- I; (Please read the note r on the back before writing 4-page) -68- This paper size applies to China National Standard (CNS) A4 (210X297 mm) 587078 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Invention Description (66) 264 6-MeO cf3 CH2CH2- (3-NMe2) Ph H 265 6-MeO cf3 CH2CH2- (4-NMe2 ) Ph H 266 6-MeO cf3 CH2CH2-2-pyridyl H 267 6_MeO cf3 CH2CH2-3-pyridyl H 268 6-MeO cf3 CH2CH2-4 ^ pyridyl H 269 6-MeO cf3 CH2CHr2-furyl H 270 6 -MeO cf3 CH2CH2-3-furanyl H 271 6-MeO cf3 CH2CH2_4-furyl H 272 6-MeO cf3 CH2CHr3-fluorenyl H 273 6_MeO cf3 CH2CH2-2-oxazolyl H 274 6-MeO cf3 CH2CHr2-pyrimidine Azolyl H 275 6_MeO cf3 CH2CH2-4-isoxazolyl H 276 6-MeO cf3 CH2CH2-2-imidazolyl H 277 6-MeO cf3 C = C-cycPr ch3 278 6_MeO cf3 C ^ C-Ph ch3 279 6- MeO cf3 C Ξ C-2-p than Yodoyl ch3 280 6-MeO cf3 OC-3-pyridyl ch3 281 6-MeO cf3 pyridyl ch3 282 6-MeO cf3 C = C_2-furyl ch3 283 6_MeO cf3 C Ξ C-3-branyl ch3 284 6-MeO cf3 C = C-2-thienyl ch3 285 6_MeO cf3 C = C- 3-ρ sephenyl ch3 286 6-MeO cf3 C = C_cycPr ch3 287 6-MeO cf3 C = C-Ph ch3 288 6-MeO cf3 C = C-2-p than yodoyl ch3 289 6-MeO cf3 C = C-3 · pyridyl ch3 290 6_MeO cf3 C = C-4-p ratio than yl ch3 291 6-MeO cf3 C = C-2-pyranyl ch3 292 6_MeO cf3 〇C_3-furyl ch3 293 6-MeO cf3 C = C-2-p sephenyl ch3 -69- (Please read the note of r on the back before writing this page) 4

、 1T This paper size applies to Chinese National Standard (CNS) A4 specification (210X297 mm) 587078 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs A7 B7 V. Description of the invention (67) 294 6_MeO cf3 C = C-3-pyrimidine Ch3 295 6_MeO cf3 CH2CH2-cycPr ch3 296 6-MeO cf3 CH2CHrPh ch3 297 6-MeO cf3 CH2CH2-2-pyridyl ch3 298 6-MeO cf3 CH2CH2_3-pyridyl ch3 299 6-MeO cf3 CH2CH2-4-pyridyl ch3 300 6_MeO cf3 CH2CH2-2-furyl ch3 301 6-MeO cf3 CH2CH2-3-furyl ch3 302 6_MeO cf3 CH2CH2-2_pyrimyl ch3 303 6-MeO cf3 CH2CH2-3 · pyrimyl ch3 304 6_MeO cf3 C = C-cycPr ch2ch3 305 6-MeO cf3 C ^ C-Ph CH2CH3 306 6-MeO cf3 C Ξ C_2-p than Yodo CH2CH3 307 6-MeO cf3 C Ξ 03-EYODO CH2CH3 308 6-MeO cf3 C e C-4w ratio Yodo CH2CH3 309 6-MeO cf3 C = C_2-furanyl CH2CH3 310 6-MeO cf3 C = C-3-creanyl ch2ch3 311 6-MeO cf3 CeC-2-pyridinyl CH2CH3 312 6 -MeO cf3 C Ξ C_3_p sephenyl CH2CH3 313 6-MeO cf3 C = C-cycPr CH2CH3 314 6-MeO cf3 C = C-Ph CH2CH3 315 6-MeO cf3 C = C-2-pyridyl ch2ch3 316 6-MeO cf3 C = C-3- Pyridyl CH2CH3 317 6-MeO cf3 C = C-4-pyridyl CH2CH3 318 6-MeO cf3 C = C-2-furyl ch2ch3 319 6-MeO cf3 C = C_3-furyl CH2CH3 320 6-MeO cf3 C = C-2-fluorenyl ch2ch3 321 6-MeO cf3 C = C-3-pyridinyl CH2CH3 322 6-MeO cf3 CH2CH2-cycPr ch2ch3 323 6-MeO cf3 CH2CH2-Ph CH2CH3 (Please read the note on the back first (Further, write this page) -70- This paper size is in accordance with Chinese National Standard (CNS) A4 (210X297 mm) 587078 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs A7 B7 V. Invention Description (68) 324 6- MeO cf3 CH2CHr2-pyridyl CH2CH3 1 325 6-MeO cf3 CH2CH2-3-pyridyl CH2CH3 1 326 6-MeO cf3 CH2CHr4-pyridyl CH2CH3 Please read 1 first 1 read back | tomb 1 r 丨 2 1 again 1 Fill-J book 7 hundred 327 6-MeO cf3 CH2CH2-2-furyl CH2CH3 328 6-MeO cf3 CH2CH2-3-furyl ch2ch3 329 6-MeO cf3 CH2CH2-2-pyridyl ch2ch3 330 6-MeO cf3 CH2CH2- 3-fluorenyl CH2CH3 331 5,6_diF cf3 C = C- (2-Cl) Ph H 332 5,6-diF cf3 C = C- (3_Cl) Ph H 333 5,6-diF cf3 C «4-Cl ) Ph H 334 5,6-diF cf3 C = C- (2-F) Ph H Xs 1-^ I 335 5,6-diF cf3 C ^ C- (3-F) Ph H 1 I 336 5,6-diF cf3 C = C- (4-F) Ph H 1 I 337 5,6-diF cf3 C = C- (2-OH) Ph H 1 1 338 5,6-diF cf3 C ^ C- (3-OH) Ph H 339 5,6-diF cf3 C = C- (4-OH) Ph H 1 I 340 5 , 6-diF cf3 C ^ C- (2-OMe) Ph H 1 I 341 5,6-diF cf3 C ^ C- (3-OMe) Ph H 1 1 342 5,6-diF cf3 C ^ C- ( 4-OMe) Ph H 1 I 343 5,6-diF cf3 CEC- (2-CN) Ph H 1 4 344 5,6-diF cf3 C = C- (3-CN) Ph H 345 5,6-diF cf3 C ^ C- (4-CN) Ph H j 346 5,6-diF cf3 C ^ C- (2-N02) Ph HI 347 5,6-diF cf3 C ^ C- (3-N02) Ph H 1 348 5,6-diF cf3 CEC_ (4-N02) Ph H 1 1 349 5,6-diF cf3 C ^ C- (2-NH2) Ph H 350 5,6-diF cf3 C ^ C- (3-NH2 ) Ph H 1 I 351 5,6-diF cf3 C ^ C- (4-NH2) Ph HI 352 5,6-diF cf3 C ^ C- (2-NMe2) Ph H 1 353 5,6-diF cf3 CEC -(3-NMe2) Ph H 1 -71-This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) 587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Invention Description (69)

354 5,6-diF cf3 C ^ C- (4-NMe2) Ph H 355 5,6_diF cf3 C = 〇3-pyridylH 356 5,6-diF cf3 CeC-4-Eodoyl H 357 5,6 -diF cf3 C = 02-creanyl H 358 5,6-diF cf3 C Ξ C-3-octanoyl H 359 5,6-diF cf3 C = C-2-pyridinyl H 360 5,6- diF cf3 C Ξ C-3-p sedenyl H 361 5,6-diF cf3 CeC-2-azazolyl H 362 5,6-diF cf3 C = C-2-pyrazolyl H 363 5,6- diF cf3 C ^ C-4-isoxazolyl H 364 5,6-diF cf3 C = C-2-imidazolyl H 365 5,6-diF cf3 C = C- (2-Cl) Ph H 366 5, 6-diF cf3 C = C- (3-Cl) Ph H 367 5,6-diF cf3 C = C- (4-Cl) Ph H 368 5,6-diF cf3 C = C- (2-F) Ph H 369 5,6-diF cf3 C = C- (3-F) Ph H 370 5,6-diF cf3 C = C- (4-F) Ph H 371 5,6-diF cf3 C = C_ (2- OH) Ph H 372 5,6-diF cf3 C = C- (3-OH) Ph H 373 5,6-diF cf3 C = C- (4-OH) Ph H 374 5,6-diF cf3 C = C -(2-OMe) Ph H 375 5,6-diF cf3 C = C- (3-OMe) Ph H 376 5,6-diF cf3 C = C- (4-OMe) Ph H 377 5,6-diF cf3 C = C- (2-CN) Ph H 378 5,6-diF cf3 C = C- (3-CN) Ph H 379 5,6-diF cf3 C = C_ (4-CN) Ph H 380 5, 6-diF cf3 C = C- (2-N02) Ph H 381 5,6-diF cf3 C = C- (3-N02) Ph H 382 5,6-diF cf3 C = C- (4-N02) Ph H 383 5,6-diF cf3 C = C- (2-NH2) Ph H -72- This paper size is applicable to China National Standard (CNS) A4 (210X297 mm) 587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of the invention (%)

384 5,6-diF cf3 C = C- (3-NH2) Ph H 385 5,6-diF cf3 C = C- (4-NH2) Ph H 386 5,6-diF cf3 C = C- (2- NMe2) Ph H 387 5,6-diF cf3 C = C- (3-NMe2) Ph H 388 5,6-diF cf3 C = C- (4-NMe2) Ph H 389 5,6-diF cf3 C = C -3-Edoyl H 390 5,6-diF cf3 than Yodo H 391 5,6-diF cf3 C = C-2-octanoyl H 392 5,6-diF cf3 C = C-3_furanyl H 393 5,6-diF cf3 OC-2-pyridinyl H 394 5,6-diF cf3 C = C-3-p cephenyl H 395 5,6-diF cf3 C = C-2-zawalyl H 396 5,6-diF cf3 C = C-2-pyrazolyl H 397 5,6-diF cf3 OC-4-isoxazolyl H 398 5,6-diF cf3 C = C-2-imidazolyl H 399 5,6-diF cf3 CH2CH2-cycPr H 400 5,6-diF cf3 CH2CH2CH2CH2OH H 401 5,6-diF cf3 CH2CH2-CH (OH) Me H 402 5,6-diF cf3 CH2CH2-Ph H 403 5,6 -diF cf3 CH2CH2- (2-Cl) Ph H 404 5,6-diF cf3 CH2CH2- (3-Cl) Ph H 405 5,6-diF cf3 CH2CH2- (4-Cl) Ph H 406 5,6-diF cf3 CH2CH2- (2-F) Ph H 407 5,6-diF cf3 CH2CH2- (3-F) Ph H 408 5,6-diF cf3 CH2CH2- (4-F) Ph H 409 5,6-diF cf3 CH2CH2 -(2-OH) Ph H 440 5,6-diF cf3 CH2CH2- (3.〇H) Ph H 411 5,6-diF cf3 CH2CH2- (4-OH) Ph H 412 5,6-diF cf3 CH2CH2- (2-OMe) Ph H 413 5, 6-diF cf3 CH2CH2- (3-〇Me) Ph H -73- This paper size applies to China National Standard (CNS) A4 (210X297 mm) 587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs Β7 71 — 5 Description of the invention () 414 5,6-diF cf3 CH2CH2- (4-OMe) Ph H 415 5,6_diF cf3 CH2CH2- (2-CN) Ph H 416 5,6-diF cf3 CH2CH2- (3-CN) Ph H 417 5,6-diF cf3 CH2CH2- (4-CN) Ph H 418 5,6-diF cf3 CH2CH2- (2-N02) Ph H 419 5,6-diF cf3 CH2CHr (3-N02) Ph H 420 5 , 6-diF cf3 CH2CH2- (4-N02) Ph H 421 5,6-diF cf3 CH2CH2- (2-NH2) Ph H 422 5,6-diF cf3 CH2CH2- (3-NH2) Ph H 423 5,6 -diF cf3 CH2CHr (4_NH2) Ph H 424 5,6-diF cf3 CH2CH2_ (2-NMe2) Ph H 425 5,6-diF cf3 CH2CH2- (3-NMe2) Ph H 426 5,6-diF cf3 CH2CHr (4 -NMe2) Ph H 427 5,6-diF cf3 CH2CHr2-pyridyl H 428 5,6-diF cf3 CH2CHr3-pyridyl H 429 5,6-diF cf3 CH2CH2-4-pyridyl H 430 5,6-diF cf3 CH2CHr2-furanyl H 431 5,6-diF cf3 CH2CHr3-furanyl H 432 5,6-diF cf3 CH2CH2-2-pyridinyl H 433 5,6-diF cf3 CH2CH2-3 ^ sedenyl H 434 5, 6-diF cf3 CH2CH2_2-oxazolyl H 435 5,6-diF cf3 CH2CH2-2 -Oxazolyl H 436 5,6-diF cf3 CH2CH2_4-isoxazolyl H 437 5,6-diF cf3 CH2CH2_2_imidazolyl H 438 5,6-diF cf3 C = C-cycPr ch3 439 5,6-diF cf3 CeC-2-pyridyl ch3 440 5,6-diF cf3 CeC_3 · pyridyl ch3 441 5,6-diF cf3 CeC_4-saidyl ch3 442 5,6-diF cf3 C Ξ C-2-pyranyl ch3 443 5,6-diF cf3 C Ξ C-3-branyl ch3 -74- This paper size is applicable to China National Standard (CNS) A4 (210X297 mm) 587078 Printed by A7, Consumer Cooperative of the Central Standards Bureau, Ministry of Economic Affairs V. Description of the invention (72) 444 5,6-diF cf3 C = C-2-ρ sephenyl ch3 445 5,6-diF cf3 C = C-3-p sephenyl ch3 446 5,6-diF cf3 C = C-cycPr ch3, ^ v Please read the notice on the back-fill in the entries-write a hundred hundred 447 5,6-diF cf3 C = C-2-p than Yodo ch3 448 5,6-diF cf3 C = C- 3-pyridyl ch3 449 5,6-diF cf3 C = C-4-p than yodoyl ch3 450 5,6-diF cf3 C = C-2-ylanyl ch3 451 5,6-diF cf3 C = C -3-Oranyl ch3 452 5,6-diF CFs C = C-2-pyridinyl ch3 453 5,6-diF cf3 C = C-3-fluorenyl ch3 454 5,6-diF cf3 CH2CH2- cycPr ch3 May 455 5,6-diF cf3 CH2CH2-Ph ch3 456 5, 6-diF cf3 CH2CH2-2 · pyridyl ch3 457 5,6-diF cf3 CH2CH2-3-pyridyl ch3 458 5,6-diF cf3 CH2CH2-4-pyridyl ch3 459 5,6-diF cf3 CH2CHr2-furyl ch3 460 5,6-diF cf3 CH2CH2-3-furyl ch3 461 5,6-diF cf3 CH2CHr2-fluorenyl ch3 462 5,6-diF cf3 CH2CH2_3_fluorenyl ch3 463 5,6-diF cf3 C ^ C-cycPr. CH2CH3 464 5,6-diF cf3 C ^ C-Ph CH2CH3 465 5,6-diF cf3 C Ξ C-2-p than the base CH2CH3 466 5,6-diF cf3 Ce〇3-pyridyl CH2CH3 467 5,6-diF cf3 c = c-pyridyl group CH2CH3 468 5,6-diF cf3 C Ξ C-2-ylpyranyl CH2CH3 469 5,6-diF cf3 C Ξ C-3-pyranyl ch2ch3 470 5 , 6-diF cf3 C Ξ C-2-distenyl CH2CH3 471 5,6-diF cf3 C Ξ C-3-p sephenyl CH2CH3 472 5,6-diF cf3 C = C-cycPr CH2CH3 473 5,6 -diF cf3 C = C-Ph CH2CH3 -75- This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) 587078 Employees' Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs printed A7 B7 V. Description of the invention (73)

474 5,6-diF cf3 C = C-2-p ratio Yodo CH2CH3 475 5,6_diF cf3 C = C-3-pyridyl CH2CH3 476 5,6-diF cf3 C = C-4-p ratio Yodo CH2CH3 -V Please read 477 5,6-diF cf3 C = C_2-furyl CH2CH3 First read 478 5,6-diF cf3 C = C-3 · furyl CH2CH3 Read back 479 5,6-diF cf3 C = C-2- p-Cyphenyl CH2CH3 480 5,6-diF cf3 C = C-3-p-Cyphenyl ch2ch3 > Wang Yi 481 5,6-diF cf3 CH2CH2-cycPr ch2ch3 contention 482 5,6-diF cf3 CH2CH2 -Ph CH2CH3 Danfill- 483 5,6-diF cf3 CH2CH2-2-pyridylCH2CH3 Benzene 484 5,6-diF cf3 CH2CH2-3-pyridyl CH2CH3 485 5,6-diF cf3 CH2CH2_4-pyridyl ch2ch3 486 5,6-diF cf3 CH2CH2-2-furyl CH2CH3 487 5,6-diF cf3 CH2CHr3-furyl CH2CH3 488 5,6-diF cf3 CH2CH2-2-pyrimyl ch2ch3 489 5,6-diF cf3 CH2CH2-3 -Pyrimidinyl CH2CH3 490 5,6-diCl cf3 C ^ C- (2-Cl) Ph H 491 5,6-diCl cf3 C ^ C- (3-Cl) Ph H 492 5,6-diCl cf3 C ^ C- (4-Cl) Ph H 493 5,6-diCl cf3 C ^ C- (2-F) Ph H 494 5,6-diCl cf3 C ^ C- (3-F) Ph H 495 5,6- diCl cf3 C ^ C- (4-F) Ph H 496 5,6-diCl cf3 CeC- (2-OH) Ph H 497 5,6-diCl cf3 C ^ C- (3-OH) Ph H 498 5,6-diCl cf3 C ^ C- (4-OH) Ph H 499 5,6-diCl cf3 C ^ C- (2-OMe) Ph H 500 5,6-diCl cf3 C ^ C- (3 -OMe) Ph H 501 5,6-diCl cf3 〇C- (4-OMe) Ph H 502 5,6-diCl cf3 C ^ C- (2-CN) Ph H 503 5,6-diCl cf3 C ^ C -(3-CN) Ph H -76- This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) 587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs kl B7 74 V. Description of Invention () 504 5 , 6-diCl cf3 C ^ C- (4-CN) Ph H 雠 1 505 5,6-diCl cf3 C ^ C- (2-N02) Ph H 1 506 5,6-diCl cf3 C ^ C- (3 -N02) Ph HI Please 507 5,6-diCl cf3 C «4_N02) Ph HI Read 1 508 5,6-diCl cf3 C ^ C- (2-NH2) Ph H Read back 509 5,6-diCl cf3 C ^ C- (3-NH2) Ph H surface 1 510 5,6-diCl cf3 C = C- (4-NH2) Ph H t, ancient-1 511 5,6-diCl cf3 C ^ C- (2-NMe2 ) Ph H matter 2 1 512 5,6-diCl cf3 C tri-C_ (3-NMe2) Ph H 513 5,6-diCl cf3 C ^ C- (4-NMe2) Ph H 514 5,6-diCl cf3 Ce 〇3-PyridylH Page 1 515 5,6-diCl cf3 C Ξ C_4-Exopyridyl H 1 1 516 5,6-diCl cf3 C = C-2-Branyl H 1 I 517 5,6- diCl cf3 C = C-3-branyl H 1 I 518 5,6-diCl cf3 C ^ C-2-fluorenyl H 1 order 519 5,6-diCl cf3 C = C-3-thienyl H 1 520 5,6-diCl cf3 C = C-2-oxazolyl H 1 I 521 5,6-diCl cf3 C ^ C-2 -Oxazolyl H 1 | 522 5,6-diCl cf3 OC-4-isooxazolyl H 1 523 5,6-diCl cf3 C = C-2-imidazolyl H 1 524 5,6-diCl cf3 C = C-(2-Cl) Ph H 1 525 5,6-diCl cf3 C = C- (3-Cl) Ph H 1 526 5,6-diCl cf3 C = C- (4-Cl) Ph H Ί 527 5 , 6-diCl cf3 C = C- (2-F) Ph H 1 528 5,6-diCl cf3 C = C- (3-F) Ph H _l 1 529 5,6-diCl cf3 C = C- (4 -F) Ph H 530 5,6-diCl cf3 C = C- (2-OH) Ph H 1 I 531 5,6-diCl cf3 C = C- (3-OH) Ph HI 532 5,6-diCl cf3 C = C- (4-OH) Ph H 1 1 533 5,6-diCl cf3 C = C- (2-OMe) Ph H 1 -77- This paper size applies Chinese National Standard (CNS) A4 specification (210X 297 (Mm) 587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs Β7. Invention Description (75)

534 5,6-diCl cf3 OC_ (3-OMe) Ph H 535 5,6-diCl cf3 C = C- (4-OMe) Ph H 536 5,6-diCl cf3 C = C- (2-CN) Ph H 537 5,6_diCl cf3 C = C- (3-CN) Ph H 538 5,6-diCl cf3 C = C- (4-CN) Ph H 539 5,6-diCl cf3 C = C- (2-N02 ) Ph H 540 5,6-diCl cf3 C = C- (3-N02) Ph H 541 5,6-diCl cf3 C = C- (4-NO: j) Ph H 542 5,6-diCl cf3 C = C- (2-NH2) Ph H 543 5,6-diCl cf3 C = C- (3-NH2) Ph H 544 5,6-diCl cf3 C = C- (4-NH2) Ph H 545 5,6- diCl cf3 C = C- (2-NMe2) Ph H 546 5,6-diCl cf3 C = C- (3-NMe2) Ph H 547 5,6-diCl cf3 OC_ (4_NMe2) Ph H 548 5,6-diCl cf3 C = C-3-p ratio Yodo H 549 5,6-diCl cf3 C = C-4- # b Yodo H 550 5,6-diCl cf3 C = C-2-Oranyl H 551 5, 6-diCl cf3 C = C-3-octanoyl H 552 5,6-diCl cf3 C = C-2- ^ phenyl H 553 5,6-diCl cf3 C = C-3-p cephenyl H 554 5,6-diCl cf3 owayl H 555 5,6-diCl cf3 C = C-2-pyrazolyl H 556 5,6-diCl cf3 C = C-4-isooxazolyl H 557 5,6- diCl cf3 C = C-2-imidazolyl H 558 5,6-diCl cf3 CH2CH2-cycPr H 559 5,6-diCl cf3 CH2CH2CH2CH2OH H 560 5,6-diCl cf3 CH2CH2-CH (OH) Me H 561 5,6 -diCl cf3 CH2CH2-Ph H 562 5,6-diCl cf3 CH2CH2- (2-Cl) P h H 563 5,6-diCl cf3 CH2CHr (3-Cl) Ph H (Please read the precautions on the back before 4-writing this page) " 口 -73- This paper size applies to China National Standard (CNS) A4 specifications (210X 297 mm) 587078 A7 B7 printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 5. Description of the invention (76)

564 5,6-diCl cf3 CH2CH2- (4-Cl) Ph H 565 5,6-diCl cf3 CH2CH2- (2-F) Ph H 566 5,6-diCl cf3 CH2CHr (3-F) Ph H 567 5, 6-diCl cf3 CH2CH2- (4-F) Ph H 568 5,6-diCl cf3 CH2CH2- (2-OH) Ph H 569 5,6-diCl cf3 CH2CH2- (3-〇H) Ph H 570 5,6 -diCl cf3 CH2CH2- (4-OH) Ph H 571 5,6-diCl cf3 CH2CH2- (2-OMe) Ph H 572 5,6-diCl cf3 CH2CH2- (3-OMe) Ph H 573 5,6-diCl cf3 CH2CH2- (4-OMe) Ph H 574 5,6-diCl cf3 CH2CH2- (2-CN) Ph H 575 5,6-diCl cf3 CH2CH2- (3-CN) Ph H 576 5,6-diCl cf3 CH2CH2 -(4-CN) Ph H 577 5,6-diCl cf3 CH2CH2_ (2-N02) Ph H 578 5,6-diCl cf3 CH2CH2- (3-N02) Ph H 579 5,6-diCl cf3 CH2CH2- (4 -N02) Ph H 580 5,6-diCl cf3 CH2CH2- (2-NH2) Ph H 581 5,6-diCl cf3 CH2CH2- (3-NH2) Ph H 582 5,6-diCl cf3 CH2CH2- (4-NH2 ) Ph H 583 5,6-diCl cf3 CH2CH2- (2-NMe2) Ph H 584 5,6-diCl cf3 CH2CH2- (3-NMe2) Ph. H 585 5,6-diCl cf3 CH2CH2- (4-NMe2) Ph H 586 5,6-diCl cf3 CH2CHr2-pyridyl H 587 5,6-diCl cf3 CH2CHr3-pyridyl H 588 5,6-diCl cf3 CH2CH2-4-this pyridyl H 589 5,6-diCl cf3 CH2CH2- 2-furyl H 590 5,6-diCl cf3 CH2CHr3-furyl H 5 91 5,6-diCl cf3 CH2CH2-2-thienyl H 592 5,6-diCl cf3 CH2CHr3-pyrimyl H 593 5,6-diCl cf3 CH2CHr2-oxazolyl H -79- (Please read the note on the back first • Matters again 4- write this page)

、 1T This paper size is applicable to Chinese National Standard (CNS) A4 specification (210X 297 mm) 587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of the invention (77) 594 5,6-diCl cf3 CH2CHr2-pyrimide Azolyl H 595 5,6-diCl cf3 CH2CH2-4-isoxazolyl H 596 5,6-diCl cf3 CH2CHr2-imidazolyl H Please 597 5,6-diCl cf3 C = C-cycPr ch3 Read 598 5 , 6_diCl cf3 C Ξ C-2-p is more than the base ch3 term 599 5,6-diCl cf3 C e C_3-p is 600 than the surface of the base ch3 5,6-diCl cf3 CeC-4_pyridyl ch3 Note the ancient 601 5,6-diCl cf3 C Ξ C-2-Oranyl ch3 602 5,6-diCl cf3 C Ξ C-3 · Orano ch3 Refill 603 5,6-diCl cf3 C Ξ C-2- p-Cephenyl ch3 Benzene 604 5,6-diCl cf3 C Ξ C-3-p-Cephenyl ch3 Bay 605 5,6-diCl cf3 C = C-cycPr ch3 606 5,6-diCl cf3 C = C- 2-pyridyl ch3 607 5,6-diCl cf3 C = C-3 than yl ch3 608 5,6-diCl cf3 than yl ch3 609 5,6-diCl cf3 C = C-2-pyranyl ch3 610 5,6-diCl cf3 C = C-3-octanoyl ch3 611 5,6-diCl cf3 C = C-2-p-sedenyl ch3 612 5,6-diCl cf3 C = C-3-p-sedyl Ch3 613 5,6-di Cl cf3 CH2CH2-cycPr ch3 614 5,6-diCl cf3 CH2CH2-Ph ch3 615 5,6-diCl cf3 CH2CHr2-pyridyl ch3 616 5,6-diCl cf3 • CH2CHr3-pyridyl ch3 617 5,6-diCl cf3 CH2CH2 -4-pyridyl ch3 618 5,6-diCl cf3 CH2CH2-2 · furyl ch3 619 5,6-diCl cf3 CH2CH2-3 · furyl ch3 620 5,6-diCl cf3 CH2CH2-2-fluorenyl ch3 621 5,6-diCl cf3 CH2CH2-3_fluorenyl ch3 622 5,6-diCl cf3 C = C-cycPr ch2ch3 623 5,6-diCl cf3 C ^ C-Ph ch2ch3 -80- This paper size applies to Chinese national standards (CNS) A4 specification (210 X 297 mm) 587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs Β7 78 V. Description of the invention ()

624 5,6-diCl cf3 C = C-2-pyridyl CH2CH3 625 5,6-diCl cf3 CeC-3_p Bicyl CH2CH3 626 5,6-diCl cf3 C Ξ C-4-p Bidyl ch2ch3 627 5 , 6-diCl cf3 C ^ C-2-furyl CH2CH3 628 5,6-diCl cf3 C = C-3-creanyl CH2CH3 629 5,6-diCl cf3 C = C-2-thienyl CH2CH3 630 5, 6-diCl cf3 C ^ C-3-fluorenyl CH2CH3 631 5,6-diCl cf3 C = C-cycPr CH2CH3 632 5,6-diCl cf3 C = C-Ph ch2ch3 633 5,6-diCl cf3 C = C -2-pyridyl ch2ch3 634 5,6-diCl cf3 C = C-3_p than Yodo CH2CH3 635 5,6-diCl cf3 C = C_4_Edianji ch2ch3 636 5,6-diCl cf3 C = C-2_ Furyl ch2ch3 637 5,6-diCl cf3 C = C-3-Branyl ch2ch3 638 5,6-diCl cf3 C = C-2-p Cephenyl CH2CH3 639 5,6-diCl cf3 C = C-3 -p sephenyl ch2ch3 640 5,6-diCl cf3 CH2CH2-cycPr CH2CH3 641 5,6-diCl cf3 CH2CHrPh CH2CH3 642 5,6-diCl cf3 CH2CHr2-pyridyl ch2ch3 643 5,6-diCl cf3 CH2CH2-3-pyridine CH2CH3 644 5,6-diCl cf3 CH2CHr4-pyridyl CH2CH3 645 5,6-diCl cf3 CH2CH2_2_furyl ch2ch3 646 5,6-diCl cf3 CH2CHr3-furyl CH2CH3 647 5,6-diCl cf3 CH2CH2-2-p Cephenyl CH2CH3 648 5,6-diC l cf3 CH2CH2-3-fluorenylCH2CH3 649 6-F cf3 C ^ CCH2CH2OH H 650 6_F cf3 OC-CH (OH) Me H 651 6-F cf3 C ^ C- (2-Cl) Ph H 652 6-F cf3 C = C- (3-Cl) Ph H 653 6-F cf3 C ^ C- (4-Cl) Ph H (Please read the precautions and notes on the back before filling out this page), 1Τ -81-Standard of this paper Applicable to China National Standard (CNS) A4 specification (210X297 mm) 587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of the invention (79) 654 6_F cf3 C = C- (2-F) Ph Η 655 6 -F cf3 C ^ C- (3-F) Ph Η 656 6-F cf3 C ^ C- (4-F) Ph Η 657 6-F cf3 C = C- (2_OH) Ph Η 658 6-F cf3 C ^ C- (3-OH) Ph Η 659 6-F cf3 C ^ C- (4-OH) Ph Η 660 6-F cf3 C ^ C- (2-OMe) Ph Η 661 6-F cf3 C «3_OMe ) Ph Η 662 6-F cf3 C = C- (4-OMe) Ph Η 663 6-F cf3 C ^ C- (2-CN) Ph Η 664 6-F cf3 C ^ C- (3-CN) Ph Η 665 6-F cf3 C ^ C- (4-CN) Ph Η 666 6-F cf3 CEC- (2-N02) Ph Η 667 6-F cf3 C ^ C- (3-N02) Ph Η 668 6- F cf3 C ^ C- (4-N02) Ph 669 669 6-F cf3 C tri-C- (2-NH2) Ph Η 670 6-F cf3 C ^ C- (3-NH2) Ph Η 671 6-F cf3 C three C- (4-NH2) Ph Η 672 6-F cf3 C ^ C- (2-NMe2) Ph Η 673 6-F cf3 C ^ C- (3-NMe2 ) Ph Η 674 6-F cf3 C ^ C- (4-NMe2) Ph Η 675 6-F cf3 CeC-3-p ratio Yodo base Η 676 6-F cf3 C three C-4- mouth specific drink: Η 677 6-F cf3 C ^ C-2-creanyl Η 678 6_F cf3 C Ξ C-3-pyranyl Η 679 6-F cf3 C ^ C-2-pyrimyl Η 680 6-F cf3 C Ξ C-3-distenylpyrene 681 6-F cf3 Ce〇2-oxazolylΗ 682 6-F cf3 C = C-2-pyrazolylΗ 683 6-F cf3 C ^ C-4-isohumidazole Base Η -82- (Please read the note r on the back before filling this page) This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) 587078 A7 B7 V. Description of Invention (8Q) Central Standard of the Ministry of Economic Affairs Printed by the Bureau's Consumer Cooperatives 684 6-F cf3 C = C-2-Mi Junji H 1 1 685 6-F cf3 C = CCH2CH2OH H 1 I 686 6-F cf3 C = C-CH (OH) Me H 1 Please read 1 first, read 1 back, 1 of I, r 1 item 1 fd 687 6-F cf3 C = C- (2-Cl) Ph H 688 6-F cf3 C = C_ (3_Cl) Ph H 689 6 -F cf3 C = C- (4-Cl) Ph H 690 6-F cf3 C = C- (2-F) Ph H 691 6-F cf3 C = C- (3-F) Ph H 692 6-F cf3 C = C- (4-F) Ph H 693 6-F cf3 C = C- (2-OH) Ph H this ^ 694 hundred 6-F cf3 C = C- (3-OH) Ph H month 1 ν ^ I 695 6-F cf3 C = C- (4-OH) Ph H 1 696 6_F cf3 C = C- (2-OMe) Ph H 1 I 697 6-F cf3 C = C- (3-OMe) Ph H 1 I 698 6-F cf3 C = C- (4-OMe) Ph H Order 699 6 -F cf3 C = C- (2-CN) Ph H 1 I 700 6-F cf3 C = C- (3-CN) Ph H 1 I 701 6-F cf3 C = C- (4-CN) Ph H 1 1 702 6-F cf3 C = C- (2-N02) Ph H 1 I 703 6-F cf3 C = C- (3-N02) Ph H 1 704 6-F cf3 C = C- (4-N02 ) Ph H 705 6-F cf3 C = C- (2-NH2) Ph HJ 706 6-F cf3 C = C- (3-NH2) Ph H 707 6-F cf3 OC- (4-NH2) Ph H 1 708 6-F cf3 C = C- (2-NMe2) Ph H 1 1 709 6-F cf3 OC- (3_NMe2) Ph H 710 6-F cf3 C = C- (4-NMe2) Ph H 1 1 711 6 -F cf3 0 = 0-3-0 than Yodo HI 712 6-F cf3 C = C-4-pyridyl H 1 1 713 6-F cf3 C = C-2-pyranyl-83-H 1 1 1 1 1 This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) 587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of the invention (81) 714 6_F cf3 C = C-3-bit Uranyl H 1 715 6-F cf3 C = C-2-pyridinyl H 1 716 6-F cf3 C = C-3-telephenyl H 1 Please 717 6_F cf3 C = C-2-oxazolyl H First read 1 -i person 1 718 6-F cf3 C = C-2-oxazolyl H back-1 death 719 6-F cf3 C = C_4-isooxazolyl H face ^ 'I 720 6 -F cf3 C = C-2-imidazolyl H *-721 6-F cf3 CH2CH2-cycPr H contention 1 item I 5 1 722 6-F cf3 CH2CH2CH2CH2OH H% 723 6-F cf3 CH2CH2-CH (OH) Me H Ben ^ 724 6-F cf3 CH2CHr (2-Cl) Ph H Μ 1 1 725 6-F cf3 CH2CH2_ (3-Cl) Ph H 1 726 6-F cf3 CH2CH2- (4-Cl) Ph H 1 I 727 6-F cf3 CH2CH2- (2-F) Ph H 1 1 728 6-F cf3 CH2CH2- (3-F) Ph H Order 729 6-F cf3 CH2CH2- (4-F) Ph H 1 I 730 6-F cf3 CH2CH2_ (2-OH) Ph H 1 I 731 6-F cf3 CH2CH2- (3-OH) Ph H 1 1 732 6-F cf3 CH2CH2- (4-〇H) Ph H 1 733 6-F cf3 CH2CH2- (2-OMe) Ph H 1 if 734 6-F cf3 CH2CH2- (3-OMe) Ph H 735 6-F cf3 CH2CH2- (4-OMe) Ph H 1 736 6-F cf3 CH2CHr (2-CN) Ph H Ί 737 6-F cf3 CH2CH2- (3-CN) Ph H 1 738 6-F cf3 CH2CH2_ (4_CN) Ph H 1 1 739 6-F cf3 CH2CH2- (2-N02) Ph H 740 6-F cf3 CH2CH2 -(3-N02) Ph H 1 I 741 6-F cf3 CH2CH2- (4-N02) Ph HI 742 6-F cf3 CH2CH2- (2-NH2) Ph H 1 1 743 6-F CF3 CH2CH2- (3- NH2) Ph H 1 -84- This paper size is applicable to Chinese National Standard (CNS) A4 (210X297 mm) 587078 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs Β7 82 V. Invention Ming () 744 6-F cf3 CH2CH2- (4-NH2) Ph H 745 6-F cf3 CH2CH2- (2-NMe2) Ph H 746 6_F cf3 CH2CH2- (3-NMe2) Ph H 747 6-F cf3 CH2CH2- (4-NMe2) Ph H 748 6-F cf3 CH2CH2-3-pyridyl H 749 6-F cf3 CH2CHr4-pyridyl H 750 6-F cf3 CH2CH2-2-furyl H 751 6-F cf3 CH2CH2-3- Furyl H 752 6-F cf3 CH2CHr2_fluorenyl H 753 6-F cf3 CH2CHr3-fluorenyl H 754 6-F cf3 CH2CHr2_oxazolyl H 755 6-F cf3 CH2CHr2_oxazolyl H 756 6- F cf3 CH2CH2-4-isoxazolyl H 757 6-F cf3 CH2CH2-2-imidazolyl H 758 6-F cf3 C = C-cycPr ch3 759 6-F cf3 C = C-iPr ch3 760 6-F cf3 C ^ C-Pr ch3 761 6-F cf3 C ^ C-Bu ch3 762 6-F cf3 C = C-iBu ch3 763 6-F cf3 C = C-tBu ch3 764 6-F cf3 C ^ C-Et ch3 765 6-F cf3 C ^ C-Me ch3 766 6-F cf3 C ^ C-Ph ch3 767 6_F cf3 〇C-2-pyridyl ch3 768 6-F cf3 CeC-3- ^: bityl ch3 769 6- F cf3 C Ξ C-4_p than Yodo ch3 770 6-F cf3 C Ξ C_2-pyranyl ch3 771 6-F cf3 C Ξ C-3-pyranyl ch3 772 6-F cf3 C = C-2- Far-phenyl ch3 773 6-F cf3 C = C-3_ ^ phenyl ch3 -85- (Please read the note on the back first " 4- Write this page)

、 1T This paper size is applicable to Chinese National Standard (CNS) A4 specification (210X 297 mm) 587078 Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of Invention (83) 774 6-F cf3 C = C-cycPr ch3 775 6-F cf3 C = C-iPr ch3 776 6-F cf3 C = C-Pr ch3 777 6-F cf3 OC-Bu ch3 778 6-F cf3 C = C-iBu ch3 779 6-F cf3 C = C-tBu ch3 780 6-F cf3 C = C-Et ch3 781 6-F cf3 C = C_Me ch3 782 6-F cf3 C = C-Ph ch3 783 6-F cf3 C = C-2-pyridyl ch3 784 6-F cf3 C = C-3-pyridyl ch3 785 6-F cf3 C = C-4-p than Yodo ch3 786 6-F cf3 C = C-2-furyl ch3 787 6-F cf3 C = C-3-branyl ch3 788 6-F cf3 C = C-2 · fluorenyl ch3 789 6-F cf3 C = C-3-p sedenyl ch3 790 6-F cf3 CH2CH2-cycPr ch3 791 6 -F cf3 CH2CH2-Ph ch3 792 6-F cf3 CH2CHr2-pyridyl ch3 793 6_F cf3 CH2CH2-3-pyridyl ch3 794 6-F cf3 CH2CH2-4-pyridyl ch3 795 6-F cf3 CH2CHr2-furyl ch3 796 6-F cf3 CH2CHr3-furyl ch3 797 6-F cf3 CH2CHr2-pyrimyl ch3 798 6-F cf3 CH2CH2-3-pyridinyl ch3 799 6-F cf3 C = C-cycPr ch3 800 6-F cf3 C ^ C-Ph CH2CH3 801 6-F cf 3 CeC_2-pyridyl CH2CH3 802 6_F cf3 CeC-3-Edianyl CH2CH3 803 6-F cf3 CeC-4-pyridyl ch2ch3 -86- This paper size applies to China National Standard (CNS) A4 specification (210X297 mm) 587078 A7 B7 V. Description of Invention (84 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs

804 6-F cf3 C = C-2-creanyl CH2CH3 805 6-F cf3 C Ξ C-3- sulfanyl ch2ch3 806 6_F cf3 C Ξ C-2-ρ sephenyl ch2ch3 807 6-F cf3 C e C-3-Farphenyl CH2CH3 808 6-F cf3 C = C-cycPr CH2CH3 809 6-F cf3 C = C_Ph CH2CH3 810 6-F cf3 C = C-2-p than Yodo CH2CH3 811 6-F cf3 C = C-3-p ratio 1 group CH2CH3 812 6-F cf3 C = C-4- # bb 基 CH2CH3 813 6-F cf3 C = C-2-furyl ch2ch3 814 6-F cf3 C = C_3- Furyl CH2CH3 815 6-F cf3 C = C_2-pyriminyl ch2ch3 816 6-F cf3 C = C-3-p sedenyl CH2CH3 817 6-F cf3 CH2CH2-cycPr CH2CH3 818 6-F cf3 CH2CH2-Ph ch2ch3 819 6-F cf3 CH2CH2-2-pyridyl CH2CH3 820 6-F cf3 CH2CH2-3-pyridyl CH2CH3 821 6-F cf3 CH2CHr4-pyridyl CH2CH3 822 6-F cf3 CH2CH2-2-furyl ch2ch3 823 6-F cf3 CH2CH2-3-furylCH2CH3 824 6-F cf3 CH2CHr2-fluorenyl CH2CH3 825 6-F cf3 CH2CH2-3-fluorenyl ch2ch3 826 5-C1 cf3 C = C-cycPr H 827 5-C1 cf3 C ^ CCH2CH2OH H 828 5-C1 cf3 C ^ C-CH (OH) Me H 829 5-C1 cf3 C = C-Ph H 830 5-C1 cf3 C = C- (2-Cl) Ph H 831 5-C1 cf3 C ^ C- (3-Cl) Ph H 832 5-C1 cf3 C «4_Cl) Ph H 833 5-C1 cf3 C ^ C- (2-F) Ph H -87 · This paper size is applicable to Chinese National Standard (CNS) A4 (210X297 mm) Please read the Ϊ item on the back side and fill in the page. · Write this page to order 587078 Printed by the Consumer Standards Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs A7 B7 V. Invention Description

834 5-C1 cf3 C = C- (3-F) Ph H 835 5-C1 cf3 C ^ C- (4-F) Ph H 836 5-C1 cf3 C ^ C- (2-OH) Ph H 837 5 -C1 cf3 C ^ C- (3-OH) Ph H 838 5-C1 cf3 C ^ C- (4-OH) Ph H 839 5-C1 cf3 C ^ C- (2-OMe) Ph H 840 5-C1 cf3 C ^ C- (3-0Me) Ph H 841 5-C1 cf3 C «4-OMe) Ph H 842 5-C1 cf3 C ^ C- (2-CN) Ph H 843 5-C1 cf3 C ^ C- (3-CN) Ph H 844 5-C1 cf3 C ^ C- (4-CN) Ph H 845 5-C1 cf3 C ^ C- (2-N02) Ph H 846 5-C1 cf3 CEC- (3_N02) Ph H 847 5-C1 cf3 CEC- (4_N02) Ph H 848 5-C1 cf3 C ^ C- (2-NH2) Ph H 849 5-C1 cf3 C ^ C- (3-NH2) Ph H 850 5-C1 cf3 C ^ C- (4-NH2) Ph H 851 5-C1 cf3 C ^ C- (2-NMe2) Ph H 852 5-C1 cf3 C = C- (3-NMe2) Ph H 853 5-C1 cf3 C ^ C- (4-NMe2) Ph H 854 5-C1 cf3 CeC-2-pyridyl H 855 5-C1 cf3 C Ξ C-2-p than Yodoyl H 856 5-C1 cf3 C Ξ C-3-Edian H 857 5-C1 cf3 C e C-4-p than Yodo H 858 5-C1 cf3 C Ξ C-2-pyranyl H 859 5-C1 cf3 C Ξ C-3-pyranyl H 860 5 -C1 cf3 〇C-2-fluorenyl H 861 5-C1 cf3 C ξ C-3-distenyl H 862 5-C1 cf3 〇C-2_azazolyl H 863 5-C1 cf3 C ^ C- 2_ pyrimidyl H -88- This paper size applies to China National Standard (CNS) A4 specifications (2 10X 297 mm) 587078 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs A7 B7 V. Description of Invention (86)

864 5-C1 cf3 C = C-4-isoxazolyl H 865 5-C1 cf3 C = C-2-imidazolyl H 866 5-C1 cf3 C = C-cycPr H 867 5-C1 cf3 C = CCH2CH2OH H 868 5-C1 cf3 C = C-CH (OH) Me H 869 5-C1 cf3 C = C-Ph H 870 5-C1 cf3 C = C- (2-Cl) Ph H 871 5-C1 cf3 C = C -(3-Cl) Ph H 872 5-C1 cf3 C = C_ (4-Cl) Ph H 873 5-C1 cf3 C = C- (2-F) Ph H 874 5-C1 cf3 C = C- (3 -F) Ph H 875 5-C1 cf3 C = C- (4-F) Ph H 876 5-C1 cf3 C = C- (2-OH) Ph H 877 5-C1 cf3 C = C- (3-OH ) Ph H 878 5-C1 cf3 C = C- (4-OH) Ph H 879 5-C1 cf3 C = C- (2-OMe) Ph H 880 5-C1 cf3 C = C- (3-OMe) Ph H 881 5-C1 cf3 C = C- (4-OMe) Ph H 882 5-C1 cf3 C = C- (2-CN) Ph H 883 5-C1 cf3 C = C- (3-CN) Ph H 884 5-C1 cf3 C = C- (4-CN) Ph H 885 5-C1 cf3 C = C_ (2-N02) Ph H 886 5-C1 cf3 C = C- (3-N02) Ph H 887 5-C1 cf3 C = C- (4-N02) Ph H 888 5-C1 cf3 C = C- (2-NH2) Ph H 889 5-C1 cf3 C = C- (3-NH2) Ph H 890 5-C1 cf3 C = C- (4-NH2) Ph H 891 5-C1 cf3 C = C- (2-NMe2) Ph H 892 5-C1 cf3 C = C- (3-NMe2) Ph H 893 5-C1 cf3 C = C -(4-NMe2) Ph H (Please read the notes on the back before filling in this page) d Order-89-This paper size applies to China National Standard (CNS) A4 regulations Grid (210X 297 mm) 587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Invention Description (87)

894 5-C1 cf3 C = C-2-p specific group H 895 5-C1 cf3 C = C-2-pyridyl H 896 5-C1 cf3 C = C-3-pyridyl H 897 5-C1 cf3 C = C-4-p than Yodo H 898 5-C1 cf3 C = C_2-furyl H 899 5-C1 cf3 C = C-3-pyranyl H 900 5-C1 cf3 OC-2-fluorenyl H 901 5-C1 cf3 C = C-3-fluorenyl H 902 5-C1 cf3 C = C-2-pyrazolyl H 903 5-C1 cf3 C = C-2- ^ oxazolyl H 904 5-C1 cf3. C-4-Isoxazolyl H 905 5-C1 cf3 C = C-2-imidazolyl H 906 5-C1 cf3 CH2CH2-cycPr H 907 5-C1 cf3 CH2CH2CH2CH2OH H 908 5-C1 cf3 CH2CH2-CH (OH) Me H 909 5-C1 cf3 CH2CH2-Ph H 910 5-C1 cf3 CH2CHr (2-Cl) Ph H 911 5-C1 cf3 CH2CH2- (3-Cl) Ph H 912 5-C1 cf3 CH2CH2- (4-Cl) Ph H 913 5-C1 cf3 CH2CH2- (2-F) Ph H 914 5-C1 cf3 CH2CH2- (3-F) Ph H 915 5-C1 cf3 CH2CH2- (4-F) Ph H 916 5-C1 cf3 CH2CH2 -(2-OH) Ph H 917 5-C1 cf3 CH2CHr (3-OH) Ph H 918 5-C1 cf3 CH2CH2- (4-OH) Ph H 919 5-C1 cf3 CH2CHr (2-OMe) Ph H 920 5 -C1 cf3 CH2CH2- (3-OMe) Ph H 921 5-C1 cf3 CH2CH2- (4-OMe) Ph H 922 5-C1 cf3 CH2CHr (2-CN) Ph H 923 5-C1 cf3 CH2CHr (3-CN) Ph H -90-(Please read the notes on the back before filling in this ) This paper size applies to Chinese National Standard (CNS) A4 specification (210X297 mm) 587078 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs A7 B7 5. Invention Description (88) 924 5-C1 cf3 CH2CH2- (4-CN) Ph Η 925 5-C1 cf3 CH2CH2- (2-N02) Ph Η 926 5-C1 cf3 CH2CH2- (3-N02) Ph Η 927 5-C1 cf3 CH2CH2- (4-N02) Ph Η 928 5-C1 cf3 CH2CH2 -(2-NH2) Ph Η 929 5-C1 cf3 CH2CHr (3-NH2) Ph 930 930 5-C1 cf3 CH2CH2- (4-NH2) Ph Η 931 5-C1 cf3 CH2CH2- (2-NMe2) Ph Η 932 5-C1 cf3 CH2CH2- (3-NMe2) Ph Η 933 5-C1 CFs CH2CH2- (4-NMe2) Ph Η 934 5-C1 cf3 CH2CH2-2-pyridylΗ 935 5-C1 cf3 CH2CH2-3 · pyridyl Η 936 5-C1 cf3 CH2CH2-4-pyridylΗ 937 5-C1 cf3 CH2CHr2-furylΗ 938 5-C1 cf3 CH2CH2-3_furanylΗ 939 5-C1 cf3 CH2CHr2 · pyrimylΗ 940 5-C1 cf3 CH2CH2-3-pyrimidinyl Η 941 5-C1 cf3 CH2CH2-2-oxazolyl Η 942 5-C1 cf3 CH2CH2-2-oxazolyl Η 943 5.α cf3 CH2CH2-4-isooxazolyl Η 944 5-Cl cf3 CH2CH2-2-imidazolylΗ 945 5-C1 cf3 C = C-cycPr ch3 946 5.α cf3 C ^ C-Ph ch3 947 5-C1 cf3 C = C-2-p ch3 948 5-α cf3 Ce〇3-pyridyl ch3 949 5-C1 cf3 C Ξ C_4-O-pyridyl ch3 950 5-C1 cf3 C Ξ C_2 · Branyl ch3 951 5-α cf3 C = C-3 -Chrysanyl ch3 952 5 · α CFs C = C-2-distenyl ch3 953 5-C1 cf3 C Ξ C-3-ρ sephenyl ch3 (Please read the precautions on the back before filling this page)- 91-This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) 587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs Β7 V. Description of the Invention (89) 954 5-C1 cf3 C = C-cycPr ch3 955 5-C1 cf3 C = C-Ph ch3 956 5-C1 cf3 ¢ = 02-0 than Yodo ch3 957 5-C1 cf3 C = C-3-pyridyl ch3 958 5-C1 cf3 C = C-4 -Pyridyl ch3 959 5-C1 cf3 C = C-2-octyl ch3 960 5-C1 cf3 C = C-3-furyl ch3 961 5-C1 cf3 C = C-2-fluorenyl ch3 962 5 -C1 cf3 C = C-3-p sephenyl ch3 963 5-C1 cf3 CH2CH2-cycPr ch3 964 5-C1 cf3 CH2CH2-Ph ch3 965 5-C1 cf3 CH2CHr2-pyridyl ch3 966 5-C1 cf3 CH2CHr3-pyridine Ch3 967 5-C1 cf3 CH2CHr4pyridyl ch3 968 5-C1 cf3 CH2CH2-2-furyl ch3 969 5-C1 cf3 CH2CH2-3-furyl ch3 970 5-C1 c f3 CH2CH2-2-fluorenyl ch3 971 5-C1 cf3 CH2CHr3-pyriminyl ch3 972 5-C1 cf3 C = C-cycPr ch2ch3 973 5-C1 cf3 C ^ C-Ph ch2ch3 974 5-C1 cf3 CeC-2 -Pyridyl CH2CH3 975 5.α cf3 CeC-3-p than ytyl ch2ch3 976 5-C1 cf3 CeC-4-pyridyl CH2CH3 977 5-C1 cf3 C = C-2-furyl CH2CH3 978 5-C1 cf3 C Ξ C-3-pyranyl ch2ch3 979 5-C1 cf3 C Ξ C-2-p sedenyl ch2ch3 980 5-C1 cf3 C = C-3-fluorenyl ch2ch3 981 5-C1 cf3 C = C-cycPr CH2CH3 982 5-C1 cf3 C = C-Ph ch2ch3 983 5-C1 cf3 C = C-2-pyridyl CH2CH3 (Please read the note on the back first and then 4-write this page) -92-This paper size applies to China National Standard (CNS) A4 specification (210X297 mm) 587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economy A7 B7-V. Description of the invention () 984 5-C1 cf3 OC-3-pyridyl CH2CH3 1 1 985 5-C1 cf3 OC-4-pyridyl CH2CH3 1 986 5-C1 cf3 C = C-2-furanyl CH2CH3 1 Please 987 5-C1 cf3 C = C_3_furanyl CH2CH3 Dragon 1 See 988 5-C1 cf3 C = C-2 -Pyridinyl CH2CH3 Read back 1 989 5-C1 cf3 C = C-3 · Pyridinyl CH2CH3 face | of I 990 5-C1 cf3 CH2CH2-c ycPr CH2CH3 t-991 5-C1 cf3 CH2CH2-Ph ch2ch3 Compete for one item I 992 5-C1 cf3 CH2CHr2-pyridyl CH2CH3 One more, j 993 5-C1 cf3 CH2CH2-3-pyridyl CH2CH3 Ben 7 994 5-C1 cf3 CH2CHr4-pyridylCH2CH3 Page 1 995 5-C1 cf3 CH2CH2-2-furyl CH2CH3 1 996 5-C1 cf3 CH2CH2-3-furanyl CH2CH3 1 1 997 5-C1 cf3 CH2CHr2-Angyl CH2CH3 1 I 998 5 -C1 cf3 CH2CHr3-fluorenylCH2CH3 1 Order 999 5-F cf3 C = C-cycPr H 1 I 1000 5-F cf3 C = CCH2CH2OH H 1 I 1001 5-F cf3 C ^ C-CH (OH) Me H 1 I 1002 5-F cf3 C = C-Ph H 1 1003 5-F cf3 C = C- (2-Cl) Ph H 1 1004 5-F cf3 C ^ C- (3-Cl) Ph H # 1005 5 -F cf3 C ^ C- (4-Cl) Ph H 1 1 1006 5-F cf3 C ^ C- (2-F) Ph H Ί 1007 5-F cf3 C ^ C- (3-F) Ph H 1 1008 5-F cf3 C ^ C- (4-F) Ph H 1 I 1009 5-F cf3 C «2_OH) Ph H _ 1 1010 5-F cf3 〇C_ (3_OH) Ph H 1 I 1011 5-F cf3 C ^ C- (4-OH) Ph HI 1012 5-F cf3 C ^ C- (2-OMe) Ph H 1 1 1013 5-F cf3 C ^ C- (3-OMe) Ph H 1 -93-book Paper size applies Chinese National Standard (CNS) A4 (210X297 mm) 587078 Μ B7 V. Description of invention (91 Central Bureau of Standards, Ministry of Economic Affairs Workers Co-op print

1014 5-F cf3 C = C- (4-OMe) Ph H 1015 5-F cf3 C = C- (2-CN) Ph H 1016 5-F cf3 C ^ C- (3-CN) Ph H 1017 5 -F cf3 C ^ C- (4-CN) Ph H 1018 5-F cf3 C three C- (2_N02) Ph H 1019 5-F cf3 C three C_ (3-N02) Ph H 1020 5_F cf3 C = C- (4-N02) Ph H 1021 5-F cf3 C ^ C- (2-NH2) Ph H 1022 5-F cf3 C ^ C- (3-NH2) Ph H 1023 5-F cf3 C ^ C- (4 -NH2) Ph H 1024 5-F cf3 C ^ C- (2-NMe2) Ph H 1025 5-F cf3 C = C- (3-NMe2) Ph H 1026 5-F cf3 C ^ C- (4-NMe2 ) Ph H 1027 5-F cf3 C Ξ C_2-Hydro-based H 1028 5-F cf3 C Ξ C-2-p Hydro-based H 1029 5-F cf3 CeC-3-p Hydro-based H 1030 5- F cf3 C = H 1031 5-F cf3 C Ξ C-2-octanoyl H 1032 5-F cf3 〇C_3-furyl H 1033 5-F cf3 〇C-2-fluorenyl H 1034 5-F cf3 C Ξ C-3-p sephenyl H 1035 5-F cf3 〇02-oxazolyl H 1036 5-F cf3 OC-2-pyrazolyl H 1037 5-F cf3 C = C-4-isoxazole H 1038 5-F cf3 C ^ C-2-imidazolyl H 1039 5-F cf3 C = C-cycPr H 1040 5-F cf3 C = CCH2CH2OH H 1041 5-F cf3 C = C-CH (0H) Me H 1042 5-F cf3 C = C-Ph H 1043 5-F cf3 C = C- (2-Cl) Ph H -94- This paper size applies to China National Standard (CNS) Α4 specifications 210 χ 297 mm) Please read the intent and refill the item _ write this page to order 587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs kl B7 92 V. Description of the invention () 1044 5-F cf3 C = C- (3-Cl) Ph Η 1045 5-F cf3 C = C- (4-Cl) Ph Η 1046 5-F cf3 C = C- (2-F) Ph Η 1047 5-F cf3 C = C- (3 -F) Ph Η 1048 5-F cf3 C = C_ (4_F) Ph Η 1049 5-F cf3 C = C- (2-OH) Ph Η 1050 5-F cf3 〇C- (3_OH) Ph Η 1051 5- F cf3 C = C- (4_OH) Ph Η 1052 5-F cf3 C = C- (2_OMe) Ph Η 1053 5-F cf3 C = C- (3-OMe) Ph Η 1054 5-F cf3 OC- (4 -OMe) Ph Η 1055 5-F cf3 C = C- (2-CN) Ph Η 1056 5-F cf3 C = C- (3_CN) Ph Η 1057 5-F cf3 C = C_ (4-CN) Ph Η 1058 5-F cf3 C = C- (2-N02) Ph Η 1059 5-F cf3 C = C- (3-N02) Ph Η 1060 5-F cf3 C = C- (4-N02) Ph Η 1061 5 -F cf3 C = C- (2-NH: >) Ph Η 1062 5-F cf3 C = C- (3-NH2) Ph Η 1063 5-F cf3 C = C- (4-NH2) Ph Η 1064 5-F CFb C = C- (2-NMe2) Ph Η 1065 5-F cf3 C = C- (3-NMe2) Ph Η 1066 5-F cf3 C = C- (4-NMe2) Ph Η 1067 5- F cf3 C = C-2-pyridylΗ 1068 5-F cf3 C = C-2-p ratio ytyl 淀 1069 5-F cf3 C = C_3-pyridylΗ 1070 5-F cf3 C = C_ 4-pyridinyl fluorene 1071 5-F cf3 C = C-2-furyl fluorene 1072 5_F cf3 C = C-3-pyranyl fluorene 1073 5-F cf3 C = C-2-p cephenyl fluorene -95 -(Please read the notes on the back before filling out this page) " The size of the paper is applicable to the Chinese National Standard (CNS) A4 (210X 297 mm) 587078 Printed by the Consumer Standards Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 5. Description of the invention (93)

1074 5_F cf3 C = C-3-pyrimidinyl H 1075 5_F cf3 C = C-2 · oxazolyl H 1076 5-F cf3 C = C-2_pyrazolyl H 1077 5-F cf3 C = C- 4-Isozazolyl H 1078 5_F cf3 C = C-2-imidazolyl H 1079 5-F cf3 CH2CH2-cycPr H 1080 5-F cf3 CH2CH2CH2CH2OH H 1081 5_F cf3 CH2CHrCH (OH) Me H 1082 5-F cf3 CH2CH2 -Ph H 1083 5-F cf3 CH2CH2- (2-Cl) Ph H 1084 5-F cf3 CH2CH2- (3-Cl) Ph H 1085 5-F cf3 CH2CHr (4-Cl) Ph H 1086 5_F cf3 CH2CH2- ( 2-F) Ph H 1087 5-F cf3 CH2CH2- (3-F) Ph H 1088 5-F cf3 CH2CH2_ (4-F) Ph H 1089 5-F cf3 CH2CHr (2-OH) Ph H 1090 5-F cf3 CH2CH2- (3-OH) Ph H 1091 5-F cf3 CH2CHr (4-OH) Ph H 1092 5-F cf3 CH2CH2- (2-OMe) Ph H 1093 5-F cf3 CH2CH2- (3-OMe) Ph H 1094 5-F cf3 CH2CH2- (4-OMe) Ph H 1095 5-F cf3 CH2CH2- (2-CN) Ph H 1096 5-F cf3 CH2CH2- (3-CN) Ph H 1097 5_F cf3 CH2CHr (4- CN) Ph H 1098 5-F cf3 CH2CH2- (2-N02) Ph H 1099 5-F cf3 CH2CH2- (3-N02) Ph H 1100 5-F cf3 CH2CH2- (4-N02) Ph H 1101 5-F cf3 CH2CHr (2-NH2) Ph H 1102 5-F cf3 CH2CH2- (3-NH2) Ph H 1103 5-F cf3 CH2CH2- (4-NH2) Ph H -96-(Please read the precautions on the back before filling (This page) This paper size is in accordance with Chinese National Standard (CNS) A4 (210X297 mm) 587078 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs A7 B7 5. Invention Description (94) 1104 5-F cf3 CH2CH2- (2- NMe2) Ph H 1105 5-F cf3 CH2CH2- (3-NMe2) Ph H 1106 5-F cf3 CH2CH2- (4-NMe2) Ph H 1107 5_F cf3 CH2CHr2-pyridylH 1108 5_F cf3 CH2CH2-3-pyridylH 1109 5-F cf3 CH2CH2-4-pyridyl H 1110 5-F cf3 CH2CH2-2-furyl H 1111 5-F cf3 CH2CH2-3-furyl H 1112 5-F cf3 CH2CH2-2-fluorenyl H 1113 5-F cf3 CH2CH2-3-pyrimidinyl H 1114 5-F cf3 CH2CH2-2 · Zazolyl H 1115 5-F cf3 CH2CHr2-oxazolyl H 1116 5-F cf3 CH2CH2-4-Isozazolyl H 1117 5-F cf3 CH2CH2-2-imidazolyl H 1118 5-F cf3 C = C-cycPr ch3 1119 5-F cf3 C = C-Ph CHb 1120 5-F cf3 〇C-2-pyridyl ch3 1121 5- F cf3 CeC-3-pyridyl ch3 1122 5-F cf3 〇C-4-pyridyl ch3 1123 5-F cf3 C Ξ C-2-pyranyl ch3 1124 5-F cf3 C Ξ C-3 · bitan Radical ch3 1125 5-F cf3 C Ξ C-2-farphenyl ch3 1126 5-F cf3 C Ξ C-3-farphenyl ch3 1127 5-F cf3 C = C-cycPr c h3 1128 5-F cf3 C = C-Ph ch3 1129 5-F cf3 C = C-2-pyridyl ch3 1130 5-F cf3 C = C-3 than yodo ch3 1131 5-F cf3 C = C-4 -Pyridyl ch3 1132 5-F cf3 C = C-2_furanyl ch3 1133 5-F cf3 C = C-3-octanoyl ch3 -97- (Please read the precautions on the back before filling this page) This Paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) 587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs Kl B7 V. Description of the invention (95) 1134 5-F cf3 C = C-2-p Base ch3 1135 5-F cf3 ch3 1136 5-F cf3 CH2CH2-cycPr ch3 Please 1137 5-F cf3 CH2CH2-Ph ch3 Read 1138 5-F cf3 CH2CH2-2-pyridyl ch3 Read back 1139 5-F cf3 CH2CH2- 3-pyridyl ch3 surface 1140 5-F cf3 CH2CH2-4-pyridyl ch3 meaning 1141 5-F cf3 CH2CH2-2-furyl ch3 Ψ item 1142 5-F cf3 CH2CHr3-furyl ch3 refill, 1143 5-F cf3 CH2CH2-2-fluorenyl ch3 Ben 1144 5-F cf3 CH2CHr3-thienyl ch3 Page 1145 5-F cf3 C = C-cycPr ch2ch3 1146 5-F cf3 C ^ C-Ph CH2CH3 1147 5-F cf3 C Ξ Yodo ch2ch3 1148 5-F cf3 C Ξ C-3_ # b ^ radical CH2CH3 1149 5-F cf3 C Ξ C-4-p than Yodo ch2ch3 1150 5-F cf3 C Ξ C-2-Oranyl ch2ch3 1151 5-F cf3 C Ξ C-3-Oranyl ch2ch3 1152 5-F cf3 C Ξ C-2- Farphenyl CH2CH3 1153 5-F cf3 C ^ C-3-fluorenyl ch2ch3 1154 5-F cf3 C = C-cycPr ch2ch3 1155 5-F cf3 C = C-Ph CH2CH3 1156 5-F cf3 C = C- 2-pyridyl CH2CH3 1157 5_F cf3 C = C-3-p ratio Yodo group ch2ch3 1158 5-F cf3 C = C_4w ratio Yodo group CH2CH3 1159 5_F cf3 C = C-2-furyl group CH2CH3 1160 5_F cf3 〇C_3_furan Ch2ch3 1161 5-F cf3 C = C-2-fluorenyl CH2CH3 1162 5_F cf3 C = C-3-pyrimidinyl CH2CH3 1163 5-F cf3 CH2CHrcycPr ch2ch3 -98- This paper is in accordance with the Chinese National Standard (CNS) A4 specification (210X297 mm) 587078 A7 B7 printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 5. Description of the invention (96)

1164 5_F cf3 CH2CHrPh CH2CH3 1165 5-F cf3 CH2CH2-2-pyridyl ch2ch3 1166 5-F cf3 CH2CH2-3-pyridyl ch2ch3 1167 5-F cf3 CH2CHr4_pyridyl ch2ch3 1168 5-F cf3 CH2CH2-2-furyl CH2CH3 1169 5-F cf3 CH2CHr3-furyl CH2CH3 1170 5-F cf3 CH2CH2-2-pyriminyl CH2CH3 1171 5-F cf3 CH2CH2-3-pyriminyl CH2CH3 1172 5-Cl, 6-F cf3 C = C- cycPr H 1173 5-Cl, 6-F cf3 C ^ C-Ph H 1174 5-Cl, 6-F cf3 CeC-2-pyridyl H 1175 5-Cl, 6-F cf3 OC-3_pyridyl H 1176 5_C1,6-F cf3 C Ξ CM-p than Yodo H 1177 5-Cl, 6-F cf3 CeC-2-furyl H 1178 5-Cl, 6-F cf3 C ^ C-3-furyl H 1179 5-Cl, 6-F cf3 C Ξ C-2-p selphenyl H 1180 5-Cl, 6-F cf3 C = C-3-p selphenyl H 1181 5-Cl, 6-F cf3 C = C-cycPr H 1182 5-Cl, 6-F cf3 C = C-Ph H 1183 5-Cl, 6-F cf3 C = C-2-pyridyl H 1184 5_C1, 6-F cf3 C = C-3- Pyridyl H 1185 5-Cl, 6-F cf3 C = C-4-p ratio HYdron H 1186 5-Cl, 6-F cf3 C = C-2-pyranyl H 1187 5-Cl, 6-F cf3 C = C-3-furanyl H 1188 5-Cl, 6-F cf3 C = C-2-p selphenyl H 1189 5-Cl, 6-F cf3 C = C-3-p selphenyl H 1190 5-Cl, 6-F cf3 CH2CH2-cycPr H 1191 5-Cl, 6-F cf3 CH2CH2-Ph H 1192 5-Cl, 6-F cf3 CH2CHr2-pyridyl H 1193 5-Cl, 6-F cf3 CH2CHr3-pyridyl H (Please read the back first (Notes to fill out this page)

、 1T -99-This paper size is applicable to China National Standard (CNS) A4 (210X297mm) 587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs Β7 V. Description of the Invention (97) 1194 5-Cl, 6-F cf3 CH2CH2_4-pyridyl H 1195 5-Cl, 6-F cf3 CH2CH2-2-furyl H 1196 5-Cl, 6-F cf3 CH2CH2-3-furyl H 1197 5-Cl, 6-F cf3 CH2CH2-2 · Fenyl H 1198 5-Cl, 6-F cf3 CH2CH2-3-Fenyl H 1199 5-Cl, 6-F cf3 C = C-cycPr ch3 1200 5-Cl, 6_F cf3 C ^ C-Ph ch3 1201 5-Cl, 6-F cf3 CeC-2-pyridyl ch3 1202 5-Cl, 6-F cf3 C = C-3-pyridyl ch3 1203 5-Cl, 6-F cf3 CeC-4-pyridyl ch3 1204 5-Cl, 6-F cf3 C Ξ C-2_branyl group ch3 1205 5-Cl, 6-F cf3 C Ξ C-3-branyl group ch3 1206 5-Cl, 6-F cf3 C ^ C -2-thienyl ch3 1207 5-Cl, 6-F cf3 C = C-3-p selphenyl ch3 1208 5-Cl, 6-F cf3 C = C-cycPr ch3 1209 5-Cl, 6-F cf3 C = C-Ph ch3 1210 5-Cl, 6-F cf3 C = C-2-p than Yodo ch3 1211 5-Cl, 6-F cf3 than Yodo ch3 1212 5-Cl, 6-F cf3 C = C-4_p than chrysyl ch3 1213 5-Cl, 6-F cf3 C = C-2-furyl ch3 1214 5-Cl, 6-F cf3 C = C-3- cytyl ch3 1215 5-Cl, 6-F cf3 C = C-2-p sephenyl ch3 1216 5-Cl, 6-F cf3 C = C-3-thienyl ch3 1217 5-Cl, 6-F cf3 CH2CH2-cycPr ch3 1218 5-Cl, 6-F cf3 CH2CH2-Ph ch3 1219 5-Cl, 6-F cf3 CH2CHr2-pyridyl ch3 1220 5-Cl, 6-F cf3 CH2CH2-3-pyridyl ch3 1221 5-Cl, 6_F cf3 CH2CH2-4-pyridyl ch3 1222 5-Cl, 6-F cf3 CH2CH2-2 · furanyl ch3 1223 5-Cl, 6-F cf3 CH2CHr3-furanyl ch3 -100- This paper is in accordance with Chinese national standards (CNS ) A4 specification (210X297 mm) 587078 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs A7 B7 V. Description of the invention (98) 1224 5-Cl, 6-F cf3 CH2CHr2 · fenphenyl ch3 1225 5-Cl, 6- F cf3 CH2CH2-3 · pyrimidinyl ch3 1226 5-F, 6-Cl cf3 C = C-cycPr H 1227 5-F, 6-Cl cf3 C ^ C-Ph H 1228 5-F, 6-Cl cf3 CeC -2-pyridyl H 1229 5-F, 6-Cl cf3 CeC-3-pyridyl H 1230 5-F, 6-Cl cf3 CeC-4-p than Hyl 1231 5-F, 6-Cl cf3 C = C-2-Cyranyl H 1232 5-F, 6-Cl cf3 C Ξ C-3-Cyranyl H 1233 5-F, 6-Cl cf3 C Ξ C-2-p Cephenyl H 1234 5 -F, 6-Cl cf3 C Ξ C-3-p sephenyl H 1235 5-F, 6-Cl cf3 C = C_cycPr H 1236 5-F, 6-Cl cf3 C = C_Ph H 1237 5-F, 6-Cl cf3 C = C-2-pyridyl H 1238 5-F, 6-Cl cf3 C = C-3-pyridyl H 1239 5-F, 6-Cl cf3 C = C-4-Eodoyl H 1240 5-F, 6-Cl cf3 C = C-2-furyl H 1241 5-F, 6-Cl cf3 C = C -3-octanoyl H 1242 5-F, 6-Cl cf3 C = C_2-pyriminyl H 1243 5-F, 6-Cl cf3 C = C-3-p selphenyl H 1244 5-F, 6 -Cl cf3 CH2CH2-cycPr H 1245 5-F, 6-Cl cf3 CH2CH2-Ph H 1246 5-F, 6-Cl cf3 CH2CHr2-pyridyl H 1247 5-F, 6-Cl cf3 CH2CH2-3-pyridinyl H 1248 5-F, 6-Cl cf3 CH2CHr4-pyridyl H 1249 5-F, 6-Cl cf3 CH2CHr2-furyl H 1250 5-F, 6-Cl cf3 CH2CH2-3-furyl H 1251 5-F, 6-Cl cf3 CH2CH2_2_pyriminyl H 1252 5-F, 6-Cl cf3 CH2CHr3-fluorenyl H 1253 5-F, 6-Cl cf3 C = C-cycPr ch3 (Please read the precautions on the back before filling (This page)

、 1T ——. -101-This paper size is applicable to the Chinese National Standard (CNS) Α4 specification (210X 297 mm) 587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs Ｍ Β7 99 V. Description of the invention ()

1254 5-F, 6-Cl cf3 C = C_Ph ch3 1255 5-F, 6-Cl cf3 C Ξ C-2-p than ytyl ch3 1256 5-F, 6-Cl cf3 C = C-3-pyridyl ch3 1257 5-F, 6-Cl cf3 CeC-4-pyridyl ch3 1258 5-F, 6-Cl cf3 C = C-2-furyl ch3 1259 5-F, 6-Cl cf3 C = C-3- Furyl ch3 1260 5-F, 6-Cl cf3 C Ξ C-2-p sephenyl ch3 1261 5-F, 6-Cl cf3 C = C-3-fluorenyl ch3 1262 5-F, 6-Cl cf3 C = C-cycPr ch3 1263 5-F, 6-Cl cf3 C = C-Ph ch3 1264 5-F, 6-Cl cf3 C = C-2-pyridyl ch3 1265 5-F, 6-Cl cf3 C = C-3-pyridyl ch3 1266 5-F, 6-Cl cf3 C = C-4-pyridyl ch3 1267 5-F, 6-Cl cf3 C = C-2-pyranyl ch3 1268 5-F, 6-Cl cf3 C = C-3-pyranyl ch3 1269 5-F, 6-Cl cf3 C = C-2- ^ phenyl ch3 1270 5-F, 6-Cl cf3 C = C-3-pyrimidine Ch3 1271 5-F, 6-Cl cf3 CH2CH2-cycPr ch3 1272 5-F, 6-Cl cf3 CH2CH2-Ph ch3 1273 5-F, 6-Cl cf3 CH2CHr2-pyridyl ch3 1274 5-F, 6-Cl cf3 CH2CH2-3-pyridyl ch3 1275 5-F, 6-Cl cf3 CH2CH2-4-pyridyl ch3 1276 5-F, 6-Cl cf3 CH2CH2-2-furyl ch3 1277 5-F, 6-Cl cf3 CH2CH2_3 -Furyl ch3 1278 5-F, 6-Cl cf3 CH2CH2-2-pyrimidine ch3 1279 5-F, 6-Cl cf3 CH2CH2-3-pyrimyl ch3 1280 6_C1, 8-F cf3 C = C-cycPr H 1281 6-Cl, 8_F cf3 C ^ C-Ph H 1282 6-Cl, 8 -F cf3 CeC_2-pyridyl H 1283 6-Cl, 8 -F cf3 C Ξ C_3_p than Yodo H (Please read the notes on the back before filling this page) -102- This paper size applies to Chinese National Standards (CNS) A4 specifications (210X297 mm) 587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Invention Description (1 (K)) 1284 6-Cl, 8-F cf3 c Tri-C-4 · pyridyl H 1285 6 -Cl, 8_F cf3 C = C-2-octyl group H 1286 6-Cl, 8-F cf3 C Ξ C-3-octyl group H 1287 6_C1,8-F cf3 C ^ C-2-fluorenyl group H 1288 6_C1, 8-F cf3 C = C-3-p sedenyl H 1289 6-Cl, 8-F cf3 C = C-cycPr H 1290 6_C1, 8_F cf3 C = C-Ph H 1291 6_C1, 8_F cf3 C = C_2_p than Yodo H 1292 6_C1,8-F cf3 C = C-3-pyridyl H 1293 6-Cl, 8-F cf3 C = C-4 ^ Yodo H 1294 6-Cl, 8-F cf3 C = C-2-octanoyl H 1295 6-Cl, 8-F cf3 C = C-3-furanyl H 1296 6_C1,8_F cf3 C = C-2-fluorenyl H 1297 6_C1, 8_F cf3 C = C-3-pyridinyl H 1298 6-Cl, 8-F cf3 CH2CH2-cycPr H 1299 6-Cl ， 8_F cf3 CH2CH2-Ph H 1300 6-Cl, 8-F cf3 CH2CH2-2-pyridylH 1301 6_C1,8-F cf3 CH2CH2-3-pyridylH 1302 6_C1,8-F cf3 CH2CH2-4 · pyridyl H 1303 6-Cl, 8_F cf3 CH2CHr2-furyl H 1304 6-Cl, 8-F cf3 CH2CH2-3-furanyl H 1305 6-Cl, 8-F cf3 CH2CH2-2- ^ phenyl H 1306 6_C1, 8 -F cf3 CH2CHr3-pyridinyl H 1307 6_C1,8_F cf3 C = C-cycPr ch3 1308 6-Cl, 8-F cf3 C ^ C-Ph ch3 1309 6-Cl, 8-F cf3 CeC-2-pyridyl ch3 1310 6_C1, 8_F cf3 C = C-3-p ratio Yodo group ch3 1311 6-Cl, 8-F cf3 Ce〇4-p ratio Yodo group ch3 1312 6-Cl, 8-F cf3 C Ξ C-2- Chrysyl ch3 1313 6-Cl, 8-F cf3 C Ξ C-3-Chrysyl ch3 (Please read the notes on the back before filling out this page) -103- This paper size applies to China National Standard (CNS) Α4 Specifications (210 × 297 mm) 587078 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs A7 B7 V. Invention Description (1 () 1)

1314 6-Cl, 8_F cf3 C Ξ C-2-p sephenyl ch3 1315 6-Cl, 8-F cf3 OC-3-pyrimyl ch3 1316 6-Cl, 8-F cf3 C = C-cycPr ch3 1317 6-Cl, 8-F cf3 C = C-Ph ch3 1318 6-Cl, 8-F cf3 C = C-2-pyridyl ch3 1319 6-Cl, 8-F cf3 C = C-3-p ratio Yodo ch3 1320 6-Cl, 8-F cf3 C = C-4-p than Yodo ch3 1321 6-Cl, 8_F cf3 C = C-2-furyl ch3 1322 6_C1, 8-F cf3 C = C- 3 · furanyl ch3 1323 6-Cl, 8-F cf3 C = C-2-fluorenyl ch3 1324 6-Cl, 8-F cf3 C = C-3-p cephenyl ch3 1325 6_C1,8-F cf3 CH2CH2_cycPr ch3 1326 6_C1,8-F cf3 CH2CH2-Ph ch3 1327 6-Cl, 8-F cf3 CH2CHr2-pyridyl ch3 1328 6-Cl, 8-F cf3 CH2CH2-3-pyridyl ch3 1329 6-Cl, 8 -F cf3 CH2CH2-4-pyridyl ch3 1330 6-Cl, 8-F cf3 CH2CH2-2-furyl ch3 1331 6_C1, 8_F cf3 CH2CH2_3-furyl ch3 1332 6-Cl, 8-F cf3 CH2CH2-2-pyrimidin Phenyl ch3 1333 6-Cl, 8-F cf3 CH2CH2-3 · Pyramidyl ch3 1334 6-CH3 cf3 C ^ C-cycPr H 1335 6_CH3 cf3 C ^ C-Ph H 1336 6-CH3 cf3 C tri-C-2_ Methylpyridyl H 1337 6-CH3 cf3 C Ξ C-3- ^ Pyridyl H 1338 6-CH3 cf3 CeC-4_pyridyl H 1339 6-CH3 cf3 C Ξ C-2 H 1340 6-CH3 cf3 C Ξ C-3-Oranyl H 1341 6-CH3 cf3 C Ξ C-2-ρ Cephenyl H 1342 6-CH3 cf3 C = C-3-Pyridinyl H 1343 6 -CH3 cf3 C = C-cycPr H (Please read the notes on the back before filling out this page) -104- This paper size applies to China National Standard (CNS) A4 (210X 297 mm) 587078 Employees of the Central Standards Bureau of the Ministry of Economic Affairs Printed by the consumer cooperatives Β7 102 V. Description of the invention () 1344 6-CH3 CF3 C = C-Ph H 1345 6-CH3 cf3 C = C-2-p than Yodo H 1346 6-CH3 cf3 C = C-3 -p than Dynyl H 1347 6-CH3 cf3 C = C-4- # b Dynyl H 1348 6-CH3 cf3 C = C-2-ylanyl H 1349 6-CH3 cf3 C = C-3-furanyl H 1350 6-CH3 cf3 C = C-2-distenyl H 1351 6-CH3 cf3 C = C-3-pyriminyl H 1352 6-CH3 cf3 CH2CH2-cycPr H 1353 6-CH3 cf3 CH2CH2-Ph H 1354 6-CH3 cf3 CH2CHr2-pyridyl H 1355 6-CH3 cf3 CH2CH2-3-pyridyl H 1356 6-CH3 cf3 CH2CH2-4-pyridyl H 1357 6-CH3 cf3 CH2CH2-2_furyl H 1358 6-CH3 cf3 CH2CH2-3-furanyl H 1359 6-CH3 cf3 CH2CHr2_fluorenyl H 1360 6-CH3 cf3 CH2CH2-3pyriminyl H 1361 6-CH3 cf3 C = C-cycPr ch3 1362 6-CH 3 cf3 C ^ C-Ph ch3 1363 6-CH3 cf3 C Ξ C-2-p ratio Yodo ch3 1364 6-CH3 cf3 C = C-3 · Edo ch3 1365 6-CH3 cf3 C Ξ C-4- p ratio ytyl ch3 1366 6-CH3 cf3 C Ξ C-2-ylfuranyl ch3 1367 6-CH3 cf3 C = C-3-furyl ch3 1368 6-CH3 cf3 C Ξ C-2-p cephenyl ch3 1369 6-CH3 cf3 C Ξ C_3-distenyl ch3 1370 6-CH3 cf3 C = C-cycPr ch3 1371 6-CH3 cf3 C = C-Ph ch3 1372 6-CH3 cf3 C = C-2-pyridyl ch3 1373 6-CH3 cf3 C = C-3-pyridyl ch3 (Please read the notes on the back before filling out this page) -105- This paper size applies to China National Standard (CNS) A4 (210X297 mm) 587078 Central Ministry of Economic Affairs Printed by the Consumer Bureau of Standards Bureau A7 B7 V. Description of Invention (1 () 3)

1374 6-CH3 cf3 C = C-4-pyridyl ch3 1375 6-CH3 cf3 C = C-2-pyranyl ch3 1376 6-CH3 cf3 C = C-3-pyranyl ch3 1377 6-CH3 cf3 C = C-2-fluorenyl ch3 1378 6-CH3 cf3 C = C-3-p phenenyl ch3 1379 6-CH3 cf3 CH2CH2-cycPr ch3 1380 6-CH3 cf3 CH2CH2-Ph ch3 1381 6-CH3 cf3 CH2CH2- 2-pyridyl ch3 1382 6-CH3 cf3 CH2CH2-3-pyrimidyl ch3 1383 6-CH3 cf3 CH2CH2-4-pyridyl ch3 1384 6-CH3 cf3 CH2CHr2-furyl ch3 1385 6-CH3 cf3 CH2CH2-3-furan Ch3 1386 6-CH3 cf3 CH2CH2-2-thienyl ch3 1387 6_CH3 cf3 CH2CH2-3-pyriminyl ch3 1388 6-COCH3 cf3 C = C-cycPr H 1389 6-COCH3 cf3 CC-Ph H 1390 6-COCH3 cf3 OC-2-pyridyl H 1391 6-COCH3 cf3 C ^ C-3-p than octyl H 1392 6-COCH3 cf3 Ce〇4-erodoyl H 1393 6-COCH3 cf3 C Ξ C-2 H 1394 6-COCH3 cf3 C Ξ C-3 · Oranyl H 1395 6-COCH3 cf3 C Ξ C-2-p sedenyl H 1396 6-COCH3 cf3 C Ξ C-3_sulfenyl H 1397 6- NH2 cf3 C = C-cycPr H 1398 6-NH2 cf3 C ^ C-Ph H 1399 6-NH2 cf3 C Ξ C-2-p specific bite group H 1400 6-NH2 cf3 03-outer base H 1401 6- NH2 cf3 C e 〇4-p ratio Base H 1402 6_NH2 cf3 C = C-2-furyl H 1403 6-NH2 cf3 C Ξ C-3-branyl H (Please read the notes on the back before filling out this page) -106- This paper size is applicable to China National Standard (CNS) A4 specification (210X297 mm) 587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Invention Description (104)

1404 6-NH2 cf3 C ^ C-2-distenyl H 1405 6-NH2 cf3 C ^ C-3e Cephenyl H 1406 6-NMe2 cf3 C = C-cycPr H 1407 6-NMe2 cf3 C ^ C-Ph H 1408 6-NMe2 cf3 C Ξ C-2-p than Yodo-based H 1409 6-NMe2 cf3 Ce〇3_ Edo-based H 1410 6-NMe2 cf3 Ce〇4-p than Yodo-based H 1411 6-NMe2 cf3 C Ξ C_2 -Branyl H 1412 6-NMe2 cf3 C Ξ C-3-Branyl H 1413 6-NMe2 cf3 C ^ C-2-pyriminyl H 1414 6-NMe2 cf3 C Ξ C-3-p sephenyl H 1415 7-C1 cf3 C = C-cycPr H 1416 7-C1 cf3 C ^ C-Ph H 1417 7-C1 cf3 C = 02-ρ than HYD H 1418 7-C1 cf3 CeC-3-pyridyl H 1419 7-C1 cf3 C ξ C-4-Eodoyl H 1420 7-C1 cf3 C = C-2-pyranyl H 1421 7-C1 cf3 C Ξ C-3-pyranyl H 1422 7-C1 cf3 C = C-2-fluorenyl H 1423 7-C1 cf3 C Ξ C-3-ρ sephenyl H 1424 5,6-0CH20- cf3 C = C-cycPr H 1425 5,6-0CH20- cf3 C ^ CCH2CH2OH H 1426 5,6-0CH20- cf3 C ^ C-CH (OH) Me H 1427 5,6-0CH20- cf3 C ^ C-Ph H 1428 5,6-0CH20- cf3 C = C- (2-Cl) Ph H 1429 5,6_0CH20- cf3 C ^ C- (3-Cl) Ph H 1430 5,6-0CH20- cf3 C ^ C- (4-Cl) Ph H 1431 5,6_0CH20- cf3 C = C- (2 -F) Ph H 1432 5,6-0CH20- cf3 C ^ C- (3 -F) Ph H 1433 5,6-0CH20- cf3 C ^ C- (4-F) Ph H (Please read the notes on the back before filling out this page) -107- This paper size applies to Chinese National Standard (CNS) A4 specification (210X297mm) 587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 105 V. Description of the invention () 1434 5,6-0CH20- cf3 C ^ C- (2-OH) Ph Η 1435 5,6 -0CH20- cf3 C = C- (3-〇H) Ph Η 1436 5,6-0CH20- cf3 C ^ C- (4-OH) Ph Η 1437 5,6-0CH20- cf3 C ^ C- (2- OMe) Ph Η 1438 5,6-0CH20- cf3 C ^ C- (3-OMe) Ph Η 1439 5,6-0CH20- cf3 C = C- (4-OMe) Ph Η 1440 5,6-0CH20- cf3 C = C- (2-CN) Ph Η 1441 5,6-0CH20- cf3 C ^ C- (3-CN) Ph Η 1442 5,6-0CH20- cf3 C ^ C- (4-CN) Ph Η 1443 5,6-0CH20- cf3 C tri-C- (2-N02) Ph Η 1444 5,6-0CH20- cf3 C ^ C- (3-N02) Ph Η 1445 5,6-0CH20- cf3 〇C- (4 -N02) Ph Η 1446 5,6_0CH20 · cf3 C ^ C- (2-NH2) Ph Η 1447 5,6-0CH20- cf3 C ^ C- (3-NH2) Ph Η 1448 5,6-0CH20- cf3 C ^ C- (4-NH2) Ph Η 1449 5,6-0CH20- cf3 C ^ C- (2-NMe2) Ph Η 1450 5,6-0CH20- cf3 C three C- (3_NMe2) Ph Η 1451 5,6 -0CH20- cf3 C ^ C- (4-NMe2) Ph Η 1452 5,6-0CH20- cf3 CeC_2 · py Base Η 1453 5,6-0CH20- cf3 C Ξ C-2-p ratio Yodo base Η 1454 5,6-0CH20_ cf3 Ce〇3-Edian base Η 1455 5,6-0CH20- cf3 CX-4-outer dagger Yodo base Η 1456 5,6-0CH20- cf3 C = C-2-furanyl Η 1457 5,6-0CH20- cf3 C Ξ C-3-pyranyl Η 1458 5,6-0CH20- cf3 C Ξ C- 2-p sedenyl fluorene 1459 5,6_0CH20- cf3 OC-3-fluorenyl fluorene 1460 5,6-0CH20- cf3 OC-2-oxazolyl fluorene 1461 5,6-0CH20- cf3 C = C-2 -OxazolylΗ 1462 5,6-0CH20- cf3 C ^ C-4-isoxazolylΗ 1463 5,6-0CH20- cf3 C = C-2-imidazolylΗ -108-(Please read the Note: Please fill in this page again.) This paper size applies Chinese National Standard (CNS) A4 (210X 297 mm). 587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs.

1464 6-COCH3 cf3 C = C-cycPr H 1465 6-COCH3 cf3 C = C-Ph H 1466 6-COCH3 cf3 C = C-2-pyridyl H 1467 6-COCH3 cf3 C = C-3_p 1468 6-COCH3 cf3 C = C-4-p than Yodo H 1469 6.COCH3 cf3 C = C-2-Oranyl H 1470 6-COCH3 cf3 C = C-3-Oranyl H 1471 6-COCH3 cf3 C = C-2-fluorenyl H 1472 6-COCH3 cf3 OC-3-pyridinyl H 1473 6-NH2 cf3 C = C-cycPr H 1474 6-NH2 cf3 C = C-Ph H 1475 6 · ΝΗ2 cf3 C = C -2 _ p ratio H 1476 6_NΉ2 cf3 C = C-3-p》 bYodo H 1477 6-ΝΗ2 cf3 C = C-4-p ratio Y H 1478 6-ΝΗ2 cf3 C = C_2_furanyl H 1479 6 · NΗ2 cf3 C = C-3-branyl H 1480 6-ΝΗ2 cf3 C = C-2-p sedenyl H 1481 6_ΝΗ2 cf3 C = C-3-p sedenyl H 1482 6-NMe2 cf3 C = C-cycPr H 1483 6-NMe2 cf3 OC-Ph H 1484 6-NMe2 cf3 C = C-2-pyridyl H 1485 6-NMe2 cf3 OC_3-pyridyl H 1486 6-NMe2 cf3 C = C-4- # b Yodo-based H 1487 6-NMe2 cf3 C = C-2-Oranyl H 1488 6-NMe2 cf3 C = C-3-Oranyl H 1489 6-NMe2 cf3 C = C-2 -p sephenyl H 1490 6-NMe2 cf3 C = C-3-fluorenyl H 1491 7-C1 cf3 C = C-cycPr H 1492 7-C1 cf3 C = C_Ph H 1493 7-C1 cf3 C = C- 2-p ratio Dianji H (Please read the notes on the back before filling in this page) -109- This paper size is applicable to China National Standard (CNS) A4 specifications (210 × 297 mm) 587078 Printed by A7, B7, Consumer Cooperatives V. Description of the invention (1Q7)

1494 7-C1 cf3 C = C-3-flt octyl H 1495 7-C1 cf3 C = C-4_p ratio HYD 1496 7-C1 cf3 C = C-2-octyl H 1497 7-C1 cf3 C = C_3-furanyl H 1498 7-C1 cf3 C = C-2-p sedenyl H 1499 7-C1 cf3 C = C-3-p sedenyl H 1500 5,6-0CH20- cf3 C = C- cycPr H 1501 5,6-0CH20- cf3 C = CCH2CH2OH H 1502 5,6-0CH20- cf3 C = C-CH (OH) Me H 1503 5,6-0CH20- cf3 OC-Ph H 1504 5,6-0CH20 -cf3 C = C- (2-Cl) Ph H 1505 5,6-0CH20- cf3 C = C- (3-Cl) Ph H 1506 5,6-0CH20- cf3 C = C- (4-Cl) Ph H 1507 5,6-0CH20- cf3 C = C- (2_F) Ph H 1508 5,6-0CH20 · cf3 C = C- (3-F) Ph H 1509 5,6-0CH20- cf3 C = C- ( 4-F) Ph H 1510 5,6-0CH20- cf3 C = C- (2-0H) Ph H 1511 5,6-0CH20- cf3 C = C- (3-0H) Ph H 1512 5,6-0CH20 -cf3 C = C- (4-0H) Ph H 1513 5,6_0CH20 · cf3 C = C_ (2-0Me) Ph H 1514 5,6-0CH20- cf3 C = C- (3-0Me) Ph H 1515 5 , 6-0CH20_ cf3 C = C- (4-0Me) Ph H 1516 5,6-0CH20 · cf3 C = C- (2-CN) Ph H 1517 5,6-0CH20- cf3 C = C- (3- CN) Ph H 1518 5,6-0CH20 'cf3 C = C- (4-CN) Ph H 1519 5,6-0CH20- cf3 C = C- (2-N02) Ph H 1520 5,6-0CH20- cf3 C = C- (3-N02) Ph H 1521 5,6-0CH20- cf3 C = C_ (4-N02) Ph H 1522 5,6-0C H20- cf3 C = C- (2-NH2) Ph H 1523 5,6-0CH20- cf3 C = C- (3-NH2) Ph H -110- This paper size applies to China National Standard (CNS) A4 specification (210X 297 mm) 587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7

Λ QO V. Description of the invention ()

1524 5,6-0CH20- cf3 C = C- (4-NH2) Ph H 1525 5,6-0CH20_ cf3 C = C- (2-NMe2) Ph H 1526 5,6-0CH20 · cf3 C = C- ( 3-NMe2) Ph H 1527 5,6-0CH20-cf3 C = C- (4-NMe2) Ph H 1528 5,6-0CH20- cf3 C = C-2-p ratio H 1529 5,6-0CH20 -cf3 yl H 1530 5,6-0CH20- cf3 yl H 1531 5,6-0CH20- cf3 C = C-4-pyridylH 1532 5,6-0CH20- cf3 C = C-2-furyl H 1533 5,6_0CH20_ cf3 C = C-3-octanoyl H 1534 5,6-0CH20- cf3 C = C-2-p sedenyl H 1535 5,6-0CH20- cf3 〇C-3-fluorenyl H 1536 5,6_0CH20- cf3 OC-2-oxazolyl H 1537 5,6-0CH20- cf3 C = C-2- ^ Junki H 1538 5,6-0CH20- cf3 OC-4-isosinyl H 1539 5,6-0CH20- cf3 C = C-2-imidazolyl H 1540 5,6-0CH20- cf3 CH2CH2-cycPr H 1541 5,6-0CH20- cf3 CH2CH2CH2CH2OH H 1542 5,6-0CH20- cf3 CH2CH2-CH ( OH) Me H 1543 5,6-0CH20- cf3 CH2CH2-Ph H 1544 5,6-0CH20- cf3 CH2CHr (2-Cl) Ph H 1545 5,6-0CH20- cf3 CH2CH2- (3-Cl) Ph H 1546 5,6-0CH20- cf3 CH2CHr (4-Cl) Ph H 1547 5,6-0CH20 · cf3 CH2CH2- (2-F) Ph H 1548 5,6-0CH20- cf3 CH2CH2- (3-F) Ph H 1549 5,6-0CH20- cf3 CH2CH2- (4-F) Ph H 1550 5,6-0CH20- cf3 C H2CHr (2_OH) Ph H 1551 5,6-0CH20- cf3 CH2CHr (3-OH) Ph H 1552 5,6-0CH20- cf3 CH2CH2- (4-OH) Ph H 1553 5,6-0CH20-cf3 CH2CH2- ( 2-OMe) Ph H -111-(Please read the notes on the back before filling out this page), 1T .__ This paper size applies to China National Standard (CNS) A4 (210X 297 mm) 587078 Central Bureau of Standards, Ministry of Economic Affairs Printed by employee consumer cooperative A7 B7 109 V. Description of invention () 1554 5,6_0CH20- cf3 CH2CH2- (3-OMe) Ph Η 1555 5,6_0CH20- cf3 CH2CH2- (4-OMe) Ph Η 1556 5,6-0CH20 Cf3 CH2CH2- (2_CN) Ph Η 1557 5,6-0CH20- cf3 CH2CH2_ (3-CN) Ph Η 1558 5,6-0CH20- cf3 CH2CH2- (4-CN) Ph Η 1559 5,6-0CH20- cf3 CH2CHr (2-N02) Ph Η 1560 5,6-0CH2O cf3 CH2CH2- (3-N02) Ph Η 1561 5,6-0CH20- cf3 CH2CH2- (4-N02) Ph Η 1562 5,6-0CH20- cf3 CH2CH2 -(2-NH2) Ph Η 1563 5,6-0CH20- cf3 CH2CH2- (3-NH2) Ph Η 1564 5,6-0CH20- cf3 CH2CH2- (4-NH2) Ph Η 1565 5,6-0CH20- cf3 CH2CH2- (2-NMe2) Ph Η 1566 5,6-0CH20- cf3 CH2CHr (3_NMe2) Ph Η 1567 5,6-0CH20- cf3 CH2CH2- (4-NMe2) Ph Η 1568 5,6-0CH20- cf3 CH2CH2- 2-pyridylfluorene 1569 5,6-0C H20- cf3 CH2CH2-3 · pyridylfluorene 1570 5,6-0CH20- cf3 CH2CH2-4-pyridylfluorene 1571 5,6-0CH20- cf3 CH2CH2_2_furanylfluorene 1572 5,6-0CH20_ cf3 CH2CH2-3-furan Base Η 1573 5,6-0CH20- cf3 CH2CHr2-pyridinyl Η 1574 5,6-0CH20- cf3 CH2CHr3-ThienylΗ 1575 5,6-0CH20- cf3 CH2CH2-2-oxazolyl 576 1576 5,6- 0CH20- cf3 CH2CHr2-pyrazolyl fluorene 1577 5,6-0CH20- cf3 CH2CH2-4-isoazazolyl fluorene 1578 5,6-0CH20- cf3 CH2CH2-2-imidazolyl fluorene 1579 5,6-0CH20- cf3 C Ξ C-cycPr ch3 1580 5,6-0CH20- cf3 OC-Ph ch3 1581 5,6-0CH20- cf3 C three C-2 · mouth ratio Yodo ch3 1582 5,6_0CH20- cf3 C three C-3- mouth ratio Yodo ch3 1583 5,6-0CH20- cf3 C = C-4-pyridyl ch3 (Please read the precautions on the back before filling out this page) 112- This paper size applies to China National Standard (CNS) A4 specifications (210X 297 (Mm) 587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 110 V. Description of the invention () 1584 5,6-0CH20 · cf3 C = C-2-Branyl ch3 1585 5,6-0CH20_ cf3 C = C-3-branyl ch3 1586 5,6-0CH20- cf3 C ^ C_2-pyriminyl ch3 1587 5,6_0CH20- cf3 C Ξ C-3 · * 7 Sedenyl ch3 1588 5,6-0CH20- cf3 C = C-cycPr ch3 1589 5,6-0CH20 · cf3 OC-Ph ch3 1590 5,6-0CH20- cf3 C = C- 2 · pyridyl ch3 1591 5,6-0CH20- cf3 C = C-3 than yodo ch3 1592 5,6-0CH20 · cf3 C = C-4-p than yodo ch3 1593 5,6-OCH20- cf3 C = C_2_furanyl ch3 1594 5,6-0CH20- cf3 C = C-3-branyl ch3 1595 5,6-0CH20 · cf3 C = C-2-fluorenyl ch3 1596 5,6-0CH20- cf3 C = C-3 · pyrimyl ch3 1597 5,6-0CH2O cf3 CH2CH2-cycPr ch3 1598 5,6-0CH20- cf3 CH2CH2-Ph ch3 1599 5,6-0CH20 · cf3 CH2CHr2-pyridyl ch3 1600 5,6 -0CH20- cf3 CH2CH2-3-pyridyl ch3 1601 5,6-0CH20- cf3 CH2CH2-4_pyridyl ch3 1602 5,6-0CH20- cf3 CH2CH2-2-furyl ch3 1603 5,6-0CH20- cf3 CH2CHr3 -Furyl ch3 1604 5,6-0CH20 · cf3 CH2CHr2-pyrimyl ch3 1605 5,6-0CH20- cf3 CH2CHr3-fluorenyl ch3 1606 5,6-0CH20- cf3 C = C-cycPr CH2CH3 1607 5,6 -0CH20- cf3 C = C-Ph CH2CH3 1608 5,6-0CH20- cf3 C three C_2-port ratio CH2CH3 1609 5,6-0CH20- cf3 C = C_3-p ratio ridge CH2CH3 1610 5,6-0CH20 -cf3 CeC-4-pyridylCH2CH3 1611 5,6-0CH20- cf3 C = C-2-furyl ch2ch3 1612 5,6-0CH20- cf3 C Ξ C-3-branyl ch2ch3 1613 5,6-0CH20- cf3 C = C-2-farphenyl CH2CH3 (Please read the back first Please note this page before filling out this page) -113- This paper size is applicable to Chinese National Standard (CNS) A4 (210X297 mm) 587078 Printed by A7 B7 111, Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of invention () 1614 5 , 6-0CH20- cf3 C Ξ C-3-p sephenyl CH2CH3 1615 5,6-0CH20- cf3 C = C-cycPr ch2ch3 1616 5,6-0CH20- cf3 C = C-Ph ch2ch3 1617 5,6- 0CH20- cf3 C = C-2-p than Yodo ch2ch3 1618 5,6-0CH20 · cf3 C = C-3-pyridyl CH2CH3 1619 5,6-0CH20- cf3, C = C-4 · pyridyl CH2CH3 1620 5,6-0CH20- cf3 C = C-2-furyl CH2CH3 1621 5,6-0CH20- cf3 C = C-3-furyl CH2CH3 1622 5,6-0CH20- cf3 C = C-2-fluorenyl CH2CH3 1623 5,6_OCH20- cf3 C = C_3-pyrimyl ch2ch3 1624 5,6-0CH2O cf3 CH2CH2-cycPr CH2CH3 1625 5,6-OCH ^ O- cf3 CH2CH2-Ph CH2CH3 1626 5,6-0CH20- cf3 CH2CHr2- Pyridyl CH2CH3 1627 5,6-0CH20- cf3 CH2CHr3-pyridyl CH2CH3 1628 5,6-0CH20- cf3 CH2CH2-4-pyridyl CH2CH3 16 29 5,6-0CH20- cf3 CH2CHr2_furanylCH2CH3 1630 5,6-0CH20- cf3 CH2CH2-3_furanyl CH2CH3 1631 5,6-0CH20- cf3 CH2CHr2-pyrimidyl CH2CH3 1632 5,6-0CH20 · cf3 CH2CH2-3_pyriminylCH2CH3 * Unless specifically mentioned, the stereochemistry is (+/-). -114- (Please read the notes on the back before filling this page)

、 1T __ This paper size is applicable to China National Standard (CNS) A4 specification (210X 297mm) 587078-A7 B7 112 V. Description of invention () Table 3 *

Printed by the Consumer Standards Cooperative of the Central Bureau of Standards, Ministry of Economic Affairs # R3 R1 R2 R8, 1 6-C1 cf3 C = C-Pr H 2 6-C1 cf3 C ^ C-Bu H 3 6_C1 cf3 C ^ C-iBu H 4 6 -C1 cf3 C Ξ C-tBu H 5 6-C1 cf3 K-Me H 6 6-C1 cf3 CH2CH2CH2CH2CH3 H 7 6-C1 cf3 CH2CH2CH (CH3) 2 H 8 6-C1 cf3 CH2CH2CH2CH3 H 9 6-C1 cf3 CH2CH2CH3 H 10 6-C1 cf3 CH2CH2-tBu H 11 6-C1 cf3 CH2C ^ C-CH3 H 12 6 · α cf3 ch2c ^ c-ch2ch3 H 13 6 · α cf3 C ^ C-iPr ch3 14 6-α cf3 C = C -Pr ch3 15 6 · α cf3 C ^ C-Bu ch3 16 6-α cf3 C ^ C-iBu ch3 17 6-C1 cf3 C-tBu ch3 18 6_α cf3 C ^ C-Et ch3 19 6-α cf3 C ^ C-Me ch3 20 6-α cf3 CH2C = C_CH3 ch3 21 6-α cf3 ch2c ^ c-ch2ch3 ch3 22 6-α cf3 CH2CH2CH (CH3) 2 ch3 23 6-α cf3 ch2ch2ch2ch3 ch3 24 6-α cf3 ch2ch2 --- | _ ^ --- 0 ------ 1T ------ #-, fm (Please read the notes on the back before filling this page), -115- This paper size is applicable to China National Standard (CNS) A4 specification (210X 297 mm) 587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs B7 — One, five, invention description () 25 6-C1 cf3 CH2CH2-tBu 26 6_C 1 cf3 C = C_iPr 27 6-C1 cf3 C ^ C-Pr 28 6_C1 cf3 C ^ C-Bu 29 6-C1 cf3 C ^ C-iBu 30 6_C1 cf3 C ^ C-tBu 31 6-C1 cf3 C ^ C- Et 32 6_C1 cf3 C ^ C-Me 33 6_C1 cf3 CH2C «H3 34 6-C1 cf3 ch2c« h2ch3 35 6-C1 cf3 ch2ch2ch (ch3) 2 36 6-C1 cf3 ch2ch2ch2ch3 37 6-C1 cf3 ch2ch2ch2ch2ch2ch3ch CH2CHrtBu 39 6-MeO cf3 C = C-Pr 40 6-MeO cf3 C ^ C-Bu 41 6-MeO cf3 C ^ C-iBu 42 6-MeO cf3 C ^ C-tBu 43 6-MeO cf3 C ^ C- Et 44 6-MeO cf3 C = C_Me 45 6_MeO cf3 CH2C «H3 46 6-MeO cf3 ch2c ^ c-ch2ch3 47 6-MeO cf3 ch2ch2ch2ch2ch3 48 6-MeO cf3 ch2ch2ch (ch3) 2 49 6-MeO cf3 CH2 CH2 MeO cf3 ch2ch2ch3 51 6-MeO cf3 CH2CH2-tBu 52 6-MeO cf3 CH2C ^ C-CH3 53 6-MeO cf3 ch2c «h2ch3 54 6-MeO cf3 C ^ C-iPr 55 6-MeO cf3 C ^ C-Pr 56 6-MeO cf3 C ^ C-Bu

ch3 ch2ch3 ch2ch3 ch2ch3 CH2CH3 CH2CH3 ch2ch3 ch2ch3 CH2CH3 CH2CH3 ch2ch3 ch2ch3 CH2CH3 CH2CH3 HHHH (Please read the notes on the back before filling out this page) -116- This paper size is applicable to the Chinese national standard (CNS) 597X 297 (Aug. 208) 208 mm Printed by the Consumer Standards Cooperative of the Ministry of Standards of the People's Republic of China A7 B7 V. Invention Description (114)

57 6-MeO cf3 C ^ C-iBu ch3 58 6-MeO cf3 C = C-tBu ch3 59 6-MeO cf3 C ^ C-Et ch3 60 6-MeO cf3 C ^ C-Me ch3 61 6-MeO cf3 CH2C = C-CH3 ch3 62 6-MeO cf3 ch2c «h2ch3 ch3 63 6-MeO cf3 ch2ch2ch (ch3) 2 ch3 64 6_MeO cf3 ch2ch2ch2ch3 ch3 65 6-MeO cf3 CH2CH2CH3 ch3 66 6-MeO cf3 cf3 ch3 = C-iPr ch2ch3 68 6_MeO cf3 C ^ C-Pr CH2CH3 69 6-MeO cf3 C ^ C-Bu CH2CH3 70 6-MeO cf3 C ^ C-iBu CH2CH3 71 6-MeO cf3 C = C-tBu CH2CH3 72 6- MeO cf3 C ^ C-Et ch2ch3 73 6-MeO cf3 C ^ C-Me CH2CH3 74 6-MeO cf3 CH2C ^ C-CH3 CH2CH3 75 6-MeO cf3 ch2c ^ c-ch2ch3 CH2CH3 76 6-MeO cf3 ch2ch2ch (ch3) 2 CH2CH3 77 6-MeO cf3 ch2ch2ch2ch3 ch2ch3 78 6-MeO cf3 ch2ch2ch3 ch2ch3 79 6-MeO cf3 CH2CH2-tBu ch2ch3 80 5,6-diF cf3 C ^ C-Pr H 81 5,6-diF cf3 C = C-Bu H 82 5,6_diF cf3 C ^ C-iBu H 83 5,6-diF cf3 C = C-tBu H 84 5,6-diF cf3 C = C-Me H 85 5,6-diF cf3 CH2C «H3 H 86 5,6-diF cf3 ch2c ^ c-ch2ch3 H 87 5,6-diF cf3 CH2CH2CH2CH2CH3 H 88 5,6-diF cf3 CH2CH2CH3 H (Please read the precautions on the back before filling this page) -117- Paper scale applicable Chinese National Standard (CNS) A4 size (210X297 mm) 587 078 Ministry of Economic Affairs Bureau of Standards employees consumer cooperatives printed Μ Β7 V. invention is described in (115)

89 5,6-diF cf3 CH2CHrtBu H 90 5,6-diF cf3 C = C-iPr ch3 91 5,6-diF cf3 C ^ C-Pr ch3 92 5,6-diF cf3 CeC-Bu ch3 93 5,6 -diF cf3 C ^ C-iBu ch3 94 5,6-diF cf3 C = C-tBu ch3 95 5,6-diF cf3 C ^ C-Et ch3 96 5,6-diF cf3 C ^ C-Me ch3 97 5 , 6-diF cf3 C ^ C-Ph ch3 98 5,6-diF cf3 CH2C = C-CH3 ch3 99 5,6-diF cf3 ch2c = c-ch2ch3 ch3 100 5,6-diF cf3 ch2ch2ch (ch3) 2 ch3 101 5,6-diF cf3 ch2ch2ch2ch3 ch3 102 5,6-diF cf3 CH2CH2CH3 ch3 103 5,6-diF cf3 CH2CH2-tBu ch3 104 5,6-diF cf3 C ^ C-iPr CH2CH3 105 5,6-diF cf3 C = C-Pr ch2ch3 106 5,6-diF cf3 C ^ C-Bu CH2CH3 107 5,6-diF cf3 C ^ C-iBu ch2ch3 108 5,6-diF cf3 C ^ C-tBu CH2CH3 109 5,6-diF cf3 C ^ C-Et CH2CH3 110 5,6-diF cf3 C ^ C-Me ch2ch3 111 5,6-diF cf3 CH2C = C-CH3 CH2CH3 112 5,6-diF cf3 ch2c «h2ch3 CH2CH3 113 5,6-diF cf3 CH2CH2CH (CH3) 2 CH2CH3 114 5,6-diF cf3 ch2ch2ch2ch3 CH2CH3 115 5,6-diF cf3 ch2ch2ch3 ch2ch3 116 5,6-diF cf3 CH2CH2_tBu CH2CH3 117 6-F cf3 C ^ C-Pr H 118 6-F C ^ C-Bu H 119 6-F cf3 C ^ C-iBu H 120 6-F cf3 C ^ C-tBu H -118- (Please read first Please fill in this page again if you need to pay attention to this page) This paper size is applicable to Chinese National Standard (CNS) A4 specification (210 × 297 mm) 587078 kl B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs -F cf3 OC-Me HIII 122 6-F cf3 ch2c-c-ch2ch3 HI 123 6-F cf3 ch2ch2ch2ch2ch3 H ^^^ I Please 124 6-F cf3 ch2ch2ch3 H First I read I 125 6-F cf3 CH2CH2-tBu H Read back-126 6-F cf3 C ^ C-iPr ch3 Face I i $ · Ί Item I refill · 'Write a book 127 6-F cf3 C = C-Pr ch3 128 6-F cf3 C ^ C-Bu ch3 129 6-F cf3 C ^ C-iBu ch3 130 6-F cf3 C ^ C-tBu ch3 131 6-F cf3 C ^ C-Et ch3 page I 132 6-F cf3 C ^ C-Me ch3 N ^^ II 133 6-F cf3 CH2C «H3 ch3 1 I 134 6-F cf3 ch2oc-ch2ch3 ch3 1 | 135 6-F cf3 CH2CH2CH (CH3) 2 ch3 1 136 6-F cf3 ch2ch2ch2ch3 ch3 Order 137 6-ch ch3 ch3 ch2 1 I 138 6-F cf3 CH2CHrtBu ch3 1 I 139 6-F cf3 C ^ C-iPr CH2CH3 1 1 140 6-F cf3 C = C_Pr ch2ch3 1 141 6-F cf3 C ^ C-Bu ch2ch3 1 t 1 142 6 -F cf3 C ^ C-iBu CH2CH3 143 6-F cf3 C = C-tBu CH2CH3 144 6-F cf3 OC-Et ch2ch3 1 145 6- F cf3 C ^ C-Me CH2CH3 1 146 6-F cf3 CH2OC-CH3 CH2CH3 1 147 6-F cf3 ch2c ^ c-ch2ch3 CH2CH3 1 148 6-F cf3 ch2ch2ch (ch3) 2 ch2ch3 1 1 149 6-F cf3 CH2CH2CH2 CH2CH3 150 6-F cf3 CH2CH2CH3 CH2CH3 1 1 151 6-F cf3 CH2CH2.tBu ch2ch3 1 1 152 5-C1 cf3 C ^ C-iPr -119- H 1 1 1 1 1 This paper is applicable to the Chinese National Standard (CNS) A4 specification (210 X 297 mm) 587078 A7 B7 117 V. Description of the invention () Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 153 5-C1 cf3 C ^ C-Pr H 154 5-C1 cf3 C ^ C-Bu H 155 5-C1 cf3 C ^ C-iBu H 156 5-C1 cf3 C ^ C-tBu H 157 5-C1 cf3 C ^ C-Et H 158 5-C1 cf3 C ^ C-Me H 159 5-C1 cf3 CH2C «H3 H 160 5-C1 cf3 ch2c = c_ch2ch3 H 161 5-C1 cf3 ch2ch2ch2ch2ch3 H 162 5-C1 cf3 CH2CH2CH (CH3) 2 H 163 5-C1 cf3 ch2ch2ch2ch2ch3 H 164 5-C1 cf3 ch2 ch2165 2 CH2CH2-tBu H 166 5-C1 cf3 C ^ C-iPr ch3 167 5-C1 cf3 C ^ C-Pr ch3 168 5-C1 cf3 C ^ C-Bu ch3 169 5-C1 cf3 C ^ C-iBu ch3 170 5 -C1 cf3 C = C-tBu ch3 171 5-C1 cf3 C ^ C-Et ch3 172 5-C1 cf3 C ^ C-Me ch3 173 5-C1 cf3 CH2C ^ C-CH3 ch3 174 5-C 1 cf3 ch2oc-ch2ch3 ch3 175 5-C1 cf3 ch2ch2ch (ch3) 2 ch3 176 5-C1 cf3 ch2ch2ch2ch3 ch3 177 5-C1 cf3 CH2CH2CH3 ch3 178 5-C1 cf3 CH2CH2-tBu ch3 P1-C1-C1-C1 ch2ch3 180 5-C1 cf3 C ^ C-Pr CH2CH3 181 5-C1 cf3 OC-Bu ch2ch3 182 5-C1 cf3 C ^ C-iBu ch2ch3 183 5-C1 cf3 C = C-tBu CH2CH3 184 5-C1 cf3 C ^ C-Et ch2ch3 (Please read the notes on the back before filling out this page) -120- This paper size is applicable to China National Standard (CNS) A4 specification (210X297 mm) 587078 Printed by A7 B7, a staff consumer cooperative of the Central Bureau of Standards, Ministry of Economic Affairs V. Description of the invention (118) 185 5-C1 cf3 C ^ C-Me ch2ch3 186 5-C1 cf3 ch2c = c-ch3 ch2ch3 187 5-C1 cf3 ch2c ^ c-ch2ch3 ch2ch3 188 5-C1 cf3 CH2CH2CH (CH3) 2 ch2ch3 189 5-C1 cf3 ch2ch2ch2ch3 ch2ch3 190 5-C1 cf3 ch2ch2ch3 ch2ch3 191 5-C1 cf3 CH2CH2-tBu ch2ch3 192 5-F cf3 C ^ C-iPr H 193 5-F cf3 C ^ C-Fr H 194 cf3 C ^ C-Bu H 195 5-F cf3 C ^ C-iBu H 196 5-F cf3 C = C-tBu H 197 5-F cf3 C ^ C-Et H 198 5-F cf3 C ^ C-Me H 199 5-F cf3 CH2C = C-CH3 H 200 5-F cf3 ch2c ^ c-ch2ch3 H 201 5_F cf3 ch 2ch2ch2ch2ch3 H 202 5-F cf3 CH2CH2CH (CH3) 2 H 203 5-F cf3 ch2ch2ch2ch3 H 204 5-F cf3 ch2ch2ch3 H 205 5-F cf3 CH2CH2_tBu H 206 5-F cf3 C ^ C-iPr ch3 207 5-F cf C ^ C-Pr ch3 208 5-F cf3 C ^ C-Bu ch3 209 5-F cf3 C = C_iBu ch3 210 5-F cf3 C = C-tBu ch3 211 5_F cf3 C ^ C-Et ch3 212 5-F cf3 C = C-Me ch3 213 5-F cf3 CH2C = C-CH3 ch3 214 5-F cf3 ch2c = c-ch2ch3 ch3 215 5-F cf3 CH2CH2CH (CH3) 2 ch3 216 5-F cf3 ch2ch2ch2ch3 ch3 -121- (Please read the precautions on the back before filling this page) This paper size is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) 587078 Printed by the Consumers Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 119 V. Description of the invention () 217 5-F cf3 ch2ch2ch3 ch3 218 5-F cf3 CH2CH2-tBu ch3 219 5-F cf3 C ^ C-iPr ch2ch3 220 5-F cf3 C ^ C-Pr ch2ch3 221 5-F cf3 C ^ C-Bu CH2CH3 222 5-F cf3 C ^ C-iBu CH2CH3 223 5-F cf3 C ^ C-tBu CH2CH3 224 5_F cf3 C ^ C-Et CH2CH3 225 5-F cf3 OC-Me CH2CH3 226 5-F cf3 CH2C «H3 CH2CH3 227 5 -F cf3 ch2c = c-ch2ch3 CH2CH3 228 5-F cf3 ch2ch2ch (ch3) 2 CH2CH3 229 5-F cf3 ch2ch2ch2ch3 CH2CH3 230 5-F cf3 ch2ch2ch3 CH2CH3 231 5-F cf3 CH2CH2_tBu ch2ch3 232 5-Cl, 6-F cf3 C ^ C-iPr H 233 5-Cl, 6-F cf3 C ^ C-Pr H 234 5-Cl, 6-F cf3 C ^ C-Bu H 235 5-Cl, 6-F cf3 C ^ C-iBu H 236 5-Cl, 6-F cf3 C = C-tBu H 237 5-Cl , 6-F cf3 C ^ C-Et H 238 5-Cl, 6-F cf3 C ^ C-Me H 239 5-Cl, 6-F cf3 CH2C ^ C-CH3 H 240 5-Cl, 6-F cf3 ch2c ^ c-ch2ch3 H 241 5-Cl, 6-F cf3 CH2CH2CH (CH3) 2 H 242 5-Cl, 6-F cf3 ch2ch2ch2ch3 H 243 5-Cl, 6-F cf3 ch2ch2ch3 H 244 5-Cl, 6- F cf3 CH2CH2-tBu H 245 5-Cl, 6-F cf3 C ^ C-iPr ch3 246 5-Cl, 6-F cf3 C ^ C-Pr ch3 247 5_C1, 6_F cf3 C = C-Bu ch3 248 5- Cl, 6-F cf3 C ^ C-iBu ch3 -122-:: --- Read II (Please read the notes on the back before filling in this page) 4 This paper size applies to China National Standard (CNS) A4 specifications ( 210X297 mm) 587078 Μ B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (120) III 249 5-Cl, 6-F cf3 C = C-tBu ch3 III 250 5-Cl, 6-F cf3 C ^ C-Et ch3 1 251 5_C1,6-F cf3 C ^ C-Me ch3 1 Please 252 5-Cl, 6-F cf3 CH2CeC-CH3 ch3 first read 1 253 5-Cl, 6-F cf3 ch2c ^ c-ch2ch3 ch3 I read back-254 5-Cl, 6-F cf3 ch2ch2ch (ch3) 2 ch3 Π 1 side | of 1 255 5 -Cl, 6-F cf3 ch2ch2ch2ch3 ch3 I! Refill the item I · 'Write zero 7 Page 1 256 5-Cl, 6-F cf3 ch2ch2ch3 ch3 257 5-Cl, 6-F cf3 CH2CH2-tBu ch3 258 6_C1, 8-F cf3 C ^ C-iPr H 259 6-Cl, 8-F cf3 C = C-Pr H 260 6-Cl, 8-F cf3 C ^ C-Bu HN ^^ 1 261 6-Cl, 8- F cf3 C ^ C-iBu H 1 I 262 6-Cl, 8-F cf3 C = C-tBu H 1 I 263 6_C1, 8-F cf3 C = C_Et H 1 1 264 6_C1, 8-F cf3 C ^ C -Me H 265 6-Cl, 8-F cf3 CH2C ^ C-CH3 H 1 I 266 6-Cl, 8-F cf3 ch2c = c-ch2ch3 H 1 I 267 6-Cl, 8-F cf3 ch2ch2ch (ch3 ) 2 H 1 1 268 6-Cl, 8-F cf3 ch2ch2ch2ch3 H 1 269 6-Cl, 8-F cf3 ch2ch2ch3 H 1 η I 270 6_C1, 8-F cf3 CH2CHrtBu H 271 6-Cl, 8-F cf3 C ^ C-iPr ch3 272 6-Cl, 8-F cf3 C ^ C-Pr ch3 1 273 6-Cl, 8-F cf3 C ^ C-Bu ch3 1 274 6-Cl, 8_F cf3 C ^ C-iBu ch3 I 275 6-Cl, 8-F cf3 C = C-tBu ch3 1 276 6-Cl, 8-F cf3 C ^ C-Et ch3 1 | 277 6-Cl, 8_F cf3 C = C-Me ch3 ch3 278 6 -Cl ， 8-F cf3 CH2C ^ C-CH3 1 279 6_C1,8-F cf3 ch2c ^ c-ch2ch3 ch3 1 I 280 6-Cl, 8-F cf3 CH2CH2CH (CH3) 2 -123- ch3 1 1 1 1 1 This paper size applies to China National Standard (CNS) Α4 size (210X 297 mm) 587078 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs Β7. Invention Description (121)

281 6-Cl, 8_F cf3 ch2ch2ch2ch3 ch3 282 6-Cl, 8-F cf3 ch2ch2ch3 ch3 283 6-Cl, 8-F cf3 CH2CH2-tBu ch3 284 6-CH3 cf3 C = C_iPr 285 6-CH3 cf3 C = C- Pr H 286 6-CH3 cf3 C ^ C-Bu Ή 287 6-CH3 cf3 C ^ C-iBu H 288 6-CH3 cf3 C ^ C-tBu H 289 6-CH3 cf3 C ^ C-Et H 290 6-CH3 cf3 C ^ C-Me H 291 6-CH3 cf3 CH2C ^ C-CH3 H 292 6-CH3 cf3 ch2c «h2ch3 H 293 6-CH3 cf3 ch2ch2ch (ch3) 2 H 294 6-CH3 cf3 CH2CH2CH2CH3 H 295 6-CH3 cf3 ch2ch2ch3 H 296 6-CH3 cf3 CH2CH2-tBu H 297 6-CH3 cf3 C ^ C-iPr ch3 298 6_CH3 cf3 C = C-Pr ch3 299 6-CH3 cf3 C ^ C-Bu ch3 300 6-CH3 cf3 C ^ C -iBu ch3 301 6_CH3 cf3 C = C-tBu ch3 302 6-CH3 cf3 C ^ C-Et ch3 303 6-CH3 cf3 C = C-Me ch3 304 6-CH3 cf3 CH2C «H3 ch3 305 6-CH3 cf3 ch2c ^ c-ch2ch3 ch3 306 6-CH3 cf3 ch2ch2ch (ch3) 2 ch3 307 6-CH3 cf3 ch2ch2ch2ch3 ch3 308 6-CH3 cf3 ch2ch2ch3 ch3 309 6-CH3 cf3 CH2CH2-tBu ch3 310 6-COCH3 cf-Ci3-6 -COCH3 cf3 C ^ C-Pr H 312 6-COCH3 cf3 C ^ C-Bu H --- 1--14 ------ IT ------ Squat (Please read the precautions on the back first (Fill in this page again) 124- This paper Degree applies to Chinese National Standard (CNS) A4 specification (210X297 mm) 587078 Printed by the Consumers' Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs A7 B7 V. Description of the invention (122) 313 6-COCH3 cf3 C ^ C-iBu H 314 6-COCH3 cf3 C = C-tBu H 315 6-COCH3 cf3 C ^ C-Et H 316 6-COCH3 cf3 C ^ C-Me H 317 6-NH2 cf3 C ^ C-iPr H 318 6_NH2 cf3 C ^ C-Pr H 319 6_NH2 cf3 C ^ C-Bu H 320 6-NH2 cf3 C ^ C-iBu H 321 6-NH2 cf3 C = C-tBu H 322 6-NH2 cf3 C ^ C-Et H 323 6-NH2 cf3 C = C- Me H 324 6-NMe2 cf3 C ^ C-iPr H 325 6-NMe2 cf3 C = C-Pr H 326 6-NMe2 cf3 C ^ C-Bu H 327 6-NMe2 cf3 C ^ C-iBu H 328 6-NMe2 cf3 C = C-tBu H 329 6-NMe2 cf3 C ^ C-Et H 330 6-NMe2 cf3 C ^ C-Me H 331 7-C1 cf3 C ^ C-iPr H 332 7-C1 cf3 C = C-Pr H 333 7-C1 cf3 C ^ C-Bu H 334 7-C1 cf3 C ^ C-iBu H 335 7-C1 cf3 C-tBu H 336 7-C1 cf3 C ^ C-Et H 337 7-C1 cf3 C ^ C-Me H * Unless specifically mentioned, stereochemistry is (+/-). -125- (Please read the notes on the back before filling in this page) This paper size is applicable to China National Standard (CNS) A4 size (210X 297 mm) 587078 Printed by the Consumer Standards Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 ---- -------- B7 V. Description of the invention (123) ~ Use The compound of the present invention has the activity of inhibiting the reversal of green enzymes, specifically, the ability to inhibit HIV A. The compound of formula (I) has the property of inhibiting the reversal of green enzyme by HIV, so it can be used as an antiviral agent for treating HIV infection and related diseases. The compound of formula (I) has the activity of inhibiting HIV reverse transcriptase, and can be used as an inhibitor of growth inhibition. A quasi-analytical method for virus growth or infectivity proves the ability of the compounds of the present invention to inhibit the growth or money of virulence, such as by using the analysis method described later. The compounds of formula (I) of the present invention can also inhibit HIV in in vitro samples containing HIV or have been exposed to HIV samples. Therefore, the compounds of the present invention can be used to inhibit body fluid samples (such as serum or Semen). The compound provided by the present invention can also be used as a standard or reference compound for a test or analysis method for determining the ability of a drug to inhibit virus pure replication and / or HIV reverse transcriptase, for example, for use in pharmaceutical research. Therefore, the compound of the present invention can be used as a reference or reference compound in such an analysis method, and can also be used as a standard for quality control. A commercially available kit or package can be accompanied by the compound of the present invention as such a standard or reference compound. Because the compound of the present invention has the specificity of inhibiting the reversion of lutetase IV to green enzyme, the compound of the present invention can also be used as a diagnostic reagent in a diagnostic method for detecting HIV reverse green enzyme. Therefore, the reversibility of green enzyme inhibition by the analytical method using the compound of the present invention (such as the analytical method described in this patent specification) is an indicator of the presence of HI V reverse green enzyme and HIV virus. "Mg" used in this patent specification means micrograms, and "mg" means milli-126- the standard applicable to this paper standard (CNsT ^ specification (21〇X297 ^ tj '—————— I —I —— —— · —— I —- ding n ϋ nn (please read the note on the back first and then fill out this page) 587078 A7 B7 printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs. “g” means grams, “μΐ / 'means microliters,“ L ”means liters,“ nM ”means nanomolar,“ μM ”means micromolar,“ mM ”means nanomolar, "M" means Mohr and nm "means nanometers, and" Sigma "is the Sigma Aleric company of Saint Louis, M .. HIV RNA analysis method DNA plastids and in vitro RNA to green: According to Erickson-Viitanen et al., AIDS Research and Human Retrovirus 1989,5,577. The method described will contain the BH10 shangyi & 8 and? 〇1 sequences.卩 113-1816) mouth 0-8 672 plastids were transplanted to? Ding 2 19R, the plastids were cut into lines with Bam HI, and then the Riboprobe Gemini system II kit (Pumig T7 RNA polymerase was used to generate RNA transcripts in vitro. The synthesized RN A was purified using DNAse (Pumeg) without RNase, and then extracted with benzene gas imitation, followed by alcohol precipitation, and the resulting RNA transcription was precipitated. This sample was dissolved in water and stored at -70 ° C, and the RNA concentration was measured with A26q. Probe: Using a DNA synthesizer from Applied Biosystems (Vost City, CA), Cocuzza, Tet. Lett 1989,30,6287 method, adding biotin to the 5 'end of oligonucleotide, the synthesized biotinylated capture probe was purified by HPLC, gag biotinylated capture probe (5'-biotin -CTAGCTCCCTGCTTGCCCATACTA 3,) is complementary to the nucleotide 889-912 of HXB2, and the pol biotinylated capture probe (5, biotin-CCCTATCATTTTTGGTTTCCAT 3 '), which is complementary to the nucleotide 2374-2395 of HXB2, utilizes Syngene (San Diego, CA) Prepared as -127- This paper size applies to the Chinese National Standard (CNS) A4 size (210X297 mm) (Please read the precautions on the back before filling this page) Staff of the Central Bureau of Standards of the Ministry of Economic Affairs Printed by the cooperative 587078 Α7 Β7 Description of the Invention (125) Alkaline enzyme co-consumptive oligonucleotide of reporter probe, pol reporter probe (5, CTGTCTTACTTTGATAAAACCTC 3,) is complementary to HXB2 nucleotide 2403-2425, and gag reporter probe (5 'CCCAGTATTTGTCTACAGCCTTCT 3,) 丨] Complementary with HXB2 nucleotides 950-973, all nuclear depleted acid positions are positions in the GenBank Genetic Sequence Data Bank and accepted by the Genetics Computer Group Sequence Analysis Software Package (Devereau Nucleic Acids Research 1984, 12,387). The reporting probe was prepared with 2 x SSC (0 · 3M NaCl, 0.03M sodium citrate), 0.05M Tris ρΗ8.8, 1 mg / ml BSA in 0.5 μM stock solution, and the biotin capture probe was water. Prepare a 100 μM stock solution. Avidin overlay: Avidin overlay was obtained from DuPont Biotechnology Systems (Boston, MA). Cells and viral materials: MT-2 and MT-4 cells were cultured in RPMI 1640 medium containing 2 mM L-glutamic acid and 50 μg / ml gentamycin, and MT-2 cells were supplemented with 5% fetal bovine Serum (FCS), MT-4 was added with 10% FCS, and HIV_1 RF was propagated in MT_4 cells cultured in the same medium. About 10 days after acute infection of MT-4 cells, virus material was prepared and the virus material was divided into small packages. Store at -70 ° C. The infectivity value of HIV-1 (RF) material is l_3xl07 PFU (plaque forming units / ml), which is determined by cytolytic analysis method on MT-2 cells (see below). The small package of virus material used for infection can only be -128- This paper size is applicable to China National Standard (CNS) Α4 size (210 × 297 mm) III-I — I! ......---m I · ϋ -I- I 丁 — IIII-: ----Ψ " (Please read the notes on the back before filling out this page) 587078 Printed by the Consumers Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Invention Description (126 Xie Kang once. When evaluating the antiviral efficacy, the cells used for infection need to be cultured one day before infection. On the day of infection, the cells are resuspended in 5% FCS RPMI medium (concentration: 5 X 105). Cells / ml), for large-scale infection, or suspend the cells in a Baker's Modified IS medium (concentration 2χ / 106 ml) containing 5% FCS and infect them in a microplate, add the virus and incubate at 37 ° Cultivate for 3 days at C. HIV RNA analysis method: Cell lysate or The purified RNA dissolved in 31V [or 5M GED was mixed with 5M GED and the capture probe to make the final concentration of guanidine isothiocyanate to 3 μ, and the final concentration of biotin oligonucleotide to 30 ηM. At 37 ° C, at Hybridization was performed in a sealed U-bottom 96-well tissue culture plate (Nak or Costa) for 16-20 hours, and the RNA hybridization reaction was diluted 3 times with deionized water, so that the final concentration of guanidine isothiocyanate was 1M. , And aliquot a small amount (150 microliters) of the reaction solution into the slot of the avidin-coated microplate. At room temperature, bind the capture probe and the capture probe-RNA hybrid to the fixed antibiotic. After reacting for 2 hours, the microplate was washed 6 times with DuPont ELISA plate washing buffer (phosphate buffered saline (PBS) '0.05% Tween 20), and 120 μm containing 4 X SSC' 0.66% Tritonx100, 6.66% was added. Deionized amylase, 1 mg / ml BSA and 5 nM reporter probe hybridization solution for the second hybridization in order to hybridize the reporter probe to the immobilized capture probe and hybrid target RNA After hybridization at 37 ° C for 1 hour, the microplate was washed again 6 times, and dissolved in buffer j (2.5 Diethylamine pH 8.9 (JBL Technology), i0mM MgCl2, 5 mM zinc acetate dihydrate and 5 -129- This paper size applies to China National Standard (CNS) A4 specification (210X297 mm): Φ-- Enough * (Please read the notes on the back before filling this page) Order 07 870 Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 _____B7 V. Description of the invention (127) mM N-Ethylethyl · Ethylene_Diamine -Triacetic acid) 〇2 mM methylumbelliferyl phosphate (MUBP, JBL Technology) 100μΐ To measure the activity of immobilized alkaline phosphatase, the microplate was cultured at 37 ° C, using a microplate luminometer (sodium diacetate) Turk) Determine the fluorescence intensity of 450 nM emitted when excited at a wavelength of 3 6 5 nM. Evaluation of HIV-1 infected MT_2 cells by microdisc basic compounds: Dissolve the compound to be evaluated in DMS0 and dilute to 2 times the highest concentration to be measured, and the highest concentration of DMS0 is 2%. (Nag) Directly dilute the compound 3 times in tissue culture medium. After serial dilution of the compound, add MT-2 cells (50 μΐ) to a final concentration of 5 X 105 cells per ml (1 X in each well). 105 cells), and the cells containing the compound were cultured in a 37 t carbon dioxide incubator for 30 minutes. When assessing the antiviral potential of a compound, an appropriately diluted HIV-1 (RF) virus stock (50 μΐ) was added to the wells of a culture dish containing cells and a dilution of the test compound. The final volume of each well was 2 〇〇μ1, where there are 8 wells with 50 medium without virus, and 8 wells with virus but no antiviral compound But there was no virus infection. After incubating for 3 days in a humidified 37 C carbon dioxide tank, remove the medium from each well of the hi ν infected culture plate and leave only 25 μE medium. '37 μL containing the biotinylated capture probe 5M GED was added to the cells' while the final GED in the remaining medium in each well was 3M and the capture probe was 30 nM. Captured in the same microplate used for virus culture -130- ^ Paper size applies Chinese National Standard (CNS) A4 specification (2KΓ × 297 mm)-——I | _ ^ ——Φ ------ 1T ------ > * (Please read the precautions on the back before filling out this page) 587078 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs Β7. V. Description of the invention (128) Capture probes and lysates For the hybridization of HI V RNA, seal the pulp tray with a microplate (costa), and incubate in a 37 ° C incubator for 16-20 hours, then add distilled water to each well to dilute the hybridization reaction solution. 3 times, and then transferred the diluted mixture to a microtiter plate of avidin cloth, and quantified HIV RNA by the method described above. A standard curve prepared by adding a known amount of pDAB 72 in vitro RNA transcripts to wells containing lysed but uninfected cells can measure RNA produced by the virus during infection. In order to standardize the amount of virus inoculation used in assessing the antiviral activity of a compound, the number of compounds capable of producing IC90 for dideoxycytosine nucleoside (ddC) (compound concentration required to reduce the amount of HIV RNA by 90%) was selected to be 0.2 μg / Ml of diluted virus, when using this step to perform experiments with several HIV-1 (RF) viral materials, the IC90 of other antiviral compounds (higher or lower than ddC) are relinear, and this concentration corresponds to each Each slot is ~ 3xl05PFU (based on the lysis analysis method of MT-2 cells), and any virus inoculation amount can produce about 75% of the highest virus content RNA. For the HIV RNA analysis method, IC90 is based on the net signal (signal of infected cell sample minus signal of uninfected cell sample) reduced in the RN A analysis method compared to the net signal of infected but untreated cells in the same culture plate. Signal (average of 8 slots). Each infection and RNA analysis method is performed according to three standards. The RNA analysis signal generated by the virus infection must be equal to or greater than 2 nanograms of pDAB 72 in vitro transcript. The ddC measured by each analysis method is The IC90 needs to be between 0.1 and 0.3 μg / ml. Finally, the content of viral RNA stasis produced by effective reverse transcriptase inhibitors should be less than 10% of the amount of uninhibited infection. If the compound IC90 is less than 20 μM, It means that the compound has -131-(Please read the precautions on the back before filling in this page) This paper size is applicable to China National Standard (CNS) A4 specification (210X297 mm) 587078 Printed by A7, Consumers Cooperative of Central Bureau of Standards, Ministry of Economic Affairs B7 V. Description of the invention (129) Active. For the antiviral potential test, all those who performed in the microplates, after the first addition of 2X concentration of compounds to a single row of wells, used Parkin Elma / Heterspropit. Protein binding and mutation resistance To describe the potential of NNRTI for its antiviral potential against plasma proteins, and to determine the resistance to wild-type and mutant (amino acid changes at the known binding positions on NNRTIs) HIV anti-virus Potential. This test theory has two meanings: 1. Many drugs can bind to plasma proteins in many ways, although most drugs have a major human plasma component (ie, human serum protein (HSA) or alpha-1 -acid glycoprotein). (AAG)) has a low affinity for bonding, but these main components are present in high concentrations in the blood, and only free or unbound drugs can cross the infected cell's cell membrane in order to reach the target location (such as HIV-1 reverse transcription Enzyme, HIV-1RT) interaction, so the potential effect of adding HSA + AAG in tissue culture on antiviral can better reflect the potential of a compound in clinical trials. The concentration of a compound required to inhibit 90% of viral replication (measured by a meaningful viral RNA-based detection method) is defined as 1C 90, the performance of test compounds in the presence of HS A and AAG or with HSA and AAG IC90. The increase factor reflects the concentration in vivo (45 mg / mL HSA, 1 mg / mL AAG). The lower the increase factor, the more compounds can react with the target position. 2. Due to the efficient replication of the virus and the poor loyalty of the virus RT in the infected individuals, the quasi-type or HIV-132- of HIV produced in the infected individuals (please read the precautions on the back before filling this page) Applicable to China National Standard (CNS) A4 specification (210X297 mm) 587078 A7 ----- B7 V. Description of invention (130) — Mixed species printed by the staff consumer cooperative of the Central Standards Bureau of the Ministry of Economic Affairs. These types include most of them Wild type, but it also contains a map variant of HIV, and the proportion of a certain mutant type reflects its relative suitability and replication rate. Because the mutant type includes changes in the amino acid of the quasi-species virus RT in previously infected individuals, the overall potential inhibited by the drug found in clinical trials reflects not only wild-type HIV-1, but also wild-type virus . Therefore, based on the background of known genetic knowledge, we construct HIV-1 mutants whose amino acids are changed at the NNRTI bonding site, and determine the ability of test compounds to inhibit these mutant viruses. Suppress 90 /. The concentration of the compound required for the replication of the mother (determined by a meaningful viral RNA-based detection method) is IC90. What we want is a compound with high activity against various mutations. The amount of M and its preparation in mammals can be treated by any method that makes contact with the active agent and the active site of the agent (such as virus reversal green enzyme). (Or individual therapeutic agents or a combination of therapeutic agents) traditional methods of administration, which can be used alone, but it is preferred to use according to the selected method of administration and standard medical procedures and pharmaceutical carriers. Of course, the dosage used will depend on many factors, such as the pharmacokinetic characteristics of the particular agent and its mode and route of administration; the age of the recipient, health status and weight, the nature and extent of symptoms; the type of simultaneous treatment; the type of treatment Frequency, and the desired effect. The daily amount of the active ingredient per kilogram of body weight is about 0.0001 to about 1000 mg, and the preferred dose is about 0.1 to about 3 mg / kg 0 ___ -133- (CNS) A4ΐ ^ [ΊΓ〇X 297 ^ f) 丨II I! — — #! · _ C Please read the notes on the back before filling out this page), 1T printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 587078 Μ Β7 5. Invention Description (131) ~ — '~ The dosage form of the administered composition contains about 1 mg to about 100 mg of the active ingredient per unit. According to the total weight of the composition, these = the active ingredient of the pharmaceutical composition is usually 0 weight ratio of the total weight of the composition. It can be administered orally in a solid dosage form, such as capsules, tablets, and powders, or in a liquid dosage form, such as tonics, syrups, and suspensions. It can also be administered parenterally in a sterile liquid dosage form. Animal capsules contain active ingredients and powder carriers such as lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like. Similar diluents can be used to prepare compressed tablets. Both tablets and capsules can be made into a sustained release form so that the medicament can be continuously released over a period of time. Compressed tablets can be coated with sugar maps or coated with a film to hide the unpleasant Taste and can protect the tablets from the damage of air, can also be coated with casings, so as to selectively break down in the gastrointestinal tract. Liquid dosage forms for oral administration may contain color formation and fragrances to improve patient acceptance. Water, suitable fats, normal saline, dextrose aqueous solution and related sugar solutions and ethylene glycol (such as propylene glycol or polyethylene glycol) are usually suitable carriers for parenteral solutions. Parenteral solutions are preferred Contains water-soluble active ingredient salts, suitable stabilizers, and buffer substances if necessary. Antioxidants (such as sodium sulfite or ascorbic acid, used alone or in combination) are suitable stabilizers. In addition, citric acid and its salts, and sodium EDTA can also be used. In addition, the parenteral solution may contain preservation Agents such as alkyl dimethyl sulfonyl chloride, p-methyl benzoate or propyl ester and gas butane, suitable pharmaceutical carriers are described in Remington, Pharmaceutical Sciences, as before, for this field Standard Reference Regulations in China • 134- This paper size applies to the Chinese National Standard (CNS) A4 size Ϊ210 × 297 mm] "---- ^ --- q --- Φ-- ··· (Please read the back first (Notes to fill out this page)

， 1T Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 587078 A7 ——_________ V. Description of Invention (132). The medicinal dosage forms for administering the compounds of the present invention can be described as follows: 敎 Using standard two-piece hard animal capsules containing 100 mg of powdered active ingredient '150 mg of lactose, 50 mg of cellulose and 6 mg of magnesium stearate, a large amount is prepared Capsule. Capsules to prepare active ingredient mixtures mixed with digestible fats (such as soybean oil, cottonseed oil, or olive oil) and fill them into capsules with a positive displacement capsule to form an animal capsule containing 100 mg of active ingredient , Then wash the capsule and dry. Mosquitoes use traditional procedures to prepare a large unit dose of 100 mg of active ingredient, 0.2 mg of feathery silica, 5 mg of magnesium stearate, 275 mg of microcrystalline cellulose, 11 mg of starch, and 98.8 mg of lactose. , Can be appropriately overlaid to improve palatability or delay absorption. An oral suspension was prepared so that 5 ml of the suspension contained 25 mg of finely divided active ingredients, 200 mg of sodium hydroxymethyl cellulose, 5 mg of sodium benzoate '1.0 g of sorbitol solution of the United States Pharmacopoeia, and 0.025 g Vanillic acid 0 spraying agent agitates 10% by volume of propylene glycol and 15% by weight of active ingredients in water to prepare parenteral compositions suitable for injection administration, using general techniques -135- Guan Jia Standard (CNS) Α4 specification (21GX297: centimeter) one-;. Φ-tank one (please read the notes on the back before filling this page), 1T 587078 Μ --s ------- Β7__ V. Description of the invention (133)-'Sterilize the solution. Combination of ingredients (a) and (b) (please read the notes on the back before filling this page) Each of the therapeutic agent ingredients of the present invention can be used individually in any dosage form, as described above, and can be administered in various ways As mentioned before. The component (b) described below represents one or more of the aforementioned agents. Therefore, if the components (a) and (b) can be treated simultaneously or separately, each component (b) can be treated simultaneously or independently. The Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs printed the ingredients (a) and (b) of the present invention and can be formulated together in a single dosage unit (in other words, combined in a capsule, tablet, powder or liquid) to form a combined Product, when ingredients (a) and (b) are not formulated together in a single dosage unit, ingredient (a) can be administered simultaneously with ingredient (b), or in any order; for example, the ingredient (a) of the present invention is administered first And then administer the ingredients, or in the reverse order. 'If ingredient (b) contains more than one agent, such as an RT inhibitor and a protease inhibitor, these agents can be administered together or in any order. When the drugs are not administered at the same time, the interval between the components (a) and (b) is preferably one hour, and the preferred route of administration of the components (magic and (1)) is oral. The oral agents used in this specification Oral inhibitors, oral compounds, or the like means a compound that is administered orally. Although compound (a) and compound (b) are preferably administered by the same route (in other words, both are administered orally) or by the same dosage form, they can also be administered by different routes if necessary (in other words, For example, one component of the combination product is administered orally and the other component is administered intravenously) or in different dosage forms. Pharmacy practitioners who are familiar with the technique apply the dose of the combination treatment of the present invention as before-136. This paper size applies the Chinese National Standard (CNS) A4 specification (210X297 mm) 587078 kl-~ ^ V. Description of the invention (134) The Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs printed various factors (such as the pharmacokinetic characteristics and mode of # 定 药 and the way they are administered, the age of the recipient, the health status and weight, the characteristics and severity of symptoms, and the common treatment of The type, the frequency of treatment, and the desired therapeutic effect are determined. According to the disclosure of the present invention, those skilled in pharmacy can easily understand the proper dosage of the ingredients (a) and (b) of the present invention. Generally speaking, the dosage is about 丨. Milligram to about ... If ingredient (b) exceeds the above, the dosage of each agent of ingredient (b) is about 100 milligrams to about i $ grams. Generally speaking, when ingredients (a) and Ingredients (^), the content of each ingredient can be reduced by about 70_80% when a single agent is used to treat Ηιν infection 'because of the multiplier effect of combined treatment. Although the active ingredient is contained in a single dosage unit, but The combination product of the present invention is formulated to minimize the physiological contact between the active ingredients. For example, in order to reduce the contact, the product is administered orally, and one of the active ingredients is an enteric coating. It may not only reduce the contact between the combined active ingredients, but also control the release of one of these ingredients in the gastrointestinal tract. Therefore, one of these ingredients can be released instead of being released in the stomach. A specific example is a combination product for oral administration, in which _ active ingredients are covered with a sustained release substance, the effect is that they can be continuously released throughout the gastrointestinal tract, and the material contact between the combined active ingredients is reduced, In addition, the sustained-release component can also be coated with an enteric coating, so that the component can only be released in the intestine. Another method involves the formulation of a combination product, in which one component is coated with a sustained- and / or enteric-release polymer, and The other ingredient is aggregated—-137- Shicai Guanjia Standard Cell (2iGX297 Citizenship) ----——

· M--I II-I ni 11-·; ---; I — 4I — ·-(Please read the notes on the back before filling out this page), \ 5 口 70 Staff Consumer Cooperatives, Central Standards Bureau, Ministry of Economic Affairs Print A7 __—__ B7 V. Description of the invention (135) Object map, such as low-viscosity methylcellulose hydroxypropyl ester or appropriate substances known in the art, so that the active ingredients can be further distinguished. Through the map or other substances, the contact of the components (a) and (b) in each formulation can be avoided, and the contact of the individual agents in the component (b) can also be avoided. One of the active ingredients in the dosage form of the combination product of the present invention is an enteric coating, which can be in the form of tablets, and the other active ingredients are mixed together, and then compressed into a tablet, or the enteric coating is compressed into a coating tablet layer. While other active ingredients are curled up into another layer, another option is to store one or more placebo layers in order to further distinguish between the quantitative layers. Such a placebo layer is bounded between two active ingredient layers, in addition to this In addition, the dosage form of the present invention can be in the form of a capsule, in which one of the active ingredients is compressed into a tablet or a ali micro-tablet, in the form of particles, granules or non-perils, and then the casing pictures are overlaid, and these casing pictures are overlaid Tablets, granules, granules or non_perils are placed in capsules or compressed into capsules with granules of other active ingredients. Based on the disclosure of the present invention, those skilled in the art will understand these methods (whether administered in a single dose form or co-administered in separate forms at the same time or in the same method) to reduce the contact between the components of the combination product of the present invention. The pharmaceutical kit for treating HIV infection contains a therapeutic content of a pharmaceutical composition, which includes the component (a) compound and one or more component (b) compounds in one or more sterile containers, which are also within the scope of the present invention. in. Containers can be sterilized using conventional sterilization methods known in the art. Ingredients (a) and (b) can be placed in the same sterile container as required, or in different sterile containers, or in one or more multi-zone containers. Ingredients (a) and (b) can be separated or physically combined into the aforementioned single dose form. -138- This paper size applies to China National Standard (CNS) A4 specification (2i0x) 97 mm j -—- ---— I! — #! 0 (Please read the notes on the back before filling out this page) Order 587078 Μ _ Β7 ___ V. Description of the invention (136) Formula or unit, if necessary, this set A pack can contain one or more of various traditional medical kit components, such as one or more pharmaceutically acceptable carriers, and vials containing mixed ingredients, which are well known to those skilled in the art. The kit also includes The instructions of the card or label to explain the dosage of ingredients, instructions for administration, and / or guidelines for mixing ingredients. Obviously, the present invention has various modifications and changes according to the aforementioned technology, so it is important to understand that Project, the present invention may be different from the one described in this specification in actual application. ^ ^ 噃 — 丨 m · (Please read the notes on the back before filling out this page} -Order printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs- 139 paper sizes Applicable to China National Standard (CNS) A4 specification (210X297 mm)

Claims (1)

587078 8 8 8 8 AB c D Patent Application No. 087105365 Chinese Patent Application Replacement (March 1992) Patent Application Range 丨 Amendment 丨 Supplement 1. A compound of formula (I) R1 R2 R3iDil〇Η or a steric variant Structure or pharmaceutically acceptable salt, wherein: R1 is CF3; Λ R2 is selected from Ci_5 alkyl substituted with 1-2 R4; C2_5 alkenyl substituted with 1-2 R4; and 1 R4, substituted C2_5 alkynyl; R3 (in each case) is independently selected from 6-4 alkyl, OH, Cw alkoxy, F, Cl, Br, and I; R4 is selected from 0-2 R3 substituted C3_5 cycloalkyl groups, 0-5 R3 substituted phenyl groups, and 0-2 R3 substituted 5-6 membered heterocyclic systems (which contain 1-3 selected from oxygen, Nitrogen, and heteroatoms of sulfur); R8 is selected from hydrogen, and Ci_3 alkyl; and η is selected from 0, 1, and 2. 2. The compound according to item 1 of the scope of patent application, wherein: Ri is cf3; R2 is selected from CN5 alkyl substituted with 1 R4, C2_5 alkenyl substituted with 1 R4, and C2_5 substituted with 1 R4 Alkynyl; this paper size applies Chinese National Standard (CNS) A4 specification (210 X 297 mm) 587078 A8 B8 C8 --------- P8 _ 'Application for patent scope R3 (in each case) is Independently selected from: cN4 alkyl, hydroxy, C4 alkoxy, F, Cl, Br, and I; R4 is selected from C3_5 cycloalkyl substituted with 0-2 R3, and substituted with 0-2 R3 Phenyl, and 5-6 membered heterocyclic system substituted with 0-1 R3 (which contains 1-3 heteroatoms selected from oxygen, nitrogen, and sulfur); R8 is selected from hydrogen, cyclopropyl, CH3 and C2H5; and η are selected from 0, 1, and 2. 3. The compound according to item 2 of the scope of patent application, wherein: R1 is CF3; R2 is selected from the group consisting of C1 · 3 alkyl substituted with 1 R4, C2_3fluorenyl substituted with 1 R4, and substituted with 1 r4 C2_3 block; R3 (in each case) is independently selected from Cw alkyl, hydroxyl, CN3 alkoxy, F, Cl, Br, &I; R is selected from C3- substituted with 0-2 R3 5-ring alkyl, phenyl substituted with 0-2 R3, and 5-6 membered heterocyclic system substituted with 0-R3 (which contains 1-3 heteroatoms selected from oxygen, nitrogen, and sulfur ); R8 is selected from hydrogen, CH3 and C2H5; and η is selected from 0, 1, and 2. 4. The compound according to item 3 of the scope of patent application, where: R1 is CF3; R2 is selected from Ci_3 alkyl substituted with 1 R4, and -2 substituted with 1 R4-This paper applies Chinese National Standard (CNS) A4 specification (210X 297 mm) 78 70 8 5 8 8 8 8 ABCD C2_3 alkenyl and C2_3 block substituted with 1 R4; R3 (in each case) is independently selected from Cl · 3 Alkyl, hydroxy, Cw alkoxy, F, and C1; 'Fur R4 is selected from cyclopropyl substituted with 0-1 R3' phenyl substituted with 0_2 R3, and substituted with 0-1 r3 5-membered heterocyclic system (which contains I-3 atoms selected from oxygen, nitrogen and sulfur foot cones), wherein the heterofluorene system is selected from 2-pyridyl, 3pyridyl '4-pyridyl, ranyl, 3 -Furyl, 2-4 phenyl '3-thienyl, phenyl, 2-thiazolyl, 4-isohumazolyl, and 2. imidazolyl; R8 is selected from hydrogen, CH3 and C2H5; and η is selected from 1 and 2. 5. The compound according to item 4 of the scope of the patent application, wherein the compound is of formula la: la. 6. The compound according to item 4 of the scope of the patent application, where the compound is represented by the formula lb: This paper size applies the Chinese National Standard (CNS) A4 specification (210X 297 cm) 78 70 8 5 8 8 8 8 AB c D, Patent application scope lb. 7. The compound according to item 1 of the scope of patent application, wherein the compound is selected from: (+ /-)-6 -chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro -2 (1 hydrogen) -junyalenone; (+ /-)-6-chloro-4- (2 -ρ ratio) ethyl block-4 -difluoromethyl-3,4 -dihydro- 2 (1 hydrogen) -p quinone pirinone; (+ /-) -6-chloro-4-phenylethyl block-4 -diazylmethyl-3,4 -diaza-2 (1 hydrogen) -p quincolnone; (+ /-)-4-J-Alkylethyl-6-methoxy ^ -4-difluoromethyl-3,4-dihydro-2 (1 hydrogen)- Jun. 4 ketones; (+ /-)-6-methoxy-4- (2 -ρ than octyl) ethoxy-4-difluoromethyl_ 3,4-dihydro-2 (1 hydrogen)- 4 ol 4M is the same; (+ /-)-6 -methoxy-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2 (1hydro) -π-quine (+ /-)-4-cyclopropylethyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2 (1-hydro) -4 ketanone; (+ / -)-5,6 -digas-4- (2-ρ-pyridinyl) ethoxy-4-difluoromethyl-3,4-dihydro-2 (1hydro) -quinazolinone;- 4-This paper size applies to China National Standard (CNS) A4 (210 X 297 mm) 587078 AB c D 々, patent application scope (+ /-)-5,6 -digas-4 -benzyl-4-dimethyl-2,4-dihydro-2 (1 hydrogen)- ηquine 4M is the same; (+ /-)-4- 5 p-propyl ethlyl-6-gas-4-dimethyl-3, 4- dimorat _ 2 (1 hydrogen)-oxazolinone ; (+ /-)-6-Ga-4- (2-ρ than yodoyl) ethyl block-4-digasmethyl-3,4 -dihydro-2 (1 hydrogen) -junjunlinone; (+/-)-6 -fluoro-4 -phenylethyl-4-trifluoromethyl-3,4-dihydro-2 (1 hydrogen) -junjunlinone; (+ /-)-6 -Murine-4- (2'-2-^? Bitoyl) ethyl-4-difluoromethyl-3,4-dihydro-2 (1 hydrogen) -rhoquinone; (+ /- ) -6-fluoro-4-phenylethyl-4-trifluoromethyl-.3,4-dihydro-2 (1 hydrogen) -p Kui Junlin g; (-)-6 -chloro-4 -Cyclopropylethynyl-4-trifluoromethyl-3,4 -dihydro-2 (1 hydrogen) -π-Ketulinine; (+)-6-chloro-4-cyclopropylethynyl-4 -Trifluoromethyl-3,4-dihydro-2 (1 hydrogen) -juntalenone; (+)-4-cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl- 3,4-dihydro-2 (1 hydrogen) -p quinoxaline; (-)-4-cyclopropylethyl-5,6-digas-4-digasmethyl-3,4- Dichloro_ 2 (1 hydrogen) -η quinazone; (+)-E- 4-ring Propylethenyl-5,6 -digas-4-digasmethyl-3,4 -di-5- This paper size applies to China National Standard (CNS) A4 (210 X 297 mm) ^ δ / υ / 8 Gas-2 u hydrogen) -oxazolinone; (_) · 6 -gas_4-E_cyclopropylvinyl_4 -trifluoromethyl_3,4_dihydro · 2 (1 hydrogen)- Junturin; or its pharmaceutically acceptable salts. 8. A pharmaceutical composition for inhibiting HIV reverse transcriptase, comprising: a pharmaceutically acceptable carrier and a medically effective amount of a compound according to any one of claims 1 to 7 of the scope of patent application, or a medicament thereof Acceptable salts 9. A pharmaceutical kit suitable for the treatment of HIV infection, comprising a medically effective amount of one or more candida bacteria containers: (a) any A compound of one item, or an a-isomer type, stereoisomer type mixture thereof, or a pharmaceutically acceptable salt thereof; and (b) at least one selected from HIV reverse transcriptase inhibitor and HIV protease inhibitor剂 的 化合物。 Chemical compounds. 10 · — Compounds of formula (I): R1 R2 -6-This paper size applies to China National Standard (CNS) A4 (210 X 297 mm) 587078 Or its stereoisomers or medically accessible, literal < salts, where R1 is cf3; c2_5 fluorenyl substituted by 1-2 R4; R (in each case) is independently selected : #!, 4 ammo, OH, Α · 4 alkoxy'F, Cl, Br, &I; R4 is selected from C 3 · 5 methanyl substituted with 0-2 R3, 5 R] substituted phenyl groups, and membered heterocyclic systems substituted by 0-2 r 3 can be t _ K (which contains 1-3 heteroatoms selected from oxygen, nitrogen, and stone walking); r8 selected From hydrogen, and CN3 alkyl; and η is selected from 0, 1, and 2. 11. Compound 0 according to item 10 of the scope of patent application, wherein the compound is selected from (+)-E-4-cyclopropylvinyl-5,6-dihydro-2 (1 hydrogen) ^ Kui Junlin Ketones; and (-)-6-chloro-4-E-cyclopropylethenyl, 4 2 (1 gas) -ρ quetulline; or a pharmaceutically acceptable salt thereof. 12. The compound according to item 10 of the scope of patent application, wherein the compound is: (+ /-)-6-chloro-4-cyclopropylethynyl-4.trifluoromethyl-3,4-dihydro 2 (1 hydrogen) -quinazolinone, or a pharmaceutically acceptable salt thereof. 13. The compound according to item 10 of the scope of patent application, wherein the compound is: This paper size applies the Chinese National Standard (CNS) A4 specification (210 X 297 mm) Fluoro-4-trifluoromethyl-3,4-di’difluoromethyl-3,4-dihydro (+ Cyclopropylethynyl-6 · methoxytrifluorofluorenyl "^-dihydro · 2 (1hydro) -quinazolinone, or a pharmaceutically acceptable salt thereof. W · Based on patent application The compound of the range 10, wherein the compound is: (+ /-)-4-cyclopropylethynyl_5,6-difluoro · 4-trifluoromethyl · 3,4dihydro-2 (1 hydrogen ) -Quinazolinone, or a pharmaceutically acceptable salt thereof. 15. The compound according to item 10 of the scope of patent application, wherein the compound is: (+/-) _ 4-cyclopropylethynyl-6- Fluoro-4_trifluoromethyl_3,4 · dihydro_2 (1hydro) -quinazolinone, or a pharmaceutically acceptable salt thereof. 16. Compound according to item 10 of the scope of patent application Wherein the compound is: (-)-6-chloro-4-cyclopropylethynyltrifluoromethyl-3,4 · dihydrohydro) -quinazolinone, or a pharmaceutically acceptable salt thereof . Hydrogen Π · The compound according to item 10 of the scope of patent application, wherein the compound is: (+)-4-cyclopropylethynyl-5,6-difluoro-4_trifluoromethyl-3,4_ 2 (1 Hydrogen) -quinazolinone, or a pharmaceutically acceptable salt thereof. 18. The compound according to item 10 of the scope of patent application, wherein the compound is: (+) -E-4-cyclopropylethenyl-5,6 • difluoro_4 • trisylfluorene ”, Rendihydro -2 (1hydro) -quinazolinone, or a pharmaceutically acceptable salt thereof. 19. The compound according to item 10 of the scope of patent application, wherein the compound is: (-)-6-chloro-4-E-cyclopropylethynyl ^ -trifluoromethyl_3,4 · dihydro_ 2 (1 hydrogen) -quinazolinone, or a pharmaceutically acceptable salt thereof. 20. —A pharmaceutical composition for treating HIV infection, which includes: -8-8 7 7 8 5 AB c D in medicine 6. Acceptable carrier and medically effective amount according to the scope of patent application No. 1 A compound according to any one of 0 to 19, or a pharmaceutically acceptable salt thereof. 21. The compound according to any one of claims 10 to 19, wherein the pharmaceutically acceptable salt is selected from the group consisting of hydrochloride, hydrobromide, sulfate, phosphate, Acetate, succinate, glycolate, stearate, lactate, malate, tartrate, citrate, ascorbate, maleate, fumarate, tosylate, methanesulfonate And oxalate. * 9-This paper size applies to China National Standard (CNS) A4 (210 X 297 mm)