SK137899A3 - 4,4-disubstituted-3,4-dihydro-2(1h)-quinazolinones useful as hiv reverse transcriptase inhibitors - Google Patents

Abstract

The present invention relates to 4,4-disubstituted-3,4-dihydro-2(1H)-quinazolines of formula (I), or stereoisomeric forms, stereoisomeric mixtures, or pharmaceutically acceptable salt forms thereof, which are useful as inhibitors of HIV reverse transcriptase, and to pharmaceutical compositions and diagnostic kits comprising the same, and methods of using the same for treating viral infection or as an assay standard or reagent.

Description

4. 4-Disubstituted-3,4-dihydro-2C (1H) -quinazolinones in the hormone as inhibitors of HIV reverse transcriptase

Technical field

The present invention relates generally to 4,4-disubstituted -3,4

d.ihydrin-2 (1H) -quinazolinones which are useful as inhibitors of HIV reverse transcriptase, pharmaceutical compositions and diagnostic kits containing them, and methods of using them in the treatment of viral infections or as test standards or reagents and intermediates and methods of preparation .

The prior art

Two adult retroviruses, human HIV-1 deficiency virus (type 1 (CHIV-1) or type 2 (CHIV-2)) were ethologically associated with an immunosuppressive disease. acquired immune deficiency syndrome (CATDS). HIV ser opposition individual ;! they are originally asymptinatic, but typically develop the AIDS-related complex CARO, followed by AIDS. Affected individuals exhibit many immunosuppressions that predispose them to attenuation and ultimately to fatal occasional infections.

AIDS is the ultimate consequence of HIV-1 or HIV-2. that follow their own life cycle. The virinia life cycle begins with the virinin attack on the host human immune cell T-4 lymphocyte via binding of the glycoprotein to the surface of the viruria protective coating with the CD4 glycoprotein on the lymphocyte cell. Upon attachment, the virion loses its glycoprotein coating, penetrates the host cell membrane and does not wrap its RNA. Viriun Eiism. reverse transcriptase, directed. a procedure for transcribing RNA into single-stranded DNA. The viral DNA is cleaved to form a second strand of DNA. Now, double-stranded DNA is integrated into human cellular genes and these genes are used to reproduce cells. From this point of view. RNA polymerase transfers integrated DNA to viral RNA. The viral RNA is translated into the precursor q ' of the fusion polyprotein. Then, the polyprotein is cleaved by the HIV protease enzyme to yield mature viral proteins. The HIV protease is thus responsible for regulating the cascade of cleavage steps that result in the maturation of the viral particles to a virus capable of complete infectivity.

The typical response of the human immune system, the killing of invading virions, has been challenged because viruses infect and kill T cells of the immune system. Furthermore, the viral reverse transcriptase, the enzyme used in the preparation of the new particle of the vlriun, is not very specific and causes transcription errors that result in continuously altered glycoproteins on the surface of the viral protective envelope. This lack of specificity reduces efficiency. of the immune system, since antibodies specifically produced against one glycoprotein may be useless against others, thereby reducing the number of antibodies capable of competing with the virus. The virus continues to reproduce while the immune response system weakens. HIV largely controls the body's immune system, allowing intermittent infections to be detected, and without the administration of anti-viral agents, immunomodulators, or both, but may even result in death.

In the viral life cycle, there are at least three critical points that have been identified as possible targets for anti-viral drugs with C1) initial attachment of the waveform to the T-4 lymphocyte or macrophage site, C 2) viral RNA transcription to viral DNA (reverse transcriptase, RT and C3) treating the gag-pol protein with an HIV protease.

Inhibition of viruses at the second critical point, the viral RNA transcription procedure to viral DNA, provides many conventional therapies used in the treatment of AIDS. This transcription has to be done to reproduce, since virion genes are encoded in RNA and host cells read only DNA. By introducing drugs that block reverse transcriptase from the completion of viral DNA production, it stops HIV-1 replication.

Many compounds have been developed that affect replication

Rus of viruses to treat AIDS. For example, nucleoside analogs. such as 3 ' -azldo-3 ' -denoxy-Lymidine (ddC). 2 ’. 3 '--dideoxytyline (d d T).

2 ', 3'-dideoxy-3'-tlacytidine <3TC> and stopping HTV replication at the

CAZT). 2 ', 3' - dideoxycyl 11

2 ', 3' -dideoxy is found to be 1d (ddT) and showed relatively effective reverse transcriptase (CRT).

The active field of research is the discovery of non-kleoside HIV reverse transcriptase inhibitors. For example, it has been found that certain beosoxazinorines and chlnazolinones are active in inhibiting HIV reverse transcriptase, preventing or treating HIV infection and treating AIDS.

U. pat. 51 51H 02J attributes reverse-transcriptase inhibitors by which benzuxazinones of the general formula:

where

X is halogen and

Z may be Cl.

F.P patent U 530 004 and WO 93/04047 disclose reverse transcriptase inhibitors which are the chlorzolinones of the general formula A:

And where

G are different groups,

R ^{: i} and R * may be H,

L may be O.

R ^a can be unsubstituted alkyl, unsubstituted alkenyl, unsubstituted alkynyl, unsubstituted cycloalkyl, unsubstituted heterocycle and optionally substituted aryl and

R ¹ may be different groups including substituted alkyl.

LJIJ 95/12583 also discloses HIV reverse transcriptase inhibitors of the general formula A. In this publication:

U are different groups,

R ³ and R * can be H,

Z may be U.

R ² is substituted aikenyl or substituted alkynyl a

R ¹ is cycloalkyl, alkynyl, aikenyl and cyano.

WU 95/13273 depicts the asymmetric synthesis of one of the compounds 95/12583, (S) -C1-6-Chloro-4-cyclopropyl-4-dihydro-4- (C2-pyridyl) ethynyl-2 (1H) - ehi riazolimine.

Synthetic procedures for the preparation of quinazolinones similar to those described above are in the following references: Houpis et al., Tetr. Lett. 1994, 35 (37), 6811-8814; junker et al., J. Med.

Chem. 1994, 37, 2437-2444; and Huffman et al., J. Org. Chem. 1995. 60. 1590-1594.

U.S. Pat. No. 4,320,347 discloses chloroazones having the general formula s

where

R is phenyl], a carbocyclic ring or a heterocyclic ring.

Compounds of this kind are not considered to be part of the present invention.

Despite the recent success of reverse transcriptase inhibitors, zistο is found. that patients with HIV may become. resistant to one Loru. Therefore, it is desirable to develop rhinitis and anti-HIV infection.

Pi id: tata vez iá ezu

One object of the present invention is to provide novel reverse transcriptase inhibitors.

in

It is an object of the present invention to provide a novel method of treating HIV infection. which comprises administering to the host. who needs such treatment. a therapeutically effective amount of at least one of the compounds of the present invention or a pharmaceutically acceptable salt.

It is a further object of the present invention to provide a novel method of treating HIV infection which comprises administering to a host in need thereof a therapeutically effective combination of (a) one of the compounds of the present invention and Cb) one or more compounds selected from the group consisting of HIV reverse transcriptase inhibitors and HTV protease inhibitors.

It is a further object of the present invention to provide pharmaceutical compositions with a reverse protease inhibitory activity which comprise pharmaceuticals in a stable carrier and a therapeutically effective amount of at least one of the compounds of the present invention or a pharmaceutically acceptable salt. .

It is a further object of the present invention to provide a method of inhibiting HIV present in a body fluid sample, comprising treating a body fluid sample with an effective amount of a compound of the present invention.

in

A further object of the present invention is k1. or a container containing at least one of the compounds of the invention in an amount effective for use as a standard or reagent in tests or assays to determine the potential of a potential drug, HIV growth, or growth. is a.

These and other objects will become apparent during the following description of the subject. tmi i. Based on the inventor's finding that compounds of formula J:

I kde

R ¹ , R ®, R ³ and R ^H are as defined above, their stereoisomeric forms, or pharmaceutically acceptable salts thereof, are effective as reverse transcriptase inhibitors.

Eli In a first embodiment, the present invention includes novel compounds of formula I:

or where:

R ⁸

ABOUT

A stereoisomer thereof or a pharmaceutically acceptable salt thereof.

R ¹ is C _1-3 alkyl substituted with 1 to 7 halogen atoms;

R ⁴ 'is selected from the group consisting of? A C alkyl substituted _with 1-7 R *, 0, .--, 3Ikeriyl substituted with 1-2 R ^A and r. ^ - ^ alkynyl substituted with LR I, ^1;

R * is each independently selected from the group consisting of

Oj- "alkyl, OH, L _x -" -alkoxy, L, Cl, Hr, T, NR ^e R ", NOS ·, CN.

C (CJ) R ^Ä . NHC <O> R ^Z and NHCCIDNR'R '^5-;

alternatively, if two substituents R ³ are present and are attached to adjacent carbon atoms, they may together form a -UCH 5 -O- group;

R ¹ is selected spots the group comprising C ₃ _ _C 11-2 cycloalkyl substituted with R ^3, phenyl, substituted with 0-R b ³ and b K membered heterocyclic system containing 1-3 heteroatoms selected from O, N, S, substituted with 0-2 R ³ ;

R ³ and R ³ '' are independently selected from H and C _1-3 alkyl;

R ^A is independently selected from the group comprising H, OH, i-C "alkyl, _x .-" alkoxy, and NR ³ R ^3a;

R ⁷ is selected from C _1-3 alkyl and C _1-3 alkoxy;

R .is selected from ^the group consisting _of HC .- i.'ykloalkyl ₃ and C ₃ alkyl; and n is selected from 0, 1, 2, 3 and 4.

In a preferred embodiment, the present invention provides a novel compound of formula I. kdei

R ¹ is a C _t _ ₃ alkyl substituted with 1-7 halogens;

^And R is selected from the group OJ-alkyl substituted by the R and C -._ 3-allyl alkenyl substituted with 1 R a ⁺ _p C9_ al kinyl substituted with 1 ^R4;

R ³ is each independently selected from C 1-6 alkyl, OH, C 1-6 alkoxy. F, Cl, LCD) R ^O, and NHC NHCC01R ⁷⁾ NR ^S R · ^U *;

file that Br. I, NR ^S R ^S '.

includes NU ₂ , CN, alternatively, if two R ³ substituents are present and are attached to adjacent carbon atoms, they may together form -OCH ₂ O-;

R is selected from the group comprising C ₃ _ _cycloalkyl substituted with 0-2 ^R3, phenyl substituted with 0-2 ^R3, and 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from O, N, S, substituted with 0-1 R ³ ;

^{R 15} and R * are independently selected from H and CH _3, and C _K H _S;

R ^f is independently selected from the group comprising H, OH, CIG, C _and H _fifth OCH ₃ . OC ^ Hs, and NR ^a R * ^Si;

R * is selected from the group consisting of CH ₃ , C ₃ H ₅ , OCH _3, and L _{C =} H _S ;

R 0 is selected from the set. which includes H, cyclopropyl, CH ₃ and C ₁ H ₅ ; and n is selected from U. 1, 2 and 3.

In a more preferred embodiment, the present invention provides a novel compound of formula 1 wherein:

R ^{1 is} selected from CF _; , and C _and F _with t

R ^p is selected from the group comprising a C ₃ alkyl substituted with

LR *. C 1-6 alkenyl substituted with 1 R 1 and C _{= 3} alkynyl substituted with 1 R ¹ ;

R ³ is each independently selected from C 1-4 alkyl, C 1-4 alkyl, C _1-3 alkoxy. F, Cl, Br, I. NR 5 R ⁵ '. ΝΟ ^. CN, C <H> ^RA. NHCCCDR ⁷ and NHC (IDNR ^S R ^S ;

alternatively, if two R ³ substituents are present and are attached to adjacent carbon atoms, they may together form a -tlCHaCJ- group;

R ⁴ s selected from the group comprising C ₃ _ cycloalkyl substituted _with 0--2 R ^3, phenyl, substituted Π-2 R ³ and B-5 membered heterocyclic system containing 1-3 heteroatoms selected from □, N, S, substituted with 0-1 R ³ ;

^R and R are independently selected ^with Christians from H and _CH , and C _and H-;

R ^A is selected from the group consisting of H, CH, CFG, C _and Hi,

CCH ₃ . OC _and H _n and NR ⁵ R ' ³ - ^J ;

R ⁷ is selected from the group consisting of CH ₃ , C, _and H 4. CCH ₃ a

OC _and H, i

R ^Q is selected from H, CH ₃ and C _and H _s ; and n is selected from 0, 1, 2 and 3.

In an even more preferred embodiment, the present invention provides a novel compound of formula I, wherein:

R ^{1 is} CF _S ;

R ² .is selected from the group Ľi_3alkyl substituted with LR ^4, L 2 .. ₃ alkenyl substituted with 1 ^R4, and C ^ - ^ alkynyl substituted with 1 ^R4;

R ³ is each independently selected from C _1-3 alkyl, OH, L _1-3 alkoxy, F, L 1, C <O> R ^A. NHIXIDR 'and NHCC FDNR ® R ⁵³⁰ ;

the file that Br, I. NR ^ R · - ^, includes NU ₂ . LN, alternatively. if two R ³ substituents are present and are attached to adjacent atomic carbon, they can be taken together to form a "H 1 H 5" O group;

R ⁴ is selected from the group consisting of cycloprupyl substituted with 0-1 R ³ , thenyl substituted with 0-2 R ^3, and 5-6

A membered heterocyclic system containing 1-3 heteroatoms selected from O, N, S, substituted with 0-1 R ³ , wherein the heterocyclic system is selected from the group consisting of 2-pyridyl,

4-pyridyl, 2-turanyl, 3-turanyl, 1,2-thienyl, 2-oxazolyl, 2-thiazolyl. 4-isoxazolyl a

3-pyridyl.

3-t ± phenyl,

2-imidazolyl;

R ^s and R ⁵ 'are independently selected from H and UH. ₃ and C _and H

R ^A is selected from the group consisting of H, OH, CH 3, CaH _B.

Or: H.- "UCaH" and NR ³ R ^5a ;

R ⁷ is selected from the group. which includes CH 3, C ₌ H 4, OCH ₃ and γχ: η-, j

R 8 is selected from the group consisting of H, CH. ₃ and L _B H _S ; and n is selected from 0, 1, 2 and 3.

Another preferred formula Ia of the invention comprises a compound of general formula

LFJ3 Another preferred r-realization comprises the pattern oom 1b with compound e in general

C71 In formula

rfal ňw j ll indi ie i r e i j cc: 1 won out o fn. which: i 1. is a compound comprising t; by general (i.e., 4'-chloro-4-cyclopentyl) ethyl-4-trifluoromethyl-3,4-diidro-2 (1H) -cyl-thiazolone ;

N- (1H-chloro-4- (2-pyridyl) ethynyl-4-trifluoromethyl-3,4-dihydro-2H-quinazolinone;

(+/-) - 6-Chloro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2H-quinazolinone;

C +/- 1-4-Cyclopropylethynyl-6-methoxy-4-trifluoromethyl-3,4-dihydro-2H-quinazolinone;

C +/-) -6-1 * methoxy-4-C2-pyridyl) vinyl-4-trifluoromethyl-3. 4-dihydro12

-2C (1H) -quinazolinone;

C + 1 - 6-Ethoxy-4-phenylethynyl-4-trifluoromethyl-3. 4-dlhydro-2H-1H-quinolinone;

(+/-) -4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2H-quinazolinone;

C +/-) - 5,6-D (fluoro-4- (2-pyridyl) ethynyl-4-trifluoromethyl-3,4-dihydro-2 (1H) -quinazolinones-5 - + - -) - 5, 6- Difluoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2 (1H) -quinazoline;

C +/-) 4-Ľyklopropyletinyl-6-fluoro-4-trifluoromethyl-3, 4-di-an ether or 2 C 1 H) -chinazoll Nóri p ¢ +/-) - p, _p i5 j _{U r} · · -4 - C 2 -pyridyl) ethines L-4-trifluoromethyl-3,4-dihydro-2 H -quinazolinone;

(+/-) - (1-Fluoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2H) -quinazolinone;

¢ +/-) -6-F-fluoro-4- (2'-2-pyridyl) ethyl-4-trifluoromethyl-3,4-dihydro-1H-quinazolinone;

(R) -6-Fluoro-4-thenylethyl-4-trifluoromethyl-3,4-dihydro-2H-quinazolinone;

¢ - / -) - B-chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydrα-2 ¢ 1 H) -quinazolinone;

C + 6 -6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2H-quinazolinone;

(+) - 4-Cyclopropylethynyl-5. B-difluoro-4-trifluoromethyl-3,4-dihydro-2 H -quinazolinone;

1.3

C-4-Cyclopropyl ethynyl-5, B-difluoro-4-trifluoromethyl-3,4-dihydrin-2 (1H) -quinazoline;

<+ 5 -4-E-Cyclopropylpropyl-phenyl-5. 6-difluoro-4-trifluoromethyl-3,4-dihydro-2H (1 H) -isodium salt; and (-) -6-Chloro-4-E-Cyclopropylethenyl-5,11-trifluoro-4-trifluoromethyl-3. 4-dihydro-2C1H) -quinazolinone;

or a pharmaceutically acceptable salt thereof.

In a second embodiment, the present invention provides a compound of the formula L 1 -

or a storeol thereof, or a pharmaceutically acceptable salt thereof.

R '·' is also: == C-R * "»

R ^J is selected from the group Cj_4alkyl, OH. i: T_ "alkoxy. L, C, EIR, T, NR ^B R ^{R T,} N0i ;, CN. IXU) R. NHC «DR 'and NHC <0> NR ^u R ^e * #

H ^- ** is selected from the group consisting of methyl, ethyl, n-propyl. i-propyl, i-butyl, tert-butyl and i-pentyl;

R ^a and ^{R 5} · ® are independently selected from the group consisting of H and alkyl Cx-:

R ^A is independently selected from H, OH. C <alkyl. C _x - alkoxy, and NR ^{R, SR S;}

R ⁷ Is a selected from the group consisting of C _1-3 alkyl and C 1-3. ₃ alkoxy; R ^H is a selected from the group comprising C H ₃ _. ₃ cycloalkyl a Cl. - ₃ alkyl; and n .is a selected of 0. 1. 2, 3 and 4. r 91 IN another In an embodiment, the present invention provides a new one

the compound of formula II. where

R ^a is C = C-R * -; R ³ is selected from file. comprising L _x _ alkyl, OH. C ^ alkoxy. F. Cl, Br. I, NR ^p R ^p - \ N0 _and CN. IXLOR ^Ä a NHC (O) R ^7;

R * is selected from the group consisting of methyl. ethyl, n-propyl, L-propyl, i-butyl, tert-butyl and i-pentyl;

^R and R · ³ are independently selected from the group consisting of H and CH _{3 and} H, and L ₃ and

R ^A is selected from H, OH. CH ₃ . C _and H. _A. OCH ₃ . OC _a H _p and NR ^{R, 5} ies

R ⁷ is selected from the group consisting of CH ₃ , C ₂ H ₅ , ICH ₃ and CX: ₂ H _e ;

R 0 is selected from the group consisting of H, cyclopropyl, CH ₃ and L 2, _and H 2 _and n is selected from U, L and 2.

In another preferred embodiment, the present invention encompasses a compound of formula TTa '.

Ila.

[11.] In another preferred embodiment, the present invention comprises a compound of the formula IIb *

[123] In another preferred embodiment, the compound of formula (T) is selected from the group consisting of:

(R) -4- (4-Chloro-4-nitro) ethyl] -4-trifluoromethyl-3,4-dihydro-2H (1 H) -quinazoline;

R-N-N-Chloro-4-ethyl-phenyl-4-trifluoromethyl-3,4-dihydro-2H-1,1-quinazolinone;

<+/-) -4-Isopropylethynyl-6-meter> xy-4-trifluoromethyl! -3,4-dihydro-2 (1H) -quinazolinone;

(+/-) - 5,6-Difluoro-4-isopropylethiryl-4-trifluoromethyl-3. 4-dihydro-2 (1H) -quinazolinone;

C +/-) -5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2 (1H) -quinazolinone;

(+/-) -5,6-Difluoro-4-isopentyl-4-trifluoromethyl-3. 4-dihydro-2C1H) -quinazolinone;

.TE

C +/-) - R -Fluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2 (1H) -quinazolinone

C +/-) -6-Fluoro-4-ethyl-ethynyl-4-trifluoromethyl-3,4-dihydro-2H-quinazoline;

C 5 -, 5-B-Difluoro-4-isopropyl-4-vinyl-4-trifluoromethyl-3,4-dihydro-2 H -quinazoline;

C + -5,5-D-fluoro-4-isopropyl-1-4-trifluoromethyl-1,3,4-dihydro-2H-quinazolinone;

(-) - 5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2H (1 H) -quinazolinone; and

C + -5,5-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2H-quinazolinone;

or a pharmaceutically acceptable salt thereof. liver salt.

In a third embodiment, the present invention provides a new pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of a compound of formula I or II or a pharmaceutically acceptable salt thereof.

In a fourth embodiment, the present invention provides a novel method of treating HIV infection which comprises administering to a host in need of such treatment a therapeutically effective amount of a compound of Formula I or II, or a pharmaceutically acceptable salt thereof.

In a fifth embodiment, the present invention provides a new method of treating HIV infection, comprising administering, in combination, to a host in need of such treatment a therapeutically effective amount with an

C a) compounds of formula I or II; and

C b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors.

In another preferred embodiment, the reverse transcriptase inhibitor is selected from the group consisting of AZT. 3TC. ddl, ddC, d4T, delavirdine, TIBU derivatives, BI-RG-587, nevirapine, L-697. 661, L Y 73497. Ro 18.893. loviride, trovirdine. I4KC-442 and HBY 097 and the protease inhibitor is selected from the group consisting of saquinavir, ritonavir, iridinavir, VX-478, nelfinavir, KNI-272. CGP-61,755th U-140690 and ABT-378.

In an even more preferred embodiment, the reverse transcriptase inhibitor is selected from the group. which comprises AZT and 3TG and the protease inhibitor is selected from the group consisting of saquinavir. ritonavir, nelfinavir, and indinavir.

In an even more preferred embodiment, the transcriptase is AZT.

reverse inhibitor

In another preferably indinavir.

an embodiment is a protease inhibitor

In a sixth embodiment, the present pharmaceutical kit useful for treating comprises a therapeutically effective amount. The invention provides HIV infections which a) the compounds of formula I or II; and C b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors in one or more sterile containers.

In a seventh embodiment, the present invention provides a novel method of inhibiting HI present in a body fluid sample, comprising treating a body fluid sample with an effective amount of a compound of Formula T or II.

In an eighth embodiment, the present invention provides a new kit or container comprising at least one of the compounds of Formula I or II in an amount effective for use as a standard or reagent in assays or assays to determine the ability of a potential therapeutic to inhibit HIV reverse transcriptase, HIV growth, or both.

definition

The following terms and expressions as used herein have the meanings indicated. It will be appreciated that the compounds of the present invention contain an asymmetrically substituted carbon atom and may be isolated in optically active or racemic forms. It is well known in the art how to prepare optically active forms such as e.g. resolution of racemic forms. or by synthesis, from optically active starting materials. All chiral, diastereoisomeric, raceric forms, and all geometric isomeric forms of the structure are possible, unless a specific stereochemistry or isomeric form is specifically indicated.

The application of the method according to the invention in practice is contemplated at least in a multigram dimension. in kilogram size. in a multi-kilogram dimension or on an industrial scale. A multigram range as used herein refers to a range in which at least one feedstock is used in an amount of 10 g or more, more preferably at least 50 g or more, and even more preferably at least 100 q or more. The multi-kilogram range as used herein means that at least one feedstock is used in an amount greater than 1 kg. Industrial scale means a range not different from laboratory scale, and in this scale production produces a quantity of product that is sufficient for either clinical trials or consumer distribution.

As used herein, alkyl refers to a straight or branched chain saturated hydrocarbon aliphatic group having a specific number of carbon atoms. Examples of alkyl include, but are not limited to, methyl, ethyl, n-propyl, i-propyl. n-butyl. sec-butyl, t-butyl, n-perityl and sec-pentyl. Haloalkyl denotes a straight or branched chain saturated hydrocarbon aliphatic group having a specific number of carbon atoms which is substituted by 1 or more halogen atoms (for example, -C _v 1 _-W . Wherein v is 1 to 3 and v is 1 to (2v + 1) Examples of haloalkyl include, but are not limited to, trifluoromethyl, trichloromethyl, pentafluoroethyl, and pentachloroethyl Alkoxy means an alkyl group having an indicated number of carbon atoms attached through an oxygen atom Examples of alkoxy include, but are not limited to, methoxy, ethoxy, n-propoxy Cycloalkyl refers to a saturated cyclic group, such as cyclopropyl, cyclobutyl or cyclopentyl. Alkenyl refers to straight or branched chain hydrocarbon chains and one to one. or by multiple unsaturated carbon-carbon bonds which may be located at any stable chain position, such as ethenyl, propenyl Alkynyl denotes straight or branched chain hydrocarbon chains and one or more carbon-carbon triple bonds which may be located at any stable chain position such as ethynyl, propynyl, and the like.

As used herein, halo or halogen refers to fluorine, chlorine, bromine and iodine. The reverse charged iuria is a small, negatively charged particle such as chloride, bromide, hydroxide. acetate, sulfate, and the like.

As used herein. means an aryl or aromatic moiety having an aromatic moiety containing a specific number of carbon atoms, such as phenyl or naphthyl. As used herein. means a carbocycle or carbocyclic moiety any stable 3- to 5-membered monocyclic ring which may be saturated or partially unsaturated. Examples of such carbocycles include, but are not limited to, cyclopropyl. cyclopentyl, cyclohexyl, phenyl, b.thienyl, phenyl, indanyl, adamarityl or tetrahydronaphthyl (tetralin).

heterocycle or 6-membered monocyclic partially unsaturated

As used herein, a heterocyclic system means a stable 5- or heterocyclic ring that is saturated or unsaturated (aromatic) and which contains carbon atoms and 1 to 3 heteroatoms selected independently from the group consisting of N, O and S. Heteroatoms The nitrogen and sulfur may optionally be oxidized. The heterocyclic ring may be attached to its pendant group by any heteroatom or carbon atom that results in a stable structure. The heterocyclic rings described herein may be substituted on a carbon or nitrogen atom if the resulting compound is stable. If specifically mentioned, the nitrogen in the heterocycle may be quaternized. Preferably, when the total number of SaU atoms in the heterocycle is greater than 1, these heteroatoms are not in adjacent positions. Is a; preferably, the total number of S and l) atoms in the heterocycle was not greater than 1. As used herein, the term aromatic heterocyclic system means a stable 5- to b-membered monocyclic heterocyclic aromatic ring composed of carbon atoms and 1 to 3 heteroatoms independently selected from N, IJ and S. It is preferred that the total number of atoms of S a1) in the aromatic heterocycle is not greater than 1.

Examples of heterocycles include, but are not limited to, 2-pyrrolidoriyl, 2H-pyrrolyl. 4-piperidoriyl-BH-1,2,5-thladiazinyl, 2H, 6H-1. 5,2-thiazinyl, turanyl, furazanyl, imidazolidinyl, imidazolinyl, imidazolyl, isoxazolyl, oxadiazolyl, 1,2,3,3,4,4-oxadiazolyl, 1,2,5-oxadiazolyl, 1,3,4-oxazolidinyl, oxazolyl, piperazinyl, piperldinyl, piperidonyl, 4-piperidonyl, purinyl, pyranyl, pyrazinyl, pyrazinyl 1, pyrazolinyl, pyrazolyl, pyridazinyl, pyridinyl, pyridyl, pyrlmidinyl, pyrrolidinyl, pyrolinyl, pyrrolyl.

-oxadiazolyl, -oxadiaznlyl, pteridinyl.

tetr ahydrofurány1. 1,2,4-thiadlazolyl, thiazolyl, thieriyl,

L, 2,3-thiadiazolyl. 1,3,4-thiadiazolyl,

BH-1,2,5-thiadiazinyl,

1,2,5-thiadiazolyl, thienotlazolyl, thienoxazolyl, thienoimidazolyl, thiophenyl, triazinyl. 1,2,3-triazolyl, 1,2,4-triaznlyl, 1,2,5-trlazolyl and 1,3,4-triazolyl. Preferred heterocycles include, but are not limited to. pyridinyl, furanyl, tlenyl, pyrrolyl. pyrazolyl. imidazolyl and oxazolidinyl. Also included are fused cyclic and opio compounds containing, for example, the above heterocycles.

As used herein, an HIV reverse transcriptase inhibitor means both nucleoside and non-nucleoside HIV reverse transcriptase (RT) inhibitors. Examples of nucleoside RT inhibitors include. but are not limited to AZ1, ddC, dd1, d4T, and 3f'C. Examples of non-nucleoside RT inhibitors include, but are not limited to. delavírdiri (Pharmacia und Upjohn IJ90152S), derivatives TT.BO, BI-RG-587. nevirapine (Boehriner Ingelheim). L-697, 661, LY73497, Ro 18,893 (Roche), Lovirdin (Janssen), troviridine (Lilly), MCK-442 (Triangle) and HBY 097 (Hoechst).

As used herein, an HIV protease inhibitor refers to compounds. that inhibit HIV protease. Examples include, but are not limited to, saquiriavir (Roche, Ro31-8959), ritonavir (Abbott, ABT-538). Indinavir (Merck MK-639), VX-478 (Vertex / Glaxo Wellcome), Nelfinavir (Agourori, AG-1343), KNI-272 (Japan Energy), CGP-61755 (Liba-Geigy), U140690 (Pharmacia und Upjohn) ) and ABT-378. Other examples include the cyclic protease inhibitors disclosed in WU93 / 07128. WU 94/19329, WU 94/22840 and PCT application no. US96 / 03,426th

As used herein, the term pharmaceutically acceptable salts refers to derivatives of the disclosed compounds wherein the starting material is modified by converting it to its acidic or basic salts. Examples of acceptable salts include, but are not limited to, salts. mineral or organic acids and basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and so on. Pharmaceutically acceptable salts include conventional non-toxic salts of the quaternary ammonium salts of the starting materials formed, for example, from non-toxic inorganic or organic acids. For example, these conventional non-toxic salts include salts derived from inorganic acids such as hydrogen chloride, hydrogen bromide, sulfuric acid, sulfamic acid, phosphoric acid, nitric acid and the like; and salts prepared from organic acids such as acetic acid, propionic acid, succinic acid.

glycolic, stearic, milk, apple. wool, lemon, ascorbic, pamoic, inalein, hydroxyinalein, phenylacetic, glutamic, benzoic, salicylic, sulfanil, 2-acetoxybenzoic, fumaric. toluenesulfonic, methanesulfonic, ethanedisulfonic, oxal 2-hydroxyethanesulfonic and the like.

The pharmaceutically acceptable salts of the present invention can be synthesized from a starting material that contains a basic or acidic moiety. by conventional chemical procedures. In general, these salts may be prepared by reacting the free acid or basic farms of the compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or a mixture of both; generally non-aqueous media such as ether, ethyl acetate, ethanol, isopropanol, but acetonitrile is preferred. A list of suitable salts can be found in Remingtorl and Pharmaceutical Sciences, 17th ed., Black Publishing Company. Easton, PA, 1985. p. 1418, the disclosure of which is incorporated herein by reference.

The phrase pharmaceutically acceptable is used herein to denote those compounds, materials, compositions and / or dosage forms which, according to medical opinion, are suitable for use in contact with human and animal tissue without excessive toxicity. irritation, allergic response or other problems or complications. corresponding to a reasonable profit / risk ratio.

It is understood to include a prodrug and is meant to include any covalently bound carriers that release an active parent drug of formula (C1) or CII) or other formulas or compounds of the present invention in vivo when such prodrug is administered to a mammal. Prodrugs of the present invention, for example of Formula C1), are prepared by modifying the functional groups present in the compound in such a way that the modified substances are cleaved, either by routine manipulation or in vivo, to the starting material. Prodrugs include compounds of the present invention wherein the hydroxy or amino group is bound to another group such that when the prodrug is administered to a mammal, it cleaves to form the free hydroxyl or amine. Examples of prodrugs include, but are not limited to, acetate. tormiate or benzoate derivatives of alcohol and amine functional groups in the compounds of the invention.

Stable compound and stable structure refer to a compound that is strong enough to survive isolation from the reaction mixture to an appropriate degree of purity and formulation for an effective therapeutic agent. According to the present invention, only stable compounds are contemplated.

Substituted indicates that one or more of the hydrogen of the atom contemplated for use by the substituted is replaced by selection from the labeled group (s), provided that the normal patency of the labeled atom is not exceeded and that the substitution results in a stable compound. When the substituent is a keto group (i.e., = O), two hydrogens are replaced on the atom.

By a therapeutically effective amount is meant an amount of a compound of the present invention or an amount of a combination of the claimed compounds that is capable of effectively inhibiting HIV infection or treating the symptoms of HIV infection in a host. The combination of compounds is preferably a synergistic combination. Synergies as described, for example, by Chou and Talalay, Adv. Enzyme Regul. 22 * 75-55 (1384) occurs when effect C in this case inhibits HIV replication) of the compounds when administered in combination is greater than the additive effect of the compounds when administered alone as single agents. In general, the synergistic effect is most clearly demonstrated at suboptimal concentrations of the compounds. Synergy may also be in terms of lower cytotoxicity. an increased antiviral effect or some other advantageous effect of the combination compared to the individual components.

The compounds of the present invention can be prepared in a number of ways well known to those skilled in the art of organic synthesis. The compounds of the invention can be prepared using the methods described below. together with synthetic methods known in organic chemistry or variations thereof as recognized by one skilled in the art. Preferred methods include, but are not limited to, those set forth below. Each of these references is incorporated herein by reference.

Scheme 1

1TMSCl, base RiMgX

Scheme 1 illustrates a process for preparing ketoanilines from appropriately substituted 2-aminobenzoic acids. The acid is converted to its N-inethoxy-N-methyl ainide derivative, which can then be displaced to give the R ¹ -substituted ketrtn. Ketoanilines are useful intermediates for the claimed compounds of the invention.

2b

Science 2

Scheme 2 describes another method for preparing the ketoanilines 7 of an appropriately substituted aniline. After iodination and protection of the amino, a trifluoromethyl group can be introduced using a strong base and trifluoroacetate. Removal of the protecting group provides ketoanil.n. Other methods for preparing ketoanilines are known to those skilled in the art, for example, Houpis et al., Totr. LTST. JH 34 34C37),

6R1: I-R014, referred to Lu acc.

Soline 3 ^{R 1} = ^COOH HH (CH ₃ ) OCH 3, ^K 0 ^{-CON (} OCH '> ^CH '

Another process for the preparation of 2-trifluoromethylaniline is described in Example 3. After formation of the protected aniline, and.d is reduced and trifluoromethyl is added. Oxidation with an oxidizing agent such as 1 * 10n _{and a} provides a useful intermediate.

Scheme 4

A mol. screens

-►>

a. n-BuLi / HCCR ⁴ / THF

b. BF3'OEt ₂

Using the general method described in Scheme 4, compounds of the invention can be prepared. The ketoaniline 1, which can be prepared by the method described in Schemes 1 and 2, is treated with trimethylsilyl isocyanate in dry tetrahydrofuran in the presence of dimethylaminopyrldine and then tetrabutylammonium fluoride to give hydroxyinochoviria 2. Hydroxyurea 2 is then dehydrated with dehydrate 4 with dehydrate with dehydrate in toluene or xylenes under reflux to give ketimine 3. Subsequently, the substituted acetylenic group R is introduced ^and treatment of ketlinin 3 with lithium adetylide prepared in a separate vessel by reacting the corresponding substituted acetylene with n-butyllithium in dry tetrahydrofuran yields 4,4,4 The 3,4-dihydro-2 (1H) -quinazolinone 4 disubstituted compound of formula I. The acetylene bond of compound 4 can be reduced, for example, by catalytic hydrogenation to give the corresponding alkenyl group (not shown or saturated compound 5).

Other R ² groups may also be introduced directly by reaction of imine 3 with lithium R ² Li or a Grignard reagent R ^{2 11} * 1hX in the presence or absence of a Lewis acid catalyst such as BF ₃ etherate. See also Huffman et al., J. Or <3. Chem. 1995, 60, 1590-1594, the contents of which are incorporated herein by reference.

In some cases, one enantiomer of a compound of Formula 1 or clay may exhibit a higher activity compared to another. If desired, separation of the racemic material may be accomplished by HPLC using a chiral column as described in Examples 27-34 (Scheme 41) or by resolution using a resolving agent such as camphor chloride as described in Thomas J. Tucker et al., J. Med. Chem. L994, 37, 2437-2444. The chiral compound of formula I can also be directly synthesized using a chiral catalyst or chiral ligand, for example, A. HutFman et al. J. Or <3 Chem 1995, 60, 1590-1594.

The following examples are provided in no way limit the scope of the invention.

for illustration and v

DETAILED DESCRIPTION OF THE INVENTION

The abbreviations used in the examples are defined as 'C' for degrees Celsius, d for doublets. dd for doublet of doublets, eg for equivalent or equivalents, g for gram or grams, mg for milligram or milligrams, ml for milliliter or milliliters, H for hydrogen or hydrogen, hour for hour or hours, m for multiplet, in for inole. min "for minute or minutes, MHz spectra opj u for megahertz, MS for osk opj u mass spectrum, MIR or NMR for nuclear magnetic resonance spectroscopy, t for triplet, TLL for thin layer chromatograph, EDAC for hydrochloride 1-- (3-dimethylamiriopropyl) -ethylcarbodiimide, DIPEA for diisopropylethylamine, TBAF for tetrabutylammonium fluoride, LAH for lithium aluminum hydride and TEA for triethylamine.

Example 1

Preparation C +/- 1-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3. 4-dihydro-2 (H) -chinazolinúriu (R ¹ '- Pr)

Ill-a IV-a

Step 1. Preparation of I-a from I-a

To a solution of Ia (4.55 g, 20.2 mmol) in anhydrous THF (40 mL) was added dimethylaminopyridine (0.25 g, 2.02 mmol) and trimethylsilyl isocyanate (6.05 g, 7.11 mL). 52.5 ml). The mixture was stirred at room temperature for about 16 hours and then tetrabutylammonium fluoride (21 mL of a 1 M solution in THF) was added. The thick slurry was diluted with additional THF (20 mL) and stirred at room temperature for 0.5 h. THF was removed under reduced pressure, the residue was taken up in EtOAc (100 mL) and washed with 1 N HCl (1 mL), saturated aqueous NaHCl? <70 mL) and saturated aqueous NaCl (<50 mL). The organic phase was dried over MgSO 4, filtered and concentrated under reduced pressure to give a light yellow solid. The light yellow color was removed by trituration with hexanes to give 11a (5.09 g, 94%) as a white solid (1 _{H NMR} (acettin-dg) δ 9.06 (br s, 1H), 7 48 (s, 1H), 7.40 (br s, 1H), 7.34 (dd, J = 8.8, 2.6 Hz, 1H), 6.97 (d, J = 8) .8 Hz, 1H); ¹⁹ F NMR (282 MHz, acetidine-dg) δ -86.33, -86.35; IR (KBr pellets) 1724, 1678, 1398, 1198, 1174 cm ^-1 ; MS (CI) m / e 266 (MH &lt; ^{+ &gt};, 100).

Step 2. Preparation of IIJ-a from I-a

A suspension of J'1-a (5.09 g, 1.9, J minn'1) in toluene (150 ml) containing 4 A molecular sieves (about 100 mg) was heated under reflux for 16 hours. The resulting clear yellow solution was cooled to room temperature, the precipitated solids were dissolved in acetone, and the molecular sieves were removed by vacuum filtration. The filtrate was concentrated under pressure to the three zriížnnom Cattle U is with hexanes to afford III-a <4.25 g, HH%) as a yellow solid NMR * ^X <300 MHz, acetone-d _R) R 7,05- 7.02 (m, 2H), 7.61 (d, J = 0.0 Hz, 1H); "" T

NMR <202 MHz. acetone-d _A ) -67.00.

Step 3. Preparation of IV-a from ill-a

Cyclopropylacetylene solution <13.00 ml 30% density. of a solution in a mixture of toluene / THF / hexanes, 59.0 mmol) in anhydrous THF (118 mL) was cooled to -78 ° C and treated with n-BuLi <32.8 mL of a 1.6 M solution in hexanes, 52 mL. (4 mmol) and warmed to 0 ° C in an ice bath and aged for 0.5 h. To a solution of III-a (3.12 g, 12.6 mmol) in anhydrous FHF (66 mL) at -78 ° C was added lithium acetylide over about 10 minutes. To this mixture was added boron trifluoride etherate (0.89 g, 0.80 mL, 6.28 mmol) followed by removal of the cooling bath. The temperature of the reaction mixture is allowed to reach room temperature and the zines are stirred at this temperature for 4 hours

After 1 hour and then cooled with 1 L * 1 citric acid (1 mL). Concentrate the mixture under reduced pressure to 1/2 volume (volume, dilute (200 mL) (200 mL), remove the aqueous phase and wash the organic phase with saturated aqueous IMaHCO ₃ and saturated aqueous NaCl. 00 ml). The organic phase is dried over 1 * 18S (U, filtered and concentrated under reduced pressure. The crude material is purified by flash chromatography <3% MeOH / CH 2 Cl 2) to give a thick yellow oil, from which a crystalline compound of TV-a CR is obtained. ⁴ cyclopropyl (3.85 g, 97%) as a white solid> mp 05.6-88 ^rt C; 1 H NMR (300 MHz, acetone-dg) δ 8.95 (br s,

H), 7.51 (br s, 1H), 7.43 (br s, 1H), 7.40 (dd, J = 8.8,

2.4 Hz, 1H), 7.02 (d, J = 8.8 Hz, 1H), 1.49-1.41 (m, 1H), 0.93-0.82 (m, 1 H), 0.77-0.74 (m, 1H); ¹⁹ F NMR (282 MHz, acetone-dg) δ -82.96; IR (KBr pellets) 1696, 1172 cm ^-1 ; MS (CI) m / e calcd for C ₁₄ H ₁₀ ClF ₃ N ₂ O: 315.051201, found.

315.051626; 315 (MH ⁺ , 51), 332 (M + NH 4 ⁺ , 100); Analysis, calculated for 14 H ₁₀ N ₂ C1 F ₃ 0.0,5H ₂ 0: C, 52.68; H, 3.32; N, 8.78;

found: C, 52.61; H, 3.35; N, 8.28.

Example 2

Preparation of (R) -6- (1H-rr-4-isopropylpyridine-4-trifluoromethyl-1,3,4-dimethylpyrido-2 (1H) -quinazolinone (R ⁴ ) -isopropyl upy'J)

A solution of 1 (1 '- a (50 mg, 0.201 mmol) was treated with 3-methyl-butyne-derived lithium acetylide (52 mg, H 3 ml, 0.91 I mmoL) according to the procedure of Step 3 of Example 1. The resulting crude material was Purified by flash chromatography <36 (EtCl 3 / hexanes) to give 26 mg <41 ZD of the desired product: 1 H NMR (300 MHz) δ 9.08 (br s, 1H), 7.59 (br s, 1H), 7.53 (br s, 1H), 7.40 (dd, J = 8.4, 2.2 Hz, 1H), 7.02 (d, J = 8.8 Hz, 1H), 2 81-2.68 (m,

H), 1.20 (dd, J = 6.6 Hz, 6H); NMR (282 MHz, acetdh-dg) δ -83.5; MS (CI) m / e calcd for C ₁₄ H ₁₂ ClF ₃ N ₂ O: 317.066851, found · 317.06933; 317 (MH ⁺ , 43), 334 (M + NH ₄ ⁺ , 100).

Example 3

Preparation of <+/-) -6-methyl-4- (2-pyrrolidinyl) ethyl-4-trifluoromethyl-3,4-dihydro-2H (1 H) -quinazoline CR ' * = 2-pyridyl)

A solution of IIIa (100 mg, 0.402 mmol) was treated with 2-ethynylpyridine-derived lithium acetylide (0.19 g, 1.01 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC <2.5% MeOH / CH _and Cl _a ) to give 85 mg (<60%) of the desired product: mp 105 ° C dec. * NMR (300 MHz) δ 9.14 (br s, 1H), 8.64-8.61 (m, 1H),

7.89-7.84 (m, 2H), 7.70-7.66 (m, 2H), 7.48-7.43 (m, 2H),

7.09 (CL, J = 8.8 Hz, 1H); ¹⁹ F NMR (282 MHz, acetone-dg) δ -82.48; IR (KBr pellets) 1704, 1430, 1186 cm ^-1 ; MS (CI) m / e calcd for C 18 H 18 ClFN 4 O 2: 352.046450, found 352.04656;

352 (MH ⁺ , 100) Anal. Calcd. For C ₁₆ H ₉ ClF ₃ N ₃ 0.0.125 H ₂ 0:

C, 54.3; H, 2.56; N, 11.9; found: C, 54.71; H, 3.03; N,

11.3.

Example 4

Preparation of (+/-) -thiurour-4-ethynyl-4-trifluoromethyl-3,4-dihydro-2 (1H) -quinazolinone (R ' ^k -ethyl)

A solution of IIT-a (100 mg, 0.402 miss) was treated with lithium acetyl-derived ud according to the procedure of Step 3 of Example

1-butyne <109 mg, 1. Resulting crude

The material was purified by HPLC <2.5% MeCl 3 / CH _and Cl _a ) to give 79 mg (65%) of the desired product: ¹ H NMR (300 MHz, acetidine-dg) δ 9.05 (br s, 1H), 7.54 (br s, 2H), 7.41-7.39 (m, 1H, 7.02 (d, J = 8.4 Hz, 1H), 2.36 -2.32 (m, 2H), 2.18-1.13 (m, 3H); ¹⁹ F NMR (282 MHz, acetone-dg) δ -82.99; MS (Cl) m / e calcd for ^C 13 ^H 10 ^ClF 3 ^N 2 ^O: 303.051201, found: 303.051882; 303 (MH ⁺ ,

55), 320 (M + H &lt; ^{+ &gt};, 100).

Example 5

Preparation of (+/-) - 6-chloro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2 (1H) -quinazoline (R * - phenyl)

A solution of III-a (100 µg, 0.402 nol) is treated with lithium acetylidoin derived from phenylacetylene <185 µg. 1.81 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.52 MeOH / CH 2 Cl 2) to give 54 mg (38) of the desired product: 1 H NMR (300 MHz, acetone-dg) δ 9.07 (br s, 1H), 7.74 (br s, 1H), 7.67 (br s, 1H), 7.62-7.58 (m, 2H), 7, 48-7.40 (m, 4H), 7.08 (d, J = 8.4 Hz, 1H); ¹⁹ F

NMR (282 MHz, acetone-dg) δ -82.67, IR (KBr pellets) 1696, 1186 cm ^-1 ; MS (CI) m / e calcd for C 17 H 13 ClF 3 N 2 O: 351.051201, found 351.051704; 351 (MH ⁺ , 51), 368 (M + NH 4 ⁺ , 100);

Anal. Calcd. 0.25%: C, 57.48; H, 2.98; N, 7.89; found C, 57.00; H, 3.03; N, 7.48.

Example 6

Preparation of (+/-) -4-cyclopropylethylphenyl-N-methoxy-4-trifluoromethyl-3. 4-dihydro-2 (1H) -chenzazoline (cyclopropyl)

VII-a

Vxxx-a

Step J. Preparation of VJ-n from V-a

Ruztok Va CO. 50 g (2.28 mmol) were treated with dimethylaminopyridine and trimethylsilyl isocyanate as described in Step 1 of Example 1 to give 0.58 g (97%) of the desired product. ^{@ 1} H NMR (300 MHz, acetone-d6) .delta. 81 (br s, 1H), 7.17 (br s, 1H), 7.11 (br s, 1H), 7.00-6.92 (m, 2H),

6.83 (s, 1H); 3.76 (s, 3H); ¹⁹ F NMR (282 MHz, acetone-dg) δ -85.99.

Step 2. Preparation of V1a-a from V1a-a

A solution of Vl-a (58 g, 2.21 mmol) was heated to reflux in toluene as described in Step 2 of Example 1 to afford

11, 50 g C 93 X) required product » ¹ H NMR <300 µlHz, acetone-d _rf> ) ti 7. 52 C br n. 2 H). 7.27 (S, 11). 3,90 C s. 3H); ^1V F Ni * IR <282 ľlHz. at. : nti'i — d _Ä S S -HR, 08. degree 3. Preparation of VL.T. VLT and

RnzLdk (I-a (10 mg, 0.41 mmol) was treated with lithium cyclopropyl acetylene CO. 41 ml 30 wt. solution in toluene / LHF / hexanes, 1.85 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by C 2, L * bX leOH / CH Cl _{and ffl)} to give 103 mg of 81 · X) desired product » ¹ H NMR (300 MHz, acetone-dg) δ 8.77 (br s,

H), 7.29 (br s, 1H), 7.06 (br s, 1H), 6.99-6.90 (m, 2H),

3.77 (s, 3H), 1.46-1.38 (m, 1H), 0.91-0.85 (m, 2H),

0.79-0.72 (m, 2 H); ¹⁹ F NMR (282 MHz, acetone-dg) δ -82.61; MS (Cl) m / e calcd for C ₁₅ H ₁₄ F ₃ N ₂ O ₂ : 311.100738, found: 311.0999970; 311 (MH &lt; ^{+ &gt};, 100).

Example 7

Preparation C +/-) -4-Isopropylethynyl-6-methoxy-4-trifluoromethyl-3. 4-dihydro-2 (1H) -quinazolinone CR * = isopropyl)

Solution III-Cd1 mg. 0.411.1 inmol) was treated with lithium acetylidone derived from 3-methyl-1-butyne C126 mg, 0.19 mL. 1.66 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by flash chromatography C 2, 5% L * Leghe / CH _and C _a) to give 30 mg of the desired product C24: m.p.

226-229 °; ^{Τ Η} NMR (300 MHz, acetone-d) δ 8.72 (br s, 1H), 7.27 (br s, 1H), 7.10 (br s, 1H), 7.00 to 6 , 91 (m, 2H), 3.77 (s, 3H), 2.73-2.67 (τη, 1H), 1.20 (dd, J =

7.0, 1.5 Hz, 6 H); ¹⁹ F NMR (282 MHz, acetone-dg) δ -82.71; IR (KBr pellets) 1696, 1428, 1190, 1176 cm ^-1 ; MS (CI) m / e calcd for ΟΟΗΗΗΡΡΡ ^ 313: 313.116388, found 313.115871;

313 (MH ⁺ , 100), 330 (M + NH4 ⁺ , 15); Analysis calculated for ^C 15 ^H 15 ^F 3 ^N 2 ° 2 ^{: C} ' ⁵⁷ ' ⁶⁹ '· ^H ' ⁴ ' ⁸⁴ ' · ^N 'θ' ⁹⁷ ' ^- found C, 57.74;

H, 5.01; N, 8.57.

Example 8

PREPARATION C (H) - N-Methoxy-4-C 2 -pyridinyl-4-trifluoromethyl-3,4-dihydropyridin-2-yl (D-C 1 -dimethyl) (R ¹ - 2-pyridyl)

Solution VIII-C10U mg. 0.410 mmol) was treated with lithium acetylidoin derived from 2-ethynylpyridine CO. 19 g. 1, HFI inmnl.) According to the procedure of Step 3 of Example 1. The resulting crude material was purified by flash chromatograFdou C2,5% do not move / CH _s CLAT) to give BTI mg C39 PI) of the desired product: NMR (300 MHz, acetone-d) δ 8.81 (br s, 1H), 8.61 (d, J = 4.8 Hz, 1H), 7.88-7.82 (m, 1H), 7.66 (d, J) 7.7 Hz, 1H), 7.61 (br s, 1H), 7.46-7.42 (m, 1H), 7.23 (br s, 1H), 7.06- 6.97 (m, 2H),

3.79 (s, 3H); ¹⁹ F NMR (282 MHz, acetone-dg) δ -82.13; IR (KBr pellets) 1698, 1518, 1464, 1430, 1244, 1208, 1184 cm ^-1 ;

MS (CI) m / e calcd for C ₁₇ H ₁₃ F ₃ N ₃ O ₂ : 348.095987, found 348.095629; 348 (MH &lt; ^{+ &gt};,100); calcd for ^C 17 ^H 12 ^F 3 ^N 3 ° 2 · ^{0 '25 C} 3 ^H 6 ° ^{: C} ' ^{58 '92} * ^H '3.76; N, 11.61;

found: C, 59.38; H, 4.04; N, 11.35.

Example A

Preparation of (-) - 6-methoxy-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2H (quinazolinone ( ¹ -phenyl))

Solution VII-a < 100 mg. 0.410 mmol) was treated with phenylacetylene-derived lithium acetylide (0.19 g, 1.8h mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by flash chromatography (<2.5% 1 * lOH / CH ₉ Cl ₂ ) to give 34 mg (<24%) of the desired product: mp 206.2-

207.7 ° C; ¹ H NMR (300 MHz, acetone-dg) δ 8.85 (br s, 1H), 7.60-7.57 (m, 3H), 7.49-7.39 (m, 3H) 7.21 (br s, 1H), 7.05-6.96 (m, 2H), 3.79 (s, 3H); ¹⁹ F NMR (282 MHz, acet <5n-dg) δ -82.32, - IR (KBr pellets) 1696, 1516, 1430, 1236,

1204, 1184, 1128 cm -1; MS (CI) m / e calcd for ^C 18 ^H 14 ^F 3 ^N 2 ^O 2 ^: 347.100738, found 347.101482; 347 (MH &lt; ^{+ &gt};,

100), 364 (M + NH4 ⁺ , 48); Analysis calculated for Ο ^ βΗ ^ βΡβΝ2θ2:

C, 62.43; H, 3.78; N, 8.10; found: C, 62.35; H, 3.58; N,

7.83.

Example 10

Preparation of (4R -) - 4-1: Lycyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2 (1H) -quinazolinone (R ' ¹ = cyclinopropyl) ylpropyl)

XXZ-a

XXII-a

Step J. Preparation of X-a from T.X-a

A solution of TX-α (6. 46 g (28.7 mmol)) was treated with dimethylaminopyridine in trimethylsilyl isocyanate as described in Step 1 of Example 1 to give 6-74 g C 88 X) of the desired product with ¹ H NMR (300 mg). MHz, acetone-dg) Ô 9.13 (br s,

H), 7.45-7.32 (m, 2H), 7.18 (br s, 1H), 6.85-6.80 (m, 1H); ¹⁹ F NMR (282 MHz, acetone-dg) δ -86.6 (d, 17.2, 3), -137.52-137.68 (m, 1), -148.47-148.59 (m , 1).

Step 2. Preparation of X1-a from X-a

A solution of X-a (8, 74 g, 25.1 mm) was heated to reflux in xylenes. as described in step 2 of Example 1 by replacing toluene with xylenes to give 6.3 g (1J) of the desired product with 1-1 1-1

NMR (300 MHz, acetone-dg) δ 7.92-7.83 (m, 1H), 7.46-7.44 (m,

H); ¹⁹ F NMR (282 MHz, acetone-dg) δ -70.7 (d, 38.7, 3),

-136.72 (s, 1), -146.47-146.57 (m, 1).

Step 3. Preparation of XJ1-a from X1-a

A solution of XT-a (6, 28 g, 25.1 mmol) was treated with 11% cyclohexylacetylene C 24, 9 ml 30% (w / w). solution in toluene / 1 HP / hexanes. U, 113 mol) according to the procedure of Step 3 of Example 1. The resulting crude yellow oil was dissolved in acetone and concentrated under reduced pressure to give a yellow solid. Crystallization from acetone gave 5.98 g (75%) of the desired material: mp 86.5-88.5

NMR (300 MHz, acetone-dg) δ 9.01 (br s, 1H), 7.46 (br s, 1H), 7.44-7.35 (m, 1H), 6.86- 6.81 (m, 1H), 1.41-1.37 (m, 1H), 0.90-0.83 (m, 1H), 0.74-0.69 (m, 1H) ); ¹⁹ F NMR (282 MHz, acetone-dg) δ -83.3 (d, J = 12.9, 1), -136.04-136.23 (m, 1), -148.14-148.26 (m, 1); IR (KBR pellets) 1706, 1516,

1442, 1246, 1214, 1196 cm @ -1; MS (CI) m / e calcd for ^C 14 ^H 10 ^F 5 ^N 2 ^O 317.071329, found: 317.070366; 317 (MH &lt; ^{+ &gt};, 100),

334 (M + NH ₄ ^+, 62); Analysis calculated for C ₁₄ H ₉ F ₅ N ₂ O: C, 53.17;

., 2.88; N, 8.87; found: C, 53.30; H, 3.16; N, 8.53.

Example 11

Preparation C +/-) -5, G-Difluoro-4-isopropyl-ethynyl-4-trifluoromethyl-3. 4-dihydro-2 (1H) -quinazolinone (R * = isopropyl)

Solution Xa C 7.24 g. 28.9 (ininol) was treated with 3-methyl-1-butyne-derived thioacetylld (0.87 g, 13.3 ml, 0.130 mol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by flash chromatography <2, m.p. (MeOH / CH 2 Cl 2) to give a yellow oil. Crystallization from acetone to give 77.7 g (74%) of the desired product: mp 79 DEG -80 DEG C .; ^T H NMR (300 MHz, acetone-d) δ 9.02 (br s, 1

H), 7.50 (br s, 1H), 7.44-7.35 (m, 1H), 6.87-6.82 (m, 1H), 2.69-2.65 (m) m, 1H), 1.17 (d, J = 7.0 Hz, 6H); ¹⁹ F NMR (282 MHz, acetone-dg) δ -83.4 (d, J = 12.9, 1), -135.79-135.94 (m,

I), -148.14-148.26 (m, 1); MS (CI) m / e calcd for ^C 14 ^H 12 ^F 5 ^N 2 ^{O: 319} »086979, found 319.087376; 319 (MH &lt; ^{+ &gt};, 100),

336 (M + NH4 _& ^lt ; ^{+ &gt};, 76).

Ex .12

Preparation of (1H) -5,6-difluoro-4- (2-pyridyl) ethyl-4-trifluoromethyl-3,4-dihydro-2 (1H) -quinazolinone (1 '= 2-pyridyl)

A solution of X1-a (100 mg, 0.400 mmol) was treated with lithium acetylide from 2-ethynylpyridine (0.19 g, 1.0 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by flash chromatography <4 < 4 &gt; (CH _and Clsa) to give 83 mg (59%) of the desired product: m.p.

220 ° C ¹ H NMR (300 MHz, acetone-dg) δ 9.15 (br s, 1H),

8.61 (d, J = 4.4 Hz, 1H), 7.88-7.82 (m, 2H), 7.63 (dd, J =

7.0, 1.1 Hz, 1H), 7.47-7.42 (m, 2H), 6.94-6.88 (m, 1H); ¹⁹ F NMR (282 MHz, acetone-dg) δ -82.8 (d, J = 12.9, 3),

-135.78-135.93 (m, 1), -147.86-147.98 (m, 1); IR (KBr pellets)

1712, 1470, 1450, 1430, 1416, 1264, 1238, 1226, 1198, 1186 cm &lt; ^{-1 &gt};; MS (CI) m / e calcd for C 18 H 18 F 6 N 3 O: 354.0666578, found 354.0667821; 354 (MH &lt; ^{+ &gt};, 100).

Example 13

Preparation of <+/-) - 5,6-difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2 (1H) -diazolirione (R * = 2-ethyl)

Solution X1-a <100 mg. 0.400 min) was treated with 1-methacrylate lithium acetylide (97 mg, 1.80 inmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPI.C <2.5% 1 * leOH / CH ₉ Uls ») and 69 mg (57%) of the desired product is obtained; mp 191-194 ° C; ¹ H NMR (300 MHz, CDCl 3)?

MHz, acetone-d 8) 9.03 (br s, 1H), 7.50 (br s, 1H),

7.45-7.35 (m, 1H), 6.87-6.82 (m, 1H), 2.34-2.27 (m, 2H), 1.20-1.15 (m, 1H) m, 3H); ¹⁹ F NMR (282 MHz, acetone-dg) δ -83.3 (d,

J = 12.9, 3), -135.79-135.98 (m, 1), -148.16-148.29 (m, 1);

IR (KBr pellets) 1704, 1686, 1518, 1444, 1244, 1210, 1192,

1172 cm -1 · · · ·; MS (CI) m / e calcd for C 17 H 18 F 6 O 3: 305.071329, found 305.071146; 305 (MH &lt; ^{+ &gt};,100); Analysis for C ₁₃ H ₉ F ₅ N ₂ O:

C, 51.33; H, 2.98; N, 9.22; found: C, 51.00; H, 2.79; N,

8.99.

Example 34

Preparation of (+/-) - 5,6-difluoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2H (quinazoline) (R ** = phenyl)

A solution of X1-a (100 mg, 0.400 mmol) was treated with phenylacetylene-derived lithium acetylide (18 g, 0.20 mL, 1.80 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2, 5% 1 * leOH / CH _and Cl _a ) to give 92 mg (65%) of the desired product: 1 H NMR (300 MHz, acetone-dg) δ 9.14 (br s, 1H), 7.80 ( br s, 1H), 7.57-7.54 (m, 2H), 7.49-7.40 (m, 4H), 6.92-6.87 (m, 1H); ¹⁹ F NMR (282

3Η

MHz, acetone-d 6 -83.0 (d, J = 12.9, 3), -136.08-136.27 (m, 1), -147.87-148.00 (m, 1) ; MS (CI) m / e calcd for ^C 17 ^H 10 ^F 5 ^N 2 ^O: 353.071329, found 353.071716; 353 (MH ⁺ , 42), 370 (M + NH ₄ ⁺ , 100).

Example 15

Preparation C (+/-) - 5,6-Difluoro-4-isopentyl-4-trifluoromethyl-3,4-dihydro-2H (quinazolinium (R (= isopropyl))

Preparation of XJII-a from XJII-a

A solution of XIIT-a CR ( ¹ = isopropyl) (25 mg, 82 mmol) in ethanol (1 mL) was treated with 10 mL of Pd and treated with 10% Pd on carbon (35 mg) below H-. Cl atm.) For 15 hours. The catalyst was removed by vacuum filtration through celite and the filter cake was washed with L-tUAc. The combined filtrates were concentrated under reduced pressure to give 26 µg (11%) of the desired material. Rfalňie No purification was necessary ^X * H NMR (300 MHz, acetone-d) δ 8.88 (br s, 1H), 7.41-7.31 (m, 1H), 6.89 to 6, 81 (m, 2H), 2.55-2.50 (m, 1H), 1.64-1.45 (m, 2H), 1.06-1.02 (m, 1H), 0.89 (dd, J = 6.6, 2.2 Hz, 6H); ¹⁹ F NMR (282 MHz, acetone-dg) δ -83.22 (d, J = 12.1, 3), -138.97-139.13 (m, 1), -148.46-148.58 (m,

1); IR (KBr pellets) 1700, 1678, 1518, 1438, 1252, 1188, 1172 cm ^-1 ; MS (CI) m / e calcd for C 19 H 18 F 6 O 2: 323.118280, found: 323.117070; 323 (MH ^+, 100), 340 (M + NH ₄ ^+, 57).

Example 16

Preparation C +/-) -4-Butyl-5,6-difluoro-4-trifluoromethyl-3,4-

-dihydro-2 (1H) -quinazolinium (R * ethyl)

A solution of ΧΙΙΙ-a CR ⁴ = -ethyl) (20 mmol (66 mmol) in ethanol (1 mL) and EtOAc (5 mL) was treated with 10% Pd on carbon under H ₂ according to the procedure described in Example 15. HPLC purification C2.5 % MeOH / CH 2 Cl 2), 12 mg (56%) of the desired product is obtained: ¹ H NH 1 IR

Δ (300 MHz, acetone-dg) δ 8.89 (br s, 1H), 7.41-7.32 (m, 1H), 6.86-6.81 (m, 2H), 2 57-2.47 (m, 1H), 1.56-1.15 (m, 5H), 0.88 (t, J = 7.3 Hz, 3H); ¹⁹ F NMR (282 MHz, acetone-dg) δ -83.19-83.24 (m, 1), -139.14 (s, 1), -148.49-148.62 (m, 1); MS (CI) m / e calcd P ^{re c} i3 i4 ^{H F} 5 ^N 2 ^O: 309.102629, found 309.103555; 309 (MH ^+, 100), 326 (M + NH ₄ ^+, 62).

Example 17

Preparation C (+/-) - 4-cyclopropylethynyl-6-fluoro-4-trifluoromethyl-3,4-dihydro-2 (1H) -quinazolinone (R * = cyclopropyl)

XIV and XVI and XVI

Step 1. Preparation of XV-a from XIV-a

XCTI-α solution with diethylaminopyrldine

(3.0 g (14.8 mmol)) and trimethylsilyl isocyanate.

working up as described in Step J of Example 1 to give 2.01 g (76%) of the desired product.

Step 2. Preparation of XVJ-a from XV-n

A solution of XV-a (6.74 g, 25.1 min) was heated to reflux in toluene as described in Step 2 of Example 1 to give U, 73 g (94%) of the desired product.

Step 3. Preparation of XVI-a from XVT-a

A solution of XVI-a (1.00 mg, 0.431 mmol) was treated with: cyclopropyl acetylene lithium (1.43 mL of a 3% solution in toluene / NH 3 / hexanes J, 94 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material is purified by HPI. L (2% and b * letlH / D _and C _{and a.)} To give 44 mg (34%) of product with melting point LBN C; NMR (300 MHz, acetone-dg) δ 8.86 (br s, 1H), 7.36 (br s, 1H), 7.30-7.27 (m, 1H), 7.22- 7.15 (m, 1H), 7.04-6.99 (m, 1H), 1.47-1.42 (m, 1H), 0.90-0.87 (m, 2H) 18.76-0.75 (m, 2H), ¹⁹ F NMR (282 MHz, acetone-dg) δ -82.86, -123.36-123.44; MS (CI) m / e calcd for C 18 H 17 F 3 O 2 ^: 299.080751, found: 299.079976;

299 (MH &lt; ^{+ &gt};, 100).

Example 10

Preparation of (+/-) - 6-Fluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2 (1H) -quinazolinone (R * = isopropyl)

A solution of XVI-a (100 mg, 0.431 mmol) was treated with 3-methyl-1-butyne-derived lithium acetylide (0.13 g, 0.20 mL, 1.94 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material , purified by HPLC (2.5 # MeOH / CHaCl 3) to give 24 mg (10X) of the desired product; mp 158 ° C:

¹ H NMR (300 MHz, acetone-dg) δ 9.07 (br s, 1H), 7.60 (br s, 1H), 7.32-7.30 (m, 1H), 7, 24-7.16 (m, 1H), 7.05-6.99 (m, 1H), 2.77-2.67 (m, 1H), 1.20 (dd, J = 7, (2.6 Hz, 6 H); ¹⁹ F NMR (282 MHz, acetone-dg) δ -82.95, -123.41-123.49; MS (301) m / e calcd for C ₁₄ H ₁₃ F ₄ N ₂ O: 301.096401, found 301.096235; 301 (MH &lt; ^{+ &gt};, 100).

Example 19

Preparation of C (+/-) - 6-fluoro-4-C2-pyridyl) ethynyl-4-trifluoromethyl-3,4-dihydro-2 (1H) -quinazolinone CR * = 2-pyridyl)

A solution of XVI-a (100 mg mg, 0.431 mg) was treated with 111 [mu] -urihicetylld derived from 2-ethynyl pyridine (20 g, 1.94 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC C2.5% 1 * 1L (1H (CH _and Cl _a )) to give 65 mg (45%) of the desired product: mp 155 ° C; ¹ H NMR (300

MHz, acetone-dg) δ 9.02 (br s, 1H), 8.60 (d, J = 4.0 Hz, 1H), 7.87-7.78 (m, 2H), 7 66 (d, J = 7.7 Hz, 1H), 7.45-7.41 (m, 2H), 7.26-7.20 (m, 1H), 7.09-7, 05 (m, 1H); ¹⁹ F NMR (282 MHz, acetone-d6) δ -82.36, -122.94-123.02; MS (CI) m / e calcd for C ₁₆ H ₁₀ F ₄ N ₃ O: 336.076000, found 336.074156;

336 (MH &lt; ^{+ &gt};, 25).

Example 20

Preparation of C +/- 1-6-Fluoro-4-ethylethynyl-4-trifluoromethyl-3. 4-dihydro-2 (1H) -quinazolinone (R * = ethyl)

A solution of XV.Ia (100 mg, 0.431 mmol) was treated with 1-butyne CO-derived lithium acetylld. 10 g, 1.94 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC <2.5% 1 * 1OH / CH ₂ Cl _a ) to give 40 C C 33 X) of the desired product: mp 190 ° C ; NMR (300 MHz, acetone-dg) δ 8.86 (br s, 1H), 7.38 (br s, 1H), 7.34-7.31 (m,

H), 7.22-7.16 (m, 1H), 7.05-7.00 (m, 1H), 2.04-2.01 (m, 2H), 1.19-1 14 (m, 3H); ¹⁹ F NMR (282 MHz, acetone-dg) δ

-75,392, -123,42-123,50; MS (CI) m / e calcd for ^C 13 ^H 11 ^F 4 ^N 2 ^O: 287.080751, found 287.080740; 287 (MH &lt; ^{+ &gt};, 100).

Ex.l.ad 21

Preparation of (1H) -8-fluoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2 (1H) -quinazolinone (R * = phenyl)

Solution XV1-a C100 mg, 0.431. mmol) and treated with phenylacetylene-derived lithium acetylide (0.20 g, 0.21 mL, 3.94 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC <2.5% MeOH / CH _and Cl _a > a 41 mg (28%) of the desired product is obtained: mp 1.07 ° C; IR (300 MHz, acetone-dg) δ 9.00 (br s, 1H), 7.69 (br s, 1H), 7.63-7.59 (m, 2H), 7.50-7.40 (m, 4H), 7.27-7.20 (m, 1H), 7.10-7.05 (m, 1H); ¹⁹ F NMR (282 MHz, acetone-dg) δ -82.56, -122.99-123.07; MS (Cl) m / e calcd for C ₁₇ H ₂₂ F ₄ N ₂ O:

335.080751, found 335.082057; 335 (MH ⁺ , 74), 352 (M + NH ₄ ⁺ ,

100).

Example 22

Preparation of (R) -6-fluoro-4-isopentyl-4-trifluoromethyl-3,4-dihydro-2 (1H) -quinazolinone <R ^{Z |} - isopropyl)

Preparation of XVIII from XVIII

A solution of XVII-a (R ' ^k == isopropyl) (2 mg (87 mmol) in ethanol (J mL) and EtOAc (0.5 mL) was treated with 10% Pd on carbon under H _ffl according to the procedure of Example 1.5 to give with 15 mg (58%) of the desired product. No further purification is necessary: mp 178 ° C; 1 H-NMR (300 MHz, acetone-dg) δ 7.02-6.97 (m, 2H),

6.80-6.76 (m, 1H), 2.18-2.09 (m, 2H), 1.92-1.82 (m, 2H), 1.52-1.45 (m, 2H) m, 1H), 0.88-0.79 (m, 6H); ¹⁹ F NMR (282 MHz, acetone-dg) δ -82.60, -123.72-123.84; MS (Cl) m / e calcd for C ₁₄ H ₁₇ F ₄ N ₂ O; 305.127707, found 305.126790; 305 (MH &lt; ^{+ &gt};,

100).

Example 23

Preparation of <+/-> - 6-fluoro (4- (2'-2-pyridyl) ethyl-4-trifluoromethyl-3,4-dihydro-2H-quinazolone-one CR ' ¹ = 2 pyrid ± Dyl>

A solution of XVII-a CR (= 2-pyridyl) (33 mg, 99 mmol) in ethanol (1 ml) and EtOAc (0.5 ml) was treated with 10% Pd on carbon below H _and following the procedure of Example 15 and 10 mg (30%) of the desired product is obtained. No further purification is necessary MP ^{00, J} L; NMR (300 MHz, acetone-dg) δ 8.35 (d, J = 4.4 Hz, 1H),

7.63 (dt, J = 7.7, 1.5 Hz, 1H), 7.20-7.13 (m, 3H),

7.04-6.98 (m, 1H), 6.83-6.79 (m, 1H), 2.84-2.78 (m, 1H), 2.68-2.48 (m, 1H) m, 2H), 2.27-2.06 (m, 1H); ¹⁹ F NMR (282 MHz, acetone-dg) δ -82.58, -123.26-123.34; MS (CI) m / e calcd for C ₁₈ H ₁₄ F ₄ N ₃ O: 340.107300, found 340.107719; 340 (MH ⁺ )

100).

Example 24

Preparation <+/-) -4-butyl. -H-1-fluoro-4-fluoro-1-methylmethyl-3,4-dihydrofluoride <11D-ehinazolinone <R ^{1 |} - ethyl)

A solution of XVII-a (R ( ¹ -ethyl) (24 mg, 84 mmol) in ethanol (1 ml) and LiCl (0.5 ml) was treated with 10% Pd on carbon below H ₂ according to the procedure of Example 15 to give with 24 mg <100%) of the desired product. No perfection Cleaning of the river is essential: mp 198 ° C; ^X H NMR (300 MHz, acetone-d) δ 7.03-6.97 (m, 2H);

6.80-6.76 (m, 1H), 2.18-2.11 (m, 1H), 1.90-1.81 (m, 1H), 1.30-1.19 ( m, 3H), 0.97-0.80 (m, 4H); ¹⁹ F NMR (282 MHz, acetone-dg) δ -82.692, -123.78-123.86; MS (CI) m / e calcd for C ₁₃ H ₁₅ F ₄ N ₂ O: 291.112051, found 291.1112227; 291 (MH &lt; ^{+ &gt};

100).

Example 25

4b

Preparation of <+ / -) - B-Fluoro-4-phenylethyl-4-trifluoromethyl-3,4-dihydro-β (1H) -quinazolone <R * = (enyl)

A solution of XVTI-a CR (= phenyl) (30 mg, 90 mmol) in ethanol ¢ 1. ml) and EtCl 3 (0.5 ml) were treated with 10% Pd on carbon below H _and following the procedure of Example 15 to give 20 mg (67%) of the desired product. No further purification is necessary: mp 90 ° C ^Χ Η NMR (300 MHz, acetone-dg) δ 7.18-6.99 (m, 7 H),

6.84-6.79 (m, 1H), 2.68-2.60 (m, 1H), 2.48-2.12 (m, 3H);

¹⁹ F NMR (282 MHz, acetone-dg) δ -82.67, -123.24-123.32; MS (CI) m / e calcd for C 19 H 18 F 6 F 3 O 3: 339.112051, found 339.1110781; 339 (MH &lt; ^{+ &gt};, 100).

Example 26

Preparation of N - (-) - 6-fluoro-4-methylpropargyl-4-trifluoromethyl-3,4-diliydro-2 (H) -quinazolidione (R, 4-methyl)

Preparation of XJX-a from XV 1.-a

A solution of 2-butyne (94 mg, J, 75 mmol) in dry THF (<3.5 mL) was cooled to 0 ° C, treated with n-HuL1 <0.97 mL of a 1.6 µL solution in hexane. 1.55 mmol) and aged for 0.1 h. To a solution of XVT-α (90 mg, 0.3 µM mol) in anhydrous THF (1.9 mL) at -78 ° C was added a lithium anion for 15 minutes followed by boron trifluoride etherate <25 mL, 0.194 mmol). The cooling bath is removed and the grains ·. Allow to warm to room temperature. At 16 hours at room temperature, it is cooled by the addition of 3. 1 * 1 citric acid (<10 ml), diluted with EtAOc (50 ml), the phases are separated, the organic phase is washed successively with saturated aqueous NaHCO ₃ (20 ml). saturated aqueous NaCl <20 mL). The resulting material was purified by HPLC <2.5% 1 * 1OH / CH _and Cl _a ) to give 10 mg <9%) of the desired product: mp 181 ° C; * NMR (300 MHz, acetone-dg) δ 8.91 (br s, 1H), 7.27 (d, 8.4 H), 7.18-7.08 (m,

H), 7.02-6.97 (m, 2H), 3.29 (dd, J = 16.8, 2.6 Hz, 1H),

3.00 (dd, J = 16.8, 2.2 Hz, 1H), 1.61-1.59 (m, 3H); ¹⁹ F NMR (282 MHz, acetone-dg) δ -81.86, -123.69-123.70; MS (CI) m / e calcd for C 14 H 14 F 3 O 4: 287.080751, found: 287.080340; 287 (MH ⁺ , 75), 304 (M + NH ₄ ⁺ , 100).

Scheme 4

Chiral distribution

6-C16-MeO 5,6-diF6-F

compound

IV-A

VIII-a

H-and

XVII-a

6-C1

6-MeO

2,6-difluoro

6-F

Compound IV-b 6-Cl

VIII-b 6-MeO

ΧΙΙ-b 5,6-diF

XVII-b 6-F

compound

IV-c VIII-C XII-C XVII-C

Examples 27 and 20

Preparation of <-) -6-chloro-4-cyclupropylethynyl-4-trifluoromethyl-3,4-dihydro-2 (1H) -quinazolinone (Example 27) n + + - 6-chloro-4-cyclopropylpropylthiyl-4 - Fluoromethyl-3,4-dihydro-2 (1H) -quinazolinone (Example 28)

Distribution of IV-b, c from IV-a (R ^- ** = cyclopropyl)

Chiral HPLC using 1'D column, 3% isopropanol, 5% CH _and Cl _ffl and 92% hexanes at ambient temperature, with a flow rate of 1.0 ml / min and detection at 250 nm provides a separation of IV-b from IV-c with an enantiomeric excess of 99% resp. 99.4%. IV-bs mp 106-109 ° C; [d _D ²³ -60.34 · = * (c = 0.274, MeOH). Mp 105-107 ^° C; Melting point: ³ + 58.33 * = (c = U, 208. MeUH).

Examples 29 and 30

Preparation of (+) - 4-cyclopropylethynyl ™ 5, B-difluoro-4-trifluoromethyl-3,4-dihydro-2 (1H) -quinazolinone (Example 29) and C 1-4 -cyclopropyl-ethyl-5. G-difluoro-4-trifluórmetyl.-third 4-dihydro-2 (1H) -quinazolinone (Example 30)

Division XII-b. c from ΧΙΙ-a (R (cyclopropyl)).

HPLC using a Clilralpak AD column, 5% water, and 9% methanol at ambient temperature. with a flow rate of Π, in ml / min and detection at 25U nm, it provides a distribution of XIX-b from XT1-c with an enarithic specific excess of 1QU% and 1% respectively. 99 ° XL-1 'mp 187 ° C _S nod + 1. 45 ° (? 0.274, MeOH). XII-C: mp 187.5-1UU. H ° C; ítťln ^{1 5} -1,4b * · (c-41. 278, MellH).

Examples 3J. and 32

Preparation of (-) - 5, R-Difluoro-4'-cyclopylethynyl · 4-trifluoromethyl-3,4'-dibaso-2C (1H) -quinazoline (Example 31) (-O) -5,6-Difluoro-4-t-propylethynyl-4-trifluoromethyl-3,4-dihydro-2 (1H) -chenzazoline (Example 32)

Distribution of Χΐΐ-b, c from X11-a (R * - isopropyl).

A chiral HPLC using a Clilralpak AD column, 5% water and 95 Z methanol at ambient temperature, with a flow rate of 0.5 ml / m 2 and detection at 250 nm provides a split e XII-b from XII-c with an enantiomeric excess of 100 Z and 100 Z, respectively. 99 Issue XII-b: mp 155 ° C C ^and _D of -2, 14 ° (c == 0, 280. MeOH).

Mp 98 ° C; CTRL ^{and _D? S} + 4, 45 (c-0, 292, MeOH).

Examples 33 and 34

Preparation of ¢ - - - 5,6-difluoro-4-ethyl-ethyl-4-trifluoromethyl-3. 4-dihydro-2 (1H) -quinazolinone (Example 33) and C + 5,6-difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2H-quinazolinone (Example 34)

Distribution of ΧΙΙ-b, c from ΧΙΙ-a (R '´ = ethy]).

Chiral HPLC using an AS column. 20 # of ethanol and 80 # of hexanes at 1 ambient temperature with a flow rate of 1.0 ml / min and detection at 250 nm provides a distribution of ΧΙΙ-b from XIT-n with an enantiomeric excess of 100 # resp. 99%. Mp 165-167 ° C; XTT-en mp 157-159 ° C.

Examples 35 and 36

Preparation of H, 6-Difluoro-4- (2-1-hydroxyethyl) ethinyl-4-trifluoromethyl-3,4-dihydro-2 (J1) -quinazone (Example 35) 5 , 6-difluoropyridin-fluoro-4- (1-hydroxy-diyl oxyetyDntj r 4 tr: ^if:] uórmotyl-3, 4 - dihydro-2 (1H) -ohi nazollnúnu (example 36)

Pr. 36 CH (OTBS) CH ₃

Pr. 35 CH ₂ CH ₂ OH

Pr. 36 CH (0H) CH ₃

To the slurry of C30D mg, JL. 711 mmuJ) in bexvine THF ⁷ (11 ml) at -79 ° C was added successively uncooled (° C) solution of silyl-protected lithium acetylide (5, 411 ml) and BF (V / O (60 mmol)). The resulting mixture was stirred at room temperature overnight. The reaction mixture was cooled by addition of 1 L * 1 citric acid and diluted with FtOAc. The phases are separated, the organic phase is washed with water, saturated NaHCO 3 and saturated aqueous NaCl. The organic extracts were dried over 1 * 5gCl, filtered and concentrated. The material was purified by by chromatography C 41, 4 mm column Rainin Dynamax ^{R <employing} silica, 25 inl / min) of 2, 5% MeQH / ĽHaCl _and for 24 min, increasing to 30% ľleľJI 1 / H _{and C, and} for 4 min, 30% ľlRllH / CHeClsä for 10 minutes and recovered 2.5% l * lel'JH / I CI _U C1 ₂ for 2 minutes. The yield of protected intermediates was 47% and 32%, respectively.

Example 35-between product. Mp 62.9-64 ° C: 1 H NMR (300 MHz, acetone-dg) δ 8.98 (br s, 1H), 7.41-7.32 (m, 2H), 6.83-6 78 (m, 1H), 3.74 (t, J = 6.6 Hz, 2H), 2.47 (t, J = 6.6 Hz, 2H), 0.81 (s, 9 H), 0.00 (s, 6H); ¹⁹ F NMR (282 MHz, acetone-δ) δ -83.17, -135.16--135.31, -148.09--148.22, - MS (Cl) calcd for C ¹⁹ H ²⁴ F 5 N 2 O 2 Si: m / z 435 152723, found * 435.151149; 435 (MH ⁺ , 94), 452 (M ⁺ NH 4 ⁺ , 100); Analysis calculated for C18H22 ^: C, 52.52; H, 5.35; N, 6.46;

found: C, 52.65; H, 5.29; N, 6.31.

Example 36-intermediate. 1 H NMR (300 MHz, acetone-dg) δ 8.96 (br s, 1H), 7.50 (br s, 1H), 7.37-7.28 (m, 1H), 6, 79-6.74 (m, 1H), 4.61 (q, J = 13.2, 6.6 Hz, 1H), 1.30 (d, J = 6.6 Hz, 3 H), 0.78 (s, 9H), 0.01 (s, 6H); ¹⁹ F NMR (282 MHz, acetone-dg) δ -82.88--82.95, -135.20--135.42, -148.06--148.23, MS (Cl) calcd for C ¹⁹ H ²⁴ F 5 N 2 O 2 Si: m / z 435.152723, found 435.152927; 435 (MH ⁺ , 51), 452 (M + NH 4 ⁺ , 100);

Analysis calculated for C ₁₉ H ₃ F ₅ N ₂ O ₂ Si: C, 52.52; H, 5.35; N, 6.46; found: C, 52.54; H, 5.34; N, 6.69.

To a solution of the protected intermediate of Example 35 CO. 56 mmol) in THF <1.1 mL) is added TBAF CO. 62 mL of a 1.0 * 1 solution in THF). The resulting mixture was stirred at room temperature for 1 hour, diluted

511 oa EtUAc. J. washed with N IICL, saturated aqueous NaHCO (l ₃ and saturated aqueous NaCl. The organic extracts were dried over ľlgSO <, filtered and concentrated. The material was purified by. HPLC chromáLogr Aflou (41.4 mm Rainin Dynamax ™ column employing silica 25% MeOH / CHstCl _and 24 min, increase to 30% MeOH / CH _and Cl _and 4 min, 30% MeOH / CH _with Cl ₂ for 10 min and back 2.5% MeQH / CH 2 Cl 2 over 2 minutes The yield of Example 35 is isolated at 82%.

Example 35. mp 190-192 ^R, C; NMR (300 MHz, acetone-d6) δ 9.05 (br s, 1H), 7.53 (br s, 1H), 7.45-7.36 (m, 1H), 6.88- 6.83 (m, 1H), 4.01-3.98 (m, 1H), 3.68-3.64 (m, 2H), 2.50 (t, J = 6.6 Hz) 2 H); ¹⁹ F NMR (282 MHz, acetone-d6) δ -83.3, -135.68--135.88, -148.10--148.22, MS (Cl) calcd for C 12 H ¹⁰ F 5 N 2 O 2: m / z 321 , 066 244, found 321.066479 ^1; 321 (MH &lt; ^{+ &gt};,100); Anal. Calcd for &lt; 13 &gt; 9 &lt; 5 &gt; H, 2.83; N, 8.76; found: C, 49.05;

H, 3.23; N, 8.38.

Example 30 was prepared in an analogous manner to give the title compound in 8H% yield, mp 190-110 ° C; ¹ H NMR (300 MHz, axcetone-dg) δ 9.06 (br s, 1H), 7.56 (br s, 1H), 7.46-7.37 (m, 1H), 6, 88-6.83 (m,

H), 4.58-4.57 (m, 2H), 1.39 (d, J = 5.5 Hz, 3 H); ¹⁹ F NMR (282 MHz, acetone-dg) δ -83.15, -135.40, -135.60,

MS (CI) calcd for C 14 H 14 F 3 F 3 Cl 2: m / z 321.06662, found 321.065983; 321 (MH ⁺ , 58), 338 (M ⁺ NH 4 ⁺ , 100); Calcd for C ₁₃ H ₉ F ₅ N ₂ O ₂ : C, 48.76; H, 2.83;

N, 8.76; found _: C, 48.84; H, 2.76; N, 8.63.

Example 37

Preparation of (+) - 4-E-cyclopropyletenyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2 (1H) -quinazoline

To a solution of XH-ti (200 mg, 0.632 mmol) in anhydrous THF (1.3 mL) at room temperature was added lithium aluminum hydride (1.3 mL).

1.0 1 * 1 solution in THF). The resulting mixture was stirred at room temperature overnight. The reaction mixture was quenched by addition of 10 N NaH (3 mL) and water (3 mL). The mixture was diluted with IL-1Ac (30 mL) and the phases were separated. The organic phase was washed with saturated aqueous NaCl, dried over MgSO 4, filtered and concentrated. The title compound was purified by HPLC (41.4 mm Ral.nin Dynamax ® silica, 60 A): 2.5% MeOH / CH ₉ Cl _s for 24 min, increasing to 30 # MeOH / CHsaClsä for 4 min 30 # Me (> 1 / CH ₂ C1 for 10 minutes _with a back-# 2.5 * leOH l / D _and C _and for 2 minutes. mp 80-03 C;

^X H NMR (300 MHz, acetone-d) d 9.07 (br s, 1H), 7.33 (q, J = 8.8 Hz, 1H), 6.94 (br s, 1H) 6.84-6.79 (m, 1H), 6.27 (dd, J = 15.6, 7.5 Hz, 1 H), 5.67 (dd, J = 15.2, 9) 4 Hz, 1H), 1.65-1.56 (m, 1H), 0.80-0.71 (m, 2H), 0.50-0.42 (m, 2H); ¹⁹ F NMR (282 MHz, acetone-d 6) d -82.68, -135.05, -148.49; MS (CI) calcd for ^C 14 ^H 12 ^F 5 ^N 2 ^{O: m} / ^z 319.086979, found: 319.087755; MH ⁺ , 100); [Α] D ²⁰ + 72.77 ° (c = 0.382, MeOH); Calcd. for ^C 14 ^H 11 ^F 5 ^N 2 ^{O: C 52 52} → ⁸⁴ 3.48; N, 8.80; found: C, 53.02;

H, 3.48; N, 8.61.

Example 3H

Preparation of 6-chloro-6-chloro-E-cyclopropylethenyl-4-trifluoromethyl-3,4-dihydro-2 H -cyclinazolium ion

The title compound was prepared as described in Example 37 (starting from IV-b), with purification carried out at. using Chiralcel OD, at a flow rate of 1.5 inl / ml in U, 5% EtOH, 20% H ₃ .L 2/79, 5% hexanes. Mp 97 - 09 ° C; ¹ H NMR (300 MHz, acetidine-d 6) d 9.08 (br s, 1H), 7.40-7.25 (m, 2H), 7.04-6.90 (m, 2H) 6.28-6.18 (m, 1H), 5.64-5.52 (m, 1H), 1.68-1.55 (m, 1H), 0.83-0.71 (m, 2H). 0.53-0.41 (m, 2H); ¹⁹ F NMR (282 MHz, acetone-dg) d -81.67; MS (CI) calcd for C ₁₄ H ₁₃ ClF ₃ N ₂ O: m / z 317.066851, found 317.065857; 317 (MH &lt; ^{+ &gt};,100); [Α] D ²⁰ -6.81 ° (c = 0.382, MeOH); Calcd for C ₁₄ H ₁₂ ClF ₃ N ₂ 0.0.27 C ₃ H ₈ O: C, 53.52; H,

4.13; N, 8.43; found _: C, 53.90; H, 4.07; N, 8.80.

Ex. # R ³ R ¹ R 2 R ⁸ t i. (“C J Materials. spectra 1 6-Cl cf ₃ CEC cycPr H 86.6- 88 332 (M + NH ₄ *, 2 6-Cl CF ₃ CsC-Pr H 180 334 (M + NH ₄ *) 3 6-Cl cf ₃ CsC-2-pyridyl H 105 352 (MH *) 4 6-Cl cf ₃ CsC-Et H 217- 219 303 (MH +), 5 6-Cl cf ₃ CsC Ph H 104- 107 368 (M + NH ₄ +) 6 6-MeO cf ₃ C = C-cycPr H 208 311 (MH +) 7 6-MeO cf ₃ CsC-Pr H 228- 229 313 (MH *) 8 6-MeO cf ₃ CsC-2-pyridyl H 97-98 348 (MH +) 9 6-MeO cf ₃ C-C-Ph H 206.2- 207.7 347 (MH +), 10 5,6-difluoro cf ₃ C ^ C-cycPr H 101 dec. 317 (MH +) 11 5,6-difluoro cf ₃ CSSC-Pr H 79-80 319 (MH +), 12 5,6-difluoro cf ₃ CsC-2-pyridyl H 219- 220 354 (MH +), 13 5,6-difluoro cf ₃ CsC-Et H 191- 194 305 (MH +), 14 5,6-difluoro cf ₃ CEC-Ph H 215- 217 370 (M + NH4 + ₎ 15 5,6-difluoro cf ₃ CH ₂ CH ₂ CH (CH ₃ ) 2 H 192- 193 323 (MH +), 16 5,6-difluoro cf ₃ CH ₂ CH ₂ CH ₂ CH ₃ H 309 (MH +), 17 6-F cf ₃ CEC cycPr H 155 299 (MH +), 18 6-F cf ₃ CsC-Pr H 158 301 (MH +) 19 6-F cf ₃ Jul-2-pyridyl H 155 336 (MH +), 20 6-F cf ₃ CsC-Et H 190 287 (MH +), 21 6-F cf ₃ CEC Ph H 107 352 (M + NH ₄ *, 22 6-F cf ₃ CH ₂ CH ₂ CH (CH ₂ , ₂ H 179 305 (MH +)

23 6-F cf ₃ CH ₂ CH ₂ -2-Pyridyl H 88 340 (MH +) 24 6-F cf ₃ ch ₂ ch ₂ ch ₂ ch ₃ H 198 291 (MH) 25 6-F cf ₃ CH ₂ CH ₂ Ph H 98 339 (MH +) 26 6-F cf ₃ CH ₂ CSC-CH ₃ H 181 304 (M + NH 4) 27 (-) 6-C1 cf ₃ CsC-cycPr H 106- 109 313 (M) 28 (+) 6-C1 cf ₃ CEC cycPr H 105- 107 313 (M) 29 (+) 5,6-difluoro cf ₃ CsC-cycPr H 187 315 (M “) 30 (-) 5,6-difluoro cf ₃ CsC-cycPr H 188- 189 315 (M “) 3R-) 5,6-difluoro cf ₃ CsC-Pr H 155 317 (M ') 32 (+) 5,6-difluoro cf ₃ CsC-Pr H 98 317 (M ') 33 (-) 5,6-difluoro cf ₃ CsC-Et H 165- 167 303 (M) 34 (+) 5,6-AIF cf ₃ CsC-Et H 157- 159 303 (M) 35 5,6-difluoro cf ₃ CsCCH ₂ CH ₂ OH H 190- 192 321 (MH *) 36 5,6-difluoro cf ₃ Jul-CH (OH) Me H 190- 191 338 (M + NH 4) 37 (+) 5,6-difluoro cf ₃ C = C-cycPr (E) H 80-83 319 (MH +) 38 (-) 6-C1 cf ₃ C = C-cycPr (E) H 87-89 317 (MH +)

χ Unless otherwise stated, stereochemistry is (+/-)

1 6-Cl cf ₃ 2 6-Cl cf ₃ 3 6-Cl cf ₃ 4 6-Cl cf ₃ 5 6-Cl cf ₃ 6 6-Cl cf ₃ 7 6-Cl cf ₃ 8 6-Cl cf ₃ 9 6-Cl cf ₃ 10 6-Cl cf ₃ 11 6-Cl cf ₃ 12 6-Cl cf ₃ 13 6-Cl cf ₃ 14 6-Cl cf ₃ 15 6-Cl cf ₃ 16 6-Cl cf ₃ 17 6-Cl cf ₃ 18 6-Cl cf ₃ 19 6-Cl cf ₃ 20 6-Cl cf ₃ 21 6-Cl cf ₃ 22 6-Cl cf ₃ 23 6-Cl cf ₃ 24 6-Cl cf ₃ 25 6-Cl cf ₃ 26 6-Cl cf ₃ 27 6-Cl cf ₃ 28 6-Cl .. cf ₃

R ² r8

CsCCH ₂ CH ₂ OH H

CsC-CH (OH) MeH

C = C - (2-Cl) Ph H

CsC - (3-Cl) Ph H

CsC - (4-Cl) Ph H

CsC - (2-F) Ph H

CsC - (3-F) Ph H

CsC - (4-F) Ph H

CsC- (2-OH) Ph H

CsC- (3-0H) Ph 1 H

CsC - (4-OH) Ph H

CsC - (2-OMe) Ph H

CsC - (3-OMe) Ph H

CsC - (4-OMe) Ph H

CsC - (2-CN) Ph H

CsC - (3-CN) Ph H

CsC - (4-CN) Ph H

CsC - (2-NO ₂ ) Ph H

CsC- _(3-NO2) Ph H

CsC- (4-NO ₂ ) Ph H

CsC- (2-NH ₂ ) Ph H

CsC- (3-NH ₂ ) Ph H

CsC- (4-NH ₂ ) Ph H

CsC - (2-NMe ₂ ) Ph H

CsC - (3-NMe ₂ ) Ph H

CsC - (4-NMe ₂ ) Ph H

C 6 -C 3 -pyridyl H

CsC-4-Pyridyl H

29 6-Cl CF ₃ CsC-2-furanyl H 30 6-Cl cf ₃ C = C-3-furanyl H 31 6-Cl cf ₃ CsC-2-thienyl H 32 6-Cl cf ₃ CsC-3-thienyl H 33. 6-Cl cf ₃ Jul-2-oxazolyl H 34 6-Cl cf ₃ CsC-2-thiazolyl H 35 6-Cl cf ₃ C 6 -C 4 -thiazolyl H 36 6-Cl cf ₃ C 6 -C 2 isoxazolyl H 37 6-Cl cf ₃ C = CCH ₂ CH ₂ OH H 38 6-Cl cf ₃ C = C-CH (OH) Me H 39 6-Cl cf ₃ C = C- (2-Cl) Ph H 40 6-Cl cf ₃ C = C- (3-Cl) Ph H 41 6-Cl cf ₃ C = C- (4-Cl) Ph H ' 42 6-Cl cf ₃ C = C- (2-F) Ph H 43 6-Cl cf ₃ C. C- (3-F) Ph H 44 6-Cl cf ₃ C = C- (4-F) Ph H 45 6-Cl cf ₃ C = C- (2-OH) Ph H 46 6-Cl cf ₃ C = C- (3-OH) Ph H 47 6-Cl cf ₃ C = C- (4-OH) Ph H 48 6-Cl cf ₃ C = C- (2-OMe) Ph H 49 6-Cl cf ₃ C = C- (3-OMe) Ph H 50 6-Cl cf ₃ C = C- (4-OMe) Ph H 51 6-Cl cf ₃ C = C- (2-CN) Ph H 52 6-Cl cf ₃ C = C- (3-CN) Ph H 53 6-Cl cf ₃ C = C- (4-CN, Ph H 54 6-Cl cf ₃ C = C- (2-NO ₂ ) Ph H 55 6-Cl cf ₃ C = C- (3-NO ₂ ) Ph H 56 6-Cl cf ₃ C = C- (4-NO ₂ ) Ph H 57 6-Cl cf ₃ C = C- (2-NH2 ₎ , Ph H 58 6-Cl cf ₃ C = C- (3-NH ₂ ) Ph H 59 6-Cl cf ₃ C = C- (4-NH ₂ ) Ph H 60 6-Cl cf ₃ C = C- (2-NMe ₂ ) Ph H 61 6-Cl cf ₃ C = C- (3-NMe ₂ ) Ph H 62 6-Cl cf ₃ C = C- (4-NMe ₂₎ , Ph H

63 6-C1 CF ₃ C = C-3-pyridyl 64 6-C1 cf ₃ C-C-4-Pyridyl 65 6-C1 cf ₃ C = C-2-furány1 66 6-C1 cf ₃ C = C-3-furanyl 67 6-C1 cf ₃ C = C-2-thienyl 68 6-C1 cf ₃ C = C-3-thienyl 69 6-C1 cf ₃ C = C-2-oxazolyl 70 6-C1 cf ₃ C = C-2-thiazolyl 71 6-C1 cf ₃ C = C-4-isoxazolyl 72 6-C1 cf ₃ C = C-2-imidazolyl 73 6-C1 cf ₃ CH ₂ CH ₂ -cycPr 74 6-C1 cf ₃ CH ₂ CH ₂ CH ₂ CH ₂ OH 75 6-C1 cf ₃ CH ₂ CH ₂ -CH (OH, Me 76 6-C1 cf ₃ CH ₂ CH ₂ -Ph 77 6-C1 cf ₃ CH ₂ CH ₂ - (2-Cl) Ph 78 6-C1 cf ₃ CH ₂ CH ₂ - (3-Cl, Ph 79 6-C1 cf ₃ CH ₂ CH ₂ - (4-Cl, Ph 80 6-C1 cf ₃ CH ₂ CH ₂ - (2-F) Ph 81 6-C1 cf ₃ CH ₂ CH ₂ - (3-F, Ph 82 6-C1 cf ₃ CH ₂ CH ₂ - (4-F) Ph 83 6-C1 cf ₃ CH ₂ CH ₂ - (2-OH, Ph 84 6-C1 CF ₃ CH ₂ CH ₂ - (3-OH, Ph 85 6-C1 cf ₃ CH ₂ CH ₂ - (4-OH, Ph 86 6-C1 cf ₃ CH ₂ CH ₂ - (2-OMe) Ph 87 6-C1 cf ₃ CH ₂ CH ₂ - (3-OMe, Ph 88 6-C1 cf ₃ CH ₂ CH ₂ - (4-OMe, Ph 89 6-C1 cf ₃ CH ₂ CH ₂ - (2-CN, Ph 90 6-C1 cf ₃ CH ₂ CH ₂ - (3-CN, Ph 91 6-C1 cf ₃ CH ₂ CH ₂ - (4-CN, Ph 92 6-C1 cf ₃ CH ₂ CH ₂ - (2-NO ₂ , Ph 93 6-C1 cf ₃ CH ₂ CH ₂ - (3-NO ₂ , Ph 94 6-C1 cf ₃ CH ₂ CH ₂ - (4-NO ₂ , Ph 95 6-C1 cf ₃ CH ₂ CH ₂ - (2-NH ₂ , Ph 96 6-C1 cf ₃ CH ₂ CH ₂ - (3-NH ₂ , Ph

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Κ

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Κ

Η

Η

Η

Η

97 6-Cl CF ₃ CH ₂ CH ₂ - (4-NH ₂ ) Ph H 98 6-Cl cf ₃ CH ₂ CH ₂ - (2-NMe ₂ ) Ph H 99 6-Cl cf ₃ CH ₂ CH ₂ - (3-NMe ₂ ) Ph H 100 6-Cl cf ₃ CH ₂ CH ₂ - (4-NMe ₂ ) Ph H 101 6-Cl cf ₃ CH ₂ CH ₂ -2-Pyridyl H 102 6-Cl cf ₃ CH ₂ CH ₂ -3 - Pyridyl H 103 6-Cl cf ₃ CH ₂ CH ₂ -4-Pyridyl H 104 6-Cl cf ₃ CH ₂ CH ₂ -2 - uranium 1 H 105 6-Cl cf ₃ CH ₂ CH ₂ -3 - Furan 1 H 106 6-Cl cf ₃ CH ₂ CH ₂ -4-furanyl H 107 6-Cl cf ₃ CH ₂ CH ₂ -3-thienyl H 108 6-Cl cf ₃ CH ₂ CH ₂ - 2 - oxazoyl 1 H 109 6-Cl cf ₃ CH ₂ CH ₂ -2-thiazolyl H · 110 6-Cl cf ₃ CH ₂ CH ₂ -4-: isoxazolyl H lll 6-Cl cf ₃ CH ₂ CH ₂ -2-imidazolyl H 112 6-Cl cf ₃ CsC-cycPr ch ₃ 113 6-Cl cf ₃ CsC Ph ch ₃ 114 6-Cl cf ₃ CsC-2-Pyridyl ch ₃ 115 6-Cl cf ₃ CbC-3 - Pyridyl ch ₃ 116 6-Cl cf ₃ Jul-4-pyridyl ch ₃ 117 6-Cl cf ₃ C = C-2-furanyl ch ₃ 118 6-Cl cf ₃ CsC-3-furanyl ch ₃ 119 6-Cl cf ₃ C = C-2-thienyl ch ₃ 120 6-Cl cf ₃ C 3 -C 3 -thienyl ch ₃ 121 6-Cl cf ₃ C = C-cycPr ch ₃ 122 6-Cl cf ₃ C-C-Ph ch ₃ 123 6-Cl cf ₃ C = C-2-Pyridyl ch ₃ 124 6-Cl cf ₃ C = C-3-pyridyl ch ₃ 125 6-Cl cf ₃ C-C-4-Pyridyl ch ₃ 126 6-Cl cf ₃ C = C-2-furan 1 ch ₃ 127 6-Cl cf ₃ C = C-3-uranyl ch ₃ 128 6-Cl cf ₃ C = C-2-1 ienyl ch ₃ 129 6-Cl cf ₃ C = C-3-thienyl ch ₃ 130 6-Cl cf ₃ CH ₂ CH ₂ -cycPr ch ₃

6-Cl CF ₃ CH ₂ CH ₂ -Ph ch ₃ 6-Cl cf ₃ CH ₂ CH ₂ -2-Pyridyl ch ₃ 6-Cl cf ₃ CH ₂ CH ₂ -3-Pyridyl ch ₃ 6-Cl cf ₃ CH ₂ CH ₂ -4-Pyridyl ch ₃ 6-Cl cf ₃ CH ₂ CH ₂ -2 - urea 1 ch ₃ 6-Cl cf ₃ CH ₂ CH ₂ -3 - Furan 1 ch ₃ 6-Cl cf ₃ CH ₂ CH ₂ -2-1 enyl ch ₃ 6-Cl cf ₃ CH ₂ CH ₂ -3-thienyl ch ₃ 6-Cl cf ₃ CsC-cycPr ch ₂ ch ₃ 6-Cl cf ₃ CsC Ph ch ₂ ch ₃ 6-Cl cf ₃ CsC-2-pyridyl ch ₂ ch ₃ 6-Cl cf ₃ CsC-3-pyridyl ch ₂ ch ₃ 6-Cl cf ₃ CsC-4-pyridyl ch ₂ ch ₃ 6-Cl cf ₃ CsC-2-furány1 ch ₂ ch ₃ 6-Cl cf ₃ CsC-3-f uranes1 ch ₂ ch ₃ 6-Cl cf ₃ CsC-2-thienyl ch ₂ ch ₃ 6-Cl cf ₃ CsC-3-tlenyl ch ₂ ch ₃ 6-Cl cf ₃ C = C-cycPr ch ₂ ch ₃ 6-Cl cf ₃ C-C-Ph ch ₂ ck ₂ 6-Cl cf ₃ C = C-2-Pyridyl ch ₂ ch ₃ 6-Cl cf ₃ C = C-3-pyridyl ch ₂ ch ₃ 6-Cl cf ₃ C-C-4-Pyridyl ch ₂ ch ₃ 6-Cl cf ₃ C = C-2-furány1 ch ₂ ch ₃ 6-Cl cf ₃ C = C-3-furány1 ch ₂ ch ₃ 6-Cl cf ₃ C = C-2-thienyl ch ₂ ch ₃ 6-Cl cf ₃ C = C-3-thienyl ch ₂ ch ₃ 6-Cl cf ₃ CH ₂ CH ₂ -cycPr ch ₂ ch ₃ 6-Cl cf ₃ CH ₂ CH ₂ -Ph ch ₂ ch ₃ 6-Cl cf ₃ CH ₂ CH ₂ -2-Pyridyl ch ₂ ch ₃ 6-Cl cf ₃ CH ₂ CH ₂ -3 -Pyridyl ch ₂ ch ₃ 6-Cl cf ₃ CH ₂ CH ₂ -4-Pyridyl ch ₂ ch ₃ 6-Cl cf ₃ CH ₂ CH ₂ -2-furanyl ch ₂ ch ₃ 6-Cl cf ₃ CH ₂ CH ₂ -3-furanyl ch ₂ ch ₃ 6-Cl cf ₃ CH ₂ CH ₂ -2-thienyl ch ₂ ch ₃

165 6-C1 cf ₃ 166 6-MeO cf ₃ 167 6-MeO cf ₃ 168 6-MeO cf ₃ 169 6-MeO cf ₃ 170 6-MeO cf ₃ 171 6-MeO cf ₃ 172 6-MeO cf ₃ 173 6-MeO cf ₃ 174 6-MeO cf ₃ 175 6-MeO cf ₃ 176 6-MeO cf ₃ 177 6-MeO CF ₃ 178 6-MeO cf ₃ 179 6-MeO cf ₃ 180 6-MeO cf ₃ 181 6-MeO cf ₃ 182 6-MeO cf ₃ 183 6-MeO cf ₃ 184 6-MeO cf ₃ 185 6-MeO cf ₃ 186 6-MeO cf ₃ 187 6-MeO CF ₃ 188 6-MeO CF ₃ 189 6-MeO cf ₃ 190 6-MeO cf ₃ 191 6-MeO cf ₃ 192 6-MeO cf ₃ 193 6-MeO cf ₃ 194 6-MeO cf ₃ 195 6-MeO cf ₃ 196 6-MeO cf ₃ 197 6-MeO . cf ₃ 198 6-MeO cf ₃

CH ₂ Cl ₂ -3-thienyl. CH ₂ CH ₃

CSCCH2CH2OH H

C = C-CH (OH) Me-H

C = C - (2-Cl) Ph H

C 6 - (3-Cl) Ph H

C = C - (4-Cl) Ph H

C = C- (2-F) Ph H

CsC - (3-F) Ph H

CsC - (4-F) Ph H

CsC - (2-OH, Ph H

CsC - (3-OH) Ph H

CsC - (4-OH) Ph H

CsC - (2-OMe) Ph H

CsC - (3-OMe) Ph H

CsC - (4-OMe) Ph H

CsC - (2-CN) Ph H

CsC - (3-CN) Ph H

CsC- (4-CN, Ph. H

CsC - (2-NO ₂ ) Ph H

Csc - (3 - NO ₂ ) Ph H

CsC- (4-NO ₂ ) Ph H

CsC- (2-NH ₂₎ , Ph H

CsC- (3-NH ₂ ) Ph H

CsC- (4-NH ₂ ) Ph H

CsC - (2-NMe ₂ ) Ph H

C = C - (3-NMe ₂ ) Ph ^H

CsC - (4-NMe ₂ ) Ph H

CsC-3-Pyridyl H

CsC-4-Pyridyl H

CsC-2-furanyl H

Csc-3-furanyl H.

C 1-4 -2-thienyl H

C 3 -C 3 -thienyl H

CsC-2-oxazolyl H

IN

199 6-MeO cf ₃ C = C-2-thiazolyl H 200 6-MeO cf ₃ OC-4-isoxazolyl H 201 6-MeO cf ₃ CsC-2-imidazolyl H 202 6-MeO cf ₃ C = CCH ₂ CH ₂ OH H 203 6-MeO cf ₃ OC-CH (OH) Me H 204 6-MeO cf ₃ C = C- (2-Cl) Ph H 205 6-MeO cf ₃ C = C- (3-Cl) Ph H 206 6-MeO cf ₃ C = C- (4-Cl) Ph H 207 6-MeO cf ₃ C = C- (2-F) Ph H 208 6-MeO cf ₃ C. C- (3-F) Ph H 209 6-MeO cf ₃ C = C- (4-F) Ph H 210 6-MeO cf ₃ C = C- (2-OH) Ph H 211 6-MeO cf ₃ C = C- (3-OH) Ph H 212 6-MeO cf ₃ C = C- (4-OH) Ph H 213 6-MeO cf ₃ C = C- (2-OMe) Ph H 214 6-MeO cf ₃ C = C- (3-OMe) Ph H 215 6-MeO cf ₃ C = C- (4-OMe) Ph H 216 6-MeO cf ₃ C = C- (2-CN) Ph H 217 6-MeO cf ₃ C = C- (3-CN) Ph H 218 6-MeO cf ₃ C = C- (4-CN) Ph H 219 6-MeO cf ₃ C = C- (2-NO ₂ ) Ph H 220 6-MeO cf ₃ C = C- (3-NO 2) Ph H 221 6-MeO cf ₃ C = C- (4-NO ₂ ) Ph H 222 6-MeO cf ₃ C = C- (2-NH ₂ ) Ph H 223 6-MeO cf ₃ C = C- (3-NH ₂ ) Ph H 224 6-MeO cf ₃ C = C- (4-NH ₂ ) Ph H 225 6-MeO cf ₃ C = C- (2-NMe ₂ ) Ph H 226 6-MeO cf ₃ C = C- (3-NMe ₂ ) Ph H 227 6-MeO cf ₃ C = C- (4-NMe ₂ ) Ph H 228 6-MeO cf ₃ C = C-3-pyridyl H 229 6-MeO cf ₃ C-C-4-Pyridyl H 230 6-MeO cf ₃ C-C-2-furány1 H 231 6-MeO cf ₃ C = C-3-furány1 H 232 6-MeO cf ₃ C = C-2-thienyl H

233 6-MeO cf ₃ C = C-3-thienyl H 234 6-MeO cf ₃ C = C-2-oxazolyl H 235 6-MeO cf ₃ C = C-2-thiazolyl H 236 6-MeO cf ₃ C = C-4-isoxazolyl H 237 6-MeO cf ₃ C = C-2-imidazolyl H 238 6-MeO cf ₃ CH ₂ CH ₂ -cycPr H 239 6-MeO cf ₃ CH ₂ CH ₂ CH ₂ CH ₂ OH H 240 6-MeO cf ₃ CH ₂ CH ₂ -CH (OH) Me H 241 6-MeO cf ₃ CH ₂ CH ₂ -Ph H 242 6-MeO cf ₃ CH ₂ CH ₂ - (2-Cl) Ph H 243 6-MeO cf ₃ CH ₂ CH ₂ - (3-Cl) Ph H 244 6-MeO cf ₃ CH ₂ CH ₂ - (4-Cl) Ph H 245 6-MeO cf ₃ CH ₂ CH ₂ - (2-F) Ph H 246 6-MeO cf ₃ CH ₂ C ₂ - (3-F) Ph H 247 6-MeO cf ₃ CH ₂ CH ₂ - (4-F) Ph H 248 6-MeO cf ₃ CH ₂ C ₂ - (2-OH) Ph H 249 6-MeO cf ₃ CH ₂ CH ₂ - (3-OH) Ph H 250 6-MeO cf ₃ CH ₂ CH ₂ - (4-OH) Ph H 251 6-MeO cf ₃ CH ₂ CH ₂ - (2-OMe) Ph H 252 6-MeO cf ₃ CH ₂ CH ₂ - (3-OMe) Ph H 253 6-MeO cf ₃ CH ₂ CH ₂ - (4-OMe) Ph H 254 6-MeO cf ₃ CH ₂ CH ₂ - (2-CN) Ph H 255 6-MeO cf ₃ CH ₂ C ₂ - (3-CN) Ph H 256 6-MeO cf ₃ CH ₂ CH ₂ - (4-CN) Ph H 257 6-MeO cf ₃ CH ₂ CH ₂ - (2-NO ₂ ) Ph H 258 6-MeO cf ₃ CH ₂ CH ₂ - (3-NO ₂ ) Ph H 259 6-MeO cf ₃ CH ₂ CH ₂ - (4-NO ₂ ) Ph H 260 6-MeO cf ₃ CH ₂ CH ₂ - (2-NH ₂ ) Ph H 261 6-MeO cf ₃ CH ₂ CH ₂ - (3-NH ₂ ) Ph H 262 6-MeO cf ₃ CH ₂ CH ₂ - (4-nh ₂ ) Ph H 263 6-MeO cf ₃ CH ₂ CH ₂ - (2-NMe ₂ ) Ph H 264 6-MeO cf ₃ CH ₂ CH ₂ - (3-NMe ₂ ) Ph H 265 6-MeO cf ₃ CH ₂ CH ₂ - (4-NMe ₂ ) Ph H 266 6-MeO cf ₃ CH ₂ CH ₂ -2-Pyridyl H

267 6-MeO ^cf 3 CH2CH2-3-Pyridyl H 268 6-MeO cf ₃ CH ₂ CH ₂ -4-Pyridyl H 269 6-MeO cf ₃ CH 2 CH 2 -2 -furan 1 H 270 6-MeO cf ₃ CH2CH2-3-furan 1 H 271 6-MeO cf ₃ CH 2 CH 2 -4 -furan 1 H 272 6-MeO cf ₃ CH2CH2-3-1-enyl H 273 6-MeO cf ₃ CH2CH2-2-oxazolyl 1 The 274 6-MeO cf ₃ CH2CH2-2-thiazolyl H 275 6-MeO cf ₃ CH2CH2-4-isoxazolyl H 276 6-MeO cf ₃ CH2CH2-2-imidazolyl H 277 6-MeO cf ₃ CsC-cycPr ch ₃ 278 6-MeO cf ₃ CEC-Ph ch ₃ 279 6-MeO cf ₃ C = C-2-Pyridyl ch ₃ 280 6-MeO cf ₃ CsC-3-pyridyl ch ₃ 281 6-MeO cf ₃ CSC-4-pyridyl ch ₃ 282 5-MeO cf ₃ CsC-2 - furan 1 ch ₃ 283 t-MeO cf ₃ CSC-3-furanyl ch ₃ 284 6-MeO cf ₃ CsC-2-thienyl ch ₃ 285 6-MeO cf ₃ C = C-3-thienyl ch ₃ 286 6-MeO cf ₃ C = C-cycPr ch ₃ 287 S-MeO cf ₃ C-C-Ph ch ₃ 288 6-MeO cf ₃ C = C-2-Pyridyl ch ₃ 289 6-MeO cf ₃ C = C-3-pyridyl ch ₃ 290 6-MeO cf ₃ C = C-4-Pyridyl ch ₃ 291 6-MeO cf ₃ C = C-2-furanyl ch ₃ 292 6-MeO cf ₃ C = C-3-furanyl ch ₃ 293 6-MeO cf ₃ C = C-2-thienyl ch ₃ 294 6-MeO cf ₃ C = C-3-thienyl ch ₃ 295 6-MeO cf ₃ CH2CH2-cycPr ch ₃ 296 6-MeO cf ₃ CH 2 CH ₂ Ph ch ₃ 297 6-MeO cf ₃ CH2CH2-2-pyridyl ch ₃ 298 6-MeO cf ₃ CH ₂ CH ₂ -3-Pyridyl ch ₃ 299 6-MeO cf ₃ CH ₂ CH ₂ -4-Pyridyl ch ₃ 300 6-MeO cf ₃ CH 2 CH 2 - 2 - uranes 1 ch ₃

6-MeO cf ₃ CH2CH2-3-furanyl ch ₃ 6-MeO cf ₃ CH2CH2-2-thienyl ch ₃ 6-MeO cf ₃ CH2CH2-3-1-enyl ch ₃ 6-MeO cf ₃ CsC-cycPr ch ₂ ch ₃ 6-MeO cf ₃ CsC Ph ch ₂ ch ₃ 6-MeO cf ₃ CsC-2-pyridyl ch ₂ ch ₃ 6-MeO cf ₃ C = C-3-pyridyl ch ₂ ch ₃ 6-MeO cf ₃ C-C-4-Pyridyl ch ₂ ch ₃ 6-MeO cf ₃ C = C-2-furanyl ch ₂ ch ₃ 6-MeO cf ₃ CsC-3-furanyl ch ₂ ch ₃ 6-MeO cf ₃ C = C-2-thienyl ch ₂ ck ₃ 6-MeO cf ₃ CsC-3-thienyl ch ₂ ch ₃ 6-MeO cf ₃ C = C-cycPr ch ₂ ch ₃ 6-MeO cf ₃ C-C-Ph ch ₂ ch ₃ 6-MeO cf ₃ C = C-2-Pyridyl ch ₂ ch ₃ 6-MeO cf ₃ C = C-3-pyridyl ch ₂ ch ₃ 6-MeO cf ₃ C-C-4-Pyridyl ch ₂ ch ₃ 6-MeO cf ₃ C = C-2-furanyl ch ₂ ch ₃ 6-MeO cf ₃ C = C-3-furanyl ch ₂ ch ₃ 6-MeO cf ₃ C = C-2-thienyl ch ₂ ch ₃ 6-MeO cf ₃ C = C-3-thienyl ch ₂ ch ₃ 6-MeO cf ₃ CH ₂ CH ₂ -cycPr ch ₂ ch ₃ 6-MteO cf ₃ CH ₂ CH ₂ -Ph ch ₂ ch ₃ 6-MeO cf ₃ CH2CH2-2-pyridyl CH2CH3 6-MeO cf ₃ CH2CH2--3-pyridyl CH ₂ CH ₃ 6-MeO cf ₃ CH2CH2-4-pyridyl ch ₂ ch ₃ 6-MeO cf ₃ CH ₂ CH ₂ -2 - urea 1 ch ₂ ch ₃ 6-MeO cf ₃ CH ₂ CH ₂ -3-furanyl ch ₂ ch ₃ 6-MeO cf ₃ CH2CH2-2-thienyl ch ₂ ch ₃ 6-MeO cf ₃ CH ₂ CH ₂ -3-thienyl ch ₂ ch ₃ 5,6-difluoro cf ₃ CAC- (2-Cl) Ph H 5,6-difluoro cf ₃ CsC- (3-Cl) Ph H 5,6-difluoro cf ₃ C = C- (4-Cl Ph H 5,6-difluoro cf ₃ CsC- (2-F) Ph H

S / Ί *

335 5,6-difluoro cf ₃ CsC- (3-F) Ph H 336 5,6-difluoro cf ₃ CsC- (4-F) Ph H 337 5,6-difluoro cf ₃ CEC-(2-OH) Ph H 338 5,6-difluoro cf ₃ C = C- (3-OH, Ph H 339 5,6-difluoro cf ₃ CsC- (4-OH) Ph H 340 5,6-difluoro cf ₃ CsC- (2-OMe) Ph H 341 5,6-difluoro cf ₃ CsC- (3-OMe) Ph H 342 5,6-difluoro cf ₃ CsC- (4-OMe) Ph H 343 5,6-difluoro cf ₃ C = C- (2-CN) Ph H 344 5,6-difluoro cf ₃ CsC- (3-CN) Ph H 345 5,6-difluoro cf ₃ CsC- (4-CN) Ph H 346 5,6-difluoro cf ₃ CsC- (2-NO ₂ ) Ph H 347 5,6-difluoro cf ₃ CsC- _(3-NO2) Ph H 348 5,6-difluoro cf ₃ C = C- (4-NO ₂ ) Ph H 349 5,6-difluoro cf ₃ CsC- (2-NH ₂ ) Ph H 350 5,6-difluoro cf ₃ CsC- _(3-NH2) Ph H 351 5,6-difluoro cf ₃ CsC- _(4-NH2) Ph H 352 5,6-difluoro cf ₃ CsC- (2 -NMe ₂ ) Ph H 353 5,6-difluoro cf ₃ CsC- (3-NMe ₂ ) Ph H 354 5,6-difluoro cf ₃ CsC- (4-NMe ₂ ) Ph H 355 5,6-difluoro cf ₃ CsC-3-pyridyl H 356 5,6-difluoro cf ₃ CsC-4-pyridyl H 357 5,6-difluoro cf ₃ CsC-2-furanyl H 358 5,6-difluoro cf ₃ CsC-3 - furan 1 H 359 5,6-difluoro cf ₃ C 1 H -2-L-enyl H 360 5,6-difluoro cf ₃ CsC-3-thienyl H 361 5,6-difluoro cf ₃ CsC-2-oxazolyl H 362 5,6-difluoro cf ₃ CsC-2-Liazolyl H 363 5,6-difluoro cf ₃ CsC-4-oxoxazolyl H 364 5,6-difluoro cf ₃ QsC-2-thiazoles I H 365 5,6-difluoro cf ₃ C = C- (2-Cl) Ph H 366 5,6-difluoro cf ₃ C = C- (3-Cl) Ph H 367 5,6-difluoro cf ₃ C = C- (4-Cl) Ph H 368 5,6-difluoro cf ₃ C = C- (2-F) Ph The

369 5,6-difluoro cf ₃ C. C- (3-F) Ph H 370 5,6-difluoro cf ₃ C = C- (4-F) Ph H 371 5,6-difluoro cf ₃ C = C- (2-OH) Ph H 372 5,6-diF. cf ₃ C = C- (3-OH) Ph H 373 5,6-difluoro cf ₃ C = C- (4-OH) Ph H 374 5,6-difluoro cf ₃ C = C- (2-OMe) Ph H 375 5,6-difluoro cf ₃ Cs = C- (3-OMe) Ph H 376 5,6-difluoro cf ₃ C = C- (4-OMe) Ph H 377 5,6-difluoro cf ₃ C = C- (2-CN, Ph H 378 5,6-difluoro cf ₃ C = C- (3-CN) Ph H 379 5,6-difluoro cf ₃ C = C- (4-CN) Ph H 380 5,6-difluoro cf ₃ C = C- (2-NO ₂ ) Ph H 381 5,6-difluoro cf ₃ C = C- (3-NO ₂ ) Ph The 382 5,6-difluoro cf ₃ C = C- (4-NO ₂ ) Ph H 383 5,6-difluoro CF ₃ C = C- (2-NH ₂ ) Ph H 384 5,6-difluoro cf ₃ C = C- (3-NH ₂ ) Ph H 385 5,6-difluoro cf ₃ C = C- (4-NH ₂ ) Ph H 386 5,6-difluoro cf ₃ C = C- (2-NMe ₂ ) Ph H 387 5,6-difluoro cf ₃ C = C- (3-NMe ₂ ) Ph H 388 5,6-difluoro cf ₃ C = C- (4-NMe ₂ ) Ph H 389 5,6-difluoro cf ₃ C = C-3-pyridyl H 390 5,6-difluoro cf ₃ C-C-4-Pyridyl H 391 5,6-difluoro cf ₃ C = C-2-furanyl H 392 5,6-difluoro cf ₃ C = C-3-furanyl H 393 5,6-difluoro cf ₃ C = C-2-thienyl The 394 5,6-difluoro cf ₃ C = C-3-thienyl H 395 5,6-difluoro cf ₃ C = C-2-oxazolyl H 396 5,6-difluoro cf ₃ C = C-2-thiazolyl H 397 5,6-difluoro cf ₃ C = c-4 -1 oxazo 1 y 1 H 398 5,6-difluoro cf ₃ C = C-2-imidazolyl H 399 5,6-difluoro cf ₃ CH ₂ CH ₂ -cycPr H 400 5,6-difluoro cf ₃ CH ₂ CH ₂ CH ₂ CH ₂ OH H 401 5,6-difluoro cf ₃ CH ₂ CH ₂ -CH (OH) Me H 402 5,6-difluoro cf ₃ CH ₂ CH ₂ -Ph. H

403 5,6-difluoro cf ₃ 404 5,6-difluoro cf ₃ 405 5,6-difluoro cf ₃ 406 5,6-difluoro cf ₃ 407 5,6-difluoro cf ₃ 408 5,6-difluoro cf ₃ 409 5,6-difluoro cf ₃ 410 5,6-difluoro cf ₃ 411 5,6-difluoro cf ₃ 412 5,6-difluoro cf ₃ 413 5,6-difluoro cf ₃ 414 5,6-difluoro cf ₃ 415 5,6-difluoro cf ₃ 416 5,6-difluoro cf ₃ 417 5,6-difluoro cf ₃ 418 5,6-difluoro cf ₃ 419 5,6-difluoro cf ₃ 420 5,6-difluoro cf ₃ 421 5,6-difluoro cf ₃ 422 5,6-difluoro cf ₃ 423 5,6-difluoro cf ₃ 424 5,6-difluoro cf ₃ 425 5,6-difluoro cf ₃ 426 5,6-difluoro cf ₃ 427 5,6-difluoro cf ₃ 428 5,6-difluoro cf ₃ 429 5,6-difluoro cf ₃ 430 5,6-difluoro cf ₃ 431 5,6-difluoro cf ₃ 432 5,6-difluoro CF ₃ 433 5,6-difluoro cf ₃ 434 5,6-difluoro cf ₃ 435 5,6-difluoro cf ₃ 436 5,6-difluoro cf ₃

CH ₂ CH ₂ - (2-Cl) Ph H

CH ₂ CH ₂ - (3-Cl) Ph H

CH ₂ CH ₂ - (4-Cl) Ph H

CH ₂ CH ₂ - (2-F) Ph H

CH ₂ C ₂ - (3-F) Ph H

CH ₂ CH ₂ - (4-F) Ph H

CH ₂ CH ₂ - (2-OH) Ph H

CH ₂ CH ₂ - (3-OH) Ph H

CH ₂ CH ₂ - (4-OH) Ph H

CH ₂ CH ₂ - (2-OMe, Ph H

CH ₂ CH ₂ - (3-OMe) Ph H

CH ₂ CH ₂ - (4-OMe) Ph H

CH ₂ CH ₂ - (2-CN) Ph H

CH ₂ CH ₂ - (3-CN) Ph H

CH ₂ CH ₂ - (4-CN) Ph H

CH ₂ CH ₂ - (2-NO ₂ ) Ph H

CH ₂ CH ₂ - (3-NO ₂ ) Ph H

CH ₂ CH ₂ - (4-NO ₂ ) Ph H

CH ₂ CH ₂ - (2-NH ₂₎ Ph H

CH ₂ CH ₂ - (3-NH ₂ , Ph H

CH ₂ CH ₂ - (4-NH ₂ ) Ph H

CH ₂ C ₂ - (2 -NMe ₂ ) Ph H

CH ₂ CH ₂ - (3-NMe ₂ ) Ph H

CH ₂ CH ₂ - (4-NMe ₂ ) Ph H

CH ₂ CH ₂ -2-Pyridyl H

CH ₂ CH ₂ -3-Pyridyl H

CH ₂ CH ₂ -4-Pyridyl H

CH ₂ CH ₂ -2-furanyl H

CH ₂ CH ₂ -3-furanyl H

CH ₂ CH ₂ -2-thienyl H

CH ₂ CH ₂ -3-thienyl h

CH ₂ CH ₂ -2-oxazolyl H

CH ₂ CH ₂ -2-Liazolyl H

CH ₂ CH ₂ -4-isoxazolyl H

437 5,6-difluoro CF ₃ CH 2 CH 2 -2-imidazoles 1 H 438 5,6-difluoro cf ₃ CsC-cycPr ch ₃ 439 5,6-difluoro cf ₃ O-C-2-Pyridyl ch ₃ 440 5,6-difluoro cf ₃ CsC-3-pyridyl ch ₃ . 441 5,6-difluoro cf ₃ CSC-4-pyridyl ch ₃ 442 5,6-difluoro cf ₃ CsC-2-furány1 ch ₃ 443 5,6-difluoro cf ₃ CsC-3-furanyl ch ₃ 444 5,6-difluoro cf ₃ CsC-2-thienyl ch ₃ 445 5,6-difluoro cf ₃ C = C-3-thienyl ch ₃ 446 5,6-difluoro cf ₃ C = C-cycPr ch ₃ .447 5,6-difluoro cf ₃ C = C-2-Pyridyl ch ₃ 448 5,6-difluoro cf ₃ C = C-3-pyridyl ch ₃ 449 5,6-difluoro cf ₃ C-C-4-Pyridyl ch ₃ - 450 5,6-difluoro cf ₃ C = C-2-furanyl ch ₃ 451 5,6-difluoro cf ₃ C = C-3-furanyl ch ₃ 452 5,6-difluoro cf ₃ C = C-2-thienyl ch ₃ 453 5,6-difluoro cf ₃ C = C-3-thienyl ch ₃ 454 5,6-difluoro cf ₃ CH2CH2-cycPr ch ₃ 455 5,6-difluoro cf ₃ CH 2 CH ₂ Ph ch ₃ 456 5,6-difluoro cf ₃ CH2CH2-2-pyridyl ch ₃ 457 5,6-difluoro cf ₃ CH2CH2-3-pyridyl ch ₃ 458 5,6-difluoro cf ₃ CH2CH2-4 - Pyridyl ch ₃ 459 5,6-difluoro cf ₃ CH2CH2-2-furanyl ch ₃ 460 '5,6-difluoro cf ₃ CH ₂ CH ₂ -3-furanyl ch ₃ 461 5,6-difluoro cf ₃ CH ₂ CH ₂ -2-thienyl ch ₃ 462 5,6-difluoro cf ₃ CH ₂ CH ₂ -3-thienyl ch ₃ 463 5,6-difluoro cf ₃ CEC cycPr CH ₂ CH ₃ 464 5,6-difluoro cf ₃ CsC Ph CH ₂ CH ₃ 465 5,6-difluoro cf ₃ C = C-2-Pyridyl CH2CH3 466 5,6-difluoro cf ₃ CsC-3-pyridyl ch ₂ ch ₃ 467 5,6-difluoro cf ₃ GsC-4-Pyridyl CH2CH3 468 5,6-difluoro cf ₃ C = C-2-furans1 CH2CH3 469 5,6-difluoro cf ₃ CeC-3 - furan 1 ch ₂ ch ₃ 470 5,6-difluoro cf ₃ Jul-2-thienyl ch ₂ ch ₃

471 5,6-difluoro CF ₃ CsC-3-thienyl CH ₂ CH ₃ 472 5,6-difluoro cf ₃ C = C-cycPr ch ₂ ch ₃ 473 5,6-difluoro cf ₃ C-C-Ph ch ₂ ch ₃ 474 5,6-difluoro cf ₃ C = C-2-Pyridyl ch ₂ ch ₃ 475 5,6-difluoro cf ₃ C = C-3 - Pyridyl ch ₂ ch ₃ 476 5,6-difluoro cf ₃ C-C-4-Pyridyl ch ₂ ch ₃ 477 5,6-difluoro cf ₃ C = C-2-furanyl ch ₂ ch ₃ 478 5,6-difluoro cf ₃ C = C-3-furanyl ch ₂ ch ₃ 479 5,6-difluoro cf ₃ C = C-2-thienyl ch ₂ ch ₃ 480 5,6-difluoro cf ₃ C = C-3-thienyl ch ₂ ch ₃ 481 5,6-difluoro cf ₃ CH ₂ CH ₂ -cycPr ch ₂ ch ₃ 482 5,6-difluoro cf ₃ CH ₂ CH ₂ -Ph ch ₂ ch ₃ 483 5,6-difluoro cf ₃ CH ₂ CH ₂ -2-Pyridyl ch ₂ ch ₃ 484 5,6-difluoro cf ₃ CH ₂ CH ₂ -3 - Pyridyl ch ₂ ch ₃ 485 5,6-difluoro cf ₃ CH ₂ CH ₂ - 4 - Pyrid 1 ch ₂ ch ₃ 486 5,6-difluoro cf ₃ CH2CH2-2-furanyl ch ₂ ch ₃ 487 5,6-difluoro cf ₃ CH ₂ CH ₂ -3-furanyl ch ₂ ch ₃ 488 5,6-difluoro cf ₃ CH ₂ CH ₂ -2-thienyl ch ₂ ch ₃ 489 5,6-difluoro cf ₃ CH ₂ CH ₂ -3-thienyl ch ₂ ch ₃ 490 5,6-diCl cf ₃ CsC- (2-Cl) Ph H 491 5,6-diCl cf ₃ CssC- (3-Cl), Ph H 492 5,6-diCl cf ₃ C = C- (4-Cl) Ph H 493 5,6-diCl cf ₃ CsC- (2-F), Ph H 494 "5,6-diCl cf ₃ CsC- {3-F) Ph H 495 5,6-diCl cf ₃ CsC - (4-F, Ph H 496 5,6-diCl cf ₃ C = C- (2-OH, Ph H 497 5,6-diCl cf ₃ CsC- (3-OH) Ph H 498 5,6-diCl cf ₃ CsC - (4-OH, Ph H 499 5,6-diCl cf ₃ CsC- (2-OMe) Ph H 500 5,6-diCl cf ₃ CsC- (3-OMe) Ph H 501 5,6-diCl cf ₃ OC- (4-OMe) Ph H 502 5,6-diCl cf ₃ C = C- (2-CN) Ph H 503 5,6-diCl cf ₃ C = C- (3-CN, Ph H 504 5,6-diCl cf ₃ CsC- (4-CN) Ph H

505 5,6-diCl CF ₃ CSC- _(2-NO2) Ph H 506 5,6-diCl cf ₃ CsC- _(3-NO2) Ph H 507 5,6-diCl cf ₃ CsC- (4-NO ₂ ) Ph H 508 5,6-diCl cf ₃ CsC- (2-NH ₂ ) Ph H 509 5,6-diCl cf ₃ C = C- (3-NH ₂ ) Ph H 510 5,6-diCl cf ₃ CsC- _(4-NH2) Ph H 511 5,6-diCl cf ₃ CsC- (2-NMe ₂ ) Ph H 512 5,6-diCl cf ₃ C = C- (3-NMe ₂ ) Ph H 513 5,6-diCl cf ₃ CsC- (4-NMe ₂ ) Ph H 514 5,6-diCl cf ₃ CsC-3-pyridyl H 515 5,6-diCl cf ₃ CsC-4-pyridyl H 516 5,6-diCl cf ₃ CsC-2-furanyl H 517 5,6-diCl cf ₃ C = C-3-uranyl H 518 5,6-diCl cf ₃ CsC-2-thienyl H 519 5,6-diCl cf ₃ CsC-3-thienyl H 520 5,6-diCl cf ₃ CsC-2-oxazolyl H 521 5,6-diCl cf ₃ CsC-2-thiazolyl H 522 5,6-diCl cf ₃ CsC-4-isoxazol-1-y H 523 5,6-diCl cf ₃  CsC-2-imidazolyl H 524 5,6-diCl cf ₃ C = C- (2-Cl) Ph H 525 5,6-diCl cf ₃ C = C- (3-Cl) Ph H 526 5,6-diCl cf ₃ C = C- (4-Cl) Ph H 527 5,6-diCl cf ₃ C = C- (2-F) Ph H 528 5,6-diCl cf ₃ C. C- (3-F) Ph The 529 5,6-diCl cf ₃ C = C- (4-F) Ph H 530 5.6-diCl cf ₃ C = C- (2-OH) Ph · H 531 5,6-diCl cf ₃ C = C- (3-OH, Ph H 532 5,6-diCl cf ₃ C = C- (4-OH) Ph H 533 5,6-diCl cf ₃ C = C- (2-OMe) Ph H 534 5,6-diCl cf ₃ C = C- (3-OMe) Ph H 535 5,6-diCl cf ₃ C = C- (4-OMe) Ph H 536 5,6-diCl cf ₃ C = C- (2-CN) Ph H 537 5,6-diCl cf ₃ C = C- (3-CN) Ph H 538 5,6-diCl cf ₃ C = C- (4-CN) Ph H

539 5,6-diCl cf ₃ C = C- (2-NO 2) Ph H 540 5,6-diCl cf ₃ C = C- (3-NO ₂ ) ph H 541 5,6-diCl cf ₃ C = C- (4-NO ₂ ) Ph H 542 5,6-diCl cf ₃ C = C- (2-NH ₂ ) Ph H 543 5,6-diCl cf ₃ C = C- (3-NH ₂ ) Ph H 544 5,6-diCl cf ₃ C = C- (4-NH ₂ ) Ph H 545 5,6-diCl cf ₃ C = C- (2-NMe ₂ ) Ph H 546 5,6-diCl cf ₃ C = C- (3-NMe ₂ ) Ph H 547 5,6-diCl cf ₃ C = C- (4-NMe ₂ ) Ph H 548 5,6-diCl cf ₃ C = C-3-pyridyl H 549 5,6-diCl cf ₃ C-C-4-Pyridyl H 550 5,6-diCl cf ₃ C = C-2-furanyl H 551 5,6-diCl cf ₃ C = C-3-furány1 H ' 552 5,6-diCl cf ₃ C = C-2-thienyl H 553 5,6-diCl cf ₃ C = C-3-thienyl H 554 5,6-diCl cf ₃ C = C-2-oxazolyl H 555 5,6-diCl cf ₃ C = C-2-thiazolyl H 556 5,6-diCl cf ₃ C = C-4-isoxazolyl H 557 5,6-diCl cf ₃ C = C-2-imidazolyl H 558 5,6-diCl cf ₃ CH ₂ CH ₂ -cycPr H 559 5,6-diCl cf ₃ CH ₂ CH ₂ CH ₂ CH ₂ OH H 560 5,6-diCl cf ₃ CH ₂ CH ₂ -CH (OH) Me H 561 5,6-diCl cf ₃ CH ₂ CK ₂ -Ph H 562 5,6-diCl cf ₃ CH ₂ CH ₂ - (2-Cl) Ph H 563 5,6-diCl cf ₃ CH ₂ CH ₂ - (3-Cl) Ph H 564 5,6-diCl cf ₃ CH ₂ CH ₂ - (4-Cl) Ph H 565 5,6-diCl cf ₃ CH ₂ CH ₂ - (2-F) Ph H 566 5,6-diCl cf ₃ CH ₂ CH ₂ - (3-F) Ph H 567 5,6-diCl cf ₃ CH ₂ CH ₂ - (4-F) Ph H 568 5,6-diCl cf ₃ CH ₂ CH ₂ - (2-OH) Ph H 569 5,6-diCl CF ₃ CH ₂ CH ₂ - (3-OH) Ph H 570 5,6-diCl cf ₃ CH ₂ CH ₂ - (4-OH) Ph H 571 5,6-diCl cf ₃ CH ₂ CH ₂ - (2-OMe) Ph H 572 5,6-diCl cf ₃ CH ₂ CH ₂ - (3-OMe) Ph H

573 5,6-piece CF ₃ CH ₂ CH ₂ - (4-OMe) Ph H 574 5,6-diCl cf ₃ CH 2 CH 2 - (2-CN) Ph H 575 5,6-diCl cf ₃ CH 2 CH 2 - (3-CN) Ph H 576 5,6-diCl cf ₃ CH 2 CH 2 - (4-CN) Ph H 577 5,6-diCl cf ₃ CH 2 CH 2 - (2-NO ₂ ) Ph H 578 5,6-diCl cf ₃ CH ₂ CH ₂ - (3-NO ₂ ) Ph H 579 5,6-diCl cf ₃ CH ₂ CH ₂ - (4-NO ₂ ) Ph H 580 5,6-diCl cf ₃ CH 2 CH 2 - (2-NH ₂ ) Ph H 581 5,6-diCl cf ₃ CH ₂ CH ₂ - (3 -nh ₂ ) Ph H 582 5,6-diCl cf ₃ CH ₂ CH ₂ - (4-NH 2) Ph H 583 5,6-diCl cf ₃ CH 2 CH 2 - (2-NMe ₂ ) Ph H 584 5,6-diCl cf ₃ CH ₂ CH ₂ - (3-NMe ₂ ) Ph H 585 5,6-diCl cf ₃ CH 2 CH 2 - (4 -NMe ₂ ) Ph H ' 586 5,6-diCl cf ₃ CH ₂ CH ₂ -2-Pyridyl H 587 5,6-diCl cf ₃ CH2CH2-3-pyridyl H 588 5,6-diCl cf ₃ CH2CH2-4-pyridyl H 589 5,6-diCl cf ₃ CH ₂ CH ₂ -2-furanyl H 590 5,6-diCl cf ₃ CH ₂ CH ₂ -3-furanyl H 591 5,6-diCl cf ₃ CH ₂ CH ₂ -2-thienyl H 592 5,6-diCl cf ₃ CH2CH2-3-thienyl H 593 5,6-diCl cf ₃ CH ₂ CH ₂ -2-oxazolyl H 594 5,6-diCl cf ₃ CH ₂ CH ₂ -2-thiazolyl H 595 5,6-diCl cf ₃ CH ₂ CH ₂ -4-isoxazolyl H 596 5,6-diCl cf ₃ CH ₂ CH ₂ -2-imidazolyl H 597 5,6-diCl cf ₃ CEC cycPr ch ₃ 598 5,6-diCl cf ₃ Jul-2-pyridyl ch ₃ 599 5,6-diCl cf ₃ C 6 -C 3 -Pyridyl ch ₃ 600 5,6-diCl CF ₃ Jul-4-pyridyl ch ₃ 601 5,6-diCl cf ₃ CsC-2-furanyl ch ₃ 602 5,6-diCl cf ₃ CsC-3-furanyl ch ₃ 603 5,6-diCl cf ₃ C1-4-thienyl ch ₃ 604 5,6-diCl cf ₃ CsC-3-thienyl ch ₃ 605 5,6-diCl cf ₃ C = C-cycPr ch ₃ 606 5,6-diCl cf ₃ C = C-2-Pyridyl ch ₃

5,6-diCl cf ₃ C = C-3-pyridyl ch ₃ 5,6-diCl cf ₃ C-C-4-Pyridyl ch ₃ 5,6-diCl cf ₃ C = C-2-furanyl ch ₃ 5,6-diCl cf ₃ C = C-3-furanyl ch ₃ 5,6-diCl cf ₃ C = C-2-thienyl ch ₃ 5,6-diCl cf ₃ C = C-3-thienyl ch ₃ 5,6-diCl cf ₃ CH2CH2-cycPr ch ₃ 5,6-diCl cf ₃ CH ₂ CH ₂ -Ph ch ₃ 5,6-diCl cf ₃ CH ₂ CH ₂ -2-Pyridyl ch ₃ 5,6-diCl cf ₃ CH ₂ CH ₂ -3-Pyridyl ch ₃ 5,6-diCl cf ₃ CH ₂ CH ₂ -4-Pyridyl ch ₃ 5,6-diCl cf ₃ CH ₂ CH ₂ -2-furanyl ch ₃ 5,6-diCl cf ₃ CH ₂ CH ₂ -3-furanyl ch ₃ . 5,6-diCl cf ₃ CH ₂ CH ₂ -2-thienyl ch ₃ 5,6-diCl cf ₃ CH ₂ CH ₂ -3-thienyl ch ₃ 5,6-diCl cf ₃ CsC-cycPr ch ₂ ch ₃ 5,6-diCl cf ₃ CEC Ph ch ₂ ch ₃ 5,6-diCl cf ₃ Jul-2-pyridyl ch ₂ ch ₃ 5,6-diCl cf ₃ CsC-3-pyridyl ch ₂ ch ₃ 5,6-diCl cf ₃ CsC-4-pyridyl ch ₂ ch ₃ 5,6-diCl cf ₃ C = C-2-furanyl ch ₂ ch ₃ 5,6-diCl cf ₃ CsC-3-furány1 ch ₂ ch ₃ 5,6-diCl cf ₃ CsC-2-thienyl ch ₂ ch ₃ 5,6-diCl cf ₃ C = C-3-thienyl ch ₂ ck ₃ 5,6-diCl cf ₃ C = C-cycPr ch ₂ ch ₃ 5,6-diCl cf ₃ C-C-Ph ch ₂ ch ₃ 5,6-diCl cf ₃ C = C-2-Pyridyl ch ₂ ch ₃ 5,6-diCl cf ₃ C = C-3-pyridyl ch ₂ ch ₃ 5,6-diCl cf ₃ C-C-4-Pyridyl ch ₂ ch ₃ 5,6-diCl cf ₃ C = C-2-furanyl ch ₂ ch ₃ 5,6-diCl cf ₃ C = C-3-uranyl ch ₂ ch ₃ 5,6-diCl cf ₃ C = C-2-thienyl ch ₂ ch ₃ 5,6-diCl cf ₃ C = C-3-thienyl ch ₂ ch ₃ 5,6-diCl cf ₃ CH ₂ CH ₂ -cycPr ' ch ₂ ch ₃

641 5,6-diCl cf ₃ 642 5,6-diCl cf ₃ 643 5,6-diCl cf ₃ 644 5,6-diCl cf ₃ 645 5,6-diCl cf ₃ 646 5,6-diCl cf ₃ 647 5,6-diCl cf ₃ 648 5,6-diCl cf ₃ 649 6-F cf ₃ 650 6-F cf ₃ 651 6-F cf ₃ 652 6-F cf ₃ 653 6-F cf ₃ 654 6-F cf ₃ 655 6-F cf ₃ 656 6-F cf ₃ 657 6-F cf ₃ 658 6-F cf ₃ 659 6-F cf ₃ 660 6-F cf ₃ 661 6-F cf ₃ 662 6-F cf ₃ 663 6-F cf ₃ 664 6-F cf ₃ 665 6-F cf ₃ 666 6-F cf ₃ 667 6-F cf ₃ 668 6-F cf ₃ 669 6-F cf ₃ 670 6-F cf ₃ 671 6-F cf ₃ 672 6-F cf ₃ 673 6-F cf ₃ 674 6-F cf ₃

CH ₂ CH ₂ -Ph CH ₂ CH ₃ CH ₂ CH ₂ -2-Pyridyl ch ₂ ch ₃ CH ₂ CH ₂ -3-Pyridyl ch ₂ ch ₃ CH ₂ CH ₂ -4-Pyridyl ch ₂ ch ₃ CH ₂ CH ₂ - 2 - f ur anyl ch ₂ ch ₃ CH ₂ CH ₂ -3 - Furan 1 ch ₂ ch ₃ CH ₂ CH ₂ -2-thienyl ch ₂ ch ₃ CH ₂ CH ₂ -3 -1 enyl ch ₂ ch ₃ CsCCH ₂ CH ₂ OH H CsC-CH (OH) Me H CsC- (2-Cl, Ph H C = C- (3-Cl) Ph H CAC- {4-Cl) Ph H ' CsC- (2-F) Ph H CsC- (3-Ph H CsC- (4-F) Ph H CsC- (2-OH) Ph H CsC- (3-OH, Ph H CsC- (4-OH) Ph H CsC- (2-OMe), Ph H CsC- (3-OMe) Ph H CsC- (4-OMe), Ph H CsC- (2-CN) Ph H CsC- (3-CN) Ph H CsC- (4-CN, Ph H CsC- (2-NO ₂₎ , Ph H CsC- (3-NO ₂₎ , Ph H CsC- (4-NO ₂₎ , Ph H CsC- (2-NH ₂₎ , Ph H C = C- (3-NH ₂₎ , Ph H CsC- (4-NH2 ₎ , Ph H C = C- (2-NMe ₂ ) Ph H CeC- (3-NMe ₂ ) Ph H C = C- (4-NMe ₂₎ , Ph The

675 6-F cf ₃ C = C-3-pyridyl H 676 6-F cf ₃ CsC-4-pyridyl H 677 6-F cf ₃ C = C-2-furanyl H 678 6-F cf ₃ CsC-3-furanyl H 679 6-F cf ₃ C = C-2-thienyl. H 680 6-F cf ₃ C = C-3-thienyl. H 681 6-F cf ₃ CsC-2-oxazolyl H 682 6-F cf ₃ CsC-2-thiazolyl H 683 6-F cf ₃ CsC-4-isoxazolyl H 684 6-F cf ₃ C 5 -C 2 -imidazolyl H 685 6-F cf ₃ c = cch ₂ ch ₂ oh H 686 6-F cf ₃ C = C-CH (OH) Me H 687 6-F cf ₃ C = C- (2-Cl) Ph H ' 688 6-F cf ₃ C = C- (3-Cl) Ph H 689 6-F cf ₃ C = C- (4-Cl Ph H 690 6-F cf ₃ C = C- (2-F) Ph H 691 6-F cf ₃ C. C- (3-F) Ph H 692 6-F cf ₃ C = C- (4-F) Ph H 693 6-F cf ₃ C = C- (2-OH) Ph H 694 6-F cf ₃ C = C- (3-OH) Ph H 695 6-F cf ₃ C = C- (4-OH) Ph H 696 6-F cf ₃ C = C- (2-OMe) Ph H 697 6-F cf ₃ C = C- (3-OMe) Ph H 698 6-F cf ₃ C = C- (4-OMe) Ph H 699 6-F cf ₃ C = C- (2-CN) Ph H 700 . 6-F cf ₃ C = C- (3-CN) Ph H 701 6-F cf ₃ C = C- (4-CN) Ph H 702 6-F cf ₃ C = C- (2-NO ₂ ) Ph H 703 6-F cf ₃ C = C- (3-NO ₂ ) Ph H 704 6-F cf ₃ C = C- (4-NO ₂ ) Ph H 705 6-F cf ₃ C = C- (2-NH ₂ ) Ph H 706 6-F cf ₃ C = C- (3-NH ₂ ) Ph H 707 6-F cf ₃ C = C- (4-NH ₂ ) Ph H 708 6-F cf ₃ C = C- (2-NMe ₂ ) Ph H

709 6-F CF ₃ C = C- (3-NMe ₂ ) Ph 710 6-F cf ₃ C = C - (4-NMe ₂ ) Ph 711 6-F cf ₃ C = C-3-pyridyl 712 6-F cf ₃ C-C-4-Pyridyl 713 6-F cf ₃ C = C-2-furanyl 714 6-F cf ₃ C = C-3-furanyl 715 6-F cf ₃ C = C-2-thienyl 716 6-F cf ₃ C = C-3-thienyl 717 6-F cf ₃ C = C-2-oxazolyl 718 6-F cf ₃ C = C-2-thiazolyl 719 6-F cf ₃ C = C-4-isoxazolyl 720 6-F cf ₃ C = C-2-imidazolyl 721 6-F cf ₃ CH ₂ CH ₂ -cycPr 722 6-F cf ₃ CH ₂ CH ₂ CH ₂ CH ₂ OH 723 6-F cf ₃ CH ₂ CH ₂ -CH (OH) Me 724 6-F cf ₃ CH ₂ CH ₂ - (2-Cl) Ph 725 6-F cf ₃ CH ₂ CH ₂ - (3-Cl) Ph 726 6-F cf ₃ CH ₂ CH ₂ - (4-Cl) Ph 727 6-F cf ₃ CH ₂ CH ₂ - (2-F) Ph 728 6-F cf ₃ CH ₂ CH ₂ - (3-F) Ph 729 6-F cf ₃ CH ₂ CH ₂ - (4-F) Ph 730 6-F cf ₃ CH ₂ CH ₂ - (2-OH) Ph 731 6-F cf ₃ CH ₂ CH ₂ - (3-OH) Ph 732 6-F cf ₃ CH ₂ CH ₂ - (4-OH) Ph 733 6-F cf ₃ CH ₂ CH ₂ - (2-OMe) Ph 734 6-F cf ₃ CH ₂ CH ₂ - (3 - ä e) Ph 735 6-F cf ₃ CH ₂ CH ₂ - (4-OMe) Ph 736 6-F cf ₃ CH ₂ CH ₂ - (2-CN) Ph 737 6-F cf ₃ CH ₂ CH ₂ - (3-CN) Ph 738 6-F cf ₃ CH ₂ CH ₂ - (4-CN) Ph 739 6-F cf ₃ CH ₂ CH ₂ - (2-NO ₂ ) Ph 740 6-F cf ₃ CH ₂ CH ₂ - (3-NO ₂ ) Ph 741 6-F cf ₃ CH ₂ CH ₂ - (4-NO ₂ ) Ph 742 6-F cf ₃ CH ₂ CH ₂ - (2-NH ₂ ) Ph

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Κ

Η

Η

Η

Η

Η

Η

Η

Η

Η

ΊΊ

743 6-F cf ₃ CH ₂ CH ₂ - (3-NH ₂ ) Ph H 744 6-F cf ₃ CH ₂ CH ₂ - (4-NH ₂ ) Ph H 745 6-F cf ₃ CH ₂ CH ₂ - (2-NMe ₂ ) Ph H 746 6-F cf ₃ CH ₂ CH ₂ - (3-NMe ₂ ) Ph H 747 6-F CF ₃ CH ₂ CH ₂ - (4-NMe ₂ ) Ph H 748 6-F cf ₃ CH ₂ CH ₂ -3-Pyridyl H 749 6-F cf ₃ CH ₂ CH ₂ -4-Pyridyl H 750 6-F cf ₃ CH ₂ CH ₂ -2-furanyl H 751 6-F cf ₃ CH ₂ CH ₂ -3 - Furan 1 H 752 6-F cf ₃ CH ₂ CH ₂ -2-Lenyl H 753 6-F cf ₃ CH ₂ CH ₂ -3-thienyl H 754 6-F cf ₃ CH ₂ CH ₂ -2-oxazolyl H 755 6-F cf ₃ CH ₂ CH ₂ -2-thiazolyl H 756 6-F cf ₃ CH ₂ CH ₂ -4-isoxazolyl H 757 6-F cf ₃ CH ₂ CH ₂ -2-imidazolyl H 758 6-F cf ₃ CsC-cycPr ch ₃ 759 6-F cf ₃ CsC-Pr ch ₃ 760 6-F cf ₃ CsC-Pr ch ₃ 761 6-F cf ₃ CsC-Bu ch ₃ 762 6-F cf ₃ CsC-Ibu ch ₃ 763 6-F cf ₃ CsC-Bu ch ₃ 764 6-F cf ₃ CsC-Et ch ₃ 765 6-F cf ₃ CEC Me ch ₃ 766 6-F cf ₃ CsC Ph ch ₃ 767 6-F cf ₃ CsC-2-pyridyl ch ₃ 768 6-F cf ₃ Jul-3-pyridyl ch ₃ 769 6-F cf ₃ CsC-4-pyridyl ch ₃ 770 6-F cf ₃ CsC-2 - furan 1 ch ₃ 771 6-F cf ₃ CsC-3 - furan 1 ch ₃ 772 6-F cf ₃ CsC-2-thienyl ch ₃ 773 6-F cf ₃ CsC-3-thienyl ch ₃ 774 6-F cf ₃ C = C-cycPr ch ₃ 775 6-F cf ₃ C = C-iPr ch ₃ 776 6-F cf ₃ C = C-Pr ch ₃

777 6-F cf ₃ C = C-BU ch ₃ 778 6-F cf ₃ C-C-iBu ch ₃ 779 6-F cf ₃ C = C-tBu ch ₃ 780 6-F cf ₃ C = C-Et ch ₃ 781 6-F cf ₃ C-C-Me ch ₃ 782 6-F cf ₃ C-C-Ph ch ₃ 783 6-F cf ₃ C = C-2-Pyridyl ch ₃ 784 6-F cf ₃ C = C-3-pyridyl ch ₃ 785 6-F cf ₃ C-C-4-Pyridyl ch ₃ 786 6-F cf ₃ C = C-2-furanyl ch ₃ 787 6-F cf ₃ C = C-3-furanyl ch ₃ 788 6-F cf ₃ C = C-2-thienyl ch ₃ 789 6-F cf ₃ C = C-3-thienyl ch ₃ 790 6-F cf ₃ CH ₂ CH ₂ -cycPr ch ₃ 791 6-F cf ₃ CH ₂ CH ₂ -Ph ch ₃ 792 6-F cf ₃ CH ₂ CH ₂ -2-Pyridyl ch ₃ 793 6-F cf ₃ CH ₂ CH ₂ -3-Pyridyl ch ₃ 794 6-F cf ₃ CH ₂ CH ₂ -4-Pyridyl ch ₃ 795 6-F cf ₃ CH ₂ CH ₂ -2-furanyl ch ₃ 796 6-F cf ₃ CH ₂ CH ₂ -3-furanyl ch ₃ 797 6-F cf ₃ CH ₂ CH ₂ -2-ethylen ch ₃ 798 6-F cf ₃ CH ₂ CH ₂ -3-thienyl ch ₃ 799 6-F cf ₃ CEC cycPr ch ₂ ch ₃ 800 6-F cf ₃ CEC Ph ch ₂ ch ₃ 801 6-F cf ₃ CsC-2-Pyridyl ch ₂ ch ₃ 802 6-F cf ₃ Jul-3-pyridyl ch ₂ ch ₃ 803 6-F cf ₃ CsC-4-Pyridyl ch ₂ ch ₃ 804 6-F cf ₃ C = C-2-furanyl ch ₂ ch ₃ 805 6-F cf ₃ CsC-3-furanyl ch ₂ ch ₃ 806 6-F cf ₃ C 5 -C 2 -lenyl ch ₂ ch ₃ 807 6-F cf ₃ C 3 -C 3 -lenyl ch ₂ ch ₃ 808 6-F cf ₃ C = C-cycPr ch ₂ ch ₃ 809 6-F cf ₃ C = C · Ph · ch ₂ ch ₃ 810 6-F cf ₃ C = C-2-Pyridyl ch ₂ ch ₃

811 6-F CF ₃ C = C-3-pyridyl CH ₂ CH ₃ 812 6-F cf ₃ C-C-4-Pyridyl ch ₂ ch ₃ 813 6-F cf ₃ C = C-2-furanyl ch ₂ ch ₃ 814 6-F cf ₃ C = C-3-furanyl CH2CH3 815 6-F cf ₃ C = C-2-Lienyl CH ₂ CH ₃ 816 6-F cf ₃ C = C-3-thienyl CH ₂ CH ₃ 817 6-F cf ₃ CH2CH2-cycPr CH ₂ CH ₃ 818 6-F cf ₃ CH ₂ CH ₂ -Ph ch ₂ ch ₃ 819 6-F cf ₃ CH ₂ CH ₂ -2-Pyridyl CH2CH3 820 6-F cf ₃ CH2CH2-3-pyridyl ch ₂ ch ₃ 821 6-F cf ₃ CH2CH2-4-pyridyl ch ₂ ch ₃ 822 6-F cf ₃ CH2CH2-2-furány1 ch ₂ ch ₃ 823 6-F cf ₃ CH2CH2-3-furan 1 ch ₂ ch ₃ 824 6-F cf ₃ CH2CH2-2-thienyl ch ₂ ch ₃ 825 6-F cf ₃ CH ₂ CH ₂ -3-thienyl ch ₂ ch ₃ 826 5-Cl cf ₃ CsC-cycPr h 827 5-Cl cf ₃ CsCCH ₂ CH ₂ OH h 828 5-Cl cf ₃ C = C-CH (OH) Me H 829 5-Cl cf ₃ CsC Ph H 830 5-Cl cf ₃ CsC- (2-Cl) Ph H 831 5-C1 cf ₃ CEC-(3-Cl) Ph H 832 5-Cl cf ₃ CsC- (4-Cl) Ph H 833 5-Cl cf ₃ C = C- (2-F) Ph H 834 5-Cl cf ₃ C = C- (3-F, Ph H 835 5-Cl cf ₃ C = C- (4-F) Ph H 836 5-Cl cf ₃ CsC- (2-OH) Ph H 837 "5-Cl cf ₃ CsC- (3-OH, Ph H 838 5-Cl cf ₃ OC- (4-OH) Ph H 839 5-Cl cf ₃ CsC- (2-OMe) Ph H 840 5-Cl cf ₃ CsC- (3-OMe) Ph H 841 5-Cl cf ₃ CsC- (4-OMe) Ph H 842 5-Cl cf ₃ CsC- (2-CN) Ph H 843 5-Cl cf ₃ CsC- {3-CN) Ph H 844 5-Cl cf ₃ CsC- (4-CN) Ph H

845 5-Cl CF ₃ CsC- (2-NO ₂ ) Ph H 846 5-Cl cf ₃ CsC- _(3-NO2) Ph H 847 5-Cl cf ₃ CSC- _(4-NO2) Ph H 848 5-Cl cf ₃ CsC- (2-NH ₂ ) Ph H 849 5-Cl cf ₃ CsC- _(3-NH2) Ph H 850 5-Cl cf ₃ CsC- _(4-NH2) Ph H 851 5-Cl cf ₃ CsC- (2-NMe ₂ ) Ph H 852 5-Cl cf ₃ CsC- (3-NMe ₂ ) Ph H 853 5-Cl cf ₃ C = C- (4-NMe ₂ ) Ph H 854 5-Cl cf ₃ CsC-2-Pyridyl H 855 5-Cl cf ₃ CsC-2-pyridyl H 856 5-Cl, cf ₃ CsC-3-pyridyl H 857 5-Cl cf ₃ CsC-4-pyridyl H 858 5-Cl cf ₃ C 1 -C 2 -furan 1 H 859 5-Cl cf ₃ CsC-3-furanyl H 860 5-Cl cf ₃ C = C-2-thienyl H 861 5-Cl cf ₃ C = C-3-thienyl H 862 5-Cl cf ₃ C = C-2-oxazolyl H 863 5-Cl cf ₃ C = C-2-thiazolyl H 864 5-Cl cf ₃ CsC-4-izoxazo1y1 H 865 5-Cl cf ₃ CsC-2-imidazolyl H 866 5-Cl cf ₃ C = C-cycPr H 867 5-Cl cf ₃ C = CCH ₂ CH ₂ OH H 868 5-Cl cf ₃ C = C-CH (OH) Me H 869 5-Cl cf ₃ C-C-Ph H 870 5-Cl cf ₃ C = C- (2-Cl) Ph H 871 5-Cl cf ₃ C = C- (3-Cl) Ph H 872 5-Cl cf ₃ C = C- (4-Cl) Ph H 873 5-Cl cf ₃ C = C- {2-F) Ph H 874 5-Cl cf ₃ C. C- (3-F) Ph H 875 5-Cl cf ₃ C = C- (4-F) Ph H 876 5-Cl cf ₃ C = C- (2-OH) Ph H 877 5-Cl cf ₃ C = C- (3-OH) Ph H 878 5-Cl cf ₃ C = C- (4-OH) Ph H

879 5-Cl CF3 C = C- (2-OMe) Ph H 880 5-Cl CF ₃ C = C- (3-OMe) Ph H 881 5-Cl ’ cf ₃ C = C- (4-OMe) Ph H 882 S-C cf ₃ C = C- (2-CN) Ph H 883 5-Cl cf ₃ C = C- (3-CN) Ph H 884 5-Cl cf ₃ C = C- (4-CN) Ph H 885 5-Cl CF3 C = C- (2-NO ₂ ) Ph H 886 5-Cl cf ₃ C = C- (3-NO ₂ ) Ph H 887 5-Cl cf ₃ C = C- (4-NO ₂ ) Ph H 888 5-Cl cf ₃ C = C- (2-NH ₂ ) Ph H 889 5-Cl cf ₃ C = C- (3-NH ₂ ) Ph H 890 5-Cl cf ₃ C = C- (4-NH ₂ ) Ph H 891 5-Cl CF3 C = C- (2-NMe ₂ ) Ph H 892 5-Cl cf ₃ C = C- (3-NMe ₂ ) Ph H 893 5-Cl cf ₃ C = C- (4-NMe ₂ ) Ph H 894 5-Cl cf ₃ C = C-2-Pyridyl H 895 5-Cl cf ₃ C = C-2-Pyridyl H 896 5-Cl CF3 C = C-3-pyridyl H 897 5-Cl CF3 C = C-4-Pyridyl H 898 5-Cl cf ₃ C = C-2-furanyl H 899 5-Cl cf ₃ C = C-3-furanyl H 900 5-Cl CF3 C = C-2-thienyl H 901 5-Cl cf ₃ C = C-3-thienyl H 902 5-Cl cf ₃ C = C-2-oxazolyl H 903 5-Cl cf ₃ C = C-2-Liazolyl H 904 5-Cl cf ₃ C = C-4-isoxazolyl H 905 5-Cl cf ₃ C = C-2-imidazolyl H 906 5-Cl cf ₃ CH ₂ CH ₂ -cycPr H 907 5-Cl cf ₃ CH ₂ CH ₂ CH ₂ CH ₂ OH H 908 5-Cl cf ₃ CH ₂ CH ₂ -CH (OH) Me H 909 5-Cl cf ₃ CH ₂ CH ₂ Ph H 910 5-Cl CF3 CH 2 CH 2 - (2-Cl) Ph H 911 5-Cl cf ₃ CH ₂ CH ₂ - (3-Cl) Ph H 912 5-Cl cf ₃ CH ₂ CH ₂ - (4-Cl) Ph H

913 5-Cl CF ₃ 914 5-Cl cf ₃ 915 5-Cl cf ₃ 916 5-Cl cf ₃ 917 5-Cl cf ₃ 918 5-Cl cf ₃ 919 5-Cl cf ₃ 920 5-Cl cf ₃ 921 5-Cl cf ₃ 922 5-Cl cf ₃ 923 5-Cl cf ₃ 924 5-Cl cf ₃ 925 5-Cl cf ₃ 926 5-Cl cf ₃ 927 5-Cl cf ₃ 928 5-Cl cf ₃ 929 5-Cl cf ₃ 930 5-Cl cf ₃ 931 5-Cl cf ₃ 932 5-Cl cf ₃ 933 5-Cl cf ₃ 934 5-Cl cf ₃ 935 5-Cl cf ₃ 936 5-Cl cf ₃ 937 5-Cl cf ₃ 938 5-Cl cf ₃ 939 5-Cl cf ₃ 940 5-Cl cf ₃ 941 5-Cl cf ₃ 942 5-Cl cf ₃ 943 5-Cl cf ₃ 944 5-Cl cf ₃ 945 5-Cl cf ₃ 946 5-Cl cf ₃

CH ₂ CH ₂ - (2-F) Ph H

CH ₂ CH ₂ - (3-F) Ph H

CH ₂ CH ₂ - (4-F) Ph H

CH ₂ CH ₂ - (2-OH) Ph H

CH ₂ CH ₂ - (3-OH) Ph H

CH ₂ CH ₂ - (4-OH) Ph H

CH ₂ CH ₂ - (2-OMe) Ph H

CH ₂ CH ₂ - (3-OMe) Ph H

CH ₂ CH ₂ - (4-OMe) Ph H

CH ₂ CH ₂ - (2-CN) Ph H

CH ₂ CH ₂ - (3-CN) Ph H

CH ₂ CH ₂ - (4-CN) Ph H

CH ₂ CH ₂ - (2-NO ₂ ) Ph H

CH ₂ CH ₂ - (3-NO ₂ ) Ph H

CH ₂ CH ₂ - (4-NO ₂ ) Ph H

CH ₂ CH ₂ - (2-NH ₂ ) Ph H

CH ₂ CH ₂ - (3-NH ₂ ) Ph H

CH ₂ CH ₂ - (4-NH ₂ ) Ph H

CH ₂ CH ₂ - (2 -NMe ₂ ) Ph H

CH ₂ CH ₂ - (3 -NMe ₂ ) Ph H

CH ₂ CH ₂ - (4-NMe ₂ ) Ph H

CH ₂ CH ₂ -2-Pyridyl H

CH ₂ CH ₂ -3-Pyridyl H

CH ₂ CH ₂ -4-Pyridyl H

CH ₂ CH ₂ -2-furanyl H

CH ₂ CH ₂ -3-furanyl H

CH ₂ CH ₂ -2-1 ienyl H

CH ₂ CH ₂ -3-1 ienyl H

CH ₂ CH ₂ -2-oxazolyl H

CH ₂ CH ₂ -2-thiazolyl H

CH ₂ CH ₂ -4-isoxazolyl H

CH ₂ CH ₂ -2-imidazoles 1 H

Jul-cycPr _CH3

CeC-Ph CH ₃

947 5-Cl CF ₃ CSC-2-pyridyl ch ₃ 948 5-Cl CF ₃ CsC-3-pyridyl ch ₃ 949 5-Cl CF ₃ Jul-4-pyridyl ch ₃ 950 5-Cl CF ₃ CsC-2-furanyl ch ₃ 951 5-Cl CF ₃ Csc-3-f uranyl ch ₃ 952 5-Cl cf ₃ Cec-2-thienyl ch ₃ 953 5-Cl CF ₃ C 6 -C 3 -phenyl ch ₃ 954 5-Cl CF ₃ C = C-cycPr ch ₃ 955 5-Cl CF ₃ C-C-Ph ch ₃ 956 5-Cl CF3 C = C-2-Pyridyl ch ₃ 957 5-Cl cf ₃ C = C-3-pyridyl ch ₃ 958 5-Cl cf ₃ C-C-4-Pyridyl ch ₃ 959 5-Cl CF ₃ C = C-2-furanyl ch ₃ 960 5-Cl CF ₃ C = C-3-furanyl ch ₃ 961 5-Cl cf ₃ C = C-2-thienyl ch ₃ 962 5-Cl cf ₃ C = C-3-thienyl ch ₃ 963 5-Cl cf ₃ Chachi-cycPr ch ₃ 964 5-Cl CF ₃ CH ₂ CH ₂ -Ph ch ₃ 965 5-Cl cf ₃ CH2CH2-2-pyridyl ch ₃ 966 5-Cl cf ₃ CH ₂ CH ₂ -3-Pyridyl ch ₃ 967 5-Cl cf _{3 CH2} CH2-4-pyridyl ch ₃ 968 5-Cl CF ₃ CH ₂ CH ₂ -2-furanyl ch ₃ 969 5-Cl cf ₃ CH2CH2-3-furan 1 ch ₃ 970 5-Cl cf ₃ CH ₂ CH ₂ -2-1 enyl ch ₃ 971 5-Cl cf ₃ CH2CH2-3-1 ienyl ch ₃ 972 5-Cl cf ₃ CsC-cycPr ch ₂ ch ₃ 973 5-Cl cf ₃ CaC-Ph ch ₂ ch ₃ 974 5-Cl cf ₃ CsC-2-pyridyl ch ₂ ch ₃ 975 5-Cl cf ₃ CBC-3-pyridyl CH 2 CH ₃ 976 5-Cl cf ₃ CsC-4-pyridyl CH ₃ CH ₃ 977 5-Cl cf ₃ CeC-2-furanyl CH2CH3 978 5-Cl cf ₃ Cbc-3-furanyl ch ₂ ch ₃ 979 5-Cl cf ₃ CsC-2-1 enyl ch ₂ ch ₃ 980 5-Cl cf ₃ Jul-3-thienyl ch ₂ ch ₃

981 5-Cl CF3 C = C-cycPr CH2CH3 982 5-Cl cf ₃ C-C-Ph CH2CH3 983 5-Cl cf ₃ C = C-2-Pyridyl CH2CH3 984 5-Cl CF ₃ C = C-3-pyridyl CH 2 CH ₃ 985 5-Cl cf ₃ C-C-4-Pyridyl CH2CH3 986 5-Cl cf ₃ C = C-2-furanyl CH 2 CH ₃ 987 5-Cl CF ₃ C = C-3-furanyl CH2CH3 988 5-Cl cf ₃ C = C-2-thienyl CH ₂ CH ₃ 989 5-Cl cf ₃ C = C-3-thienyl CH2CH3 990 5-Cl cf ₃ CHaCHz-cycPr CH2CH3 991 5-Cl cf ₃ CH 2 CH ₂ Ph CH ₂ CH ₃ 992 5-Cl cf ₃ CH ₂ CH ₂ -2-Pyridyl CH2CH3 993 5-Cl cf ₃ CH2CH2-3-Pyridyl CH2CH3 994 5-Cl cf ₃ CH2CH2-4-pyridyl CH2CH3 995 5-Cl cf ₃ CH 2 CH 2 -2 -furan 1 CH2CH3 996 5-Cl cf ₃ CH 2 CH 2 -3 -furan 1 CH2CH3 997 5-Cl cf ₃ CH2CH2-2-thienyl CH2CH3 998 5-Cl cf ₃ CH2CH2-3-thienyl CH2CH3 999 5-F cf ₃ CEC cycPr H 1000 F-5 cf ₃ CBCCH2CH2OH H 1001 5-F cf ₃ CsC-CH (OH) Me H 1002 5-F cf ₃ CsC Ph H 1003 5-F cf ₃ CsC- (2-Cl) Ph H 1004 5-F cf ₃ CsC- (3-Cl) Ph H 1005 5-F cf ₃ CsC- (4-Cl) Ph H 1006 5-F cf ₃ CEC-(2-F) Ph H 1007 5-F cf ₃ CAC- (3-Ph H 1008 5-F cf ₃ CSC- (4-F) Ph H 1009 5-F cf ₃ C = C- (2-OH) Ph H 1010 5-F cf ₃ CsC- (3-OH) Ph H 1011 5-F cf ₃ CC (4-OH) Ph H 1012 5-F cf ₃ OsC- (2-OMe) Ph H 1013 5-F cf ₃ CEC-(3-OMe) Ph H 1014 5-F cf ₃ CSC- (4-OMe) Ph H

1015 5-F cf ₃ CsC- (2-CN) Ph H 1016 5-F cf ₃ C = C- (3-CN) Ph H 1017 5-F cf ₃ CsC- (4-CN) Ph H 1018 5-F cf ₃ CsC- (2-NO ₂ ) Ph H 1019 5-F cf ₃ CsC- _(3-NO2) Ph H 1020 5-F cf ₃ CsC- (4-NO ₂ ) Ph H 1021 5-F cf ₃ CsC- (2-NH ₂ ) Ph H 1022 5-F cf ₃ CsC- _(3-NH2) Ph H 1023 5-F cf ₃ CsC- _(4-NH2) Ph H 1024 5-F cf ₃ CsC- (2-NMe ₂ ) Ph H 1025 5-F cf ₃ CsC- (3-NMe ₂ ) Ph H 1026 5-F cf ₃ CsC- (4-NMe ₂ ) Ph H 1027 5-F cf ₃ CsC-2-pyridyl H 1028 5-F cf ₃ CsC-2-pyridyl H 1029 5-F cf ₃ CsC-3-pyridyl H 1030 5-F cf ₃ CsC-4-pyridyl H 1031 5-F cf ₃ CsC-2-furanyl H 1032 5-F cf ₃ CsC-3-furanyl H 1033 5-F cf ₃ CsC-2-thienyl H 1034 5-F cf ₃ CsC-3-thienyl H 1035 5-F cf ₃ CsC-2-oxazolyl H 1036 5-F cf ₃ CsC-2-thiazolyl H 1037 5-F cf ₃ CsC-4-isoxazolyl H 1038 5-F cf ₃ CsC-2-imidazolyl H 1039 5-F cf ₃ C = C-cycPr H 1040 5-F cf ₃ C = CCH ₂ CH ₂ OH H 1041 5-F cf ₃ C = C-CH (OH) Me H 1042 5-F cf ₃ C-C-Ph H 1043 5-F cf ₃ C = C- (2-Cl) Ph H 1044 5-F cf ₃ C = C- (3-Cl) Ph H 1045 5-F cf ₃ C = C- (4-Cl) Ph H in 1046 5-F cf ₃ C = C- (2-F) Ph H 1047 5-F cf ₃ C. C- (3-F) Ph The 1048 5-F cf ₃ C = C- (4-F) Ph H

1049 5-F CF ₃ C = C- (2-OH) Ph 1050 5-F cf ₃ C = C- (3-OH) Ph in 1051 5-F cf ₃ C = C- (4-OH) Ph 1052 5-F cf ₃ C = C- (2-OMe) Ph 1053 5-F cf ₃ C = C- (3-OMe) Ph 1054 5-F cf ₃ C = C- (4-OMe) Ph 1055 5-F cf ₃ C = C- (2-CN) Ph 1056 5-F cf ₃ C = C- (3-CN) Ph 1,057 5-F cf ₃ C = C- (4-CN) Ph 1058 5-F cf ₃ C = C- (2-NO ₂ ) Ph 1059 5-F cf ₃ C = C- (3-NO ₂ ) Ph 1060 5-F cf ₃ C = C- (4-NO ₂ ) Ph 1061 5-F cf ₃ C = C- (2-NH ₂ ) Ph 1062 5-F cf ₃ C = C- (3-NH ₂ ) Ph 1063 5-F cf ₃ C = C- (4-NH ₂ ) Ph 1064 5-F cf ₃ C = C- (2-NMe ₂ ) Ph 1065 5-F cf ₃ C = C- (3-NMe ₂ ) Ph 1066 5-F cf ₃ C = C- (4-NMe ₂ ) Ph 1067 5-F cf ₃ C = C-2-Pyridyl 1068 5-F cf ₃ C = C-2-Pyridyl 1069 5-F cf ₃ C = C-3-pyridyl 1070 5-F cf ₃ C-C-4-Pyridyl 1071 5-F cf ₃ C = C-2-furanyl 1072 5-F cf ₃ C = C-3-furanyl 1073 5-F cf ₃ C = C-2-thienyl 1074 5-F cf ₃ C = C-3-thienyl 1075 5-F cf ₃ C = C-2-oxazolyl 1076 5-F cf ₃ C = C-2-thiazolyl 1077 5-F cf ₃ C-C-4-isoxazolyl 1078 5-F cf ₃ C = C-2-imidazolyl 1079 5-F cf ₃ CH ₂ CH ₂ -cycPr 1080 5-F cf ₃ CH ₂ CH ₂ CH ₂ CH ₂ OH 1081 5-F cf ₃ CH ₂ CH ₂ -CH (OH) Me 1082 5-F cf ₃ CH ₂ CH ₂ Ph

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

1083 5-F cf ₃ CH ₂ CH ₂ - (2-Cl, Ph H 1084 5-F cf ₃ CH ₂ CH ₂ - (3-Cl, Ph H 1085 5-F cf ₃ CH ₂ CH ₂ - (4-C1) Ph H 1086 5-F cf ₃ CH ₂ CH ₂ - (2-F, Ph H 1087 5-F cf ₃ CH ₂ CH ₂ - (3-F, Ph H 1088 5-F cf ₃ CH ₂ CH ₂ - (4-F) Ph H 1089 5-F cf ₃ CH ₂ CH ₂ - (2-OH) Ph H 1090 5-F cf ₃ CH ₂ CH ₂ - (3-OH) Ph H 1091 5-F cf ₃ CH ₂ CH ₂ - (4-OH, Ph H 1092 5-F cf ₃ CH ₂ CH ₂ - (2-OMe, Ph H 1093 5-F cf ₃ CH ₂ CH ₂ - (3-OMe, Ph H 1094 5-F cf ₃ CH ₂ CH ₂ - (4-OMe, Ph H 1095 5-F cf ₃ CH ₂ CH ₂ - (2-CN) Ph H 1096 5-F cf ₃ CH ₂ CH ₂ - (3-CN) Ph H 1097 5-F cf ₃ CH ₂ CH ₂ - (4-CN, Ph H 1098 5-F cf ₃ CH ₂ CH ₂ - (2-NO ₂ ) Ph H 1099 5-F cf ₃ CH ₂ CH ₂ - (3-NO ₂ ) Ph H 1100 5-F cf ₃ CH ₂ CH ₂ - (4-NO ₂ ) Ph H 1101 5-F cf ₃ CH ₂ CH ₂ - (2-NH ₂ , Ph H 1102 5-F cf ₃ CH ₂ CH ₂ - (3-NH ₂ ) Ph H 1103 5-F cf ₃ CH ₂ CH ₂ - (4-NH ₂ , Ph H 1104 5-F cf ₃ CH ₂ CH ₂ - (2-NMe ₂ , Ph H 1105 5-F cf ₃ CH ₂ CH ₂ - (3-NMe ₂ , Ph H 1106 5-F cf ₃ CH ₂ CH ₂ - (4-NMe ₂ , Ph H 1107 5-F cf ₃ CH ₂ CH ₂ -2 -Pyridyl H 1108 5-F cf ₃ CH ₂ CH ₂ -3-Pyridyl H 1109 5-F cf ₃ CH ₂ CH ₂ -4-Pyrxdyl H 1110 5-F cf ₃ CH ₂ CH ₂ -2-furanyl H 1111 5-F cf ₃ CH ₂ CH ₂ -3-furanyl H 1112 5-F cf ₃ CH ₂ CH ₂ -2-1 ienyl H 1113 5-F cf ₃ CH ₂ CH ₂ -3-thienyl H 1114 5-F cf ₃ CH ₂ CH ₂ -2-oxazolyl H 1115 5-F cf ₃ CH ₂ CH ₂ -2-thiazolyl H 1116 5-F cf ₃ CH ₂ CH ₂ -4-oxazolyl H

1117 5-F . cf ₃ CH ₂ CH ₂ -2-imidazolyl H 1118 5-F cf ₃ CaC-cycPr ch ₃ 1119 5-F cf ₃ CsC Ph ch ₃ 1120 5-F cf ₃ CsC-2-pyridyl ch ₃ 1121 5-F cf ₃ Jul-3-pyridyl ch ₃ 1122 5-F cf ₃ CsC-4-pyridyl ch ₃ 1123 5-F cf ₃ CsC-2-furanyl ch ₃ 1124 5-F cf ₃ C 1-4 '-3-furanyl ch ₃ 1125 5-F cf ₃ CsC-2-enyl ch ₃ 1126 5-F cf ₃ C = C-3-thienyl ch ₃ 1127 5-F cf ₃ C = C-cycPr ch ₃ 1128 5-F cf ₃ C-C-Ph ch ₃ 1129 5-F cf ₃ C = C-2-Pyridyl ch ₃ 1130 5-F cf ₃ C = C-3-pyridyl ch ₃ 1131 5-F cf ₃ C-C-4-Pyridyl ch ₃ 1132 5-F cf ₃ C = C-2-uranyl ch ₃ 1133 5-F cf ₃ C = C-3-uranyl ch ₃ 1134 5-F cf ₃ C = C-2-enyl ch ₃ 1135 5-F cf ₃ C = C-3-thienyl ch ₃ 1136 5-F cf ₃ CH ₂ CH ₂ -cycPr ch ₃ 1137 5-F cf ₃ CH ₂ CH ₂ -Ph ch ₃ 1138 5-F cf ₃ CH ₂ CH ₂ -2-Pyridyl ch ₃ 1139 5-F cf ₃ CH ₂ CH ₂ -3-Pyridyl ch ₃ 1140 5-F cf ₃ CH ₂ CH ₂ -4-Pyridyl ch ₃ 1141 5-F cf ₃ CH ₂ CH ₂ -2-furan 1 ch ₃ 1142 5-F cf ₃ CH ₂ CH ₂ -3-furanyl ch ₃ 1143 5-F cf ₃ CH ₂ CH ₂ -2-thienyl ch ₃ 1144 5-F cf ₃ CH ₂ CH ₂ -3-thienyl ch ₃ 1145 5-F cf ₃ CXL-cycPr ch ₂ ch ₃ 1146 5-F cf ₃ C-C-Ph ch ₂ ch ₃ 1147 5-F cf ₃ CBC-2-pyridyl ch ₂ ch ₃ 1148 5-F cf ₃ CsC-3-pyridyl ch ₂ ch ₃ 1149 5-F cf ₃ OEC-4-pyridyl CH2CH3 1150 5-F cf ₃ CsC-2-furanyl ch ₂ ch ₃

5-F CF ₃ CsC-3-furanyl ch ₂ ch ₃ 5-F cf ₃ CsC-2-1 enyl ch ₂ ch ₃ 5-F cf ₃ CsC-3-Lienyl ch ₂ ch ₃ 5-F cf ₃ C = C-cycPr . ch ₂ ch ₃ 5-F cf ₃ C-C-Ph ch ₂ ch ₃ 5-F cf ₃ C = C-2-Pyridyl ch ₂ ch ₃ 5-F cf ₃ C = C-3-pyridyl ch ₂ ch ₃ 5-F cf ₃ C-C-4-Pyridyl ch ₂ ch ₃ 5-F cf ₃ C = C-2-furanyl ch ₂ ch ₃ 5-F cf ₃ C = C-3-furanyl ch ₂ ch ₃ 5-F cf ₃ C = C-2-thienyl ch ₂ ch ₃ 5-F cf ₃ C = C-3-thienyl ch ₂ ch ₃ 5-F cf ₃ CH ₂ CH ₂ -cycPr ch ₂ ch ₃ 5-F cf ₃ CH ₂ CH ₂ -Ph ch ₂ ch ₃ 5-F cf ₃ CH ₂ CH ₂ -2-Pyridyl ch ₂ ch ₃ 5-F cf ₃ CH ₂ CH ₂ -3-Pyridyl ch ₂ ch ₃ 5-F cf ₃ CH ₂ CH ₂ - 4 - Pyridyl ch ₂ ch ₃ 5-F cf ₃ CH ₂ CH ₂ -2-furan 1 ch ₂ ch ₃ 5-F cf ₃ CH ₂ CH ₂ -3 - Furan 1 ch ₂ ch ₃ 5-F cf ₃ CH ₂ CH ₂ -2-thienyl ch ₂ ch ₃ 5-F cf ₃ CH ₂ CH ₂ -3-thienyl ch ₂ ch ₃ 5-C1-6-F cf ₃ CC-cycPr H 5-Cl, 6-F cf ₃ CsC Ph H 5-Cl, 6-F CF ₃ CsC-2-pyridyl H 5-Cl, 6-F cf ₃ C = C-3-pyridyl H 5-C1-6-F cf ₃ CsC-4-pyridyl H 5-C1,6-F cf ₃ CsC-2-furány1 H 5-Cl, 6-F cf ₃ CsC-3-furány1 H 5-Cl, 6-F cf ₃ Jul-2-thienyl H 5-Cl, 6-F cf ₃ Jul-3-thienyl H 5-C1-6-F cf ₃ C = C-cycPr H 5-Cl, 6-F cf ₃ C-C-Ph H 5-C1-6-F cf ₃ C = C-2-Pyridyl H 5-Cl, 6-F cf ₃ C = C-3-pyridyl H

1185 5-Cl, 6-F cf ₃ C-C-4-Pyridyl H 1186 5-C1-6-F cf ₃ C = C-2-furanyl H 1187 5-C1-6-F cf ₃ C = C-3-furanyl H 1188 5-C1-6-F cf ₃ C = C-2-thienyl H 1189 5-Cl, 6-F cf ₃ C = C-3-thienyl H 1190 5-C1-6-F cf ₃ CH ₂ CH ₂ -cycPr H 1191 5-C1-6-F cf ₃ CH ₂ CH ₂ -Ph H 1192 5-C1-6-F cf ₃ CH ₂ CH ₂ -2-Pyridyl H 1193 5-C1-6-F cf ₃ CH ₂ CH ₂ -3-Pyridyl H 1194 5-C1-6-F cf ₃ CH ₂ CH ₂ -4 - Pyridyl H 1195 5-C1-6-F cf ₃ CH ₂ CH ₂ -2-furan 1 H 1196 5-Cl, 6-F cf ₃ CH ₂ CH ₂ -3-furanyl H 1197 5-C1-6-F cf ₃ CH ₂ CH ₂ -2-thienyl H ' 1198 5-C1-6-F cf ₃ CH ₂ CH ₂ -3-thienyl H 1199 5-C1-6-F cf ₃ CsC-cycPr ch ₃ 1200 5-C1-6-F cf ₃ CEC Ph ch ₃ 1201 5-C1-6-F cf ₃ CsC-2-pyridyl ch ₃ 1202 5-C1-6-F cf ₃ C = C-3-pyridyl ch ₃ 1203 5-C1-6-F cf ₃ C ^ C-4-Pyridyl ch ₃ 1204 5-C1-6-F cf ₃ CsC-2-furanyl ch ₃ 1205 5-Cl, 6-F cf ₃ C = C-3-furanyl ch ₃ 1206 5-Cl, 6-F cf ₃ CsC-2-thienyl ch ₃ 1207 5-Cl, 6-F cf ₃ CbC-3-thienyl ch ₃ 1208 5-C1-6-F cf ₃ C = C-cycPr ch ₃ 1209 5-Cl, 6-F cf ₃ C-C-Ph ch ₃ 1210 5-C1-6-F cf ₃ C = C-2-Pyridyl ch ₃ 1211 5-Cl, 6-F cf ₃ C = C-3-pyridyl ch ₃ 1212 5-C1-6-F cf ₃ C-C-4-Pyridyl ch ₃ 1213 5-Cl, 6-F cf ₃ C = C-2-furanyl ch ₃ 1214 5-Cl, 6-F cf ₃ C = C-3-furanyl ch ₃ 1215 5-Cl, 6-F cf ₃ C = C-2-thienyl ch ₃ 1216 5-Cl, 6-F cf ₃ C = C-3-thienyl ch ₃ 1217 5-Cl, 6-F cf ₃ CH ₂ CH ₂ -cycPr ch ₃ 1218 5-Cl, 6-F cf ₃ CH ₂ CH ₂ -Ph ch ₃

1219 5-C1-6-F cf ₃ CH ₂ CH ₂ -2-Pyridyl ch ₃ 1220 5-C1-6-F cf ₃ CH ₂ CH ₂ -3-Pyridyl CH ₃ 1221 5-Cl, 6-F cf ₃ CH ₂ CH ₂ -4-Pyridyl ch ₃ 1222 5-C1-6-F cf ₃ CH ₂ CH ₂ -2-furanyl ch ₃ 1223 5-C1-6-F cf ₃ CH ₂ CH ₂ -3 - Furan 1 ch ₃ 1224 5-C1-6-F cf ₃ CH ₂ CH ₂ -2-thienyl ch ₃ 1225 5-C1-6-F cf ₃ CH ₂ CH ₂ -3-thienyl ch ₃ 1226 5-F, 6-Cl cf ₃ CsC-cycPr H 1227 5-C1-F.6 cf ₃ CsC Ph H 1228 5-F, 6-Cl cf ₃ CsC-2-pyridyl H 1229 5-F, 6-Cl cf ₃ CsC-3-pyridyl H 1230 5-F, 6-Cl cf ₃ CsC-4-pyridyl H 1231 5-F, 6-Cl cf ₃ CsC-2-furanyl H 1232 5-F, 6-Cl cf ₃ C = C-3-furanyl H 1233 5-F, 6-Cl cf ₃ CsC-2-thienyl H 1234 5-F, 6-Cl cf ₃ C 6 -C 3 -thienyl H 1235 5-F, 6-Cl cf ₃ C = C-cycPr H 1236 5-F, 6-Cl cf ₃ C-C-Ph H 1237 5-F, 6-Cl cf ₃ C = C-2-Pyridyl H 1238 5-F, 6-Cl cf ₃ C = C-3-pyridyl H 1239 5-F, 6-Cl cf ₃ C-C-4-Pyridyl H 1240 5-F, 6-Cl cf ₃ C = C-2-furanyl H 1241 5-F, 6-Cl cf ₃ C = C-3-uranyl H 1242 5-F, 6-Cl cf ₃ C = C-2-thienyl H 1243 5-F, 6-Cl cf ₃ C = C-3-thienyl H 1244 5-F, 6-Cl cf ₃ CH ₂ CH ₂ -cycPr H 1245 5-F, 6-Cl cf ₃ CH ₂ CH ₂ -Ph H 1246 5-F, 6-Cl cf ₃ CH ₂ CH ₂ -2-Pyridyl H 1247 5-F, 6-Cl cf ₃ CH ₂ CH ₂ -3-Pyridyl H 1248 5-F, 6-Cl cf ₃ CH ₂ CH ₂ -4-Pyridyl H 1249 5-F, 6-Cl cf ₃ CH ₂ CH ₂ -2-furans 1 H 1250 5-Cl-F.6 cf ₃ CH ₂ CH ₂ -3-furanyl H 1251 5-F, 6-Cl cf ₃ CH ₂ CH ₂ -2-thienyl H 1252 5-F, 6-Cl cf ₃ CH ₂ CH ₂ -3-thienyl H

1253 5-F, 6-Cl CF ₃ CsC-cycPr CH ₃ 1254 5-F, 6-Cl cf ₃ CsC Ph CH ₃ 1255 5-F, 6-Cl cf ₃ CsC-2-pyridyl ch ₃ 1256 5-F, 6-Cl cf ₃ Jul-3-pyridyl ch ₃ 1257 5-F, 6-Cl cf ₃ C = C-4-Pyridyl ch ₃ 1258 5-F, 6-Cl cf ₃ CsC-2 - furan 1 ch ₃ 1259 5-C1-F.6 cf ₃ CC-3-furanyl ch ₃ 1260 5-F, 6-C1 cf ₃ CsC-2-thienyl ch ₃ 1261 5-C1-F.6 cf ₃ C 6 -C 3 -thienyl ch ₃ 1262 5-C1-F.6 cf ₃ C = C-cycPr ch ₃ 1263 5-F, 6-Cl cf ₃ C-C-Ph ch ₃ 1264 5-C1-F.6 cf ₃ C = C-2-Pyridyl ch ₃ 1265 5-F, 6-Cl cf ₃ C = C-3-pyridyl ch ₃ 1266 5-F, 6-Cl cf ₃ C-C-4-Pyridyl ch ₃ 1267 5-C1-F.6 cf ₃ C = C-2-uranyl ch ₃ 1268 5-C1-F.6 cf ₃ C = C-3-uranyl ch ₃ 1269 5-F, 6-Cl cf ₃ C = C-2-thienyl ch ₃ 1270 5-C1-F.6 cf ₃ C = C-3-thienyl ch ₃ 1271 5-F, 6-Cl cf ₃ CH ₂ CH ₂ -cycPr ch ₃ 1272 5-C1-F.6 cf ₃ CH ₂ CH ₂ -Ph ch ₃ 1273 5-F, 6-Cl cf ₃ CH ₂ CH ₂ -2-Pyridyl ch ₃ 1274 5-C1-F.6 cf ₃ CH ₂ CH ₂ -3-Pyridyl ch ₃ 1275 5-F, 6-Cl cf ₃ CH ₂ CH ₂ -4-Pyridyl ch ₃ 1276 5-F, 6-Cl cf ₃ CH ₂ CH ₂ -2-furanyl ch ₃ 1277 5-F, 6-Cl cf ₃ CH ₂ CH ₂ -3-furanyl ch ₃ 1278 5-F, 6-Cl cf ₃ CH ₂ CH ₂ -2-thienyl ch ₃ 1279 5-C1-F.6 cf ₃ CH ₂ CH ₂ -3-thienyl ch ₃ 1280 6-1-8-F cf ₃ CsC-cycPr H 1281 6-Cl, 8-F cf ₃ CsC Ph H 1282 6-Cl, 8-F cf ₃ OC-2-pyridyl H 1283 6-Cl, 8-F cf ₃ CsC-3-pyridyl H 1284 6-Cl, 8-F cf ₃ CsC-4 -Pyr idyl H 1285 6-Cl, 8-F cf ₃ CsC-2-furanyl H 1286 6-C1-8-F cf ₃ Osc-3-f-uranyl H

1287 6-Cl, 8-F cf ₃ CsC-2-tlenyl H 1288 6-Cl, 8-F cf ₃ CsC-3-thienyl H 1289 6-1-8-F cf ₃ C = C-cycPr H 1290 6-1-8-F cf ₃ C-C-Ph H 1291 6-Cl, 8-F cf ₃ C = C-2-Pyridyl H 1292 6-1-8-F cf ₃ C = C-3-pyridyl H 1293 6-1-8-F cf ₃ C-C-4-Pyridyl H 1294 6-Cl, 8-F cf ₃ C = C-2-furanyl H 1295 6-1-8-F cf ₃ C = C-3-furanyl H 1296 6-Cl, 8-F cf ₃ C = C-2-thienyl H 1297 6-1-8-F cf ₃ C = C-3-tlenyl H 1298 6-Cl, 8-F cf ₃ CH ₂ CH ₂ -cycPr H 1299 6-1-8-F cf ₃ CH ₂ CH ₂ -Ph The 1300 6-Cl, 8-F cf ₃ CH ₂ CH ₂ -2-Pyridyl H 1301 6-Cl, 8-F cf ₃ CH ₂ CH ₂ -3 - Pyridyl H 1302 6-Cl, 8-F cf ₃ CH ₂ CH ₂ -4-Pyridyl H 1303 6-Cl, 8-fluoro cf ₃ CH ₂ CH ₂ -2-furanyl H 1304 6-Cl, 8-F cf ₃ CH ₂ CH ₂ -3-furanyl H 1305 6-Cl, 8-F cf ₃ CH ₂ CH ₂ -2-ethylen H 1306 6-Cl, 8-F cf ₃ CH ₂ CH ₂ -3-tlenyl H 1307 6-Cl, 8-F cf ₃ CsC-cycPr CH ₃ 1308 Article 8-6-F cf ₃ CsC Ph ch ₃ 1309 6-Cl, 8-F cf ₃ CsC-2-pyridyl ch ₃ 1310 6-Cl, 8-F cf ₃ CsC-3-pyridyl ch ₃ 1311 6-Cl, 8-F cf ₃ CsC-4-pyridyl ch ₃ 1312 6-Cl, 8-F cf ₃ CBC-2-furanyl ch ₃ 1313 6-Cl, 8-F cf ₃ Jul-3-furanyl ch ₃ 1314 6-Cl, 8-F cf ₃ CsC-2-thienyl ch ₃ 1315 6-Cl, 8-F cf ₃ CsC-3-thienyl ch ₃ 1316 C-6/8-F CF ₃ C = C-cycPr ch ₃ 1317 6-Cl, 8-F cf ₃ C-C-Ph ch ₃ 1318 6-Cl, 8-F cf ₃ C = C-2-Pyridyl ch ₃ 1319 6-Cl, 8-F cf ₃ C = C-3-pyridyl ch ₃ 1320 6-Cl, 8-F cf ₃ C = C-4-Pyridyl ch ₃

1321 6-Cl, 8-F CF3 C = C-2-furanyl ch ₃ 1322 6-C1,8-F cf ₃ C = C-3-furanyl ch ₃ 1323 6-Cl, 8-F cf ₃ C = C-2-thienyl ch ₃ 1324 6-1-8-F cf ₃ C = C-3-thienyl ch ₃ 1325 6-Cl, 8-F cf ₃ CH ₂ CH ₂ -cycPr ch ₃ 1326 6-1-8-F cf ₃ CH ₂ CH ₂ -Ph ch ₃ 1327 6-C1,8-F cf ₃ CH ₂ CH ₂ - 2 - Pyridyl ch ₃ 1328 6-1-8-F cf ₃ CH ₂ CH ₂ -3-Pyridyl ch ₃ 1329 ' 6-Cl, 8-F cf ₃ CH ₂ CH ₂ -4-Pyridyl ch ₃ 1330 6-1-8-F cf ₃ CH ₂ CH ₂ -2-furan 1 ch ₃ 1331 6-1-8-F cf ₃ CH ₂ CH ₂ -3-furanyl ch ₃ 1332 6-Cl, 8-F cf ₃ CH ₂ CH ₂ -2-thienyl ch ₃ 1333 6-1-8-F cf ₃ CH ₂ CH ₂ -3 -1 enyl ch ₃ 1334 6-CH3 CF ₃ CsC-cycPr H 1335 6-CH3 cf ₃ CsC Ph H 1336 6-CH3 CF _S CsC-2-pyridyl H 1337 6-CH3 cf ₃ C = C-3-pyridyl H 1338 6-CH3 cf ₃ CsC-4-pyridyl H 1339 6-CH3 cf ₃ C = C-2-furanyl H 1340 6-CH3 cf ₃ CsC-3-furanyl H 1341 6-CH3 cf ₃ CsC-2-thienyl H 1342 6-CH3 cf ₃ CsC-3-thienyl H 1343 6-CH3 cf ₃ C = C-cycPr H 1344 6-CH3 cf ₃ C-C-Ph H 1345 6-CH3 cf ₃ C = C-2-Pyridyl H 1346 6-CH3 cf ₃ C = C-3-pyridyl H 1347 6-CH3 cf ₃ C-C-4-Pyridyl H 1348 6-CH3 cf ₃ C = C-2-furanyl H 1349 6-CH3 cf ₃ C = C-3-furanyl H 1350 6-CH3 cf ₃ C = C-2-thienyl H 1351 6-CH3 cf ₃ C = C-3-thienyl H 1352 6-CH3 cf ₃ CH ₂ CH ₂ -cycPr H 1353 6-CH3 cf ₃ CH ₂ CH ₂ -Ph ' H 1354 6-CH3 cf ₃ CH ₂ CH ₂ -2-Pyridyl H

1355 _6-CH3 cf ₃ CH ₂ CH ₂ -3-Pyridyl H 1356 _6-CH3 cf ₃ CH ₂ CH ₂ - 4 - Pyridyl H 1357 _6-CH3 cf ₃ CH ₂ CH ₂ -2-furanyl H 1358 _6-CH3 cf ₃ CH ₂ CH ₂ -3 - Furan 1 H 1359 6-CH _third cf ₃ CH2CH2-2-L-phenyl H 1360 _6-CH3 cf ₃ CH ₂ CH ₂ -3-Lienyl H 1361 _6-CH3 cf ₃ CsC-cycPr ch ₃ 1362 _6-CH3 cf ₃ CSC-Ph ch ₃ 1363 _6-CH3 cf ₃ CsC-2-pyridyl ch ₃ 1364 _6-CH3 cf ₃ CsC-3-pyridyl ch ₃ 1365 _6-CH3 cf ₃ CsC-4-pyridyl ch ₃ 1366 _6-CH3 cf ₃ CsC-2-furanyl ch ₃ 1367 _6-CH3 cf ₃ CsC-3-furanyl CH ₃ ' 1368 _6-CH3 cf ₃ CsC-2-thienyl ch ₃ 1369 _6-CH3 cf ₃ CsC-3-thienyl ch ₃ 1370 _6-CH3 cf ₃ C = C-cycPr ch ₃ 1371 _6-CH3 cf ₃ C-C-Ph ch ₃ 1372 _6-CH3 cf ₃ C = C-2-Pyridyl ch ₃ 1373 _6-CH3 cf ₃ C = C-3-pyridyl ch ₃ 1374 6-CH3 cf ₃ C-C-4-Pyridyl ch ₃ 1375 6-CH3 cf ₃ C = C-2-furanyl ch ₃ 1376 _6-CH3 cf ₃ C = C-3-furanyl ch ₃ 1377 _6-CH3 cf ₃ C = C-2-thienyl ch ₃ 1378 _6-CH3 cf ₃ C = C-3-thienyl ch ₃ 1379 _6-CH3 cf ₃ CH ₂ CH ₂ -cycPr ch ₃ 1380 _6-CH3 cf ₃ CH ₂ CH ₂ -Ph ch ₃ 1381 _6-CH3 cf ₃ CH ₂ CH ₂ -2-Pyridyl ch ₃ 1382 6-CH3 cf ₃ CH ₂ CH ₂ -3-Pyridyl ch ₃ 1383 _6-CH3 cf ₃ CH ₂ CH ₂ -4-Pyridyl ch ₃ 1384 6-CH3 cf ₃ CH ₂ CH ₂ -2-furanyl ch ₃ 1385 6-CH3 cf ₃ CH ₂ CH ₃ -3-furanyl ch ₃ 1386 _6-CH3 cf ₃ CH ₂ CH ₂ -2-11 en 1 ch ₃ 1387 _6-CH3 cf ₃ CH ₂ CH ₂ -3-thienyl ch ₃ 1388 _6-COCH3 cf ₃ CsC-cycPr H

1389 _6-COCH3 cf ₃ CsC Ph H 1390 6-COCH3 cf ₃ CsCr2-pyridyl H 1391 _6-COCH3 cf ₃ CsC-3-pyridyl H 1392 6-COCH3 cf ₃ CsC-4-pyridyl H 1393 6-COCH3 cf ₃ Csc-2-f uranyl H 1394 _6-COCH3 cf ₃ C = C-3-uranyl H 1395 _6-COCH3 cf ₃ C = C-2-1 ienyl H 1396 _6-COCH3 cf ₃ CsC-3-thienyl H 1397 6-ΝΗ ₂ cf ₃ CsC-cycPr H 1398 6-ΝΗ ₂ cf ₃ CsC Ph H 1399 6-ΝΗ ₂ cf ₃ CsC-2-pyridyl H 1400 6-ΝΗ ₂ cf ₃ CsC-3-pyridyl H 1401 6-ΝΗ ₂ cf ₃ C-C-4-Pyridyl H 1402 6-ΝΗ ₂ cf ₃ C = c-2-uranyl H 1403 6-ΝΗ ₂ cf ₃ CsC-3-furanyl H 1404 6-ΝΗ ₂ cf ₃ CsC-2-thienyl H 1405 6-ΝΗ ₂ cf ₃ C 3 -C 3 -thienyl H 1406 6-NMe ₂ cf ₃ CsC-cycPr H 1407 6-NMe ₂ cf ₃ CsC Ph H 1408 6-NMe ₂ cf ₃ CsC-2-pyridyl H 1409 6-NMe ₂ cf ₃ CsC-3-pyridyl H 1410 6-NMe ₂ cf ₃ CsC-4-pyridyl H 1411 6-NMe ₂ cf ₃ CsC-2-furanyl H 1412 6-NMe ₂ cf ₃ OC-3-furanyl H 1413 6-NMe ₂ cf ₃ CsC-2-1 enyl H 1414 6-NMe ₂ cf ₃ CsC-3-1 ienyl H 1415 7-C1 cf ₃ CsC-cycPr H 1416 7-C1 cf ₃ CsC Ph H 1417 7-C1 cf ₃ Jul-2-pyridyl H 1418 7-C1 cf ₃ CsC-3-Pyridyl H 1419 7-C1 cf ₃ CSC-4-pyridyl H 1420 7-C1 cf ₃ CeC-2-furanyl H 1421 7-C1 cf ₃ CsC-3-furanyl H 1422 7-C1 cf ₃ CsC-2-thienyl H

1423 7-C1 cf ₃ 1424 5,6-OCH ₂ O- cf ₃ 1425 5,6-OCH ₂ O- cf ₃ 1,426 5,6-OCH ₂ O- cf ₃ 1427 5,6-OCH ₂ O- cf ₃ 1428 5,6-OCH ₂ O- cf ₃ 1429 5,6-OCH ₂ O- cf ₃ 1430 5,6-OCH ₂ O- cf ₃ 1431 5,6-OCH ₂ O- cf ₃ 1432 5,6-OCH ₂ O- cf ₃ 1433 5,6-OCH ₂ O- cf ₃ 1434 5,6-OCH ₂ O- cf ₃ 1435 5,6-OCH ₂ O- cf ₃ 1436 5,6-OCH ₂ O- cf ₃ 1437 5,6-OCH ₂ O- cf ₃ 1438 5,6-OCH ₂ O- cf ₃ 1439 5,6-0CH ₂ O- cf ₃ 1440 5,6-OCH ₂ O- cf ₃ 1441 5,6-OCH ₂ O- cf ₃ 1442 5,6-OCH ₂ O- cf ₃ 1443 5,6-OCH ₂ O- cf ₃ 1444 5,6-OCH ₂ O- cf ₃ 1445 5,6-OCH ₂ O- cf ₃ 1446 5,6-OCH ₂ O- cf ₃ 1447 5,6-OCH ₂ O- cf ₃ 1448 5,6-OCH ₂ O- cf ₃ 1449 5,6-OCH ₂ O- cf ₃ 1450 5,6-OCH ₂ O- cf ₃ 1451 5,6-OCH ₂ O- cf ₃ 1452 5,6-OCH ₂ O- cf ₃ 1453 5,6-OCH ₂ O- cf ₃ 1454 5,6-OCH ₂ O- cf ₃ 1455 5,6-OCH ₂ O- cf ₃ 1456 5,6-OCH ₂ O- cf ₃

C = C-3-thienyl H

CsC-cycPr H

CsCCH ₂ CH ₂ OH H

CsC-CH (OH) MeH

CsC-Ph H

CsC - (2-Cl) Ph H

CsC - (3-Cl) Ph H

CsC - (4-Cl) Ph H

CsC - (2-F) Ph H

CsC- (3-F) Ph H

CsC - (4-F) Ph H

CsC- (2-OH) Ph H

CsC- (3-OH) Ph H

CsC- (4-OH) Ph H

CsC- (2-Me) Ph H

CsC - (3-OMe) Ph H

CsC - (4-OMe) Ph H

CsC - (2-CN) Ph H

CsC - (3-CN) Ph H

CsC - (4-CN) Ph H

CsC- (2-NO ₂ , Ph H

CsC- (3-NO ₂ , Ph H

CsC- (4-NO ₂ ) Ph H

CsC- _{2-NH2) Ph H

CsC- (3-NH ₂ ) Ph H

CsC- (4-NH ₂ ) Ph H

CsC - (2-NMe ₂ ) Ph H

CsC - (3-NMe ₂ ) Ph H

CsC - (4-NMe ₂ ) Ph ^H

CsC-2-Pyridyl ^H

CsC-2-Pyridyl H

CsC-3-Pyridyl H

Csc-4-Pyridyl H

CsC-2-f uranes 1 H

1457 5,6-OCH ₂ O- cf ₃ CsC-3-furanyl H 1458 5,6-OCH ₂ O- cf ₃ CaC-2-thienyl H 1459 5,6-OCH ₂ O- cf ₃ CsC-3-thienyl H 1460 5,6-OCH ₂ O- cf ₃ C = C-2-oxazolyl H 1461 5,6-OCH ₂ O- cf ₃ CsC-2-thiazolyl H 1462 5,6-OCH ₂ O- cf ₃ CsC-4-isoxazolyl H 1463 5, 6-OCH ₂ O- cf ₃ C = C-2-imidazolyl H 1464 6-COCH3 cf ₃ C = C-cycPr H 1465 6-COCH3 cf ₃ C-C-Ph H 1466 6-COCH3 cf ₃ C = C-2-Pyridyl H 1467 6-COCH3 cf ₃ C = C-3-pyridyl H 1468 6-COCH3 cf ₃ C-C-4-Pyridyl H 1469 6-COCH3 cf ₃ C = C-2-furanyl H 1470 6-COCH3 cf ₃ C = C-3-furanyl H 1471 6-COCH3 cf ₃ C = C-2-thienyl H 1472 6-COCH3 cf ₃ C = C-3-thienyl H 1473 6-NH ₂ cf ₃ C = C-cycPr H 1474 6-NH ₂ cf ₃ C-C-Ph H 1475 6-NH ₂ cf ₃ C = C-2-Pyridyl H 1476 6-NH ₂ cf ₃ C = C-3-pyridyl H 1477 6-NH ₂ cf ₃ C-C-4-Pyridyl H 1478 6-NH ₂ CF3 C = C-2-furanyl H 1479 6-NH ₂ cf ₃ C = C-3-furanyl H 1480 6-NH ₂ cf ₃ C = C-2-thienyl H 1481 6-NH ₂ cf ₃ C = C-3-thienyl H 1482 6-NMe ₂ cf ₃ C = C-cycPr H 1483 6 — NMe ₂ cf ₃ C-C-Ph H 1484 6-NMe ₂ cf ₃ C = C-2-Pyridyl H 1485 6-NMfe ₂ cf ₃ C = C-3-pyridyl H 1486 6-NMe ₂ cf ₃ C-C-4-Pyridyl H 1487 6-NMe ₂ cf ₃ C = C-2-furanyl H 1488 6-NMe ₂ CF3 C = C-3-furanyl H 1489 6-NMe ₂ CF ₃ C = C-2-thienyl H 1490 6-NMe ₂ cf ₃ C = C-3-thienyl H

1491 7-d cf ₃ C = C-cycPr H 1492 7-C1 cf ₃ C-C-Ph H 1493 7-C1 cf ₃ C = C-2-Pyridyl H 1494 7-C1 cf ₃ C = C-3-pyridyl H 1495 7-C1 cf ₃ C-C-4-Pyridyl H 1496 7-C1 cf ₃ C = C-2-uranyl H 1497 7-C1 cf ₃ C = C-3-furanyl H 1498 7-C1 cf ₃ C = C-2-L-enyl H 1499 7-C1 cf ₃ C = C-3-thienyl H 1500 5,6-OCH ₂ O- cf ₃ C = C-cycPr H 1501 5,6-OCH ₂ O- cf ₃ C = CCH ₂ CH ₂ OH H 1502 5,6-OCH ₂ O- cf ₃ C = C-CH (OH) Me H 1503 5,6-OCH ₂ O- cf ₃ C-C-Ph The 1504 5,6-OCH ₂ O- cf ₃ C = C- (2-Cl) Ph H 1505 5,6-OCH ₂ O- cf ₃ C = C- (3-Cl) Ph H 1506 5,6-OCH2O- cf ₃ C = C- (4-Cl) Ph H 1507 5,6-OCH ₂ O- cf ₃ C = C- (2-F) Ph H 1508 5,6-OCH ₂ O- cf ₃ C. C- (3-F) Ph H 1509 5,6-OCH ₂ O- cf ₃ C = C- (4-F Ph H 1510 5,6-OCH ₂ O- cf ₃ C = C- (2-OH) Ph H 1511 5,6-OCH ₂ O- cf ₃ C = C- (3-OH) Ph H 1512 5,6-OCH2O- cf ₃ C = C- (4-OH) Ph H 1513 5,6-OCH ₂ O- cf ₃ C = C- (2-OMe) Ph H 1514 5,6-OCH ₂ O- cf ₃ C = C- (3-OMe) Ph H 1515 5,6-OCH ₂ O- cf ₃ C = C- (4-OMe) Ph H 1516 5,6-OCH ₂ O- cf ₃ C = C- (2-CN) Ph H 1517 5,6-OCH ₂ O- cf ₃ C = C- (3-CN) Ph H 1518 5,6-OCH ₂ O- cf ₃ C = C- (4-CN) Ph H 1519 5,6-OCH ₂ O- cf ₃ C = C- (2-NO ₂ ) Ph H 1520 5,6-OCH ₂ O- cf ₃ C = C- (3-NO ₂ ) Ph H 1521 5,6-OCH ₂ O- cf ₃ C = C- (4-NO ₂ ) Ph H 1522 5,6-OCH ₂ O- cf ₃ C = C- (2-NH ₂ ) Ph H 1523 5,6-OCH ₂ O- cf ₃ C = C- (3-NH ₂ ) Ph H 1524 5,6-OCH ₂ O- cf ₃ C = C- (4-NH ₂ ) Ph H

100

1525 5,6-OCH ₂ O- cf ₃ C = C- (2-NMe ₂ ) Ph 1526 5,6-OCH ₂ O- cf ₃ C = C- (3-NMe ₂ ) Ph 1527 5,6-OCH ₂ O- cf ₃ C = C- (4-NMe ₂ ) Ph 1528 5,6-OCH ₂ O- cf ₃ C = C-2-Pyridyl 1529 5,6-OCH ₂ O- cf ₃ C = C-2-Pyridyl 1530 5,6-OCH ₂ O- cf ₃ C = C-3-pyridyl 1531 5,6-OCH ₂ O- cf ₃ C-C-4-Pyridyl 1532 5,6-0CH ₂ O- cf ₃ C = C-2-furanyl 1533 5,6-OCH ₂ O- cf ₃ C = C-3-furány1 1534 5,6-OCH ₂ O- cf ₃ C = C-2-1 enyl 1535 5, 6-OCH ₂ O- cf ₃ C = C-3-thienyl 1536 5,6-OCH ₂ O- cf ₃ C = C-2-oxazolyl 1537 5, 6-0CH ₂ O cf ₃ C = C-2-thiazolyl 1538 5,6-OCH ₂ O- cf ₃ C = C-4-isoxazolyl 1539 5, 6-OCH ₂ O- cf ₃ C = C-2-imidazolyl 1540 5, 6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -cycPr 1541 5,6-OCH ₂ O- cf ₃ ch ₂ ch ₂ ch ₂ ch ₂ oh 1542 5,6-0CH ₂ O- cf ₃ CH ₂ CH ₂ -CH (OH) Me 1543 5,6-0CH ₂ O- cf ₃ CH ₂ CH ₂ Ph 1544 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ - (2-Cl) Ph 1545 5, 6-0CH ₂ O cf ₃ CH ₂ CH ₂ - (3-Cl) Ph 1546 5, 6-OCH ₂ O- cf ₃ CH ₂ CH ₂ - (4-C1) Ph 1547 5,6-0CH ₂ O- cf ₃ CH ₂ CH ₂ - (2-F) Ph 1548 5,6-0CH ₂ O- cf ₃ CH ₂ CH ₂ - (3-F) Ph 1549 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ - (4-F) Ph 1550 5, 6-0CH ₂ O cf ₃ CH ₂ CH ₂ - (2-OH) Ph 1551 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ - (3-OH) Ph 1552 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ - (4-OH) Ph 1553 5,6-0CH ₂ O- cf ₃ CH ₂ CH ₂ - (2-OMe) Ph 1554 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ - (3-QMe) Ph 1555 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ '(4-OMe) Ph 1556 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ - (2-CN) Ph 1557 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ - (3-CN) Ph 1558 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ - (4-CN) Ph

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

Η

101

1559 5,6-OCH ₂ O-. cf ₃ CH ₂ CH ₂ - (2-NO ₂ ) Ph H 1560 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ - (3-NO ₂ ) Ph H 1561 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ - (4-NO ₂ ) Ph H 1562 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ - (2-NH ₂ ) Ph. H 1563 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ - (3-NH ₂ ) Ph H 1564 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ - (4-NH ₂ ) Ph H 1565 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ - (2-NMe ₂ ) Ph H 1566 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ - (3-NMe ₂ ) Ph H 1567 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ - (4-NMe ₂ ) Ph H 1568 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -2-Pyridyl H 1569 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -3-Pyridyl H 1570 5, 6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -4-Pyridyl H 1571 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -2-furanyl H 1572 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -3-furanyl H 1573 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -2-thienyl H 1574 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -3-thienyl H 1575 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -2-oxazolyl H 1576 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -2-thiazolyl H 1577 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -4-isoxazolyl H 1578 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -2-imidazolyl H 1579 5,6-OCH ₂ O- cf ₃ CsC-cycPr ch ₃ 1580 5,6-OCH ₂ O- cf ₃ CsC Ph ch ₃ 1581 5,6-OCH ₂ O- cf ₃ Jul-2-pyridyl ch ₃ 1582 5,6-OCH ₂ O- cf ₃ CaC-3-Pyridyl ch ₃ 1583 5,6-OCH ₂ O- cf ₃ Jul-4-pyridyl ch ₃ 1584 5,6-OCH ₂ O- cf ₃ OC-2-F uranyl ch ₃ 1585 5,6-OCH ₂ O- cf ₃ CsC-3-furanyl ch ₃ 1586 5,6-OCH ₂ O- cf ₃ CsC-2-thienyl ch ₃ 1587 5,6-OCH ₂ O- cf ₃ CsC-3-thienyl ch ₃ 1588 5,6-OCH ₂ O- cf ₃ C = C-cycPr ch ₃ 1589 5,6-OCH ₂ O- cf ₃ C-C-Ph ch ₃ 1590 5,6-OCH ₂ O- cf ₃ C = C-2-Pyridyl ch ₃ 1591 5,6-OCH ₂ O- cf ₃ C = C-3-pyridyl ch ₃ 1592 5,6-OCH ₂ O- cf ₃ C-C-4-Pyridyl ch ₃

102

5,6-OCH ₂ O- cf ₃ C = C-2-furanyl ch ₃ 5,6-OCH ₂ O- cf ₃ C = C-3-furanyl ch ₃ 5,6-OCH ₂ O- cf ₃ C = C-2-thienyl ch ₃ 5,6-OCH ₂ O- cf ₃ C = C-3-thienyl ch ₃ 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -cycPr ch ₃ 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -Ph ch ₃ 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -2-Pyridyl ch ₃ 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -3-Pyridyl ch ₃ 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -4-Pyridyl ch ₃ 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -2-furanyl ch ₃ 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -3-furanyl ch ₃ 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -2-thienyl ch ₃ 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -3-thienyl ch ₃ ' 5,6-OCH ₂ O- cf ₃ CsC-cycPr ch ₂ ch ₃ 5,6-OCH ₂ O- cf ₃ CSC-Ph ch ₂ ch ₃ 5,6-OCH ₂ O- cf ₃ CsC-2-pyridyl ch ₂ ch ₃ 5,6-OCH ₂ O- cf ₃ CsC-3-pyridyl ch ₂ ch ₃ 5,6-OCH ₂ O- cf ₃ CEC-4-pyridyl ch ₂ ch ₃ 5,6-OCH ₂ O- cf ₃ CsC-2 -f uranyl ch ₂ ch ₃ 5,6-OCH ₂ O- cf ₃ CsC-3-furanyl ch ₂ ch ₃ 5,6-OCH ₂ O- cf ₃ CsC-2-thienyl ch ₂ ch ₃ 5,6-OCH ₂ O- cf ₃ C = C-3-thienyl ch ₂ ch ₃ 5,6-OCH ₂ O- cf ₃ C = C-cycPr ch ₂ ch ₃ 5,6-OCH ₂ O- cf ₃ C-C-Ph ch ₂ ch ₃ 5,6-OCH ₂ O- cf ₃ C = C-2-Pyridyl ch ₂ ch ₃ 5,6-OCH ₂ O- cf ₃ C = C-3-pyridyl ch ₂ ch ₃ 5,6-OCH ₂ O- cf ₃ C-C-4-Pyridyl ch ₂ ch ₃ 5,6-OCH ₂ O- cf ₃ C = C-2-uranyl ch ₂ ch ₃ 5.6-OCH ₂ O- cf ₃ C = C-3-uranyl ch ₂ ch ₃ 5,6-OCH ₂ O- cf ₃ C = C-2-thienyl ch ₂ ch ₃ 5,6-OCH ₂ O- cf ₃ C = C-3-thienyl ch ₂ ch ₃ 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -cycPr ch ₂ ch ₃ 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -Ph ch ₂ ch ₃ 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -2-Pyridyl ch ₂ ch ₃

103

1627 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -3-Pyridyl CH ₂ CH ₃ 1628 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -4-Pyridyl ch ₂ ch ₃ 1629 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -2-furanyl ch ₂ ch ₃ 1630 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -3-furanyl ch ₂ ch ₃ 1631 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -2-thienyl ch ₂ ch ₃ 1632 5,6-OCH ₂ O- cf ₃ CH ₂ CH ₂ -3-thienyl ch ₂ ch ₃ x If not it is stated anything other, stereochemistry is (* / -)

104

Table 3 *

R ³ R ¹ R 2 R ⁸ 6-Cl cf ₃ Jul-Pr H 6-Cl cf ₃ CsC-Bu H 6-Cl cf ₃ CsC-iBu H 6-Cl cf ₃ CsC-Bu H 6-Cl cf ₃ CsC-Me H 6-Cl cf ₃ CH2CH2CH2CH2CH3 H 6-Cl cf ₃ CH ₂ CH ₂ CH (CH ₃ ) 2 H 6-Cl cf ₃ CH ₂ CH ₂ CH ₂ CH ₃ H 6-Cl cf ₃ CH ₂ CH ₂ CH ₃ H 6-Cl cf ₃ CH ₂ CH ₂ -tBu H 6-Cl cf ₃ CH ₂ CsC-CH ₃ H 6-Cl cf ₃ CH ₂ CsC-CH ₂ CH ₃ H 6-Cl cf ₃ CEC Pr CH ₃ 6-Cl cf ₃ CsC-Pr ch ₃ 6-Cl cf ₃ CsC-Bu ch ₃ 6-Cl cf ₃ CEC iBu ch ₃ 6-Cl cf ₃ CsC-Bu ch ₃ 6-Cl cf ₃ CsC-Et ch ₃ 6-Cl cf ₃ CsC-Me ch ₃ 6-Cl cf ₃ CH ₂ Ce-CH ₃ ch ₃ 6-Cl cf ₃ CH ₂ CsC-CH ₂ CH ₃ ch ₃ 6-Cl cf ₃ CH ₂ CH ₂ CH (CH 3) 2 ch ₃ 6-Cl cf ₃ CH ₂ CH ₂ CH ₂ CH ₃ ch ₃ 6-Cl cf ₃ CH ₂ CH ₂ CH ₃ ch ₃ 6-Cl cf ₃ CH ₂ CH ₂ -tBu ch ₃ 6-Cl cf ₃ CsC-Pr ch ₂ ch ₃ 6-Cl cf ₃ CSSC-Pr CH2CH3 6-Cl cf ₃ CsC-Bu CH ₂ CH ₃

105

6-Cl CF ₃ CsC-iBu ch ₂ ch ₃ 6-Cl cf ₃ CsC-Bu ch ₂ ch ₃ 6-Cl cf ₃ CSC-Et ch ₂ ch ₃ 6-Cl cf ₃ CEC Me ch ₂ ch ₃ 6-Cl cf ₃ CH ₂ CsC-CH ₃ ch ₂ ch ₃ 6-Cl cf ₃ CH ₂ CsC-CH ₂ CH ₃ ch ₂ ch ₃ 6-Cl cf ₃ CH ₂ CH ₂ CH (CH ₃ ) ₂ ch ₂ ch ₃ 6-Cl cf ₃ ch ₂ ch ₂ ch ₂ ch ₃ ch ₂ ch ₃ 6-Cl cf ₃ ch ₂ ch ₂ ch ₃ ch ₂ ch ₃ 6-Cl cf ₃ CH ₂ CH ₂ -tBu ch ₂ ch ₃ 6-MeO cf ₃ CsC-Pr H 6-MeO cf ₃ Jul-Bu H 6-MeO cf ₃ CsC-iBu H 6-MeO cf ₃ CsC-Bu H 6-MeO cf ₃ CsC-Et H 6-MeO cf ₃ CsC-Me H 6-MeO cf ₃ CH ₂ CsC-CH ₃ H 6-MeO cf ₃ CH ₂ CbC-CH ₂ CH ₃ H 6-MeO cf ₃ ch ₂ ch ₂ ch ₂ ch ₂ ch ₃ H 6-MeO cf ₃ CH ₂ CH ₂ CH (CH ₃ ) ₂ H 6-MeO cf ₃ CH ₂ CH ₂ CH ₂ CH ₃ H 6-MeO cf ₃ ch ₂ ch ₂ ch ₃ H 6-MeO cf ₃ CH ₂ CH ₂ -tBu H 6-MeO cf ₃ CH ₂ CsC-CH ₃ H 6-MeO cf ₃ CH ₂ CsC-CH ₂ CH ₃ The 6-MeO cf ₃ CsC-Pr ch ₃ 6-MeO cf ₃ C = C-Pr ch ₃ 6-MeO cf ₃ CsC-Bu ch ₃ 6-MeO cf ₃ CsC-iBu ch ₃ 6-MeO cf ₃ CsC-Bu ch ₃ 6-MeO cf ₃ CsC-Et ch ₃ 6-MeO cf ₃ CsC-Me ch ₃ 6-MeO cf ₃ CH ₂ CsC-CH ₃ . ch ₃ 6-MeO cf ₃ ch ₂ oc-ch ₂ ch ₃ ch ₃

106

63 6-MeO cf ₃ CH ₂ CH ₂ CH (CH ₃ ) 2 ch ₃ 64 6-MeO cf ₃ CH ₂ CH ₂ CH ₂ CH ₃ ch ₃ 65 6-MeO cf ₃ ch ₂ ch ₂ ch ₃ ch ₃ 66 6-MeO cf ₃ CH ₂ CH ₂ -tBu ch ₃ 67 6-MeO cf ₃ CSC-Pr ch ₂ ch ₃ 68 6-MeO cf ₃ CSC-Pr ch ₂ ch ₃ 69 6-MeO cf ₃ C = C-Bu ch ₂ ch ₃ 70 6-MeO cf ₃ CsC-iBu ch ₂ ch ₃ 71 6-MeO cf ₃ CsC-Bu ch ₂ ch ₃ 72 6-MeO cf ₃ CsC-Et ch ₂ ch ₃ 73 6-MeO cf ₃ CsC-Me ch ₂ ch ₃ 74 6-MeO cf ₃ CH ₂ CsC-CH ₃ ch ₂ ck ₃ 75 6-MeO cf ₃ CH ₂ CsC-CH ₂ CH ₃ ch ₂ ch ₃ 76 6-MeO cf ₃ CH ₂ CH ₂ CH (CH ₃ ) ₂ ch ₂ ch ₃ 77 6-MeO cf ₃ ch ₂ ch ₂ ch ₂ ch ₃ ch ₂ ch ₃ 78 6-MeO cf ₃ ch ₂ ch ₂ ch ₃ ch ₂ ch ₃ 79 6-MeO cf ₃ CH ₂ CH ₂ -tBu ch ₂ ch ₃ 80 5,6-difluoro cf ₃ CsC-Pr H 81 5,6-difluoro cf ₃ CsC-Bu H 82 5,6-difluoro cf ₃ CsC-iBu H 83 5,6-difluoro cf ₃ CsC-Bu H 84 5,6-difluoro cf ₃ CsC-Me H 85 5,6-difluoro cf ₃ CH ₂ CsC-CH ₃ H 86 5,6-difluoro cf ₃ CH ₂ CsC-CH ₂ CH ₃ H 87 5,6-difluoro cf ₃ CH ₂ CH ₂ CH ₂ CH ₂ CH ₃ H 88 5,6-difluoro cf ₃ ch ₂ ch ₂ ch ₃ H 89 5,6-difluoro cf ₃ CH ₂ CH ₂ -tBU H 90 5,6-difluoro cf ₃ CsC-Pr ch ₃ 91 5,6-difluoro cf ₃ CsC-Pr ch ₃ 92 5,6-difluoro cf ₃ CsC-Bu ch ₃ 93 5,6-difluoro cf ₃ CsC-iBu ch ₃ 94 5,6-difluoro cf ₃ CsC-Bu ch ₃ 95 5,6-difluoro cf ₃ CsC-Et ch ₃ 96 5,6-difluoro cf ₃ CsC-Me ch ₃

107

97 5,6-difluoro cf ₃ . CsC Ph ch ₃ 98 5,6-difluoro cf ₃ CH ₂ CsC-CH ₃ ch ₃ 99 5,6-difluoro cf ₃ CH ₂ CsC-CH ₂ CH ₃ ch ₃ 100 5,6-difluoro cf ₃ CH ₂ CH ₂ CH (CH ₃ ) ₂ ch ₃ 101 5,6-difluoro cf ₃ ch ₂ ch ₂ ch ₂ ch ₃ ch ₃ 102 5,6-difluoro cf ₃ ch ₂ ch ₂ ch ₃ ch ₃ 103 5,6-difluoro cf ₃ CH ₂ CH ₂ -tBu ch ₃ 104 5,6-difluoro cf ₃ CsC-Pr ch ₂ ch ₃ 105 5,6-difluoro cf ₃ CsC-Pr ch ₂ ch ₃ 106 5,6-difluoro cf ₃ CsC-Bu ch ₂ ch ₃ 107 5,6-difluoro cf ₃ CsC-iBu ch ₂ ch ₃ 108 5,6-difluoro cf ₃ CsC-Bu ch ₂ ck ₃ 109 5,6-difluoro cf ₃ CsC-Et ch ₂ ch ₃ 110 5,6-difluoro cf ₃ CsC-Me ch ₂ ch ₃ 111 5,6-difluoro cf ₃ CH ₂ CsC-CH ₃ ch ₂ ch ₃ 112 5,6-difluoro cf ₃ CH ₂ CsC-CH ₂ CH ₃ ch ₂ ch ₃ 113 5,6-difluoro cf ₃ CH ₂ CH ₂ CH (CH ₃ ) ₂ ch ₂ ch ₃ 114 5,6-difluoro cf ₃ ch ₂ ch ₂ ch ₂ ch ₃ ch ₂ ch ₃ - 115 5,6-difluoro cf ₃ ch ₂ ch ₂ ch ₃ ch ₂ ch ₃ 116 5,6-difluoro cf ₃ CH ₂ CH ₂ -tBu ch ₂ ch ₃ 117 6-F cf ₃ CsC-Pr H 118 6-F cf ₃ CsC-Bu H 119 6-F cf ₃ CsC-iBu H 120 6-F cf ₃ CsC-Bu H 121 6-F cf ₃ CsC-Me H 122 6-F cf ₃ CH ₂ CsC-CH ₂ CH ₃ H 123 6-F cf ₃ CH ₂ CH ₂ CH ₂ CH ₂ CH ₃ H 124 6-F cf ₃ ch ₂ ch ₂ ch ₃ H 125 6-F cf ₃ CH ₂ CH ₂ -tBu H 126 6-F cf ₃ CsC-Pr ch ₃ 127 6-F cf ₃ Jul-Pr ch ₃ 128 6-F cf ₃ CsC-Bu ch ₃ 129 6-F cf ₃ CsC-iBu ch ₃ 130 6-F cf ₃ CsC-Bu ch ₃

108

131 6-F cf ₃ . CsC-Et ch ₃ 132 6-F cf ₃ CsC-Me ch ₃ 133 6-F cf ₃ CH ₂ CsC-CH ₃ ch ₃ 134 6-F cf ₃ CH ₂ CsC-CH ₂ CH ₃ ch ₃ 135 6-F cf ₃ ch ₂ ch ₂ ch (ch ₃ ) ₂ ch ₃ 136 6-F cf ₃ ch ₂ ch ₂ ch ₂ ch ₃ ch ₃ 137 6-F cf ₃ ch ₂ ch ₂ ch ₃ ch ₃ 138 6-F cf ₃ CH ₂ CH ₂ -tBu ch ₃ 139 6-F cf ₃ CsC-Pr ch ₂ ch ₃ 140 6-F cf ₃ CSC-Pr CH2CH3 141 6-F cf ₃ CSC-Bu CH2CH3 142 6-F cf ₃ CsC-iBu ch ₂ ch ₃ 143 6-F cf ₃ CsC-Bu ch ₂ ch ₃ 144 6-F cf ₃ CsC-Et ch ₂ ch ₃ 145 6-F cf ₃ CsC-Me ch ₂ ch ₃ 146 6-F cf ₃ CH ₂ CsC-CH ₃ ch ₂ ch ₃ 147 6-F cf ₃ CH ₂ CsC-CH ₂ CH ₃ ch ₂ ch ₃ 148 6-F cf ₃ CH ₂ CH ₂ CH (CH ₃ ) ₂ CH2CH3 149 6-F cf ₃ ch ₂ ch ₂ ch ₂ ch ₃ CH ₂ CH ₃ 150 6-F cf ₃ ch ₂ ch ₂ ch ₃ CH ₂ CH ₃ 151 6-F cf ₃ CH ₂ CH ₂ -tBu ch ₂ ch ₃ 152 5-Cl cf ₃ CsC-Pr H 153 5-Cl cf ₃ CsC-Pr H 154 5-Cl cf ₃ CsC-Bu H 155 5-Cl cf ₃ C-C-iBu H 156 5-Cl cf ₃ CsC-Bu H 157 5-Cl cf ₃ C = C-Et H 158 5-Cl cf ₃ CsC-Me H 159 5-Cl cf ₃ CH ₂ CSC-CH ₃ H 160 5-Cl cf ₃ CH ₂ CsC-CH ₂ CH ₃ H 161 5-Cl cf ₃ ch ₂ ch ₂ ch ₂ ch ₂ ch ₃ H 162 5-Cl cf ₃ ch ₂ ch ₂ ch ₃ ) ₂ H 163 5-Cl cf ₃ ch ₂ ch ₂ ch ₂ ch ₃ H 164 5-Cl cf ₃ ch ₂ ch ₂ ch ₃ H

109

165 5-Cl CF ₃ CH ₂ CH ₂ -tBu H 166 5-Cl cf ₃ CsC-Pr ch ₃ 167 5-Cl cf ₃ CsC-Pr ch ₃ 168 5-Cl cf ₃ CsC-Bu ch ₃ 169 5-Cl cf ₃ CsC-iBu ch ₃ 170 5-Cl cf ₃ CsC-Bu ch ₃ 171 5-Cl cf ₃ CsC-Et ch ₃ 172 5-Cl cf ₃ CsC-Me ch ₃ 173 5-Cl cf ₃ CH ₂ CsC-CH ₃ ch ₃ 174 5-Cl cf ₃ CH ₂ CsC-CH ₂ CH ₃ ch ₃ 175 5-Cl cf ₃ CH ₂ CH ₂ CH (CH ₃ ) ₂ ch ₃ 176 5-Cl cf ₃ CH ₂ CH ₂ CH ₂ CH ₃ ch ₃ 177 5-Cl cf ₃ ch ₂ ch ₂ ch ₃ ch ₃ 178 5-Cl cf ₃ CH ₂ CH ₂ -tBu ch ₃ 179 5-Cl cf ₃ CsC-Pr ch ₂ ch ₃ 180 5-Cl cf ₃ CsC-Pr ch ₂ ch ₃ 181 5-Cl cf ₃ CsC-Bu ch ₂ ch ₃ 182 5-Cl cf ₃ CsC-iBu ch ₂ ch ₃ 183 5-Cl cf ₃ CsC-Bu ch ₂ ch ₃ 184 5-Cl cf ₃ CsC-Et ch ₂ ch ₃ 185 5-Cl cf ₃ CsC-Me ch ₂ ch ₃ 186 5-Cl cf ₃ CH ₂ Ce-CH ₃ ch ₂ ch ₃ 187 5-Cl cf ₃ CH ₂ CbC-CH ₂ CH ₃ ch ₂ ch ₃ 188 5-Cl cf ₃ CH ₂ CH ₂ CH (CH ₃ ) 2 ch ₂ ch ₃ 189 5-Cl cf ₃ CH ₂ CH ₂ CH ₂ CH ₃ ch ₂ ch ₃ 190 5-Cl cf ₃ CH ₂ CH ₂ CH ₃ ch ₂ ch ₃ 191 5-Cl cf ₃ CH ₂ CH ₂ -tBu ch ₂ ch ₃ 192 5-F cf ₃ CsC-Pr The 193 5-F cf ₃ CsC-Pr H 194 5-F cf ₃ CaC-Bu H 195 5-F cf ₃ CsC-iBu H 196 5-F cf ₃ CsC-Bu H 197 5-F cf ₃ CsC-Et H 198 5-F cf ₃ CsC-Me The

110

199 5-F CF ₃ . CH ₂ CsC-CH ₃ H 200 5-F cf ₃ CH ₂ CsC-CH ₂ CH ₃ H 201 5-F cf ₃ ch ₂ ch ₂ ch ₂ ch ₂ ch ₃ H 202 5-F cf ₃ CH ₂ CH ₂ CH (CH ₃ ) ₂ H 203 5-F cf ₃ ch ₂ ch ₂ ch ₂ ch ₃ H 204 5-F cf ₃ ch ₂ ch ₂ ch ₃ H 205 5-F cf ₃ CH ₂ CH ₂ -tBu H 206 5-F cf ₃ CsC-Pr ch ₃ 207 5-F CF ₃ CSC-Pr ch ₃ 208 5-F cf ₃ CSC-Bu ch ₃ 209 5-F cf ₃ CsC-iBu ch ₃ 210 5-F cf ₃ CsC-Bu ch ₃ 211 5-F cf ₃ CSC-Et ch ₃ 212 5-F CF ₃ CsC-Me ch ₃ 213 5-F cf ₃ CH ₂ CSC-CH ₃ ch ₃ 214 5-F cf ₃ CH ₂ CsC-CH ₂ CH ₃ ch ₃ 215 5-F cf ₃ CH ₂ CH ₂ CH (CH ₃ ) ₂ ch ₃ 216 5-F cf ₃ ch ₂ ch ₂ ch ₂ ch ₃ ch ₃ 217 5-F cf ₃ ch ₂ ch ₂ ch ₃ ch ₃ 218 5-F cf ₃ CH ₂ CH ₂ -tBu ch ₃ 219 5-F cf ₃ CEC Pr ch ₂ ch ₃ 220 5-F cf ₃ CsC-Pr ch ₂ ch ₃ 221 5-F cf ₃ CsC-Bu ch ₂ ch ₃ 222 5-F cf ₃ CsC-iBu ch ₂ ch ₃ 223 5-F cf ₃ CsC-Bu ch ₂ ch ₃ 224 5-F cf ₃ CsC-Et ch ₂ ch ₃ 225 5-F cf ₃ CsC-Me ch ₂ ch ₃ 226 5-F cf ₃ CH ₂ C = C-CH ₃ ch ₂ ch ₃ 227 5-F cf ₃ CH ₂ CsC-CH ₂ CH ₃ ch ₂ ch ₃ 228 5-F cf ₃ CH ₂ CH ₂ CH (CH ₃ ) ₂ ch ₂ ch ₃ 229 5-F cf ₃ ch ₂ ch ₂ ch ₂ ch ₃ ch ₂ ch ₃ 230 5-F cf ₃ ch ₂ ch ₂ ch ₃ ch ₂ ch ₃ 231 5-F cf ₃ CH ₂ CH ₂ -tBu ch ₂ ch ₃ 232 5-C1-6-F cf ₃ C = C-iPr H

111

233 5-Cl, 6-F cf ₃ CsC-Pr H 234 5-Cl, 6-F cf ₃ CsC-Bu H 235 5-C1-6-F cf ₃ CsC-iBu H 236 5-Cl, 6-F cf ₃ CsC-Bu H 237 5-Cl, 6-F cf ₃ CSC-Et H 238 5-Cl, 6-F cf ₃ CsC-Me H 239 5-Cl, 6-F cf ₃ CH ₂ CsC-CH ₃ H 240 5-Cl, 6-F cf ₃ CH ₂ CsC-CH ₂ CH ₃ H 241 5-C1-6-F cf ₃ CH ₂ CH ₂ CH (CH ₃ ) 2 H 242 5-Cl, 6-F cf ₃ CH ₂ CH ₂ CH ₂ CH ₃ H 243 5-C1-6-F cf ₃ CH ₂ CH ₂ CH ₃ H 244 5-Cl, 6-F cf ₃ CH ₂ CH ₂ -tBu H 245 5-Cl, 6-F cf ₃ CsC-Pr ch ₃ 246 Article 6-5-F cf ₃ CsC-Pr ch ₃ 247 5-Cl, 6-F cf ₃ CsC-Bu ch ₃ 248 5-Cl, 6-F cf ₃ CsC-iBu ch ₃ 249 5-Cl, 6-F cf ₃ CsC-Bu ch ₃ 250 5-C1-6-F cf ₃ CsC-Et ch ₃ 251 5-Cl, 6-F cf ₃ CsC-Me ch ₃ 252 5-Cl, 6-F cf ₃ CH ₂ CsC-CH ₃ ch ₃ 253 5-Cl, 6-F cf ₃ ch ₂ c = c-ch ₂ ch ₃ ch ₃ 254 5-Cl, 6-F cf ₃ CH ₂ CH ₂ CH (CH ₃ ) ₂ ch ₃ 255 5-Cl, 6-F cf ₃ CH ₂ CH ₂ CH ₂ CH ₃ ch ₃ 256 5-Cl, 6-F cf ₃ CH ₂ CH ₂ CH ₃ ch ₃ 257 5-Cl, 6-F cf ₃ CH ₂ CH ₂ -tBu ch ₃ 258 6-Cl, 8-F cf ₃ CsC-Pr H 259 6-Cl, 8-F cf ₃ CsC-Pr H 260 6-Cl, 8-F cf ₃ CsC-Bu H 261 6-Cl, 8-F cf ₃ CsC-iBu H 262 6-Cl, 8-F cf ₃ CC-Bu H 263 6-Cl, 8-F cf ₃ CsC-Et H 264 6-Cl, 8-F cf ₃ CsC-Me H 265 6-Cl, 8-F cf ₃ CH ₂ CsC-CH ₃ H 266 6-Cl, 8-F cf ₃ CH ₂ CbC-CH ₂ CH ₃ H

3.12

267 6-1-8-F cf ₃ . CH 2 CH 2 CH (CH ₃ , 2 H 268 6-Cl, 8-F cf ₃ CH ₂ CH ₂ CH ₂ CH ₃ H 269 6-1-8-F CF3 ch ₂ ch ₂ ch ₃ H 270 6-Cl, 8-F cf ₃ CH ₂ CH ₂ -tBu H 271 6-Cl, 8-F cf ₃ CsC-Pr ch ₃ 272 6-1-8-F cf ₃ CsC-Pr ch ₃ 273 6-1-8-F cf ₃ CSC-Bu ch ₃ 274 6-Cl, 8-F cf ₃ CsC-iBu ch ₃ 275 6-Cl, 8-F cf ₃ CsC-Bu ch ₃ 276 6-1-8-F cf ₃ CsC-Et ch ₃ 277 6-Cl, 8-F cf ₃ CsC-Me ch ₃ 278 6-1-8-F cf ₃ CH ₂ CsC-CH ₃ ch ₃ 279 6-1-8-F cf ₃ CH ₂ CsC-CH ₂ CH ₃ ch ₃ 280 6-1-8-F cf ₃ CH ₂ CH ₂ CH (CH ₃ ) ₂ ch ₃ 281 6-Cl, 8-F cf ₃ ch ₂ ch ₂ ch ₂ ch ₃ ch ₃ 282 6-Cl, 8-F cf ₃ ch ₂ ch ₂ ch ₃ ch ₃ 283 6-Cl, 8-F cf ₃ CH ₂ CH ₂ -tBu ch ₃ 284 6-CH3 cf ₃ CsC-Pr H 285 6-CH3 cf ₃ CsC-Pr H 286 6-CH3 cf ₃ CsC-Bu H 287 6-CH3 cf ₃ CsC-iBu H 288 6-CH3 cf ₃ CsC-Bu H 289 6-CH3 cf ₃ CsC-Et H 290 6-CH3 cf ₃ CsC-Me H 291 6-CH3 cf ₃ CH ₂ C = C-CH 3 H 292 6-CH3 cf ₃ CH ₂ CsC-CH ₂ CH ₃ H 293 6-CH3 cf ₃ ch ₂ ch ₂ ch (ch ₃ , ₂ H 294 6-CH3 cf ₃ ch ₂ ch ₂ ch ₂ ch ₃ H 295 6-CH3 cf ₃ ch ₂ ch ₂ ch ₃ H 296 6-CH3 cf ₃ CH ₂ CH ₂ -tBu H 297 6-CH3 cf ₃ CsC-Pr ch ₃ 298 6-CH3 cf ₃ CsC-Pr ch ₃ 299 6-CH3 cf ₃ CsC-Bu. ch ₃ 300 6-CH3 cf ₃ CsC-iBu ch ₃

113

_6-CH3 CF ₃ CsC-Bu ch _{3 6-CH3} cf ₃ CSC-EL ch _{3 6-CH3} cf ₃ CsC-Me ch _{3 6-CH3} cf ₃ CH ₂ CEC-CH ₃ ch _{3 6-CH3} cf ₃ CH ₂ CsC ₂ CH ₂ CH ₃ ch ₃ 6-CH3 cf ₃ CH ₂ CH ₂ CH (CH ₃ ) ₂ ch _{3 6-CH3} cf ₃ ch ₂ ch ₂ ch ₂ ch ₃ ch _{3 6-CH3} cf ₃ ch ₂ ch ₂ ch ₃ ch _{3 6-CH3} cf ₃ CH ₂ CH ₂ tBu ch _{3 6-COCH3} cf ₃ CsC-Pr H _6-COCH3 cf ₃ CsC-Pr H 6-COCH3 cf ₃ CsC-Bu H 6-COCH3 cf ₃ CsC-iBu H 6-COCH3 cf ₃ CsC-Bu H 6-COCH3 cf ₃ CsC-Et H 6-COCH3 cf ₃ CsC-Me H 6-NH ₂ cf ₃ CsC-Pr H 6-NH ₂ cf ₃ C = C-Pr H 6-NH ₂ cf ₃ CsC-Bu H 6-NH ₂ cf ₃ CsC-iBu H 6-NH ₂ cf ₃ CsC-Bu H 6-NH ₂ cf ₃ CsC-Et H 6-NH ₂ cf ₃ CsC-Me H 6-NMe ₂ cf ₃ CsC-Pr H 6-NMe ₂ cf ₃ CsC-Pr H 6-NMe ₂ cf ₃ CsC-Bu H 6-NMe ₂ cf ₃ CsC-Ibu H 6-NMe ₂ cf ₃ CsC-tBu H 6-NMe ₂ cf ₃ CsC-Et H 6 — NMe ₂ cf ₃ CsC-Me H 7-C1 cf ₃ CsC-Pr H 7-C1 cf ₃ CsC-Pr H 7-C1 cf ₃ CsC-Bu H 7-C1 cf ₃ CsC-iBu H

114

335 7-Cl cf ₃ . CsC-Bu H 336 7-Cl cf ₃ CsC-Et H 337 7-Cl cf ₃ CsC-Me H

Unless otherwise noted, sLereochemistry is <♦ / ->

1JF.

Use Loss

The compounds of the invention show an inhibitory activity against reverse transcriptase, in particular an inhibitory activity against HTV. Compounds T exhibit HTV reverse transcriptase inhibitory activity and are therefore useful in the treatment of HIV infection and associated diseases. The compounds of formula I exhibit an HTV reverse transcriptase transcriptase inhibitory activity and are effective as HIV growth inhibitors. The ability of the compounds of the invention to inhibit viral growth or infectivity is demonstrated by standard viral growth or infectivity assays. for example using the assay described below.

The compounds of formula (T) of the present invention are also useful for inhibiting HTV in an ex vivo sample containing or suspected of being exposed to HIV. Therefore, the compounds of the present invention can be used to inhibit the HIV present in a body fluid sample (e.g., a serum and seed sample) that it contains. or believed to contain HIV. or has been exposed to HIV.

The compounds provided by the present invention are also suitable as standard or reference compounds for use in assays or assays to determine the ability of a substance to inhibit replication of viral clones and / or HIV reverse transcriptase, for example, in pharmaceutical research programs. Therefore, the compounds of the present invention can be used in these assays as control or reference compounds and as standards for quality control. The compounds of the present invention may be stored in a commercial kit or container using such a standard or reference compound.

Since the compounds of the present invention exhibit specificity for HTV reverse transcriptase, the compounds of the present invention may also be useful as diagnostic agents in diagnostic assays for the detection of HIV reverse transcriptase. Therefore, inhibition of reverse transcriptase activity in an assay (such as

116

An assay described herein) with a compound of the present invention may indicate the presence of HIV protease and HIV virus.

As used herein, µg refers to mlkrogram, mg refers to milligram, g refers to gram, ul refers to mlkroliter, ml refers to indicates milliliter, 1 refers to liter, 111 * 1 nanomolar, µM refers to micro olarolar. ml * 1 mole molar, 1 * 1 indicates molar and rim indicates nanometer. Sigma is a designation for Sigma-Aldrioh Corp. from St. Louis, 1 * 10.

HIV RNA Assay

IJNA plasmids and in vitro RNA transcripts

Plasmid pDAB 72 containing both gag and pol sequences of BH.10 (bp 113-1816) cloned the L ΓΖ 3! JR was prepared as ^l: .r-Lckson VIITANET, et al., AIDS Research and Human Retrosiruses 1989, 5, 577 The plasmid was near the BAM HT isovariate before generating in vitro RNA transcripts using a Riboprobe Gernini II kit (Promega) with Γ7 polymerase. The synthetized RNA was purified by treatment with DNAse-free RNAse (Promega) by extraction with eriol-chloroform and precipitation with ethanol. RNA transcripts were dissolved in water and stored at -711 G. The concentration of the RNA BNL set of _S and _{<I, O.}

probe:

Biotinylated capture probes were. Purified HPLC after synthesis on Applied Biosystems (Foster Gity, GA) DNA synthesized by adding biotin to the 5 'terminal end of the oligonucleotide using a biotin-phosphnramidite reagent nd Coouzza, Tnt. Lett. 1989, 3U, 6287. The Gag biotinylated capture probe (5-biotin-1TAGGTGGGTGCTTGCGGATACTA 3 ') was complementary to nucleotides 889-912 of HXB2 and the pcil to the iotinylated capture probe (5'-biotin-GCGTGTATCAT' 3T) ' —2395 of HXB2. The alkaline phosphatase enzymes used as receptor probes were prepared in

117

Synqene

C San

Diego,

C 5 'reporter probe

CTGTC1 T AC Γ Γ TGATAAAACC C C 3 ') 2403-2425 of HXB2).

CCLAGlATTTGTCTACAGCCTTCT complementary to nucleotides reporter probe C 5 'complementary to nucleotides tu ila Gag

3 ’) was

950-973 HXB2. All nucleotide positions are from the GenBank Genetic Sequence Data Bank, as available through the Genetics Group Sequence Arialysis Sriftuare Package (Deverau Nuc. Acids Research 19H4, 12, 387). Reporter probes were prepared as 0.5 U M stock solutions in 2 X SSC CO, 3 1 * 1 NaCl, 0.03 1 * 1 sodium citrate). 0.05 1 * 1 Tris pH 8, H, 1 mg / ml BSA. Blotiriylated capture probes were. prepared as 100 µl * l stocks in water.

Streptavidin-coated boards *

Streptavidin-coated plates were obtained from Du Pont Biutechnology Systems (Boston, MA).

Stock cells and viruses:

MT-2 and MT-4 cells were maintained in RPMT 1K40 supplemented with 5% fetal calf serum (FCS) for MT-2 cells or 10% FCS for MT-4 cells, 2 mM L-glutamine and 50 µg / ml gentamination. well, everything from Glbco. HIV-1 RF was propagated in MT-4 cells in the same medium.

approximately 10 days after acute as aliquots at -70 ° C. 7 x 3 x 1 () ^{S * 7} PTJ (plaque creature Laclch

Virus stocks were prepared

i.nf-ekcii. MT-4 cells and stored infectious HTV-1 (RF) stick plates) / ml as measured by plaque assay on M1-2 cells (see below). Each portion of the stock viruses used for infection was allowed to melt only once.

In order to evaluate antiviral activity, the cells to be infected were. subcultured one day before infection. On the day of infection, cells were resuspended at 5 x 1.0 ¹⁵ cells / ml in RPMT 1R40, 5X FCS for large infections or 2 x 10 10 ^A / ml in modified nrulum medium from Dulbecco with 5% FCS for infrared plates. They were. added viruses and cultivation continued for 3 days at 37 ^° C.

118

HIV RNA Test:

Cell lysates or pur. RNA stained in 3 1 * 1 or 5 1 * 1 GED probe to a final 3 1 * 1 and 30 nl * l linearity. Hybridization with a deletion of the streptavial isocyanate was mixed with 5 1 * 1 RFC and capture concentration. guariidinium isocyanate co-centrifugation in blunt-gonucleotide.

was performed in sealed 96-well 11-day culture plates (Nunc or Costar) for 16-20 hours at 37 ° L. The RNA hybridization reaction mixtures were diluted 3-fold with water to a final guanidinium concentration of 1 * 1 and aliquots (150 µl) were transferred to coated wells of the microtiter plates.

The capture probe binding and the sorida-RNA hybrid to immobilized streptavidin were allowed to proceed for 2 hours at room temperature, and then the plates were washed 6 times with wash buffer of El ISA plates from DuPont (phosphate buffered saline (PBS), 0.5%). Tween 2U). A second hybridization of the reporter probe to the tinobium-captured capture probe complex and hybridization of the target RNA was performed in the washed, epidermis-coated wells by adding 120 µl of a 4X SSO hybridization cocktail containing 0.66% Triton X .1.00, 6, 66 % deionized form, 1 mg / ml BSA and 5 µL / L reporter probe. After hybridization for one hour at 37 ° C, the plate was washed 6 more times. The activity of immobilized and alkaline phosphatase was determined by the addition of 4-methylumbellophenyl phosphate (MIJBP, JBL Scierttific)

1 * 1 diethanolamine pH 8.9 (JBl Scientific), 10.00 µl 0. 2 ml * 1 in buffer 6 (2.5 ml * 1 MgCl _a . S nil * 1 zinc acetate dihydrate and 5 ml * 1 N- hydroxy-ethylene-diamine-triacetic acid). The plates were incubated at 37 C. ^The fluorescence was measured at 450 nm using a microplate fluorumetra (Dyriateck) excitation at 365 nM.

They are also useful for treating 11 in HIV-1 infected MT-2 cells

Test compounds were dissolved in DMSO and dissolved in DMSO

The culture medium is twice the highest concentration to be tested and the maximum concentration is 2%. Another series of triple rs! of the compound in the culture medium was performed in L1-day microtiter plates (Nuric). When diluted compounds were added to MT-2 cells were <50 yl) to a final concentration of 5 x I ¹⁵ ml <1 × 10 ^Ώ the recess). Cells were compounded for 30 min. at 37 ° C in C0 _{and the} detection of antiviral activity holo added to the vials, the cell content and the regulation

Incubated with incubators. For culture test compounds, appropriate dilutions of HIV-1 (RF) virus stock (50 µl). The final volume in each well was 200 µl. Eight depressions per plate were left uninfected with 50 µl of medium added instead of viruses, while eight depressions were infected in the absence of any virus compound. Parallel plates of pretty viral infection were cultured to investigate compound toxicity.

After 3 days of culture at 37 ^R H in a humidified chamber inside a CL) _and incubator were taken from the HIV-infected plates 25 yl media / well. 37 µL of 5 L * 1 GFD containing biotins, the boiling capture probe and the remaining medium were added to the plated cells to each well to a final concentration of 3 L * 1 GFD and 30 µL * 1 capture probe. Hybridization of the RJ HJV RNA capture probe in the cell lysate was performed at the same microplate well as used in virus culture by sealing the plate with sealant (Gostar) sealant and incubating for 16-18 hours in a 376 incubator. Distilled water was then added to each well to dilute the fusion hybrid in triplicate and 1.50 µL of this diluted mixture was transferred to a streptavidin-coated microtiter plate. The HTV RNA was quarified as described above. A standard curve, prepared by adding known amounts of pDAB 72 in vitro RNA transcript to wells containing lysed uninfected cells, was run through each microtiter plate to determine the amount of viral RNA produced during infection.

To standardize the viral inoculum used in the study

120 of the compounds in terms of antiseptic activity, virus dilutions were selected that reached Γβ _9Ο (compound concentration required to reduce HIV RNA by 9Π Z) for dideoxycytic hole (ddC), 0.2 µg / ml. The rc ₉₀ values of other anti-viral compounds, more or less stronger than ddC, were. reproduced using a series of HIV-1 (RF) stocks as long as this procedure followed. This virus concentration corresponded to about 3 x 10 6 ^with PI J (plaque forming units, as measured by plaque assay on MT-2 cells) per test well, and typically produced approximately 75% of the maximum level of viral NRA achievable by viral unit. For the HIV RNA assay, IC ₅₀ values from the pure (neC) signal (signal from samples minus the signal relative to the percentage reduction in infected cell cells) were determined in the RNA assay from the samples not infected with the net (net) signal from the same culture plate. as assessed by three infected untreated cells (eight wells in diameter).

Infection and RNA Testing Criteria. Viral infection in the RNA assay was required to have a signal equivalent to or greater than the signal generated by 2 ng of pDAB in vitro RNA transcript. The Π: _νο for ddC, determined in each series of tests, should be between 0, 1 and 0, 3 µg / ml. Finally, the value of the fifth viral inhibition of the protease should be achieved in a non-infectious infection.

RNA produced efficiently less than WZ of Compound is considered active if its TC: _{VO was} determined to be less than 2U µL * 1.

When testing against. viral challenge, all manipulations in the incubation plates followed by initial administration of a 2X concentrated compound solution to a single row of wells were performed using Perkin Elmer / Cetus ProPette.

Protein binding and mutant resistance

The objective of characterizing NNRTT ana'LgTs for 1c: h clinical potency was to investigate the effect of plasma proteins on antiviral potency and the level of antiviral potency against wild-type and mutant HIV variations that introduce amino acid changes in

121 known NNRTI binding sites. The standard for this testing strategy is two:

1. Many drugs are extensively bound to plasma proteins. Although it has a binding affinity for most drugs for the major components of human plasma, particularly human serum albumin (HSA) or alpha-1-acid glycoprotein (AAG). low, these major components are present in high concentration n blood. L en free or unbound The drug is able to penetrate the infected cell membrane in order to Lriterate to the target site (i.e. HIV-J (tris-indiscriminase, HIV-RT). Briefly, the effect delivered by the HSA + AAG antiviral potency in tissue culture more closely illustrates the potency of a given compound in a clinical setting. Compound concentration required for 90% Inhibition of viral replication, as measured by a viral RNA-based sensitive detection method, is indicated by Ii: 90, Then the fold increase for the apparent TC90 for test compounds in the presence of added amounts of US and AAG is displayed. in vivo Kunceritrations <45 mg / ml HSA, 1 mg / ml AAG). The lower the fold increase, the more the compound will be able to interact with the target site.

2. The combination of the high rate of viral rtspl lkácle in the Infected individual and the weakness of the results of the viral RI results in the production of quasi-species or a mixture of HIV varieties in the infected individual. These varieties will mainly include the wild type, but these? mutant variants of HIV and the size of a given mutant will show its relative capability and replication rate. Since mutant variants include mutants with changes in the amino acid sequences of viral RTs that are likely to exist in infected quasi-species of individuals, the overall potency observed in clinical settings will show the ability of the drug to not only wild type HTV-1 but mutant variants as a whole. . We have prepared, in a known genetic background, mutant HIV-1 mutants that carry amino acid substitutions at positions that are believed to be involved in NNRTI binding and measured the ability of test compounds to inhibit replication of these mutaritrient viruses. Concentration of Compound

122 required for 90% inhibition of viral replication measured using a viral-based sensitive detection method; marked

TGUIJ. It is desirable to have a compound that has high potency against many mutants.

Dosage and composition:

The antiviral compounds of the present invention can be used as a medicament for viral infections by any means that ensures contact of the agent with the site of action of the subject, i.e., viral reverse transcriptase, in the mammalian body. They may be administered by any of the conventional methods for use in conjunction with pharmaceuticals, either as a single therapeutic agent or in a combination of therapeutic agents. They may be administered alone, but administration with a pharmaceutical carrier selected on the basis of choice is preferred; routes of administration and standard pharmaceutical practice.

Of course, the dosage will vary depending on many factors, such as the pharmacodynamic nature of the particular substance and its type and route of administration? the age, health and weight of the recipient; nature and extent of symptoms, type of further treatment.a; frequency of treatment; and the desired effect. The daily dose of the active ingredient is acceptable from about 0.001 to about. 100 milligrams per kilogram of body weight, with a preferred dose being about 0.1 to 30 mg / kg.

Dosage forms of compositions suitable for administration contain from about 1 mg to about 101 µg of active ingredient per unit. In these pharmaceutical compositions, the active ingredient will usually be present in an amount of about 0.5 to 95% by weight, based on the total weight of the compositions. The active ingredient may also be administered orally in solid dosage forms, such as capsules, tablets and powders, or in liquid dosage forms, such as elixirs, syrups and suspensions. It can also be administered parenterally in sterile liquid dosage formulations.

123

Gelatin capsules contain the active ingredient and a powdered powder such as lactose, starch, cellulose derivatives, magnesium stearate, stearic acid and the like. Similar diluents may be used to prepare compressed tablets. Both tablets and capsules can be manufactured as sustained release products that provide continuous drug release over a period of hours. Compressed tablets may be sugar-coated or film-coated to mask any unpleasant taste and protect the tablet from the effects of air, or enteric coated for selective disintegration in the gastrointestinal tract. Liquid dosage forms for oral administration may contain coloring and flavoring to increase patient acceptance.

In general, water is suitable carriers for parenteral solutions. suitable oil, saline, aqueous dextrose (glucose) and similar sugar solutions and glycols such as propylene glycol or polyethylene glycols. Solutions for parenteral administration preferably contain water-soluble salts of the active ingredient, suitable stabilizing agents and, if necessary, buffering agents. Antioxidant substances. such as sodium bisulfite, sodium sulfite or ascorbic acid, either singly or in combination, are suitable stabilizing agents. Citric acid is also used and is a salt and sodium salt. Further, parenteral solutions may contain preservatives such as berizalkonium chloride, methyl or propylparaben and chlorobutanol. Suitable pharmaceutical carriers are described in ReminqLon's Pharmaceutical Scaler, es, standard for reference in the art.

Suitable pharmaceutical dosage forms for administration of the compounds of this invention may be exemplified as follows:

capsules

A large number of unit capsules can be prepared by filling standard two-piece hard gelatin capsules, each with 100 mg powdered active ingredient, 150 mg lactose, 50 mg

L24 of cellulose and 6 ing of magnesium stearate.

Soft gelatin capsules

A mixture of the active ingredient in an edible oil such as soybean oil, cottonseed oil or olive oil can be prepared and injected by means of a positive displacement pump into gelatin to form soft gelatin capsules containing 100 mg of the active ingredient. The capsules are then washed and dried.

tablets

A large number of tablets may be prepared by conventional methods such that a dosage unit is 100 mg of active ingredient, 0.2 mg of colloidal silica, 5 mg of magnesium stearate. 275 mg of inicrocrystalline cellulose, 11 mg of starch and 98.8 lactose. Appropriate coatings may be applied to improve palatability and gradual absorption.

Susper iz l.e

The aqueous suspension may be ready for oral administration such that each 5 ml contains 25 mg of finely divided active ingredient, 200 mg of sodium carboxymethylcellulose, 5 mg of benzoate, 1.0 g of sorbitol-II solution, II.S.P and 0.025 mg of vanillin.

Injectable solutions

A parenteral formulation suitable for injection may be prepared by mixing 1m5 of a wt. of the active substance in 10% by volume. propylene glycol and water. The solution is sterilized by commonly used techniques.

Combination of components (a) and (b)

Each component of the therapeutic agent of the invention may be independently in any dosage form, such as that which is

125 as described above, and can also be administered by a variety of procedures, as described above. In the following, component C b) is to be understood as representing one or more substances as described above. Therefore, if items C a) and C b) are to be treated equally or independently, each substance of component C b) can be treated equally or independently.

Components C a) and C b) of the present invention may be formulated together in a single dosage unit (i.e., combined in a single capsule, tablet, powder, liquid, etc.) as a combination product. If component C a) and C b) are not formulated together in a single dosage form, component C a) may be administered at the same time as component C b), or in any order .; for example, component C a) of the invention may be administered first, followed by component C b), or may be administered in reverse order. If component C b) contains more than one substance, for example one RT inhibitor and one protease inhibitor. they may be administered together or in any order. If not administered at the same time, it is preferable to administer components C a) and Cb) in a range of less than about one hour apart. Preferably, the route of administration of component C a) and component C b) is oral. Dates of oral substance. oral inhibitor, oral compound or soil, as used herein, refers to compounds that can be administered orally. Although preferred. for both components C a) and C b) to be administered by the same route (i.e., orally), if desired, can be administered by each other route Ctn means, for example, that one component of the combination product can be administered orally and the other component administered intravenously) or in dosage forms.

The medical practitioner, as one skilled in the art, will assume that the dose at. the combination therapy of the invention changes. depending on various factors, such as the pharmacodynamic characteristics of the particular substance and its type and route of administration, the age, health and weight of the recipient, the nature and extent of the symptoms, the nature of the other treatment, the frequency of treatment and the effect desired as described above.

J2B

The actual dosage of components C a) and C b) of the present invention will be readily ascertainable by a medical practitioner skilled in the art based on the present disclosure. As a general guide, a typical daily dosage may be about 100 milligrams to about 1.5 grams of each component. If component Cb) denotes more than one compound, the putt may be a typical daily dosage of about 100 milligrams to about 1.5 grams of each component of component Cb). As a general guideline, when the compounds of component C a) and component C b) are administered in combination, the dosage amount of each component may be reduced to about 70 to 80% relative to the usual dosage of the component when administered alone as an individual to treat MTV infection. .

The combination products of the present invention can be formulated such that even if the active ingredients are combined into a single dosage unit, physical contact between the active ingredients is minimal. In order to minimize contact, for example when the product is administered orally, one active ingredient should be enteric coated.

By internally coating one of the active ingredients, it is not only possible to minimize the contact of the inter. but it is also possible to control the release of one of these components in the gastrointestinal tract so that one of these components is not released in the stomach but rather released in the intestines.

Another embodiment of the present invention wherein oral administration is desired provides a combination product. wherein one or more active ingredients are coated with a sustained release material that causes sustained release in the gastrointestinal tract and also serves to minimize physical contact between the combined active ingredients. Further, the sustained release component may be additionally enteric coated with lacquer that the release of this component occurs only in the intestines. Yet another formulation of the combination product, in a sustained and / or enteric release coated polymer, and the second component is coated with a polymer, such as low viscosity hydroxymethylcellulose, or the concept is included in which one component is

Other suitable materials known in the art to further separate the active ingredients. The polymeric coating serves to form a barrier against interaction with another component. In any composition where contact between the components Ca) and <b) is prevented by a coating or some other material, the contact between the individual substances (component C 1) can also be avoided.

and other active tablets, or multiple enteric agents

The dosage forms of the combination products of the present invention are wherein one enteric coated active ingredient may be in the form of tablets, such that the enteric coated ingredient component is mixed together and then compressed so that the enteric coated component is compressed into one a tablet layer and another active ingredient is compressed into another layer. Alternatively, to further separate the two layers, one or more placebo layers may be present, so; there is a placebo layer between the active ingredient layers. Further, the dosage forms of the present invention may be in the form of capsules wherein one of the active ingredients is compressed into a tablet or in the form of microtablets, particles, granules. which are then coated. These enteric coated microtablets, particles, granules are then introduced into a capsule or compressed into a capsule during granulation of the other active ingredient.

These, as well as other, methods minimize contact between the components of the poodle combination products of the present invention when administered in unit dosage form or administered in separate forms. but at the same time or concurrently in the same manner, are readily conceivable to one of ordinary skill in the art based on the above description.

Pharmaceutical kits suitable for the treatment of HIV infection, comprising a therapeutically effective amount of a pharmaceutical composition comprising a compound of component (Ca) and one or more compounds of component (b), in a single flight of multiple sterile containers / containers are also within the scope of the present invention. Sterilization of the container may be accomplished by conventional sterilization procedures well known in the art.

128

Component C a) and (b) may be in the same sterile container or in separate sterile containers. Sterile material containers may include separate containers or one or more multi-part containers as required. Component Ca) and component (b) may be separated or physically combined into a single dosage form or unit as described above. Such kits may further include, if appropriate, one or more different conventional ingredients of pharmaceutical kits, such as one or more pharmaceutically acceptable carriers, additional containers for mixing the ingredients, etc., as will be apparent to those skilled in the art. Instructions, either as leaflets or stickers, indicating the amount of ingredients to be administered, instructions for administration and / or instructions for mixing the ingredients may also be included here.

the above description of a possible present invention. Thus, the claims may also be as otherwise specific herein

Of course, given the numerous modifications and variations, it will be apparent that the invention will be practiced within the scope of the appended claims.

Claims (13)

1. Merged to g by general formula com T. s R ¹ R ² or a stereoisomer thereof or an macuutically acceptable salt thereof; R ^{1 is} N-C 1-6 alkyl substituted by 1 to 7 atoms R '·' is selected from the group consisting of: r: _x . _{u is} alkyl substituted with J-2 R ¹ , O-. . ^ alkenyJ substituted with 1, 2-R @ ^t and I .: _p; . _And Al which ny 1 substituted with one R; R * is independently vyfcír aný from the group which includes: _x. ~ "Alkyl, IIH, C .. _and alkoxy. F, i :: i „l) r. I, NR * R · · '·, _{it, and,} ON, R CU) ^RA, NHC (I.'1) R ^7, and s ^ NHCCIDNR'R alternative, where there are two substituents R ⁷⁵ and are attached to adjacent carbon atoms, then may together form L '-DCH _and r'-; R 6 is selected from the group C 3-8 -cycloalkyl substituted with 0-2 R ³ . phenyl substituted with 0-5 R ³ and a 5-5 membered heterocyclic system containing 1-3 heteroatoms selected from O, N, S, substituted with 0-2 R ³ ; R ³ and R ⁶ are independently selected from H and C _1-3 alkyl; 130 R ^A is independently selected from the group. which included the H, OH, C ^ -alkyl, L _x - alkoxy and NR ^with R ^3; R ⁷ is selected from the group comprising a C ₃ DSD alkyl and C _t _ ₃ alkoxy; R ^B is selected from the group consisting of H. C 3-8 cycloalkyl and C _1-3 alkyl; and n is selected from 0, 1, 2, 3, and 4. A compound according to claim 1, wherein R ¹ is C 1 -C 7 alkyl substituted with 1 to 7 halogen atoms; R ² is selected from the group comprising C _x alkyl. LR * a substituted a-gaLkenyl substituted with R * and _C - _with the dl ynyl substituted with R 1 '*; R ³ is each independently selected from the group consisting of C _t _ < »alkyl. OH, C 1-6 alkoxy, F, Cl, Br, I, NR ³ R ^8a . NO _a , CN, C: (U) R ^{A. 7} NHCC05R NHR a (0) NR ^{i 5} R ^{f, '<;} alternatively, if two R ³ substituents are present and are attached to adjacent carbon atoms, the bonds may together form -OCH-pO-; R ¹ is selected from C 1 -C 5 cycloalkyl substituted with 0-2 R ³ , phenyl. substituted 0-2 R ³ and a 5-6 membered heterocyclic system containing 1-3 heternatomes selected from O. N, S, substituted with 0-1 R ³ ; R ^a and ^{R a} are independently selected from H and CH ~ _J and Γ ₂ Η _5; R ^A is independently selected from H, OH. CH ₃ . C ₌ Hs. OCH. OC _a H _p, and NR ^a R ^{5 N;} 131 R ^x is selected from the group consisting of H ₃ , C _and H ₃ , OCH ₃ , O ₂ , or O ₃ R 1 is selected from H, cyclopropyl, CH ₃ and Li * H 5; and n is a selected from 0. 1, 2 and 3. Third Article 2, where < R ¹ is a selected from file. which include them (.F ₃ and l. _And Fϋ t R ^s is a selected from file. which includes C _1-3 alkyl substituted L R ^- * _ _and C ₃ alkenyl, substituted 1 R ⁼ * and C 5-6 salkynyl substituted with 1 R *; R ³ is each independently selected from the group consisting of RT-alkyl. OH. C _x _, alkoxy. F, CL. Br, I, NR ⁵ R ^S, \ N0 _and CN, C (C1) R ^A. NHCCOJR ⁷ and NHC (NR 11 R 11 ⁾ s alternatively, if two R ³ substituents are present and are attached to adjacent carbon atoms, then they may together form -IICH _and II-; R ⁴ is selected from the group comprising C ₃ _ oyklualkyl substituted _with 0-2 R ^3, thienyl, substituted with 0-2 R ³ and C-5 membered heterocyclic system containing 1-3 heternatúmy selected from O, N, S, substituted with 0-1 R ³ ; R ^{3 R 3} and R are independently selected from H and CH _3, and C _and H t _s R ^A is selected from H, OH. CH ₃ , C _and H _s , UCH _3, UC ₂ and H _p NR ⁵ R ⁵ · *; R ⁷ is selected from the group. comprising a CH _3, C _and H, _s, 0CH _3, and OC _and H _e ; J 32 R ^V is selected from the group comprising H, CH _{3 and} H, and L _s; and n is selected from 0, 1, and 2. The compound of claim 3, wherein s R ¹ is CF ₃ ; R ² is selected from the group comprising L _{t. 3} alkyl substituted with R i, ._ _x C ₃ Al alkenyl substituted with 1 R ₂ and G ₃ _ alk ny'l suhsti monosubstituted with R 1; R is each independently selected from C _x . ₃ alkyl, OH. 6 _{at 3} α, alkoxy, F, 1'1. C <1 R ^A. NHIXIDR 'a and CDNR ⁵ R ^5a ; file that Br. 1, NR ³ R ^{3 '} includes NOa. GN, alternatively, if two R ³ substituents are present and are attached to adjacent carbon atoms, they may together form -OCH _and O- » R * is selected from the file. which comprises a cyclopropyl substituted with β-R ³ , a phenyl substituted with a 0-2 R ^3, and a 5-6 membered heterucyclic system containing 1-3 heteroatoms selected from O, N, S, substituted with 11-1 R ³ , wherein the heterocyclic system is selected from 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-furanyl, 3-turanyl, 2-thienyl, 3-thienyl, 2-oxazolyl, 2-thiazolyl, 4-isoxazolyl and 2-imidazolyl; R ^'3 and R ** are independently selected from H and LH ₃ and L' - '. H _S; R ^{A is} selected from H, OH, CH ₃ , L ₂ H ₅ . OCH ₃ , OC ₂ H ₃ and NR 4 R ³ -; R ^x is selected from H ₃ . Π ~ _»Η η» uLH ₃ and NCS, H '; ι: η R ¹ is selected from the group comprising H, III and ₃ Ľs.H tan _n is selected from 1 and 2. The compound of claim 4, wherein the compound has the formula Ia: Ia. A compound according to claim 4, wherein the compound has the formula Ib: A compound according to claim 1, wherein x <file is selected from J account i i, comprising: CH 2 - (4-Cyclohexyl) ethyl-4-trifluoromethyl-1,4-dihydro-2,4-dihydro-quinazolium; C 1 -) -G Chloro-4-C 2 -pyridine Dotiny I 4 Lr 1 Fluoromethyl-3,4-d -2C11.1-linazolazoliriones (R) -G- Chloro-4-phenyl-4-phenyl-4-trifluoromethyl-3,4-dihydro-2H-1-chloro-zirconium; C + 1 -4-Cycloprophylethynyl-G-inethoxy-4-trifluoromethyl-3. 4-dihydro-2C (1H) -quinazolone; (1H) -E-1-ethoxy-4 (2-pyridyl) ethynyl-4-trifluoromethyl-3,4-dihydro-2H-quinazolinone; C +/-) -6-1 * methoxy-4-phenylethylenes 1-4-trifluoromethyl-3,4-dihydro-2H-quinazolinone; 134 C + - (-) - 4-Cyclopropylethyllyl-1,6,6-di-fluoro-4-trifluoromethyl-3,4-dihydropyridine-2-carboxylic acid ; (R) -5,6-Difluoro-4- (p-pyridyl) ethynyl-4-trifluoromethyl-3,4-dihydric-2 (1H) -quinazoline; (+ - / -) -5, H -Di. fluoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2- (1H) -quinazoline-ion; ¢ +/-) -4-Cycluprupyl-vinyl-β-fluoro-4-trifluoromethyl-3,4-dihydro-2 H- quinazolinone; (+/-) -E1-Fluoro-4-C2-pyrrolidinylmethyl-4-trifluoromethyl-3,4-diidyl-2H (1 H) -1: hexazolidin; (+ -) - 6-Fluoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2 (1H) -pyridinilone (+) - E-Fluoro-4- 2 C '2-pyridylamino J) ety1-4-tr ^Lf: luúrmeLyl-3, 4-di lydr the 2 <1H) -chlnazollnón; ¢ +/-) - β-Flurtr-4-phenylethyl-4-trifluoromethyl-3,4-dihydro-2 H -quinazonium; (R) -6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2H (1 H) -quinazolinone; C + 1 - 6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2H-naphthalenone; (+) - 4-Cyclopropylmethynyl-5, 1-difluoro-4-trifluoromethyl-3,4-dihydro-2H (1 H) -quinazolinone; ... 4. Cyclripropylethynyl-5, N-difluoro-4-1H-fluoromethyl-3,4-dihydro- [eta] < 1 &gt; Fluoro-3,4-trifluoromethyl-3,4 13b IDI-2'.1 ID-ch'i is found in another; and C 1 -C 4 Cl-4-E-Cyclopropyl-5-methyl-5-fluoro-4-triene. 3-methyl-3,4-dihydro-2H-1H-indol-1-one; or a pharmaceutically acceptable salt thereof. 0.Merged with a general formula II with nlotii where: ic The R 1 'sLerene isomer or one of its groups: -R ¹ ''; a pharmaceutically acceptable salt. ic is selected from the group consisting of, O, N, alkoxy, Γ, C, H, I, and NHIX II) NR ^, * R ''*; which include · O _(. ^ al.kyl, 1111, ^NR "R °, Load Balancing. In, LXIII) R ^A, NHCCIOR ' R ' ⁴ ' ³ &apos; is selected from the group consisting of methyl, ethyl, o-propyl, i-propyl, i-thiyl, tert. butyl and i-pntyls ® R ¹ and R ^are independently selected from the group consisting of H and C ₃ alkyl; R ^A is selected from the group comprising H, ΟΙΊ, C ^ alkyJ, Calkoxy, and NR ^{ss R! 5} s R ^x is selected from C _1-3 alkyl and C _1-3 alkoxy; R ^e is selected from the group consisting of H, L _{3 ' s} cycloalkyl and 1,3 R' What- . ₃ alkyl: a n is a selected from 0. 1, 2, 3 and 4th 9th compound according to claim B, where R® is a CsC-R ⁴ “» R ³ .is a selected from file which includes a C _x _ alkyl, OH, C. ,. . ₄ alkoxy, F. Cl. Br. I, NR In ^n, N0 _ft. CN. CCO) R ^A, and NHCCCDR ⁷ ; R ^{4 is} selected from methyl. ethyl, n-propyl, 1-propyl], i-butyl, tert. butyl and iipents]; ^When R '1 R ^{,, R} ferroalloy envy selected from the group comprising H, CH _5, and n, .I-HJS: R * '· is selected from the group consisting of H, UI I, CH ₃ , C _and I Ι _Ώ , OCH ,, iC-Jk- »and ΝΗ'ΝΗ- *': R ⁷ is selected from CH 3. C _and H _Li . tlCH.jal) as: _p = _.H,, R ^{1 is} selected from H, cyclopropyl, CH, and C _and H. 5; and n is selected from 0, 1 and 2. The compound of claim 9, wherein the compound has the general formula IIIa. The compound of claim 9, wherein the compound has the general formula 137 pattern ec Ilb. The compound of claim 8, wherein the compound is selected from the group consisting of: (R) -B-Chloro-4-isopropyl-ethynyl-4-trifluoromethyl-3. 4-dihydro-2H-chloro-azirium; (R) -N-Chloro-4-ethyl-ethyl-4-trifluoromethyl-3,4-dihydro-2 (1H) -quinazoline; ζ i /. 4-Tzopropylethynyl-R-methoxy-4-trifluoromethyl-3,4-dihydro-2 (11D-clonazolinone); (I) R, (1) Fluoro-4-1-propylethynyl-4-trifluoromethyl-3,4-dihydro-2 (11I) -chlorosolonone; (R) (4-Difluoro-4-ethynyl-vinyl) 4-trifluoromethyl-1-3, 4-dihydro-2 (11-D-quinazolyl); (R) -B, 6-Difluoro-4-ispentyl-4-trifluoromethyl-3,4-dihydro-2 (1H) -naphthalenone (1H) -6-fluoro-4-i zopropylotinyl-4-trifluoromethyl-1,3,4-dihydro-2 (1H) -quinazoline-one; (-./-)-6-Fluór-4-etyletiny1-4-trifluórmetyl-3,4-dihydro-2(IH)-chlnazollnón; (-) - 5, R-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2H-quinolinone; (+) - 5,6-D-fluoro-4-isopropylethynyl-4-trifluoromethyl-3. 4-dihydro138 -2C1H) -quinazol inone; C -) - 5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2 (1H) -quinazolinone; and <+) - 5. 6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2 (1H) -quinazolinone; or a pharmaceutically acceptable salt thereof. . A pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of a compound according to any one of claims 1 to 12, or a pharmaceutically acceptable salt thereof. . 14. A method of treating HIV infection, comprising administering to the host in need of such treatment a therapeutically effective amount of a compound according to any one of claims L to 1.2, or a pharmaceutically acceptable salt thereof. 15. A method of treating an HIV infection comprising: that a therapeutically effective amount is administered to the host in need of such treatment in combination: a) a compound according to any one of claims 1 to 12, or is a stereoisomeric form, a mixture of stereoisomeric forms, or a pharmaceutically acceptable salt; and b) at least one compound selected from the group consisting of reverse transcriptase inhibitors and HIV protease inhibitors. L6. The method of claim 15, wherein the reverse transcriptase inhibitor is selected from the group consisting of AZT, 3TC, dd1, ddC, d4T, delavirdine, ΠΠ derivatives, BI-RG-587, nevirapine. L-697, 661, LY 73497, Ro 1E1 893, ref. trovirdine, MKO-442 and HBY 097 and the protease inhibitor is selected from the group consisting of saqulnav ir, ritonavlr, iridinavir, 139 nelflnavir. KNT-272nd CGP-61,755th U-140690 and ABT-37H. 1.7. The method of claim 15, wherein the reverse transcriptase inhibitor is selected from the group consisting of AZT and 3TC, and the protease inhibitor is selected from the group consisting of saquiriavir. ritonavir, nelfinavir, and indinavir. 18. A pharmaceutical plaque useful in the treatment of HIV infection, characterized in that it comprises a therapeutically effective amount of: a) a compound according to any one of claims 1 to 12, or non-aeroisrimeric forms, mixtures of stereoisomeric forms, or a pharmaceutically acceptable salt thereof; and b) at least one compound selected from the group consisting of reverse triglycerase inhibitors and HIV protease inhibitors in one or more sterile containers.