CA2284996A1 - 4,4-disubstituted-3,4-dihydro-2(1h)-quinazolinones useful as hiv reverse transcriptase inhibitors - Google Patents
4,4-disubstituted-3,4-dihydro-2(1h)-quinazolinones useful as hiv reverse transcriptase inhibitors Download PDFInfo
- Publication number
- CA2284996A1 CA2284996A1 CA002284996A CA2284996A CA2284996A1 CA 2284996 A1 CA2284996 A1 CA 2284996A1 CA 002284996 A CA002284996 A CA 002284996A CA 2284996 A CA2284996 A CA 2284996A CA 2284996 A1 CA2284996 A1 CA 2284996A1
- Authority
- CA
- Canada
- Prior art keywords
- ch2ch2
- pyridyl
- dihydro
- trifluoromethyl
- quinazolinone
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D239/00—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
- C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
- C07D401/06—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/18—Antivirals for RNA viruses for HIV
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D239/00—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings
- C07D239/70—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings condensed with carbocyclic rings or ring systems
- C07D239/72—Quinazolines; Hydrogenated quinazolines
- C07D239/78—Quinazolines; Hydrogenated quinazolines with hetero atoms directly attached in position 2
- C07D239/80—Oxygen atoms
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Chemical & Material Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Virology (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- AIDS & HIV (AREA)
- Tropical Medicine & Parasitology (AREA)
- Molecular Biology (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Plural Heterocyclic Compounds (AREA)
Abstract
The present invention relates to 4,4-disubstituted-3,4-dihydro-2(1H)-quinazolines of formula (I), or stereoisomeric forms, stereoisomeric mixtures, or pharmaceutically acceptable salt forms thereof, which are useful as inhibitors of HIV reverse transcriptase, and to pharmaceutical compositions and diagnostic kits comprising the same, and methods of using the same for treating viral infection or as an assay standard or reagent.
Description
TITLE
4,4-DISUBSTITUTED-3,4-DIHYDRO-2(1H)-QUINAZOLINONES USEFUL AS
HIV REVERSE TRANSCRIPTASE INHIBITORS
FIELD OF THE INVENTION
This invention relates generally to 4,4-disubstituted-3,4-dihydro-2(1H)-quinazolinones which are useful as inhibitors of HIV reverse transcriptase, pharmaceutical compositions and diagnostic kits comprising the same, methods of using the same for treating viral infection or as assay standards or reagents, and intermediates and processes for making the same.
BACKGROUND OF THE INVENTION
Two distinct retroviruses, human immunodeficiency virus (HIV) type-1 (HIV-1) or type-2 (HIV-2), have been etiologically linked to the immunosuppressive disease, acquired immunodeficiency syndrome (AIDS). HIV seropositive individuals are initially asymptomatic but typically develop AIDS related complex (ARC) followed by AIDS. Affected individuals exhibit severe immunosuppression which predisposes them to debilitating and ultimately fatal opportunistic infections.
The disease AIDS is the end result of an HIV-1 or HIV-2 virus following its own complex life cycle. The virion life cycle begins with the virion attaching itself to the host human T-4 lymphocyte immune cell through the bonding of a glycoprotein on the surface of the virion's protective coat with the CD4 glycoprotein on the lymphocyte cell. Once attached, the virion sheds its giycoprotein coat, penetrates into the membrane of the host cell, and uncoats its RNA. The virion enzyme, reverse transcriptase, directs the process of transcribing the RNA into single-stranded DNA. The viral RNA
is degraded and a second DNA strand is created. The now double-stranded DNA is integrated into the human cell's genes and those genes are used for virus reproduction.
At this point, RNA polymerise transcribes the integrated DNA into viral RNA. The viral RNA is translated into the precursor gag-pot fusion polyprotein. The polyprotein is then cleaved by the HIV protease enzyme to yield the mature viral proteins. Thus, HIV protease is responsible for regulating a cascade of cleavage events that lead to the virus particle's maturing into a virus that is capable of full infectivity.
The typical human immune system response, killing the invading virion, is taxed because the virus infects and kills the immune system's T cells. In addition, viral reverse transcriptase, the enzyme used in making a new virion particle, is not very specific, and causes transcription mistakes that result in continually changed glycoproteins on the surface of the viral protective coat. This lack of specificity decreases the immune system's effectiveness because antibodies specifically produced against one glycoprotein may be useless against another, hence reducing the number of antibodies available to fight the virus. The virus continues to reproduce while the immune response system continues to weaken. Eventually, the HIV largely holds free reign over the body's immune system, allowing opportunistic infections to set in and without the administration of antiviral agents, immunomodulators, or both, death may result.
There are at least three critical points in the virus's life cycle which have been identified as possible targets for antiviral drugs: (1) the initial attachment of the virion to the T-4 lymphocyte or macrophage site, (2) the transcription of viral RNA to viral DNA (reverse transcriptase, RT), and (3) the processing of gag-pol protein by HIV protease.
Inhibition.of the virus at the second critical point, the viral RNA to viral DNA transcription process, has provided a number of the current therapies used in treading AIDS. This transcription must occur for the virion to reproduce because the virion's genes are encoded in RNA and the host cell reads only DNA. By introducing drugs that block the reverse transcriptase from completing the formation of viral DNA, HIV-1 replication can be stopped.
A number of compounds that interfere with viral replication have been developed to treat AIDS. For example, nucleoside analogs, such as 3'-azido-3'-deoxythymidine (AZT), . 2',3'-dideoxycytidine (ddC), 2',3'-dideoxythymidinene (d4T), 2',3'-dideoxyinosine (ddI), and 2',3'-dideoxy-3'-thia-cytidine (3TC) have been shown to be relatively effective in halting HIV replication at the reverse transcriptase (RT) stage.
An active area of research is in the discovery of non-nucleoside HIV reverse transcriptase inhibitors. As an example, it has been found that certain benzoxazinones and quinazolinones are active in the inhibition of HIV reverse transcriptase, the prevention or treatment of infection by HIV and the treatment of AIDS.
U.S. 5,519,021 describe reverse transcriptase inhibitors which are benzoxazinones of the formula:
X
O
\ N~Z
H
wherein X is a halogen, Z may be 0.
EP 0,530,994 and w0 93/04047 describe HIV reverse transcriptase inhibitors which are quinazolinones of the formula A:
R1 Rz w Ni n \ ~
N' ' Z
A
wherein G is a variety of groups, R3 and R4 may be H, Z may be O, R2 may be unsubstituted alkyl, unsubstituted alkenyl, unsubstituted alkynyl, unsubstituted cycloalkyl, unsubstituted heterocycle, and optionally substituted aryl, and R1 may be a variety of groups including substituted alkyl.
4,4-DISUBSTITUTED-3,4-DIHYDRO-2(1H)-QUINAZOLINONES USEFUL AS
HIV REVERSE TRANSCRIPTASE INHIBITORS
FIELD OF THE INVENTION
This invention relates generally to 4,4-disubstituted-3,4-dihydro-2(1H)-quinazolinones which are useful as inhibitors of HIV reverse transcriptase, pharmaceutical compositions and diagnostic kits comprising the same, methods of using the same for treating viral infection or as assay standards or reagents, and intermediates and processes for making the same.
BACKGROUND OF THE INVENTION
Two distinct retroviruses, human immunodeficiency virus (HIV) type-1 (HIV-1) or type-2 (HIV-2), have been etiologically linked to the immunosuppressive disease, acquired immunodeficiency syndrome (AIDS). HIV seropositive individuals are initially asymptomatic but typically develop AIDS related complex (ARC) followed by AIDS. Affected individuals exhibit severe immunosuppression which predisposes them to debilitating and ultimately fatal opportunistic infections.
The disease AIDS is the end result of an HIV-1 or HIV-2 virus following its own complex life cycle. The virion life cycle begins with the virion attaching itself to the host human T-4 lymphocyte immune cell through the bonding of a glycoprotein on the surface of the virion's protective coat with the CD4 glycoprotein on the lymphocyte cell. Once attached, the virion sheds its giycoprotein coat, penetrates into the membrane of the host cell, and uncoats its RNA. The virion enzyme, reverse transcriptase, directs the process of transcribing the RNA into single-stranded DNA. The viral RNA
is degraded and a second DNA strand is created. The now double-stranded DNA is integrated into the human cell's genes and those genes are used for virus reproduction.
At this point, RNA polymerise transcribes the integrated DNA into viral RNA. The viral RNA is translated into the precursor gag-pot fusion polyprotein. The polyprotein is then cleaved by the HIV protease enzyme to yield the mature viral proteins. Thus, HIV protease is responsible for regulating a cascade of cleavage events that lead to the virus particle's maturing into a virus that is capable of full infectivity.
The typical human immune system response, killing the invading virion, is taxed because the virus infects and kills the immune system's T cells. In addition, viral reverse transcriptase, the enzyme used in making a new virion particle, is not very specific, and causes transcription mistakes that result in continually changed glycoproteins on the surface of the viral protective coat. This lack of specificity decreases the immune system's effectiveness because antibodies specifically produced against one glycoprotein may be useless against another, hence reducing the number of antibodies available to fight the virus. The virus continues to reproduce while the immune response system continues to weaken. Eventually, the HIV largely holds free reign over the body's immune system, allowing opportunistic infections to set in and without the administration of antiviral agents, immunomodulators, or both, death may result.
There are at least three critical points in the virus's life cycle which have been identified as possible targets for antiviral drugs: (1) the initial attachment of the virion to the T-4 lymphocyte or macrophage site, (2) the transcription of viral RNA to viral DNA (reverse transcriptase, RT), and (3) the processing of gag-pol protein by HIV protease.
Inhibition.of the virus at the second critical point, the viral RNA to viral DNA transcription process, has provided a number of the current therapies used in treading AIDS. This transcription must occur for the virion to reproduce because the virion's genes are encoded in RNA and the host cell reads only DNA. By introducing drugs that block the reverse transcriptase from completing the formation of viral DNA, HIV-1 replication can be stopped.
A number of compounds that interfere with viral replication have been developed to treat AIDS. For example, nucleoside analogs, such as 3'-azido-3'-deoxythymidine (AZT), . 2',3'-dideoxycytidine (ddC), 2',3'-dideoxythymidinene (d4T), 2',3'-dideoxyinosine (ddI), and 2',3'-dideoxy-3'-thia-cytidine (3TC) have been shown to be relatively effective in halting HIV replication at the reverse transcriptase (RT) stage.
An active area of research is in the discovery of non-nucleoside HIV reverse transcriptase inhibitors. As an example, it has been found that certain benzoxazinones and quinazolinones are active in the inhibition of HIV reverse transcriptase, the prevention or treatment of infection by HIV and the treatment of AIDS.
U.S. 5,519,021 describe reverse transcriptase inhibitors which are benzoxazinones of the formula:
X
O
\ N~Z
H
wherein X is a halogen, Z may be 0.
EP 0,530,994 and w0 93/04047 describe HIV reverse transcriptase inhibitors which are quinazolinones of the formula A:
R1 Rz w Ni n \ ~
N' ' Z
A
wherein G is a variety of groups, R3 and R4 may be H, Z may be O, R2 may be unsubstituted alkyl, unsubstituted alkenyl, unsubstituted alkynyl, unsubstituted cycloalkyl, unsubstituted heterocycle, and optionally substituted aryl, and R1 may be a variety of groups including substituted alkyl.
WO 9814527b PCT/US98106733 WO 95/12583 also describes HIV reverse transcriptase inhibitors of formula A. In this publication, G is a variety of groups, R3 and R4 may be H, Z may be O, R2 is substituted alkenyl or substituted alkynyl, and R1 is cycloalkyi, alkynyl, alkenyl, or cyano. WO 95/13273 illustrates the asymmetric synthesis of one of the compounds of WO 95/12583, (S)-(-)-6-chloro-4-cyclopropyl-3,4-dihydro-4((2-pyridy)ethynyl)-2(1H)-quinazolinone.
Synthetic procedures for making quinazolinones like those described above are detailed in the following references: Houpis et al, Tetr. Lett. 1994, 35(37), 6811-6814; Tucker et aI, J. Med. Chem. 1994, 37, 2437-2444; and, Huffman et al, J. Org. Chem. 1995, 60, 1590-2594.
DE 4,320,347 illustrates quinazolinones of the formula:
/Y ~R2 ~N
N- 'X
H
wherein R is a phenyl, carbocyclic ring, or a heterocyclic ring. Compounds of this sort are not considered to be part of the present invention.
Even with the current success of reverse transcriptase inhibitors, it has been found that HIV patients can become resistant to a single inhibitor. Thus, it is desirable to develop additional inhibitors to further combat HIV
infection.
SUMMARY OF THE INVENTION
Accordingly, one object of the present invention is to provide novel reverse transcriptase inhibitors.
It is another object of the present invention to provide a novel method for treating HIV infection which comprises administering to a host in need of such treatment a therapeutically effective amount of at least one of the compounds of the present invention or a pharmaceutically acceptable salt form thereof.
It is another object of the present invention to provide a novel method for treating HIV infection which comprises administering to a host in need thereof a therapeutically effective combination of (a) one of the compounds of the present invention and (b) one or more compounds selected form the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors.
It is another object of the present invention to provide pharmaceutical compositions with reverse transcriptase inhibiting activity comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of at least one of the compounds of the present invention or a pharmaceutically acceptable salt form thereof.
It is another object of the present invention to provide a method of inhibiting HIV present in a body fluid sample which comprises treating the body fluid sample with an effective amount of a compound of the present invention.
It is another object of the present invention to provide a kit or container containing at least one of the compounds of the present invention in an amount effective for use as a standard or reagent in a test or assay for determining the ability of a potential pharmaceutical to inhibit HIV reverse transcriptase, HIV growth, or both.
These and other objects, which will become apparent during the following detailed description, have been achieved by the inventors' discovery that compounds of formula (I):
_z ~ N'~O
H
I
wherein Rl, R2, R3, and R$ are defined below, stereoisomeric forms, mixtures of stereoisomeric forms, or pharmaceutically acceptable salt forms thereof, are effective reverse " transcriptase inhibitors.
DETAILED DESCRTP'1'TON OF PREFERRED EMBODIMENTS
I1] Thus, in a first embodiment, the present invention provides a novel compound of formula I:
Synthetic procedures for making quinazolinones like those described above are detailed in the following references: Houpis et al, Tetr. Lett. 1994, 35(37), 6811-6814; Tucker et aI, J. Med. Chem. 1994, 37, 2437-2444; and, Huffman et al, J. Org. Chem. 1995, 60, 1590-2594.
DE 4,320,347 illustrates quinazolinones of the formula:
/Y ~R2 ~N
N- 'X
H
wherein R is a phenyl, carbocyclic ring, or a heterocyclic ring. Compounds of this sort are not considered to be part of the present invention.
Even with the current success of reverse transcriptase inhibitors, it has been found that HIV patients can become resistant to a single inhibitor. Thus, it is desirable to develop additional inhibitors to further combat HIV
infection.
SUMMARY OF THE INVENTION
Accordingly, one object of the present invention is to provide novel reverse transcriptase inhibitors.
It is another object of the present invention to provide a novel method for treating HIV infection which comprises administering to a host in need of such treatment a therapeutically effective amount of at least one of the compounds of the present invention or a pharmaceutically acceptable salt form thereof.
It is another object of the present invention to provide a novel method for treating HIV infection which comprises administering to a host in need thereof a therapeutically effective combination of (a) one of the compounds of the present invention and (b) one or more compounds selected form the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors.
It is another object of the present invention to provide pharmaceutical compositions with reverse transcriptase inhibiting activity comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of at least one of the compounds of the present invention or a pharmaceutically acceptable salt form thereof.
It is another object of the present invention to provide a method of inhibiting HIV present in a body fluid sample which comprises treating the body fluid sample with an effective amount of a compound of the present invention.
It is another object of the present invention to provide a kit or container containing at least one of the compounds of the present invention in an amount effective for use as a standard or reagent in a test or assay for determining the ability of a potential pharmaceutical to inhibit HIV reverse transcriptase, HIV growth, or both.
These and other objects, which will become apparent during the following detailed description, have been achieved by the inventors' discovery that compounds of formula (I):
_z ~ N'~O
H
I
wherein Rl, R2, R3, and R$ are defined below, stereoisomeric forms, mixtures of stereoisomeric forms, or pharmaceutically acceptable salt forms thereof, are effective reverse " transcriptase inhibitors.
DETAILED DESCRTP'1'TON OF PREFERRED EMBODIMENTS
I1] Thus, in a first embodiment, the present invention provides a novel compound of formula I:
~N~
~ N ~O
H
I
or a stereoisomer or pharmaceutically acceptable salt thereof, wherein:
R1 is C1_3 alkyl substituted with 1-7 halogen;
R2 is selected from C1_5 alkyl substituted with 1-2 R4, C2-5 alkenyl substituted with 1-2 R4, and C2_5 alkynyl substituted with 1 R4;
R3, at each occurrence, is independently selected from C1_4 alkyl, OH, C1_4 alkoxy, F, C1, Br, I, NR5R5a, N02, CN, C ( O ) R6 , NHC ( O ) R7 , and NHC ( O ) NRSRSa ;
alternatively, if two R3's are present and are attached to adjacent carbons, then they may combine to form -OCH20-;
R4 is selected from C3_5 cycloalkyl substituted with 0-2 R3, phenyl substituted with 0-5 R3, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from O, N, and S, substituted with 0-2 R3;
R~ and R5a are independently selected from H and C1_3 alkyl;
R6 is selected from H, OH, C1_4 alkyl, C~_g alkoxy, and NRSRSa;
R7 is selected from C~_3 alkyl and C1_3 alkoxy;
R8 is selected from H, C3-5 cycloalkyl, and C1_3 alkyl; and, n is selected from 0, 1, 2, 3, and 4.
~ N ~O
H
I
or a stereoisomer or pharmaceutically acceptable salt thereof, wherein:
R1 is C1_3 alkyl substituted with 1-7 halogen;
R2 is selected from C1_5 alkyl substituted with 1-2 R4, C2-5 alkenyl substituted with 1-2 R4, and C2_5 alkynyl substituted with 1 R4;
R3, at each occurrence, is independently selected from C1_4 alkyl, OH, C1_4 alkoxy, F, C1, Br, I, NR5R5a, N02, CN, C ( O ) R6 , NHC ( O ) R7 , and NHC ( O ) NRSRSa ;
alternatively, if two R3's are present and are attached to adjacent carbons, then they may combine to form -OCH20-;
R4 is selected from C3_5 cycloalkyl substituted with 0-2 R3, phenyl substituted with 0-5 R3, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from O, N, and S, substituted with 0-2 R3;
R~ and R5a are independently selected from H and C1_3 alkyl;
R6 is selected from H, OH, C1_4 alkyl, C~_g alkoxy, and NRSRSa;
R7 is selected from C~_3 alkyl and C1_3 alkoxy;
R8 is selected from H, C3-5 cycloalkyl, and C1_3 alkyl; and, n is selected from 0, 1, 2, 3, and 4.
(2] In a preferred embodiment, the present invention provides a novel compound of formula I, wherein:
v R1 is C1_3 alkyl substituted with 1-7 halogen;
R2 is selected from C1_5 alkyl substituted with 1 R4, C2_5 alkenyl substituted with 1 R4, and C2_5 alkynyl substituted with 1 R4;
R3, at each occurrence, is independently selected from C1_4 alkyl, OH, C1_4 alkoxy, F, C1, Br, I, NR5R5a, N02, CN, C(O)RE, NHC(O)R~, and NHC(O)NR5R5a;
alternatively, if two R3's are present and are attached to adjacent carbons, then they may combine to form -OCHzO-, R4 is selected from C3_5 cycloalkyl substituted with 0-2 R3, phenyl substituted with 0-2 R3, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from O, N, and S, substituted with 0-1 R3;
R5 and RSa are independently selected from H, CH3 and C2H5;
RE is selected from H, OH, CH3, CzHS, OCH3, OC2H5, and NR5R5a.
R~ is selected from CH3, C2H5, OCH3, and OCzHS;
RB is selected from H, cyclopropyl, CH3 and C2H5; and, n is selected from 0, 1, 2, and 3.
[3] In a more preferred embodiment, the present invention provides a novel compound of formula I, wherein:
R1 is selected from CF3, and C2F5;
v R1 is C1_3 alkyl substituted with 1-7 halogen;
R2 is selected from C1_5 alkyl substituted with 1 R4, C2_5 alkenyl substituted with 1 R4, and C2_5 alkynyl substituted with 1 R4;
R3, at each occurrence, is independently selected from C1_4 alkyl, OH, C1_4 alkoxy, F, C1, Br, I, NR5R5a, N02, CN, C(O)RE, NHC(O)R~, and NHC(O)NR5R5a;
alternatively, if two R3's are present and are attached to adjacent carbons, then they may combine to form -OCHzO-, R4 is selected from C3_5 cycloalkyl substituted with 0-2 R3, phenyl substituted with 0-2 R3, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from O, N, and S, substituted with 0-1 R3;
R5 and RSa are independently selected from H, CH3 and C2H5;
RE is selected from H, OH, CH3, CzHS, OCH3, OC2H5, and NR5R5a.
R~ is selected from CH3, C2H5, OCH3, and OCzHS;
RB is selected from H, cyclopropyl, CH3 and C2H5; and, n is selected from 0, 1, 2, and 3.
[3] In a more preferred embodiment, the present invention provides a novel compound of formula I, wherein:
R1 is selected from CF3, and C2F5;
R2 is selected from C1_3 alkyl substituted with 1 R4, CZ-3 alkenyl substituted with 2 R4, and CZ_3 alkynyl substituted with 1 R4;
R3, at each occurrence, is independently selected from CI_3 alkyl, OH, C1_3 alkoxy, F, C1, Br, I, NR5R5a, N02, CN, C(0)R6, NHC(0)R7, arid NHC(O)NR5R5a;
alternatively, if two R3's are present and are attached to adjacent carbons, then they may combine to form -OCH20-;
R4 is selected from C3_5 cycloalkyl substituted with 0-2 R3, phenyl substituted with 0-2 R3, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from 0, N, and S, substituted with 0-1 R3;
R5 and RSa are independently selected from H, CH3 and C2H5;
R6 is selected from H, OH, CH3, CZHS, OCH3, OC2H5, and NRSRSa;
R~ is selected from CH3, CzHS, OCH3, and OC2H5;
Re is selected from H, CH3 and C2H5; and, n is selected from 0, 1, and 2.
[4] In an even more preferred embodiment, the present invention provides a novel compound of formula I, wherein:
R3 is CF3;
R2 is selected from C1_3 alkyl substituted with 1 R4, C2_3 alkenyl substituted with 1 R4, and C2_3 alkynyl substituted with 1 R4;
R3, at each occurrence, is independently selected from CI_3 alkyl, OH, C1_3 alkoxy, F, C1, Br, I, NR5R5a, N02, CN, C(0)R6, NHC(0)R7, arid NHC(O)NR5R5a;
alternatively, if two R3's are present and are attached to adjacent carbons, then they may combine to form -OCH20-;
R4 is selected from C3_5 cycloalkyl substituted with 0-2 R3, phenyl substituted with 0-2 R3, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from 0, N, and S, substituted with 0-1 R3;
R5 and RSa are independently selected from H, CH3 and C2H5;
R6 is selected from H, OH, CH3, CZHS, OCH3, OC2H5, and NRSRSa;
R~ is selected from CH3, CzHS, OCH3, and OC2H5;
Re is selected from H, CH3 and C2H5; and, n is selected from 0, 1, and 2.
[4] In an even more preferred embodiment, the present invention provides a novel compound of formula I, wherein:
R3 is CF3;
R2 is selected from C1_3 alkyl substituted with 1 R4, C2_3 alkenyl substituted with 1 R4, and C2_3 alkynyl substituted with 1 R4;
R3, at each occurrence, is independently selected from C1_3 alkyl, OH, C1_3 alkoxy, F, Cl, NR5R5a, N02, CN, C(O)R6, NHC(0)R~, and NHC(0)NR5R5a;
alternatively, if two R3's are present and are attached to adjacent carbons, then they may combine to form -OCH20-;
R4 is selected from cyclopropyl substituted with 0-1 R3, phenyl substituted with 0-2 R3, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from 0, N, and S, substituted with 0-1 R3, wherein the heterocyclic system is selected from 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-furanyl, 3-furanyl, 2-thienyl, 3-thienyl, 2-oxazolyl, 2-thiazolyl, 4-isoxazolyl, and 2-imidazolyl;
R5 and R5a are independently selected from H, CH3 and C2H5;
R6 is selected from H, OH, CH3, C2H5, OCH3, OC2H5, and NR5R5a;
R~ is selected from CH3, C2H5, OCH3, and OC2H5;
R$ is selected from H, CH3 and C2H5; and, n is selected from 1 and 2.
[5] In a further preferred embodiment, wherein the compound is of formula Ia \ :~N~Ra ~ N' 'O
Ia.
[5] In a further preferred embodiment, wherein the compound is of formula Ib:
alternatively, if two R3's are present and are attached to adjacent carbons, then they may combine to form -OCH20-;
R4 is selected from cyclopropyl substituted with 0-1 R3, phenyl substituted with 0-2 R3, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from 0, N, and S, substituted with 0-1 R3, wherein the heterocyclic system is selected from 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-furanyl, 3-furanyl, 2-thienyl, 3-thienyl, 2-oxazolyl, 2-thiazolyl, 4-isoxazolyl, and 2-imidazolyl;
R5 and R5a are independently selected from H, CH3 and C2H5;
R6 is selected from H, OH, CH3, C2H5, OCH3, OC2H5, and NR5R5a;
R~ is selected from CH3, C2H5, OCH3, and OC2H5;
R$ is selected from H, CH3 and C2H5; and, n is selected from 1 and 2.
[5] In a further preferred embodiment, wherein the compound is of formula Ia \ :~N~Ra ~ N' 'O
Ia.
[5] In a further preferred embodiment, wherein the compound is of formula Ib:
R' R2 \R
~N O
H
Ib .
[7] In a further preferred embodiment, the compound of formula I is selected from:
(+/-)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Chloro-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Chloro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-4-Cyclopropylethynyl-6-methoxy-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Methoxy-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-5-Methoxy-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-5,6-Difluoro-4-(2-pyridyl)ethynyl-4-trifluaromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-5,6-Difluoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-4-Cyclopropylethynyl-6-fluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quina2olinone;
(+/-)-6-Fluoro-4-(2'-2-pyridyl)ethyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-phenylethyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(-)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(-)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+)-4-E-Cyclopropylethenyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone; and, (-)-6-Chloro-4-E-cyclopropylethenyl-4-trifluorornethyl-3,4-dihydro-2(1H)-quinazolinone;
or a pharmaceutically acceptable salt thereof.
[8] In a second embodiment, the present invention provides a novel compound of formula II:
Ra w \R3 n~
N O
H
II
or a stereoisomer or pharmaceutically acceptable salt thereof, wherein:
R2 is C=C-R4a;
R3 is selected from C1_q alkyl, OH, C1_4 alkoxy, F, C1, Br, I, NR'RSa, N02, CN, C (O) R6, NHC (O) R7, and NHC (O) NR5R5a;
R4a is selected from methyl, ethyl, n-propyl, i-propyl, i-butyl, t-butyl, and i-pentyl;
R5 and R5a are independently selected from H arid C1_3 alkyl;
R6 is selected from H, OH, C1_q alkyl, C1_4 alkoxy, and NR5R5a;
R7 is selected from C1_3 alkyl and C1_3 alkoxy;
R8 is selected from H, C3_5 cycloalkyl, and C~_3 alkyl; and, n is selected from 0, 1, 2, 3, and 4.
[9] In another preferred embodiment, the present invention provides a novel compound of formula II, wherein:
R2 is C=C-R4a;
R3 is selected from C1_4 alkyl, OH, C1-4 alkoxy, F, C1, Br, I, NRSR~a, N02, CN, C (O) R6, and NHC (O) R7;
R4a is selected from methyl, ethyl, n-propyl, i-propyl, i-butyl, t-butyl, and i-pentyl;
RS and Rsa are independently selected from H, CH3 and C2H5;
R6 is selected from H, OH, CH3, C2H5, OCH3, OC2H5, and NR~RSa;
R~ is selected from CH3, C2H5, OCH3, and OCZHS;
R8 is selected from H, cyclopropyl, CH3 and C2H5; and, n is selected from 0, 1, and 2.
~N O
H
Ib .
[7] In a further preferred embodiment, the compound of formula I is selected from:
(+/-)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Chloro-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Chloro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-4-Cyclopropylethynyl-6-methoxy-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Methoxy-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-5-Methoxy-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-5,6-Difluoro-4-(2-pyridyl)ethynyl-4-trifluaromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-5,6-Difluoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-4-Cyclopropylethynyl-6-fluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quina2olinone;
(+/-)-6-Fluoro-4-(2'-2-pyridyl)ethyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-phenylethyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(-)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(-)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+)-4-E-Cyclopropylethenyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone; and, (-)-6-Chloro-4-E-cyclopropylethenyl-4-trifluorornethyl-3,4-dihydro-2(1H)-quinazolinone;
or a pharmaceutically acceptable salt thereof.
[8] In a second embodiment, the present invention provides a novel compound of formula II:
Ra w \R3 n~
N O
H
II
or a stereoisomer or pharmaceutically acceptable salt thereof, wherein:
R2 is C=C-R4a;
R3 is selected from C1_q alkyl, OH, C1_4 alkoxy, F, C1, Br, I, NR'RSa, N02, CN, C (O) R6, NHC (O) R7, and NHC (O) NR5R5a;
R4a is selected from methyl, ethyl, n-propyl, i-propyl, i-butyl, t-butyl, and i-pentyl;
R5 and R5a are independently selected from H arid C1_3 alkyl;
R6 is selected from H, OH, C1_q alkyl, C1_4 alkoxy, and NR5R5a;
R7 is selected from C1_3 alkyl and C1_3 alkoxy;
R8 is selected from H, C3_5 cycloalkyl, and C~_3 alkyl; and, n is selected from 0, 1, 2, 3, and 4.
[9] In another preferred embodiment, the present invention provides a novel compound of formula II, wherein:
R2 is C=C-R4a;
R3 is selected from C1_4 alkyl, OH, C1-4 alkoxy, F, C1, Br, I, NRSR~a, N02, CN, C (O) R6, and NHC (O) R7;
R4a is selected from methyl, ethyl, n-propyl, i-propyl, i-butyl, t-butyl, and i-pentyl;
RS and Rsa are independently selected from H, CH3 and C2H5;
R6 is selected from H, OH, CH3, C2H5, OCH3, OC2H5, and NR~RSa;
R~ is selected from CH3, C2H5, OCH3, and OCZHS;
R8 is selected from H, cyclopropyl, CH3 and C2H5; and, n is selected from 0, 1, and 2.
[10] In a further preferred embodiment, wherein the compound is of formula IIa ,R8 CR ~
~N O
H
IIa.
~N O
H
IIa.
[11] In a further preferred embodiment, wherein the compound is of forniula IIb:
CFg R2 N~Rs \R h' / N
H
IIb.
CFg R2 N~Rs \R h' / N
H
IIb.
[12] In another more preferred embodiment, the compound of formula II is selected from:
(+/-)-6-Chloro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Chloro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Chloro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Chloro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
WO 98!45276 PCT/US98/06733 (+/-)-4-Isopropylethynyl-6-methoxy-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-guinazolinone;
(+/-)-5,6-Difluoro-4-isopentyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(-)-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+)-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(-)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone; and, (+)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
or a pharmaceutically acceptable salt thereof.
In a third embodiment, the present invention provides a novel pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of a compound of formula I or II or pharmaceutically acceptable salt form thereof.
(+/-)-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-guinazolinone;
(+/-)-5,6-Difluoro-4-isopentyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(-)-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+)-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(-)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone; and, (+)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
or a pharmaceutically acceptable salt thereof.
In a third embodiment, the present invention provides a novel pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of a compound of formula I or II or pharmaceutically acceptable salt form thereof.
In a fourth embodiment, the present invention provides a novel method for treating HIV infection which comprises S administering to a host in need of such treatment a therapeutically effective amount of a compound of formula I
or II or pharmaceutically acceptable salt form thereof.
In a fifth embodiment, the present invention provides a novel method of treating HIV infection which comprises administering, in combination, to a host in need thereof a therapeutically effective amount of:
(a) a compound of formula I or II; and, (b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV
protease inhibitors.
In another preferred embodiment, the reverse transcriptase inhibitor is selected from AZT, 3TC, ddI, ddC, d4T, delavirdine, TIBO derivatives, BI-RG-587, nevirapine, L-697,661, LY 73497, Ro 18,893, loviride, trovirdine, MKC-442, and HBY 097, and the protease inhibitor is selected from saquinavir, ritonavir, indinavir, VX-478, nelfinavir, KNI-272, CGP-61755, U-140690, and ABT-378.
In an even more preferred embodiment, the reverse transcriptase inhibitor is selected from AZT and 3TC and the protease inhibitor is selected from saquinavir, ritonavir, nelfinavir, and .indinavir.
In a still further preferred ebodiment, the reverse transcriptase inhibitor is AZT.
In another still further preferred embodiment, the protease inhibitor is indinavir.
In a sixth embodiment, the present invention provides a pharmaceutical kit useful for the treatment of HIV infection, which comprises a therapeutically effective amount of:
(a) a compound of formula I or II; and, (b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV
protease inhibitors, in one or more sterile containers.
In a seventh embodiment, the present invention provides a novel method of inhibiting HIV present in a body fluid sample which comprises treating the body fluid sample with an effective amount of a compound of formula I or II.
In a eighth embodiment, the present invention to provides a novel a kit or container comprising a compound of formula I or II in an amount effective for use as a standard or reagent in a test or assay for determining the ability of a potential pharmaceutical to inhibit HIV reverse transcriptase, HIV growth, or both.
DEFINITIONS
As used herein, the following terms and expressions have the indicated meanings. It will be appreciated that the compounds of the present invention contain an asymmetrically substituted carbon atom, and may be isolated in optically active or racemic forms. It is well known in the art how to prepare optically active forms, such as by resolution of racemic forms or by synthesis, from optically active starting materials. All chiral, diastereomeric, racemic forms and all geometric isomeric forms of a structure are intended, unless the specific stereochemistry or isomer form is specifically indicated.
The processes of the present invention are contemplated to be practiced on at least a multigram scale, kilogram scale, multikilogram scale, or industrial scale. Multigram scale, as used herein, is preferably the scale wherein at least one starting material is present in 10 grams or mare, more preferably at least 50 grams or more, even more preferably at least 100 grams or more. Multikilogram scale, as used herein, is intended to mean the scale wherein more than one kilogram of at least one starting material is used.
Industrial scale as used herein is intended to mean a scale which is other than a laboratory scale and which is sufficient to supply product sufficient for either clinical tests or distribution to consumers.
As used herein, "alkyl" is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms. Examples of alkyl include, but are not limited to, methyl, ethyl, n-propyl, i-propyl, n-butyl, s-butyl, t-butyl, n-pentyl, and s-pentyl. "Haloalkyl" is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms, substituted with 1 or more halogen (for example -CVFW where v = 1 to 3 and w = 1 to (2v+1)). Examples of haloalkyi include, but are not limited to, trifluoromethyl, trichloromethyl, pentafluoroethyl, and pentachloroethyl. "Alkoxy" represents an alkyl group as defined above with the indicated number of carbon atoms attached through an oxygen bridge. Examples of alkoxy include, but are not limited to, methoxy, ethoxy, n-propoxy, i-propoxy, n-butoxy, s-butoxy, t-butoxy, n-pentoxy, and s-pentoxy. "Cycloalkyi" is intended to include saturated ring groups, such as cyclopropyl, cyclobutyl, or cyclopentyl.
Alkenyl" is intended to include hydrocarbon chains of either a straight or branched configuration and one or more unsaturated carbon-carbon bonds which may occur in any stable point along the chain, such as ethenyl, propenyl and the like. "Alkynyl" is intended to include hydrocarbon chains of either a straight or branched configuration and one or more triple carbon-carbon bonds which may occur in any stable point along the chain, such as ethynyl, propynyl and the like.
"Halo" or "halogen" as used herein refers to fluoro, chloro, bromo and iodo. "Counterion" is used to represent a small, negatively charged species such as chloride, bromide, hydroxide, acetate, sulfate and the like.
As used herein, "aryl" or "aromatic residue" is intended to mean an aromatic moiety containing the specified number of carbon atoms, such as phenyl or naphthyl. As used herein, "carbocycle" or "carbocyclic residue" is intended to mean any stable 3- to 5- membered monocyclic ring, which may be saturated or partially unsaturated. Examples of such carbocyles include, but are not limited to, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, biphenyl, naphthyl, indanyl, adamantyl, or tetrahydronaphthyl (tetralin).
As used herein, the term "heterocycle" or "heterocyclic system" is intended to mean a stab7,e 5- to 6- membered monocyclic heterocyclic ring which is saturated partially unsaturated or unsaturated (aromatic), and which consists of carbon atoms and from 1 to 3 heteroatoms independently selected from the group consisting of N, O and S. The nitrogen and sulfur heteroatoms may optionally be oxidized.
The heterocyclic ring may be attached to its pendant group at any heteroatom or carbon atom which results in a stable structure. The heterocyclic rings described herein may be substituted on carbon or on a nitrogen atom if the resulting compound is stable. If specifically noted, a nitrogen in the heterocycle may optionally be quaternized. It is preferred that when the total number of S and O atoms in the heterocycle exceeds 1, then these heteroatoms are not adjacent to one another. It is preferred that the total number of S and.0 atoms in the heterocycle is not more than 1. As used herein, the term "aromatic heterocyclic system"
is intended to mean a stable 5- to 6- membered monocyclic heterocyclic aromatic ring which consists of carbon atoms and from 1 to 3 heterotams independently selected from the group consisting of N, O and S. It is preferred that the total number of S and O atoms in the aromatic heterocycle is not more than 1.
Examples of heterocycles include, but are not limited to, 2-pyrrolidonyl, 2H-pyrrolyl, 4-piperidonyl, 6H-1,2,5-thiadiazinyl, 2H,6H-1,5,2-dithiazinyl, furanyl, furazanyl, imidazolidinyl, imidazolinyl, imidazolyl, isoxazolyl, morpholinyl, oxadiazolyl, 2,2,3-oxadiazolyl, 1,2,4-oxadiazolyl, 1,2,5-oxadiazolyl, 1,3,4-oxadiazolyl, oxazolidinyl., oxazolyl, piperazinyl, piperidinyl, 20 pteridinyl, piperidonyl, 4-piperidonyl, pteridinyl, purinyl, pyranyl, pyrazinyl, pyrazolidinyl, pyrazolinyl, pyrazolyl, pyridazinyl, pyridinyl, pyridyl, pyrimidinyl, pyrrolidinyl, pyrrolinyl, pyrrolyl, tetrahydrofuranyl, 6H-1,2,5-thiadiazinyl, 1,2,3-thiadiazolyl, 1,2,4-thiadiazolyl, 1,2,5-thiadiazolyl, 1,3,4-thiadiazolyl, thiazolyl, thienyl, thienothiazolyl, thienooxazolyl, thienoimidazolyl, thiophenyl, triazinyl, 1,2,3-triazolyl, 1,2,4-triazolyl, 1,2,5-triazolyl, and 1,3,4-triazolyl. Preferred heterocycles include, but are not limited to, pyridinyl, furanyl, thienyl, pyrrolyl, pyrazolyl, imidazolyl, and oxazolidinyl. Also included are fused ring and spiro compounds containing, for example, the above heterocycles.
As used herein, "HIV reverse transcriptase inhibitor" is intended to refer to both nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT). Examples of nucleoside RT inhibitors include, but are not limited to, AZT, ddC, ddI, d4T, and 3TC. Examples of non-nucleoside RT
inhibitors include, but are no limited to, delavirdine (Pharmacia and Upjohn U901525), TIBO derivatives, BI-RG-587, nevirapine (Boehringer Ingelheim), L-697,661, LY 73497, Ro 18,893 (Roche), loviride (Janssen), trovirdine (Lilly), MKC-442 (Triangle), .and HBY 097 (Hoechst).
. As used herein, "HIV protease inhibitor" is intended to refer to compounds which inhibit HIV protease. Examples include, but are not limited, saquinavir (Roche, Ro31-8959), ritonavir (Abbott, ABT-538), indinavir (Merck, MK-639), VX-478 (Vertex/Glaxo wellcome), nelfinavir (Agouron, AG-1343), KNI-272 (Japan Energy), CGP-61755 (Ciba-Geigy), U-140690 (Pharmacia and Upjohn), and ABT-378. Additional examples include the cyclic protease inhibitors disclosed in W093/07128, WO 94/19329, WO 94/22840, and PCT Application Number US96/03426.
As used herein, "pharmaceutically acceptable salts"
refer to derivatives of the disclosed compounds wherein the parent compound is modified by making acid or base salts thereof. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like. The pharmaceutically acceptable salts include the conventional non-toxic salts or the quaternary ammonium salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. For example, such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like; and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, malefic, hydroxymaleic, phenylacetic, giutamic, benzoic, salicylic, sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, and the like.
The pharmaceutically acceptable salts of the present invention can be synthesized from the parent compound which contains a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two;
generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. Lists of suitable salts are found in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, PA, 1985, p. 1418, the disclosure of which is hereby incorporated by reference.
The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication commensurate with a reasonable benefit/risk ratio.
"Prodrugs" are intended to include any covalently bonded carriers which release the active parent drug according to formula (I) or other formulas or compounds of the present invention in vivo when such prodrug is administered to a mammalian subject. Prodrugs of a compound of the present invention, for example formula (I), are prepared by modifying functional groups present in the compound in such a way that the modifications are cleaved, either in routine manipulation or in vivo, to the parent compound. Prodrugs include compounds of the present invention wherein the hydroxy or amino group is bonded to any group that, when the prodrug is administered to a mammalian subject, cleaves to form a free hydroxyl or free amino, respectively. Examples of prodrugs include, but are not limited to, acetate, forrnate and benzoate derivatives of alcohol and amine functional groups in the compounds of the present invention, and the like.
"Stable compound" and "stable structure" are meant to indicate a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and formulation into an efficacious therapeutic agent. Only stable compounds are contempleted by the present invention.
"Substituted" is intended to indicate that one or more hydrogens on the atom indicated in the expression using "substituted" is replaced with a selection from the indicated group(s), provided that the indicated atom's normal valency is not exceeded, and that the substitution results in a stable compound. When a substituent is keto (i.e., =O) group, then 2 hydrogens on the atom are replaced.
WO 98/4527b PCT/US98/06733 "Therapeutically effective amount" is intended to include an amount of a compound of the present invention or an amount of the combination of compounds claimed effective to inhibit HIV infection or treat the symptoms of HIV
infection in a host. The combination of compounds is preferably a synergistic combination. Synergy, as described for example by Chou and Talalay, Adv. Enzyme Regul. 22:27-55 (1984), occurs when the effect (in this case, inhibition of HIV replication) of the compounds when administered in combination is greater than the additive effect of the compounds when administered alone as a single agent. In general, a synergistic effect is most clearly demonstrated at suboptimal concentrations of the compounds. Synergy can be in terms of lower cytotoxicity, increased antiviral effect, or some other beneficial effect of the combination compared with the individual components.
SYNTHESIS
The compounds of the present invention can be prepared in a number of ways well known to one skilled in the art of organic synthesis. The compounds of the present invention can be synthesized using the methods described below, together with synthetic methods known in the art of synthetic organic chemistry, or variations thereon as appreciated by those skilled in the art. Preferred methods include but are not limited to those methods described below. Each of the references cited below are hereby incorporated herein by reference.
WO 98/45276 PCTlUS98/06733 R3~\ COOH ~ ~CH3) OCH3 R\ \ V N..OCH3 NHZ
TMSC1, base R1 MgX
Scheme 1 illustrates a method of preparing keto-anilines from an appropriately substituted 2-aminobenzoic acid. The acid is converted to its N-methoxy-N-methyl amide derivative which can then be displaced to obtain the R1-substituted ketone. The keto-anilines are useful intermediates for the presently claimed compounds.
R\ I Me3CCOC1 I2 , NaHC03 \\
NaI-iC03 I ~ I / ~ NH
~2 ~2 O
n-BuLi I \ CF3 6N-HCl ~\ CF3 CF3 COZ Et ~ / NH2 O
Scheme 2 describes another method of preparing keto-anilines, this time from an appropriately substituted aniline. After iodination and amine protection, a group such as trifluoromethyl can be introduced using a strong base and ethyl trifluoroacetate. Deprotection provides the keto-aniline. Additional means of preparing keto-anilines are known to one of skill in the art, e.g, Houpis et al, Tetr.
Lett. 1994, 35(37), 6811-6814, the contents of which are 24 hereby incorporated herein by reference.
R~~ COOH HN ( CH3 ) OCH3 ~~~ CON ( OCH3 ) CH3 NH
2 NHz TrBr, DIPEA ~~ CON (OCH3 ) CH3 R~~ CHO
reduction z z N(H)Tr N(H)Tr CF3TMS, TBAF R\~ OH oxidation R\~ CF
THF / N(H)Tr / N(H)Tr Another method of making 2-trifluoroacetylanilines is shown in Scheme 3. After forming the protected aniline, the amide is then reduced and the trifluoromethyl group added.
Oxidation with an oxidant, such as Mn02, provides the useful intermediate.
a) TMSNCO 3 4 ~ mol.
DMAP/THF
vn R1 b) TBAF/T F ~ \ sieves / NH2 ~ ~ 0 R\ ~ ~ a. n-BuLi/HCCR4/THF
N b. BF3 ~OEtz N~O
H
Ei2 , Pd/C
NH
N~O
H
5_ Using the general method detailed in Scheme 4, one can prepare compounds of the present invention. Keto-aniline _1, which may be prepared by the methods desribed in Schemes 1 and 2, is treated with trimethylsilyl isocyanate in dry tetrahydofuran in the presence of dimethylaminopyridine followed by tetrabutylammonium fluoride to give the hydroxy-S urea 2. The hydroxy-urea 2 is then dehydrated with a dehydrating agent such as 4~1 molecular sieves in refluxing toluene or xylenes to give the ketimine 3. A substituted acetylenic R2 group is added by treating the ketimine 3 with a lithium acetylide, which is prepared in a separate vessel by reacting the corresponding substituted acetylene with n-butyllithium in dry tetrahydrofuran, to give the 4,4-disubstituted 3,4-dihydro-2(1H)-quinazolinone 4_, a compound of formula I. The acetylenic bond of the compound 4 may be reduced, e.g., by catalytic hydrogenation, to give the corresponding alkenyl group (not shown) or the saturated compound 5_.
Other R2 groups may also be introduced by directly reacting the imine 3_ with a lithiate RZLi or a Grignard reagent R2MgX in the presence or absence of Lewis acid catalyst, such as BF3 etherate. See also Huffman et al, J.
Org. Chem. 1995, 60, 1590-1594, the contents of which are hereby incorporated herein by reference.
In certain instances, one enantiomer of a compound of Formula I or II may display superior activity compared with the other. inlhen required, separation of the racemic material can be achieved by HPLC using a chiral column as exemplified in Examples 27-34 (Scheme 4) or by a resolution using a resolving agent such as camphonic chloride as in Thomas J.
Tucker, et al, J. Med. Chem. 1994, 3 7, 2437-2444. A chiral compound of Formula I may also be directly synthesized using a chiral catalyst or a chiral ligand, e.g. Mark A. Huffman, et al, J. Org. Chem. 1995, 60, 1590-1594.
Other features of the invention will become apparent in the course of the following descriptions of exemplary embodiments which are given for illustration of the invention and are not intended to be limiting thereof.
WO 9$/45276 PCTIUS98/06733 Examples Abbreviations used in the Examples are defined as follows: "°C" for degrees Celsius, "d" for doublet, "dd" for doublet of doublets, "eq" for equivalent or equivalents, "g"
for gram or grams, "mg" for milligram or milligrams, "mL" for milliliter or milliliters, "H" for hydrogen or hydrogens, "hr" for hour or hours, "m" for multiplet, "M" for molar, "min" for minute or minutes, "MHz" for megahertz, "MS" for mass spectroscopy, "nmr" or "NMR" for nuclear magnetic resonance spectroscopy, "t" for triplet, "TLC" for thin layer chromatography, "EDAC" for 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride, "DIPEA" for diisopropylethylamine, "TBAF" for tetrabutylammonium fluoride, "LAH" for lithium aluminium hydride, and "TEA" for triethylamine.
Examvle 1 Prepration of (+/-)-6-Chloro-4-cyclopropylethynyl-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (Rd _ Cyclopropyl) O a) TMSNCO CF3 OH
C1 DMAP/THF C1 PhCH3 T.1.
\CF3 b) TBAF/THF ~ \ \NH 4 A mol. sieves NH2 ~ ~~ o I-a II-a R4 Fg CF3 ~~
C1 a. THF/n-BuLi/HCCR4 C1 \ ~N b. BF3~OEtZ ~ \
N' '_ O
O H
III-a IV-a Step 1. Synthesis of II-a from I-a.
To a solution of compound I-a (4.55 g, 20.2 mmol) in anhydrous THF (40 mL) was added dimethylaminopyridine (0.25 g, 2.02 mmol) and trimethylsilyl isocyanate (6.05 g, 7.11 mL, 52.5 mmol). The mixture was stirred at room temperature for approximately 16 hours, then tetrabutylammonium fluoride (21 mL of 1 M solution in THF) was added. The thick slurry was diluted with additional THF (20 mL) and stirred at room temperature for 0.5 hours. The THF was removed under reduced S pressure, the residue was taken up in EtOAc (100 mL) and washed sequentially with I N HC1 (70 mL), saturated aqueous NaHC03 (70 mL) and saturated aqueous NaCl (50 mL). The organic phase was dried over MgS04, filtered and concentrated under reduced pressure to afford a light yellow solid. The yellow color was removed upon trituration with hexanes to afford IIa (5.09 g, 94~) as a white solid: 1H NMR (300 MHz, acetone-ds) 8 9.06 (br s, 1 H), 7.48 (s, 1 H), 7.40 (br s, 1 H), 7.34 (dd, J = 8.8, 2.6 Hz, 1 H), 6.97 (d, J = 8.8 Hz, 1 H); ~9F NMR (282 MHz, acetone-d6) 8 -86.33, -86.35; IR (KBr Pellet) 1724, 1678, 1398, 1198, 1174 cm-1; MS (CI) m/e 266 ( MH+ , 10 0 ) .
Step 2. Synthesis of III-a from II-a.
A suspension of II-a (5.09 g, 19.1 mmol) in toluene (150 mL) containing 4 ~ molecular sieves (approximately 100 mg) was heated at reflex for 16 hours. The resulting clear yellow solution was cooled to room temperature, the precipitated solids were dissolved in acetone and the molecular sieves were removed by vacuum filtration. The filtrate was concentrated under reduced pressure, and triturated with hexanes to afford III-a (4.25 g, 89g) as a yellow solid: 1H NN~ (300 N~iz, acetone-d6) 8 7.86-7.82 (m, 2 H), 7.61 (d, J = 8.8 Hz, 1 H); 19F NMR (282 MHz, acetone-d6) $
-67.88.
Step 3. Synthesis of IV-a from IIIa.
A solution of cyclopropylacetylene (13.0 mL of 30 wt~
solution in toluene/THF/hexanes, 59.0 mmol) in anhydrous THF
(118 mL) was cooled to -78 °C, treated with n-BuLi (32.8 mL
of 1.6 M solution in hexanes, 52.4 mmol), warmed to 0 °C in an ice bath, and aged for 0.5 h. To a solution of III-a (3.12 g, 12.6 mmol) in anhydrous THF (66 mL) at -78 °C was added the lithium acetylide over approximately 10 minutes.
To this was added boron trifluoride etherate (0.89 g, 0.80 mL, 6.28 rnmol), followed by removal of the cooling bath. The reaction was allowed to reach room temperature and stirred at room temperature for 4 hours before quenching with 1 M citric acid (100 mL). The mixture was concentrated under reduced pressure to 1/2 original volume, diluted with EtOAc (200 mL), the aqueous phase was removed and the organic phase was sequentially washed with saturated aqueous NaHC03 (100 mL), and saturated aqueous NaCl (100 mL). The organic phase was dried over MgS04, filtered and concentrated under reduced pressure. The crude material was purified by flash chromatography (3~ MeOH/CH2C12) to afford a thick yellow oil from which was obtained crystalline IV-a (R4 = cyclopropyl) (3.85 g, 97~) as a white solid: mp 86.6-88 °C; 1H NMR (300 MHz, acetone-d6) b 8.95 (br s, 1 H), 7.51 (br s, 1 H), 7.43 (br s, 1 H), 7.40 (dd, J = 8.8, 2.4 Hz, 1 H), 7.02 (d, J =
8.8 Hz, 1 H), 1.49-1.41 (m, 1 H), 0.93-0.82 (m, 1 H), 0.77-0.74 (m, 1 H); 19F NMR (282 MHz, acetone-d6) S -82.96; IR
(KBr Pellet) 1696, 1272 cm-1; MS (CI) m/e calc'd for C14H1oC1F3N20: 315.051201, found 315.051626; 315 (MH+, 51), 332 (M+NH4+, 100) ; Analysis calc'd for C14H10N2CIF30~0.25 H20:
C, 52.68; H, 3.32; N, 8.78; found: C, 52.61; H, 3.35;
N, 8.28.
Example 2 Preparation of (+/-)-6-Chloro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 -Isopropyl) A solution of III-a (50 mg, 0.201 mmol) was treated with the lithium acetylide derived from 3-methyl-1-butyne (62 mg, 93 mL, 0.905 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by flash chromatography (35~ EtOAc/hexanes) to afford 26mg (41$) of the desired product: 1H NMR (300 MHz, ) 8 9.08 (br s, 1 H), 7.59 (br s, 1 H), 7.53 (br s, 1 H), 7.40 (dd, J = 8.4, 2.2 Hz, 1 H), 7.02 (d, J = 8.8 Hz, 1 H), 2.81-2.68 (m, 1 H), 1.20 (dd, J = 6.6 Hz, 6H); 19F NMR (282 MHz, acetone-ds) b -83.05; MS (CI) m/e calc'd for C14H12C1F3N20: 317.066851, found 317.069433; 317 (MH+, 43), 334 (M+NH4+, 100).
Example 3 Preparation of (+/-)-5-Chloro-4-(2-pyridyl)ethynyl-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 2-Pyridyl) A solution of III-a (100 mg, 0.402 mmol) was treated with the the lithium acetylide derived from 2-ethynylpyridine (0.19 g, 1.81 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC
(2.5~ MeOH/CH2C12) to afford 85 mg (60~) of the desired product: mp 105 °C dec.; 1H NMR (300 MHz, acetone-d6) 8 9.14 (br s, 1 H), 8.64-8.61 (m, 1 H), 7.89-7.84 (m, 2 H), 7.70-7.66 (m, 2 H), 7.48-7.43 (m, 2 H), 7.09 (d, J = 8.8 Hz, 1 H);
19F NMR (282 MHz, acetone-d6) 8 -82.48; IR (KBr Pellet) 1704, 1430, 1286 cm 1; MS (CI) m/e calc'd for ClgHIoC1F3N30:
352.046450, found 352.046956; 352 (MH+, 100); Analysis calc'd for Cl6HgC1F3N30~0.125 H20: C, 54.3; H, 2.56; N, 11.9; found: C, 54.71; H, 3.03; N, 11.3.
Examule 4 Preparation of (+/-)-6-Chloro-4-ethylethynyl-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazoliaone (R4 _ Ethyl) A solution of III-a (100 mg, 0.402 mmol) was treated with the the lithium acetylide derived from 1-butyne (109 mg, 2.01 mmol) according to the procedure of Step 3 of Example 2.
The resulting crude material was purified by HPLC (2.5~
MeOH/CH2C12) to afford 79 mg (65~) of the desired product: 1H
NMR (300 MHz, acetone-d6) 8 9.05 (br s, 1 H), 7.54 (br s, 2 H), 7.41-7.39 (m, 1 H), 7.02 (d, J = 8.4 Hz, 1 H), 2.36-2.32 (m, 2 H), 2.18-1.23 (m, 3 H); 19F NMR (282 MHz, acetone-d6) 8 -82.99; MS (CI) m/e calc'd for C13H1oC1F3N20: 303.051201, found 303.051882; 303 (MH+, 55), 320 (M+NH4+, 100).
Example 5 Preparation of (+/-)-6-Chloro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(iH)-quinazolinone (R4 _ Phenyl) A solution of III-a (100 mg, 0.402 mmol) was treated with the the lithium acetylide derived from phenylacetylene (185 mg, 1.81 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC
(2.5~ MeOH/CH2C12) to afford 54 mg (38~) of the desired product: 1H NMR (300 MHz, acetone-d6) 8 9.07 (br s, 1 H), 7.74 (br s, 1 H), 7.67 (br s, 1 H), 7.62-7.58 (m, 2 H), 7.48-7.40 (m, 4H), 7.08 (d, J = 8.4 Hz, 1 H); 19F NMR (282 MHz, acetone-d6) S -82.67; IR (KBr Pellet) 1696, 1186 cm-1; MS
(CI) m/e calc'd for C17H11C1F3N20: 351.051201, found 351.051704; 351 (MH+, 51), 368 (M+NH4+,100); Analysis calc'd for Cl~HIpC1F3N20~0.25 H20: C, 57.48; H, 2.98; N, 7.89;
found: C, 57.00; H, 3.03; N, 7.48.
Example 6 Preparation of (+/-)-4-Cyclopropylethynyl-6-methoxy-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (Ra _ Cyclopropyl) Me ~ a ) TMSNCO Me PhCH3 T.~
~CF3 DMpP/,hHF~ ~ ~ ~ 4 ~. mol. sieves b) TBAF/THF
NHz N O
H R°
V-a VI-a CF3 F3 ~~
Me ~ ~ a. THF/n-BuLi/HCCR4 Me N b. BFg~OEtz 'O
H~ O
VII-a VIII-a Step 1. Synthesis of VI-a from V-a.
A solution of V-a (0.50 g, 2.28 mmol) was treated with dimethylaminopyridine and trimethylsilyl isocyanate as described in Step 1 of Example 1 to afford 0.58 g (97~) of the desired product: 1H NMR (300 MHz, acetone-d6) b 8.81 (br s, 1 H), 7.17 (br s, 1 H), 7.11 (br s, 1 H), 7.00-5.92 (m, 2 H), 6.83 (s, 1 H), 3.76 (s, 3 H); ~9F NMR (282 MHz, acetone-d6) S -85.99.
Step 2. Synthesis of VII-a from VI-a.
A solution of VI-a (0.58 g, 2.21 mmol) was heated in toluene at reflux as described in Step 2 of Example 1 to afford 0.50 g (93~) of the desired product: 1H NMR (300 MHz, acetone-d6) 8 7.52 (br s, 2 H), 7.27 (s, 1 H), 3.90 (s, 3 H);
19F NMR (282 MHz, acetone-d6) 8 -68.08.
Step 3. Synthesis of VIII-a from VII-a.
A solution of VII-a (100 mg, 0.410 mmol) was treated with the the lithium acetylide derived from cyclopropylacetylene (0.41 mL of 30 wt~ solution in toluene/THF/hexanes, 1.85 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5~ MeOH/CH2C12) to afford 103 mg (81~) of the desired product: 1H NNgt (300 MHz, acetone-d6) 8 8.77 (br s, 1 H), 7.29 (br s, 1 H), 7.06 (br s, 1 H), 6.99-6.90 (m, 2 H), 3.77 (s, 3 H), 1.46-1.38 (m, 1 H), 0.91-0.85 (m, 2 H), 0.79-0.72 (m, 2 H); I9F NMR (282 MHz, acetone-d6) 8 -82.61;
MS (CI) mle calc'd for C15H14F3N2~2: 311.100738, found 311.099970; 311 (MH+, 100).
Example 7 Preparation of (+/-)-4-Isopropyiethynyl-6-methoxy-4 trifluoromethyl-3,4-dihydro-2(2H)-quinazolinone (R4 _ Isopropyl) A solution of VII-a (100 mg, 0.410 mmol) was treated with the the lithium acetylide derived from 3-methyl-1-butyne (126 mg, 0.29 mL, 1.85 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by flash chromatography (2.5~ MeOH/CHZC12) to afford 30 mg (24~) of the desired product: mp 228-229 °C; 1H NMR
(300 MHz, acetone-ds) S 8.72 (br s, 1 H), 7.27 (br s, 1 H), 7.10 (br s, 1 H), 7.00-6.91 (m, 2 H), 3.77 (s, 3 H), 2.73-2.67 (m, 1 H), 1.20 (dd, J = 7.0, 1.5 Hz, 6 H); 19F NMR (282 MHz, acetone-d6) 8 -82.71; IR (KBr Pellet) 1696, 1428, 1190, 1176 cm'I; MS (CI) m/e calc'd for C15H1sF3N2O2: 313.116388, found 313.115871; 313 (MH~~ 100), 330 (M+NH4+, 15); Analysis calc'd for C15H15F3N2O2: C, 57.69; H, 4.84; N, 8.97;
found: C, 57.74; H, 5.01; N, 8.57.
Example 8 Preparation of (+/-)-6-Methoxy-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 2-Pyridyl) A solution of VII-a (100 mg, 0.410 mmol) was treated with the the lithium acetylide derived from 2-ethynylpyridine (0.19 g, 1.85 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by flash chromatography (2.5~ MeOH/CH2C12) to afford 56 mg (39~) of the desired product: 1H NMR (300 MHz, acetone-d6) 8 8.81 (br s, 1 H), 8.6.1 (d, J = 4.8 Hz, 1 H), 7.88-7.82 (m, 1 H), 7.66 (d, J = 7.7 Hz, 1 H), 7.61 (br s, 1 H), 7.46-7.42 (m, 1 H), 7.23 (br s, 1 H), 7.06-6.97 (m, 2 H), 3.79 (s, 3 H); 19F
NMR (282 MHz, acetone-d6) 8 -82.13; IR (KBr Pellet) 1698, 1518, 1464, 1430, 1244, 1208, 1184 cm-1; MS (CI) mle calc'd for C17H13F3N302: 348.095987, found 348.095629; 348 (MEIt, 100); Analysis calc'd for C1~H12F3N302~0.25 C3H60: C, 58.92;
H, 3.76; N, 11.61; found: C, 59.38; H, 4.04; N, 11.35.
Example 9 Preparation of (+/-)-6-Methoxy-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinoae (Rd -Phenyl) A solution of VII-a (100 mg, 0.410 mmol) was treated 30 with the the lithium acetylide derived from phenylacetylene (0.19 g, 1.85 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by flash chromatography (2.5~ MeOH/CH2C12) to afford 34 mg (24~) of the desired product. mp 206.2-207.7 °C; 1H NMR (300 MHz, acetone-d6) 8 8.85 (br s, 1 H), 7.60-7.57 (m, 3 H), 7.49-7.39 (m, 3 H), 7.21 (br s, 1 H), 7.05-6.96 (m, 2H), 3.79 (s, 3 H);
19F NMR (282 MHz, acetone-d6) b -82.32; IR (KBr Pellet) 1696, 1516, 1430, 1236, 1204, 11$4, 1128 cm-1; MS (CI) m/e calc'd for ClgH~4F3N202: 347.100738, found 347.101482; 347 (Ngi+, 100), 364 (M+NH4+, 48); Analysis calc'd for C1gH13F3N202: C, 62.43; H, 3.78; N, 8.10; found: C, 62.35; H, 3.58; N, 7.83.
Example 10 Preparation of (+/-)-4-Cyclopropylethynyl-5,6 difluoro-4-trifluoromethyl-3,4-dihydro-2(1H) quiaazolinoae (R4 - Cyclopropyl) a) TMSNCO F ~ Xylenes T.~ F
F ~NH N
W
\CF3 DMAP/THF
b) TBAF/THF ~ / N~ O
NH2 H ~~ O
IX-a X-a XI-a a. THF/n-BuLi/HCCR' 10$ Pd/C F F3 b. BF3~OEtz F EtOH/EtOAc) F I ~ NH
N_ '_ O
H
XIII-a XII-a Step 1. Synthesis of X-a from IX-a.
A solution of IX-a (6.46 g, 28.7 mmol) was treated with dimethylaminopyridine and trimethylsilyl isocyanate as described in Step 1 of Example 1 to afford 6.74 g (88~) of the desired product: 1H NMR (300 MHz, acetone-d6) 8 9.13 (br s, 1 H), 7.45-7.32 (m, 2 H), 7.18 (br s, 1 H), 6.85-6.80 (m, 1 H); 19F NMR (282 MHz, acetone-d6) 8 -86.6 (d, 17.2, 3), -137.52-137.68 (m, 1), -148.47-148.59 (m, 1).
Step 2. Synthesis of XI-a from X-a.
A solution of X-a (6.74 g, 25.1 mmol) was heated in xylenes at reflux as described in Step 2 of Example 1, substituting xylenes for toluene, to afford 6.3 g (100$) of the desired product: 1H NMR (300 MHz, acetone-d6) b 7.92-7.83 (m, 1 H), 7.46-7.44 (m, 1 H); 19F NMR (282 MHz, acetone-d6) 8 -70.7 (d, 38.7, 3), -136.72 (s, 1), -246.47-146.57 (m, 1).
Step 3. Synthesis of XII-a from XI-a.
A solution of XI-a (6.28 g, 25.1 mmol) was treated with the the lithium acetylide derived from cyclopropylacetylene (24.9 mL of 30 wt~ solution in toluene/THF/hexanes, 0.113 mol) according to the procedure of Step 3 of Example 1. The resulting crude yellow oil was dissolved in acetone and concentrated under reduced pressure to deliver a yellow solid. Crystallization from acetone afforded 5.98 g (75~) of the desired material: mp 86.5-88.5 °C; 1H NMR (300 MHz, acetone-d6) 8 9.01 (br s, 1 H), 7.46 (br s, 1 H), 7.44-7.35 (m, 1 H), 6.86-6.8I (m, 1 H), 1.41-1.37 (m, 1 H), 0.90-0.83 (m, 1 H), 0.74-0.69 (m, 1 H); 1gF NI~ (282 MHz, acetone-d6) $
-83.3 (d, J = 12.9, 1), -136.04-136.23 (m, 1), -148.14-148.26 (m, 1); IR (KBr Pellet) 1706, 1516, 1442, 1246, 1214, 1196 cm-1; MS (CI) rrtle calc'd for Cl4H~pF5NZ0: 317.071329, found 317.070836; 317 (MH+, 100), 334 (M+NH4+, 62); Analysis calc'd for C14H9F5N20: C, 53.17; H, 2.88; N, 8.87; found:
C, 53.30; H, 3.16; N, 8.53.
Example 11 Preparation of (+/-y-5,6-Difluoro-4-isopropylethynyl 4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 - Isopropyl) A solution of XI-a (7.24 g, 28.9 mmol) was treated with the the lithium acetylide derived from 3-methyl-1-butyne (8.87 g, 13.3 mL, 0.130 mol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by flash chromatography (2.5~ MeCH/CH2C12) to afford a yellow oil. Crystallization from acetone afforded 6.77 g (74~) of the desired product: mp 79-80 °C; 1H NMR (300 MHz, acetone-d6) $ 9.02 (br s, 1 H), 7.50 (br s, 1 H), 7.44-7.35 (m, 1 H), 6.87-6.82 (m, 1 H), 2.69-2.65 (m, 1 H), 1.17 (d, J
- 7.0 Hz, 6H); 19F NMR (282 MHz, acetone-d6) 8 -83.4 (d, J =
12.9, 1), -135.79-135.94 (m, 1), -148.14-148.26 (m, 1); MS
(CI) m/e calc'd for C14H12F5N20: 319.086979, found 319.087376; 319 (MH+, 100), 336 (M+NH4+, 76).
Exam~Le I2 Preparation of (+/-)-5,6-Difluoro-4-(2 pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(1H) quinazoliaone (R4 - 2-Pyridyl) A solution of XI-a (100 mg, 0.400 mmol) was treated with the the lithium acetylide derived from 2-ethynylpyridine (0.19 g, 1.80 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by flash chromatography (4~ MeOH/CHZC12) to afford 83 mg (59g) of the desired product: rnp 219-220 °C; 1H NMR (300 MHz, acetone-d6) 8 9.15 (br s, 1 H), 8.61 (d, J = 4.4 Hz, 1 H), 7.88-7.82 (m, 2H), 7.63 (dd, J = 7.0, 1.1 Hz, 1 H), 7.47-7.42 (m, 2H), 6.94-6.88 (m, 1 H); 19F NMR (282 MHz, acetone-d6) 8 -82.8 (d, J = 12.9, 3), -135.78-135.93 (m, 1), -147.86-147.98 (m, 1);
IR (KBr Pellet) 1712, 1470, 1450, 1430, 1416, 1264, 1238, 1226, 1198, 1186 cm-1; MS (CI) m/e calc'd for ClgHgF5N30:
354.066578, found 354.067821; 354 (MH+, 100).
Examble 13 Preparation of (+/-)-5,6-Difluoro-4-ethylethynyl-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 _ 2-Ethyl) A solution of XI-a (100 mg, 0.400 mmol) was treated with the the lithium acetylide derived from 1-butyne (97 mg, 1.80 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5~
MeOH/CH2C12) to afford 69 mg (57~) of the desired product: mp 191-194 °C; 1H NMR (300 MHz, acetone-d6) 8 9.03 (br s, 1 H), 7.50 (br s, 1 H), 7.45-7.35 (m, 1 H), 6.87-6.82 (m, 1 H), 2.34-2.27 (m, 2H), 1.20-1.15 (m, 3 H); 19F NMR (282 MHz, acetone-d6) 8 -83.3 (d, J = 12.9, 3), -135.79-135.98 (m, 1), -148.16-148.29 (m, 1); IR (KBr Pellet) 1704, 1686, 1518, 1444, 1244, 1210, 1192, 1172 cm-1; MS (CI) m/e calc'd for C13H1oF5N2~~ 305.071329, found 305.071146; 305 (MH+, 100);
Analysis calc'd for Cl3HgF5N20: C, 51.33; H, 2.98; N, 9.22;
found: C, 52.00; H, 2.79; N, 8.99.
WO 98/45276 PCTlUS98/06733 ~:xamnle 14 Preparation of (+/-)-5,6-Difluoro-4-phenylethynyl-4 trifluoromethyl-3,4-dihydro-2(1H)-quiaazolinone (Ra Phenyl) A solution of XI-a (100 mg, 0.400 mmol) was treated with the the lithium acetylide derived from phenylacetylene (0.18 g, 0.20 mL, 1.80 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5~ MeOH/CH2C12) to afford 92 mg (65~) of the desired product: 1H NMR (300 MHz, acetone-d6) S 9.14 (br s, 1 H), 7.80 (br s, 1 H), 7.57-7.54 (m, 2H), 7.49-7.40 (m, 4H), 6.92-6.87 (m, 1 H); 19F NMR (282 MHz, acetone-d6) 8 -83.0 (d, J =
12.9, 3), -136.08-136.27 (m, 1), -147.87-148.00 (m, 1); MS
(CI) m/e calc'd for Cl~HIpF5N20: 353.071329, found 353.071716; 353 (MH+, 42), 370 (M+NH4+, 100).
Examflle 15 Preparation of (+/-)-5,6-Difluoro-4-isopentyl-4-trifluoromethyl-3,4-dihydro-2(iH)-quinazolinone (R4 -Isopropyl) Synthesis of XIII-a from XII-a.
A solution of XIII-a (R4 = isopropyl) (26 mg, 82 mmol) in ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10~ Pd on carbon (35 mg) under H2 (1 atm) for 16 hours. The catalyst was removed by vacuum filtration through Celite and the filter cake was washed with EtOAc. The combined filtrates were concentrated under reduced pressure to afford 26 mg (1000 of the desired material. No further purification was necessary: 1H NMR (300 MHz, acetone-d6) 8 8.88 (br s, 1 H), 7.41-7.31 (m, 1 H), 6.89-6.81 (m, 2H), 2.55-2.50 (m, 1 H), 1.64-1.45 (m, 2H), 1.06-1.02 (m, 1 H), 0.89 (dd, J = 6.6, 2.2 Hz, 6H); 19F NMR (282 MHz, acetone-d6) 8 -83.22 (d, J = 12.1, 3), -138.97-139.13 (m, 1), -148.46-148.58 (m, 1); IR (KBr Pellet) 1700, 1678, 1518, 1438, 1252, 1188, 1172 cm-I; MS
(CI) mle calc'd for C14H1sF5N2~: 323.118280, found 323.116703; 323 (MH+, 100), 340 (M+NH4+, 57).
Example 16 Preparation of (+/-)-4-Butyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 -Ethyl) A solution of XIII-a (R4 = ethyl) (20 mg, 66 mmol) in ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10~ Pd on carbon under H2 according to the procedure of Example 15.
Purification by HPLC (2.5~ MeOH/CH2C12) afforded 12 mg (56~) of the desired product: 1H NMft (300 MHz, acetone-d6) b 8.89 (br s, 1 H), 7.41-7.32 (m, 1 H), 6.86-6.81 (m, 2H), 2.57-2.47 (m, 1 H) , 1.56-1.15 (m, 5H) , 0.88 (t, J = 7.3 Hz, 3 H) ; 19F
NMR (282 MHz, acetone-d6) 8 -83.19-83.24 (m, 1), -139.14 (s, 1), -148.49-148.62 (m, 1); MS (CI) m/e calc'd for C~3H14F5N20: 309.102629, found 309.103555; 309 (MH+, 100), 326 (M+NH4+, 62).
Example 17 Preparation of (+/-)-4-Cyclopropylethynyl-6-fluoro-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 Cyclopropyl) F a) TMSNCO F F
DMAP/THF
Toluene T~. ~ _N
CFA /
/ NH b ~ TBAF / THF / N/~ O ~ 0 z H
XIV-a XV-a XVI-a Ra a. THF/n-HuLi/HCCR° F3 10$ Pd/C
b. BF3-OEtz F ~ EtOH/EtOAc) F
/ ~ ~ O
XVIII-a XVII-a n-BuLi/0 °C ~ \ \ NH
XVI-a ~
/ NI '-O
H
XIX-a Step 1. Synthesis of XV-a from XIV-a.
A solution of XIII-a (3.07 g, I4.8 mmol) was treated with dimethylaminopyridine and trimethylsilyl isocyanate as described in Step 1 of Example 1 to afford 2.81 g (76~) of the desired product.
Step 2. Synthesis of XVI-a from XV-a.
A solution of XV-a (6.74 g, 25.1 mmol) was heated in toluene at reflex as described in Step 2 of Example 1 to afford 0.73 g (94~) of the desired product.
Step 3. Synthesis of XVII-a from XVI-a.
A solution of XVI-a (100 mg, 0.431 mmol) was treated with the the lithium acetylide derived from cyclopropylacetylene (1.43 mL of 30 wt~ solution in toluene/THF/hexanes, 1.94 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5~ MeOH/CHZC12) to afford 44 mg (34~) of the des fired produc t : mp 15 5 °C ; 1H NMR ( 3 0 0 Ng-iz , acetone-d6 ) 8 8.86 (br s, 2 H), 7.36 (br s, 1 H), 7.30-7.27 (m, 1 H), 7.22-7.15 (m, 1 H), 7.04-6.99 (m, 1 H), 1.47-1.42 (m, 1 H), 0.90-0.87 (m, 2 H), 0.76-0.75 (m, 2 H); 19F NMR (282 MHz, acetone-d6) S -82.86, -123.36-123.44; MS (CI) m/e calc'd for C14H11F4N20: 299.080751, found 299.079976; 299 (MH+, 100).
Example I8 Preparation of (+/-)-6-Fluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 _ Isopropyl) A solution of XVI-a (100 mg, 0.431 mmol) was treated with the the lithium acetylide derived from 3-methyl-1-butyne (0.13 g, 0.20 mL, 1.94 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5~ MeOH/CH2C12) to afford 24 mg (18~) of the desired product: mp 158 °C; 1H NMR (300 MHz, acetone-d6) S 9.07 (br s, 1 H), 7.60 (br s, 1 H), 7.32-7.30 (m, 1 H), 7.24-7.16 (m, 1 H), 7.05-6.99 (m, 1 H), 2.77-2.67 (m, 1 H), 1.20 (dd, J = 7.0, 2.6 Hz, 6H); 19F NMR (282 MHz, acetone-d6) b -82.95, -123.41-123.49; MS (301) m/e calc'd for ClqH~3F4N20: 301.096401, found 301.096235; 301 (MH+, 100).
Examale 19 Preparation of (+/-)-6-Fluoro-4-(2-pyridyl)ethynyl-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (Ra _ 2-Pyridyl) A solution of XVI-a (100 mg, 0.431 mmol) was treated with the the lithium acetylide derived from 2-ethynylpyridine (0.20 g, 1.94 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC
(2.5~ MeOH/CH2C12) to afford 65 mg (45~) of the desired product: rnp 155 °C; 1H NMR (300 MHz, acetone-d6) 8 9.02 (br s, 1 H), 8.60 (d, J = 4.0 Hz, 1 H), 7.8?-7.78 (m, 2 H), 7.66 (d, J = 7.7 Hz, 1 H), 7.45-7.41 (m, 2 H), 7.26-7.20 (m, 1 H), 7.09-7.05 (m, 1 H); ~9F NMR (282 MHz, acetone-dg) b -82.36, -122.94-123.02; MS (CI) m/e calc'd for C16H1oF4N30~
336.076000, found 336.074156; 336 (MH+, 25).
Example 20 Preparation of (+/-)-6-Fluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 Ethyl) A solution of XVI-a (100 mg, 0.431 mmol) was treated with the the lithium acetylide derived from 1-butyne (0.10 g, 1.94 mmol) according to the procedure of Step 3 of Example 1.
The resulting crude material was purified by HPLC (2.5~
MeOH/CH2C12) to afford 40 mg (33~) of the desired product: mp 190 °C; 1H NMR (300 MHz, acetone-d6) b 8.86 (br s, 1 H), 7.38 (br s, 1 H), 7.34-7.31 (m, 1 H), 7.22-7.16 (m, 1 H), 7.05-7.00 (m, 1 H), 2.04-2.01 (m, 2 H), 1.19-1.14 (m, 3 H); 19F
IVMR (282 MHz, acetone-d6) 8 -75.392, -123.42-123.50; MS (CI) m/e calc'd for C13H11F4N20~ 287.080751, found 287.080740;
287 (MH+, 100) .
Examvle 21 Preparation of (+/-)-6-Fluoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(iH)-quinazolinone (R4 _ Phenyl) A solution.of XVI-a (100 mg, 0.431 mmol) was treated with the the lithium acetylide derived from phenylacetylene (0.20 g, 0.21 mL, 1.94 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5~ MeOH/CH2C12) to afford 41 mg (28~) of the desired product: mp 107 °C; 1H NMR (300 MHz, acetone-d6) 8 9.00 (br s, 1 H), 7.69 (br s, I H), 7.63-7.59 (m, 2 H), 7.50-7.40 (m, 4H), 7.27-7.20 (m, 1 H), 7.10-7.05 (m, 1 H);
19F NMR (282 MHz, acetone-d6) 8 -82.56, -122.99-123.07; MS
(CI) m/e calc'd for C17H11F4N2O: 335.080751, found 335.082057; 335 (MH+, 74), 352 (M+NH4+, 100).
Example 22 Preparation of (+/-)-6-Fluoro-4-isopentyl-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 _ Isopropyl) Synthesis of XVIII-a from XVII-a.
A solution of XVII-a (R4 = isopropyl) (26 mg, 87 mmol) in ethanol (1 mL) and EtOAc (0.5 mL) was treated with 20~ Pd on carbon under HZ according to the procedure of Example 15 to afford 15 mg (58~) of the desired product. No further purification was necessary: mp 179 °C; 1H NMR (300 Ngiz, acetone-d6) 8 7.02-6.97 (m, 2 H), 6.80-6.76 (m, 1 H), 2.18-2.09 (m, 2 H), 1.92-1.82 (m, 2 H), 1.52-1.45 (m, 1 H), 0.88-0.79 (m, 6 H); 19F NMR (282 MHz, acetone-d6) 8 -82.60, -123.72-123.84; MS (CI) m/e calc'd for C14H1~F4N20:
305.127707, found 305.126790; 305 (MH+, 100).
Examale 23 Preparation of (+/-)-6-Fluoro-4-(2'-2-pyridyl)ethyl-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 _ 2-Pyridyl) A solution of XVII-a (R~ = 2-pyridyl) (33 mg, 99 mmol) in ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10$ Pd on carbon under H2 according to the procedure of Example 15 to afford 10 mg (30.x) of the desired product. No further purification was necessary: mp 88 °C; 1H NMR {300 MHz, acetone-d6) 8 8.35 (d, J = 4.4 Hz, 1 H), 7.63 (dt, J = 7.7, 1.5 Hz, 1 H), 7.20-7.13 (m, 3 H), 7.04-6.98 {m, 1 H), 6.83-6.79 (m, 1 H), 2.84-2.78 (m, 1 H), 2.68-2.48 (m, 2 H), 2.27-2.06 (m, 1 H); 29F NMR (282 MHz, acetone-d6) 8 -82.58, WO 98/4527b PCT/US98/06733 -123.26-123.34; MS (CI) m/e calc'd for C16H14F'4N3~=
340.107300, found 340.107719; 340 (MH+, 100).
Examflle 24 Preparation of (+/-)-4-Hutyl-fi-fluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 _ Ethyl) A solution of XVII-a (R4 = ethyl) (24 mg, 84 mmol) in ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10~ Pd on carbon under H2 according to the procedure of Example 15 to afford 24 mg (1000 of the desired product. No further purification was necessary: mp 198 °C; 1H NMR (300 MHz, acetone-d6) 8 7.03-6.97 (m, 2 H), 6.80-6.76 (m, 1 H), 2.18-2.11 (m, 1 H), 1.90-1.81 (m, 1 H), 1.30-1.19 (m, 3 H), 0.97-0.80 (m, 4 H); 19F NMR (282 MHz, acetone-d6) b -82.692, -123.78-123.86; MS (CI) m/e calc'd for C13H15F4N2O:
291.112051, found 291.112227; 291 (MH+, 100).
Example 25 Preparation of (+/-)-6-Fluoro-4-pheaylethyl-4 trifluoromethyl-3,4-dihydro-2(iH)-quinazolinone (Ra _ Phenyl) A solution of XVII-a (R4 = phenyl) (30 mg, 90 mmol) in ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10~ Pd on carbon under H2 according to the procedure of Example 15 to afford 20 mg (67~) of the desired product. No further purification was necessary: mp 98 °C; 1H NMR (300 MHz, acetone-d6) 8 7.18-6.99 (m, 7H), 6.84-6.79 (m, 1 H), 2.68-2.60 (m, 1 H), 2.48-2.12 (m, 3 H); 19F NMR (282 MHz, acetone-d6) 8 -82.67, -123.24-.123.32; MS (CI) m/e calc'd for C1~H~5F4N20:
339.112051, found 339.110781; 339 (MH+, 100).
WO 98!45276 PCT/US98/06733 Examvle 26 Preparation of (+/-)-f-Fluoro-4-methylpropargyl-4 trifluoromethyl-3,4-dihydro-2(2Fi)-quinazolinone (R4 _ Methyl) Synthesis of XIX-a from XVI-a.
A solution of 2-butyne (94 mg, 1.75 mmol) in anhydrous THF (3.5 mL) was cooled to 0 °C, treated with n-BuLi (0.97 mL
of 1.6 M solution in hexanes, 1.55 mmol), and aged for 0.5 h.
To a solution of XVI-a (90 mg, 0.388 mmol) in anhydrous THF
(1.9 mL) at -78 °C was added the lithium anion over 5 minutes, followed by boron trifluoride etherate (25 mL, 0.194 mmol). The cooling bath was removed and the mixture was allowed to warm to room temperature. After 16 h at room temperature, quench by addition of 1 M citric acid (10 mL), dilute with EtOAc (50 mL), separate phases and wash the organic phase sequentially with saturated aqueous NaHC03 (20 mL) and saturated aqueous NaCl (20 mL). The resulting material was purified by HPLC (2.5~ MeOH/CH2C12) to afford 10 mg (9~) of the desired product: mp 181 °C; 1H NMR (300 Ngiz, acetone-d6) $ 8.91 (br s, 2 H), 7.27 (d, 8.4H), 7.18-7.08 (m, 1 H), 7.02-6.97 (m, 2 H), 3.29 (dd, J = 16.8, 2.6 Hz, 1 H), 3.00 (dd, J = 16.8, 2.2 Hz, 1 H), 1.61-1.59 (m, 3 H); 19F NMR
(282 MHz, acetone-d6) S -81.86, -123.69-123.70; MS (CI) m/e calc'd for C13H11F4N20: 287.080751, found 287.080340; 287 (MH+, 75) , 304 (M+N~i4+, 100) .
SCHEME 4: Chiral Resolution Q4 p4 CF3 'i CF3 :~ CF3 Chiral HPLC 3 ' 3 \ ~ Separation ~\ ~ ~\
. ( / N' ' O I / N' '_ 0 I / N' ' 0 H H H
Combound ~3- Compound ~3- Compound 6-C1 IV-a 6-C1 IV-b 6-C1 IV-c 6-Me0 VIII-a 6-Me0 VIII-b 6-Me0 VIII-c 5,6-diF XII-a 5,6-diF XII-b 5,6-diF XII-c 6-F XVII-a 6-F XVII-b 6-F XVII-c Examples 27 and 28 Preparation of (-)-6-Chloro-4-cyclopropylethynyl-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (Example 27) and (+)-6-Chloro-4-cyclopropylethynyl-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (Example 28) Resolution of IV-b,c from IV-a (R4 = Cyclopropyl).
Chiral HPLC utilizing a Chiralcel OD column, 3~
isopropanol, 5~ CH2C12 and 92~ hexanes at ambient temperature with a 1.0 mL/min flow rate and detection at 250 nm afforded seperation of IV-b from IV-c with enantiomeric excesses of 99~ and 99.4$, respectively. IV-b: mp 106-109 °C; [a]D25 -50.34° (c=0.274, MeOH) . IV-c: mp105-107 °C; [oc]D25 +58.33°
(c=0.288, MeOH).
Examples 29 aad 30 Preparation of (+)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (Example 29) aad (-)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(1H) quiaazolinone (Example 30) Resolution of XII-b,c from XII-a (R4 = Cyclopropyl).
Chiral HPLC utilizing a Chiralpak AD column, 5$ water and 95~ methanol at ambient temperature with a 0.8 mL/min flow rate and detection at 250 nm afforded seperation of XII-b from XII-c with enantiomeric excesses of 100 and 99~, respectively. XII-b: mp 187 °C; [a]D25 +1.46° (c=0.274, MeOH). XII-c: mp 187.5-188.8 °C; [a]D25 _1,45° (c=0.278, MeOH).
Examvies 31 and 32 Preparation of (-)-5,6-Difluoro-4-isopropylethynyl-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazolinoae (Example 31) and (+)-5,6-Difluoro-4-isopropylethynyl 4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (Example 32) Resolution of XII-b,c frorn XII-a (R4 = Isopropyl).
Chiral HPLC utilizing a Chiralpak AD column, 5$ water and 95~ methanol at ambient temperature with a 0.5 mL/min flow rate and detection at 250 nm afforded seperation of XII-b from XII-c with enantiomeric excesses of 100 and 99~, respectively. XII-b: mp 155 °C; [oC]~25 -2.14° (c=0.280, MeOH) . XII-c: 98 °C; (o6)D25 +4.45° (c=0.292, MeOH) .
Examvles 33 and 34 Preparation of (-)-5,6-Difluoro-4-ethylethynyl-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (Example 33) and (+)-5,6-Difluoro-4-ethylethynyl-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (Example 34) Resolution of XII-b,c from XII-a (R4 = Ethyl}.
Chiral HPLC utilizing a AS column, 20~ ethanol and 80$
hexanes at ambient temperature with a 1.0 mL/min flow rate and detection at 250 nm afforded seperation of XII-b from XII-c with enantiomeric excesses of 100 and 99~, respectively. XII-b: mp 165-167 °C. XII-c: mp 157-159 °C.
E~caa~p 1 a s 3 5 and 3 6 Preparation of 5,6-Dif luoro-4-(2-hydroxyethyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (Example 35) and 5,6-Difluoro-4-(1-hydroxyethyl)ethynyl-4-trifluoromethyl-3,4-dihydro 2(1H)-quinazolinone (Example 36) LiC=CCH2CH20TBS R
or F LiC=CCH(OTBS)CH3F 3 F ~ \ N THF/BF3 ~OEt2 ~ ~NH
N O
C'~mr~ound R
Ex. 35 CH2CH20TBS
Ex. 36 CH(OTBS)CH3 TBAF
THF ""
H
Compound R
Ex. 35 CHzCH20H
Ex. 36 CH(OH)CH3 To a slurry of ketimine (300 mg, 1.20 mmol) in anhyd.
THF (11 mL) at -78 °C was sequentially added a precooled (0 °C) solution of the silyl protected lithium acetylide (5.40 mmol) and BF3.OEt2 (0.60 mmol). The resulting mixture was stirred at rt overnight. The reaction was quenched by the addition of 1 M citric acid and diluted with EtOAc. The phases were separated, the organic phase was washed with water, sat. aq. NaHC03 arid sat. aq. NaCl. The organic extracts were dried over MgS04, filtered and concentrated.
WO 98!45276 PCT/US98/06733 The material was purified by regular phase HPLC
chromatography (41.4 mrn Rainin Dynamax~ column using 60 silica @ 25 mL/min): 2.5~ MeOH/CH2C12 for 24 min, increase to 30~ MeOH/CH2C12 over 4 min, 30~ MeOH/CHZC12 for 10 min, and ramp back to 2.5~ MeOH/CH2C12 over 2 min. The yield of the protected intermediates was 47~ and 32~, respectively.
Example 35-intermediate. Mp 62.9-64 °C; 1H NMR (300 MHz, acetone-d6) b 8.98 (br s, 1H), 7.41-7.32 (m, 2H), 6.83 6.78 (m, 1H), 3.74 (t, J = 6.6 Hz, 2H), 2.47 (t, J = 6.6 Hz, 2H), 0.81 (s, 9H), 0.00 (s, 6H); ~9F NMR (282 MHz, acetone d6) 8 -83.17, -135.16--135.31, -148.09--148.22; MS (CI) calc'd for C19H24F5N202Si: m/2 435.152723, found 435.151149;
435 (N~i+, 94), 452 (M+NH4+, 100); Analysis calc'd for C1gH23F5N202Si: C, 52.52; H, 5.35; N, 6.46; found: C, 52.65; H, 5.29; N, 6.31.
Example 36-intermediate. 1H NMR (300 MHz, acetone-d~) S
8.96 (br s, 1H), 7.50 (br s, 1H), 7.37-7.28 (m, 1H), 6.79-6.74 (m, 1H), 4.61 (q, J = 13.2, 6.6 Hz, 1H), 1.30 (d, J =
6.6 Hz, 3H), 0.78 (s, 9H), 0.01 (s, 6H); 1gF NMR (282 MHz, acetone-ds) d -82.88--82.95, -135.20--135.42, -248.06--148.23;
MS (CI) calc'd for C19H24F5N202Si: m/z 435.152723, found 435.152927; 435 (MH+, 51), 452 (M+NH4+, 100); Analysis calc'd for C19H23F5N202Si: C, 52.52; H, 5.35; N, 6.46; found: C, 52.54; H, 5.34; N, 6.69.
To a solution of the protected intermediate for Example (0.56 mmol) in THF (1.1 mL) was added TBAF (0.62 mL of 1.0 M solution in THF). The resulting mixture was stirred at rt for 1 h, diluted with EtOAc, washed with 1 N HC1, sat. aq.
NaHC03, and sat. aq. NaCl. The organic extract was dried over 30 MgS04, filtered and concentrated. The material was purified by regular phase HPLC chromatography (41.4 mm Rainin Dynamax~
column using 60 $r silica @ 25 mL/min): 2.5~ MeOH/CH2C12 for 24 min, increase to 30~ MeOH/CH2C12 over 4 min, 30~
MeOH/CH2C12 for 10 min, and ramp back to 2.5~ MeOH/CH2C12 over 35 2 min. Example 35 was isolated in 82~ yield.
Example 35. Mp 190-192 °C; 1H NMR (300 N~iz, acetone-d6) 8 9.05 (br s, 1H), 7.53 (br s, 1H), 7.45-7.36 (m, 1H), 6.88-6.83 (m, IH), 4.01-3.98 (m, 1H), 3.68-3.64 (m, 2H), 2.50 (t, J = 6.6 Hz, 2H); 1gF NMR (282 MHz, acetone-d6) 8 -83.3, -135.68--135.88, -148.10--148.22; MS (CI) calc'd for C~3H1pF5N202: m/z 321.066244, found 321.066479; 321 (MH+, 100); Analysis calc'd for Cl3HgF5N202: C, 48.76; H, 2.83; N, 8.76; found: C, 49.05; H, 3.23; N, 8.38.
. Example 36 was synthesized in an analogous manner to deliver the title compound in 88~ yield. Mp 190-191 °C; 1H
NMR (300 MHz, acetone-d6) 8 9.06 (br s, 1H), 7.56 (br s, 1H), 7.46-7.37 (m, 1H), 6.88-6.83 (m, 1H), 4.58-4.57 (m, 2H), 1.39 (d, J = 5.5 Hz, 3H); 19F NMR (282 MHz, acetone-d6) 8 -83.15, -135.40, -135.60, -148.08--148.20; MS (CI) calc'd for C13H10F5N202- m/z 321.066244, found 321.065983; 321 (MH+, 58), 338 (M+NH4+, 100); Analysis calc'd for C13H9F5N202: C, 48.76; H, 2.83; N, 8.76; found: C, 48.84; H, 2.76; N, 8.63.
Example 37 Preparation of (+)-4-E-Cyclopropylethenyl-5,6 difluoro-4-trifluoromethyl-3,4-dihydro-2(1H) guinazolinone To a solution of XII-b (200 mg, 0.632 mmol) in anhyd.
THF (1.3 mL) at rt was added a solution of lithium aluminium hydride (1.3 mL of 1.0 M solution in THF). The resulting mixture was stirred at rt overnight. The reaction was quenched by addition of 10~ NaOH (3 mL) and water (3 mL).
The mixture was diluted with EtOAc (30 mL) and the phases were separated. The organic phase was washed with sat. aq.
NaCl, dried over MgS04, filtered and concentrated. The title compound was purified by regular phase HPLC (41.4 mm Rainin Dynamaxt~ column using 60 ~ silica): 2.5~ MeOH/CH2C12 for 24 min, increase to 30$ MeOH/CH2C12 over 4 min, 30~ MeOH/CHZC12 for 10 min, and ramp back to 2.5~ MeOH/CHzCl2 over 2 min. Mp 80-83 °C; 1H NMR (300 MHz, acetone-d6) d 9.07 (br s, 1H), 7.33 (q, J=8.8 Hz, 1H), 6.94 (br s, 1H), 6.84-6.79 (m, 1H), 6.27 (dd, J = 15.6, 7.5 Hz, 1H), 5.67 (dd, J = 15.2, 9.4 Hz, 1H), 1.65-1.56 (m, 1H), 0.80-0.71 (m, 2H), 0.50-0.42 (m, 2H);
i9F NMR (282 MHz, acetone-d6) d -82.68, -3.35.05, -148.49; MS
(CI) calc'd for C14H12FSNZ0: m/z 319.086979, found WO 98!45276 PCT/US98/06733 319.087755; 319 (MH+, 100); [oc)D2o +72.77° (c=0.382, MeOH);
Analysis calc'd for C14H12F5N20: C, 52.84; H, 3.48; N, 8.80; found: C, 53.02; H, 3.48; N, 8.61.
Exatnn l a 3 8 Preparation of (-)-6-Chloro-4-E-cyclopropylethenyl-4 trifluoromethyl-3,4-dihydro-2(1A)-quinazolinone The title compound was prepared as described for Example 37 (starting from IV-b), except that it was purified using a Chiralcel OD column at 1.5 mL/min in 0.5~ EtOH/20~
CH2C12/79.5~ hexanes. Mp 87-89 °C; 1H NMR (300 MHz, acetone-d6) d 9.08 (br s, 1H), 7.40-7.25 (m, 2H), 7.04-6.90 (m, 2H), 6.28-6.18 (m, 1H), 5.64-5.52 (m, 1H), 1.68-1.55 (m, 1H), 0.83-0.71 (m, 2H), 0.53-0.41 (rn, 2H); 1gF NMR (282 MHz, acetone-d6) d -81.67; MS (CI) calc'd for C14H13C1F3N20: m/z 317.066851, found 317.065857; 317 (Ng3+, 100); [a]D2o _6. g1°
(c=0.382, MeOH); Analysis calc'd for C14H12C1F3N20 . 0.27 C3H60: C, 53.52; H, 4.13; N, 8.43; found: C, 53.90; H, 4.07; N, 8.80.
Table 1*
i z .,Ra 'R n ~ ~ N'~O
H
Ex.# R3 RI RZ R8 m.p. Mass Spec (C) 1 6-C1 CF3 C~-cycPr H 86.6- 332 88 (M+NH4+) 2 6-C1 CF3 C-C-iPr H 180 334 ( M+NH4 +
) 3 6-C1 CF3 C~-2-Pyridyl H 105 352 (Ngi+) 4 6-Cl CF3 C~-Et H 217- 303 (MH+) 6-C1 CF3 C~-Ph H 104- 368 107 (M+NFi4+) 6 6-Me0 CF3 C~-cycPr H 208 311 (MH+) 7 6-Me0 CF3 C-C-iPr H 228- 313 (MH+) 8 6-Me0 CF3 C~-2-Pyridyl H 97'98 348 (MH+) 9 6-Me0 CF3 C=C-Ph H 206.2- 347 (rg.~+) 207.7 5, 6-diFCF3 C~-cycPr H 101 317 (~+) dec.
11 5,6-diF CF3 C-C-iPr H 79-80 319 (MH+) 12 5,6-diF CF3 C~-2-Pyridyl H 219- 354 (MH+) 13 5,6-diF CF3 C~-Et H 191- 305 (MH+) 14 5,6-diF CF3 C=C-Ph H 215- 370 217 (M+NH4+) 5,6-diF CF3 CH2CH2CH(CH3)2 H 192- 323 (MH+) 16 5,6-diF CF3 CH2CHZCHZCH3 H 309 (~+) 17 6-F CF3 CSC-cycPr H 155 29g (~+) 18 6-F CF3 C-C-iPr H 158 301 (MH+) 19 6-F CF3 C~-2-Pyridyl H 155 336 (MH+) 6-F CF3 C~-Et H 190 287 (MH+) 21 6-F CF3 C-C-Ph H 107 352 (M+NH4+) 22 6-F CF3 CH2CH2CH (CH3 H 179 305 (MH+) ) 2 23 6-F CF3 CH2CH2-2-PyridylH 88 340 (MH+) 24 6-F CF3 CH2CH2CHZCH3 H 198 291 0+) 25 6-F CF3 CH2CH2Ph H 98 339 (MH+) ( M+NH4+
) 27 6-C1 CF3 C~-cycPr H 106- 313 (M-) (-) 109 28(+) 6-C1 CF3 C~-cycPr H 105- 313 (M-) 29 5, 6-diFCF3 C~-cycPr H 187 315 (M-) (+) 30(-) 5,6-diF CF3 C~-cycPr H 188- 315 (M-) ls9 31(-) 5,6-diF CF3 C=c-iPr H 155 317 (M') 32 5, 6-diFCF3 C~-iPr H 98 317 (M-) (+) 33(-) 5,6-diF CF3 C=c-Et H 165- 303 (M-) 34 5, 6-diFCF3 C~-Et H 157- 303 (M') (+) 159 35 5,6-diF CF3 C~CH2CH20H H 190- 321 (MH+) 36 5,6-diF CF3 C~-CH(OH)Me H 190- 338 191 (M+NH4+) 37(+) 5,6-diF CF3 C~-cycPr (E) H 80-83 319 (MH+) 38 6-C1 CF3 C~-cycPr (E) H 87-89 317 (MH+) (-) *Unless otherwise indicated, stereochemisty is (+/-).
Table 2*
,Re ~R ~ ~ ~ _'~O
F.~c. R3 Rz R2 R8 #
2 6-C1 CF3 C=C-CH(OH)Me H
3 6-C1 CF3 C-C-(2-C1)Ph 4 6-C1 CF3 C=C-(3-C1)Ph H
6-C1 CF3 C-C-(4-C1)Ph H
6 6-C1 CF3 C=C-(2-F)Ph H
7 6-C1 CF3 C=C-(3-F)Ph H
8 6-C1 CF3 C=C-(4-F)Ph H
9 6-C1 CF3 C=C-(2-OH)Ph H
6-C1 CF3 C=C-(3-OH)Ph H
11 6-C1 CF3 C=C-(4-OH)Ph H
12 6-C1 CF3 Cue- (2-OMe) Ph H
13 6-CI CF3 Cue- ( 3 -OMe ) Ph H
14 6-C1 CF3 C=C-(4-OMe)Ph H
6-C1 CF3 C=C-(2-CN)Ph H
16 6-C1 CF3 C=C-(3-CN)Ph H
17 6-C1 CF3 C-C-(4-CN)Ph H
18 6-C1 CF3 C=C-(2-N02)Ph H
19 6-C1 CF3 Cue- ( 3-N02 ) Ph H
6-C1 CF3 C=C-(4-N02)Ph H
21 6-C1 CF3 C~-(2-NH2)Ph H
22 6-C1 CF3 C=C-(3-NH2)Ph H
23 6-C1 CF3 Cue- ( 4-NHZ ) Ph H
24 6-C1 CF3 C=C-(2-NMe2)Ph H
6-C1 CF3 C-C-(3-NMe2)Ph H
26 6-C1 CF3 C=C-(4-NMe2)Ph H
27 6-C1 CF3 C~-3-Pyridyl H
28 6-C1 CF3 C~-4-Pyridyl H
29 6-C1 CF3 C=C-2-furanyl 30 6-C1 CF3 C~-3-furanyl H
31 6-C1 CF3 C~-2-thienyl H
32 6-C1 CF3 C~-3-thienyl H
33 6-C1 CF3 C=C-2-oxazolyl H
34 6-C1 CF3 C=C-2-thiazolyl H
35 6-C1 CF3 C~-4-isoxazolyl H
36 6-C1 CF3 C=C-2-imidazolyl H
37 6-C1 CF3 C=CCHzCHZOH H
38 6-C1 CF3 C=C-CH(OH)Me H
39 6-Cl CF3 C-C-(2-C1)Ph H
40 6-Cl CF3 C-C-(3-C1)Ph H
41 6-C1 CF3 C-C-(4-C1)Ph H
42 6-C1 CF3 C-C-(2-F)Ph H
43 6-C1 CF3 C-C-(3-F)Ph H
44 6-C1 CF3 C-C-(4-F)Ph H
45 6-C1 CF3 Cue- (2-OH) Ph H
46 6-C1 CF3 C=C-(3-OH)Ph H
47 6-CI CF3 C=C-(4-OH)Ph H
48 6-C1 CF3 C=C-(2-OMe)Ph H
49 6-C1 CF3 C=C-(3-OMe)Ph H
50 6-C1 CF3 C=C-(4-OMe)Ph H
51 6-C1 CF3 C=C-(2-CN)Ph H
52 6-C1 CF3 C=C-(3-CN)Ph H
53 6-C1 CF3 C=C-(4-CN)Ph H
54 6-C1 CF3 C=C-(2-N02)Ph H
55 6-C1 CF3 C=C-(3-N02)Ph H
56 6-CI CF3 C=C-(4-N02)Ph H
57 6-C1 CF3 C=C- ( 2-NH2 ) Ph H
58 6-C1 CF3 C=C-(3-NHZ)Ph H
59 6-C1 CF3 C=C-(4-NH2)Ph H
60 6-C1 CF3 C=C-(2-NMe2)Ph H
61 6-C1 CF3 C=C- ( 3 -NMe2 ) H
Ph 62 6-C1 CF3 C=C-(4-NMe2)Ph H
63 6-C1 CF3 C=C-3-Pyridyl H
64 6-C1 CF3 C=C-4-Pyridyl H
65 6-C1 CF3 C=C-2-furanyl H
66 6-Cl CF3 C=C-3-furanyi H
67 6-C1 CF3 C=C-2-thienyl H
68 6-C1 CF3 C=C-3-thienyl H
69 6-C1 CF3 C=C-2-oxazolyl H
70 6-C1 CF3 C=C-2-thiazolyl H
71 6-C1 CF3 C=C-4-isoxazolyl H
72 6-C1 CF3 C~-2-imidazolyl H
73 6-C1 CF3 CH2CHZ-cycPr H
75 6-C1 CF3 CH2CH2-CH(OH)Me H
76 6-C1 CF3 CH2CH2-Ph H
77 6-Cl CF3 CH2CH2-(2-C1)Ph H
78 6-C1 CF3 CH2CH2-(3-C1)Ph H
79 6-C1 CF3 CHZCHZ-(4-C1)Ph H
80 6-C1 CF3 CH2CH2-(2-F)Ph H
81 6-C1 CF3 CH2CH2-(3-F)Ph H
82 6-C1 CF3 CH2CH2-(4-F)Ph H
83 6-C1 CF3 CH2CH2-(2-OH)Ph H
84 6-C1 CF3 CH2CH2-(3-OH)Ph H
85 6-C1 CF3 CH2CH2-(4-OH}Ph H
86 6-C1 CF3 CH2CH2-(2-OMe)Ph H
87 6-C1 CF3 CH2CH2-(3-OMe)Ph H
88 6-C1 CF3 CH2CH2-(4-OMe)Ph H
89 6-C1 CF3 CH2CH2-(2-CN)Ph H
90 6-C1 CF3 CHZCH2-(3-CN)Ph H
91 6-C1 CF3 CH2CH2-(4-CN)Ph H
92 6-C1 CF3 CH2CH2-(2-N02)Ph H
93 6-C1 CF3 CH2CH2-(3-N02)Ph H
94 6-Cl CF3 CH2CH2-(4-N02)Ph H
95 6-Cl CF3 CH2CH2-(2-NH2}Ph H
96 6-C1 CF3 CH2CH2-(3-NH2)Ph H
97 6-C1 CF3 CH2CH2-(4-NH2}Ph H
98 6-C1 CF3 CH2CH2-(2-NMe2)Ph H
99 6-C1 CF3 CHZCHZ- ( 3 -NMe2 H
) Ph 100 6-C1 CF3 CHZCH2-(4-NMe2)Ph H
101 6-Cl CF3 CH2CHZ-2-Pyridyl H
102 6-C1 CF3 CH2CH2-3-Pyridyl H
103 6-C1 CF3 CH2CH2-4-Pyridyl H
104 6-C1 CF3 CH2CH2-2-furanyl H
105 6-C1 CF3 CH2CH2-3-furanyl H
106 6-C1 CF3 CH2CH2-4-furanyl H
107 6-C1 CF3 CH2CH2-3-thienyl H
108 6-C1 CF3 CH2CH2-2-oxazolyl H
109 6-C1 CF3 CH2CH2-2-thiazolyl H
110 6-CI CF3 CH2CH2-4-isoxazolyl H
111 6-Cl CF3 CH2CH2-2-imidazolyl H
112 6-C1 CF3 C~-cycPr CH3 113 6-C1 CF3 C~-Ph CH3 114 6-C1 CF3 C~-2-Pyridyl CH3 115 6-C1 CF3 C~-3-Pyridyl CH3 116 6-C1 CF3 C~-4-Pyridyl CH3 117 6-C1 CF3 C~-2-furanyl CH3 118 6-C1 CF3 C~-3-furanyl CH3 219 6-C1 CF3 C-C-2-thienyl CH3 120 6-C1 CF3 C~-3-thienyl CH3 121 6-C1 CF3 C=C-cycPr CH3 I22 6-C1 CF3 C=C-Ph CH3 123 6-C1 CF3 C=C-2-Pyridyl CH3 124 6-C1 CF3 C=C-3-Pyridyl CH3 125 6-C1 CF3 C=C-4-Pyridyl CH3 126 6-C1 CF3 C=C-2-furanyl CH3 227 6-C1 CF3 C=C-3-furanyl CH3 128 6-C1 CF3 C=C-2-thienyl CH3 129 6-C1 CF3 C=C-3-thienyl CH3 130 6-C1 CF3 CH2CH2-cycPr CH3 131 6-C1 CF3 CH2CH2-Ph CH3 132 6-Cl CF3 CH2CH2-2-Pyridyl CH3 133 6-C1 CF3 CH2CH2-3-Pyridyl CH3 134 6-C1 CF3 CHZCH2-4-Pyridyl CH3 135 6-C1 CF3 CHZCH2-2-furanyl CH3 136 6-C1 CF3 CHZCH2-3-furanyl CH3 137 6-C1 CF3 CHZCHZ-2-thienyl CH3 138 6-C1 CF3 CHZCH2-3-thienyl CH3 139 6-C1 CF3 C~-cycPr CH2CH3 140 6-C1 CF3 C-C-Ph CH2CH3 141 6-C1 CF3 C~-2-Pyridyl CH2CH3 142 6-C1 CF3 C~-3-Pyridyl CH2CH3 143 6-C1 CF3 C~-4-Pyridyl CH2CH3 144 6-C1 CF3 C=C-2-furanyl CH2CH3 145 6-C1 CF3 C~-3-furanyl CH2CH3 146 6-C1 CF3 C~-2-thienyl CH2CH3 147 6-C1 CF3 C~-3-thienyl CH2CH3 148 6-C1 CF3 C=C-cycPr CH2CH3 149 6-C1 CF3 C=C-Ph CH2CH3 150 6-C1 CF3 C=C-2-Pyridyl CH2CH3 151 6-C1 CF3 C=C-3-Pyridyl CH2CH3 152 6-C1 CF3 C=C-4-Pyridyl CH2CH3 153 6-C1 CF3 C=C-2-furanyl CH2CH3 154 6-C1 CF3 C=C-3-furanyl CH2CH3 155 6-C1 CF3 C=C-2-thienyl CH2CH3 156 6-C1 CF3 C=C-3-thienyl CHZCH3 157 6-C1 CF3 CH2CH2-cycPr CH2CH3 158 6-C1 CF3 CH2CH2-Ph CH2CH3 159 6-Cl CF3 CHZCHZ-2-Pyridyl CH2CH3 160 6-C1 CF3 CH2CH2-3-Pyridyl CH2CH3 161 6-C1 CF3 CH2CHZ-4-Pyridyl CH2CH3 162 6-C1 CF3 CH2CH2-2-furanyl CH2CH3 163 6-C1 CF3 CH2CH2-3-furanyl CH2CH3 164 6-C1 CF3 CH2CH2-2-thienyl CH2CH3 165 6-Cl CF3 CH2CH2-3-thienyl CH2CH3 166 6-Me0 CF3 C=CCH2CH20H H
167 6-Me0 CF3 C=C-CH(OH)Me H
168 6-Me0 CF3 C-C-(2-C1)Ph H
169 6-Me0 CF3 C=C-(3-C1)Ph H
170 6-Me0 CF3 C=C-(4-C1)Ph H
171 6-Me0 CF3 C=C-(2-F)Ph 172 6-Me0 CF3 C=C-(3-F)Ph H
173 6-Me0 CF3 C-C-(4-F)Ph H
174 6-Me0 CF3 C=C-(2-OH)Ph 175 6-Me0 CF3 C=C-(3-OH)Ph 176 6-Me0 CF3 C=C-(4-OH)Ph H
177 6-Me0 CF3 Cue- ( 2 -OMe ) H
Ph 178 6-Me0 CF3 C=C-(3-OMe)Ph H
179 6-Me0 CF3 C~-(4-OMe)Ph H
180 6-Me0 CF3 C=C-(2-CN)Ph H
181 6-Me0 CF3 C=C-(3-CN)Ph 182 6-Me0 CF3 C=C-(4-CN)Ph 183 6-Me0 CF3 C=C-(2-N02)Ph H
184 6-Me0 CF3 C-C-(3-N02)Ph 185 6-Me0 CF3 C-C-(4-N02)Ph 186 6-Me0 CF3 C=C-(2-NH2)Ph H
187 6-Me0 CF3 C=C-(3-NHZ)Ph 188 6-Me0 CF3 C=C-(4-NH2)Ph H
189 6-Me0 CF3 C-_--C- ( 2 -NMe2 H
) Ph 190 6-Me0 CF3 C_=C-(3-NMe2)Ph 191 6-Me0 CF3 C=C-(4-NMe2)Ph H
192 6-Me0 CF3 C~-3-Pyridyl H
193 6-Me0 CF3 C~-4-Pyridyl H
194 6-Me0 CF3 C=C-2-furanyl H
195 6-Me0 CF3 C~-3-furanyl H
196 6-Me0 CF3 C~-2-thienyl H
197 6-Me0 CF3 C=C-3-thienyl 198 6-Me0 CF3 C~-2-oxazolyl H
r , .
199 6-Me0 CF3 C=C-2-thiazolyl H
200 6-Me0 CF3 C=C-4-isoxazolyl H
201 6-Me0 CF3 C=C-2-imidazolyl H
202 6-Me0 CF3 C=CCH2CH20H H
203 6-Me0 CF3 C=C-CH(OH)Me H
204 6-Me0 CF3 C=C-(2-Cl)Ph H
205 6-Me0 CF3 C=C-(3-C1)Ph H
206 6-Me0 CF3 C=C-(4-C1)Ph H
207 6-Me0 CF3 C=C-(2-F)Ph H
208 6-Me0 CF3 C=C-(3-F)Ph H
209 6-Me0 CF3 C=C-(4-F)Ph H
210 6-Me0 CF3 C=C-(2-OH)Ph H
211 6-Me0 CF3 C=C-(3-OH)Ph H
212 6-Me0 CF3 C=C-(4-OH)Ph H
213 6-Me0 CF3 C=C-(2-OMe)Ph H
214 6-Me0 CF3 C=C-(3-OMe)Ph H
215 6-Me0 CF3 C=C-(4-OMe)Ph H
216 6-MeO CF3 C=C-(2-CN)Ph H
217 6-Me0 CF3 C=C-(3-CN)Ph H
218 6-Me0 CF3 C=C-(4-CN)Ph H
219 6-Me0 CF3 C=C-(2-N02)Ph H
220 6-Me0 CF3 C=C-(3-N02)Ph H
221 6-Me0 CF3 C=C-(4-N02)Ph H
222 6-Me0 CF3 C=C-(2-NH2)Ph H
223 6-Me0 CF3 C=C-(3-NH2)Ph H
224 6-Me0 CF3 C=C-(4-NH2)Ph H
225 6-Me0 CF3 C=C-(2-NMe2)Ph H
226 6-Me0 CF3 C=C-(3-NMe2)Ph H
227 6-Me0 CF3 C=C-(4-NMe2)Ph H
228 6-Me0 CF3 C=C-3-Pyridyl H
229 6-Me0 CF3 C=C-4-Pyridyl H
230 6-Me0 CF3 C=C-2-furanyl H
231 6-Me0 CF3 C=C-3-furanyl H
232 6-Me0 CF3 C=C-2-thienyl H
233 6-Me0 CF3 C=C-3-thienyl H
234 6-Me0 CF3 C=C-2-oxazolyl H
235 6-Me0 CF3 C=C-2-thiazolyl H
236 6-Me0 CF3 C=C-4-isoxazolyl H
237 6-Me0 CF3 C=C-2-imidazolyl H
238 6-Me0 CF3 CH2CH2-cycPr H
239 6-Me0 CF3 CH2CH2CH2CHZOH H
240 6-Me0 CF3 CH2CH2-CH(OH)Me H
241 6-Me0 CF3 CH2CH2-Ph H
242 6-Me0 CF3 CH2CH2-(2-C1)Ph H
243 6-Me0 CF3 CHZCH2-(3-C1)Ph H
244 6-Me0 CF3 CH2CH2-(4-C1)Ph H
245 6-Me0 CF3 CH2CH2-(2-F)Ph H
246 6-Me0 CF3 CH2CH2-(3-F)Ph H
247 6-Me0 CF3 CH2CH2-(4-F)Ph H
248 6-Me0 CF3 CH2CH2-(2-OH)Ph H
249 6-Me0 CF3 CH2CH2-(3-OH)Ph H
250 6-Me0 CF3 CH2CH2-(4-OH)Ph H
251 6-Me0 CF3 CH2CH2-(2-OMe)Ph H
252 6-Me0 CF3 CH2CH2-(3-OMe)Ph H
253 6-Me0 CF3 CH2CH2-{4-OMe)Ph H
254 6-Me0 CF3 CHZCH2-(2-CN)Ph H
255 6-Me0 CF3 CHZCHZ-(3-CN)Ph H
256 6-Me0 CF3 CH2CH2-(4-CN)Ph H
257 6-Me0 CF3 CH2CH2-(2-N02)Ph H
258 6-Me0 CF3 CHZCHZ-(3-NOZ)Ph H
259 6-Me0 CF3 CH2CH2-{4-NOz)Ph H
260 6-Me0 CF3 CH2CH2-(2-NH2)Ph H
261 6-Me0 CF3 CHZCH2-(3-NH2)Ph H
262 6-Me0 CF3 CH2CH2-(4-NH2)Ph H
263 6-Me0 CF3 CH2CH2-(2-NMe2)Ph H
264 6-Me0 CF3 CH2CH2-(3-NMe2)Ph H
265 6-Me0 CF3 CH2CH2-(4-NMe2)Ph H
266 6-Me0 CF3 CH2CH2-2-Pyridyl H
267 6-Me0 CF3 CH2CH2-3-Pyridyl H
268 6-Me0 CF3 CH2CH2-4-Pyridyl H
269 6-Me0 CF3 CH2CH2-2-furanyl H
270 6-Me0 CF3 CH2CH2-3-furanyl H
271 6-Me0 CF3 CHZCH2-4-furanyl H
272 6-Me0 CF3 CHZCH2-3-thienyl H
273 6-Me0 CF3 CH2CHz-2-oxazolyl H
274 6-Me0 CF3 CH2CH2-2-thiazolyl H
275 6-Me0 CF3 CHZCH2-4-isoxazolyl H
276 6-Me0 CF3 CH2CH2-2-imidazolyl H
277 6-Me0 CF3 C~-cycPr CH3 278 6-Me0 CF3 C=C-Ph CH3 279 6-Me0 CF3 C~-2-Pyridyl CH3 280 6-Me0 CF3 C~-3-Pyridyl CH3 281 6-Me0 CF3 C~-4-Pyridyl CH3 282 6-Me0 CF3 C~-2-furanyl CH3 283 6-Me0 CF3 C~ 3-furanyl CH3 284 6-Me0 CF3 C~-2-thienyl CH3 285 6-Me0 CF3 C~-3-thienyl CH3 286 6-Me0 CF3 C=C-cycPr CH3 287 6-Me0 CF3 C=C-Ph CH3 288 6-Me0 CF3 C=C-2-Pyridyl CH3 289 6-Me0 CF3 C=C-3-Pyridyl CH3 290 6-Me0 CF3 C=C-4-Pyridyl CH3 291 6-Me0 CF3 C=C-2-furanyl CH3 292 6-Me0 CF3 C=C-3-furanyl CH3 293 6-Me0 CF3 C=C-2-thienyl CH3 294 6-Me0 CF3 C=C-3-thienyl CH3 295 6-Me0 CF3 CH2CH2-cycPr CH3 296 6-Me0 CF3 CH2CH2-Ph CH3 297 6-Me0 CFg CH2CH2-2-Pyridyl CH3 298 6-Me0 CF3 CH2CH2-3-Pyridyl CH3 299 6-Me0 CF3 CH2CH2-4-Pyridyl CH3 300 6-Me0 CF3 CH2CH2-2-furanyl CH3 301 6-Me0 CF3 CHZCHZ-3-furanyl CH3 302 6-Me0 CF3 CH2CH2-2-thienyl CH3 303 6-Me0 CF3 CH2CH2-3-thienyl CH3 304 6-Me0 CF3 C~-cycPr CH2CH3 305 6-Me0 CF3 C=C-ph CH2CH3 306 6-Me0 CF3 C~-2-Pyridyl CH2CH3 307 6-Me0 CF3 C~-3-Pyridyl CH2CH3 308 6-Me0 CF3 C~-4-Pyridyl CH2CH3 309 6-Me0 CF3 C~-2-furanyl CH2CH3 310 6-Me0 CF3 C~-3 -furanyl CH2CH3 311 6-Me0 CF3 C~-2-thienyl CH2CH3 312 6-Me0 CF3 C~-3-thienyl CH2CH3 313 6-Me0 CF3 C=C-cycPr CHZCH3 314 6-Me0 CF3 C=C-Ph CH2CH3 315 6-Me0 CF3 C=C-2-Pyridyl CH2CH3 3I6 6-Me0 CF3 C=C-3-Pyridyl CH2CH3 317 6-Me0 CF3 C=C-4-Pyridyl CH2CH3 318 6-Me0 CF3 C=C-2-furanyl CH2CH3 319 6-Me0 CF3 C=C-3-furanyl CH2CH3 320 6-Me0 CF3 C=C-2-thienyl CHZCH3 321 6-Me0 CF3 C=C-3-thienyl CH2CH3 322 6-Me0 CF3 CHZCH2-cycPr CH2CH3 323 6-M'e0 CF3 CH2CH2-Ph CH2CH3 324 6-Me0 CF3 CH2CH2-2-Pyridyl CH2CH3 325 6-Me0 CF3 CH2CH2-3-Pyridyl CHZCH3 326 6-Me0 CF3 CH2CH2-4-Pyridyl CH2CH3 327 6-Me0 CF3 CH2CH2-2-furanyl CH2CH3 328 6-Me0 CF3 CH2CH2-3-furanyl CH2CH3 329 6-Me0 CF3 CH2CH2-2-thienyl CH2CH3 330 6-Me0 CF3 CH2CH2-3-thienyl CH2CH3 331 5,6-diF CF3 C=C-(2-C1)Ph H
332 5, 6-diF CF3 C~-(3-C1) Ph H
333 5,6-diF CF3 C=C-(4-C1)Ph H
334 5,6-diF CF3 C-C-(2-F)Ph H
335 5,6-diF CF3 C=C-(3-F)Ph H
336 5,6-diF CF3 C-C-(4-F)Ph H
337 5,6-diF CF3 C=C-(2-OH)Ph H
338 5,6-diF CF3 C=C-(3-OH)Ph H
339 5,6-diF CF3 C=C-(4-OH)Ph H
340 5, 6-diF CF3 Cue- (2-OMe) Ph H
341 5 , 6-diF CF3 Cue- ( 3 -OMe ) Ph H
3 42 5 , 6-diF CF3 Cue- ( 4 -OMe ) Ph H
343 5, 6-diF CF3 Cue- ( 2-CN) Ph H
344 5, 6-diF CF3 C~-(3-CN) Ph H
345 5, 6-diF CF3 Cue- (4-CN) Ph H
3 46 5 , 6 -diF CF3 Cue- ( 2 -N02 ) Ph H
347 5,6-diF CF3 C=C-(3-NOz)Ph H
348 5,6-diF CF3 C~-(4-N02)Ph H
3 4 5 , 6 -diF CF3 Cue- ( 2 -NH2 ) Ph H
350 5,6-diF CF3 C~-(3-NH2)Ph H
351 5,6-diF CF3 C~-(4-NH2)Ph H
352 5,6-diF CF3 C~-(2-NMe2)Ph H
3 53 5 , 6 -diF CF3 Cue- ( 3 -NMe2 ) Ph H
354 5,6-diF CF3 C=C-(4-NMe2)Ph H
355 5,6-diF CF3 C=C-3-Pyridyl H
356 5,6-diF CF3 C~-4-Pyridyl H
357 5,6-diF CF3 C~-2-furanyl H
358 5,6-diF CF3 C~-3-furanyl H
359 5,6-diF CF3 C~-2-thienyl H
360 5,6-diF CF3 C~-3-thienyl H
361 5,6-diF CF3 C~-2-oxazolyl H
362 5,6-diF CF3 C=C-2-thiazolyl H
363 5,6-diF CF3 CrC-4-isoxazolyl H
364 5,6-diF CF3 C=C-2-imidazolyl H
365 5,6-diF CF3 C=C-(2-C1)Ph H
366 5,6-diF CF3 C=C-(3-C1)Ph H
367 5,6-diF CF3 C=C-(4-C1)Ph H
368 5,6-diF CF3 C=C-(2-F)Ph H
369 5,6-diF CF3 C=C-(3-F)Ph H
370 5,6-diF CF3 C=C-(4-F)Ph H
371 5,6-diF CF3 C=C-{2-OH)Ph H
372 5,6-diF CF3 C=C-{3-OH)Ph H
373 5,6-diF CF3 C=C-{4-OH)Ph H
374 5,6-diF CF3 C=C-(2-OMe)Ph H
375 5,6-diF CF3 C=C-(3-OMe)Ph H
376 5,6-diF CF3 C=C-(4-OMe)Ph H
377 5,6-diF CF3 C=C-(2-CN)Ph H
378 5,6-diF CF3 C=C-(3-CN)Ph H
379 5,6-diF CF3 C=C-(4-CN)Ph H
380 5,6-diF CF3 C=C-(2-N02)Ph H
381 5,6-diF CF3 C=C-(3-N02)Ph H
382 5,6-diF CF3 C=C-{4-N02)Ph H
383 5,6-diF CF3 C=C-(2-NH2)Ph H
384 5,6-diF CF3 C=C-(3-NH2)Ph H
385 5,6-diF CF3 C=C-(4-NH2)Ph H
386 5,6-diF CF3 C=C-(2-NMe2)Ph H
3 8? 5 , 6-diF CF3 C=C- ( 3 -NMe2 ) H
Ph 388 5,6-diF CF3 C=C-(4-NMe2)Ph H
389 5,6-diF CF3 C=C-3-Pyridyl H
390 5,6-diF CF3 C=C-4-Pyridyl H
391 5,6-diF CF3 C=C-2-furanyl H
392 5,6-diF CF3 C=C-3-furanyl H
393 5,6-diF CF3 C=C-2-thienyl H
394 5,6-diF CF3 C=C-3-thienyl H
395 5,6-diF CF3 C=C-2-oxazolyl H
396 5,6-diF CF3 C=C-2-thiazolyl H
397 5,6-diF CF3 C=C-4-isoxazolyl H
398 5,6-diF CF3 C=C-2-imidazolyl H
399 5,6-diF CF3 CH2CH2-cycPr H
400 5,6-diF CF3 CH2CH2CH2CH20H H
401 5,6-diF CF3 CH2CH2-CH(OH)Me H
402 5,6-diF CF3 CH2CH2-Ph H
403 5,6-diF CF3 CH2CHZ-(2-C1)Ph H
404 5,6-diF CF3 CH2CH2-(3-C1)Ph H
405 5,6-diF CF3 CH2CH2-(4-Cl)Ph H
406 5,6-diF CF3 CHZCH2-(2-F)Ph H
407 5,6-diF CF3 CH2CH2-(3-F)Ph H
408 5,6-diF CF3 CH2CH2-(4-F)Ph H
409 5,6-diF CF3 CH2CH2-(2-OH)Ph H
410 5,6-diF CF3 CH2CH2-(3-OH)Ph H
411 5,6-diF CF3 CHZCH2-(4-OH)Ph H
412 5,6-diF CF3 CH2CH2-(2-OMe)Ph H
413 5,6-diF CF3 CHzCH2-(3-OMe)Ph H
414 5,6-diF CF3 CH2CH2-(4-OMe)Ph H
415 5,6-diF CF3 CHZCH2-(2-CN)Ph H
416 5,6-diF CF3 CH2CHZ-(3-CN)Ph H
417 5,6-diF CF3 CH2CH2-(4-CN)Ph H
418 5,6-diF CF3 CHZCH2-(2-N02)Ph H
419 5,6-diF CF3 CH2CH2-(3-N02)Ph H
420 5,6-diF CF3 CH2CH2-(4-N02)Ph H
421 5,6-diF CF3 CH2CH2-(2-NH2~Ph H
422 5,6-diF CF3 CH2CH2-(3-NH2)Ph H
423 5,6-diF CF3 CH2CH2-(4-NH2)Ph H
424 5,6-diF CF3 CHZCH2-(2-NMe2)Ph H
425 5,6-diF CF3 CHZCH2-(3-NMe2)Ph H
426 5,6-diF CF3 CH2CH2-(4-NMe2)Ph H
427 5,6-diF CF3 CH2CH2-2-Pyridyl H
428 5,6-diF CF3 CH2CH2-3-Pyridyl H
429 5,6-diF CF3 CH2CH2-4-Pyridyl H
430 5,6-diF CF3 CH2CH2-2-furanyl H
431 5,6-diF CF3 CH2CH2-3-furanyl H
432 5,6-diF CF3 CHZCH2-2-thienyl H
433 5,6-diF CF3 CH2CH2-3-thienyl H
434 5,6-diF CF3 CH2CHZ-2-oxazolyl H
435 5,6-diF CF3 CH2CH2-2-thiazolyl H
436 5,6-diF CF3 CH2CH2-4-isoxazolyl H
437 5,6-diF CF3 CH2CH2-2-imidazolyl H
438 5,6-diF CF3 C~-cycPr CH3 439 5,6-diF CF3 C~-2-Pyridyl CH3 440 5,6-diF CF3 C~-3-Pyridyl CH3 441 5 , 6-diF CF3 C~-4 CH
-Pyridyl 3 442 5,6-diF CF3 C~-2-furanyl CH3 443 5,6-diF CF3 C~-3-furanyl CH3 444 5,6-diF CF3 C~-2-thienyl CH3 445 5,6-diF CF3 C~-3-thienyl CH3 446 5,6-diF CF3 C=C-cycPr CH3 447 5,6-diF CF3 C=C-2-Pyridyl CH3 448 5,6-diF CF3 C=C-3-Pyridyl CH3 449 5,6-diF CF3 C=C-4-Pyridyl CH3 450 5,6-diF CF3 C=C-2-furanyl CH3 451 5,6-diF CF3 C=C-3-furanyl CH3 452 5,6-diF CF3 C=C-2-thienyl CH3 453 5,6-diF CF3 C=C-3-thienyl CHI
454 5,6-diF CF3 CH2CH2-cycPr CH3 455 5,6-diF CF3 CH2CH2-Ph CH3 456 5,6-diF CF3 CH2CH2-2-Pyridyl CH3 457 5,6-diF CF3 CHZCH2-3-Pyridyl CH3 458 5,6-diF CF3 CH2CH2-4-Pyridyl CH3 459 5,6-diF CF3 CH2CH2-2-furanyl CH3 460 5,6-diF CF3 CH2CH2-3-furanyl CH3 461 5,6-diF CF3 CHZCH2-2-thienyl CH3 462 5,6-diF CF3 CHZCH2-3-thienyl CH3 463 5,6-diF CF3 C~-cycPr CH2CH3 464 5,6-diF CF3 C-C-Ph CH2CH3 465 5,6-diF CF3 C~-2-Pyridyl CH2CH3 466 5,6-diF CF3 C~-3-Pyridyl CH2CH3 467 5,6-diF CF3 C~-4-Pyridyl CH2CH3 468 5, 6-diF CF3 C~-2-furanyl CH2CH3 469 5,6-diF CF3 C~-3-furanyl CH2CH3 470 5,6-diF CF3 C~-2-thienyl CH2CH3 471 5,6-diF CF3 C~-3-thienyl CH2CH3 472 5,6-diF CF3 C=C-cycPr CH2CH3 473 5,6-diF CF3 C=C-Ph CH2CH3 474 5,6-diF CF3 C=C-2-Pyridyl CH2CH3 475 5,6-diF CF3 C=C-3-Pyridyl CHZCH3 476 5,6-diF CF3 C=C-4-Pyridyl CHZCH3 477 5,6-diF CF3 C=C-2-furanyl CH2CH3 478 5,6-diF CF3 C=C-3-furanyl CH2CH3 479 5,6-diF CF3 C=C-2-thienyl CH2CH3 480 5,6-diF CF3 C=C-3-thienyl CH2CH3 481 5,6-diF CF3 CH2CH2-cycPr CH2CH3 482 5,6-diF CF3 CH2CH2-Ph CH2CH3 483 5,6-diF CF3 CH2CHZ-2-Pyridyl CH2CH3 484 5,6-diF CF3 CHZCH2-3-Pyridyl CH2CH3 485 5,6-diF CF3 CH2CH2-4-Pyridyl CH2CH3 486 5,6-diF CF3 CH2CH2-2-furanyl CH2CH3 487 5,6-diF CF3 CH2CH2-3-furanyl CHZCH3 488 5,6-diF CF3 CH2CH2-2-thienyl CH2CH3 489 5,6-diF CF3 CHZCH2-3-thienyl CH2CH3 490 5, 6-diCl CF3 Cue- (2-C1) Ph H
491 5 , 6-diCl CF3 Cue- ( 3 -C1 ) Ph H
492 5,6-diCl CF3 C~-(4-C1)Ph H
493 5, 6-diCl CF3 Cue- (2-F) Ph H
494 5, 6-diCl CF3 C~-(3-F) Ph H
495 5 , 6-diCl CF3 Cue- ( 4-F ) Ph H
496 5, 6-diCl CF3 C~-(2-OH) Ph H
497 5, 6-diCl CF3 C~-(3-OH) Ph H
498 5 , 6-diCl CF3 Cue- ( 4-OH) Ph H
499 5,6-diCl CF
Cue- ( 2 -OMe ) H
Ph 500 5,6-diCl CF
Cue- ( 3 -OMe ) H
Ph 501 5,6-diCl CF3 C~-(4-OMe)Ph H
502 5, 6-diCl CF3 C~-(2-CN) Ph H
503 5, 6-diCl CF3 C~-(3-CN) Ph H
504 5 , 6-diCl CF3 Cue- ( 4-CN) Ph H
505 5,6-diCl CF3 C-C-(2-N02)Ph H
506 5,6-diCl CF3 C-C-(3-NOZ}Ph H
507 5,6-diCl CF3 CSC-(4-N02)Ph H
508 5,6-diCl CF3 C=C-(2-NHz)Ph H
509 5,6-diCl CF3 C=C-(3-NH2)Ph H
510 5,6-diCl CF3 C=C-(4-NH2)Ph H
511 5,6-diCl CF3 C=C-(2-NMe2)Ph H
512 5 , 6-diCl CF3 C=C- ( 3 -NMe2 ) H
Ph 513 S,6-diCl CF3 C-C-(4-NMe2)Ph H
514 5,6-diCl CF3 C~-3-Pyridyl H
515 5,6-diCl CF3 C~-4-Pyridyl H
516 5,6-diCl CF3 C~-2-furanyl H
517 5,6-diCl CF3 C~-3-furanyl H
518 5,6-diCl CF3 C~-2-thienyl H
519 5,6-diCl CF3 C~-3-thienyl H
520 5,6-diCl CF3 C~-2-oxazolyl H
521 5,6-diCl CF3 C=C-2-thiazolyl H
522 5,6-diCl CF3 C~-4-isoxazolyl H
523 5,6-diCl CF3 C~-2-imidazolyl H
524 5,6-diCl CF3 C=C-(2-C1)Ph H
525 5,6-diCl CF3 C=C-(3-Cl)Ph H
526 5,6-diCl CF3 C=C-(4-C1)Ph H
527 5,6-diCl CF3 C=C-(2-F)Ph H
528 5,6-diCl CF3 C=C-(3-F)Ph H
529 5,6-diCl CF3 C=C-(4-F)Ph H
530 5,6-diCl CF3 C=C-(2-OH)Ph H
531 5,6-diCl CF3 C=C-(3-OH)Ph H
532 5,6-diCl CF3 C=C-(4-OH)Ph H
533 5,6-diCl CF3 C=C-(2-OMe)Ph H
534 5,6-diCl CF3 C=C-(3-OMe)Ph H
535 5,6-diCl CF3 C=C-(4-OMe)Ph H
536 5,6-diCl CF3 C=C-(2-CN)Ph H
537 5,6-diCl CF3 C=C-(3-CN)Ph H
538 5,6-diCl CF3 C=C-(4-CN}Ph H
, i 539 5,6-diCl CF3 C=C-(2-NOz)Ph H
540 5,6-diCl CF3 C=C-(3-N02)Ph H
541 5,6-diCl CF3 C=C-(4-N02)Ph H
542 5,6-diCl CF3 C=C-(2-NH2)Ph H
543 5,6-diCl CF3 C=C-(3-NH2)Ph H
544 5,6-diCl CF3 C=C-(4-NH2)Ph H
545 5,6-diCl CF3 C=C-(2-NMe2)Ph H
546 5,6-diCl CF3 C=C-(3-NMe2)Ph H
547 5,6-diCl CF3 C=C-(4-NMe2)Ph H
548 5,6-diCl CF3 C=C-3-Pyridyl H
549 5,6-diCl CF3 C=C-4-Pyridyl H
550 5,6-diCl CF3 C=C-2-furanyl H
551 5,6-diCl CF3 C=C-3-furanyl H
552 5,6-diCl CF3 C=C-2-thienyl H
553 5,6-diCl CF3 C=C-3-thienyl H
554 5,6-diCl CF3 C=C-2-oxazolyl H
555 5,6-diCl CF3 C=C-2-thiazolyl H
556 5,6-diCl CF3 C=C-4-isoxazolyl H
557 5,6-diCl CF3 C=C-2-imidazolyl H
558 5,6-diCl CF3 CH2CH2-cycPr H
559 5,6-diCl CFA CH2CH2CH2CH20H H
560 5,6-diCl CF3 CHZCH2-CH(OH)Me H
561 5,6-diCl CF3 CH2CH2-Ph H
562 5,6-diCl CF3 CH2CH2-(2-C1)Ph H
563 5,6-diCl CF3 CHZCH2-(3-C1)Ph H
564 5,6-diCl CF3 CH2CH2-(4-C1)Ph H
565 5,6-diCl CF3 CHZCH2-(2-F)Ph H
566 5,6-diCl CF3 CH2CH2-(3-F)Ph H
567 5,6-diCl CF3 CH2CH2-(4-F)Ph H
568 5,6-diCl CF3 CH2CH2-(2-OH)Ph H
569 5,6-diCl CF3 CHZCH2-(3-OH)Ph H
570 5,6-diCl CF3 CHZCH2-(4-OH)Ph H
571 5,6-diCl CF3 CH2CH2-(2-OMe)Ph H
572 5,6-diCl CF3 CH2CH2-(3-OMe)Ph H
573 5,6-diCl CF3 CH2CH2-(4-OMe)Ph H
574 5,6-diCl CF3 CHZCH2-(2-CN)Ph H
575 5,6-diCl CF3 CH2CH2-(3-CN)Ph H
576 5,6-diCl CF3 CH2CH2-(4-CN)Ph H
577 5,6-diCl CF3 CH2CH2-(2-NOZ)Ph H
578 5,6-diCl CF3 CH2CH2-(3-N02)Ph H
579 5,6-diCl CF3 CH2CH2-(4-N02)Ph H
580 5,6-diCl CF3 CH2CH2-(2-NH2?Ph H
581 5 , 6-diCl CF3 CH2CH2- ( 3 -NH2 H
) Ph 582 5,6-diCl CF3 CH2CH2-(4-NH2)Ph H
583 5,6-diCl CF3 CH2CH2-(2-NMe2)Ph H
584 5,6-diCl CF3 CH2CH2-(3-NMe2)Ph H
585 5,6-diCl CF3 CHZCH2-(4-NMe2)Ph H
586 5,6-diCl CF3 CH2CH2-2-Pyridyl H
587 5,6-diCl CF3 CH2CH2-3-Pyridyl H
588 5,6-diCl CF3 CH2CH2-4-Pyridyl H
589 5,6-diCl CF3 CH2CH2-2-furanyl H
590 5,6-diCl CF3 CH2CH2-3-furanyl H
591 5,6-diCl CF3 CH2CH2-2-thienyl H
592 5,6-diCl CF3 CH2CH2-3-thienyl H
593 5,6-diCl CF3 CH2CH2-2-oxazolyl H
594 5,6-diCl CF3 CHZCH2-2-thiazolyl H
595 5,6-diCl CF3 CH2CH2-4-isoxazolyl H
596 5,6-diCl CF3 CH2CH2-2-imidazolyl H
597 5 , 6-diCl CF3 C~-cycPr CH3 598 5,6-diCl CF3 C~-2-Pyridyl CH3 599 5,6-diCl CF3 C~-3-Pyridyl CH3 600 5,6-diCl CF3 C~-4-Pyridyl CH3 601 5, 6-diCl CF3 C~-2-furanyl CH3 602 5,6-diCl CF3 C~-3-furanyl CH3 603 5,6-diCl CF3 C~-2-thienyl CH3 604 5,6-diCl CF3 C~-3-thienyl CH3 605 5,6-diCl CF3 C=C-cycPr CH3 606 5,6-diCl CF3 C=C-2-Pyridyl CH3 607 5,6-diCl CF3 C=C-3-Pyridyl CH3 608 5,6-diCl CF3 C=C-4-Pyridyl CH3 609 5,6-diCl CF3 C=C-2-furanyl CH3 610 5,6-diCl CF3 C=C-3-furanyl CH3 611 5,6-diCl CF3 C=C-2-thienyl CH3 612 5,6-diCl CF3 C=C-3-thienyl CH3 613 5,6-diCl CF3 CH2CH2-cycPr CH3 614 5,6-diCl CF3 CHZCH2-Ph CH3 615 5,6-diCl CF3 CH2CH2-2-Pyridyl CH3 616 5,6-diCl CF3 CH2CH2-3-Pyridyl CH3 617 5,6-diCl CF3 CH2CH2-4-Pyridyl CH3 618 5,6-diCl CF3 CH2CH2-2-furanyl CH3 619 5,6-diCl CF3 CH2CH2-3-furanyl CH3 620 5,6-diCl CF3 CH2CH2-2-thienyl CH3 621 5,6-diCl CF3 CH2CH2-3-thienyl CH3 622 5,6-diCl CF3 C~-cycPr CH2CH3 623 5,6-diCl CF3 C~-Ph CHZCH3 624 5,6-diCl CF3 C~-2-Pyridyl CH2CH3 625 5,6-diCl CF3 C~-3-Pyridyl CH2CH3 626 5,6-diCl CF3 C~-4-Pyridyl CH2CH3 627 5,6-diCl CF3 C~-2-furanyl CH2CH3 628 5,6-diCl CF3 C~-3-furanyl CH2CH3 629 5,6-diCl CF3 C~-2-thienyl CH2CH3 630 5,6-diCl CF3 C~-3-thienyl CHZCH3 631 5,6-diCl CF3 C=C-cycPr CH2CH3 632 5,6-diCl CF3 C=C-Ph CH2CH3 633 5,6-diCl CF3 C=C-2-Pyridyl CH2CH3 634 5,6-diCl CF3 C=C-3-Pyridyl CH2CH3 635 5,6-diCl CF3 C=C-4-Pyridyl CH2CH3 636 5,6-diCl CF3 C=C-2-furanyl CH2CH3 637 5,6-diCl CF3 C=C-3-furanyl CH2CH3 638 5,6-diCl CF3 C=C-2-thienyl CH2CH3 639 5,6-diCl CF3 C=C-3-thienyl CH2CH3 640 5,6-diCl CF3 CH2CH2-cycPr CH2CH3 641 5,6-di.Cl CF3 CH2CH2-Ph CH2CH3 642 5,6-diCl CF3 CH2CH2-2-Pyridyl CH2CH3 643 5,6-diCl CF3 CH2CH2-3-Pyridyl CH2CH3 644 5,6-diCl CF3 CH2CH2-4-Pyridyl CH2CH3 645 5,6-diCl CF3 CH2CH2-2-furanyl CHzCH3 646 5,6-diCl CF3 CH2CH2-3-furanyl CH2CH3 647 5,6-diCl CF3 CH2CH2-2-thienyl CH2CH3 648 5,6-diCl CF3 CH2CH2-3-thienyl CH2CH3 649 6-F CF3 C~CH2CH20H H
650 6-F CF3 C~-CH(OH)Me H
651 6-F CF3 C~-(2-C1)Ph H
652 6-F CF3 Cue- ( 3-C1 ) Ph H
653 6-F CF3 C~-(4-CI)Ph H
654 6-F CF3 Cue- (2-F) Ph H
655 6-F CF3 Cue- ( 3 -F ) Ph H
656 6-F CFg C~-(4-F)Ph H
657 6-F CF3 Cue- ( 2-OH) Ph H
658 6-F CF3 C~-(3-OH)Ph H
659 6-F CF3 C~-(4-OH)Ph H
660 6-F CF3 Cue- (2-OMe) Ph H
661 6-F CF3 Cue- ( 3 -OMe ) H
Ph 662 6-F CF3 C~-(4-OMe)Ph H
663 6-F CF3 Cue- (2-CN) Ph H
6 6 6 -F CF3 Cue- ( 3 -CN ) H
4 Ph 665 6-F CF3 Cue- ( 4-CN) Ph H
666 6-F CF3 Cue- ( 2-N02 ) H
Ph 667 6-F CF3 C~-(3-N02)Ph H
668 6-F CF3 Cue- ( 4-N02 ) H
Ph 669 6-F CF3 Cue- ( 2-NH2 ) H
Ph 670 6-F CF3 Cue- ( 3-NH2 ) H
Ph 671 6-F CF3 Cue- ( 4-NH2 ) H
Ph 672 6-F CF3 Cue- ( 2-NMe2 ) H
Ph 673 6-F CF3 Cue- ( 3 -NMe2 H
) Ph 674 6-F CF3 Cue- ( 4-NMe2 ) H
Ph 675 6-F CF3 C-C-3-Pyridyl H
676 6-F CF3 C~-4-Pyridyl H
677 6-F CF3 C~-2-furanyl H
' 678 6-F CF3 C~-3-furanyl H
679 6-F CF3 C~-2-thienyl H
680 6-F CF3 C~-3-thienyl H
681 6-F CF3 C~-2-oxazolyl H
682 6-F CF3 C=C-2-thiazolyl H
683 6-F CF3 C=C-4-isoxazolyl H
684 6-F CF3 C=C-2-imidazolyl H
685 6-F CF3 C=CCH2CHzOH H
686 6-F CF3 C=C-CH(OH)Me H
687 6-F CF3 C=C-(2-C1)Ph H
688 6-F CF3 C=C-(3-C1)Ph H
689 6-F CF3 C=C-(4-C1)Ph H
690 6-F CF3 C=C-(2-F)Ph H
691 6-F CF3 C=C-(3-F)Ph H
692 6-F CF3 C=C-(4-F)Ph H
693 6-F CF3 C=C-(2-OH)Ph H
694 6-F CF3 C=C-(3-OH)Ph H
695 6-F CF3 C=C-(4-OH)Ph H
696 6-F CF3 C=C-(2-OMe)Ph H
697 6-F CF3 C=C-(3-OMe)Ph H
698 6-F CF3 C=C-(4-OMe)Ph H
699 6-F CF3 C=C-(2-CN)Ph H
700 6-F CF3 C=C-(3-CN)Ph H
701 6-F CF3 C=C-(4-CN)Ph H
702 6-F CF3 C=C-(2-N02)Ph H
703 6-F CF3 C=C- ( 3-N02 ) Ph H
704 6-F CF3 C=C-(4-N02)Ph H
705 6-F CF3 C=C- ( 2-NH2 ) Ph H
706 6-F CF3 C=C-(3-NH2)Ph H
707 6-F CF3 C=C-(4-NHZ)Ph H
708 6-F CF3 C=C-(2-NMe2)Ph H
7 09 6-F CF3 C=C- ( 3 -NMe2 ) H
Ph 710 6-F CF3 C=C-(4-NMe2)Ph H
711 6-F CF3 C=C-3-Pyridyl H
712 6-F CF3 C=C-4-Pyridyl H
713 6-F CF3 C=C-2-furanyl H
714 6-F CF3 C=C-3-furanyl H
715 6-F CF3 C=C-2-thienyl H
716 6-F CF3 C=C-3-thienyl H
717 6-F CF3 C=C-2-oxazolyl H
718 6-F CF3 C=C-2-thiazolyl H
719 6-F CF3 C=C-4-isoxazolyl H
720 6-F CF3 C=C-2-imidazolyl H
721 6-F CF3 CH2CH2-cycPr H
723 6-F CF3 CH2CH2-CH(OH)Me H
724 6-F CF3 CH2CH2-(2-C1)Ph H
725 6-F CF3 CH2CH2-(3-C1)Ph H
726 6-F CF3 CHZCHZ-(4-C1)Ph H
727 6-F CF3 CH2CH2-(2-F)Ph H
728 6-F CF3 CH2CH2-(3-F)Ph H
729 6-F CF3 CH2CH2-(4-F)Ph H
730 6-F CF3 CH2CH2-(2-OH)Ph H
731 6-F CF3 CH2CH2-(3-OH)Ph H
732 6-F CF3 CH2CHZ-(4-OH)Ph H
733 6-F CF3 CH2CH2-(2-OMe)Ph H
734 6-F CF3 CH2CH2-(3-OMe)Ph H
735 6-F CF3 CH2CH2-(4-OMe)Ph H
736 6-F CF3 CH2CH2-(2-CN)Ph H
737 6-F CF3 CHZCH2-(3-CN)Ph H
738 6-F CF3 CH2CH2-(4-CN)Ph H
739 6-F CF3 CH2CH2-(2-N02)Ph H
740 6-F CF3 CH2CH2- ( 3 -N02 H
) Ph 741 6-F CF3 CH2CH2-(4-N02)Ph H
742 6-F CF3 CH2CH2-(2-NHZ)Ph H
743 6-F CF3 CHZCHZ-(3-NH2)Ph H
744 6-F CF3 CH2CH2-(4-NH2)Ph H
745 6-F CF3 CH2CH2-(2-NMe2)Ph H
746 6-F CF3 CH2CH2- ( 3 -NMe2 H
) Ph 747 6-F CF3 CH2CH2-(4-NMe2)Ph H
748 6-F CF3 CH2CHz-3-Pyridyl H
749 6-F CF3 CH2CH2-4-Pyridyl H
750 6-F CF3 CH2CH2-2-furanyl H
751 6-F CF3 CHZCH2-3-furanyl H
752 6-F CF3 CH2CH2-2-thienyl H
753 6-F CF3 CH2CH2-3-thienyl H
754 6-F CF3 CHZCH2-2-oxazolyl H
755 6-F CF3 CH2CH2-2-thiazolyl H
756 6-F CF3 CH2CH2-4-isoxazolyl H
757 6-F CF3 CH2CH2-2-imidazolyl H
758 6-F CF3 C~-cycPr CH3 759 6-F CF3 C~-iPr CH3 760 6-F CF3 C~-Pr CH3 7 61 6-F CF3 C~-Bu CH3 7 62 6-F CF3 C~-iBu CH3 763 6-F CF3 C=C-tBu CH3 764 6-F CF3 C=C-Et CH3 765 6-F CF3 C=C-Me CH3 766 6-F CF3 C=_C-Ph CH3 76? 6-F CF3 C~-2-Pyridyl CH3 768 6-F CF3 C~-3-Pyridyl CH3 769 6-F CF3 C~-4-Pyridyl CH3 770 6-F CF3 C~-2-furanyl CH3 771 6-F CF3 C~-3-furanyl CH3 772 6-F CF3 C~-2-thienyl CH3 773 6-F CF3 C~-3-thienyl CH3 774 6-F CF3 C=C-cycPr CH3 775 6-F CF3 C=C-iPr CH3 776 6-F CF3 C=C-Pr CH3 777 6-F CF3 C=C-Bu CH3 778 6-F CF3 C=C-iBu CH3 779 6-F CF3 C=C-tBu CH3 780 6-F CF3 C=C-Et CH3 781 6-F CF3 C=C-Me CH3 782 6-F CF3 C=C-Ph CH3 783 6-F CF3 C=C-2-Pyridyl CH3 784 6-F CF3 C=C-3-Pyridyl CH3 785 6-F CF3 C=C-4-Pyridyl CH3 786 6-F CF3 C=C-2-furanyl CH3 787 6-F CF3 C=C-3-furanyl CH3 788 6-F CF3 C=C-2-thienyl CH3 789 6-F CF3 C=C-3-thienyl CH3 790 6-F CF3 CH2CH2-cycPr CH3 791 6-F CF3 CH2CH2-Ph CH3 792 6-F CF3 CH2CH2-2-Pyridyl CH3 793 6-F CF3 CH2CH2-3-Pyridyl CH3 794 6-F CF3 CHZCH2-4-Pyridyl CHg 795 6-F CF3 CH2CH2-2-furanyl CH3 796 6-F CF3 CH2CH2-3-furanyl CH3 797 6-F CF3 CH2CH2-2-thienyl CH3 798 6-F CF3 CH2CH2-3-thienyl CH3 799 6-F CF3 C~-cycPr CH2CH3 800 6-F CF3 C=C-Ph CH2CH3 801 6-F CF3 C~-2-Pyridyl CH2CH3 802 6-F CF3 C~-3-Pyridyl CH2CH3 803 6-F CF3 C~-4-Pyridyl CH2CH3 804 S-F CF3 C~-2-furanyl CH2CH3 805 6-F CF3 C~-3-furanyl CH2CH3 806 6-F CF3 C~-2-thienyl CH2CH3 807 6-F CF3 C~-3-thienyl CH2CH3 808 6-F CF3 C=C-cycPr CH2CH3 809 6-F CF3 C=C-Ph CH2CH3 810 6-F CF3 C=C-2-Pyridyl CH2CH3 811 6-F CF3 C=C-3-Pyridyl CH2CH3 812 6-F CF3 C=C-4-Pyridyi CH2CH3 813 6-F CF3 C=C-2-furanyl CH2CH3 814 6-F CF3 C=C-3-furanyl CH2CH3 815 6-F CF3 C=C-2-thienyl CH2CH3 816 6-F CF3 C=C-3-thienyl CH2CH3 817 6-F CF3 CH2CH2-cycPr CH2CH3 818 6-F CF3 CHzCH2-Ph CH2CH3 819 6-F CF3 CH2CH2-2-Pyridyl CHZCH3 820 6-F CF3 CH2CH2-3-Pyridyl CHZCH3 821 6-F CF3 CH2CH2-4-Pyridyl CH2CH3 822 6-F CF3 CH2CH2-2-furanyl CH2CH3 823 6-F CF3 CH2CHz-3-furanyl CH2CH3 824 6-F CF3 CHZCH2-2-thienyl CH2CH3 825 6-F CF3 CH2CH2-3-thienyl CH2CH3 826 S-C1 CF3 C~-cycPr H
827 S-C1 CF3 C~CH2CHZOH H
828 S-C1 CF3 C=C-CH(OH)Me H
829 5-C1 CF3 C-C-Ph H
830 5-CI CF3 C~-(2-C1)Ph H
831 5-C1 CF3 C~-(3-C1)Ph H
832 5-C1 CF3 C~-(4-CI)Ph H
833 5-C1 CF3 C~-(2-F)Ph H
834 5-Cl CF3 C~-(3-F)Ph 835 S-C1 CF3 C~-(4-F)Ph H
836 5-C1 CF3 C~-(2-OH)Ph H
837 5-CI CF3 C~-(3-OH)Ph H
838 5-C1 CF3 C~-(4-OH)Ph H
839 5-C1 CF3 Cue- (2-OMe) Ph H
840 5-C1 CF3 C~-(3-OMe)Ph H
841 5-C1 CF3 Cue- ( 4-OMe ) Ph H
842 5-Cl CF3 Cue- ( 2-CN) Ph H
843 5-Cl CF3 Cue- ( 3 -CN) Ph H
844 5-C1 CF3 C~-(4-CN)Ph H
845 5-C1 CF3 C=C-(2-N02)Ph H
846 5-Cl CF3 C-C-(3-N02)Ph H
847 5-C1 CF3 C=C-(4-N02)Ph H
848 5-C1 CF3 Cue- ( 2-NHZ ) Ph H
849 5-C1 CF3 C-C-(3-NH2)Ph H
850 5-C1 CF3 C-C-(4-NH2)Ph H
851 5-C1 CF3 C-C-(2-NMe2)Ph H
852 5-C1 CF3 C=C-(3-NMe2)Ph H
853 5-C1 CF3 C-C-(4-NMez)Ph H
C~-2-Pyridyl H
855 5-Cl CF3 C~-2-Pyridyl H
856 5-C1 CF3 C~-3 H
-Pyridyl 857 5-C1 CF3 C~-4 H
-Pyridyl 858 5-C1 CF3 C~-2-furanyl H
859 5-C1 CF3 C~-3-furanyl H
860 5-C1 CF3 C~-2-thienyl H
861 5-C1 CF3 C=C-3-thienyl H
862 5-C1 CF3 C=C-2-oxazolyl H
863 5-C1 CF3 C~-2-thiazolyl H
864 5-C1 CF3 C~-4-isoxazolyl H
865 5-CI CF3 C=C-2-imidazolyl H
866 5-C1 CF3 C=C-cycPr H
867 5-C1 CF3 C=CCH2CH20H H
868 5-C1 CF3 C=C-CH(OH)Me H
869 5-C1 CF3 C=C-Ph H
870 5-C1 CF3 C=C-(2-C1)Ph H
871 5-C1 CF3 C=C- ( 3 -C1 ) Ph H
872 5-C1 CF3 C=C-(4-C1)Ph H
873 5-C1 CF3 C=C-(2-F)Ph H
874 5-C1 CF3 C=C-(3-F)Ph H
875 5-C1 CF3 C=C-(4-F)Ph H
876 5-C1 CF3 C=C-(2-OH)Ph H
877 5-C1 CF3 C=C- ( 3 -OH ) Ph H
878 5-Cl CF3 C=C-(4-OH)Ph H
879 5-Cl CF3 C=C-(2-OMe)Ph H
880 5-C1 CF3 C=C-(3-OMe)Ph H
881 5-C1 CF3 C=C-(4-OMe)Ph H
882 5-C1 CF3 C=C-(2-CN)Ph H
883 5-C1 CF3 C=C-(3-CN)Ph H
884 5-C1 CF3 C=C-(4-CN)Ph H
885 5-C1 CFg C=C-(2-NOZ)Ph H
886 5-C1 CF3 C=C-(3-N02)Ph H
887 5-C1 CF3 C=C-(4-N02)Ph H
888 5-C1 CF3 C=C-(2-NH2)Ph H
889 5-C1 CF3 C=C-(3-NHZ)Ph H
890 5-CI CF3 C=C-(4-NH2)Ph H
891 5-C1 CF3 C=C-(2-NMe2)Ph H
892 5-C1 CF3 C=C-(3-NMe2)Ph H
893 5-C1 CF3 C=C-(4-NMe2)Ph H
894 5-C1 CF3 C=C-2-Pyridyl H
895 5-C1 CF3 C=C-2-Pyridyl H
896 5-C1 CF3 C=C-3-Pyridyl H
897 5-C1 CF3 C=C-4-Pyridyl H
898 5-C1 CF3 C=C-2-furanyl H
899 5-C1 CF3 C=C-3-furanyl H
900 5-C1 CF3 C=C-2-thieriyl H
901 5-C1 CF3 C=C-3-thienyl H
902 5-C1 CF3 C=C-2-oxazolyl H
903 5-C1 CF3 C=C-2-thiazolyl H
904 5-C1 CF3 C=C-4-isoxazolyl H
905 5-C1 CF3 C=C-2-imidazolyl H
906 5-C1 CF3 CH2CH2-cycPr H
907 5-C1. CF3 CH2CH2CH2CH20H H
908 5-C1 CF3 CH2CH2-CH(OH)Me H
909 5-CI CF3 CH2CHZPh H
910 5-Cl CF3 CH2CH2-(2-C1)Ph H
911 5-C1 CF3 CH2CH2-(3-Cl)Ph H
912 5-C1 CF3 CH2CH2-(4-C1)Ph H
913 5-Cl CF3 CH2CH2-(2-F)Ph H
914 5-C1 CF3 CH2CH2-(3-F)Ph H
915 5-C1 CF3 CH2CH2-(4-F)Ph H
916 5-C1 CF3 CH2CH2-(2-OH)Ph H
917 5-C1 CF3 CH2CH2-(3-OH)Ph H
918 5-C1 CF3 CH2CH2-(4-OH)Ph H
919 5-C1 CF3 CH2CHz-(2-OMe)Ph H
920 5-C1 CF3 CH2CH2-(3-OMe)Ph H
921 5-C1 CF3 CHZCH2-(4-OMe)Ph H
922 5-CI CF3 CH2CH2-(2-CN)Ph H
923 5-C1 CF3 CH2CH2-{3-CN)Ph H
924 5-C1 CF3 CH2CH2-(4-CN)Ph H
925 5-Cl CF3 CH2CH2-(2-N02)Ph H
926 5-C1 CF3 CH2CH2-(3-N02)Ph H
927 5-C1 CF3 CH2CH2-(4-N02)Ph H
928 5-C1 CF3 CH2CH2- {2-NH2 ) H
Ph 929 5-C1 CF3 CH2CH2-(3-NH2)Ph H
930 5-C1 CF3 CH2CH2-(4-NH2)Ph H
931 5-C1 CF3 CH2CH2-(2-NMe2)Ph H
932 5-C1 CF3 CH2CH2-{3-NMe2)Ph H
933 5-Cl CF3 CHZCH2-(4-NMe2)Ph H
934 5-C1 CF3 CH2CH2-2-Pyridyl H
935 5-C1 CF3 CH2CH2-3-Pyridyl H
936 5-C1 CF3 CH2CH2-4-Pyridyl H
937 5-C1 CF3 CH2CH2-2-furanyl H
938 5-C1 CF3 CH2CHZ-3-furanyl H
939 5-CZ CF3 CH2CH2-2-thienyl H
940 5-C1 CF3 CH2CH2-3-thienyl H
941 5-C1 CF3 CH2CH2-2-oxazolyl H
942 5-C1 CF3 CH2CH2-2-thiazolyl H
943 5-C1 CF3 CH2CH2-4-isoxazolyl H
944 5-Cl CF3 CH2CHZ-2-imidazolyl H
945 5-C1 CF3 C~-cycPr CH3 946 5-Cl CF3 C---.C-Ph CH3 947 5-Cl CF3 C=~-2-Pyridyl CH3 948 5-C1 CF3 C~-3-Pyridyl CH3 949 5-Cl CF3 C~-4-Pyridyl CH3 950 5-C1 CF3 C~-2-furanyl CH3 951 5-Cl CF3 C--_-C-3-furanyl CH3 952 5-Cl CF3 C-_.C-2-thienyl CH3 953 5-C1 CF3 C~-3-thienyl CH3 954 5-Cl CF3 C=C-cycPr CH3 955 5-C1 CF3 C=C-Ph CH3 956 5-C1 CF3 C=C-2-Pyridyl CH3 957 5-C1 CF3 C=C-3-Pyridyl CH3 958 5-C1 CF3 C=C-4-Pyridyl CH3 959 5-C1 CF3 C=C-2-furanyl CH3 960 5-Cl CF3 C=C-3-furanyl CH3 961 5-C1 CF3 C=C-2-thienyl CH3 962 5-C1 CF3 C=C-3-thienyl CH3 963 5-C1 CF3 CHZCHZ-cycPr CH3 964 5-C1 CF3 CH2CHZ-Ph CH3 965 5-C1 CF3 CH2CHZ-2-Pyridyl CH3 966 5-C1 CF3 CH2CHZ-3-Pyridyl CH3 967 5-C1 CF3 CH2CHZ-4-Pyridyl CH3 968 5-C1 CF3 CH2CH2-2-furanyl CH3 969 5-Cl CF3 CH2CHZ-3-furanyl CH3 970 5-C1 CF3 CH2CHZ-2-thienyl CH3 971 5-C1 CF3 CH2CHZ-3-thienyl CHg 972 5-C1 CF3 C~-cycPr CHZCH3 973 5-C1 CF3 C~-Ph CHZCH3 974 5-Cl CF3 C~-2-Pyridyl CH2CH3 975 5-C1 CF3 C~-3-Pyridyl CH2CH3 976 5-C1 CF3 C~-4-Pyridyl CH2CH3 977 5-C1 CF3 C~-2-furanyl CH2CH3 978 5-C1 CF3 C~-3-furanyl CH2CH3 979 5-C1 CF3 C~-2-thienyl CH2CH3 980 5-C1 CF3 C=C-3-thienyl CH2CH3 981 5-C1 CF3 C=C-cycPr CH2CH3 982 5-C1 CF3 C=C-Ph CHZCH3 983 5-C1 CF3 C=C-2-Pyridyl CH2CH3 984 5-C1 CF3 C=C-3-Pyridyl CH2CH3 985 5-C1 CF3 C=C-4-Pyridyl CH2CHg 986 5-C1 CF3 C=C-2-furanyl CH2CH3 987 5-C1 CF3 C=C-3-furanyl CH2CH3 988 5-C1 CF3 C=C-2-thienyl CH2CH3 989 5-C1 CF3 C=C-3-thienyl CH2CH3 990 5-C1 CF3 CH2CH2-cycPr CH2CH3 991 5-C1 CF3 CH2CH2-Ph CHZCH3 992 5-C1 CF3 CH2CH2-2-Pyridyl CH2CH3 993 5-C1 CF3 CH2CH2-3-Pyridyl CH2CH3 994 5-C1 CF3 CH2CH2-4-Pyridyl CH2CH3 995 5-C1 CF3 CH2CH2-2-furanyl CHZCH3 996 5-CI CFg CH2CH2-3-furanyl CH2CH3 997 5-C1 CF3 CH2CH2-2-thienyl CH2CH3 998 5-C1 CF3 CHZCH2-3-thienyl CH2CH3 999 5-F CF3 C~-cycPr H
1000 5-F CF3 C=_CCH2CH20H H
1001 5-F CF3 C~-CH(OH)Me H
1002 5-F CF3 C=C-Ph H
1003 5-F CF3 C~-(2-C1)Ph H
1004 5-F CF3 C~-(3-C1) Ph H
1005 5-F CF3 Cue- ( 4-C1 ) Ph H
1006 5-F CF3 C~-(2-F) Ph H
1007 5-F CF3 C~-(3-F)Ph H
1008 5-F CF3 C~-(4-F)Ph H
1009 5-F CF3 C~-(2-OH)Ph H
1010 5 -F CF3 Cue- ( 3 -OH ) Ph H
1011 5-F CF3 Cue- ( 4-OH) Ph H
1012 5-F CF3 C~-(2-OMe)Ph H
1013 5-F CF3 Cue- ( 3 -OMe ) H
Ph 1014 5-F CF3 C~-(4-OMe)Ph H
1015 5-F CF3 C=C-(2-CN)Ph H
1016 5-F CF3 C-C-(3-CN)Ph 1017 5-F CF3 C=C-(4-CN)Ph H
1018 5-F CF3 C=C-(2-NOZ)Ph H
1019 5-F CF3 C=C-(3-N02)Ph H
1020 S-F CF3 C=C-(4-N02)Ph H
1021 5-F CF3 C=C-(2-NHZ)Ph H
1022 5-F CF3 C=C- ( 3 -NH2 ) Ph H
1023 5-F CF3 C=C-(4-NHZ)Ph H
1024 5-F CF3 C=C-(2-NMe2)Ph H
1025 5-F CF3 C=C-(3-NMe2)Ph H
1026 5-F CF3 C=C-(4-NMe2)Ph H
1027 5-F CF3 C~-2-Pyridyl H
1028 5-F CF3 C~-2-Pyridyl H
1029 5-F CFg C~-3-Pyridyl H
1030 5-F CF3 C~-4-Pyridyl H
1031 5-F CF3 C~-2-furanyl H
1032 5-F CF3 C~-3-furanyl H
1033 5-F CF3 C~-2-thienyl H
1034 5-F CF3 C~-3-thienyl H
1035 5-F CF3 C=C-2-oxazolyi H
1036 5-F CF3 CSC-2-thiazolyl H
1037 5-F CF3 C=C-4-isoxazolyl H
1038 5-F CF3 C=C-2-imidazolyl H
1039 5-F CF3 C=C-cycPr H
1040 5-F CF3 C=CCHZCH20H H
1041 5-F CF3 C=C-CH(OH)Me H
1042 5-F CF3 C=C-Ph H
1043 S-P' CF3 C=C-(2-C1)Ph H
1044 5-F CF3 C=C-(3-C1)Ph H
1045 5-F CF3 C=C-(4-C1)Ph H
1046 5-F CF3 C=C-(2-F) Ph H
1047 5-F CF3 C=C-(3-F)Ph H
1048 5-F CF3 C=C-(4-F)Ph H
1049 5-F CF3 C=C-(2-OH)Ph H
1050 5-F CF3 C=C-(3-OH)Ph H
1051 5-F CF3 C=C-(4-OH)Ph H
1052 5-F CF3 C=C-(2-OMe)Ph H
1053 5-F CF3 C=C-(3-OMe)Ph H
1054 5-F CF3 C=C-{4-OMe)Ph H
1055 5-F CF3 C=C-(2-CN)Ph H
1056 5-F CF3 C=C-(3-CN)Ph H
1057 5-F CF3 C=C-(4-CN)Ph H
1058 5-F CF3 C=C-{2-N02)Ph H
1059 5-F CF3 C=C-(3-N02)Ph H
1060 5-F CF3 C=C-(4-N02)Ph H
1061 5-F CF3 C=C- ( 2-NH2 ) Ph H
1062 5-F CF3 C=C-(3-NH2)Ph H
1063 5-F CF3 C=C-(4-NH2)Ph H
1064 5-F CF3 C=C-{2-NMe2)Ph H
1065 5-F CF3 C=C-(3-NMe2)Ph H
1066 5-F CF3 C=C-(4-NMe2)Ph H
1067 5-F CF3 C=C-2-Pyridyl H
1068 5-F CF3 C=C-2-Pyridyl H
1069 5-F CF3 C=C-3-Pyridyl H
1070 5-F CF3 C=C-4-Pyridyl H
1071 5-F CF3 C=C-2-furanyl H
1072 5-F CF3 C=C-3-furanyl H
1073 5-F CF3 C=C-2-thienyl H
1074 5-F CF3 C=C-3-thienyl H
1075 5-F CF3 C=C-2-oxazolyl H
1076 5-F CF3 C=C-2-thiazolyl H
2077 5-F CF3 C=C-4-isoxazolyl H
1078 5-F CF3 C=C-2-imidazolyl H
1079 5-F CF3 CH2CH2-cycPr H
1081 5-F CF3 CH2CH2-CH(OH)Me H
1082 5-F CF3 CH2CH2Ph H
1083 5-F CF3 CH2CH2-(2-C1}Ph H
1084 5-F CF3 CH2CH2- ( 3 -C1 ) Ph H
1085 5-F CF3 CH2CH2-(4-C1)Ph H
1086 5-F CF3 CHZCH2-(2-F)Ph H
1087 5-F CF3 CHZCHZ-(3-F)Ph H
1088 5-F CF3 CHZCH2-(4-F)Ph H
1089 5-F CF3 CH2CH2-(2-OH)Ph H
1090 5-F CF3 CH2CH2-(3-OH)Ph H
1091 5-F CF3 CH2CH2-(4-OH)Ph H
1092 5-F CF3 CH2CH2-(2-OMe)Ph H
1093 5-F CF3 CH2CH2-(3-OMe)Ph H
1094 5-F CF3 CHZCH2-(4-OMe)Ph H
1095 5-F CF3 CH2CH2-(2-CN)Ph H
1096 5-F CF3 CH2CH2-(3-CN)Ph H
1097 5-F CF3 CH2CH2-(4-CN)Ph H
1098 5-F CF3 CH2CH2-(2-N02)Ph H
1099 5-F CF3 CH2CH2-(3-N02)Ph H
1100 5-F CF3 CH2CH2-(4-N02)Ph H
1101 5-F CF3 CH2CH2-(2-NH2)Ph H
1102 5-F CF3 CH2CH2-(3-NH2)Ph H
1103 5-F CF3 CH2CH2-(4-NH2)Ph H
1104 5-F CF3 CH2CH2-(2-NMe2)Ph H
1105 5-F CF3 CH2CH2-(3-NMe2)Ph H
1106 5-F CF3 CH2CH2-(4-NMe2)Ph H
1107 5-F CF3 CH2CH2-2-Pyridyl H
1108 5-F CF3 CH2CH2-3-Pyridyl H
1109 5-F CF3 CH2CH2-4-Pyridyl H
1110 5-F CF3 CH2CH2-2-furanyl H
1111 5-F CF3 CH2CH2-3-furanyl H
1112 5-F CF3 CH2CH2-2-thienyl H
1113 5-F CF3 CH2CH2-3-thienyl H
1114 5-F CF3 CH2CH2-2-oxazolyl H
1115 5-F CF3 CH2CH2-2-thiazolyl H
1116 5-F CF3 CH2CH2-4-isoxazolyl H
1117 5-F CF3 CH2CH2-2-imidazolyl H
1118 5-F CF3 C-C-cycPr CH3 1119 5-F CF3 C=C-Ph CH3 1120 5-F CF3 C-C-2-Pyridyl CH3 1121 5-F CF3 C~-3-Pyridyl CH3 1122 5-F CF3 C~-4-Pyridyl CH3 1123 5-F CF3 C~-2-furanyl CH3 1124 5-F CF3 C~-3-furanyl CH3 1125 5-F CF3 C~-2-thienyl CH3 1126 5-F CF3 C~-3-thienyl CH3 1127 5-F CF3 C=C-cycPr CH3 1128 5-F CF3 C=C-Ph CH3 1129 5-F CF3 C=C-2-Pyridyl CH3 1130 5-F CF3 C=C-3-Pyridyl CH3 1131 5-F CF3 C=C-4-Pyridyl CH3 1132 5-F CF3 C=C-2-furanyl CH3 1133 5-F CF3 C=C-3-furanyl CH3 1134 5-F CF3 C=C-2-thienyl CH3 1135 5-F CF3 C=C-3-thienyl CH3 1136 5-F CF3 CH2CH2-cycPr CH3 1137 5-F CF3 CH2CH2-Ph CH3 1138 5-F CF3 CH2CH2-2-Pyridyl CH3 1139 5-F CF3 CHZCH2-3-Pyridyl CH3 1140 5-F CF3 CH2CH2-4-Pyridyl CH3 2141 5-F CF3 CH2CH2-2-furanyl CH3 1142 5-F CF3 CH2CHz-3-furanyl CH3 1143 5-F CF3 CH2CH2-2-thienyl CH3 1144 5-F CF3 CH2CH2-3-thienyl CH3 1145 5-F CF3 C~-cycPr CH2CH3 1146 5-F CF3 C----C-Ph CH2CH3 1147 5-F CF3 C~-2-Pyridyl CH2CH3 1148 5-F CF3 C~-3-Pyridyl CH2CH3 1149 5-F CF3 C~-4-Pyridyl CH2CH3 1150 5-F CF3 C=C-2-furanyl CH2CH3 1151 5-F CF3 C=C-3-furanyl CHZCH3 1152 5-F CF3 C-C-2-thienyl CH2CH3 1153 5-F CF3 C~-3-thienyl CH2CH3 1154 5-F CF3 C=C-cycPr CHZCH3 1155 5-F CF3 C=C-Ph CH2CH3 1156 5-F CF3 C=C-2-Pyridyl CH2CH3 1157 5-F CF3 C=C-3-Pyridyl CH2CH3 1158 5-F CF3 C=C-4-Pyridyl CH2CH3 1159 5-F CF3 C=C-2-furanyl CH2CH3 1160 5-F CF3 C=C-3-furanyl CH2CH3 1161 5-F CF3 C=C-2-thienyl CH2CH3 1162 5-F CF3 C=C-3-thienyl CH2CH3 1163 5-F CF3 CH2CH2-cycPr CH2CH3 1164 5-F CF3 CH2CH2-Ph CHZCH3 1165 5-F CF3 CH2CH2-2-Pyridyl CH2CH3 1166 5-F CF3 CHZCH2-3-Pyridyl CH2CH3 1167 5-F CF3 CH2CH2-4-Pyridyl CH2CH3 1168 5-F CF3 CH2CH2-2-furanyl CH2CH3 1169 5-F CF3 CH2CH2-3-furanyl CH2CH3 1170 5-F CF3 CH2CH2-2-thienyl CH2CH3 1171 5-F CF3 CH2CH2-3-thienyl CHZCH3 1172 5-C1,6-F CF3 C~-cycPr H
1173 5-C1,6-F CF3 C~-Ph H
1174 5-C1,6-F CF3 C~-2-Pyridyl H
1175 5-C1,6-F CF3 H
C~-3 -Pyridyl 1176 5-C1,6-F CF3 C=C-4-Pyridyl H
1177 5-C1,6-F CF3 C~-2-furanyl H
1178 5-C1,6-F CF3 C~-3-furanyl H
1179 5-C1,6-F CF3 C~-2-thienyl H
1180 5-C1,6-F CF3 C~-3-thienyl H
1181 5-C1,6-F CF3 C=C-cycPr H
1182 5-C1,6-F CF3 C=C-Ph H
1183 5-C1,6-F CF3 C=C-2-Pyridyl H
1184 5-C1,6-F CF3 C=C-3-Pyridyl H
1185 5-C1,6-F CF3 C=C-4-Pyridyl H
1186 5-C1,6-F CF3 C=C-2-furanyl H
1187 5-C1,6-F CF3 C=C-3-furanyl H
1188 5-C1,6-F CF3 C=C-2-thienyl H
1189 5-C1,6-F CF3 C=C-3-thienyl H
1190 5-C1,6-F CF3 CH2CH2-cycPr H
1191 5-C1,6-F CF3 CH2CH2-Ph H
1192 5-C1,6-F CF3 CHZCHz-2-Pyridyl H
1193 5-C1,6-F CF3 CH2CH2-3-Pyridyl H
1194 5-C1,6-F CF3 CH2CH2-4-Pyridyl H
1195 5-C1,6-F CF3 CH2CH2-2-furanyl H
1196 5-C1,6-F CF3 CH2CH2-3-furanyl H
1197 5-C1,6-F CF3 CH2CH2-2-thienyl H
1198 5-C1,6-F CF3 CH2CH2-3-thienyl H
1199 5-C1, 6-F CF3 C~-cycPr CH3 1200 5-C1,6-F CF3 C~-Ph CH3 2201 5-C1,6-F CF3 C~-2-Pyridyl CH3 1202 5-C1,6-F CF3 C~-3-Pyridyl CH3 1203 5-C1,6-F CF3 C~-4-Pyridyl CH3 1204 5-C1,6-F CF3 C~-2-furanyl CH3 1205 5-C1,6-F CF3 C~-3-furanyl CH3 1206 5-C1,6-F CF3 C~-2-thienyl CH3 1207 5-C1,6-F CF3 C~-3-thienyl CH3 1208 5-C1,6-F CF3 C=C-cycPr CH3 1209 5-C1,6-F CF3 C=C-Ph CH3 1210 5-C1,6-F CF3 C=C-2-Pyridyl CH3 1211 5-C1,6-F CF3 C=C-3-Pyridyl CH3 1212 5-C1,6-F CF3 C=C-4-Pyridyl CH3 1213 5-C1,6-F CF3 C=C-2-furanyl CH3 1214 5-C1,6-F CF3 C=C-3-furanyl CH3 1215 5-C1,6-F CF3 C=C-2-thienyl CH3 1216 5-C1,6-F CF3 C=C-3-thienyl CH3 1217 5-C1,6-F CF3 CH2CH2-cycPr CH3 1218 5-C1,6-F CF3 CH2CH2-Ph CH3 1219 5-C1,6-F CF3 CHZCH2-2-Pyridyl CH3 1220 5-C1,6-F CF3 CH2CH2-3-Pyridyl CH3 1221 5-C1,6-F CF3 CH2CH2-4-Pyridyl CH3 1222 5-C1,6-F CF3 CH2CH2-2-furanyl CH3 1223 5-C1,6-F CF3 CHZCHz-3-furanyl CH3 1224 5-C1,6-F CF3 CHZCH2-2-thienyl CH3 1225 5-C1,6-F CF3 CH2CH2-3-thienyl CH3 2226 5-F,6-C1 CF3 C~-cycPr H
1227 5-F, 6-C1 CF3 C~-Ph H
1228 5-F,6-C1 CF3 C~-2-Pyridyl H
1229 5-F,6-C1 CF3 C~-3-Pyridyl 1230 5-F,6-C1 CF3 C=c-4-Pyridyl H
1231 5-F,6-C1 CF3 CSC-2-furanyl H
1232 5-F,6-C1 CF3 C~-3-furanyl H
1233 5-F,6-C1 CF3 C~-2-thienyl H
1234 5-F,6-C1 CF3 C~-3-thienyl H
1235 5-F,6-C1 CF3 C=C-cycPr H
1236 5-F,6-C1 CF3 C=C-Ph H
1237 5-F,6-C1 CF3 C=C-2-Pyridyl H
1238 5-F,6-C1 CF3 C=C-3-Pyridyl H
1239 5-F,6-C1 CF3 C=C-4-Pyridyl H
1240 5-F,6-C1 CF3 C=C-2-furanyl H
1241 5-F,6-C1 CF3 C=C-3-furanyl H
1242 5-F,6-C1 CF3 C=C-2-thienyl H
1243 5-F,6-C1 CF3 C=C-3-thienyl H
1244 5-F,6-C1 CF3 CH2CH2-cycPr H
1245 5-F,6-C1 CF3 CH2CH2-Ph H
1246 5-F,6-C1 CF3 CH2CH2-2-Pyridyl H
1247 5-F,6'-C1 CF3 CH2CH2-3-Pyridyl H
1248 5-F,6-C1 CF3 CH2CH2-4-Pyridyl H
1249 5-F,6-C1 CF3 CH2CH2-2-furanyl H
1250 5-F,6-C1 CF3 CH2CH2-3-furanyl H
1251 5-F,6-C1 CF3 CH2CH2-2-thienyl H
1252 5-F,6-C1 CF3 CH2CH2-3-thienyl H
1253 5-F,6-C1 CF3 C~-cycPr CH3 1254 5-F,6-C1 CF3 C=C-Ph CH3 1255 5-F,6-C1 CF3 C=C-2-Pyridyl CH3 1256 5-F,6-C1 CF3 C=C-3-Pyridyl CH3 1257 5-F,6-C1 CF3 C=C-4-Pyridyl CH3 1258 5-F,6-C1 CF3 C-C-2-furanyl CH3 1259 5-F,6-C1 CF3 C-C-3-furanyl CH3 1260 5-F,6-C1 CF3 C=_C-2-thienyl CH3 1261 5-F,6-C1 CF3 C~-3-thienyl CH3 1262 5-F,6-C1 CF3 C=C-cycPr CH3 1263 5-F,6-C1 CF3 C=C-Ph CH3 1264 5-F,6-C1 CF3 C=C-2-Pyridyl CH3 1265 5-F,6-C1 CF3 C=C-3-Pyridyl CH3 1266 5-F,6-Cl CF3 C=C-4-Pyridyl CH3 1267 5-F,6-C1 CF3 C=C-2-furanyl CH3 1268 5-F,6-C1 CF3 C=C-3-furanyl CH3 1269 5-F,6-C1 CF3 C=C-2-thienyl CH3 1270 5-F,6-C1 CF3 C=C-3-thienyl CH3 1271 5-F,6-C1 CF3 CH2CH2-cycPr CH3 1272 5-F,6-C1 CF3 CH2CH2-Ph CHg 1273 5-F,6-CI CF3 CH2CH2-2-Pyridyl CH3 1274 5-F,6-CI CF3 CHZCH2-3-Pyridyl CH3 1275 5-F,6-C1 CF3 CHZCH2-4-Pyridyl CH3 1276 5-F,6-C1 CF3 CH2CH2-2-furanyl CH3 1277 5-F,6-C1 CF3 CH2CH2-3-furanyl CH3 1278 5-F,6-Cl CF3 CH2CH2-2-thienyl CH3 1279 5-F,6-C1 CF3 CH2CH2-3-thienyl CH3 1280 6-C1,8-F CF3 C~-cycPr H
1281 6-C1,8-F CF3 C=C-Ph H
1282 6-C1,8-F CF3 C~-2-Pyridyl H
1283 6-C1,8-F CF3 C~-3-Pyridyl H
1284 6-C1,8-F CF3 C~-4-Pyridyl H
1285 6-C1,8-F CF3 C~-2-furanyl H
1286 6-C1,8-F CF3 C~-3-furanyl H
,.
1287 6-C1,8-F CF3 C~-2-thienyl H
1288 6-C1,8-F CF3 C~-3-thienyl H
1289 6-C1,8-F CF3 C=C-cycPr H
' 1290 6-C1,8-F CF3 C=C-Ph H
1291 6-C1,8-F CF3 C=C-2-Pyridyl H
1292 6-C1,8-F CF3 C=C-3-Pyridyl H
1293 6-C1,8-F CF3 C=C-4-Pyridyl H
1294 6-C1,8-F CF3 C=C-2-furanyl H
1295 6-C1,8-F CF3 C=C-3-furanyl H
1296 6-C1,8-F CF3 C=C-2-thienyl H
1297 6-C1,8-F CF3 C=C-3-thienyl H
1298 6-C1,8-F CF3 CH2CH2-cycPr H
1299 6-C1,8-F CF3 CH2CH2-Ph H
1300 6-C1,8-F CF3 CH2CH2-2-Pyridyl H
1301 6-C1,8-F CF3 CHZCH2-3-Pyridyl H
1302 6-C1,8-F CF3 CH2CH2-4-Pyridyl H
1303 6-C1,8-F CF3 CH2CH2-2-furanyl H
1304 6-C1,8-F CF3 CH2CH2-3-furanyl H
1305 6-C1,8-F CF3 CH2CH2-2-thienyl H
1306 6-C1,8-F CF3 CH2CH2-3-thienyl H
1307 6-C1,8-F CF3 C~-cycPr CH3 1308 6-C1,8-F CF3 C=C-Ph CH3 1309 6-C1,8-F CF3 C~-2-Pyridyl CH3 1310 6-C1,8-F CF3 C~-3-Pyridyl CH3 1311 6-C1,8-F CF3 C~-4-Pyridyl CH3 1312 6-C1,8-F CF3 C~-2-furanyl CH3 1313 6-C1,8-F CF3 C~-3-furanyl CH3 1314 6-CI,B-F CF3 C~-2-thienyl CH3 1315 6-C1,8-F CF3 C~-3-thienyl CH3 1316 6-C1,8-F CF3 C=C-cycPr CH3 1317 6-C1,8-F CF3 C=C-Ph CH3 1318 6-C1,8-F CF3 C=C-2-Pyridyl CH3 1319 6-C1,8-F CF3 C=C-3-Pyridyl CH3 1320 6-C1,8-F CF3 C=C-4-Pyridyl CH3 1321 6-C1,8-F CF3 C=C-2-furanyl CH3 1322 6-C1,8-F CF3 C=C-3-furanyl CH3 1323 6-C1,8-F CF3 C=C-2-thienyl CH3 1324 6-C1,8-F CF3 C=C-3-thienyl CH3 1325 6-C1,8-F CF3 CHZCH2-cycPr CH3 1326 6-C1,8-F CF3 CH2CH2-Ph CH3 1327 6-C1,8-F CF3 CH2CH2-2-Pyridyl CH3 1328 6-C1,8-F CF3 CH2CH2-3-Pyridyl CH3 1329 6-C1,8-F CF3 CH2CH2-4-Pyridyl CH3 1330 6-C1,8-F CF3 CH2CH2-2-furanyl CH3 1331 6-C1,8-F CF3 CH2CH2-3-furanyl CH3 1332 6-C1,8-F CF3 CH2CH2-2-thienyl CH3 1333 6-C1,8-F CF3 CH2CH2-3-thienyl CH3 1334 6-CH3 CF3 C~-cycPr H
1335 6-CH3 CF3 C~-Ph H
1336 6-CH3 CF3 C~-2-Pyridyl H
1337 6-CH3 CF3 C~-3-Pyridyl H
1338 6-CH3 CF3 C~-4-Pyridyl H
1339 6-CH3 CF3 C~-2-furanyl H
1340 6-CH3 CF3 C~-3-furanyl H
1341 6-CH3 CF3 C~-2-thienyl H
1342 6-CH3 CF3 C~-3-thienyl H
1343 6-CH3 CF3 C=C-cycPr H
1344 6-CH3 CF3 C=C-Ph H
1345 6-CH3 CF3 C=C-2-Pyridyl H
1346 6-CH3 CF3 C=C-3-Pyridyl H
1347 6-CH3 CF3 C=C-4-Pyridyl H
1348 6-CH3 CF3 C=C-2-furanyl H
1349 6-CH3 CF3 C=C-3-furanyl H
1350 6-CH3 CF3 C=C-2-thienyl H
1351 6-CH3 CF3 C=C-3-thienyl H
1352 6-CH3 CF3 CH2CH2-cycPr H
1353 6-CH3 CF3 CH2CH2-Ph H
1354 6-CH3 CF3 CH2CH2-2-Pyridyl H
1355 5-CH3 CF3 CHZCH2-3-Pyridyl H
1356 6-CH3 CF3 CH2CH2-4-Pyridyl H
1357 6-CH3 CF3 CHZCH2-2-furanyl H
1358 6-CH3 CF3 CH2CH2-3-furanyl H
1359 6-CH3 CF3 CH2CH2-2-thienyl H
1360 6-CH3 CF3 CH2CH2-3-thienyl H
1361 6-CH3 CF3 C--_.C-cycPr CH3 1362 6-CH3 CF9 C=C-Ph CH3 1363 6-CH3 CF3 CSC-2-Pyridyl CH3 1364 6-CH3 CF3 C~-3-Pyridyl CH3 1365 6-CH3 CF3 C~-4-Pyridyl CH3 1366 6-CH3 CF3 C~-2-furanyl CH3 1367 6-CH3 CF3 C~-3-furanyl CH3 1368 6-CH3 CF3 C~-2-thienyl CH3 1369 6-CH3 CF3 C~-3-thienyl CH3 1370 6-CH3 CF3 C=C-cycPr CH3 1371 6-CH3 CF3 C=C-Ph CH3 1372 6-CH3 CF3 C=C-2-Pyridyl CH3 1373 6-CH3 CF3 C=C-3-Pyridyl CH3 1374 6-CH3 CF3 C=C-4-Pyridyl CH3 1375 6-CH3 CF3 C=C-2-furanyl CH3 1376 6-CH3 CF3 C=C-3-furanyl CH3 1377 6-CH3 CF3 C=C-2-thienyl CH3 1378 6-CH3 CF3 C=C-3-thienyl CHg 1379 6-CH3 CF3 CH2CH2-cycPr CH3 1380 6-CH3 CF3 CH2CH2-Ph CH3 1381 6-CH3 CF3 CH2CH2-2-Pyridyl CH3 1382 6-CH3 CF3 CHZCH2-3-Pyridyl CH3 1383 6-CH3 CF3 CHZCH2-4-Pyridyl CH3 1384 6-CH3 CF3 CH2CH2-2-furanyl CH3 1385 6-CH3 CF3 CH2CH2-3-furanyl CH3 1386 6-CH3 CF3 CH2CH2-2-thienyl CH3 1387 6-CH3 CF3 CH2CH2-3-thienyl CH3 1388 6-COCH3 CF3 C=C-cycPr H
1389 6-COCH3 CF3 C=C-Ph H
1390 6-COCH3 CF3 C=C-2-Pyridyl H
1391 6-COCH3 CF3 C~-3-Pyridyl H
1392 6-COCH3 CF3 C~-4-Pyridyl H
1393 6-COCH3 CF3 C=C-2-furanyl H
1394 6-COCH3 CF3 C~-3-furanyl H
1395 6-COCH3 CF3 C~-2-thienyl H
1396 6-COCH3 CF3 C~-3-thienyl H
1397 6-NH2 CF3 C~-cycPr H
1398 6-NH2 CF3 C-C-Ph H
1399 6-NH2 CF3 C~-2-Pyridyl H
1400 6-NH2 CF3 CSC-3-Pyridyl H
1401 6-NH2 CF3 C=C-4-Pyridyl H
1402 6-NH2 CF3 C~-2-furanyl H
1403 6-NH2 CF3 C=C-3-furanyl H
1404 6-NH2 CF3 C~-2-thienyl H
1405 6-NH2 CF3 C~-3-thienyl H
1406 6-NMe2 CF3 C~-cycPr H
1407 6-NMe2 CF3 C=C-Ph H
1408 6-NMe2 CF3 C~-2-Pyridyl H
2409 6-NMe2 CF3 CSC-3-Pyridyl H
1410 6-NMe2 CF3 C~-4-Pyridyl H
1411 6-NMe2 CF3 C~-2-furanyl H
1412 6-NMe2 CF3 C~-3 -furanyl H
1413 6-NMe2 CF3 C~-2-thienyl H
1414 6-NMe2 CF3 C~-3-thienyl H
1415 7-C1 CF3 C~-cycPr H
1416 7-C1 CF3 C=-C-Ph H
1417 7-C3 CF3 C~-2-Pyridyl H
1418 7-C1 CF3 C~-3-Pyridyl H
1419 7-C1 CF3 C~-4-pyridyl H
1420 7-C1 CF3 C~-2-furanyl H
1421 7-C1 CF3 C=C-3-furanyl H
1422 7-C1 CF3 C=C-2-thienyl H
1423 7-C1 CF3 C~-3-thienyl 1424 5,6-OCH20- CF3 C~-cycPr H
1425 5,6-OCH20- CF3 C-CCHZCHZOH H
1426 5,6-OCH20- CF3 C=C-CH(OH)Me H
1427 5,6-OCH20- CF3 C=C-Ph H
1428 5,6-OCH20- CF3 C=C-(2-C1)Ph H
1429 5,6-OCH20- CF3 C=C-(3-C1)Ph H
1430 5,6-OCH20- CF3 C-C-(4-C1)Ph H
1431 5 , 6-OCH20- CF3 Cue- ( 2 -F ) Ph H
1432 5,6-OCH20- CF3 C~-(3-F)Ph H
1433 5,6-OCH20- CF3 C~-(4-F)Ph H
1434 5,6-OCH20- CF3 C=C-(2-OH)Ph H
1435 5,6-OCH20- CF3 C=C-(3-OH)Ph H
1436 5,6-OCH20- CF3 C~-(4-OH)Ph H
1437 5,6-OCH20- CF3 C~-(2-OMe)Ph H
1438 5,6-OCH20- CF3 C~-(3-OMe)Ph H
1439 5,6-OCH20- CF3 C~-(4-OMe)Ph H
1440 5,6-OCH20- CF3 C~-(2-CN)Ph H
1441 5,6-OCH20- CF3 C=C-(3-CN)Ph H
1442 5,6-OCH20- CF3 C~-(4-CN)Ph H
1443 5 , 6-OCH20- CF3 Cue- ( 2-N02 ) Ph H
1444 5 , 6-OCH20- CF3 Cue- ( 3 -N02 ) H
Ph 1445 5,6-OCH20- CF3 C~-(4-N02)Ph H
1446 5 , 6-OCH20- CF3 C=C_ ( 2 _~2 ) ph H
1447 5 , 6-OCH20- CF3 Cue- ( 3 -NH2 ) Ph 1448 5,6-OCH20- CF3 C~-(4-NH2)Ph H
1449 5,6-OCH20- CF3 C~-(2-NMe2)Ph H
1450 5,6-OCH20- CF3 C-C-(3-NMe2)Ph H
1451 5,6-OCH20- CF3 C-C-(4-NMe2)Ph H
1452 5,6-OCH20- CF3 C~-2-Pyridyl H
1453 5,6-OCH20- CF3 C~-2-pyridyl H
1454 5,6-OCH20- CF3 C~-3-Pyridyl H
1455 5,6-OCH20- CF3 C~-4-Pyridyl H
1456 5,6-OCH20- CF3 C~-2-furanyl H
1457 5,6-OCH20- CF3 C-C-3-furanyl H
1458 5,6-OCH20- CF3 C=C-2-thienyl H
1459 5,6-OCHZO- CF3 C-C-3-thienyl H
1460 5,6-OCH20- CF3 C~-2-oxazolyl H
1461 5,6-OCH20- CF3 C=C-2-thiazolyl H
1462 5,6-OCH20- CF3 C_C-4-isoxazolyl H
1463 5, 6-OCH20- CF3 C~-2-imidazolyl H
1464 6-COCH3 CF3 C=C-cycPr H
1465 6-COCH3 CF3 C=C-Ph H
1466 6-COCH3 CF3 C=C-2-Pyridyl H
1467 6-COCH3 CF3 C=C-3-Pyridyl H
1468 6-COCH3 CF3 C=C-4-Pyridyl H
1469 6-COCH3 CF3 C=C-2-furanyl H
1470 6-COCH3 CF3 C=C-3-furanyl H
1471 6-COCH3 CF3 C=C-2-thienyl H
1472 6-COCH3 CF3 C=C-3-thienyl H
1473 6-NH2 CF3 C=C-cycPr H
1474 6-NH2 CF3 C=C-Ph H
1475 6-NHZ CF3 C=C-2-Pyridyl H
1476 6-NHZ CF3 C=C-3-Pyridyl H
1477 6-NH2 CF3 C=C-4-Pyridyl H
1478 6-NH2 CF3 C=C-2-furanyl H
1479 6-NH2 CF3 C=C-3-furanyl H
1480 6-NH2 CF3 C=C-2-thienyl H
1481 6-NH2 CF3 C=C-3-thienyl H
1482 6-NMe2 CF3 C=C-cycPr H
1483 6-NMe2 CF3 C=C-Ph H
1484 6-NMe2 CF3 C=C-2-Pyridyl H
1485 6-NMe2 CF3 C=C-3-Pyridyl H
1486 6-NMe2 CF3 C=C-4-Pyridyl H
1487 6-NMe2 CF3 C=C-2-furanyl H
1488 6-NMe2 CF3 C=C-3-furanyl H
1489 6-NMe2 CF3 C=C-2-thienyl H
1490 6-NMe2 CF3 C=C-3-thienyl H
1491 7-C1 CF3 C=C-cycPr H
1492 7-C1 CF3 C=C-Ph H
1493 7-Cl CF3 C=C-2-Pyridyl H
1494 7-CI CF3 C=C-3-Pyridyl H
1495 7-C1 CF3 C=C-4-Pyridyl H
1496 7-C1 CF3 C=C-2-furanyl H
1497 7-C1 CF3 C=C-3-furanyl H
1498 7-C1 CF3 C=C-2-thienyl H
1499 7-C1 CF3 C=C-3-thienyl H
1500 5,6-OCH20- CF3 C=C-cycPr H
1501 5,6-OCH20- CF3 C=CCH2CHZOH H
1502 5,6-OCH20- CF3 C=C-CH(OH)Me H
1503 5,6-OCH20- CF3 C=C-Ph H
1504 5,6-OCH20- CF3 C=C-(2-C1}Ph H
1505 5,6-OCH20- CF3 C=C-(3-C1)Ph H
1506 5,6-OCH20- CF3 C=C-(4-C1)Ph H
1507 5,6-OCH20- CF3 C=C-(2-F)Ph H
1508 5,6-OCH20- CF3 C=C-(3-F)Ph H
1509 5,6-OCH20- CF3 C=C-(4-F)Ph H
1510 5,6-OCH20- CF3 C=C-(2-OH)Ph H
1511 5,6-OCH20- CF3 C=C-(3-OH)Ph H
1512 5,6-OCH20- CF3 C=C-(4-OH)Ph H
1513 5,6-OCH20- CF3 C=C-(2-OMe)Ph H
1514 5,6-OCH20- CF3 C=C-(3-OMe)Ph H
1515 5,6-OCH20- CF3 C=C-(4-OMe)Ph H
1516 5,6-OCH20- CF3 C=C-(2-CN)Ph H
1517 5,6-OCH20- CF3 C=C-(3-CN)Ph H
1518 5,6-OCH20- CF3 C=C-(4-CN)Ph H
1519 5,6-OCH20- CF3 C=C-(2-N02)Ph H
1520 5,6-OCH20- CF3 C=C-(3-N02)Ph H
1521 5,6-OCH20- CF3 C=C-(4-N02)Ph H
1522 5,6-OCH20- CF3 C=C-(2-NH2)Ph H
1523 5,6-OCH20- CF3 C=C-(3-NH2)Ph H
1524 5,6-OCH20- CF3 C=C-(4-NH2)Ph H
1525 5,6-OCH20- CF3 C=C-(2-NMe2)Ph H
1526 5,6-OCH20- CF3 C=C-(3-NMe2)Ph H
1527 5,6-OCH20- CF3 C=C-(4-NMe2)Ph H
1528 5,6-OCH20- CF3 C=C-2-Pyridyl H
1529 5,6-OCH20- CF3 C=C-2-Pyridyl H
1530 5,6-OCH20- CF3 C=C-3-Pyridyl H
1531 5,6-OCH20- CF3 C=C-4-Pyridyl H
1532 5,6-OCH20- CF3 C=C-2-furanyl H
1533 5,6-OCH20- CF3 C=C-3-furanyl H
1534 5,6-OCH20- CF3 C=C-2-thienyl H
1535 5,6-OCH20- CF3 C=C-3-thienyl H
1536 5,6-OCH20- CF3 C=C-2-oxazolyl H
1537 5,6-OCH20- CF3 C=C-2-thiazolyl H
1538 5,6-OCH20- CF3 C=C-4-isoxazolyl H
1539 5,6-OCH20- CF3 C=C-2-imidazolyl H
1540 5,6-OCH20- CF3 CHZCH2-cycPr H
1541 5,6-OCH20- CF3 CH2CH2CH2CH20H H
1542 5,6-OCH20- CF3 CH2CH2-CH(OH)Me H
1543 5,6-OCH20- CF3 CH2CH2Ph H
1544 5,6-OCH20- CF3 CH2CH2-(2-C1)Ph H
1545 5,6-OCH20- CF3 CH2CH2-(3-C1)Ph H
1546 5,6-OCH20- CF3 CH2CH2-(4-C1}Ph H
1547 5,6-OCH20- CF3 CH2CH2-(2-F)Ph H
1548 5,6-OCH20- CF3 CH2CH2-(3-F)Ph H
1549 5,6-OCHZO- CF3 CH2CH2-(4-F)Ph H
1550 5, 6-OCHZO- CF3 CH2CH2- (2-OH} Ph H
1551 5,6-OCH20- CF3 CH2CH2-(3-OH)Ph H
1552 5,6-OCH20- CF3 CH2CH2-(4-OH}Ph H
1553 5,6-OCH20- CF3 CH2CH2-(2-OMe)Ph H
1554 5,6-OCH20- CF3 CH2CH2-(3-OMe)Ph H
1555 5,6-OCH20- CF3 CH2CH2-(4-OMe)Ph H
1556 5,6-OCH20- CFg CH2CH2-(2-CN)Ph H
1557 5,6-OCH20- CF3 CH2CH2-(3-CN)Ph H
1558 5,6-OCH2O- CF3 CH2CH2-(4-CN)Ph H
1559 5,6-OCH20- CF3 CH2CH2-(2-N02)Ph H
1560 5,6-OCH20- CF3 CH2CH2-(3-N02)Ph H
1561 5,6-OCH20- CF3 CH2CH2-(4-N02)Ph H
1562 5,6-OCH20- CF3 CHZCH2-(2-NH2)Ph H
1563 5,6-OCH20- CF3 CH2CH2-(3-NH2)Ph H
1564 5,6-OCH20- CF3 CH2CH2-(4-NH2)Ph H
1565 5,6-OCH20- CF3 CHZCH2-(2-NMe2)Ph H
1566 5,6-OCH20- CF3 CH2CH2-(3-NMe2)Ph H
1567 5,6-OCH20- CF3 CH2CH2-(4-NMe2)Ph H
1568 5,6-OCH20- CF3 CH2CH2-2-Pyridyl H
1569 5,6-OCH20- CF3 CH2CH2-3-Pyridyl H
1570 5,6-OCH20- CF3 CH2CH2-4-Pyridyl H
1571 5,6-OCH20- CF3 CH2CH2-2-furanyl H
or II or pharmaceutically acceptable salt form thereof.
In a fifth embodiment, the present invention provides a novel method of treating HIV infection which comprises administering, in combination, to a host in need thereof a therapeutically effective amount of:
(a) a compound of formula I or II; and, (b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV
protease inhibitors.
In another preferred embodiment, the reverse transcriptase inhibitor is selected from AZT, 3TC, ddI, ddC, d4T, delavirdine, TIBO derivatives, BI-RG-587, nevirapine, L-697,661, LY 73497, Ro 18,893, loviride, trovirdine, MKC-442, and HBY 097, and the protease inhibitor is selected from saquinavir, ritonavir, indinavir, VX-478, nelfinavir, KNI-272, CGP-61755, U-140690, and ABT-378.
In an even more preferred embodiment, the reverse transcriptase inhibitor is selected from AZT and 3TC and the protease inhibitor is selected from saquinavir, ritonavir, nelfinavir, and .indinavir.
In a still further preferred ebodiment, the reverse transcriptase inhibitor is AZT.
In another still further preferred embodiment, the protease inhibitor is indinavir.
In a sixth embodiment, the present invention provides a pharmaceutical kit useful for the treatment of HIV infection, which comprises a therapeutically effective amount of:
(a) a compound of formula I or II; and, (b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV
protease inhibitors, in one or more sterile containers.
In a seventh embodiment, the present invention provides a novel method of inhibiting HIV present in a body fluid sample which comprises treating the body fluid sample with an effective amount of a compound of formula I or II.
In a eighth embodiment, the present invention to provides a novel a kit or container comprising a compound of formula I or II in an amount effective for use as a standard or reagent in a test or assay for determining the ability of a potential pharmaceutical to inhibit HIV reverse transcriptase, HIV growth, or both.
DEFINITIONS
As used herein, the following terms and expressions have the indicated meanings. It will be appreciated that the compounds of the present invention contain an asymmetrically substituted carbon atom, and may be isolated in optically active or racemic forms. It is well known in the art how to prepare optically active forms, such as by resolution of racemic forms or by synthesis, from optically active starting materials. All chiral, diastereomeric, racemic forms and all geometric isomeric forms of a structure are intended, unless the specific stereochemistry or isomer form is specifically indicated.
The processes of the present invention are contemplated to be practiced on at least a multigram scale, kilogram scale, multikilogram scale, or industrial scale. Multigram scale, as used herein, is preferably the scale wherein at least one starting material is present in 10 grams or mare, more preferably at least 50 grams or more, even more preferably at least 100 grams or more. Multikilogram scale, as used herein, is intended to mean the scale wherein more than one kilogram of at least one starting material is used.
Industrial scale as used herein is intended to mean a scale which is other than a laboratory scale and which is sufficient to supply product sufficient for either clinical tests or distribution to consumers.
As used herein, "alkyl" is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms. Examples of alkyl include, but are not limited to, methyl, ethyl, n-propyl, i-propyl, n-butyl, s-butyl, t-butyl, n-pentyl, and s-pentyl. "Haloalkyl" is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms, substituted with 1 or more halogen (for example -CVFW where v = 1 to 3 and w = 1 to (2v+1)). Examples of haloalkyi include, but are not limited to, trifluoromethyl, trichloromethyl, pentafluoroethyl, and pentachloroethyl. "Alkoxy" represents an alkyl group as defined above with the indicated number of carbon atoms attached through an oxygen bridge. Examples of alkoxy include, but are not limited to, methoxy, ethoxy, n-propoxy, i-propoxy, n-butoxy, s-butoxy, t-butoxy, n-pentoxy, and s-pentoxy. "Cycloalkyi" is intended to include saturated ring groups, such as cyclopropyl, cyclobutyl, or cyclopentyl.
Alkenyl" is intended to include hydrocarbon chains of either a straight or branched configuration and one or more unsaturated carbon-carbon bonds which may occur in any stable point along the chain, such as ethenyl, propenyl and the like. "Alkynyl" is intended to include hydrocarbon chains of either a straight or branched configuration and one or more triple carbon-carbon bonds which may occur in any stable point along the chain, such as ethynyl, propynyl and the like.
"Halo" or "halogen" as used herein refers to fluoro, chloro, bromo and iodo. "Counterion" is used to represent a small, negatively charged species such as chloride, bromide, hydroxide, acetate, sulfate and the like.
As used herein, "aryl" or "aromatic residue" is intended to mean an aromatic moiety containing the specified number of carbon atoms, such as phenyl or naphthyl. As used herein, "carbocycle" or "carbocyclic residue" is intended to mean any stable 3- to 5- membered monocyclic ring, which may be saturated or partially unsaturated. Examples of such carbocyles include, but are not limited to, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, biphenyl, naphthyl, indanyl, adamantyl, or tetrahydronaphthyl (tetralin).
As used herein, the term "heterocycle" or "heterocyclic system" is intended to mean a stab7,e 5- to 6- membered monocyclic heterocyclic ring which is saturated partially unsaturated or unsaturated (aromatic), and which consists of carbon atoms and from 1 to 3 heteroatoms independently selected from the group consisting of N, O and S. The nitrogen and sulfur heteroatoms may optionally be oxidized.
The heterocyclic ring may be attached to its pendant group at any heteroatom or carbon atom which results in a stable structure. The heterocyclic rings described herein may be substituted on carbon or on a nitrogen atom if the resulting compound is stable. If specifically noted, a nitrogen in the heterocycle may optionally be quaternized. It is preferred that when the total number of S and O atoms in the heterocycle exceeds 1, then these heteroatoms are not adjacent to one another. It is preferred that the total number of S and.0 atoms in the heterocycle is not more than 1. As used herein, the term "aromatic heterocyclic system"
is intended to mean a stable 5- to 6- membered monocyclic heterocyclic aromatic ring which consists of carbon atoms and from 1 to 3 heterotams independently selected from the group consisting of N, O and S. It is preferred that the total number of S and O atoms in the aromatic heterocycle is not more than 1.
Examples of heterocycles include, but are not limited to, 2-pyrrolidonyl, 2H-pyrrolyl, 4-piperidonyl, 6H-1,2,5-thiadiazinyl, 2H,6H-1,5,2-dithiazinyl, furanyl, furazanyl, imidazolidinyl, imidazolinyl, imidazolyl, isoxazolyl, morpholinyl, oxadiazolyl, 2,2,3-oxadiazolyl, 1,2,4-oxadiazolyl, 1,2,5-oxadiazolyl, 1,3,4-oxadiazolyl, oxazolidinyl., oxazolyl, piperazinyl, piperidinyl, 20 pteridinyl, piperidonyl, 4-piperidonyl, pteridinyl, purinyl, pyranyl, pyrazinyl, pyrazolidinyl, pyrazolinyl, pyrazolyl, pyridazinyl, pyridinyl, pyridyl, pyrimidinyl, pyrrolidinyl, pyrrolinyl, pyrrolyl, tetrahydrofuranyl, 6H-1,2,5-thiadiazinyl, 1,2,3-thiadiazolyl, 1,2,4-thiadiazolyl, 1,2,5-thiadiazolyl, 1,3,4-thiadiazolyl, thiazolyl, thienyl, thienothiazolyl, thienooxazolyl, thienoimidazolyl, thiophenyl, triazinyl, 1,2,3-triazolyl, 1,2,4-triazolyl, 1,2,5-triazolyl, and 1,3,4-triazolyl. Preferred heterocycles include, but are not limited to, pyridinyl, furanyl, thienyl, pyrrolyl, pyrazolyl, imidazolyl, and oxazolidinyl. Also included are fused ring and spiro compounds containing, for example, the above heterocycles.
As used herein, "HIV reverse transcriptase inhibitor" is intended to refer to both nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT). Examples of nucleoside RT inhibitors include, but are not limited to, AZT, ddC, ddI, d4T, and 3TC. Examples of non-nucleoside RT
inhibitors include, but are no limited to, delavirdine (Pharmacia and Upjohn U901525), TIBO derivatives, BI-RG-587, nevirapine (Boehringer Ingelheim), L-697,661, LY 73497, Ro 18,893 (Roche), loviride (Janssen), trovirdine (Lilly), MKC-442 (Triangle), .and HBY 097 (Hoechst).
. As used herein, "HIV protease inhibitor" is intended to refer to compounds which inhibit HIV protease. Examples include, but are not limited, saquinavir (Roche, Ro31-8959), ritonavir (Abbott, ABT-538), indinavir (Merck, MK-639), VX-478 (Vertex/Glaxo wellcome), nelfinavir (Agouron, AG-1343), KNI-272 (Japan Energy), CGP-61755 (Ciba-Geigy), U-140690 (Pharmacia and Upjohn), and ABT-378. Additional examples include the cyclic protease inhibitors disclosed in W093/07128, WO 94/19329, WO 94/22840, and PCT Application Number US96/03426.
As used herein, "pharmaceutically acceptable salts"
refer to derivatives of the disclosed compounds wherein the parent compound is modified by making acid or base salts thereof. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like. The pharmaceutically acceptable salts include the conventional non-toxic salts or the quaternary ammonium salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. For example, such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like; and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, malefic, hydroxymaleic, phenylacetic, giutamic, benzoic, salicylic, sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, and the like.
The pharmaceutically acceptable salts of the present invention can be synthesized from the parent compound which contains a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two;
generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. Lists of suitable salts are found in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, PA, 1985, p. 1418, the disclosure of which is hereby incorporated by reference.
The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication commensurate with a reasonable benefit/risk ratio.
"Prodrugs" are intended to include any covalently bonded carriers which release the active parent drug according to formula (I) or other formulas or compounds of the present invention in vivo when such prodrug is administered to a mammalian subject. Prodrugs of a compound of the present invention, for example formula (I), are prepared by modifying functional groups present in the compound in such a way that the modifications are cleaved, either in routine manipulation or in vivo, to the parent compound. Prodrugs include compounds of the present invention wherein the hydroxy or amino group is bonded to any group that, when the prodrug is administered to a mammalian subject, cleaves to form a free hydroxyl or free amino, respectively. Examples of prodrugs include, but are not limited to, acetate, forrnate and benzoate derivatives of alcohol and amine functional groups in the compounds of the present invention, and the like.
"Stable compound" and "stable structure" are meant to indicate a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and formulation into an efficacious therapeutic agent. Only stable compounds are contempleted by the present invention.
"Substituted" is intended to indicate that one or more hydrogens on the atom indicated in the expression using "substituted" is replaced with a selection from the indicated group(s), provided that the indicated atom's normal valency is not exceeded, and that the substitution results in a stable compound. When a substituent is keto (i.e., =O) group, then 2 hydrogens on the atom are replaced.
WO 98/4527b PCT/US98/06733 "Therapeutically effective amount" is intended to include an amount of a compound of the present invention or an amount of the combination of compounds claimed effective to inhibit HIV infection or treat the symptoms of HIV
infection in a host. The combination of compounds is preferably a synergistic combination. Synergy, as described for example by Chou and Talalay, Adv. Enzyme Regul. 22:27-55 (1984), occurs when the effect (in this case, inhibition of HIV replication) of the compounds when administered in combination is greater than the additive effect of the compounds when administered alone as a single agent. In general, a synergistic effect is most clearly demonstrated at suboptimal concentrations of the compounds. Synergy can be in terms of lower cytotoxicity, increased antiviral effect, or some other beneficial effect of the combination compared with the individual components.
SYNTHESIS
The compounds of the present invention can be prepared in a number of ways well known to one skilled in the art of organic synthesis. The compounds of the present invention can be synthesized using the methods described below, together with synthetic methods known in the art of synthetic organic chemistry, or variations thereon as appreciated by those skilled in the art. Preferred methods include but are not limited to those methods described below. Each of the references cited below are hereby incorporated herein by reference.
WO 98/45276 PCTlUS98/06733 R3~\ COOH ~ ~CH3) OCH3 R\ \ V N..OCH3 NHZ
TMSC1, base R1 MgX
Scheme 1 illustrates a method of preparing keto-anilines from an appropriately substituted 2-aminobenzoic acid. The acid is converted to its N-methoxy-N-methyl amide derivative which can then be displaced to obtain the R1-substituted ketone. The keto-anilines are useful intermediates for the presently claimed compounds.
R\ I Me3CCOC1 I2 , NaHC03 \\
NaI-iC03 I ~ I / ~ NH
~2 ~2 O
n-BuLi I \ CF3 6N-HCl ~\ CF3 CF3 COZ Et ~ / NH2 O
Scheme 2 describes another method of preparing keto-anilines, this time from an appropriately substituted aniline. After iodination and amine protection, a group such as trifluoromethyl can be introduced using a strong base and ethyl trifluoroacetate. Deprotection provides the keto-aniline. Additional means of preparing keto-anilines are known to one of skill in the art, e.g, Houpis et al, Tetr.
Lett. 1994, 35(37), 6811-6814, the contents of which are 24 hereby incorporated herein by reference.
R~~ COOH HN ( CH3 ) OCH3 ~~~ CON ( OCH3 ) CH3 NH
2 NHz TrBr, DIPEA ~~ CON (OCH3 ) CH3 R~~ CHO
reduction z z N(H)Tr N(H)Tr CF3TMS, TBAF R\~ OH oxidation R\~ CF
THF / N(H)Tr / N(H)Tr Another method of making 2-trifluoroacetylanilines is shown in Scheme 3. After forming the protected aniline, the amide is then reduced and the trifluoromethyl group added.
Oxidation with an oxidant, such as Mn02, provides the useful intermediate.
a) TMSNCO 3 4 ~ mol.
DMAP/THF
vn R1 b) TBAF/T F ~ \ sieves / NH2 ~ ~ 0 R\ ~ ~ a. n-BuLi/HCCR4/THF
N b. BF3 ~OEtz N~O
H
Ei2 , Pd/C
NH
N~O
H
5_ Using the general method detailed in Scheme 4, one can prepare compounds of the present invention. Keto-aniline _1, which may be prepared by the methods desribed in Schemes 1 and 2, is treated with trimethylsilyl isocyanate in dry tetrahydofuran in the presence of dimethylaminopyridine followed by tetrabutylammonium fluoride to give the hydroxy-S urea 2. The hydroxy-urea 2 is then dehydrated with a dehydrating agent such as 4~1 molecular sieves in refluxing toluene or xylenes to give the ketimine 3. A substituted acetylenic R2 group is added by treating the ketimine 3 with a lithium acetylide, which is prepared in a separate vessel by reacting the corresponding substituted acetylene with n-butyllithium in dry tetrahydrofuran, to give the 4,4-disubstituted 3,4-dihydro-2(1H)-quinazolinone 4_, a compound of formula I. The acetylenic bond of the compound 4 may be reduced, e.g., by catalytic hydrogenation, to give the corresponding alkenyl group (not shown) or the saturated compound 5_.
Other R2 groups may also be introduced by directly reacting the imine 3_ with a lithiate RZLi or a Grignard reagent R2MgX in the presence or absence of Lewis acid catalyst, such as BF3 etherate. See also Huffman et al, J.
Org. Chem. 1995, 60, 1590-1594, the contents of which are hereby incorporated herein by reference.
In certain instances, one enantiomer of a compound of Formula I or II may display superior activity compared with the other. inlhen required, separation of the racemic material can be achieved by HPLC using a chiral column as exemplified in Examples 27-34 (Scheme 4) or by a resolution using a resolving agent such as camphonic chloride as in Thomas J.
Tucker, et al, J. Med. Chem. 1994, 3 7, 2437-2444. A chiral compound of Formula I may also be directly synthesized using a chiral catalyst or a chiral ligand, e.g. Mark A. Huffman, et al, J. Org. Chem. 1995, 60, 1590-1594.
Other features of the invention will become apparent in the course of the following descriptions of exemplary embodiments which are given for illustration of the invention and are not intended to be limiting thereof.
WO 9$/45276 PCTIUS98/06733 Examples Abbreviations used in the Examples are defined as follows: "°C" for degrees Celsius, "d" for doublet, "dd" for doublet of doublets, "eq" for equivalent or equivalents, "g"
for gram or grams, "mg" for milligram or milligrams, "mL" for milliliter or milliliters, "H" for hydrogen or hydrogens, "hr" for hour or hours, "m" for multiplet, "M" for molar, "min" for minute or minutes, "MHz" for megahertz, "MS" for mass spectroscopy, "nmr" or "NMR" for nuclear magnetic resonance spectroscopy, "t" for triplet, "TLC" for thin layer chromatography, "EDAC" for 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride, "DIPEA" for diisopropylethylamine, "TBAF" for tetrabutylammonium fluoride, "LAH" for lithium aluminium hydride, and "TEA" for triethylamine.
Examvle 1 Prepration of (+/-)-6-Chloro-4-cyclopropylethynyl-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (Rd _ Cyclopropyl) O a) TMSNCO CF3 OH
C1 DMAP/THF C1 PhCH3 T.1.
\CF3 b) TBAF/THF ~ \ \NH 4 A mol. sieves NH2 ~ ~~ o I-a II-a R4 Fg CF3 ~~
C1 a. THF/n-BuLi/HCCR4 C1 \ ~N b. BF3~OEtZ ~ \
N' '_ O
O H
III-a IV-a Step 1. Synthesis of II-a from I-a.
To a solution of compound I-a (4.55 g, 20.2 mmol) in anhydrous THF (40 mL) was added dimethylaminopyridine (0.25 g, 2.02 mmol) and trimethylsilyl isocyanate (6.05 g, 7.11 mL, 52.5 mmol). The mixture was stirred at room temperature for approximately 16 hours, then tetrabutylammonium fluoride (21 mL of 1 M solution in THF) was added. The thick slurry was diluted with additional THF (20 mL) and stirred at room temperature for 0.5 hours. The THF was removed under reduced S pressure, the residue was taken up in EtOAc (100 mL) and washed sequentially with I N HC1 (70 mL), saturated aqueous NaHC03 (70 mL) and saturated aqueous NaCl (50 mL). The organic phase was dried over MgS04, filtered and concentrated under reduced pressure to afford a light yellow solid. The yellow color was removed upon trituration with hexanes to afford IIa (5.09 g, 94~) as a white solid: 1H NMR (300 MHz, acetone-ds) 8 9.06 (br s, 1 H), 7.48 (s, 1 H), 7.40 (br s, 1 H), 7.34 (dd, J = 8.8, 2.6 Hz, 1 H), 6.97 (d, J = 8.8 Hz, 1 H); ~9F NMR (282 MHz, acetone-d6) 8 -86.33, -86.35; IR (KBr Pellet) 1724, 1678, 1398, 1198, 1174 cm-1; MS (CI) m/e 266 ( MH+ , 10 0 ) .
Step 2. Synthesis of III-a from II-a.
A suspension of II-a (5.09 g, 19.1 mmol) in toluene (150 mL) containing 4 ~ molecular sieves (approximately 100 mg) was heated at reflex for 16 hours. The resulting clear yellow solution was cooled to room temperature, the precipitated solids were dissolved in acetone and the molecular sieves were removed by vacuum filtration. The filtrate was concentrated under reduced pressure, and triturated with hexanes to afford III-a (4.25 g, 89g) as a yellow solid: 1H NN~ (300 N~iz, acetone-d6) 8 7.86-7.82 (m, 2 H), 7.61 (d, J = 8.8 Hz, 1 H); 19F NMR (282 MHz, acetone-d6) $
-67.88.
Step 3. Synthesis of IV-a from IIIa.
A solution of cyclopropylacetylene (13.0 mL of 30 wt~
solution in toluene/THF/hexanes, 59.0 mmol) in anhydrous THF
(118 mL) was cooled to -78 °C, treated with n-BuLi (32.8 mL
of 1.6 M solution in hexanes, 52.4 mmol), warmed to 0 °C in an ice bath, and aged for 0.5 h. To a solution of III-a (3.12 g, 12.6 mmol) in anhydrous THF (66 mL) at -78 °C was added the lithium acetylide over approximately 10 minutes.
To this was added boron trifluoride etherate (0.89 g, 0.80 mL, 6.28 rnmol), followed by removal of the cooling bath. The reaction was allowed to reach room temperature and stirred at room temperature for 4 hours before quenching with 1 M citric acid (100 mL). The mixture was concentrated under reduced pressure to 1/2 original volume, diluted with EtOAc (200 mL), the aqueous phase was removed and the organic phase was sequentially washed with saturated aqueous NaHC03 (100 mL), and saturated aqueous NaCl (100 mL). The organic phase was dried over MgS04, filtered and concentrated under reduced pressure. The crude material was purified by flash chromatography (3~ MeOH/CH2C12) to afford a thick yellow oil from which was obtained crystalline IV-a (R4 = cyclopropyl) (3.85 g, 97~) as a white solid: mp 86.6-88 °C; 1H NMR (300 MHz, acetone-d6) b 8.95 (br s, 1 H), 7.51 (br s, 1 H), 7.43 (br s, 1 H), 7.40 (dd, J = 8.8, 2.4 Hz, 1 H), 7.02 (d, J =
8.8 Hz, 1 H), 1.49-1.41 (m, 1 H), 0.93-0.82 (m, 1 H), 0.77-0.74 (m, 1 H); 19F NMR (282 MHz, acetone-d6) S -82.96; IR
(KBr Pellet) 1696, 1272 cm-1; MS (CI) m/e calc'd for C14H1oC1F3N20: 315.051201, found 315.051626; 315 (MH+, 51), 332 (M+NH4+, 100) ; Analysis calc'd for C14H10N2CIF30~0.25 H20:
C, 52.68; H, 3.32; N, 8.78; found: C, 52.61; H, 3.35;
N, 8.28.
Example 2 Preparation of (+/-)-6-Chloro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 -Isopropyl) A solution of III-a (50 mg, 0.201 mmol) was treated with the lithium acetylide derived from 3-methyl-1-butyne (62 mg, 93 mL, 0.905 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by flash chromatography (35~ EtOAc/hexanes) to afford 26mg (41$) of the desired product: 1H NMR (300 MHz, ) 8 9.08 (br s, 1 H), 7.59 (br s, 1 H), 7.53 (br s, 1 H), 7.40 (dd, J = 8.4, 2.2 Hz, 1 H), 7.02 (d, J = 8.8 Hz, 1 H), 2.81-2.68 (m, 1 H), 1.20 (dd, J = 6.6 Hz, 6H); 19F NMR (282 MHz, acetone-ds) b -83.05; MS (CI) m/e calc'd for C14H12C1F3N20: 317.066851, found 317.069433; 317 (MH+, 43), 334 (M+NH4+, 100).
Example 3 Preparation of (+/-)-5-Chloro-4-(2-pyridyl)ethynyl-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 2-Pyridyl) A solution of III-a (100 mg, 0.402 mmol) was treated with the the lithium acetylide derived from 2-ethynylpyridine (0.19 g, 1.81 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC
(2.5~ MeOH/CH2C12) to afford 85 mg (60~) of the desired product: mp 105 °C dec.; 1H NMR (300 MHz, acetone-d6) 8 9.14 (br s, 1 H), 8.64-8.61 (m, 1 H), 7.89-7.84 (m, 2 H), 7.70-7.66 (m, 2 H), 7.48-7.43 (m, 2 H), 7.09 (d, J = 8.8 Hz, 1 H);
19F NMR (282 MHz, acetone-d6) 8 -82.48; IR (KBr Pellet) 1704, 1430, 1286 cm 1; MS (CI) m/e calc'd for ClgHIoC1F3N30:
352.046450, found 352.046956; 352 (MH+, 100); Analysis calc'd for Cl6HgC1F3N30~0.125 H20: C, 54.3; H, 2.56; N, 11.9; found: C, 54.71; H, 3.03; N, 11.3.
Examule 4 Preparation of (+/-)-6-Chloro-4-ethylethynyl-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazoliaone (R4 _ Ethyl) A solution of III-a (100 mg, 0.402 mmol) was treated with the the lithium acetylide derived from 1-butyne (109 mg, 2.01 mmol) according to the procedure of Step 3 of Example 2.
The resulting crude material was purified by HPLC (2.5~
MeOH/CH2C12) to afford 79 mg (65~) of the desired product: 1H
NMR (300 MHz, acetone-d6) 8 9.05 (br s, 1 H), 7.54 (br s, 2 H), 7.41-7.39 (m, 1 H), 7.02 (d, J = 8.4 Hz, 1 H), 2.36-2.32 (m, 2 H), 2.18-1.23 (m, 3 H); 19F NMR (282 MHz, acetone-d6) 8 -82.99; MS (CI) m/e calc'd for C13H1oC1F3N20: 303.051201, found 303.051882; 303 (MH+, 55), 320 (M+NH4+, 100).
Example 5 Preparation of (+/-)-6-Chloro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(iH)-quinazolinone (R4 _ Phenyl) A solution of III-a (100 mg, 0.402 mmol) was treated with the the lithium acetylide derived from phenylacetylene (185 mg, 1.81 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC
(2.5~ MeOH/CH2C12) to afford 54 mg (38~) of the desired product: 1H NMR (300 MHz, acetone-d6) 8 9.07 (br s, 1 H), 7.74 (br s, 1 H), 7.67 (br s, 1 H), 7.62-7.58 (m, 2 H), 7.48-7.40 (m, 4H), 7.08 (d, J = 8.4 Hz, 1 H); 19F NMR (282 MHz, acetone-d6) S -82.67; IR (KBr Pellet) 1696, 1186 cm-1; MS
(CI) m/e calc'd for C17H11C1F3N20: 351.051201, found 351.051704; 351 (MH+, 51), 368 (M+NH4+,100); Analysis calc'd for Cl~HIpC1F3N20~0.25 H20: C, 57.48; H, 2.98; N, 7.89;
found: C, 57.00; H, 3.03; N, 7.48.
Example 6 Preparation of (+/-)-4-Cyclopropylethynyl-6-methoxy-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (Ra _ Cyclopropyl) Me ~ a ) TMSNCO Me PhCH3 T.~
~CF3 DMpP/,hHF~ ~ ~ ~ 4 ~. mol. sieves b) TBAF/THF
NHz N O
H R°
V-a VI-a CF3 F3 ~~
Me ~ ~ a. THF/n-BuLi/HCCR4 Me N b. BFg~OEtz 'O
H~ O
VII-a VIII-a Step 1. Synthesis of VI-a from V-a.
A solution of V-a (0.50 g, 2.28 mmol) was treated with dimethylaminopyridine and trimethylsilyl isocyanate as described in Step 1 of Example 1 to afford 0.58 g (97~) of the desired product: 1H NMR (300 MHz, acetone-d6) b 8.81 (br s, 1 H), 7.17 (br s, 1 H), 7.11 (br s, 1 H), 7.00-5.92 (m, 2 H), 6.83 (s, 1 H), 3.76 (s, 3 H); ~9F NMR (282 MHz, acetone-d6) S -85.99.
Step 2. Synthesis of VII-a from VI-a.
A solution of VI-a (0.58 g, 2.21 mmol) was heated in toluene at reflux as described in Step 2 of Example 1 to afford 0.50 g (93~) of the desired product: 1H NMR (300 MHz, acetone-d6) 8 7.52 (br s, 2 H), 7.27 (s, 1 H), 3.90 (s, 3 H);
19F NMR (282 MHz, acetone-d6) 8 -68.08.
Step 3. Synthesis of VIII-a from VII-a.
A solution of VII-a (100 mg, 0.410 mmol) was treated with the the lithium acetylide derived from cyclopropylacetylene (0.41 mL of 30 wt~ solution in toluene/THF/hexanes, 1.85 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5~ MeOH/CH2C12) to afford 103 mg (81~) of the desired product: 1H NNgt (300 MHz, acetone-d6) 8 8.77 (br s, 1 H), 7.29 (br s, 1 H), 7.06 (br s, 1 H), 6.99-6.90 (m, 2 H), 3.77 (s, 3 H), 1.46-1.38 (m, 1 H), 0.91-0.85 (m, 2 H), 0.79-0.72 (m, 2 H); I9F NMR (282 MHz, acetone-d6) 8 -82.61;
MS (CI) mle calc'd for C15H14F3N2~2: 311.100738, found 311.099970; 311 (MH+, 100).
Example 7 Preparation of (+/-)-4-Isopropyiethynyl-6-methoxy-4 trifluoromethyl-3,4-dihydro-2(2H)-quinazolinone (R4 _ Isopropyl) A solution of VII-a (100 mg, 0.410 mmol) was treated with the the lithium acetylide derived from 3-methyl-1-butyne (126 mg, 0.29 mL, 1.85 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by flash chromatography (2.5~ MeOH/CHZC12) to afford 30 mg (24~) of the desired product: mp 228-229 °C; 1H NMR
(300 MHz, acetone-ds) S 8.72 (br s, 1 H), 7.27 (br s, 1 H), 7.10 (br s, 1 H), 7.00-6.91 (m, 2 H), 3.77 (s, 3 H), 2.73-2.67 (m, 1 H), 1.20 (dd, J = 7.0, 1.5 Hz, 6 H); 19F NMR (282 MHz, acetone-d6) 8 -82.71; IR (KBr Pellet) 1696, 1428, 1190, 1176 cm'I; MS (CI) m/e calc'd for C15H1sF3N2O2: 313.116388, found 313.115871; 313 (MH~~ 100), 330 (M+NH4+, 15); Analysis calc'd for C15H15F3N2O2: C, 57.69; H, 4.84; N, 8.97;
found: C, 57.74; H, 5.01; N, 8.57.
Example 8 Preparation of (+/-)-6-Methoxy-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 2-Pyridyl) A solution of VII-a (100 mg, 0.410 mmol) was treated with the the lithium acetylide derived from 2-ethynylpyridine (0.19 g, 1.85 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by flash chromatography (2.5~ MeOH/CH2C12) to afford 56 mg (39~) of the desired product: 1H NMR (300 MHz, acetone-d6) 8 8.81 (br s, 1 H), 8.6.1 (d, J = 4.8 Hz, 1 H), 7.88-7.82 (m, 1 H), 7.66 (d, J = 7.7 Hz, 1 H), 7.61 (br s, 1 H), 7.46-7.42 (m, 1 H), 7.23 (br s, 1 H), 7.06-6.97 (m, 2 H), 3.79 (s, 3 H); 19F
NMR (282 MHz, acetone-d6) 8 -82.13; IR (KBr Pellet) 1698, 1518, 1464, 1430, 1244, 1208, 1184 cm-1; MS (CI) mle calc'd for C17H13F3N302: 348.095987, found 348.095629; 348 (MEIt, 100); Analysis calc'd for C1~H12F3N302~0.25 C3H60: C, 58.92;
H, 3.76; N, 11.61; found: C, 59.38; H, 4.04; N, 11.35.
Example 9 Preparation of (+/-)-6-Methoxy-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinoae (Rd -Phenyl) A solution of VII-a (100 mg, 0.410 mmol) was treated 30 with the the lithium acetylide derived from phenylacetylene (0.19 g, 1.85 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by flash chromatography (2.5~ MeOH/CH2C12) to afford 34 mg (24~) of the desired product. mp 206.2-207.7 °C; 1H NMR (300 MHz, acetone-d6) 8 8.85 (br s, 1 H), 7.60-7.57 (m, 3 H), 7.49-7.39 (m, 3 H), 7.21 (br s, 1 H), 7.05-6.96 (m, 2H), 3.79 (s, 3 H);
19F NMR (282 MHz, acetone-d6) b -82.32; IR (KBr Pellet) 1696, 1516, 1430, 1236, 1204, 11$4, 1128 cm-1; MS (CI) m/e calc'd for ClgH~4F3N202: 347.100738, found 347.101482; 347 (Ngi+, 100), 364 (M+NH4+, 48); Analysis calc'd for C1gH13F3N202: C, 62.43; H, 3.78; N, 8.10; found: C, 62.35; H, 3.58; N, 7.83.
Example 10 Preparation of (+/-)-4-Cyclopropylethynyl-5,6 difluoro-4-trifluoromethyl-3,4-dihydro-2(1H) quiaazolinoae (R4 - Cyclopropyl) a) TMSNCO F ~ Xylenes T.~ F
F ~NH N
W
\CF3 DMAP/THF
b) TBAF/THF ~ / N~ O
NH2 H ~~ O
IX-a X-a XI-a a. THF/n-BuLi/HCCR' 10$ Pd/C F F3 b. BF3~OEtz F EtOH/EtOAc) F I ~ NH
N_ '_ O
H
XIII-a XII-a Step 1. Synthesis of X-a from IX-a.
A solution of IX-a (6.46 g, 28.7 mmol) was treated with dimethylaminopyridine and trimethylsilyl isocyanate as described in Step 1 of Example 1 to afford 6.74 g (88~) of the desired product: 1H NMR (300 MHz, acetone-d6) 8 9.13 (br s, 1 H), 7.45-7.32 (m, 2 H), 7.18 (br s, 1 H), 6.85-6.80 (m, 1 H); 19F NMR (282 MHz, acetone-d6) 8 -86.6 (d, 17.2, 3), -137.52-137.68 (m, 1), -148.47-148.59 (m, 1).
Step 2. Synthesis of XI-a from X-a.
A solution of X-a (6.74 g, 25.1 mmol) was heated in xylenes at reflux as described in Step 2 of Example 1, substituting xylenes for toluene, to afford 6.3 g (100$) of the desired product: 1H NMR (300 MHz, acetone-d6) b 7.92-7.83 (m, 1 H), 7.46-7.44 (m, 1 H); 19F NMR (282 MHz, acetone-d6) 8 -70.7 (d, 38.7, 3), -136.72 (s, 1), -246.47-146.57 (m, 1).
Step 3. Synthesis of XII-a from XI-a.
A solution of XI-a (6.28 g, 25.1 mmol) was treated with the the lithium acetylide derived from cyclopropylacetylene (24.9 mL of 30 wt~ solution in toluene/THF/hexanes, 0.113 mol) according to the procedure of Step 3 of Example 1. The resulting crude yellow oil was dissolved in acetone and concentrated under reduced pressure to deliver a yellow solid. Crystallization from acetone afforded 5.98 g (75~) of the desired material: mp 86.5-88.5 °C; 1H NMR (300 MHz, acetone-d6) 8 9.01 (br s, 1 H), 7.46 (br s, 1 H), 7.44-7.35 (m, 1 H), 6.86-6.8I (m, 1 H), 1.41-1.37 (m, 1 H), 0.90-0.83 (m, 1 H), 0.74-0.69 (m, 1 H); 1gF NI~ (282 MHz, acetone-d6) $
-83.3 (d, J = 12.9, 1), -136.04-136.23 (m, 1), -148.14-148.26 (m, 1); IR (KBr Pellet) 1706, 1516, 1442, 1246, 1214, 1196 cm-1; MS (CI) rrtle calc'd for Cl4H~pF5NZ0: 317.071329, found 317.070836; 317 (MH+, 100), 334 (M+NH4+, 62); Analysis calc'd for C14H9F5N20: C, 53.17; H, 2.88; N, 8.87; found:
C, 53.30; H, 3.16; N, 8.53.
Example 11 Preparation of (+/-y-5,6-Difluoro-4-isopropylethynyl 4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 - Isopropyl) A solution of XI-a (7.24 g, 28.9 mmol) was treated with the the lithium acetylide derived from 3-methyl-1-butyne (8.87 g, 13.3 mL, 0.130 mol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by flash chromatography (2.5~ MeCH/CH2C12) to afford a yellow oil. Crystallization from acetone afforded 6.77 g (74~) of the desired product: mp 79-80 °C; 1H NMR (300 MHz, acetone-d6) $ 9.02 (br s, 1 H), 7.50 (br s, 1 H), 7.44-7.35 (m, 1 H), 6.87-6.82 (m, 1 H), 2.69-2.65 (m, 1 H), 1.17 (d, J
- 7.0 Hz, 6H); 19F NMR (282 MHz, acetone-d6) 8 -83.4 (d, J =
12.9, 1), -135.79-135.94 (m, 1), -148.14-148.26 (m, 1); MS
(CI) m/e calc'd for C14H12F5N20: 319.086979, found 319.087376; 319 (MH+, 100), 336 (M+NH4+, 76).
Exam~Le I2 Preparation of (+/-)-5,6-Difluoro-4-(2 pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(1H) quinazoliaone (R4 - 2-Pyridyl) A solution of XI-a (100 mg, 0.400 mmol) was treated with the the lithium acetylide derived from 2-ethynylpyridine (0.19 g, 1.80 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by flash chromatography (4~ MeOH/CHZC12) to afford 83 mg (59g) of the desired product: rnp 219-220 °C; 1H NMR (300 MHz, acetone-d6) 8 9.15 (br s, 1 H), 8.61 (d, J = 4.4 Hz, 1 H), 7.88-7.82 (m, 2H), 7.63 (dd, J = 7.0, 1.1 Hz, 1 H), 7.47-7.42 (m, 2H), 6.94-6.88 (m, 1 H); 19F NMR (282 MHz, acetone-d6) 8 -82.8 (d, J = 12.9, 3), -135.78-135.93 (m, 1), -147.86-147.98 (m, 1);
IR (KBr Pellet) 1712, 1470, 1450, 1430, 1416, 1264, 1238, 1226, 1198, 1186 cm-1; MS (CI) m/e calc'd for ClgHgF5N30:
354.066578, found 354.067821; 354 (MH+, 100).
Examble 13 Preparation of (+/-)-5,6-Difluoro-4-ethylethynyl-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 _ 2-Ethyl) A solution of XI-a (100 mg, 0.400 mmol) was treated with the the lithium acetylide derived from 1-butyne (97 mg, 1.80 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5~
MeOH/CH2C12) to afford 69 mg (57~) of the desired product: mp 191-194 °C; 1H NMR (300 MHz, acetone-d6) 8 9.03 (br s, 1 H), 7.50 (br s, 1 H), 7.45-7.35 (m, 1 H), 6.87-6.82 (m, 1 H), 2.34-2.27 (m, 2H), 1.20-1.15 (m, 3 H); 19F NMR (282 MHz, acetone-d6) 8 -83.3 (d, J = 12.9, 3), -135.79-135.98 (m, 1), -148.16-148.29 (m, 1); IR (KBr Pellet) 1704, 1686, 1518, 1444, 1244, 1210, 1192, 1172 cm-1; MS (CI) m/e calc'd for C13H1oF5N2~~ 305.071329, found 305.071146; 305 (MH+, 100);
Analysis calc'd for Cl3HgF5N20: C, 51.33; H, 2.98; N, 9.22;
found: C, 52.00; H, 2.79; N, 8.99.
WO 98/45276 PCTlUS98/06733 ~:xamnle 14 Preparation of (+/-)-5,6-Difluoro-4-phenylethynyl-4 trifluoromethyl-3,4-dihydro-2(1H)-quiaazolinone (Ra Phenyl) A solution of XI-a (100 mg, 0.400 mmol) was treated with the the lithium acetylide derived from phenylacetylene (0.18 g, 0.20 mL, 1.80 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5~ MeOH/CH2C12) to afford 92 mg (65~) of the desired product: 1H NMR (300 MHz, acetone-d6) S 9.14 (br s, 1 H), 7.80 (br s, 1 H), 7.57-7.54 (m, 2H), 7.49-7.40 (m, 4H), 6.92-6.87 (m, 1 H); 19F NMR (282 MHz, acetone-d6) 8 -83.0 (d, J =
12.9, 3), -136.08-136.27 (m, 1), -147.87-148.00 (m, 1); MS
(CI) m/e calc'd for Cl~HIpF5N20: 353.071329, found 353.071716; 353 (MH+, 42), 370 (M+NH4+, 100).
Examflle 15 Preparation of (+/-)-5,6-Difluoro-4-isopentyl-4-trifluoromethyl-3,4-dihydro-2(iH)-quinazolinone (R4 -Isopropyl) Synthesis of XIII-a from XII-a.
A solution of XIII-a (R4 = isopropyl) (26 mg, 82 mmol) in ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10~ Pd on carbon (35 mg) under H2 (1 atm) for 16 hours. The catalyst was removed by vacuum filtration through Celite and the filter cake was washed with EtOAc. The combined filtrates were concentrated under reduced pressure to afford 26 mg (1000 of the desired material. No further purification was necessary: 1H NMR (300 MHz, acetone-d6) 8 8.88 (br s, 1 H), 7.41-7.31 (m, 1 H), 6.89-6.81 (m, 2H), 2.55-2.50 (m, 1 H), 1.64-1.45 (m, 2H), 1.06-1.02 (m, 1 H), 0.89 (dd, J = 6.6, 2.2 Hz, 6H); 19F NMR (282 MHz, acetone-d6) 8 -83.22 (d, J = 12.1, 3), -138.97-139.13 (m, 1), -148.46-148.58 (m, 1); IR (KBr Pellet) 1700, 1678, 1518, 1438, 1252, 1188, 1172 cm-I; MS
(CI) mle calc'd for C14H1sF5N2~: 323.118280, found 323.116703; 323 (MH+, 100), 340 (M+NH4+, 57).
Example 16 Preparation of (+/-)-4-Butyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 -Ethyl) A solution of XIII-a (R4 = ethyl) (20 mg, 66 mmol) in ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10~ Pd on carbon under H2 according to the procedure of Example 15.
Purification by HPLC (2.5~ MeOH/CH2C12) afforded 12 mg (56~) of the desired product: 1H NMft (300 MHz, acetone-d6) b 8.89 (br s, 1 H), 7.41-7.32 (m, 1 H), 6.86-6.81 (m, 2H), 2.57-2.47 (m, 1 H) , 1.56-1.15 (m, 5H) , 0.88 (t, J = 7.3 Hz, 3 H) ; 19F
NMR (282 MHz, acetone-d6) 8 -83.19-83.24 (m, 1), -139.14 (s, 1), -148.49-148.62 (m, 1); MS (CI) m/e calc'd for C~3H14F5N20: 309.102629, found 309.103555; 309 (MH+, 100), 326 (M+NH4+, 62).
Example 17 Preparation of (+/-)-4-Cyclopropylethynyl-6-fluoro-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 Cyclopropyl) F a) TMSNCO F F
DMAP/THF
Toluene T~. ~ _N
CFA /
/ NH b ~ TBAF / THF / N/~ O ~ 0 z H
XIV-a XV-a XVI-a Ra a. THF/n-HuLi/HCCR° F3 10$ Pd/C
b. BF3-OEtz F ~ EtOH/EtOAc) F
/ ~ ~ O
XVIII-a XVII-a n-BuLi/0 °C ~ \ \ NH
XVI-a ~
/ NI '-O
H
XIX-a Step 1. Synthesis of XV-a from XIV-a.
A solution of XIII-a (3.07 g, I4.8 mmol) was treated with dimethylaminopyridine and trimethylsilyl isocyanate as described in Step 1 of Example 1 to afford 2.81 g (76~) of the desired product.
Step 2. Synthesis of XVI-a from XV-a.
A solution of XV-a (6.74 g, 25.1 mmol) was heated in toluene at reflex as described in Step 2 of Example 1 to afford 0.73 g (94~) of the desired product.
Step 3. Synthesis of XVII-a from XVI-a.
A solution of XVI-a (100 mg, 0.431 mmol) was treated with the the lithium acetylide derived from cyclopropylacetylene (1.43 mL of 30 wt~ solution in toluene/THF/hexanes, 1.94 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5~ MeOH/CHZC12) to afford 44 mg (34~) of the des fired produc t : mp 15 5 °C ; 1H NMR ( 3 0 0 Ng-iz , acetone-d6 ) 8 8.86 (br s, 2 H), 7.36 (br s, 1 H), 7.30-7.27 (m, 1 H), 7.22-7.15 (m, 1 H), 7.04-6.99 (m, 1 H), 1.47-1.42 (m, 1 H), 0.90-0.87 (m, 2 H), 0.76-0.75 (m, 2 H); 19F NMR (282 MHz, acetone-d6) S -82.86, -123.36-123.44; MS (CI) m/e calc'd for C14H11F4N20: 299.080751, found 299.079976; 299 (MH+, 100).
Example I8 Preparation of (+/-)-6-Fluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 _ Isopropyl) A solution of XVI-a (100 mg, 0.431 mmol) was treated with the the lithium acetylide derived from 3-methyl-1-butyne (0.13 g, 0.20 mL, 1.94 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5~ MeOH/CH2C12) to afford 24 mg (18~) of the desired product: mp 158 °C; 1H NMR (300 MHz, acetone-d6) S 9.07 (br s, 1 H), 7.60 (br s, 1 H), 7.32-7.30 (m, 1 H), 7.24-7.16 (m, 1 H), 7.05-6.99 (m, 1 H), 2.77-2.67 (m, 1 H), 1.20 (dd, J = 7.0, 2.6 Hz, 6H); 19F NMR (282 MHz, acetone-d6) b -82.95, -123.41-123.49; MS (301) m/e calc'd for ClqH~3F4N20: 301.096401, found 301.096235; 301 (MH+, 100).
Examale 19 Preparation of (+/-)-6-Fluoro-4-(2-pyridyl)ethynyl-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (Ra _ 2-Pyridyl) A solution of XVI-a (100 mg, 0.431 mmol) was treated with the the lithium acetylide derived from 2-ethynylpyridine (0.20 g, 1.94 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC
(2.5~ MeOH/CH2C12) to afford 65 mg (45~) of the desired product: rnp 155 °C; 1H NMR (300 MHz, acetone-d6) 8 9.02 (br s, 1 H), 8.60 (d, J = 4.0 Hz, 1 H), 7.8?-7.78 (m, 2 H), 7.66 (d, J = 7.7 Hz, 1 H), 7.45-7.41 (m, 2 H), 7.26-7.20 (m, 1 H), 7.09-7.05 (m, 1 H); ~9F NMR (282 MHz, acetone-dg) b -82.36, -122.94-123.02; MS (CI) m/e calc'd for C16H1oF4N30~
336.076000, found 336.074156; 336 (MH+, 25).
Example 20 Preparation of (+/-)-6-Fluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 Ethyl) A solution of XVI-a (100 mg, 0.431 mmol) was treated with the the lithium acetylide derived from 1-butyne (0.10 g, 1.94 mmol) according to the procedure of Step 3 of Example 1.
The resulting crude material was purified by HPLC (2.5~
MeOH/CH2C12) to afford 40 mg (33~) of the desired product: mp 190 °C; 1H NMR (300 MHz, acetone-d6) b 8.86 (br s, 1 H), 7.38 (br s, 1 H), 7.34-7.31 (m, 1 H), 7.22-7.16 (m, 1 H), 7.05-7.00 (m, 1 H), 2.04-2.01 (m, 2 H), 1.19-1.14 (m, 3 H); 19F
IVMR (282 MHz, acetone-d6) 8 -75.392, -123.42-123.50; MS (CI) m/e calc'd for C13H11F4N20~ 287.080751, found 287.080740;
287 (MH+, 100) .
Examvle 21 Preparation of (+/-)-6-Fluoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(iH)-quinazolinone (R4 _ Phenyl) A solution.of XVI-a (100 mg, 0.431 mmol) was treated with the the lithium acetylide derived from phenylacetylene (0.20 g, 0.21 mL, 1.94 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5~ MeOH/CH2C12) to afford 41 mg (28~) of the desired product: mp 107 °C; 1H NMR (300 MHz, acetone-d6) 8 9.00 (br s, 1 H), 7.69 (br s, I H), 7.63-7.59 (m, 2 H), 7.50-7.40 (m, 4H), 7.27-7.20 (m, 1 H), 7.10-7.05 (m, 1 H);
19F NMR (282 MHz, acetone-d6) 8 -82.56, -122.99-123.07; MS
(CI) m/e calc'd for C17H11F4N2O: 335.080751, found 335.082057; 335 (MH+, 74), 352 (M+NH4+, 100).
Example 22 Preparation of (+/-)-6-Fluoro-4-isopentyl-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 _ Isopropyl) Synthesis of XVIII-a from XVII-a.
A solution of XVII-a (R4 = isopropyl) (26 mg, 87 mmol) in ethanol (1 mL) and EtOAc (0.5 mL) was treated with 20~ Pd on carbon under HZ according to the procedure of Example 15 to afford 15 mg (58~) of the desired product. No further purification was necessary: mp 179 °C; 1H NMR (300 Ngiz, acetone-d6) 8 7.02-6.97 (m, 2 H), 6.80-6.76 (m, 1 H), 2.18-2.09 (m, 2 H), 1.92-1.82 (m, 2 H), 1.52-1.45 (m, 1 H), 0.88-0.79 (m, 6 H); 19F NMR (282 MHz, acetone-d6) 8 -82.60, -123.72-123.84; MS (CI) m/e calc'd for C14H1~F4N20:
305.127707, found 305.126790; 305 (MH+, 100).
Examale 23 Preparation of (+/-)-6-Fluoro-4-(2'-2-pyridyl)ethyl-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 _ 2-Pyridyl) A solution of XVII-a (R~ = 2-pyridyl) (33 mg, 99 mmol) in ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10$ Pd on carbon under H2 according to the procedure of Example 15 to afford 10 mg (30.x) of the desired product. No further purification was necessary: mp 88 °C; 1H NMR {300 MHz, acetone-d6) 8 8.35 (d, J = 4.4 Hz, 1 H), 7.63 (dt, J = 7.7, 1.5 Hz, 1 H), 7.20-7.13 (m, 3 H), 7.04-6.98 {m, 1 H), 6.83-6.79 (m, 1 H), 2.84-2.78 (m, 1 H), 2.68-2.48 (m, 2 H), 2.27-2.06 (m, 1 H); 29F NMR (282 MHz, acetone-d6) 8 -82.58, WO 98/4527b PCT/US98/06733 -123.26-123.34; MS (CI) m/e calc'd for C16H14F'4N3~=
340.107300, found 340.107719; 340 (MH+, 100).
Examflle 24 Preparation of (+/-)-4-Hutyl-fi-fluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 _ Ethyl) A solution of XVII-a (R4 = ethyl) (24 mg, 84 mmol) in ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10~ Pd on carbon under H2 according to the procedure of Example 15 to afford 24 mg (1000 of the desired product. No further purification was necessary: mp 198 °C; 1H NMR (300 MHz, acetone-d6) 8 7.03-6.97 (m, 2 H), 6.80-6.76 (m, 1 H), 2.18-2.11 (m, 1 H), 1.90-1.81 (m, 1 H), 1.30-1.19 (m, 3 H), 0.97-0.80 (m, 4 H); 19F NMR (282 MHz, acetone-d6) b -82.692, -123.78-123.86; MS (CI) m/e calc'd for C13H15F4N2O:
291.112051, found 291.112227; 291 (MH+, 100).
Example 25 Preparation of (+/-)-6-Fluoro-4-pheaylethyl-4 trifluoromethyl-3,4-dihydro-2(iH)-quinazolinone (Ra _ Phenyl) A solution of XVII-a (R4 = phenyl) (30 mg, 90 mmol) in ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10~ Pd on carbon under H2 according to the procedure of Example 15 to afford 20 mg (67~) of the desired product. No further purification was necessary: mp 98 °C; 1H NMR (300 MHz, acetone-d6) 8 7.18-6.99 (m, 7H), 6.84-6.79 (m, 1 H), 2.68-2.60 (m, 1 H), 2.48-2.12 (m, 3 H); 19F NMR (282 MHz, acetone-d6) 8 -82.67, -123.24-.123.32; MS (CI) m/e calc'd for C1~H~5F4N20:
339.112051, found 339.110781; 339 (MH+, 100).
WO 98!45276 PCT/US98/06733 Examvle 26 Preparation of (+/-)-f-Fluoro-4-methylpropargyl-4 trifluoromethyl-3,4-dihydro-2(2Fi)-quinazolinone (R4 _ Methyl) Synthesis of XIX-a from XVI-a.
A solution of 2-butyne (94 mg, 1.75 mmol) in anhydrous THF (3.5 mL) was cooled to 0 °C, treated with n-BuLi (0.97 mL
of 1.6 M solution in hexanes, 1.55 mmol), and aged for 0.5 h.
To a solution of XVI-a (90 mg, 0.388 mmol) in anhydrous THF
(1.9 mL) at -78 °C was added the lithium anion over 5 minutes, followed by boron trifluoride etherate (25 mL, 0.194 mmol). The cooling bath was removed and the mixture was allowed to warm to room temperature. After 16 h at room temperature, quench by addition of 1 M citric acid (10 mL), dilute with EtOAc (50 mL), separate phases and wash the organic phase sequentially with saturated aqueous NaHC03 (20 mL) and saturated aqueous NaCl (20 mL). The resulting material was purified by HPLC (2.5~ MeOH/CH2C12) to afford 10 mg (9~) of the desired product: mp 181 °C; 1H NMR (300 Ngiz, acetone-d6) $ 8.91 (br s, 2 H), 7.27 (d, 8.4H), 7.18-7.08 (m, 1 H), 7.02-6.97 (m, 2 H), 3.29 (dd, J = 16.8, 2.6 Hz, 1 H), 3.00 (dd, J = 16.8, 2.2 Hz, 1 H), 1.61-1.59 (m, 3 H); 19F NMR
(282 MHz, acetone-d6) S -81.86, -123.69-123.70; MS (CI) m/e calc'd for C13H11F4N20: 287.080751, found 287.080340; 287 (MH+, 75) , 304 (M+N~i4+, 100) .
SCHEME 4: Chiral Resolution Q4 p4 CF3 'i CF3 :~ CF3 Chiral HPLC 3 ' 3 \ ~ Separation ~\ ~ ~\
. ( / N' ' O I / N' '_ 0 I / N' ' 0 H H H
Combound ~3- Compound ~3- Compound 6-C1 IV-a 6-C1 IV-b 6-C1 IV-c 6-Me0 VIII-a 6-Me0 VIII-b 6-Me0 VIII-c 5,6-diF XII-a 5,6-diF XII-b 5,6-diF XII-c 6-F XVII-a 6-F XVII-b 6-F XVII-c Examples 27 and 28 Preparation of (-)-6-Chloro-4-cyclopropylethynyl-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (Example 27) and (+)-6-Chloro-4-cyclopropylethynyl-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (Example 28) Resolution of IV-b,c from IV-a (R4 = Cyclopropyl).
Chiral HPLC utilizing a Chiralcel OD column, 3~
isopropanol, 5~ CH2C12 and 92~ hexanes at ambient temperature with a 1.0 mL/min flow rate and detection at 250 nm afforded seperation of IV-b from IV-c with enantiomeric excesses of 99~ and 99.4$, respectively. IV-b: mp 106-109 °C; [a]D25 -50.34° (c=0.274, MeOH) . IV-c: mp105-107 °C; [oc]D25 +58.33°
(c=0.288, MeOH).
Examples 29 aad 30 Preparation of (+)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (Example 29) aad (-)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(1H) quiaazolinone (Example 30) Resolution of XII-b,c from XII-a (R4 = Cyclopropyl).
Chiral HPLC utilizing a Chiralpak AD column, 5$ water and 95~ methanol at ambient temperature with a 0.8 mL/min flow rate and detection at 250 nm afforded seperation of XII-b from XII-c with enantiomeric excesses of 100 and 99~, respectively. XII-b: mp 187 °C; [a]D25 +1.46° (c=0.274, MeOH). XII-c: mp 187.5-188.8 °C; [a]D25 _1,45° (c=0.278, MeOH).
Examvies 31 and 32 Preparation of (-)-5,6-Difluoro-4-isopropylethynyl-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazolinoae (Example 31) and (+)-5,6-Difluoro-4-isopropylethynyl 4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (Example 32) Resolution of XII-b,c frorn XII-a (R4 = Isopropyl).
Chiral HPLC utilizing a Chiralpak AD column, 5$ water and 95~ methanol at ambient temperature with a 0.5 mL/min flow rate and detection at 250 nm afforded seperation of XII-b from XII-c with enantiomeric excesses of 100 and 99~, respectively. XII-b: mp 155 °C; [oC]~25 -2.14° (c=0.280, MeOH) . XII-c: 98 °C; (o6)D25 +4.45° (c=0.292, MeOH) .
Examvles 33 and 34 Preparation of (-)-5,6-Difluoro-4-ethylethynyl-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (Example 33) and (+)-5,6-Difluoro-4-ethylethynyl-4 trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (Example 34) Resolution of XII-b,c from XII-a (R4 = Ethyl}.
Chiral HPLC utilizing a AS column, 20~ ethanol and 80$
hexanes at ambient temperature with a 1.0 mL/min flow rate and detection at 250 nm afforded seperation of XII-b from XII-c with enantiomeric excesses of 100 and 99~, respectively. XII-b: mp 165-167 °C. XII-c: mp 157-159 °C.
E~caa~p 1 a s 3 5 and 3 6 Preparation of 5,6-Dif luoro-4-(2-hydroxyethyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (Example 35) and 5,6-Difluoro-4-(1-hydroxyethyl)ethynyl-4-trifluoromethyl-3,4-dihydro 2(1H)-quinazolinone (Example 36) LiC=CCH2CH20TBS R
or F LiC=CCH(OTBS)CH3F 3 F ~ \ N THF/BF3 ~OEt2 ~ ~NH
N O
C'~mr~ound R
Ex. 35 CH2CH20TBS
Ex. 36 CH(OTBS)CH3 TBAF
THF ""
H
Compound R
Ex. 35 CHzCH20H
Ex. 36 CH(OH)CH3 To a slurry of ketimine (300 mg, 1.20 mmol) in anhyd.
THF (11 mL) at -78 °C was sequentially added a precooled (0 °C) solution of the silyl protected lithium acetylide (5.40 mmol) and BF3.OEt2 (0.60 mmol). The resulting mixture was stirred at rt overnight. The reaction was quenched by the addition of 1 M citric acid and diluted with EtOAc. The phases were separated, the organic phase was washed with water, sat. aq. NaHC03 arid sat. aq. NaCl. The organic extracts were dried over MgS04, filtered and concentrated.
WO 98!45276 PCT/US98/06733 The material was purified by regular phase HPLC
chromatography (41.4 mrn Rainin Dynamax~ column using 60 silica @ 25 mL/min): 2.5~ MeOH/CH2C12 for 24 min, increase to 30~ MeOH/CH2C12 over 4 min, 30~ MeOH/CHZC12 for 10 min, and ramp back to 2.5~ MeOH/CH2C12 over 2 min. The yield of the protected intermediates was 47~ and 32~, respectively.
Example 35-intermediate. Mp 62.9-64 °C; 1H NMR (300 MHz, acetone-d6) b 8.98 (br s, 1H), 7.41-7.32 (m, 2H), 6.83 6.78 (m, 1H), 3.74 (t, J = 6.6 Hz, 2H), 2.47 (t, J = 6.6 Hz, 2H), 0.81 (s, 9H), 0.00 (s, 6H); ~9F NMR (282 MHz, acetone d6) 8 -83.17, -135.16--135.31, -148.09--148.22; MS (CI) calc'd for C19H24F5N202Si: m/2 435.152723, found 435.151149;
435 (N~i+, 94), 452 (M+NH4+, 100); Analysis calc'd for C1gH23F5N202Si: C, 52.52; H, 5.35; N, 6.46; found: C, 52.65; H, 5.29; N, 6.31.
Example 36-intermediate. 1H NMR (300 MHz, acetone-d~) S
8.96 (br s, 1H), 7.50 (br s, 1H), 7.37-7.28 (m, 1H), 6.79-6.74 (m, 1H), 4.61 (q, J = 13.2, 6.6 Hz, 1H), 1.30 (d, J =
6.6 Hz, 3H), 0.78 (s, 9H), 0.01 (s, 6H); 1gF NMR (282 MHz, acetone-ds) d -82.88--82.95, -135.20--135.42, -248.06--148.23;
MS (CI) calc'd for C19H24F5N202Si: m/z 435.152723, found 435.152927; 435 (MH+, 51), 452 (M+NH4+, 100); Analysis calc'd for C19H23F5N202Si: C, 52.52; H, 5.35; N, 6.46; found: C, 52.54; H, 5.34; N, 6.69.
To a solution of the protected intermediate for Example (0.56 mmol) in THF (1.1 mL) was added TBAF (0.62 mL of 1.0 M solution in THF). The resulting mixture was stirred at rt for 1 h, diluted with EtOAc, washed with 1 N HC1, sat. aq.
NaHC03, and sat. aq. NaCl. The organic extract was dried over 30 MgS04, filtered and concentrated. The material was purified by regular phase HPLC chromatography (41.4 mm Rainin Dynamax~
column using 60 $r silica @ 25 mL/min): 2.5~ MeOH/CH2C12 for 24 min, increase to 30~ MeOH/CH2C12 over 4 min, 30~
MeOH/CH2C12 for 10 min, and ramp back to 2.5~ MeOH/CH2C12 over 35 2 min. Example 35 was isolated in 82~ yield.
Example 35. Mp 190-192 °C; 1H NMR (300 N~iz, acetone-d6) 8 9.05 (br s, 1H), 7.53 (br s, 1H), 7.45-7.36 (m, 1H), 6.88-6.83 (m, IH), 4.01-3.98 (m, 1H), 3.68-3.64 (m, 2H), 2.50 (t, J = 6.6 Hz, 2H); 1gF NMR (282 MHz, acetone-d6) 8 -83.3, -135.68--135.88, -148.10--148.22; MS (CI) calc'd for C~3H1pF5N202: m/z 321.066244, found 321.066479; 321 (MH+, 100); Analysis calc'd for Cl3HgF5N202: C, 48.76; H, 2.83; N, 8.76; found: C, 49.05; H, 3.23; N, 8.38.
. Example 36 was synthesized in an analogous manner to deliver the title compound in 88~ yield. Mp 190-191 °C; 1H
NMR (300 MHz, acetone-d6) 8 9.06 (br s, 1H), 7.56 (br s, 1H), 7.46-7.37 (m, 1H), 6.88-6.83 (m, 1H), 4.58-4.57 (m, 2H), 1.39 (d, J = 5.5 Hz, 3H); 19F NMR (282 MHz, acetone-d6) 8 -83.15, -135.40, -135.60, -148.08--148.20; MS (CI) calc'd for C13H10F5N202- m/z 321.066244, found 321.065983; 321 (MH+, 58), 338 (M+NH4+, 100); Analysis calc'd for C13H9F5N202: C, 48.76; H, 2.83; N, 8.76; found: C, 48.84; H, 2.76; N, 8.63.
Example 37 Preparation of (+)-4-E-Cyclopropylethenyl-5,6 difluoro-4-trifluoromethyl-3,4-dihydro-2(1H) guinazolinone To a solution of XII-b (200 mg, 0.632 mmol) in anhyd.
THF (1.3 mL) at rt was added a solution of lithium aluminium hydride (1.3 mL of 1.0 M solution in THF). The resulting mixture was stirred at rt overnight. The reaction was quenched by addition of 10~ NaOH (3 mL) and water (3 mL).
The mixture was diluted with EtOAc (30 mL) and the phases were separated. The organic phase was washed with sat. aq.
NaCl, dried over MgS04, filtered and concentrated. The title compound was purified by regular phase HPLC (41.4 mm Rainin Dynamaxt~ column using 60 ~ silica): 2.5~ MeOH/CH2C12 for 24 min, increase to 30$ MeOH/CH2C12 over 4 min, 30~ MeOH/CHZC12 for 10 min, and ramp back to 2.5~ MeOH/CHzCl2 over 2 min. Mp 80-83 °C; 1H NMR (300 MHz, acetone-d6) d 9.07 (br s, 1H), 7.33 (q, J=8.8 Hz, 1H), 6.94 (br s, 1H), 6.84-6.79 (m, 1H), 6.27 (dd, J = 15.6, 7.5 Hz, 1H), 5.67 (dd, J = 15.2, 9.4 Hz, 1H), 1.65-1.56 (m, 1H), 0.80-0.71 (m, 2H), 0.50-0.42 (m, 2H);
i9F NMR (282 MHz, acetone-d6) d -82.68, -3.35.05, -148.49; MS
(CI) calc'd for C14H12FSNZ0: m/z 319.086979, found WO 98!45276 PCT/US98/06733 319.087755; 319 (MH+, 100); [oc)D2o +72.77° (c=0.382, MeOH);
Analysis calc'd for C14H12F5N20: C, 52.84; H, 3.48; N, 8.80; found: C, 53.02; H, 3.48; N, 8.61.
Exatnn l a 3 8 Preparation of (-)-6-Chloro-4-E-cyclopropylethenyl-4 trifluoromethyl-3,4-dihydro-2(1A)-quinazolinone The title compound was prepared as described for Example 37 (starting from IV-b), except that it was purified using a Chiralcel OD column at 1.5 mL/min in 0.5~ EtOH/20~
CH2C12/79.5~ hexanes. Mp 87-89 °C; 1H NMR (300 MHz, acetone-d6) d 9.08 (br s, 1H), 7.40-7.25 (m, 2H), 7.04-6.90 (m, 2H), 6.28-6.18 (m, 1H), 5.64-5.52 (m, 1H), 1.68-1.55 (m, 1H), 0.83-0.71 (m, 2H), 0.53-0.41 (rn, 2H); 1gF NMR (282 MHz, acetone-d6) d -81.67; MS (CI) calc'd for C14H13C1F3N20: m/z 317.066851, found 317.065857; 317 (Ng3+, 100); [a]D2o _6. g1°
(c=0.382, MeOH); Analysis calc'd for C14H12C1F3N20 . 0.27 C3H60: C, 53.52; H, 4.13; N, 8.43; found: C, 53.90; H, 4.07; N, 8.80.
Table 1*
i z .,Ra 'R n ~ ~ N'~O
H
Ex.# R3 RI RZ R8 m.p. Mass Spec (C) 1 6-C1 CF3 C~-cycPr H 86.6- 332 88 (M+NH4+) 2 6-C1 CF3 C-C-iPr H 180 334 ( M+NH4 +
) 3 6-C1 CF3 C~-2-Pyridyl H 105 352 (Ngi+) 4 6-Cl CF3 C~-Et H 217- 303 (MH+) 6-C1 CF3 C~-Ph H 104- 368 107 (M+NFi4+) 6 6-Me0 CF3 C~-cycPr H 208 311 (MH+) 7 6-Me0 CF3 C-C-iPr H 228- 313 (MH+) 8 6-Me0 CF3 C~-2-Pyridyl H 97'98 348 (MH+) 9 6-Me0 CF3 C=C-Ph H 206.2- 347 (rg.~+) 207.7 5, 6-diFCF3 C~-cycPr H 101 317 (~+) dec.
11 5,6-diF CF3 C-C-iPr H 79-80 319 (MH+) 12 5,6-diF CF3 C~-2-Pyridyl H 219- 354 (MH+) 13 5,6-diF CF3 C~-Et H 191- 305 (MH+) 14 5,6-diF CF3 C=C-Ph H 215- 370 217 (M+NH4+) 5,6-diF CF3 CH2CH2CH(CH3)2 H 192- 323 (MH+) 16 5,6-diF CF3 CH2CHZCHZCH3 H 309 (~+) 17 6-F CF3 CSC-cycPr H 155 29g (~+) 18 6-F CF3 C-C-iPr H 158 301 (MH+) 19 6-F CF3 C~-2-Pyridyl H 155 336 (MH+) 6-F CF3 C~-Et H 190 287 (MH+) 21 6-F CF3 C-C-Ph H 107 352 (M+NH4+) 22 6-F CF3 CH2CH2CH (CH3 H 179 305 (MH+) ) 2 23 6-F CF3 CH2CH2-2-PyridylH 88 340 (MH+) 24 6-F CF3 CH2CH2CHZCH3 H 198 291 0+) 25 6-F CF3 CH2CH2Ph H 98 339 (MH+) ( M+NH4+
) 27 6-C1 CF3 C~-cycPr H 106- 313 (M-) (-) 109 28(+) 6-C1 CF3 C~-cycPr H 105- 313 (M-) 29 5, 6-diFCF3 C~-cycPr H 187 315 (M-) (+) 30(-) 5,6-diF CF3 C~-cycPr H 188- 315 (M-) ls9 31(-) 5,6-diF CF3 C=c-iPr H 155 317 (M') 32 5, 6-diFCF3 C~-iPr H 98 317 (M-) (+) 33(-) 5,6-diF CF3 C=c-Et H 165- 303 (M-) 34 5, 6-diFCF3 C~-Et H 157- 303 (M') (+) 159 35 5,6-diF CF3 C~CH2CH20H H 190- 321 (MH+) 36 5,6-diF CF3 C~-CH(OH)Me H 190- 338 191 (M+NH4+) 37(+) 5,6-diF CF3 C~-cycPr (E) H 80-83 319 (MH+) 38 6-C1 CF3 C~-cycPr (E) H 87-89 317 (MH+) (-) *Unless otherwise indicated, stereochemisty is (+/-).
Table 2*
,Re ~R ~ ~ ~ _'~O
F.~c. R3 Rz R2 R8 #
2 6-C1 CF3 C=C-CH(OH)Me H
3 6-C1 CF3 C-C-(2-C1)Ph 4 6-C1 CF3 C=C-(3-C1)Ph H
6-C1 CF3 C-C-(4-C1)Ph H
6 6-C1 CF3 C=C-(2-F)Ph H
7 6-C1 CF3 C=C-(3-F)Ph H
8 6-C1 CF3 C=C-(4-F)Ph H
9 6-C1 CF3 C=C-(2-OH)Ph H
6-C1 CF3 C=C-(3-OH)Ph H
11 6-C1 CF3 C=C-(4-OH)Ph H
12 6-C1 CF3 Cue- (2-OMe) Ph H
13 6-CI CF3 Cue- ( 3 -OMe ) Ph H
14 6-C1 CF3 C=C-(4-OMe)Ph H
6-C1 CF3 C=C-(2-CN)Ph H
16 6-C1 CF3 C=C-(3-CN)Ph H
17 6-C1 CF3 C-C-(4-CN)Ph H
18 6-C1 CF3 C=C-(2-N02)Ph H
19 6-C1 CF3 Cue- ( 3-N02 ) Ph H
6-C1 CF3 C=C-(4-N02)Ph H
21 6-C1 CF3 C~-(2-NH2)Ph H
22 6-C1 CF3 C=C-(3-NH2)Ph H
23 6-C1 CF3 Cue- ( 4-NHZ ) Ph H
24 6-C1 CF3 C=C-(2-NMe2)Ph H
6-C1 CF3 C-C-(3-NMe2)Ph H
26 6-C1 CF3 C=C-(4-NMe2)Ph H
27 6-C1 CF3 C~-3-Pyridyl H
28 6-C1 CF3 C~-4-Pyridyl H
29 6-C1 CF3 C=C-2-furanyl 30 6-C1 CF3 C~-3-furanyl H
31 6-C1 CF3 C~-2-thienyl H
32 6-C1 CF3 C~-3-thienyl H
33 6-C1 CF3 C=C-2-oxazolyl H
34 6-C1 CF3 C=C-2-thiazolyl H
35 6-C1 CF3 C~-4-isoxazolyl H
36 6-C1 CF3 C=C-2-imidazolyl H
37 6-C1 CF3 C=CCHzCHZOH H
38 6-C1 CF3 C=C-CH(OH)Me H
39 6-Cl CF3 C-C-(2-C1)Ph H
40 6-Cl CF3 C-C-(3-C1)Ph H
41 6-C1 CF3 C-C-(4-C1)Ph H
42 6-C1 CF3 C-C-(2-F)Ph H
43 6-C1 CF3 C-C-(3-F)Ph H
44 6-C1 CF3 C-C-(4-F)Ph H
45 6-C1 CF3 Cue- (2-OH) Ph H
46 6-C1 CF3 C=C-(3-OH)Ph H
47 6-CI CF3 C=C-(4-OH)Ph H
48 6-C1 CF3 C=C-(2-OMe)Ph H
49 6-C1 CF3 C=C-(3-OMe)Ph H
50 6-C1 CF3 C=C-(4-OMe)Ph H
51 6-C1 CF3 C=C-(2-CN)Ph H
52 6-C1 CF3 C=C-(3-CN)Ph H
53 6-C1 CF3 C=C-(4-CN)Ph H
54 6-C1 CF3 C=C-(2-N02)Ph H
55 6-C1 CF3 C=C-(3-N02)Ph H
56 6-CI CF3 C=C-(4-N02)Ph H
57 6-C1 CF3 C=C- ( 2-NH2 ) Ph H
58 6-C1 CF3 C=C-(3-NHZ)Ph H
59 6-C1 CF3 C=C-(4-NH2)Ph H
60 6-C1 CF3 C=C-(2-NMe2)Ph H
61 6-C1 CF3 C=C- ( 3 -NMe2 ) H
Ph 62 6-C1 CF3 C=C-(4-NMe2)Ph H
63 6-C1 CF3 C=C-3-Pyridyl H
64 6-C1 CF3 C=C-4-Pyridyl H
65 6-C1 CF3 C=C-2-furanyl H
66 6-Cl CF3 C=C-3-furanyi H
67 6-C1 CF3 C=C-2-thienyl H
68 6-C1 CF3 C=C-3-thienyl H
69 6-C1 CF3 C=C-2-oxazolyl H
70 6-C1 CF3 C=C-2-thiazolyl H
71 6-C1 CF3 C=C-4-isoxazolyl H
72 6-C1 CF3 C~-2-imidazolyl H
73 6-C1 CF3 CH2CHZ-cycPr H
75 6-C1 CF3 CH2CH2-CH(OH)Me H
76 6-C1 CF3 CH2CH2-Ph H
77 6-Cl CF3 CH2CH2-(2-C1)Ph H
78 6-C1 CF3 CH2CH2-(3-C1)Ph H
79 6-C1 CF3 CHZCHZ-(4-C1)Ph H
80 6-C1 CF3 CH2CH2-(2-F)Ph H
81 6-C1 CF3 CH2CH2-(3-F)Ph H
82 6-C1 CF3 CH2CH2-(4-F)Ph H
83 6-C1 CF3 CH2CH2-(2-OH)Ph H
84 6-C1 CF3 CH2CH2-(3-OH)Ph H
85 6-C1 CF3 CH2CH2-(4-OH}Ph H
86 6-C1 CF3 CH2CH2-(2-OMe)Ph H
87 6-C1 CF3 CH2CH2-(3-OMe)Ph H
88 6-C1 CF3 CH2CH2-(4-OMe)Ph H
89 6-C1 CF3 CH2CH2-(2-CN)Ph H
90 6-C1 CF3 CHZCH2-(3-CN)Ph H
91 6-C1 CF3 CH2CH2-(4-CN)Ph H
92 6-C1 CF3 CH2CH2-(2-N02)Ph H
93 6-C1 CF3 CH2CH2-(3-N02)Ph H
94 6-Cl CF3 CH2CH2-(4-N02)Ph H
95 6-Cl CF3 CH2CH2-(2-NH2}Ph H
96 6-C1 CF3 CH2CH2-(3-NH2)Ph H
97 6-C1 CF3 CH2CH2-(4-NH2}Ph H
98 6-C1 CF3 CH2CH2-(2-NMe2)Ph H
99 6-C1 CF3 CHZCHZ- ( 3 -NMe2 H
) Ph 100 6-C1 CF3 CHZCH2-(4-NMe2)Ph H
101 6-Cl CF3 CH2CHZ-2-Pyridyl H
102 6-C1 CF3 CH2CH2-3-Pyridyl H
103 6-C1 CF3 CH2CH2-4-Pyridyl H
104 6-C1 CF3 CH2CH2-2-furanyl H
105 6-C1 CF3 CH2CH2-3-furanyl H
106 6-C1 CF3 CH2CH2-4-furanyl H
107 6-C1 CF3 CH2CH2-3-thienyl H
108 6-C1 CF3 CH2CH2-2-oxazolyl H
109 6-C1 CF3 CH2CH2-2-thiazolyl H
110 6-CI CF3 CH2CH2-4-isoxazolyl H
111 6-Cl CF3 CH2CH2-2-imidazolyl H
112 6-C1 CF3 C~-cycPr CH3 113 6-C1 CF3 C~-Ph CH3 114 6-C1 CF3 C~-2-Pyridyl CH3 115 6-C1 CF3 C~-3-Pyridyl CH3 116 6-C1 CF3 C~-4-Pyridyl CH3 117 6-C1 CF3 C~-2-furanyl CH3 118 6-C1 CF3 C~-3-furanyl CH3 219 6-C1 CF3 C-C-2-thienyl CH3 120 6-C1 CF3 C~-3-thienyl CH3 121 6-C1 CF3 C=C-cycPr CH3 I22 6-C1 CF3 C=C-Ph CH3 123 6-C1 CF3 C=C-2-Pyridyl CH3 124 6-C1 CF3 C=C-3-Pyridyl CH3 125 6-C1 CF3 C=C-4-Pyridyl CH3 126 6-C1 CF3 C=C-2-furanyl CH3 227 6-C1 CF3 C=C-3-furanyl CH3 128 6-C1 CF3 C=C-2-thienyl CH3 129 6-C1 CF3 C=C-3-thienyl CH3 130 6-C1 CF3 CH2CH2-cycPr CH3 131 6-C1 CF3 CH2CH2-Ph CH3 132 6-Cl CF3 CH2CH2-2-Pyridyl CH3 133 6-C1 CF3 CH2CH2-3-Pyridyl CH3 134 6-C1 CF3 CHZCH2-4-Pyridyl CH3 135 6-C1 CF3 CHZCH2-2-furanyl CH3 136 6-C1 CF3 CHZCH2-3-furanyl CH3 137 6-C1 CF3 CHZCHZ-2-thienyl CH3 138 6-C1 CF3 CHZCH2-3-thienyl CH3 139 6-C1 CF3 C~-cycPr CH2CH3 140 6-C1 CF3 C-C-Ph CH2CH3 141 6-C1 CF3 C~-2-Pyridyl CH2CH3 142 6-C1 CF3 C~-3-Pyridyl CH2CH3 143 6-C1 CF3 C~-4-Pyridyl CH2CH3 144 6-C1 CF3 C=C-2-furanyl CH2CH3 145 6-C1 CF3 C~-3-furanyl CH2CH3 146 6-C1 CF3 C~-2-thienyl CH2CH3 147 6-C1 CF3 C~-3-thienyl CH2CH3 148 6-C1 CF3 C=C-cycPr CH2CH3 149 6-C1 CF3 C=C-Ph CH2CH3 150 6-C1 CF3 C=C-2-Pyridyl CH2CH3 151 6-C1 CF3 C=C-3-Pyridyl CH2CH3 152 6-C1 CF3 C=C-4-Pyridyl CH2CH3 153 6-C1 CF3 C=C-2-furanyl CH2CH3 154 6-C1 CF3 C=C-3-furanyl CH2CH3 155 6-C1 CF3 C=C-2-thienyl CH2CH3 156 6-C1 CF3 C=C-3-thienyl CHZCH3 157 6-C1 CF3 CH2CH2-cycPr CH2CH3 158 6-C1 CF3 CH2CH2-Ph CH2CH3 159 6-Cl CF3 CHZCHZ-2-Pyridyl CH2CH3 160 6-C1 CF3 CH2CH2-3-Pyridyl CH2CH3 161 6-C1 CF3 CH2CHZ-4-Pyridyl CH2CH3 162 6-C1 CF3 CH2CH2-2-furanyl CH2CH3 163 6-C1 CF3 CH2CH2-3-furanyl CH2CH3 164 6-C1 CF3 CH2CH2-2-thienyl CH2CH3 165 6-Cl CF3 CH2CH2-3-thienyl CH2CH3 166 6-Me0 CF3 C=CCH2CH20H H
167 6-Me0 CF3 C=C-CH(OH)Me H
168 6-Me0 CF3 C-C-(2-C1)Ph H
169 6-Me0 CF3 C=C-(3-C1)Ph H
170 6-Me0 CF3 C=C-(4-C1)Ph H
171 6-Me0 CF3 C=C-(2-F)Ph 172 6-Me0 CF3 C=C-(3-F)Ph H
173 6-Me0 CF3 C-C-(4-F)Ph H
174 6-Me0 CF3 C=C-(2-OH)Ph 175 6-Me0 CF3 C=C-(3-OH)Ph 176 6-Me0 CF3 C=C-(4-OH)Ph H
177 6-Me0 CF3 Cue- ( 2 -OMe ) H
Ph 178 6-Me0 CF3 C=C-(3-OMe)Ph H
179 6-Me0 CF3 C~-(4-OMe)Ph H
180 6-Me0 CF3 C=C-(2-CN)Ph H
181 6-Me0 CF3 C=C-(3-CN)Ph 182 6-Me0 CF3 C=C-(4-CN)Ph 183 6-Me0 CF3 C=C-(2-N02)Ph H
184 6-Me0 CF3 C-C-(3-N02)Ph 185 6-Me0 CF3 C-C-(4-N02)Ph 186 6-Me0 CF3 C=C-(2-NH2)Ph H
187 6-Me0 CF3 C=C-(3-NHZ)Ph 188 6-Me0 CF3 C=C-(4-NH2)Ph H
189 6-Me0 CF3 C-_--C- ( 2 -NMe2 H
) Ph 190 6-Me0 CF3 C_=C-(3-NMe2)Ph 191 6-Me0 CF3 C=C-(4-NMe2)Ph H
192 6-Me0 CF3 C~-3-Pyridyl H
193 6-Me0 CF3 C~-4-Pyridyl H
194 6-Me0 CF3 C=C-2-furanyl H
195 6-Me0 CF3 C~-3-furanyl H
196 6-Me0 CF3 C~-2-thienyl H
197 6-Me0 CF3 C=C-3-thienyl 198 6-Me0 CF3 C~-2-oxazolyl H
r , .
199 6-Me0 CF3 C=C-2-thiazolyl H
200 6-Me0 CF3 C=C-4-isoxazolyl H
201 6-Me0 CF3 C=C-2-imidazolyl H
202 6-Me0 CF3 C=CCH2CH20H H
203 6-Me0 CF3 C=C-CH(OH)Me H
204 6-Me0 CF3 C=C-(2-Cl)Ph H
205 6-Me0 CF3 C=C-(3-C1)Ph H
206 6-Me0 CF3 C=C-(4-C1)Ph H
207 6-Me0 CF3 C=C-(2-F)Ph H
208 6-Me0 CF3 C=C-(3-F)Ph H
209 6-Me0 CF3 C=C-(4-F)Ph H
210 6-Me0 CF3 C=C-(2-OH)Ph H
211 6-Me0 CF3 C=C-(3-OH)Ph H
212 6-Me0 CF3 C=C-(4-OH)Ph H
213 6-Me0 CF3 C=C-(2-OMe)Ph H
214 6-Me0 CF3 C=C-(3-OMe)Ph H
215 6-Me0 CF3 C=C-(4-OMe)Ph H
216 6-MeO CF3 C=C-(2-CN)Ph H
217 6-Me0 CF3 C=C-(3-CN)Ph H
218 6-Me0 CF3 C=C-(4-CN)Ph H
219 6-Me0 CF3 C=C-(2-N02)Ph H
220 6-Me0 CF3 C=C-(3-N02)Ph H
221 6-Me0 CF3 C=C-(4-N02)Ph H
222 6-Me0 CF3 C=C-(2-NH2)Ph H
223 6-Me0 CF3 C=C-(3-NH2)Ph H
224 6-Me0 CF3 C=C-(4-NH2)Ph H
225 6-Me0 CF3 C=C-(2-NMe2)Ph H
226 6-Me0 CF3 C=C-(3-NMe2)Ph H
227 6-Me0 CF3 C=C-(4-NMe2)Ph H
228 6-Me0 CF3 C=C-3-Pyridyl H
229 6-Me0 CF3 C=C-4-Pyridyl H
230 6-Me0 CF3 C=C-2-furanyl H
231 6-Me0 CF3 C=C-3-furanyl H
232 6-Me0 CF3 C=C-2-thienyl H
233 6-Me0 CF3 C=C-3-thienyl H
234 6-Me0 CF3 C=C-2-oxazolyl H
235 6-Me0 CF3 C=C-2-thiazolyl H
236 6-Me0 CF3 C=C-4-isoxazolyl H
237 6-Me0 CF3 C=C-2-imidazolyl H
238 6-Me0 CF3 CH2CH2-cycPr H
239 6-Me0 CF3 CH2CH2CH2CHZOH H
240 6-Me0 CF3 CH2CH2-CH(OH)Me H
241 6-Me0 CF3 CH2CH2-Ph H
242 6-Me0 CF3 CH2CH2-(2-C1)Ph H
243 6-Me0 CF3 CHZCH2-(3-C1)Ph H
244 6-Me0 CF3 CH2CH2-(4-C1)Ph H
245 6-Me0 CF3 CH2CH2-(2-F)Ph H
246 6-Me0 CF3 CH2CH2-(3-F)Ph H
247 6-Me0 CF3 CH2CH2-(4-F)Ph H
248 6-Me0 CF3 CH2CH2-(2-OH)Ph H
249 6-Me0 CF3 CH2CH2-(3-OH)Ph H
250 6-Me0 CF3 CH2CH2-(4-OH)Ph H
251 6-Me0 CF3 CH2CH2-(2-OMe)Ph H
252 6-Me0 CF3 CH2CH2-(3-OMe)Ph H
253 6-Me0 CF3 CH2CH2-{4-OMe)Ph H
254 6-Me0 CF3 CHZCH2-(2-CN)Ph H
255 6-Me0 CF3 CHZCHZ-(3-CN)Ph H
256 6-Me0 CF3 CH2CH2-(4-CN)Ph H
257 6-Me0 CF3 CH2CH2-(2-N02)Ph H
258 6-Me0 CF3 CHZCHZ-(3-NOZ)Ph H
259 6-Me0 CF3 CH2CH2-{4-NOz)Ph H
260 6-Me0 CF3 CH2CH2-(2-NH2)Ph H
261 6-Me0 CF3 CHZCH2-(3-NH2)Ph H
262 6-Me0 CF3 CH2CH2-(4-NH2)Ph H
263 6-Me0 CF3 CH2CH2-(2-NMe2)Ph H
264 6-Me0 CF3 CH2CH2-(3-NMe2)Ph H
265 6-Me0 CF3 CH2CH2-(4-NMe2)Ph H
266 6-Me0 CF3 CH2CH2-2-Pyridyl H
267 6-Me0 CF3 CH2CH2-3-Pyridyl H
268 6-Me0 CF3 CH2CH2-4-Pyridyl H
269 6-Me0 CF3 CH2CH2-2-furanyl H
270 6-Me0 CF3 CH2CH2-3-furanyl H
271 6-Me0 CF3 CHZCH2-4-furanyl H
272 6-Me0 CF3 CHZCH2-3-thienyl H
273 6-Me0 CF3 CH2CHz-2-oxazolyl H
274 6-Me0 CF3 CH2CH2-2-thiazolyl H
275 6-Me0 CF3 CHZCH2-4-isoxazolyl H
276 6-Me0 CF3 CH2CH2-2-imidazolyl H
277 6-Me0 CF3 C~-cycPr CH3 278 6-Me0 CF3 C=C-Ph CH3 279 6-Me0 CF3 C~-2-Pyridyl CH3 280 6-Me0 CF3 C~-3-Pyridyl CH3 281 6-Me0 CF3 C~-4-Pyridyl CH3 282 6-Me0 CF3 C~-2-furanyl CH3 283 6-Me0 CF3 C~ 3-furanyl CH3 284 6-Me0 CF3 C~-2-thienyl CH3 285 6-Me0 CF3 C~-3-thienyl CH3 286 6-Me0 CF3 C=C-cycPr CH3 287 6-Me0 CF3 C=C-Ph CH3 288 6-Me0 CF3 C=C-2-Pyridyl CH3 289 6-Me0 CF3 C=C-3-Pyridyl CH3 290 6-Me0 CF3 C=C-4-Pyridyl CH3 291 6-Me0 CF3 C=C-2-furanyl CH3 292 6-Me0 CF3 C=C-3-furanyl CH3 293 6-Me0 CF3 C=C-2-thienyl CH3 294 6-Me0 CF3 C=C-3-thienyl CH3 295 6-Me0 CF3 CH2CH2-cycPr CH3 296 6-Me0 CF3 CH2CH2-Ph CH3 297 6-Me0 CFg CH2CH2-2-Pyridyl CH3 298 6-Me0 CF3 CH2CH2-3-Pyridyl CH3 299 6-Me0 CF3 CH2CH2-4-Pyridyl CH3 300 6-Me0 CF3 CH2CH2-2-furanyl CH3 301 6-Me0 CF3 CHZCHZ-3-furanyl CH3 302 6-Me0 CF3 CH2CH2-2-thienyl CH3 303 6-Me0 CF3 CH2CH2-3-thienyl CH3 304 6-Me0 CF3 C~-cycPr CH2CH3 305 6-Me0 CF3 C=C-ph CH2CH3 306 6-Me0 CF3 C~-2-Pyridyl CH2CH3 307 6-Me0 CF3 C~-3-Pyridyl CH2CH3 308 6-Me0 CF3 C~-4-Pyridyl CH2CH3 309 6-Me0 CF3 C~-2-furanyl CH2CH3 310 6-Me0 CF3 C~-3 -furanyl CH2CH3 311 6-Me0 CF3 C~-2-thienyl CH2CH3 312 6-Me0 CF3 C~-3-thienyl CH2CH3 313 6-Me0 CF3 C=C-cycPr CHZCH3 314 6-Me0 CF3 C=C-Ph CH2CH3 315 6-Me0 CF3 C=C-2-Pyridyl CH2CH3 3I6 6-Me0 CF3 C=C-3-Pyridyl CH2CH3 317 6-Me0 CF3 C=C-4-Pyridyl CH2CH3 318 6-Me0 CF3 C=C-2-furanyl CH2CH3 319 6-Me0 CF3 C=C-3-furanyl CH2CH3 320 6-Me0 CF3 C=C-2-thienyl CHZCH3 321 6-Me0 CF3 C=C-3-thienyl CH2CH3 322 6-Me0 CF3 CHZCH2-cycPr CH2CH3 323 6-M'e0 CF3 CH2CH2-Ph CH2CH3 324 6-Me0 CF3 CH2CH2-2-Pyridyl CH2CH3 325 6-Me0 CF3 CH2CH2-3-Pyridyl CHZCH3 326 6-Me0 CF3 CH2CH2-4-Pyridyl CH2CH3 327 6-Me0 CF3 CH2CH2-2-furanyl CH2CH3 328 6-Me0 CF3 CH2CH2-3-furanyl CH2CH3 329 6-Me0 CF3 CH2CH2-2-thienyl CH2CH3 330 6-Me0 CF3 CH2CH2-3-thienyl CH2CH3 331 5,6-diF CF3 C=C-(2-C1)Ph H
332 5, 6-diF CF3 C~-(3-C1) Ph H
333 5,6-diF CF3 C=C-(4-C1)Ph H
334 5,6-diF CF3 C-C-(2-F)Ph H
335 5,6-diF CF3 C=C-(3-F)Ph H
336 5,6-diF CF3 C-C-(4-F)Ph H
337 5,6-diF CF3 C=C-(2-OH)Ph H
338 5,6-diF CF3 C=C-(3-OH)Ph H
339 5,6-diF CF3 C=C-(4-OH)Ph H
340 5, 6-diF CF3 Cue- (2-OMe) Ph H
341 5 , 6-diF CF3 Cue- ( 3 -OMe ) Ph H
3 42 5 , 6-diF CF3 Cue- ( 4 -OMe ) Ph H
343 5, 6-diF CF3 Cue- ( 2-CN) Ph H
344 5, 6-diF CF3 C~-(3-CN) Ph H
345 5, 6-diF CF3 Cue- (4-CN) Ph H
3 46 5 , 6 -diF CF3 Cue- ( 2 -N02 ) Ph H
347 5,6-diF CF3 C=C-(3-NOz)Ph H
348 5,6-diF CF3 C~-(4-N02)Ph H
3 4 5 , 6 -diF CF3 Cue- ( 2 -NH2 ) Ph H
350 5,6-diF CF3 C~-(3-NH2)Ph H
351 5,6-diF CF3 C~-(4-NH2)Ph H
352 5,6-diF CF3 C~-(2-NMe2)Ph H
3 53 5 , 6 -diF CF3 Cue- ( 3 -NMe2 ) Ph H
354 5,6-diF CF3 C=C-(4-NMe2)Ph H
355 5,6-diF CF3 C=C-3-Pyridyl H
356 5,6-diF CF3 C~-4-Pyridyl H
357 5,6-diF CF3 C~-2-furanyl H
358 5,6-diF CF3 C~-3-furanyl H
359 5,6-diF CF3 C~-2-thienyl H
360 5,6-diF CF3 C~-3-thienyl H
361 5,6-diF CF3 C~-2-oxazolyl H
362 5,6-diF CF3 C=C-2-thiazolyl H
363 5,6-diF CF3 CrC-4-isoxazolyl H
364 5,6-diF CF3 C=C-2-imidazolyl H
365 5,6-diF CF3 C=C-(2-C1)Ph H
366 5,6-diF CF3 C=C-(3-C1)Ph H
367 5,6-diF CF3 C=C-(4-C1)Ph H
368 5,6-diF CF3 C=C-(2-F)Ph H
369 5,6-diF CF3 C=C-(3-F)Ph H
370 5,6-diF CF3 C=C-(4-F)Ph H
371 5,6-diF CF3 C=C-{2-OH)Ph H
372 5,6-diF CF3 C=C-{3-OH)Ph H
373 5,6-diF CF3 C=C-{4-OH)Ph H
374 5,6-diF CF3 C=C-(2-OMe)Ph H
375 5,6-diF CF3 C=C-(3-OMe)Ph H
376 5,6-diF CF3 C=C-(4-OMe)Ph H
377 5,6-diF CF3 C=C-(2-CN)Ph H
378 5,6-diF CF3 C=C-(3-CN)Ph H
379 5,6-diF CF3 C=C-(4-CN)Ph H
380 5,6-diF CF3 C=C-(2-N02)Ph H
381 5,6-diF CF3 C=C-(3-N02)Ph H
382 5,6-diF CF3 C=C-{4-N02)Ph H
383 5,6-diF CF3 C=C-(2-NH2)Ph H
384 5,6-diF CF3 C=C-(3-NH2)Ph H
385 5,6-diF CF3 C=C-(4-NH2)Ph H
386 5,6-diF CF3 C=C-(2-NMe2)Ph H
3 8? 5 , 6-diF CF3 C=C- ( 3 -NMe2 ) H
Ph 388 5,6-diF CF3 C=C-(4-NMe2)Ph H
389 5,6-diF CF3 C=C-3-Pyridyl H
390 5,6-diF CF3 C=C-4-Pyridyl H
391 5,6-diF CF3 C=C-2-furanyl H
392 5,6-diF CF3 C=C-3-furanyl H
393 5,6-diF CF3 C=C-2-thienyl H
394 5,6-diF CF3 C=C-3-thienyl H
395 5,6-diF CF3 C=C-2-oxazolyl H
396 5,6-diF CF3 C=C-2-thiazolyl H
397 5,6-diF CF3 C=C-4-isoxazolyl H
398 5,6-diF CF3 C=C-2-imidazolyl H
399 5,6-diF CF3 CH2CH2-cycPr H
400 5,6-diF CF3 CH2CH2CH2CH20H H
401 5,6-diF CF3 CH2CH2-CH(OH)Me H
402 5,6-diF CF3 CH2CH2-Ph H
403 5,6-diF CF3 CH2CHZ-(2-C1)Ph H
404 5,6-diF CF3 CH2CH2-(3-C1)Ph H
405 5,6-diF CF3 CH2CH2-(4-Cl)Ph H
406 5,6-diF CF3 CHZCH2-(2-F)Ph H
407 5,6-diF CF3 CH2CH2-(3-F)Ph H
408 5,6-diF CF3 CH2CH2-(4-F)Ph H
409 5,6-diF CF3 CH2CH2-(2-OH)Ph H
410 5,6-diF CF3 CH2CH2-(3-OH)Ph H
411 5,6-diF CF3 CHZCH2-(4-OH)Ph H
412 5,6-diF CF3 CH2CH2-(2-OMe)Ph H
413 5,6-diF CF3 CHzCH2-(3-OMe)Ph H
414 5,6-diF CF3 CH2CH2-(4-OMe)Ph H
415 5,6-diF CF3 CHZCH2-(2-CN)Ph H
416 5,6-diF CF3 CH2CHZ-(3-CN)Ph H
417 5,6-diF CF3 CH2CH2-(4-CN)Ph H
418 5,6-diF CF3 CHZCH2-(2-N02)Ph H
419 5,6-diF CF3 CH2CH2-(3-N02)Ph H
420 5,6-diF CF3 CH2CH2-(4-N02)Ph H
421 5,6-diF CF3 CH2CH2-(2-NH2~Ph H
422 5,6-diF CF3 CH2CH2-(3-NH2)Ph H
423 5,6-diF CF3 CH2CH2-(4-NH2)Ph H
424 5,6-diF CF3 CHZCH2-(2-NMe2)Ph H
425 5,6-diF CF3 CHZCH2-(3-NMe2)Ph H
426 5,6-diF CF3 CH2CH2-(4-NMe2)Ph H
427 5,6-diF CF3 CH2CH2-2-Pyridyl H
428 5,6-diF CF3 CH2CH2-3-Pyridyl H
429 5,6-diF CF3 CH2CH2-4-Pyridyl H
430 5,6-diF CF3 CH2CH2-2-furanyl H
431 5,6-diF CF3 CH2CH2-3-furanyl H
432 5,6-diF CF3 CHZCH2-2-thienyl H
433 5,6-diF CF3 CH2CH2-3-thienyl H
434 5,6-diF CF3 CH2CHZ-2-oxazolyl H
435 5,6-diF CF3 CH2CH2-2-thiazolyl H
436 5,6-diF CF3 CH2CH2-4-isoxazolyl H
437 5,6-diF CF3 CH2CH2-2-imidazolyl H
438 5,6-diF CF3 C~-cycPr CH3 439 5,6-diF CF3 C~-2-Pyridyl CH3 440 5,6-diF CF3 C~-3-Pyridyl CH3 441 5 , 6-diF CF3 C~-4 CH
-Pyridyl 3 442 5,6-diF CF3 C~-2-furanyl CH3 443 5,6-diF CF3 C~-3-furanyl CH3 444 5,6-diF CF3 C~-2-thienyl CH3 445 5,6-diF CF3 C~-3-thienyl CH3 446 5,6-diF CF3 C=C-cycPr CH3 447 5,6-diF CF3 C=C-2-Pyridyl CH3 448 5,6-diF CF3 C=C-3-Pyridyl CH3 449 5,6-diF CF3 C=C-4-Pyridyl CH3 450 5,6-diF CF3 C=C-2-furanyl CH3 451 5,6-diF CF3 C=C-3-furanyl CH3 452 5,6-diF CF3 C=C-2-thienyl CH3 453 5,6-diF CF3 C=C-3-thienyl CHI
454 5,6-diF CF3 CH2CH2-cycPr CH3 455 5,6-diF CF3 CH2CH2-Ph CH3 456 5,6-diF CF3 CH2CH2-2-Pyridyl CH3 457 5,6-diF CF3 CHZCH2-3-Pyridyl CH3 458 5,6-diF CF3 CH2CH2-4-Pyridyl CH3 459 5,6-diF CF3 CH2CH2-2-furanyl CH3 460 5,6-diF CF3 CH2CH2-3-furanyl CH3 461 5,6-diF CF3 CHZCH2-2-thienyl CH3 462 5,6-diF CF3 CHZCH2-3-thienyl CH3 463 5,6-diF CF3 C~-cycPr CH2CH3 464 5,6-diF CF3 C-C-Ph CH2CH3 465 5,6-diF CF3 C~-2-Pyridyl CH2CH3 466 5,6-diF CF3 C~-3-Pyridyl CH2CH3 467 5,6-diF CF3 C~-4-Pyridyl CH2CH3 468 5, 6-diF CF3 C~-2-furanyl CH2CH3 469 5,6-diF CF3 C~-3-furanyl CH2CH3 470 5,6-diF CF3 C~-2-thienyl CH2CH3 471 5,6-diF CF3 C~-3-thienyl CH2CH3 472 5,6-diF CF3 C=C-cycPr CH2CH3 473 5,6-diF CF3 C=C-Ph CH2CH3 474 5,6-diF CF3 C=C-2-Pyridyl CH2CH3 475 5,6-diF CF3 C=C-3-Pyridyl CHZCH3 476 5,6-diF CF3 C=C-4-Pyridyl CHZCH3 477 5,6-diF CF3 C=C-2-furanyl CH2CH3 478 5,6-diF CF3 C=C-3-furanyl CH2CH3 479 5,6-diF CF3 C=C-2-thienyl CH2CH3 480 5,6-diF CF3 C=C-3-thienyl CH2CH3 481 5,6-diF CF3 CH2CH2-cycPr CH2CH3 482 5,6-diF CF3 CH2CH2-Ph CH2CH3 483 5,6-diF CF3 CH2CHZ-2-Pyridyl CH2CH3 484 5,6-diF CF3 CHZCH2-3-Pyridyl CH2CH3 485 5,6-diF CF3 CH2CH2-4-Pyridyl CH2CH3 486 5,6-diF CF3 CH2CH2-2-furanyl CH2CH3 487 5,6-diF CF3 CH2CH2-3-furanyl CHZCH3 488 5,6-diF CF3 CH2CH2-2-thienyl CH2CH3 489 5,6-diF CF3 CHZCH2-3-thienyl CH2CH3 490 5, 6-diCl CF3 Cue- (2-C1) Ph H
491 5 , 6-diCl CF3 Cue- ( 3 -C1 ) Ph H
492 5,6-diCl CF3 C~-(4-C1)Ph H
493 5, 6-diCl CF3 Cue- (2-F) Ph H
494 5, 6-diCl CF3 C~-(3-F) Ph H
495 5 , 6-diCl CF3 Cue- ( 4-F ) Ph H
496 5, 6-diCl CF3 C~-(2-OH) Ph H
497 5, 6-diCl CF3 C~-(3-OH) Ph H
498 5 , 6-diCl CF3 Cue- ( 4-OH) Ph H
499 5,6-diCl CF
Cue- ( 2 -OMe ) H
Ph 500 5,6-diCl CF
Cue- ( 3 -OMe ) H
Ph 501 5,6-diCl CF3 C~-(4-OMe)Ph H
502 5, 6-diCl CF3 C~-(2-CN) Ph H
503 5, 6-diCl CF3 C~-(3-CN) Ph H
504 5 , 6-diCl CF3 Cue- ( 4-CN) Ph H
505 5,6-diCl CF3 C-C-(2-N02)Ph H
506 5,6-diCl CF3 C-C-(3-NOZ}Ph H
507 5,6-diCl CF3 CSC-(4-N02)Ph H
508 5,6-diCl CF3 C=C-(2-NHz)Ph H
509 5,6-diCl CF3 C=C-(3-NH2)Ph H
510 5,6-diCl CF3 C=C-(4-NH2)Ph H
511 5,6-diCl CF3 C=C-(2-NMe2)Ph H
512 5 , 6-diCl CF3 C=C- ( 3 -NMe2 ) H
Ph 513 S,6-diCl CF3 C-C-(4-NMe2)Ph H
514 5,6-diCl CF3 C~-3-Pyridyl H
515 5,6-diCl CF3 C~-4-Pyridyl H
516 5,6-diCl CF3 C~-2-furanyl H
517 5,6-diCl CF3 C~-3-furanyl H
518 5,6-diCl CF3 C~-2-thienyl H
519 5,6-diCl CF3 C~-3-thienyl H
520 5,6-diCl CF3 C~-2-oxazolyl H
521 5,6-diCl CF3 C=C-2-thiazolyl H
522 5,6-diCl CF3 C~-4-isoxazolyl H
523 5,6-diCl CF3 C~-2-imidazolyl H
524 5,6-diCl CF3 C=C-(2-C1)Ph H
525 5,6-diCl CF3 C=C-(3-Cl)Ph H
526 5,6-diCl CF3 C=C-(4-C1)Ph H
527 5,6-diCl CF3 C=C-(2-F)Ph H
528 5,6-diCl CF3 C=C-(3-F)Ph H
529 5,6-diCl CF3 C=C-(4-F)Ph H
530 5,6-diCl CF3 C=C-(2-OH)Ph H
531 5,6-diCl CF3 C=C-(3-OH)Ph H
532 5,6-diCl CF3 C=C-(4-OH)Ph H
533 5,6-diCl CF3 C=C-(2-OMe)Ph H
534 5,6-diCl CF3 C=C-(3-OMe)Ph H
535 5,6-diCl CF3 C=C-(4-OMe)Ph H
536 5,6-diCl CF3 C=C-(2-CN)Ph H
537 5,6-diCl CF3 C=C-(3-CN)Ph H
538 5,6-diCl CF3 C=C-(4-CN}Ph H
, i 539 5,6-diCl CF3 C=C-(2-NOz)Ph H
540 5,6-diCl CF3 C=C-(3-N02)Ph H
541 5,6-diCl CF3 C=C-(4-N02)Ph H
542 5,6-diCl CF3 C=C-(2-NH2)Ph H
543 5,6-diCl CF3 C=C-(3-NH2)Ph H
544 5,6-diCl CF3 C=C-(4-NH2)Ph H
545 5,6-diCl CF3 C=C-(2-NMe2)Ph H
546 5,6-diCl CF3 C=C-(3-NMe2)Ph H
547 5,6-diCl CF3 C=C-(4-NMe2)Ph H
548 5,6-diCl CF3 C=C-3-Pyridyl H
549 5,6-diCl CF3 C=C-4-Pyridyl H
550 5,6-diCl CF3 C=C-2-furanyl H
551 5,6-diCl CF3 C=C-3-furanyl H
552 5,6-diCl CF3 C=C-2-thienyl H
553 5,6-diCl CF3 C=C-3-thienyl H
554 5,6-diCl CF3 C=C-2-oxazolyl H
555 5,6-diCl CF3 C=C-2-thiazolyl H
556 5,6-diCl CF3 C=C-4-isoxazolyl H
557 5,6-diCl CF3 C=C-2-imidazolyl H
558 5,6-diCl CF3 CH2CH2-cycPr H
559 5,6-diCl CFA CH2CH2CH2CH20H H
560 5,6-diCl CF3 CHZCH2-CH(OH)Me H
561 5,6-diCl CF3 CH2CH2-Ph H
562 5,6-diCl CF3 CH2CH2-(2-C1)Ph H
563 5,6-diCl CF3 CHZCH2-(3-C1)Ph H
564 5,6-diCl CF3 CH2CH2-(4-C1)Ph H
565 5,6-diCl CF3 CHZCH2-(2-F)Ph H
566 5,6-diCl CF3 CH2CH2-(3-F)Ph H
567 5,6-diCl CF3 CH2CH2-(4-F)Ph H
568 5,6-diCl CF3 CH2CH2-(2-OH)Ph H
569 5,6-diCl CF3 CHZCH2-(3-OH)Ph H
570 5,6-diCl CF3 CHZCH2-(4-OH)Ph H
571 5,6-diCl CF3 CH2CH2-(2-OMe)Ph H
572 5,6-diCl CF3 CH2CH2-(3-OMe)Ph H
573 5,6-diCl CF3 CH2CH2-(4-OMe)Ph H
574 5,6-diCl CF3 CHZCH2-(2-CN)Ph H
575 5,6-diCl CF3 CH2CH2-(3-CN)Ph H
576 5,6-diCl CF3 CH2CH2-(4-CN)Ph H
577 5,6-diCl CF3 CH2CH2-(2-NOZ)Ph H
578 5,6-diCl CF3 CH2CH2-(3-N02)Ph H
579 5,6-diCl CF3 CH2CH2-(4-N02)Ph H
580 5,6-diCl CF3 CH2CH2-(2-NH2?Ph H
581 5 , 6-diCl CF3 CH2CH2- ( 3 -NH2 H
) Ph 582 5,6-diCl CF3 CH2CH2-(4-NH2)Ph H
583 5,6-diCl CF3 CH2CH2-(2-NMe2)Ph H
584 5,6-diCl CF3 CH2CH2-(3-NMe2)Ph H
585 5,6-diCl CF3 CHZCH2-(4-NMe2)Ph H
586 5,6-diCl CF3 CH2CH2-2-Pyridyl H
587 5,6-diCl CF3 CH2CH2-3-Pyridyl H
588 5,6-diCl CF3 CH2CH2-4-Pyridyl H
589 5,6-diCl CF3 CH2CH2-2-furanyl H
590 5,6-diCl CF3 CH2CH2-3-furanyl H
591 5,6-diCl CF3 CH2CH2-2-thienyl H
592 5,6-diCl CF3 CH2CH2-3-thienyl H
593 5,6-diCl CF3 CH2CH2-2-oxazolyl H
594 5,6-diCl CF3 CHZCH2-2-thiazolyl H
595 5,6-diCl CF3 CH2CH2-4-isoxazolyl H
596 5,6-diCl CF3 CH2CH2-2-imidazolyl H
597 5 , 6-diCl CF3 C~-cycPr CH3 598 5,6-diCl CF3 C~-2-Pyridyl CH3 599 5,6-diCl CF3 C~-3-Pyridyl CH3 600 5,6-diCl CF3 C~-4-Pyridyl CH3 601 5, 6-diCl CF3 C~-2-furanyl CH3 602 5,6-diCl CF3 C~-3-furanyl CH3 603 5,6-diCl CF3 C~-2-thienyl CH3 604 5,6-diCl CF3 C~-3-thienyl CH3 605 5,6-diCl CF3 C=C-cycPr CH3 606 5,6-diCl CF3 C=C-2-Pyridyl CH3 607 5,6-diCl CF3 C=C-3-Pyridyl CH3 608 5,6-diCl CF3 C=C-4-Pyridyl CH3 609 5,6-diCl CF3 C=C-2-furanyl CH3 610 5,6-diCl CF3 C=C-3-furanyl CH3 611 5,6-diCl CF3 C=C-2-thienyl CH3 612 5,6-diCl CF3 C=C-3-thienyl CH3 613 5,6-diCl CF3 CH2CH2-cycPr CH3 614 5,6-diCl CF3 CHZCH2-Ph CH3 615 5,6-diCl CF3 CH2CH2-2-Pyridyl CH3 616 5,6-diCl CF3 CH2CH2-3-Pyridyl CH3 617 5,6-diCl CF3 CH2CH2-4-Pyridyl CH3 618 5,6-diCl CF3 CH2CH2-2-furanyl CH3 619 5,6-diCl CF3 CH2CH2-3-furanyl CH3 620 5,6-diCl CF3 CH2CH2-2-thienyl CH3 621 5,6-diCl CF3 CH2CH2-3-thienyl CH3 622 5,6-diCl CF3 C~-cycPr CH2CH3 623 5,6-diCl CF3 C~-Ph CHZCH3 624 5,6-diCl CF3 C~-2-Pyridyl CH2CH3 625 5,6-diCl CF3 C~-3-Pyridyl CH2CH3 626 5,6-diCl CF3 C~-4-Pyridyl CH2CH3 627 5,6-diCl CF3 C~-2-furanyl CH2CH3 628 5,6-diCl CF3 C~-3-furanyl CH2CH3 629 5,6-diCl CF3 C~-2-thienyl CH2CH3 630 5,6-diCl CF3 C~-3-thienyl CHZCH3 631 5,6-diCl CF3 C=C-cycPr CH2CH3 632 5,6-diCl CF3 C=C-Ph CH2CH3 633 5,6-diCl CF3 C=C-2-Pyridyl CH2CH3 634 5,6-diCl CF3 C=C-3-Pyridyl CH2CH3 635 5,6-diCl CF3 C=C-4-Pyridyl CH2CH3 636 5,6-diCl CF3 C=C-2-furanyl CH2CH3 637 5,6-diCl CF3 C=C-3-furanyl CH2CH3 638 5,6-diCl CF3 C=C-2-thienyl CH2CH3 639 5,6-diCl CF3 C=C-3-thienyl CH2CH3 640 5,6-diCl CF3 CH2CH2-cycPr CH2CH3 641 5,6-di.Cl CF3 CH2CH2-Ph CH2CH3 642 5,6-diCl CF3 CH2CH2-2-Pyridyl CH2CH3 643 5,6-diCl CF3 CH2CH2-3-Pyridyl CH2CH3 644 5,6-diCl CF3 CH2CH2-4-Pyridyl CH2CH3 645 5,6-diCl CF3 CH2CH2-2-furanyl CHzCH3 646 5,6-diCl CF3 CH2CH2-3-furanyl CH2CH3 647 5,6-diCl CF3 CH2CH2-2-thienyl CH2CH3 648 5,6-diCl CF3 CH2CH2-3-thienyl CH2CH3 649 6-F CF3 C~CH2CH20H H
650 6-F CF3 C~-CH(OH)Me H
651 6-F CF3 C~-(2-C1)Ph H
652 6-F CF3 Cue- ( 3-C1 ) Ph H
653 6-F CF3 C~-(4-CI)Ph H
654 6-F CF3 Cue- (2-F) Ph H
655 6-F CF3 Cue- ( 3 -F ) Ph H
656 6-F CFg C~-(4-F)Ph H
657 6-F CF3 Cue- ( 2-OH) Ph H
658 6-F CF3 C~-(3-OH)Ph H
659 6-F CF3 C~-(4-OH)Ph H
660 6-F CF3 Cue- (2-OMe) Ph H
661 6-F CF3 Cue- ( 3 -OMe ) H
Ph 662 6-F CF3 C~-(4-OMe)Ph H
663 6-F CF3 Cue- (2-CN) Ph H
6 6 6 -F CF3 Cue- ( 3 -CN ) H
4 Ph 665 6-F CF3 Cue- ( 4-CN) Ph H
666 6-F CF3 Cue- ( 2-N02 ) H
Ph 667 6-F CF3 C~-(3-N02)Ph H
668 6-F CF3 Cue- ( 4-N02 ) H
Ph 669 6-F CF3 Cue- ( 2-NH2 ) H
Ph 670 6-F CF3 Cue- ( 3-NH2 ) H
Ph 671 6-F CF3 Cue- ( 4-NH2 ) H
Ph 672 6-F CF3 Cue- ( 2-NMe2 ) H
Ph 673 6-F CF3 Cue- ( 3 -NMe2 H
) Ph 674 6-F CF3 Cue- ( 4-NMe2 ) H
Ph 675 6-F CF3 C-C-3-Pyridyl H
676 6-F CF3 C~-4-Pyridyl H
677 6-F CF3 C~-2-furanyl H
' 678 6-F CF3 C~-3-furanyl H
679 6-F CF3 C~-2-thienyl H
680 6-F CF3 C~-3-thienyl H
681 6-F CF3 C~-2-oxazolyl H
682 6-F CF3 C=C-2-thiazolyl H
683 6-F CF3 C=C-4-isoxazolyl H
684 6-F CF3 C=C-2-imidazolyl H
685 6-F CF3 C=CCH2CHzOH H
686 6-F CF3 C=C-CH(OH)Me H
687 6-F CF3 C=C-(2-C1)Ph H
688 6-F CF3 C=C-(3-C1)Ph H
689 6-F CF3 C=C-(4-C1)Ph H
690 6-F CF3 C=C-(2-F)Ph H
691 6-F CF3 C=C-(3-F)Ph H
692 6-F CF3 C=C-(4-F)Ph H
693 6-F CF3 C=C-(2-OH)Ph H
694 6-F CF3 C=C-(3-OH)Ph H
695 6-F CF3 C=C-(4-OH)Ph H
696 6-F CF3 C=C-(2-OMe)Ph H
697 6-F CF3 C=C-(3-OMe)Ph H
698 6-F CF3 C=C-(4-OMe)Ph H
699 6-F CF3 C=C-(2-CN)Ph H
700 6-F CF3 C=C-(3-CN)Ph H
701 6-F CF3 C=C-(4-CN)Ph H
702 6-F CF3 C=C-(2-N02)Ph H
703 6-F CF3 C=C- ( 3-N02 ) Ph H
704 6-F CF3 C=C-(4-N02)Ph H
705 6-F CF3 C=C- ( 2-NH2 ) Ph H
706 6-F CF3 C=C-(3-NH2)Ph H
707 6-F CF3 C=C-(4-NHZ)Ph H
708 6-F CF3 C=C-(2-NMe2)Ph H
7 09 6-F CF3 C=C- ( 3 -NMe2 ) H
Ph 710 6-F CF3 C=C-(4-NMe2)Ph H
711 6-F CF3 C=C-3-Pyridyl H
712 6-F CF3 C=C-4-Pyridyl H
713 6-F CF3 C=C-2-furanyl H
714 6-F CF3 C=C-3-furanyl H
715 6-F CF3 C=C-2-thienyl H
716 6-F CF3 C=C-3-thienyl H
717 6-F CF3 C=C-2-oxazolyl H
718 6-F CF3 C=C-2-thiazolyl H
719 6-F CF3 C=C-4-isoxazolyl H
720 6-F CF3 C=C-2-imidazolyl H
721 6-F CF3 CH2CH2-cycPr H
723 6-F CF3 CH2CH2-CH(OH)Me H
724 6-F CF3 CH2CH2-(2-C1)Ph H
725 6-F CF3 CH2CH2-(3-C1)Ph H
726 6-F CF3 CHZCHZ-(4-C1)Ph H
727 6-F CF3 CH2CH2-(2-F)Ph H
728 6-F CF3 CH2CH2-(3-F)Ph H
729 6-F CF3 CH2CH2-(4-F)Ph H
730 6-F CF3 CH2CH2-(2-OH)Ph H
731 6-F CF3 CH2CH2-(3-OH)Ph H
732 6-F CF3 CH2CHZ-(4-OH)Ph H
733 6-F CF3 CH2CH2-(2-OMe)Ph H
734 6-F CF3 CH2CH2-(3-OMe)Ph H
735 6-F CF3 CH2CH2-(4-OMe)Ph H
736 6-F CF3 CH2CH2-(2-CN)Ph H
737 6-F CF3 CHZCH2-(3-CN)Ph H
738 6-F CF3 CH2CH2-(4-CN)Ph H
739 6-F CF3 CH2CH2-(2-N02)Ph H
740 6-F CF3 CH2CH2- ( 3 -N02 H
) Ph 741 6-F CF3 CH2CH2-(4-N02)Ph H
742 6-F CF3 CH2CH2-(2-NHZ)Ph H
743 6-F CF3 CHZCHZ-(3-NH2)Ph H
744 6-F CF3 CH2CH2-(4-NH2)Ph H
745 6-F CF3 CH2CH2-(2-NMe2)Ph H
746 6-F CF3 CH2CH2- ( 3 -NMe2 H
) Ph 747 6-F CF3 CH2CH2-(4-NMe2)Ph H
748 6-F CF3 CH2CHz-3-Pyridyl H
749 6-F CF3 CH2CH2-4-Pyridyl H
750 6-F CF3 CH2CH2-2-furanyl H
751 6-F CF3 CHZCH2-3-furanyl H
752 6-F CF3 CH2CH2-2-thienyl H
753 6-F CF3 CH2CH2-3-thienyl H
754 6-F CF3 CHZCH2-2-oxazolyl H
755 6-F CF3 CH2CH2-2-thiazolyl H
756 6-F CF3 CH2CH2-4-isoxazolyl H
757 6-F CF3 CH2CH2-2-imidazolyl H
758 6-F CF3 C~-cycPr CH3 759 6-F CF3 C~-iPr CH3 760 6-F CF3 C~-Pr CH3 7 61 6-F CF3 C~-Bu CH3 7 62 6-F CF3 C~-iBu CH3 763 6-F CF3 C=C-tBu CH3 764 6-F CF3 C=C-Et CH3 765 6-F CF3 C=C-Me CH3 766 6-F CF3 C=_C-Ph CH3 76? 6-F CF3 C~-2-Pyridyl CH3 768 6-F CF3 C~-3-Pyridyl CH3 769 6-F CF3 C~-4-Pyridyl CH3 770 6-F CF3 C~-2-furanyl CH3 771 6-F CF3 C~-3-furanyl CH3 772 6-F CF3 C~-2-thienyl CH3 773 6-F CF3 C~-3-thienyl CH3 774 6-F CF3 C=C-cycPr CH3 775 6-F CF3 C=C-iPr CH3 776 6-F CF3 C=C-Pr CH3 777 6-F CF3 C=C-Bu CH3 778 6-F CF3 C=C-iBu CH3 779 6-F CF3 C=C-tBu CH3 780 6-F CF3 C=C-Et CH3 781 6-F CF3 C=C-Me CH3 782 6-F CF3 C=C-Ph CH3 783 6-F CF3 C=C-2-Pyridyl CH3 784 6-F CF3 C=C-3-Pyridyl CH3 785 6-F CF3 C=C-4-Pyridyl CH3 786 6-F CF3 C=C-2-furanyl CH3 787 6-F CF3 C=C-3-furanyl CH3 788 6-F CF3 C=C-2-thienyl CH3 789 6-F CF3 C=C-3-thienyl CH3 790 6-F CF3 CH2CH2-cycPr CH3 791 6-F CF3 CH2CH2-Ph CH3 792 6-F CF3 CH2CH2-2-Pyridyl CH3 793 6-F CF3 CH2CH2-3-Pyridyl CH3 794 6-F CF3 CHZCH2-4-Pyridyl CHg 795 6-F CF3 CH2CH2-2-furanyl CH3 796 6-F CF3 CH2CH2-3-furanyl CH3 797 6-F CF3 CH2CH2-2-thienyl CH3 798 6-F CF3 CH2CH2-3-thienyl CH3 799 6-F CF3 C~-cycPr CH2CH3 800 6-F CF3 C=C-Ph CH2CH3 801 6-F CF3 C~-2-Pyridyl CH2CH3 802 6-F CF3 C~-3-Pyridyl CH2CH3 803 6-F CF3 C~-4-Pyridyl CH2CH3 804 S-F CF3 C~-2-furanyl CH2CH3 805 6-F CF3 C~-3-furanyl CH2CH3 806 6-F CF3 C~-2-thienyl CH2CH3 807 6-F CF3 C~-3-thienyl CH2CH3 808 6-F CF3 C=C-cycPr CH2CH3 809 6-F CF3 C=C-Ph CH2CH3 810 6-F CF3 C=C-2-Pyridyl CH2CH3 811 6-F CF3 C=C-3-Pyridyl CH2CH3 812 6-F CF3 C=C-4-Pyridyi CH2CH3 813 6-F CF3 C=C-2-furanyl CH2CH3 814 6-F CF3 C=C-3-furanyl CH2CH3 815 6-F CF3 C=C-2-thienyl CH2CH3 816 6-F CF3 C=C-3-thienyl CH2CH3 817 6-F CF3 CH2CH2-cycPr CH2CH3 818 6-F CF3 CHzCH2-Ph CH2CH3 819 6-F CF3 CH2CH2-2-Pyridyl CHZCH3 820 6-F CF3 CH2CH2-3-Pyridyl CHZCH3 821 6-F CF3 CH2CH2-4-Pyridyl CH2CH3 822 6-F CF3 CH2CH2-2-furanyl CH2CH3 823 6-F CF3 CH2CHz-3-furanyl CH2CH3 824 6-F CF3 CHZCH2-2-thienyl CH2CH3 825 6-F CF3 CH2CH2-3-thienyl CH2CH3 826 S-C1 CF3 C~-cycPr H
827 S-C1 CF3 C~CH2CHZOH H
828 S-C1 CF3 C=C-CH(OH)Me H
829 5-C1 CF3 C-C-Ph H
830 5-CI CF3 C~-(2-C1)Ph H
831 5-C1 CF3 C~-(3-C1)Ph H
832 5-C1 CF3 C~-(4-CI)Ph H
833 5-C1 CF3 C~-(2-F)Ph H
834 5-Cl CF3 C~-(3-F)Ph 835 S-C1 CF3 C~-(4-F)Ph H
836 5-C1 CF3 C~-(2-OH)Ph H
837 5-CI CF3 C~-(3-OH)Ph H
838 5-C1 CF3 C~-(4-OH)Ph H
839 5-C1 CF3 Cue- (2-OMe) Ph H
840 5-C1 CF3 C~-(3-OMe)Ph H
841 5-C1 CF3 Cue- ( 4-OMe ) Ph H
842 5-Cl CF3 Cue- ( 2-CN) Ph H
843 5-Cl CF3 Cue- ( 3 -CN) Ph H
844 5-C1 CF3 C~-(4-CN)Ph H
845 5-C1 CF3 C=C-(2-N02)Ph H
846 5-Cl CF3 C-C-(3-N02)Ph H
847 5-C1 CF3 C=C-(4-N02)Ph H
848 5-C1 CF3 Cue- ( 2-NHZ ) Ph H
849 5-C1 CF3 C-C-(3-NH2)Ph H
850 5-C1 CF3 C-C-(4-NH2)Ph H
851 5-C1 CF3 C-C-(2-NMe2)Ph H
852 5-C1 CF3 C=C-(3-NMe2)Ph H
853 5-C1 CF3 C-C-(4-NMez)Ph H
C~-2-Pyridyl H
855 5-Cl CF3 C~-2-Pyridyl H
856 5-C1 CF3 C~-3 H
-Pyridyl 857 5-C1 CF3 C~-4 H
-Pyridyl 858 5-C1 CF3 C~-2-furanyl H
859 5-C1 CF3 C~-3-furanyl H
860 5-C1 CF3 C~-2-thienyl H
861 5-C1 CF3 C=C-3-thienyl H
862 5-C1 CF3 C=C-2-oxazolyl H
863 5-C1 CF3 C~-2-thiazolyl H
864 5-C1 CF3 C~-4-isoxazolyl H
865 5-CI CF3 C=C-2-imidazolyl H
866 5-C1 CF3 C=C-cycPr H
867 5-C1 CF3 C=CCH2CH20H H
868 5-C1 CF3 C=C-CH(OH)Me H
869 5-C1 CF3 C=C-Ph H
870 5-C1 CF3 C=C-(2-C1)Ph H
871 5-C1 CF3 C=C- ( 3 -C1 ) Ph H
872 5-C1 CF3 C=C-(4-C1)Ph H
873 5-C1 CF3 C=C-(2-F)Ph H
874 5-C1 CF3 C=C-(3-F)Ph H
875 5-C1 CF3 C=C-(4-F)Ph H
876 5-C1 CF3 C=C-(2-OH)Ph H
877 5-C1 CF3 C=C- ( 3 -OH ) Ph H
878 5-Cl CF3 C=C-(4-OH)Ph H
879 5-Cl CF3 C=C-(2-OMe)Ph H
880 5-C1 CF3 C=C-(3-OMe)Ph H
881 5-C1 CF3 C=C-(4-OMe)Ph H
882 5-C1 CF3 C=C-(2-CN)Ph H
883 5-C1 CF3 C=C-(3-CN)Ph H
884 5-C1 CF3 C=C-(4-CN)Ph H
885 5-C1 CFg C=C-(2-NOZ)Ph H
886 5-C1 CF3 C=C-(3-N02)Ph H
887 5-C1 CF3 C=C-(4-N02)Ph H
888 5-C1 CF3 C=C-(2-NH2)Ph H
889 5-C1 CF3 C=C-(3-NHZ)Ph H
890 5-CI CF3 C=C-(4-NH2)Ph H
891 5-C1 CF3 C=C-(2-NMe2)Ph H
892 5-C1 CF3 C=C-(3-NMe2)Ph H
893 5-C1 CF3 C=C-(4-NMe2)Ph H
894 5-C1 CF3 C=C-2-Pyridyl H
895 5-C1 CF3 C=C-2-Pyridyl H
896 5-C1 CF3 C=C-3-Pyridyl H
897 5-C1 CF3 C=C-4-Pyridyl H
898 5-C1 CF3 C=C-2-furanyl H
899 5-C1 CF3 C=C-3-furanyl H
900 5-C1 CF3 C=C-2-thieriyl H
901 5-C1 CF3 C=C-3-thienyl H
902 5-C1 CF3 C=C-2-oxazolyl H
903 5-C1 CF3 C=C-2-thiazolyl H
904 5-C1 CF3 C=C-4-isoxazolyl H
905 5-C1 CF3 C=C-2-imidazolyl H
906 5-C1 CF3 CH2CH2-cycPr H
907 5-C1. CF3 CH2CH2CH2CH20H H
908 5-C1 CF3 CH2CH2-CH(OH)Me H
909 5-CI CF3 CH2CHZPh H
910 5-Cl CF3 CH2CH2-(2-C1)Ph H
911 5-C1 CF3 CH2CH2-(3-Cl)Ph H
912 5-C1 CF3 CH2CH2-(4-C1)Ph H
913 5-Cl CF3 CH2CH2-(2-F)Ph H
914 5-C1 CF3 CH2CH2-(3-F)Ph H
915 5-C1 CF3 CH2CH2-(4-F)Ph H
916 5-C1 CF3 CH2CH2-(2-OH)Ph H
917 5-C1 CF3 CH2CH2-(3-OH)Ph H
918 5-C1 CF3 CH2CH2-(4-OH)Ph H
919 5-C1 CF3 CH2CHz-(2-OMe)Ph H
920 5-C1 CF3 CH2CH2-(3-OMe)Ph H
921 5-C1 CF3 CHZCH2-(4-OMe)Ph H
922 5-CI CF3 CH2CH2-(2-CN)Ph H
923 5-C1 CF3 CH2CH2-{3-CN)Ph H
924 5-C1 CF3 CH2CH2-(4-CN)Ph H
925 5-Cl CF3 CH2CH2-(2-N02)Ph H
926 5-C1 CF3 CH2CH2-(3-N02)Ph H
927 5-C1 CF3 CH2CH2-(4-N02)Ph H
928 5-C1 CF3 CH2CH2- {2-NH2 ) H
Ph 929 5-C1 CF3 CH2CH2-(3-NH2)Ph H
930 5-C1 CF3 CH2CH2-(4-NH2)Ph H
931 5-C1 CF3 CH2CH2-(2-NMe2)Ph H
932 5-C1 CF3 CH2CH2-{3-NMe2)Ph H
933 5-Cl CF3 CHZCH2-(4-NMe2)Ph H
934 5-C1 CF3 CH2CH2-2-Pyridyl H
935 5-C1 CF3 CH2CH2-3-Pyridyl H
936 5-C1 CF3 CH2CH2-4-Pyridyl H
937 5-C1 CF3 CH2CH2-2-furanyl H
938 5-C1 CF3 CH2CHZ-3-furanyl H
939 5-CZ CF3 CH2CH2-2-thienyl H
940 5-C1 CF3 CH2CH2-3-thienyl H
941 5-C1 CF3 CH2CH2-2-oxazolyl H
942 5-C1 CF3 CH2CH2-2-thiazolyl H
943 5-C1 CF3 CH2CH2-4-isoxazolyl H
944 5-Cl CF3 CH2CHZ-2-imidazolyl H
945 5-C1 CF3 C~-cycPr CH3 946 5-Cl CF3 C---.C-Ph CH3 947 5-Cl CF3 C=~-2-Pyridyl CH3 948 5-C1 CF3 C~-3-Pyridyl CH3 949 5-Cl CF3 C~-4-Pyridyl CH3 950 5-C1 CF3 C~-2-furanyl CH3 951 5-Cl CF3 C--_-C-3-furanyl CH3 952 5-Cl CF3 C-_.C-2-thienyl CH3 953 5-C1 CF3 C~-3-thienyl CH3 954 5-Cl CF3 C=C-cycPr CH3 955 5-C1 CF3 C=C-Ph CH3 956 5-C1 CF3 C=C-2-Pyridyl CH3 957 5-C1 CF3 C=C-3-Pyridyl CH3 958 5-C1 CF3 C=C-4-Pyridyl CH3 959 5-C1 CF3 C=C-2-furanyl CH3 960 5-Cl CF3 C=C-3-furanyl CH3 961 5-C1 CF3 C=C-2-thienyl CH3 962 5-C1 CF3 C=C-3-thienyl CH3 963 5-C1 CF3 CHZCHZ-cycPr CH3 964 5-C1 CF3 CH2CHZ-Ph CH3 965 5-C1 CF3 CH2CHZ-2-Pyridyl CH3 966 5-C1 CF3 CH2CHZ-3-Pyridyl CH3 967 5-C1 CF3 CH2CHZ-4-Pyridyl CH3 968 5-C1 CF3 CH2CH2-2-furanyl CH3 969 5-Cl CF3 CH2CHZ-3-furanyl CH3 970 5-C1 CF3 CH2CHZ-2-thienyl CH3 971 5-C1 CF3 CH2CHZ-3-thienyl CHg 972 5-C1 CF3 C~-cycPr CHZCH3 973 5-C1 CF3 C~-Ph CHZCH3 974 5-Cl CF3 C~-2-Pyridyl CH2CH3 975 5-C1 CF3 C~-3-Pyridyl CH2CH3 976 5-C1 CF3 C~-4-Pyridyl CH2CH3 977 5-C1 CF3 C~-2-furanyl CH2CH3 978 5-C1 CF3 C~-3-furanyl CH2CH3 979 5-C1 CF3 C~-2-thienyl CH2CH3 980 5-C1 CF3 C=C-3-thienyl CH2CH3 981 5-C1 CF3 C=C-cycPr CH2CH3 982 5-C1 CF3 C=C-Ph CHZCH3 983 5-C1 CF3 C=C-2-Pyridyl CH2CH3 984 5-C1 CF3 C=C-3-Pyridyl CH2CH3 985 5-C1 CF3 C=C-4-Pyridyl CH2CHg 986 5-C1 CF3 C=C-2-furanyl CH2CH3 987 5-C1 CF3 C=C-3-furanyl CH2CH3 988 5-C1 CF3 C=C-2-thienyl CH2CH3 989 5-C1 CF3 C=C-3-thienyl CH2CH3 990 5-C1 CF3 CH2CH2-cycPr CH2CH3 991 5-C1 CF3 CH2CH2-Ph CHZCH3 992 5-C1 CF3 CH2CH2-2-Pyridyl CH2CH3 993 5-C1 CF3 CH2CH2-3-Pyridyl CH2CH3 994 5-C1 CF3 CH2CH2-4-Pyridyl CH2CH3 995 5-C1 CF3 CH2CH2-2-furanyl CHZCH3 996 5-CI CFg CH2CH2-3-furanyl CH2CH3 997 5-C1 CF3 CH2CH2-2-thienyl CH2CH3 998 5-C1 CF3 CHZCH2-3-thienyl CH2CH3 999 5-F CF3 C~-cycPr H
1000 5-F CF3 C=_CCH2CH20H H
1001 5-F CF3 C~-CH(OH)Me H
1002 5-F CF3 C=C-Ph H
1003 5-F CF3 C~-(2-C1)Ph H
1004 5-F CF3 C~-(3-C1) Ph H
1005 5-F CF3 Cue- ( 4-C1 ) Ph H
1006 5-F CF3 C~-(2-F) Ph H
1007 5-F CF3 C~-(3-F)Ph H
1008 5-F CF3 C~-(4-F)Ph H
1009 5-F CF3 C~-(2-OH)Ph H
1010 5 -F CF3 Cue- ( 3 -OH ) Ph H
1011 5-F CF3 Cue- ( 4-OH) Ph H
1012 5-F CF3 C~-(2-OMe)Ph H
1013 5-F CF3 Cue- ( 3 -OMe ) H
Ph 1014 5-F CF3 C~-(4-OMe)Ph H
1015 5-F CF3 C=C-(2-CN)Ph H
1016 5-F CF3 C-C-(3-CN)Ph 1017 5-F CF3 C=C-(4-CN)Ph H
1018 5-F CF3 C=C-(2-NOZ)Ph H
1019 5-F CF3 C=C-(3-N02)Ph H
1020 S-F CF3 C=C-(4-N02)Ph H
1021 5-F CF3 C=C-(2-NHZ)Ph H
1022 5-F CF3 C=C- ( 3 -NH2 ) Ph H
1023 5-F CF3 C=C-(4-NHZ)Ph H
1024 5-F CF3 C=C-(2-NMe2)Ph H
1025 5-F CF3 C=C-(3-NMe2)Ph H
1026 5-F CF3 C=C-(4-NMe2)Ph H
1027 5-F CF3 C~-2-Pyridyl H
1028 5-F CF3 C~-2-Pyridyl H
1029 5-F CFg C~-3-Pyridyl H
1030 5-F CF3 C~-4-Pyridyl H
1031 5-F CF3 C~-2-furanyl H
1032 5-F CF3 C~-3-furanyl H
1033 5-F CF3 C~-2-thienyl H
1034 5-F CF3 C~-3-thienyl H
1035 5-F CF3 C=C-2-oxazolyi H
1036 5-F CF3 CSC-2-thiazolyl H
1037 5-F CF3 C=C-4-isoxazolyl H
1038 5-F CF3 C=C-2-imidazolyl H
1039 5-F CF3 C=C-cycPr H
1040 5-F CF3 C=CCHZCH20H H
1041 5-F CF3 C=C-CH(OH)Me H
1042 5-F CF3 C=C-Ph H
1043 S-P' CF3 C=C-(2-C1)Ph H
1044 5-F CF3 C=C-(3-C1)Ph H
1045 5-F CF3 C=C-(4-C1)Ph H
1046 5-F CF3 C=C-(2-F) Ph H
1047 5-F CF3 C=C-(3-F)Ph H
1048 5-F CF3 C=C-(4-F)Ph H
1049 5-F CF3 C=C-(2-OH)Ph H
1050 5-F CF3 C=C-(3-OH)Ph H
1051 5-F CF3 C=C-(4-OH)Ph H
1052 5-F CF3 C=C-(2-OMe)Ph H
1053 5-F CF3 C=C-(3-OMe)Ph H
1054 5-F CF3 C=C-{4-OMe)Ph H
1055 5-F CF3 C=C-(2-CN)Ph H
1056 5-F CF3 C=C-(3-CN)Ph H
1057 5-F CF3 C=C-(4-CN)Ph H
1058 5-F CF3 C=C-{2-N02)Ph H
1059 5-F CF3 C=C-(3-N02)Ph H
1060 5-F CF3 C=C-(4-N02)Ph H
1061 5-F CF3 C=C- ( 2-NH2 ) Ph H
1062 5-F CF3 C=C-(3-NH2)Ph H
1063 5-F CF3 C=C-(4-NH2)Ph H
1064 5-F CF3 C=C-{2-NMe2)Ph H
1065 5-F CF3 C=C-(3-NMe2)Ph H
1066 5-F CF3 C=C-(4-NMe2)Ph H
1067 5-F CF3 C=C-2-Pyridyl H
1068 5-F CF3 C=C-2-Pyridyl H
1069 5-F CF3 C=C-3-Pyridyl H
1070 5-F CF3 C=C-4-Pyridyl H
1071 5-F CF3 C=C-2-furanyl H
1072 5-F CF3 C=C-3-furanyl H
1073 5-F CF3 C=C-2-thienyl H
1074 5-F CF3 C=C-3-thienyl H
1075 5-F CF3 C=C-2-oxazolyl H
1076 5-F CF3 C=C-2-thiazolyl H
2077 5-F CF3 C=C-4-isoxazolyl H
1078 5-F CF3 C=C-2-imidazolyl H
1079 5-F CF3 CH2CH2-cycPr H
1081 5-F CF3 CH2CH2-CH(OH)Me H
1082 5-F CF3 CH2CH2Ph H
1083 5-F CF3 CH2CH2-(2-C1}Ph H
1084 5-F CF3 CH2CH2- ( 3 -C1 ) Ph H
1085 5-F CF3 CH2CH2-(4-C1)Ph H
1086 5-F CF3 CHZCH2-(2-F)Ph H
1087 5-F CF3 CHZCHZ-(3-F)Ph H
1088 5-F CF3 CHZCH2-(4-F)Ph H
1089 5-F CF3 CH2CH2-(2-OH)Ph H
1090 5-F CF3 CH2CH2-(3-OH)Ph H
1091 5-F CF3 CH2CH2-(4-OH)Ph H
1092 5-F CF3 CH2CH2-(2-OMe)Ph H
1093 5-F CF3 CH2CH2-(3-OMe)Ph H
1094 5-F CF3 CHZCH2-(4-OMe)Ph H
1095 5-F CF3 CH2CH2-(2-CN)Ph H
1096 5-F CF3 CH2CH2-(3-CN)Ph H
1097 5-F CF3 CH2CH2-(4-CN)Ph H
1098 5-F CF3 CH2CH2-(2-N02)Ph H
1099 5-F CF3 CH2CH2-(3-N02)Ph H
1100 5-F CF3 CH2CH2-(4-N02)Ph H
1101 5-F CF3 CH2CH2-(2-NH2)Ph H
1102 5-F CF3 CH2CH2-(3-NH2)Ph H
1103 5-F CF3 CH2CH2-(4-NH2)Ph H
1104 5-F CF3 CH2CH2-(2-NMe2)Ph H
1105 5-F CF3 CH2CH2-(3-NMe2)Ph H
1106 5-F CF3 CH2CH2-(4-NMe2)Ph H
1107 5-F CF3 CH2CH2-2-Pyridyl H
1108 5-F CF3 CH2CH2-3-Pyridyl H
1109 5-F CF3 CH2CH2-4-Pyridyl H
1110 5-F CF3 CH2CH2-2-furanyl H
1111 5-F CF3 CH2CH2-3-furanyl H
1112 5-F CF3 CH2CH2-2-thienyl H
1113 5-F CF3 CH2CH2-3-thienyl H
1114 5-F CF3 CH2CH2-2-oxazolyl H
1115 5-F CF3 CH2CH2-2-thiazolyl H
1116 5-F CF3 CH2CH2-4-isoxazolyl H
1117 5-F CF3 CH2CH2-2-imidazolyl H
1118 5-F CF3 C-C-cycPr CH3 1119 5-F CF3 C=C-Ph CH3 1120 5-F CF3 C-C-2-Pyridyl CH3 1121 5-F CF3 C~-3-Pyridyl CH3 1122 5-F CF3 C~-4-Pyridyl CH3 1123 5-F CF3 C~-2-furanyl CH3 1124 5-F CF3 C~-3-furanyl CH3 1125 5-F CF3 C~-2-thienyl CH3 1126 5-F CF3 C~-3-thienyl CH3 1127 5-F CF3 C=C-cycPr CH3 1128 5-F CF3 C=C-Ph CH3 1129 5-F CF3 C=C-2-Pyridyl CH3 1130 5-F CF3 C=C-3-Pyridyl CH3 1131 5-F CF3 C=C-4-Pyridyl CH3 1132 5-F CF3 C=C-2-furanyl CH3 1133 5-F CF3 C=C-3-furanyl CH3 1134 5-F CF3 C=C-2-thienyl CH3 1135 5-F CF3 C=C-3-thienyl CH3 1136 5-F CF3 CH2CH2-cycPr CH3 1137 5-F CF3 CH2CH2-Ph CH3 1138 5-F CF3 CH2CH2-2-Pyridyl CH3 1139 5-F CF3 CHZCH2-3-Pyridyl CH3 1140 5-F CF3 CH2CH2-4-Pyridyl CH3 2141 5-F CF3 CH2CH2-2-furanyl CH3 1142 5-F CF3 CH2CHz-3-furanyl CH3 1143 5-F CF3 CH2CH2-2-thienyl CH3 1144 5-F CF3 CH2CH2-3-thienyl CH3 1145 5-F CF3 C~-cycPr CH2CH3 1146 5-F CF3 C----C-Ph CH2CH3 1147 5-F CF3 C~-2-Pyridyl CH2CH3 1148 5-F CF3 C~-3-Pyridyl CH2CH3 1149 5-F CF3 C~-4-Pyridyl CH2CH3 1150 5-F CF3 C=C-2-furanyl CH2CH3 1151 5-F CF3 C=C-3-furanyl CHZCH3 1152 5-F CF3 C-C-2-thienyl CH2CH3 1153 5-F CF3 C~-3-thienyl CH2CH3 1154 5-F CF3 C=C-cycPr CHZCH3 1155 5-F CF3 C=C-Ph CH2CH3 1156 5-F CF3 C=C-2-Pyridyl CH2CH3 1157 5-F CF3 C=C-3-Pyridyl CH2CH3 1158 5-F CF3 C=C-4-Pyridyl CH2CH3 1159 5-F CF3 C=C-2-furanyl CH2CH3 1160 5-F CF3 C=C-3-furanyl CH2CH3 1161 5-F CF3 C=C-2-thienyl CH2CH3 1162 5-F CF3 C=C-3-thienyl CH2CH3 1163 5-F CF3 CH2CH2-cycPr CH2CH3 1164 5-F CF3 CH2CH2-Ph CHZCH3 1165 5-F CF3 CH2CH2-2-Pyridyl CH2CH3 1166 5-F CF3 CHZCH2-3-Pyridyl CH2CH3 1167 5-F CF3 CH2CH2-4-Pyridyl CH2CH3 1168 5-F CF3 CH2CH2-2-furanyl CH2CH3 1169 5-F CF3 CH2CH2-3-furanyl CH2CH3 1170 5-F CF3 CH2CH2-2-thienyl CH2CH3 1171 5-F CF3 CH2CH2-3-thienyl CHZCH3 1172 5-C1,6-F CF3 C~-cycPr H
1173 5-C1,6-F CF3 C~-Ph H
1174 5-C1,6-F CF3 C~-2-Pyridyl H
1175 5-C1,6-F CF3 H
C~-3 -Pyridyl 1176 5-C1,6-F CF3 C=C-4-Pyridyl H
1177 5-C1,6-F CF3 C~-2-furanyl H
1178 5-C1,6-F CF3 C~-3-furanyl H
1179 5-C1,6-F CF3 C~-2-thienyl H
1180 5-C1,6-F CF3 C~-3-thienyl H
1181 5-C1,6-F CF3 C=C-cycPr H
1182 5-C1,6-F CF3 C=C-Ph H
1183 5-C1,6-F CF3 C=C-2-Pyridyl H
1184 5-C1,6-F CF3 C=C-3-Pyridyl H
1185 5-C1,6-F CF3 C=C-4-Pyridyl H
1186 5-C1,6-F CF3 C=C-2-furanyl H
1187 5-C1,6-F CF3 C=C-3-furanyl H
1188 5-C1,6-F CF3 C=C-2-thienyl H
1189 5-C1,6-F CF3 C=C-3-thienyl H
1190 5-C1,6-F CF3 CH2CH2-cycPr H
1191 5-C1,6-F CF3 CH2CH2-Ph H
1192 5-C1,6-F CF3 CHZCHz-2-Pyridyl H
1193 5-C1,6-F CF3 CH2CH2-3-Pyridyl H
1194 5-C1,6-F CF3 CH2CH2-4-Pyridyl H
1195 5-C1,6-F CF3 CH2CH2-2-furanyl H
1196 5-C1,6-F CF3 CH2CH2-3-furanyl H
1197 5-C1,6-F CF3 CH2CH2-2-thienyl H
1198 5-C1,6-F CF3 CH2CH2-3-thienyl H
1199 5-C1, 6-F CF3 C~-cycPr CH3 1200 5-C1,6-F CF3 C~-Ph CH3 2201 5-C1,6-F CF3 C~-2-Pyridyl CH3 1202 5-C1,6-F CF3 C~-3-Pyridyl CH3 1203 5-C1,6-F CF3 C~-4-Pyridyl CH3 1204 5-C1,6-F CF3 C~-2-furanyl CH3 1205 5-C1,6-F CF3 C~-3-furanyl CH3 1206 5-C1,6-F CF3 C~-2-thienyl CH3 1207 5-C1,6-F CF3 C~-3-thienyl CH3 1208 5-C1,6-F CF3 C=C-cycPr CH3 1209 5-C1,6-F CF3 C=C-Ph CH3 1210 5-C1,6-F CF3 C=C-2-Pyridyl CH3 1211 5-C1,6-F CF3 C=C-3-Pyridyl CH3 1212 5-C1,6-F CF3 C=C-4-Pyridyl CH3 1213 5-C1,6-F CF3 C=C-2-furanyl CH3 1214 5-C1,6-F CF3 C=C-3-furanyl CH3 1215 5-C1,6-F CF3 C=C-2-thienyl CH3 1216 5-C1,6-F CF3 C=C-3-thienyl CH3 1217 5-C1,6-F CF3 CH2CH2-cycPr CH3 1218 5-C1,6-F CF3 CH2CH2-Ph CH3 1219 5-C1,6-F CF3 CHZCH2-2-Pyridyl CH3 1220 5-C1,6-F CF3 CH2CH2-3-Pyridyl CH3 1221 5-C1,6-F CF3 CH2CH2-4-Pyridyl CH3 1222 5-C1,6-F CF3 CH2CH2-2-furanyl CH3 1223 5-C1,6-F CF3 CHZCHz-3-furanyl CH3 1224 5-C1,6-F CF3 CHZCH2-2-thienyl CH3 1225 5-C1,6-F CF3 CH2CH2-3-thienyl CH3 2226 5-F,6-C1 CF3 C~-cycPr H
1227 5-F, 6-C1 CF3 C~-Ph H
1228 5-F,6-C1 CF3 C~-2-Pyridyl H
1229 5-F,6-C1 CF3 C~-3-Pyridyl 1230 5-F,6-C1 CF3 C=c-4-Pyridyl H
1231 5-F,6-C1 CF3 CSC-2-furanyl H
1232 5-F,6-C1 CF3 C~-3-furanyl H
1233 5-F,6-C1 CF3 C~-2-thienyl H
1234 5-F,6-C1 CF3 C~-3-thienyl H
1235 5-F,6-C1 CF3 C=C-cycPr H
1236 5-F,6-C1 CF3 C=C-Ph H
1237 5-F,6-C1 CF3 C=C-2-Pyridyl H
1238 5-F,6-C1 CF3 C=C-3-Pyridyl H
1239 5-F,6-C1 CF3 C=C-4-Pyridyl H
1240 5-F,6-C1 CF3 C=C-2-furanyl H
1241 5-F,6-C1 CF3 C=C-3-furanyl H
1242 5-F,6-C1 CF3 C=C-2-thienyl H
1243 5-F,6-C1 CF3 C=C-3-thienyl H
1244 5-F,6-C1 CF3 CH2CH2-cycPr H
1245 5-F,6-C1 CF3 CH2CH2-Ph H
1246 5-F,6-C1 CF3 CH2CH2-2-Pyridyl H
1247 5-F,6'-C1 CF3 CH2CH2-3-Pyridyl H
1248 5-F,6-C1 CF3 CH2CH2-4-Pyridyl H
1249 5-F,6-C1 CF3 CH2CH2-2-furanyl H
1250 5-F,6-C1 CF3 CH2CH2-3-furanyl H
1251 5-F,6-C1 CF3 CH2CH2-2-thienyl H
1252 5-F,6-C1 CF3 CH2CH2-3-thienyl H
1253 5-F,6-C1 CF3 C~-cycPr CH3 1254 5-F,6-C1 CF3 C=C-Ph CH3 1255 5-F,6-C1 CF3 C=C-2-Pyridyl CH3 1256 5-F,6-C1 CF3 C=C-3-Pyridyl CH3 1257 5-F,6-C1 CF3 C=C-4-Pyridyl CH3 1258 5-F,6-C1 CF3 C-C-2-furanyl CH3 1259 5-F,6-C1 CF3 C-C-3-furanyl CH3 1260 5-F,6-C1 CF3 C=_C-2-thienyl CH3 1261 5-F,6-C1 CF3 C~-3-thienyl CH3 1262 5-F,6-C1 CF3 C=C-cycPr CH3 1263 5-F,6-C1 CF3 C=C-Ph CH3 1264 5-F,6-C1 CF3 C=C-2-Pyridyl CH3 1265 5-F,6-C1 CF3 C=C-3-Pyridyl CH3 1266 5-F,6-Cl CF3 C=C-4-Pyridyl CH3 1267 5-F,6-C1 CF3 C=C-2-furanyl CH3 1268 5-F,6-C1 CF3 C=C-3-furanyl CH3 1269 5-F,6-C1 CF3 C=C-2-thienyl CH3 1270 5-F,6-C1 CF3 C=C-3-thienyl CH3 1271 5-F,6-C1 CF3 CH2CH2-cycPr CH3 1272 5-F,6-C1 CF3 CH2CH2-Ph CHg 1273 5-F,6-CI CF3 CH2CH2-2-Pyridyl CH3 1274 5-F,6-CI CF3 CHZCH2-3-Pyridyl CH3 1275 5-F,6-C1 CF3 CHZCH2-4-Pyridyl CH3 1276 5-F,6-C1 CF3 CH2CH2-2-furanyl CH3 1277 5-F,6-C1 CF3 CH2CH2-3-furanyl CH3 1278 5-F,6-Cl CF3 CH2CH2-2-thienyl CH3 1279 5-F,6-C1 CF3 CH2CH2-3-thienyl CH3 1280 6-C1,8-F CF3 C~-cycPr H
1281 6-C1,8-F CF3 C=C-Ph H
1282 6-C1,8-F CF3 C~-2-Pyridyl H
1283 6-C1,8-F CF3 C~-3-Pyridyl H
1284 6-C1,8-F CF3 C~-4-Pyridyl H
1285 6-C1,8-F CF3 C~-2-furanyl H
1286 6-C1,8-F CF3 C~-3-furanyl H
,.
1287 6-C1,8-F CF3 C~-2-thienyl H
1288 6-C1,8-F CF3 C~-3-thienyl H
1289 6-C1,8-F CF3 C=C-cycPr H
' 1290 6-C1,8-F CF3 C=C-Ph H
1291 6-C1,8-F CF3 C=C-2-Pyridyl H
1292 6-C1,8-F CF3 C=C-3-Pyridyl H
1293 6-C1,8-F CF3 C=C-4-Pyridyl H
1294 6-C1,8-F CF3 C=C-2-furanyl H
1295 6-C1,8-F CF3 C=C-3-furanyl H
1296 6-C1,8-F CF3 C=C-2-thienyl H
1297 6-C1,8-F CF3 C=C-3-thienyl H
1298 6-C1,8-F CF3 CH2CH2-cycPr H
1299 6-C1,8-F CF3 CH2CH2-Ph H
1300 6-C1,8-F CF3 CH2CH2-2-Pyridyl H
1301 6-C1,8-F CF3 CHZCH2-3-Pyridyl H
1302 6-C1,8-F CF3 CH2CH2-4-Pyridyl H
1303 6-C1,8-F CF3 CH2CH2-2-furanyl H
1304 6-C1,8-F CF3 CH2CH2-3-furanyl H
1305 6-C1,8-F CF3 CH2CH2-2-thienyl H
1306 6-C1,8-F CF3 CH2CH2-3-thienyl H
1307 6-C1,8-F CF3 C~-cycPr CH3 1308 6-C1,8-F CF3 C=C-Ph CH3 1309 6-C1,8-F CF3 C~-2-Pyridyl CH3 1310 6-C1,8-F CF3 C~-3-Pyridyl CH3 1311 6-C1,8-F CF3 C~-4-Pyridyl CH3 1312 6-C1,8-F CF3 C~-2-furanyl CH3 1313 6-C1,8-F CF3 C~-3-furanyl CH3 1314 6-CI,B-F CF3 C~-2-thienyl CH3 1315 6-C1,8-F CF3 C~-3-thienyl CH3 1316 6-C1,8-F CF3 C=C-cycPr CH3 1317 6-C1,8-F CF3 C=C-Ph CH3 1318 6-C1,8-F CF3 C=C-2-Pyridyl CH3 1319 6-C1,8-F CF3 C=C-3-Pyridyl CH3 1320 6-C1,8-F CF3 C=C-4-Pyridyl CH3 1321 6-C1,8-F CF3 C=C-2-furanyl CH3 1322 6-C1,8-F CF3 C=C-3-furanyl CH3 1323 6-C1,8-F CF3 C=C-2-thienyl CH3 1324 6-C1,8-F CF3 C=C-3-thienyl CH3 1325 6-C1,8-F CF3 CHZCH2-cycPr CH3 1326 6-C1,8-F CF3 CH2CH2-Ph CH3 1327 6-C1,8-F CF3 CH2CH2-2-Pyridyl CH3 1328 6-C1,8-F CF3 CH2CH2-3-Pyridyl CH3 1329 6-C1,8-F CF3 CH2CH2-4-Pyridyl CH3 1330 6-C1,8-F CF3 CH2CH2-2-furanyl CH3 1331 6-C1,8-F CF3 CH2CH2-3-furanyl CH3 1332 6-C1,8-F CF3 CH2CH2-2-thienyl CH3 1333 6-C1,8-F CF3 CH2CH2-3-thienyl CH3 1334 6-CH3 CF3 C~-cycPr H
1335 6-CH3 CF3 C~-Ph H
1336 6-CH3 CF3 C~-2-Pyridyl H
1337 6-CH3 CF3 C~-3-Pyridyl H
1338 6-CH3 CF3 C~-4-Pyridyl H
1339 6-CH3 CF3 C~-2-furanyl H
1340 6-CH3 CF3 C~-3-furanyl H
1341 6-CH3 CF3 C~-2-thienyl H
1342 6-CH3 CF3 C~-3-thienyl H
1343 6-CH3 CF3 C=C-cycPr H
1344 6-CH3 CF3 C=C-Ph H
1345 6-CH3 CF3 C=C-2-Pyridyl H
1346 6-CH3 CF3 C=C-3-Pyridyl H
1347 6-CH3 CF3 C=C-4-Pyridyl H
1348 6-CH3 CF3 C=C-2-furanyl H
1349 6-CH3 CF3 C=C-3-furanyl H
1350 6-CH3 CF3 C=C-2-thienyl H
1351 6-CH3 CF3 C=C-3-thienyl H
1352 6-CH3 CF3 CH2CH2-cycPr H
1353 6-CH3 CF3 CH2CH2-Ph H
1354 6-CH3 CF3 CH2CH2-2-Pyridyl H
1355 5-CH3 CF3 CHZCH2-3-Pyridyl H
1356 6-CH3 CF3 CH2CH2-4-Pyridyl H
1357 6-CH3 CF3 CHZCH2-2-furanyl H
1358 6-CH3 CF3 CH2CH2-3-furanyl H
1359 6-CH3 CF3 CH2CH2-2-thienyl H
1360 6-CH3 CF3 CH2CH2-3-thienyl H
1361 6-CH3 CF3 C--_.C-cycPr CH3 1362 6-CH3 CF9 C=C-Ph CH3 1363 6-CH3 CF3 CSC-2-Pyridyl CH3 1364 6-CH3 CF3 C~-3-Pyridyl CH3 1365 6-CH3 CF3 C~-4-Pyridyl CH3 1366 6-CH3 CF3 C~-2-furanyl CH3 1367 6-CH3 CF3 C~-3-furanyl CH3 1368 6-CH3 CF3 C~-2-thienyl CH3 1369 6-CH3 CF3 C~-3-thienyl CH3 1370 6-CH3 CF3 C=C-cycPr CH3 1371 6-CH3 CF3 C=C-Ph CH3 1372 6-CH3 CF3 C=C-2-Pyridyl CH3 1373 6-CH3 CF3 C=C-3-Pyridyl CH3 1374 6-CH3 CF3 C=C-4-Pyridyl CH3 1375 6-CH3 CF3 C=C-2-furanyl CH3 1376 6-CH3 CF3 C=C-3-furanyl CH3 1377 6-CH3 CF3 C=C-2-thienyl CH3 1378 6-CH3 CF3 C=C-3-thienyl CHg 1379 6-CH3 CF3 CH2CH2-cycPr CH3 1380 6-CH3 CF3 CH2CH2-Ph CH3 1381 6-CH3 CF3 CH2CH2-2-Pyridyl CH3 1382 6-CH3 CF3 CHZCH2-3-Pyridyl CH3 1383 6-CH3 CF3 CHZCH2-4-Pyridyl CH3 1384 6-CH3 CF3 CH2CH2-2-furanyl CH3 1385 6-CH3 CF3 CH2CH2-3-furanyl CH3 1386 6-CH3 CF3 CH2CH2-2-thienyl CH3 1387 6-CH3 CF3 CH2CH2-3-thienyl CH3 1388 6-COCH3 CF3 C=C-cycPr H
1389 6-COCH3 CF3 C=C-Ph H
1390 6-COCH3 CF3 C=C-2-Pyridyl H
1391 6-COCH3 CF3 C~-3-Pyridyl H
1392 6-COCH3 CF3 C~-4-Pyridyl H
1393 6-COCH3 CF3 C=C-2-furanyl H
1394 6-COCH3 CF3 C~-3-furanyl H
1395 6-COCH3 CF3 C~-2-thienyl H
1396 6-COCH3 CF3 C~-3-thienyl H
1397 6-NH2 CF3 C~-cycPr H
1398 6-NH2 CF3 C-C-Ph H
1399 6-NH2 CF3 C~-2-Pyridyl H
1400 6-NH2 CF3 CSC-3-Pyridyl H
1401 6-NH2 CF3 C=C-4-Pyridyl H
1402 6-NH2 CF3 C~-2-furanyl H
1403 6-NH2 CF3 C=C-3-furanyl H
1404 6-NH2 CF3 C~-2-thienyl H
1405 6-NH2 CF3 C~-3-thienyl H
1406 6-NMe2 CF3 C~-cycPr H
1407 6-NMe2 CF3 C=C-Ph H
1408 6-NMe2 CF3 C~-2-Pyridyl H
2409 6-NMe2 CF3 CSC-3-Pyridyl H
1410 6-NMe2 CF3 C~-4-Pyridyl H
1411 6-NMe2 CF3 C~-2-furanyl H
1412 6-NMe2 CF3 C~-3 -furanyl H
1413 6-NMe2 CF3 C~-2-thienyl H
1414 6-NMe2 CF3 C~-3-thienyl H
1415 7-C1 CF3 C~-cycPr H
1416 7-C1 CF3 C=-C-Ph H
1417 7-C3 CF3 C~-2-Pyridyl H
1418 7-C1 CF3 C~-3-Pyridyl H
1419 7-C1 CF3 C~-4-pyridyl H
1420 7-C1 CF3 C~-2-furanyl H
1421 7-C1 CF3 C=C-3-furanyl H
1422 7-C1 CF3 C=C-2-thienyl H
1423 7-C1 CF3 C~-3-thienyl 1424 5,6-OCH20- CF3 C~-cycPr H
1425 5,6-OCH20- CF3 C-CCHZCHZOH H
1426 5,6-OCH20- CF3 C=C-CH(OH)Me H
1427 5,6-OCH20- CF3 C=C-Ph H
1428 5,6-OCH20- CF3 C=C-(2-C1)Ph H
1429 5,6-OCH20- CF3 C=C-(3-C1)Ph H
1430 5,6-OCH20- CF3 C-C-(4-C1)Ph H
1431 5 , 6-OCH20- CF3 Cue- ( 2 -F ) Ph H
1432 5,6-OCH20- CF3 C~-(3-F)Ph H
1433 5,6-OCH20- CF3 C~-(4-F)Ph H
1434 5,6-OCH20- CF3 C=C-(2-OH)Ph H
1435 5,6-OCH20- CF3 C=C-(3-OH)Ph H
1436 5,6-OCH20- CF3 C~-(4-OH)Ph H
1437 5,6-OCH20- CF3 C~-(2-OMe)Ph H
1438 5,6-OCH20- CF3 C~-(3-OMe)Ph H
1439 5,6-OCH20- CF3 C~-(4-OMe)Ph H
1440 5,6-OCH20- CF3 C~-(2-CN)Ph H
1441 5,6-OCH20- CF3 C=C-(3-CN)Ph H
1442 5,6-OCH20- CF3 C~-(4-CN)Ph H
1443 5 , 6-OCH20- CF3 Cue- ( 2-N02 ) Ph H
1444 5 , 6-OCH20- CF3 Cue- ( 3 -N02 ) H
Ph 1445 5,6-OCH20- CF3 C~-(4-N02)Ph H
1446 5 , 6-OCH20- CF3 C=C_ ( 2 _~2 ) ph H
1447 5 , 6-OCH20- CF3 Cue- ( 3 -NH2 ) Ph 1448 5,6-OCH20- CF3 C~-(4-NH2)Ph H
1449 5,6-OCH20- CF3 C~-(2-NMe2)Ph H
1450 5,6-OCH20- CF3 C-C-(3-NMe2)Ph H
1451 5,6-OCH20- CF3 C-C-(4-NMe2)Ph H
1452 5,6-OCH20- CF3 C~-2-Pyridyl H
1453 5,6-OCH20- CF3 C~-2-pyridyl H
1454 5,6-OCH20- CF3 C~-3-Pyridyl H
1455 5,6-OCH20- CF3 C~-4-Pyridyl H
1456 5,6-OCH20- CF3 C~-2-furanyl H
1457 5,6-OCH20- CF3 C-C-3-furanyl H
1458 5,6-OCH20- CF3 C=C-2-thienyl H
1459 5,6-OCHZO- CF3 C-C-3-thienyl H
1460 5,6-OCH20- CF3 C~-2-oxazolyl H
1461 5,6-OCH20- CF3 C=C-2-thiazolyl H
1462 5,6-OCH20- CF3 C_C-4-isoxazolyl H
1463 5, 6-OCH20- CF3 C~-2-imidazolyl H
1464 6-COCH3 CF3 C=C-cycPr H
1465 6-COCH3 CF3 C=C-Ph H
1466 6-COCH3 CF3 C=C-2-Pyridyl H
1467 6-COCH3 CF3 C=C-3-Pyridyl H
1468 6-COCH3 CF3 C=C-4-Pyridyl H
1469 6-COCH3 CF3 C=C-2-furanyl H
1470 6-COCH3 CF3 C=C-3-furanyl H
1471 6-COCH3 CF3 C=C-2-thienyl H
1472 6-COCH3 CF3 C=C-3-thienyl H
1473 6-NH2 CF3 C=C-cycPr H
1474 6-NH2 CF3 C=C-Ph H
1475 6-NHZ CF3 C=C-2-Pyridyl H
1476 6-NHZ CF3 C=C-3-Pyridyl H
1477 6-NH2 CF3 C=C-4-Pyridyl H
1478 6-NH2 CF3 C=C-2-furanyl H
1479 6-NH2 CF3 C=C-3-furanyl H
1480 6-NH2 CF3 C=C-2-thienyl H
1481 6-NH2 CF3 C=C-3-thienyl H
1482 6-NMe2 CF3 C=C-cycPr H
1483 6-NMe2 CF3 C=C-Ph H
1484 6-NMe2 CF3 C=C-2-Pyridyl H
1485 6-NMe2 CF3 C=C-3-Pyridyl H
1486 6-NMe2 CF3 C=C-4-Pyridyl H
1487 6-NMe2 CF3 C=C-2-furanyl H
1488 6-NMe2 CF3 C=C-3-furanyl H
1489 6-NMe2 CF3 C=C-2-thienyl H
1490 6-NMe2 CF3 C=C-3-thienyl H
1491 7-C1 CF3 C=C-cycPr H
1492 7-C1 CF3 C=C-Ph H
1493 7-Cl CF3 C=C-2-Pyridyl H
1494 7-CI CF3 C=C-3-Pyridyl H
1495 7-C1 CF3 C=C-4-Pyridyl H
1496 7-C1 CF3 C=C-2-furanyl H
1497 7-C1 CF3 C=C-3-furanyl H
1498 7-C1 CF3 C=C-2-thienyl H
1499 7-C1 CF3 C=C-3-thienyl H
1500 5,6-OCH20- CF3 C=C-cycPr H
1501 5,6-OCH20- CF3 C=CCH2CHZOH H
1502 5,6-OCH20- CF3 C=C-CH(OH)Me H
1503 5,6-OCH20- CF3 C=C-Ph H
1504 5,6-OCH20- CF3 C=C-(2-C1}Ph H
1505 5,6-OCH20- CF3 C=C-(3-C1)Ph H
1506 5,6-OCH20- CF3 C=C-(4-C1)Ph H
1507 5,6-OCH20- CF3 C=C-(2-F)Ph H
1508 5,6-OCH20- CF3 C=C-(3-F)Ph H
1509 5,6-OCH20- CF3 C=C-(4-F)Ph H
1510 5,6-OCH20- CF3 C=C-(2-OH)Ph H
1511 5,6-OCH20- CF3 C=C-(3-OH)Ph H
1512 5,6-OCH20- CF3 C=C-(4-OH)Ph H
1513 5,6-OCH20- CF3 C=C-(2-OMe)Ph H
1514 5,6-OCH20- CF3 C=C-(3-OMe)Ph H
1515 5,6-OCH20- CF3 C=C-(4-OMe)Ph H
1516 5,6-OCH20- CF3 C=C-(2-CN)Ph H
1517 5,6-OCH20- CF3 C=C-(3-CN)Ph H
1518 5,6-OCH20- CF3 C=C-(4-CN)Ph H
1519 5,6-OCH20- CF3 C=C-(2-N02)Ph H
1520 5,6-OCH20- CF3 C=C-(3-N02)Ph H
1521 5,6-OCH20- CF3 C=C-(4-N02)Ph H
1522 5,6-OCH20- CF3 C=C-(2-NH2)Ph H
1523 5,6-OCH20- CF3 C=C-(3-NH2)Ph H
1524 5,6-OCH20- CF3 C=C-(4-NH2)Ph H
1525 5,6-OCH20- CF3 C=C-(2-NMe2)Ph H
1526 5,6-OCH20- CF3 C=C-(3-NMe2)Ph H
1527 5,6-OCH20- CF3 C=C-(4-NMe2)Ph H
1528 5,6-OCH20- CF3 C=C-2-Pyridyl H
1529 5,6-OCH20- CF3 C=C-2-Pyridyl H
1530 5,6-OCH20- CF3 C=C-3-Pyridyl H
1531 5,6-OCH20- CF3 C=C-4-Pyridyl H
1532 5,6-OCH20- CF3 C=C-2-furanyl H
1533 5,6-OCH20- CF3 C=C-3-furanyl H
1534 5,6-OCH20- CF3 C=C-2-thienyl H
1535 5,6-OCH20- CF3 C=C-3-thienyl H
1536 5,6-OCH20- CF3 C=C-2-oxazolyl H
1537 5,6-OCH20- CF3 C=C-2-thiazolyl H
1538 5,6-OCH20- CF3 C=C-4-isoxazolyl H
1539 5,6-OCH20- CF3 C=C-2-imidazolyl H
1540 5,6-OCH20- CF3 CHZCH2-cycPr H
1541 5,6-OCH20- CF3 CH2CH2CH2CH20H H
1542 5,6-OCH20- CF3 CH2CH2-CH(OH)Me H
1543 5,6-OCH20- CF3 CH2CH2Ph H
1544 5,6-OCH20- CF3 CH2CH2-(2-C1)Ph H
1545 5,6-OCH20- CF3 CH2CH2-(3-C1)Ph H
1546 5,6-OCH20- CF3 CH2CH2-(4-C1}Ph H
1547 5,6-OCH20- CF3 CH2CH2-(2-F)Ph H
1548 5,6-OCH20- CF3 CH2CH2-(3-F)Ph H
1549 5,6-OCHZO- CF3 CH2CH2-(4-F)Ph H
1550 5, 6-OCHZO- CF3 CH2CH2- (2-OH} Ph H
1551 5,6-OCH20- CF3 CH2CH2-(3-OH)Ph H
1552 5,6-OCH20- CF3 CH2CH2-(4-OH}Ph H
1553 5,6-OCH20- CF3 CH2CH2-(2-OMe)Ph H
1554 5,6-OCH20- CF3 CH2CH2-(3-OMe)Ph H
1555 5,6-OCH20- CF3 CH2CH2-(4-OMe)Ph H
1556 5,6-OCH20- CFg CH2CH2-(2-CN)Ph H
1557 5,6-OCH20- CF3 CH2CH2-(3-CN)Ph H
1558 5,6-OCH2O- CF3 CH2CH2-(4-CN)Ph H
1559 5,6-OCH20- CF3 CH2CH2-(2-N02)Ph H
1560 5,6-OCH20- CF3 CH2CH2-(3-N02)Ph H
1561 5,6-OCH20- CF3 CH2CH2-(4-N02)Ph H
1562 5,6-OCH20- CF3 CHZCH2-(2-NH2)Ph H
1563 5,6-OCH20- CF3 CH2CH2-(3-NH2)Ph H
1564 5,6-OCH20- CF3 CH2CH2-(4-NH2)Ph H
1565 5,6-OCH20- CF3 CHZCH2-(2-NMe2)Ph H
1566 5,6-OCH20- CF3 CH2CH2-(3-NMe2)Ph H
1567 5,6-OCH20- CF3 CH2CH2-(4-NMe2)Ph H
1568 5,6-OCH20- CF3 CH2CH2-2-Pyridyl H
1569 5,6-OCH20- CF3 CH2CH2-3-Pyridyl H
1570 5,6-OCH20- CF3 CH2CH2-4-Pyridyl H
1571 5,6-OCH20- CF3 CH2CH2-2-furanyl H
15?2 5,6-OCH20- CF3 CH2CH2-3-furanyl H
1573 5,6-OCH20- CF3 CH2CH2-2-thienyl H
1574 5,6-OCH20- CF3 CH2CH2-3-thienyl H
1575 5,6-OCH20- CF3 CHZCHz-2-oxazolyl H
1576 5,6-OCH20- CF3 CH2CH2-2-thiazolyl H
1577 5,6-OCH20- CF3 CH2CH2-4-isoxazolyl H
1578 5,6-OCH20- CF3 CH2CH2-2-imidazolyl H
1579 5,6-OCH20- CF3 C~-cycPr CH3 1580 5,6-OCH20- CF3 C=C-Ph CH3 15$1 5,6-OCH O CF
2 - 3 C~-2-Pyridyl CH3 1582 5,6-OCH20- CF3 C~-3-Pyridyl CH3 1583 5,6-OCH20- CF3 C~-4-Pyridyl CH3 1584 5, 6-OCH20- CF3 C~-2-furanyl CH3 1585 5,6-OCH20- CF3 C~-3-furanyl CH3 1586 5,6-OCH20- CF3 C~-2-thienyl CH3 1587 5,6-OCH20- CF3 C~-3-thienyl CH3 1588 5,6-OCH20- CF3 C=C-cycPr CH3 1589 5,6-OCH20- CF3 C=C-Ph CH3 1590 5,6-OCH20- CF3 C=C-2-Pyridyl CH3 1591 5,6-OCH20- CF3 C=C-3-Pyridyl CH3 1592 5,6-OCH20- CF3 C=C-4-Pyridyl CH3 1593 5,6-OCH20- CF3 C=C-2-furanyl CEi3 1594 5,6-OCHZO- CF3 C=C-3-furanyl CH3 1595 5,6-OCH20- CF3 C=C-2-thienyl CH3 1596 5,6-OCH20- CF3 C=C-3-thienyl CH3 1597 5,6-OCH20- CF3 CH2CH2-cycPr CH3 1598 5,6-OCH20- CF3 CH2CH2-Ph CH3 1599 5,6-OCH20- CF3 CH2CH2-2-Pyridyl CH3 2600 5,6-OCH20- CF3 CH2CH2-3-Pyridyl CH3 1601 5,6-OCHZO- CF3 CH2CH2-4-Pyridyl CH3 1602 5,6-OCH20- CF3 CH2CHZ-2-furanyl CH3 1603 5,6-OCH20- CF3 CH2CH2-3-furanyl CH3 1604 5,6-OCH20- CF3 CH2CH2-2-thienyl CH3 1605 5,6-OCH20- CF3 CH2CH2-3-thienyl CH3 1606 5,6-OCH20- CF3 C~-cycPr CH2CH3 1607 5,6-OCH20- CF3 C~-Ph CH2CH3 1608 5,6-OCH20- CF3 C~-2-Pyridyl CH2CH3 1609 5,6-OCH20- CF3 C~-3-Pyridyl CH2CH3 1610 5 , 6-OCH20- CF3 C~-4-Pyridyl CH2CH3 1611 5,6-OCH20- CF3 C~-2-furanyl CH2CH3 1612 5,6-OCH20- CF3 C~-3-furanyl CH2CH3 1613 5,6-OCH20- CF3 C~-2-thienyl CH2CH3 1614 5,6-OCH20- CF3 C~-3-thienyl CH2CH3 1615 5,6-OCH20- CF3 C=C-cycPr CH2CH3 1616 5,6-OCHZO- CF3 C=C-Ph CHZCH3 1617 5,6-OCH20- CF3 C=C-2-Pyridyl CH2CH3 1618 5,6-OCH20- CF3 C=C-3-Pyridyl CHZCH3 1619 5,6-OCH20- CF3 C=C-4-Pyridyl CH2CH3 1620 5,6-OCH20- CF3 C=C-2-furanyl CH2CH3 1621 5,6-OCHZO- CF3 C=C-3-furanyl CH2CH3 1622 5,6-OCH20- CF3 C=C-2-thienyl CHZCH3 1623 5,6-OCH20- CF3 C=C-3-thienyl CH2CH3 1624 5,6-OCH20- CF3 CH2CH2-cycPr CH2CH3 1625 5,6-OCH20- CF3 CH2CH2-Ph CH2CH3 1626 5,6-OCH20- CF3 CH2CH2-2-Pyridyl CH2CH3 1627 5,6-OCH20- CF3 CH2CH2-3-Pyridyl CH2CH3 1628 5,6-OCH20- CF3 CHZCH2-4-Pyridyl CH2CH3 1629 5,6-OCH20- CF3 CH2CH2-2-furanyl CHZCH3 1630 5,6-OCH20- CF3 CH2CH2-3-furanyl CH2CH3 1631 5,6-OCH20- CF3 CH2CH2-2-thienyl CH2CH3 1632 5,6-OCH20- CF3 CH2CH2-3-thienyl CHZCH3 *Unless otherwise indicated, stereochemisty is (+/-).
Table 3*
i z R ~ w N,Rs ~ N ~O
H
Ex. R3 R1 R2 R8 #
1 6-C1 CF3 C~-Pr H
2 6-C1 CF3 C=C-Bu H
3 6-C1 CF3 C=c-iBu H
4 6-C1 CF3 C~-tBu H
6-C1 CF3 C~-Me H
7 6-C1 CF3 CH2CH2CH(CH3)2 H
6-C1 CF3 CH2CH2-tBu H
11 6-C1 CF3 CH2C=C-CH3 H
13 6-C1 CF3 C~-iPr CH3 14 6-C1 CF3 CSC-Pr CH3 6-C1 CF3 C~-Bu CH3 16 6-C1 CF3 C=C-iBu CH3 17 6-C1 CF3 C~-tBu CH3 18 6-C1 CF3 C---C-Et CH3 19 6-CI CF3 C~-Me CH3 6-Cl CF3 CH2C=C-CH3 CH3 22 6-C1 CF3 CH2CH2CH(CH3)2 CHg 6-C1 CF3 CH2CH2-tBu CH3 26 6-C1 CF3 C.=C-iPr CH2CH3 27 6-C1 CF3 C=C-Pr CH2CH3 28 6-CZ CF3 C~-Bu CH2CH3 29 6-CZ CF3 C=C-iBu CH2CH3 30 6-C1 CF3 C-C-tBu CH2CH3 31 6-C1 CF3 C=C-Et CH2CH3 32 6-CI CF3 C---C-Me CHZCH3 34 6-C1 CF3 CH2C=C-CH2CH3 CH2CH3 35 6-C1 CF3 CH2CHZCH(CH3)2 CHzCH3 38 6-C1 CF3 CH2CH2-tBu CH2CH3 39 6-Me0 CF3 C---C-Pr H
40 6-Me0 CF3 C=C-Bu H
41 6-Me0 CF3 C=C-iBu H
42 6-Me0 CF3 C~-tBu H
43 6-Me0 CF3 C=C-Et H
44 6-Me0 CF3 C=C-Me H
45 6-Me0 CF3 CH2C-C-CH3 H
46 6-Me0 CF3 CH2C=C-CH2CH3 H
47 6-Me0 CF3 CH2CH2CH2CH2CH3 H
48 6-Me0 CF3 CH2CH2CH(CH3)2 H
49 6-Me0 CF3 CH2CH2CH2CH3 H
50 6-Me0 CF3 CH2CHZCH3 H
51 6-Me0 CF3 CHZCH2-tBu H
52 6-Me0 CF3 CH2C=C-CH3 H
53 6-Me0 CF3 CH2C~-CH2CH3 H
54 6-Me0 CF3 C=C-iPr CH3 55 6-Me0 CF3 C=~-pr CH3 56 6-Me0 CF3 C~-Bu CH3 57 6-Me0 CF3 C-C-iBu CH3 58 6-Me0 CF3 C=C-tBu CH3 59 6-Me0 CF3 C=C-Et CH3 60 6-Me0 CF3 CSC-Me CH3 61 6-Me0 CF3 CH2C=C-CH3 CH3 62 6-Me0 CF3 CH2C=C-CHZCH3 CH3 63 6-Me0 CF3 CH2CH2CH(CH3)2 CH3 64 6-Me0 CF3 CHZCH2CH2CH3 CH3 65 6-Me0 CF3 CH2CH2CH3 CH3 66 6-Me0 CF3 CH2CH2-tBu CH3 67 6-Me0 CF3 C=C-iPr CH2CH3 68 6-Me0 CF3 C~-Pr CH2CH3 69 6-Me0 CF3 C-C-Bu CH2CH3 70 6-Me0 CF3 C~-iBu CH2CH3 71 6-Me0 CF3 C~-tBu CH2CH3 72 6-Me0 CF3 C~-Et CH2CH3 73 6-Me0 CF3 C~-Me CH2CH3 74 6-Me0 CFg CHIC-C-CH3 CH2CH3 75 6-Me0 CF3 CH2C=C-CH2CH3 CH2CH3 76 6-Me0 CF3 CH2CH2CH(CH3)2 CH2CH3 77 6-Me0 CFg CH2CHZCH2CH3 CH2CH3 78 6-Me0 CF3 CH2CHZCH3 CH2CH3 79 6-Me0 CF3 CH2CH2-tBu CH2CH3 84 5,6-diF CF3 C=_C-Pr H
81 5 , 6-diF CF3 C~-Bu H
82 5 , 6-diF CF3 C~-iBu H
83 5,6-diF CF3 C-C-tBu H
84 5,6-diF CF3 C=C-Me H
85 5,6-diF CF3 CH2C=C-CH3 H
86 5,6-diF CF3 CH2C=C-CH2CH3 H
87 5,6-diF CF3 CH2CH2CH2CH2CH3 H
88 5,6-diF CF3 CH2CHZCH3 H
89 5,6-diF CF3 CH2CH2-tBu H
90 5,6-diF CF3 C~-iPr CH3 91 5,6-diF CF3 C~-Pr CH3 92 5,6-diF CF3 C~-Bu CH3 93 5,6-diF CF3 C~-iBu CH3 94 5,6-diF CF3 C~-tBu CH3 95 5,6-diF CF3 C~-Et CH3 96 5,6-diF CF3 C=C-Me CH3 97 5,6-diF CF3_ C=C-Ph CH3 98 5,6-diF CF3 CH2C=C-CH3 CH3 99 5,6-diF CF3 CH2C=C-CH2CH3 CH3 100 5,6-diF CF3 CH2CH2CH(CH3)2 CH3 101 5,6-diF CF3 CH2CH2CHZCH3 CH3 102 5,6-diF CF3 CHZCH2CH3 CH3 103 5,6-diF CF3 CH2CH2-tBu CH3 104 5,6-diF CF3 C=C-iPr CH2CH3 105 5,6-diF CF3 C~-Pr CH2CH3 106 5,6-diF CF3 C=C-Bu CH2CH3 107 5,6-diF CF3 C--_C-iBu CH2CH3 108 5,6-diF CF3 C=C-tBu CH2CH3 109 5,6-diF CF3 C=C-Et CH2CH3 110 5,6-diF CF3 C=C-Me CH2CH3 111 5,6-diF CF3 CHIC=C-CH3 CH2CH3 112 5,6-diF CF3 CH2C=C-CH2CH3 CH2CH3 113 5,6-diF CF3 CH2CH2CH(CH3)2 CHZCH3 114 5,6-diF CF3 CH2CH2CH2CH3 CH2CH3 115 5,6-diF CF3 CH2CH2CH3 CH2CH3 116 5,6-diF CF3 CH2CH2-tBu CH2CH3 117 6-F CF3 C=C-Pr H
118 6-F CF3 C~-Bu H
119 6-F CF3 C=C-iBu H
120 6-F CF3 C=_C-tBu H
121 6-F CF3 C=C-Me H
125 6-F CF3 CH2CH2-tBu H
126 6-F CF3 C~-iPr CH3 127 6-F CF3 C~-Pr CH3 128 6-F CF3 C~-Bu CH3 129 6-F CF3 C=C-iBu CH3 130 6-F CF3 C=_C-tBu CH3 131 6-F CF3 C=C-Et CH3 132 6-F CF3 C=C-Me CH3 134 6-F CF3 CHIC=C-CH2CH3 CH3 135 6-F CF3 CH2CH2CH(CH3)2 CH3 138 6-F CF3 CH2CH2-tBu CH3 139 6-F CF3 C~-iPr CH2CH3 140 6-F CF3 C~-Pr CH2CH3 141 6-F CF3 C=C-Bu CH2CH3 I42 6-F CF3 C=C-iBu CH2CH3 143 6-F CF3 CSC-tBu CH2CH3 244 6-F CF3 C=C-Et CH2CH3 145 6-F CF3 C=C-Me CH2CH3 146 6-F CF3 CHIC=C-CH3 CH2CH3 147 6-F CF3 CH2C=C-CH2CH3 CH2CH3 148 6-F CF3 CH2CH2CH(CH3)2 CH2CH3 151 6-F CF3 CH2CH2-tBu CH2CH3 152 5-C1 CF3 C~-iPr H
153 5-C1 CF3 C~-Pr H
154 5-C1 CF3 C~-Bu H
155 5-C1 CF3 C--_.C-iBu H
156 5-C1 CF3 C~-tBu H
I57 5-C1 CF3 C=-C-Et H
158 5-Cl CF3 C~-Me H
159 5-C1 CF3 CH2C=C-CH3 H
160 5-Cl CF3 CH2C=C-CH2CH3 H
162 5-C1 CF3 CH2CH2CH(CH3)2 H
165 5-C1 CF3 CHZCH2-tBu H
166 5-C1 CF3 C=C-iPr CH3 167 5-C1 CF3 C=C-Pr CH3 268 5-C1 CF3 C-C-Bu CH3 169 5-C1 CF3 C-C-iBu CH3 170 5-C1 CF3 C=C-tBu CH3 171 5-C1 CF3 C=C-Et CH3 172 5-C1 CF3 C~-Me CH3 173 5-C1 CF3 CHIC=C-CH3 CH3 174 5-C1 CF3 CHZC--_C-CHZCH3 CH3 175 5-C1 CF3 CH2CH2CH(CH3)2 CH3 178 5-C1 CF3 CH2CH2-tBu CH3 179 5-C1 CF3 C~-iPr CH2CH3 180 5-C1 CF3 C~-Pr CH2CH3 181 5-C1 CF3 C~-Bu CH2CH3 182 5-C1 CF3 C~-iBu CH2CH3 183 5-C1 CF3 C~-tBu CH2CH3 184 5-C1 CF3 C~-Et CH2CH3 185 5-C1 CF3 C~-Me CH2CH3 188 5-C1 CF3 CH2CH2CH(CH3)2 CH2CH3 189 5-C1 CF3 CH2CHZCH2CHg CH2CH3 191 5-C1 CF3 CH2CH2-tBu CH2CH3 192 5-F CF3 C~-iPr H
193 5-F CF3 C~-Pr H
194 5-F CF3 C~-Bu H
195 5-F CF3 C=C-iBu H
296 5-F CF3 C=C-tBu H
197 5-F CF3 C~-Et H
198 5-F CF3 C~-Me H
WO 98/45276 PCT/US98/Ob733 200 5-F CF3 CH2C=C-CH2CH3 H
202 5-F CF3 CH2CH2CH(CH3)2 H
205 5-F CF3 CH2CH2-tBu H
206 5-F CF3 C=C-iPr CH3 207 5-F CF3 C-C-Pr CH3 208 5-F CF3 C=_C-Bu CH3 209 5-F CF3 C~-iBu CH3 210 5-F CF3 C-C-tBu CH3 211 5-F CF3 C=C-Et CH3 212 5-F CF3 C=C-Me CH3 213 5-F CF3 CHIC=C-CH3 CH3 214 5-F CF3 CH2C=C-CH2CH3 CH3 215 5-F CF3 CH2CH2CH(CH3)2 CH3 218 5-F CF3 CH2CH2-tBu CH3 219 5-F CF3 C=C-iPr CH2CH3 220 5-F CF3 C=C-Pr CH2CH3 221 5-F CF3 C=C-Bu CH2CH3 222 5-F CF3 C=C-iBu CH2CH3 223 5-F CF3 C=C-tBu CHZCH3 224 5-F CF3 C~-Et CH2CH3 225 5-F CF3 C~-Me CH2CH3 226 5-F CF3 CH2C=C-CH3 CH2CH3 228 5-F CF3 CH2CH2CH(CH3)2 CH2CH3 231 5-F CF3 CH2CH2-tBu CH2CH3 232 5-C1,6-F CF3 C=_C-iPr H
r ,.
233 5-C1,6-F CF3 C=C-Pr H
234 5-C1,6-F CF3 C---C-Bu H
235 5-C1,6-F CF3 C-C-iBu H
236 5-C1,6-F CF3 C=_C-tBu H
237 5-C1,6-F CF3 C=C-Et H
238 5-C1,6-F CF3 C=C-Me H
239 5-C1,6-F CF3 CH2C---C-CH3 H
240 5-C1,6-F CF3 CH2C=C-CH2CH3 H
241 5-C1,6-F CF3 CH2CH2CH(CH3?2 H
242 5-C1,6-F CF3 CH2CHZCH2CH3 H
243 5-C1,6-F CF3 CH2CH2CH3 H
244 5-C1,6-F CF3 CH2CH2-tBu H
245 5-C1,6-F CF3 C~-iPr CH3 246 5-C1,6-F CF3 C=-C-Pr CH3 247 5-C1,6-F CF3 C~-Bu CH3 248 5-C1,6-F CF3 C=C-iBu CH3 249 5-C1,6-F CF3 C~-tBu CH3 250 5-C1,6-F CF3 C---C-Et CH3 251 5-C1,6-F CF3 ~-Me CH3 252 5-C1,6-F CF3 CH2C=C-CH3 CH3 253 5-C1,6-F CF3 CH2C=C-CH2CH3 CH3 254 5-C1,6-F CF3 CH2CH2CH(CH3)2 CH3 255 5-C1,6-F CF3 CH2CH2CH2CH3 CH3 256 5-C1,6-F CF3 CH2CH2CH3 CH3 257 5-C1,6-F CF3 CH2CH2-tBu CH3 258 6-C1,8-F CF3 C-C-iPr H
259 6-C1,8-F CF3 C=C-Pr H
260 6-C1,8-F CF3 C=C-Bu H
261 6-C1,8-F CF3 C~-iBu H
262 6-C1,8-F CF3 C-C-tBu H
263 6-C1,8-F CF3 C-C-Et H
264 6-C1,8-F CF3 C~-Me H
265 6-C1,8-F CF3 CHIC=C-CH3 H
266 6-C1,8-F CF3 CH2C=C-CH2CH3 H
267 6-C1,8-F CF3 CHZCH2CH(CH3)2 H
268 6-C1,8-F CF3 CH2CHZCH2CH3 H
269 6-C1,8-F CF3 CHZCH2CH3 H
270 6-C1,8-F CF3 CH2CH2-tBu H
271 6-C1,8-F CF3 C=C-iPr CH3 272 6-C1,8-F CF3 C--_C-Pr CH3 273 6-C1,8-F CF3 C=C-Bu CH3 274 6-C1,8-F CF3 C~-iBu CH3 275 6-C1,8-F CF3 C~-tBu CH3 276 6-C1.8-F CF3 C=C-Et CH3 277 6-C1,8-F CF3 C~-Me CH3 278 6-C1.8-F CF3 CH2C=C-CH3 CH3 279 6-C1,8-F CF3 CH2C=C-CH2CH3 CH3 280 6-C1,8-F CF3 CH2CH2CH(CH3)2 CH3 281 6-C1,8-F CF3 CH2CHZCH2CH3 CH3 282 6-C1,8-F CF3 CH2CH2CH3 CH3 283 6-C1,8-F CF3 CH2CH2-tBu CH3 284 6-CH3 CF3 C~-iPr H
285 6-CH3 CF3 C-C-Pr H
286 6-CH3 CF3 C~-Bu H
287 6-CH3 CF3 C=C-iBu H
288 6-CH3 CF3 C=C-tBu H
289 6-CH3 CF3 C~-Et H
290 6-CH3 CF3 C=C-Me H
291 6-CH3 CF3 CH2C=C-CH3 H
292 6-CH3 CF3 CH2C=C-CHZCH3 H
293 6-CH3 CF3 CH2CH2CH(CH3)z H
296 6-CH3 CF3 CHZCH2-tBu H
297 6-CH3 CF3 C~-iPr CH3 298 6-CH3 CF3 C=C-Pr CH3 299 6-CH3 CF3 C-C-Bu CH3 300 6-CH3 CF3 C~-iBu CH3 WO 98/45276 PCTlUS98/06733 301 6-CH3 CF3 C-C-tBu CH3 302 6-CH3 CF3 C=C-Et CH3 303 6-CH3 CF3 C=C-Me CH3 304 6-CH3 CF3 CH2C=C-CH3 CH3 306 6-CH3 CF3 CH2CH2CH(CH3)2 CH3 309 6-CH3 CF3 CH2CH2-tBu CH3 310 6-COCH3 CF3 C=C-iPr H
311 6-COCH3 CF3 C~-Pr H
312 6-COCH3 CF3 C---C-Bu H
313 6-COCH3 CF3 C=C-iBu H
314 6-COCH3 CF3 C=C-tBu H
315 6-COCH3 CF3 C~-Et H
316 6-COCH3 CF3 C=C-Me H
317 6-NH2 CF3 C=C-iPr H
318 6-NH2 CF3 C~-Pr H
319 6-NH2 CF3 C~-Bu H
320 6-NHZ CF3 C~-iBu H
321 6-NH2 CF3 C=C-tBu H
322 6-NHZ CF3 C~-Et H
323 6-NH2 CF3 C=C-Me H
324 6-NMe2 CF3 C=C-iPr H
325 6-NMe2 CF3 C~-Pr H
326 6-NMe2 CF3 C~-Bu H
327 6-NMe2 CF3 C~-iHu H
328 6-NMe2 CF3 C~-tBu H
329 6-NMe2 CF3 C =C-Et H
330 6-NMe2 CF3 C~-Me H
331 7-C1 CF3 C=C-iPr H
332 7-C1 CF3 C~-Pr H
333 7-C1 CF3 C=C-Bu H
334 7-C1 CF3 C=C-iBu H
335 7-C1 CF3 C-C-tBu 336 7-C1 CF3 C=C-Et 337 7-C1 CF3 C=C-Me *Unless othenaise indicated, stereochemisty is (+/-).
Utility The compounds of this invention possess reverse transcriptase inhibitory activity, in particular, HIV
inhibitory efficacy. The compounds of formula (I) possess HIV reverse transcriptase inhibitory activity and are therefore useful as antiviral agents for the treatment of HIV
infection and associated diseases. The compounds of formula (I) possess HIV reverse transcriptase inhibitory activity and are effective as inhibitors of HIV growth. The ability of the compounds of the present invention to inhibit viral growth or infectivity is demonstrated in standard assay of viral growth or infectivity, for example, using the assay described below.
The compounds of formula (I) of the present invention are also useful for the inhibition of HIV in an ex vivo sample containing HIV or expected to be exposed to HIV.
Thus, the compounds of the present invention may be used to inhibit HIV present in a body fluid sample (for example, a serum or semen sample) which contains or is suspected to contain or be exposed to HIV.
The compounds provided by this invention are also useful as standard or reference compounds for use in tests or assays for determining the ability of an agent to inhibit viral clone replication and/or HIV reverse transcriptase, for example in a pharmaceutical research program. Thus, the compounds of the present invention may be used as a control or reference compound in such assays and as a quality control standard. The compounds of the present invention may be provided in a commercial kit or container for use as such standard or reference compound.
Since the compounds of the present invention exhibit specificity for HIV reverse transcriptase, the compounds of the present invention may also be useful as diagnostic reagents in diagnostic assays for the detection of HIV
. 35 reverse transcriptase. Thus, inhibition of the reverse transcriptase activity in an assay (such as the assays described herein) by a compound of the present invention would be indicative of the presence of HIV reverse transcriptase and HIV virus.
As used herein "~tg" denotes microgram, "mg" denotes milligram, "g" denotes gram, "~L" denotes microliter, "mL"
S denotes milliliter, "L" denotes liter, "nM" denotes nanomolar, "E.~M" denotes micromolar, "mM" denotes millimolar, "M" denotes molar and "nm" denotes nanometer. "Sigma" stands for the Sigma-Aldrich Corp. of St. Louis, MO.
HIV RNA Assav DNA Plasmids and in vitro RNA transcri,~ts:
Plasmid pDAB 72 containing both gag and pol sequences of BH10 (bp 113-1816) cloned into PTZ 19R was prepared according to Erickson-Viitanen et al. AIDS Research arid Human Retroviruses 1989, 5, 577. The plasmid was linearized with Bam HI prior to the generation of in vitro RNA transcripts using the Riboprobe Gemini system II kit (Promega) with T?
RNA polymerase. Synthesized RNA was purified by treatment with RNase free DNAse (Promega), phenol-chloroform extraction, and ethanol precipitation. RNA transcripts were dissolved in water, and stored at -70°C. The concentration of RNA was determined from the A260 2S Probes Biotinylated capture probes were purified by HPLC after synthesis on an Applied Biosystems (Foster City, CA) DNA
synthesizer by addition of biotin to the 5' terminal end of the oligonucleotide, using the biotin-phosphoramidite reagent of Cocuzza, Tet. Lett. 1989, 30, 6287. The gag biotinylated capture probe (5-biotin-CTAGCTCCCTGCTTGCCCATACTA 3') was complementary to nucleotides 889-912 of HXB2 and the pol biotinylated capture probe (S'-biotin -CCCTATCATTTTTGGTTTCCAT
3' ) was complementary to nucleotides 2374-2395 of HXB2.
Alkaline phosphatase conjugated oligonucleotides used as reporter probes were prepared by Syngene (San Diego, CA.).
The pol reporter probe (5' CTGTCTTACTTTGATAAAACCTC 3') was complementary to nucleotides 2403-2425 of HXB2. The gag r ,.
reporter probe (5' CCCAGTATTTGTCTACAGCCTTCT 3') was complementary to nucleotides 950-973 of HXB2. All nucleotide positions are those of the GenBank Genetic Sequence Data Bank as accessed through the Genetics Computer Group Sequence Analysis Software Package (Devereau Nucleic Acids Research 1984, 12, 387). The reporter probes were prepared as 0.5 ~1.M
stocks in 2 x SSC (0.3 M NaCl, 0.03 M sodium citrate), 0.05 M
Tris pH 8.8, 1 mg/mL BSA. The biotinylated capture probes were prepared as 100 ~tM stocks in water.
Streptavidin coated pl es:
Streptavidin coated plates were obtained from Du Pont Biotechnology Systems (Boston, MA).
c~e7 ~ s and virus stocks:
MT-2 and MT-4 cells were maintained in RPMI 1640 supplemented with 5~ fetal calf serum (FCS) for MT-2 cells or 10~ FCS for MT-4 cells, 2 mM z-glutamine and 50 ~1g/mL
gentamycin, all from Gibco. HIV-1 RF was propagated in MT-4 cells in the same medium. Virus stocks were prepared approximately 10 days after acute infection of MT-4 cells and stored as aliquots at -70°C. Infectious titers of HIV-1(RF) stocks were 1-3 x 107 PFU (plaque forming units)/mL as measured by plaque assay on MT-2 cells (see below). Each aliquot of virus stock used for infection was thawed only once.
For evaluation of antiviral efficacy, cells to be infected were subcultured one day prior to infection. On the day of infection, cells were resuspended at 5 x 105 cells/mL
in RPMI 1640, 5~ FCS for bulk infections or at 2 x 106/mL in Dulbecco's modified Eagles medium with 5~ FCS for infection in microtiter plates. Virus was added and culture continued for 3 days at 37°C.
HIV RNA assav:
Cell lysates or purified RNA in 3 M or 5 M GED were mixed with 5 M GED and capture probe to a final guanidinium isothiocyanate concentration of 3 M and a final biotin oligonucleotide concentration of 30 nM. Hybridization was carried out in sealed U bottom 96 well tissue culture plates (Nunc or Costar) for 16-20 hours at 37°C. RNA hybridization reactions were diluted three-fold with deionized water to a final guanidinium isothiocyanate concentration of 1 M and aliquots (150 ~tL) were transferred to streptavidin coated microtiter plates wells. Binding of capture probe and capture probe-RNA hybrid to the immobilized streptavidin was allowed to proceed for 2 hours at room temperature, after which the plates were washed 6 times with DuPont ELISA plate wash buffer (phosphate buffered saline(PBS), 0.05 Tween 20.) A second hybridization of reporter probe to the in~unobilized complex of capture probe and hybridized target RNA was carried out in the washed streptavidin coated well by addition of I20 ~.1 of a hybridization cocktail containing 4 X
SSC, 0.66 Triton X 100, 6.66 deionized formamide, 1 mg/mL
BSA and 5 nM reporter probe. After hybridization for one hour at 37°C, the plate was again washed 6 times.
Immobilized alkaline phosphatase activity was detected by addition of 100 N.L of 0.2 mM 4-methylumbelliferyl phosphate (MUBP, JBL Scientific) in buffer 8(2.5 M diethanolamine pH 8.9 (JBL Scientific), 10 mM MgCl2, 5 mM zinc acetate dihydrate and 5 mM N-hydroxyethyl-ethylene-diamine-triacetic acid).
The plates were incubated at 37°C. Fluorescence at 450 nM
was measured using a microplate fluorometer (Dynateck) exciting at 365 nM.
Mi~rot~late based compound evaluation in HIV-1 infected MT-2 c 1 s:
Compounds to be evaluated were dissolved in DMSO and diluted in culture medium to twice the highest concentration to be tested and a maximum DMSO concentration of 2~. Further three-fold serial dilutions of the compound in culture medium were performed directly in U bottom microtiter plates (Nunc).
After compound dilution, MT-2 cells (SO N,L) were added to a final concentration of 5 x 105 per mL (1 x 105 per well).
Cells were incubated with compounds for 30 minutes at 37°C in a C02 incubator. For evaluation of antiviral potency, an appropriate dilution of HIV-1 (RF) virus stock (50 ~,L) was added to culture wells containing cells and dilutions of the test compounds. The final volume in each well was 200 ~.L.
. Eight wells per plate were left uninfected with 50 ~1L of medium added in place of virus, while eight wells were infected in the absence of any antiviral compound. For evaluation of compound toxicity, parallel plates were cultured without virus infection.
After 3 days of culture at 37°C in a humidified chamber inside a C02 incubator, all but 25 ~,L of medium/well was removed from the HIV infected plates. Thirty seven ~.L of 5 M
GED containing biotinylated capture probe was added to the settled cells and remaining medium in each well to a final concentration of 3 M GED and 30 nM capture probe.
Hybridization of the capture probe to HIV RNA in the cell lysate was carried out in the same microplate well used for virus culture by sealing the plate with a plate sealer (Costar), and incubating for 16-20 hrs in a 37°C incubator.
Distilled water was then added to each well to dilute the hybridization reaction three-fold and 150 ~.L of this diluted mixture was transferred to a streptavidin coated microtiter plate. HIV RNA was quantitated as described above. A
standard curve, prepared by adding known amounts of pDAB 72 in vitro RNA transcript to wells containing lysed uninfected cells, was run on each microtiter plate in order to determine the amount of viral RNA made during the infection.
In order to standardize the virus inoculum used in the evaluation of compounds for antiviral activity, dilutions of virus were selected which resulted in an IC90 value (concentration of compound required to reduce the HIV RNA
level by 90$) for dideoxycytidine (ddC) of 0.2 ~,g/mL. IC90 values of other antiviral compounds, both more and less potent than ddC, were reproducible using several stocks of HIV-1 (RF) when this procedure was followed. This concentration of virus corresponded to -3 x 105 PFU (measured by plaque assay on MT-2 cells) per assay well and typically produced approximately 75~k of the maximum viral RNA level achievable at any virus inoculum. For the HIV RNA assay, ICgO values were determined from the percent reduction of net signal (signal from infected cell samples minus signal from uninfected cell samples) in the RNA assay relative to the net signal from infected, untreated cells on the same culture plate (average of eight wells). Valid performance of individual infection and RNA assay tests was judged according to three criteria. It was required that the virus infection should result in an RNA assay signal equal to or greater than the signal generated from 2 ng of pDAB 72 in vitro RNA
transcript. The IC9p for ddC, determined in each assay run, should be between 0.1 and 0.3 E.tg/mL. Finally, the plateau level of viral RNA produced by an effective reverse transcriptase inhibitor should be less than 10~ of the level achieved in an uninhibited infection. A compound was considered active if its ICgQ was found to be less than 20~.tM.
For antiviral potency tests, all manipulations in microtiter plates, following the initial addition of 2X
concentrated compound solution to a single row of wells, were performed using a Perkin Elmer/Cetus ProPette.
as Protein Binding and Mutant Resistance In order to characterize NNRTI analogs for their clinical efficacy potential the effect of plasma proteins on antiviral potency and measurements of antiviral potency against wild type and mutant variants of HIV which carry amino acid changes in the known binding site for NNRTIs were examined. The rationale for this testing strategy is two fold:
1. Many drugs are extensively bound to plasma proteins.
Although the binding affinity for most drugs for the major components of human plasma, namely, human serum albumin (HSA) or alpha-1-acid glycoprotein (AAG), is low, these major components are present in high concentration in the blood.
Only free or unbound drug is available to cross the infected cell membrane for interaction with the target site (i.e., HIV-1 reverse transcriptase, HIV-1 RT?. Therefore, the effect of added HSA+AAG on the antiviral potency in tissue culture more closely reflects the potency of a given compound in the clinical setting. The concentration of compound required for 90~ inhibition of virus replication as measured in a sensitive viral RNA-based detection method is designated the IC90. The fold increase in apparent IC90 for test compounds in the presence or added levels of HSA and AAG that reflect in vivo concentrations (45 mg/ml HSA, 1 mg/ml AAG) was then calculated. The lower the fold increase, the more compound will be available to interact with the target site.
2. The combination of the high rate of virus replication in the infected individual and the poor fidelity of the viral RT results in the production of a quasi-species or mixtures of HIV species in the infected individual. These species will include a majority wild type species, but also mutant variants of HIV and the proportion of a given mutant will reflect its relative fitness and replication rate.
Because mutant variants including mutants with changes in the amino acid sequence of the viral RT likely pre-exist in the infected individual's quasi-species, the overall potency observed in the clinical setting will reflect the ability of a drug to inhibit not only wild type HIV-1, but mutant variants as well. We thus have constructed, in a known genetic background, mutant variants of HIV-1 which carry amino acid substitutions at positions thought to be involved in NNRTI binding, and measured the ability of test compounds to inhibit replication of these mutant viruses. The concentration of compound required for 90~ inhibition of virus replication as measured in a sensitive viral RNA-based detection method is designated the IC90. It is desirable to have a compound which has high activity against a variety of mutants.
Dosaae and Formulation ' The antiviral compounds of this invention can be administered as treatment for viral infections by any means that produces contact of the active agent with the agent's site of action, i.e., the viral reverse transcriptase, in the body of a mammal. They can be administered by any conventional means available for use in conjunction with pharmaceuticals, either as individual therapeutic agents or in a combination of therapeutic agents. They can be administered alone, but preferably are administered with a pharmaceutical carrier selected on the basis of the chosen route of administration and standard pharmaceutical practice.
The dosage administered will, of course, vary depending upon known factors, such as the pharmacodynamic characteristics of the particular agent and its mode and route of administration; the age, health and weight of the recipient; the nature and extent of the symptoms; the kind of concurrent treatment; the frequency of treatment; and the effect desired. A daily dosage of active ingredient can be expected to be about 0.001 to about 1000 milligrams per kilogram of body weight, with the preferred dose being about 0.1 to about 30 mg/kg.
Dosage forms of compositions suitable for administration contain from about 1 mg to about 100 mg of active ingredient per unit. In these pharmaceutical compositions the active ingredient will ordinarily be present in an amount of about 0.5-95~ by weight based on the total weight of the composition. The active ingredient can be administered orally in solid dosage forms, such as capsules, tablets and powders, or in liquid dosage forms, such as elixirs, syrups and suspensions. It can also be administered parenterally, in sterile liquid dosage forms.
Gelatin capsules contain the active ingredient and powdered carriers, such as lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like.
Similar diluents can be used to make compressed tablets.
Both tablets and capsules can be manufactured as sustained release products to provide for continuous release of medication over.a period of hours. Compressed tablets can be sugar coated or film coated to mask any unpleasant taste and protect the tablet from the atmosphere, or enteric coated for selective disintegration in the gastrointestinal tract.
Liquid dosage forms for oral administration can contain coloring and flavoring to increase patient acceptance.
In general, water, a suitable oil, saline, aqueous dextrose (glucose), and related sugar solutions and glycols such as propylene glycol or polyethylene glycols are suitable carriers for parenteral solutions. Solutions for parenteral S administration preferably contain a water soluble salt of the active ingredient, suitable stabilizing agents, and if necessary, buffer substances. Antioxidizing agents such as sodium bisulfite, sodium sulfite, or ascorbic acid, either alone or combined, are suitable stabilizing agents. Also used are citric acid and its salts, and sodium EDTA. In addition, parenteral solutions can contain preservatives, such as benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol. Suitable pharmaceutical carriers are described in Rernington's Pharmaceutical Sciences, supra, a standard reference text in this field.
Useful pharmaceutical dosage-forms for administration of the compounds of this invention can be illustrated as follows:
Capsules A large number of unit capsules can be prepared by filling standard two-piece hard gelatin capsules each with 100 mg of powdered active ingredient, I50 mg of lactose, 50 mg of cellulose, and 6 mg magnesium stearic.
Soft Gelatin Capsules A mixture of active ingredient in a digestible oil such as soybean oil, cottonseed oil or olive oil can be prepared and injected by means of a positive displacement pump into gelatin to form soft gelatin capsules containing 100 mg of the active ingredient. The capsules should then be washed and dried.
T a A large number of tablets can be prepared by conventional procedures so that the dosage unit is 100 mg of active ingredient, 0.2 mg of colloidal silicon dioxide, 5 milligrams of magnesium stearate, 275 mg of microcrystalline cellulose, 11 mg of starch and 98.8 mg of lactose.
Appropriate coatings may be applied to increase palatability or delay absorption.
Sust~ension An aqueous suspension can be prepared for oral administration so that each 5 mL contain 25 mg of finely divided active ingredient, 200 mg of sodium carboxymethyl cellulose, 5 mg of sodium benzoate, 1.0 g of sorbitol solution, U.S.P., and 0.025 mg of vanillin.
In~ectable A parenteral composition suitable for administration by injection can be prepared by stirring 1.5~ by weight of active ingredient in 10~ by volume propylene glycol and water. The solution is sterilized by commonly used techniques.
C9mbination of components (a1 and lb) Each therapeutic agent component of this invention can independently be in any dosage form, such as those described above, and can also be administered in various ways, as described above. In the following description component (b) is to be understood to represent one or more agents as described previously. Thus, if components (a) and (b) are to be treated the same or independently, each agent of component (b) may also be treated the same or independently.
Components (a) and (b) of the present invention may be formulated together, in a single dosage unit (that is, combined together in one capsule, tablet, powder, or liquid, etc.) as a combination product. Vdhen component (a) and (b) are not formulated together in a single dosage unit, the component (a) may be administered at the same time as component (b) or in any order; for example component (a) of this invention may be administered first, followed by administration of component (b), or they may be administered in the revserse order. If component (b) contains more that one agent, e.g., one RT inhibitor and one protease inhibitor, r i these agents may be administered together or in any order.
V~Then not administered at the same time, preferably the administration of component (a) and (b) occurs less than about one hour apart. Preferably, the route of administration of component (a) and (b) is oral. The terms oral agent, oral inhibitor, oral compound, or the like, as used herein, denote compounds which may be orally administered. Although it is preferable that component (a) and component (b) both be administered by the same route (that is, for example, both orally) or dosage form, if desired, they may each be administered by different routes (that is, for example, one component of the combination product may be administered orally, and another component may be administered intravenously) or dosage forms.
As is appreciated by a medical practitioner skilled in the art, the dosage of the combination therapy of the invention may vary depending upon various factors such as the pharmacodynamic characteristics of the particular agent and its mode and route of administration, the age, health and weight of the recipient, the nature and extent of the symptoms, the kind of concurrent treatment, the frequency of treatment, and the effect desired, as described above.
The proper dosage of components (a) and (b) of the present invention will be readily ascertainable by a medical practitioner skilled in the art, based upon the present disclosure. By way of general guidance, typically a daily dosage may be about 100 milligrams to about 1.5 grams of each component. If component (b) represents more than one compound, then typically a daily dosage may be about 100 milligrams to about 1.5 grams of each agent of component (b).
By way of general guidance, when the compounds of component (a) and component (b) are administered in combination, the dosage amount of each component may be reduced by about 70-80~ relative to the usual dosage of the component when it is administered alone as a single agent for the treatment of HIV
infection, in view of the synergistic effect of the combination.
The combination products of this invention may be formulated such that, although the active ingredients are combined in a single dosage unit, the physical contact between the active ingredients is minimized. In order to minimize contact, for example, where the product is orally administered, one active ingredient may be enteric coated.
By enteric coating one of the active ingredients, it is possible not only to minimize the contact between the combined active ingredients, but also, it is possible to control the release of one of these components in the gastrointestinal tract such that one of these components is not released in the stomach but rather is released in the intestines. Another embodiment of this invention where oral administration is desired provides for a combination product wherein one of the active ingredients is coated with a sustained-release material which effects a sustained-release throughout the gastrointestinal tract and also serves to minimize physical contact between the combined active ingredients. Furthermore, the sustained-released component can be additionally enteric coated such that the release of this component occurs only in the intestine. Still another approach would involve the formulation of a combination product in which the one component is coated with a sustained and/or enteric release polymer, and the other component is also coated with a polymer such as a lowviscosity grade of hydroxypropyl methylcellulose or other appropriate materials as known in the art, in order to further separate the active components. The polymer coating serves to form an additional barrier to interaction with the other component. In each forniulation wherein contact is prevented between components (a) and (b) via a coating or some other material, contact may also be prevented between the individual agents of component (b) .
Dosage forms of the combination products of the present invention wherein one active ingredient is enteric coated can be in the form of tablets such that the enteric coated component and the other active ingredient are blended together and then compressed into a tablet or such that the r enteric coated component is compressed into one tablet layer and the other active ingredient is compressed into an additional layer. Optionally, in order to further separate the two layers, one or more placebo layers may be present such that the placebo layer is between the layers of active ingredients. In addition, dosage forms of the present invention can be in the form of capsules wherein one active ingredient is compressed into a tablet or in the form of a plurality of microtablets, particles, granules or non-perils, which are then enteric coated. These enteric coated microtablets, particles, granules or non-perils are then placed into a capsule or compressed into a capsule along with a granulation of the other active ingredient.
These as well as other ways of minimizing contact between the components of combination products of the present invention, whether administered in a single dosage form or administered in separate forms but at the same time or concurrently by the same manner, will be readily apparent to those skilled in the art, based on the present disclosure.
Pharmaceutical kits useful for the treatment of HIV
infection, which comprise a therapeutically effective amount of a pharmaceutical composition comprising a compound of component (a) and one or more compounds of component (b), in one or more sterile containers, are also within the ambit of the present invention. Sterilization of the container may be carried out using conventional sterilization methodology well known to those skilled in the art. Component (a) and component (b) may be in the same sterile container or in separate sterile containers. The sterile containers of materials may comprise separate containers, or one or more multi-part containers, as desired. Component (a) and component (b), may be separate, or physically combined into a single dosage form or unit as described above. Such kits may further include, if desired, one or more of various conventional pharmaceutical kit components, such as for example, one or more pharmaceutically acceptable carriers, additional vials for mixing the components, etc., as will be readily apparent to those skilled in the art. Instructions, either as inserts or as labels, indicating quantities of the components to be administered, guidelines for administration, and/or guidelines for mixing the components, may also be included in the kit.
S Obviously, numerous modifications and variations of the present invention are possible in light of the above teachings. It is therefore to be understood that within the scope of the appended claims, the invention may be practiced othervuise than as specifically described herein.
1573 5,6-OCH20- CF3 CH2CH2-2-thienyl H
1574 5,6-OCH20- CF3 CH2CH2-3-thienyl H
1575 5,6-OCH20- CF3 CHZCHz-2-oxazolyl H
1576 5,6-OCH20- CF3 CH2CH2-2-thiazolyl H
1577 5,6-OCH20- CF3 CH2CH2-4-isoxazolyl H
1578 5,6-OCH20- CF3 CH2CH2-2-imidazolyl H
1579 5,6-OCH20- CF3 C~-cycPr CH3 1580 5,6-OCH20- CF3 C=C-Ph CH3 15$1 5,6-OCH O CF
2 - 3 C~-2-Pyridyl CH3 1582 5,6-OCH20- CF3 C~-3-Pyridyl CH3 1583 5,6-OCH20- CF3 C~-4-Pyridyl CH3 1584 5, 6-OCH20- CF3 C~-2-furanyl CH3 1585 5,6-OCH20- CF3 C~-3-furanyl CH3 1586 5,6-OCH20- CF3 C~-2-thienyl CH3 1587 5,6-OCH20- CF3 C~-3-thienyl CH3 1588 5,6-OCH20- CF3 C=C-cycPr CH3 1589 5,6-OCH20- CF3 C=C-Ph CH3 1590 5,6-OCH20- CF3 C=C-2-Pyridyl CH3 1591 5,6-OCH20- CF3 C=C-3-Pyridyl CH3 1592 5,6-OCH20- CF3 C=C-4-Pyridyl CH3 1593 5,6-OCH20- CF3 C=C-2-furanyl CEi3 1594 5,6-OCHZO- CF3 C=C-3-furanyl CH3 1595 5,6-OCH20- CF3 C=C-2-thienyl CH3 1596 5,6-OCH20- CF3 C=C-3-thienyl CH3 1597 5,6-OCH20- CF3 CH2CH2-cycPr CH3 1598 5,6-OCH20- CF3 CH2CH2-Ph CH3 1599 5,6-OCH20- CF3 CH2CH2-2-Pyridyl CH3 2600 5,6-OCH20- CF3 CH2CH2-3-Pyridyl CH3 1601 5,6-OCHZO- CF3 CH2CH2-4-Pyridyl CH3 1602 5,6-OCH20- CF3 CH2CHZ-2-furanyl CH3 1603 5,6-OCH20- CF3 CH2CH2-3-furanyl CH3 1604 5,6-OCH20- CF3 CH2CH2-2-thienyl CH3 1605 5,6-OCH20- CF3 CH2CH2-3-thienyl CH3 1606 5,6-OCH20- CF3 C~-cycPr CH2CH3 1607 5,6-OCH20- CF3 C~-Ph CH2CH3 1608 5,6-OCH20- CF3 C~-2-Pyridyl CH2CH3 1609 5,6-OCH20- CF3 C~-3-Pyridyl CH2CH3 1610 5 , 6-OCH20- CF3 C~-4-Pyridyl CH2CH3 1611 5,6-OCH20- CF3 C~-2-furanyl CH2CH3 1612 5,6-OCH20- CF3 C~-3-furanyl CH2CH3 1613 5,6-OCH20- CF3 C~-2-thienyl CH2CH3 1614 5,6-OCH20- CF3 C~-3-thienyl CH2CH3 1615 5,6-OCH20- CF3 C=C-cycPr CH2CH3 1616 5,6-OCHZO- CF3 C=C-Ph CHZCH3 1617 5,6-OCH20- CF3 C=C-2-Pyridyl CH2CH3 1618 5,6-OCH20- CF3 C=C-3-Pyridyl CHZCH3 1619 5,6-OCH20- CF3 C=C-4-Pyridyl CH2CH3 1620 5,6-OCH20- CF3 C=C-2-furanyl CH2CH3 1621 5,6-OCHZO- CF3 C=C-3-furanyl CH2CH3 1622 5,6-OCH20- CF3 C=C-2-thienyl CHZCH3 1623 5,6-OCH20- CF3 C=C-3-thienyl CH2CH3 1624 5,6-OCH20- CF3 CH2CH2-cycPr CH2CH3 1625 5,6-OCH20- CF3 CH2CH2-Ph CH2CH3 1626 5,6-OCH20- CF3 CH2CH2-2-Pyridyl CH2CH3 1627 5,6-OCH20- CF3 CH2CH2-3-Pyridyl CH2CH3 1628 5,6-OCH20- CF3 CHZCH2-4-Pyridyl CH2CH3 1629 5,6-OCH20- CF3 CH2CH2-2-furanyl CHZCH3 1630 5,6-OCH20- CF3 CH2CH2-3-furanyl CH2CH3 1631 5,6-OCH20- CF3 CH2CH2-2-thienyl CH2CH3 1632 5,6-OCH20- CF3 CH2CH2-3-thienyl CHZCH3 *Unless otherwise indicated, stereochemisty is (+/-).
Table 3*
i z R ~ w N,Rs ~ N ~O
H
Ex. R3 R1 R2 R8 #
1 6-C1 CF3 C~-Pr H
2 6-C1 CF3 C=C-Bu H
3 6-C1 CF3 C=c-iBu H
4 6-C1 CF3 C~-tBu H
6-C1 CF3 C~-Me H
7 6-C1 CF3 CH2CH2CH(CH3)2 H
6-C1 CF3 CH2CH2-tBu H
11 6-C1 CF3 CH2C=C-CH3 H
13 6-C1 CF3 C~-iPr CH3 14 6-C1 CF3 CSC-Pr CH3 6-C1 CF3 C~-Bu CH3 16 6-C1 CF3 C=C-iBu CH3 17 6-C1 CF3 C~-tBu CH3 18 6-C1 CF3 C---C-Et CH3 19 6-CI CF3 C~-Me CH3 6-Cl CF3 CH2C=C-CH3 CH3 22 6-C1 CF3 CH2CH2CH(CH3)2 CHg 6-C1 CF3 CH2CH2-tBu CH3 26 6-C1 CF3 C.=C-iPr CH2CH3 27 6-C1 CF3 C=C-Pr CH2CH3 28 6-CZ CF3 C~-Bu CH2CH3 29 6-CZ CF3 C=C-iBu CH2CH3 30 6-C1 CF3 C-C-tBu CH2CH3 31 6-C1 CF3 C=C-Et CH2CH3 32 6-CI CF3 C---C-Me CHZCH3 34 6-C1 CF3 CH2C=C-CH2CH3 CH2CH3 35 6-C1 CF3 CH2CHZCH(CH3)2 CHzCH3 38 6-C1 CF3 CH2CH2-tBu CH2CH3 39 6-Me0 CF3 C---C-Pr H
40 6-Me0 CF3 C=C-Bu H
41 6-Me0 CF3 C=C-iBu H
42 6-Me0 CF3 C~-tBu H
43 6-Me0 CF3 C=C-Et H
44 6-Me0 CF3 C=C-Me H
45 6-Me0 CF3 CH2C-C-CH3 H
46 6-Me0 CF3 CH2C=C-CH2CH3 H
47 6-Me0 CF3 CH2CH2CH2CH2CH3 H
48 6-Me0 CF3 CH2CH2CH(CH3)2 H
49 6-Me0 CF3 CH2CH2CH2CH3 H
50 6-Me0 CF3 CH2CHZCH3 H
51 6-Me0 CF3 CHZCH2-tBu H
52 6-Me0 CF3 CH2C=C-CH3 H
53 6-Me0 CF3 CH2C~-CH2CH3 H
54 6-Me0 CF3 C=C-iPr CH3 55 6-Me0 CF3 C=~-pr CH3 56 6-Me0 CF3 C~-Bu CH3 57 6-Me0 CF3 C-C-iBu CH3 58 6-Me0 CF3 C=C-tBu CH3 59 6-Me0 CF3 C=C-Et CH3 60 6-Me0 CF3 CSC-Me CH3 61 6-Me0 CF3 CH2C=C-CH3 CH3 62 6-Me0 CF3 CH2C=C-CHZCH3 CH3 63 6-Me0 CF3 CH2CH2CH(CH3)2 CH3 64 6-Me0 CF3 CHZCH2CH2CH3 CH3 65 6-Me0 CF3 CH2CH2CH3 CH3 66 6-Me0 CF3 CH2CH2-tBu CH3 67 6-Me0 CF3 C=C-iPr CH2CH3 68 6-Me0 CF3 C~-Pr CH2CH3 69 6-Me0 CF3 C-C-Bu CH2CH3 70 6-Me0 CF3 C~-iBu CH2CH3 71 6-Me0 CF3 C~-tBu CH2CH3 72 6-Me0 CF3 C~-Et CH2CH3 73 6-Me0 CF3 C~-Me CH2CH3 74 6-Me0 CFg CHIC-C-CH3 CH2CH3 75 6-Me0 CF3 CH2C=C-CH2CH3 CH2CH3 76 6-Me0 CF3 CH2CH2CH(CH3)2 CH2CH3 77 6-Me0 CFg CH2CHZCH2CH3 CH2CH3 78 6-Me0 CF3 CH2CHZCH3 CH2CH3 79 6-Me0 CF3 CH2CH2-tBu CH2CH3 84 5,6-diF CF3 C=_C-Pr H
81 5 , 6-diF CF3 C~-Bu H
82 5 , 6-diF CF3 C~-iBu H
83 5,6-diF CF3 C-C-tBu H
84 5,6-diF CF3 C=C-Me H
85 5,6-diF CF3 CH2C=C-CH3 H
86 5,6-diF CF3 CH2C=C-CH2CH3 H
87 5,6-diF CF3 CH2CH2CH2CH2CH3 H
88 5,6-diF CF3 CH2CHZCH3 H
89 5,6-diF CF3 CH2CH2-tBu H
90 5,6-diF CF3 C~-iPr CH3 91 5,6-diF CF3 C~-Pr CH3 92 5,6-diF CF3 C~-Bu CH3 93 5,6-diF CF3 C~-iBu CH3 94 5,6-diF CF3 C~-tBu CH3 95 5,6-diF CF3 C~-Et CH3 96 5,6-diF CF3 C=C-Me CH3 97 5,6-diF CF3_ C=C-Ph CH3 98 5,6-diF CF3 CH2C=C-CH3 CH3 99 5,6-diF CF3 CH2C=C-CH2CH3 CH3 100 5,6-diF CF3 CH2CH2CH(CH3)2 CH3 101 5,6-diF CF3 CH2CH2CHZCH3 CH3 102 5,6-diF CF3 CHZCH2CH3 CH3 103 5,6-diF CF3 CH2CH2-tBu CH3 104 5,6-diF CF3 C=C-iPr CH2CH3 105 5,6-diF CF3 C~-Pr CH2CH3 106 5,6-diF CF3 C=C-Bu CH2CH3 107 5,6-diF CF3 C--_C-iBu CH2CH3 108 5,6-diF CF3 C=C-tBu CH2CH3 109 5,6-diF CF3 C=C-Et CH2CH3 110 5,6-diF CF3 C=C-Me CH2CH3 111 5,6-diF CF3 CHIC=C-CH3 CH2CH3 112 5,6-diF CF3 CH2C=C-CH2CH3 CH2CH3 113 5,6-diF CF3 CH2CH2CH(CH3)2 CHZCH3 114 5,6-diF CF3 CH2CH2CH2CH3 CH2CH3 115 5,6-diF CF3 CH2CH2CH3 CH2CH3 116 5,6-diF CF3 CH2CH2-tBu CH2CH3 117 6-F CF3 C=C-Pr H
118 6-F CF3 C~-Bu H
119 6-F CF3 C=C-iBu H
120 6-F CF3 C=_C-tBu H
121 6-F CF3 C=C-Me H
125 6-F CF3 CH2CH2-tBu H
126 6-F CF3 C~-iPr CH3 127 6-F CF3 C~-Pr CH3 128 6-F CF3 C~-Bu CH3 129 6-F CF3 C=C-iBu CH3 130 6-F CF3 C=_C-tBu CH3 131 6-F CF3 C=C-Et CH3 132 6-F CF3 C=C-Me CH3 134 6-F CF3 CHIC=C-CH2CH3 CH3 135 6-F CF3 CH2CH2CH(CH3)2 CH3 138 6-F CF3 CH2CH2-tBu CH3 139 6-F CF3 C~-iPr CH2CH3 140 6-F CF3 C~-Pr CH2CH3 141 6-F CF3 C=C-Bu CH2CH3 I42 6-F CF3 C=C-iBu CH2CH3 143 6-F CF3 CSC-tBu CH2CH3 244 6-F CF3 C=C-Et CH2CH3 145 6-F CF3 C=C-Me CH2CH3 146 6-F CF3 CHIC=C-CH3 CH2CH3 147 6-F CF3 CH2C=C-CH2CH3 CH2CH3 148 6-F CF3 CH2CH2CH(CH3)2 CH2CH3 151 6-F CF3 CH2CH2-tBu CH2CH3 152 5-C1 CF3 C~-iPr H
153 5-C1 CF3 C~-Pr H
154 5-C1 CF3 C~-Bu H
155 5-C1 CF3 C--_.C-iBu H
156 5-C1 CF3 C~-tBu H
I57 5-C1 CF3 C=-C-Et H
158 5-Cl CF3 C~-Me H
159 5-C1 CF3 CH2C=C-CH3 H
160 5-Cl CF3 CH2C=C-CH2CH3 H
162 5-C1 CF3 CH2CH2CH(CH3)2 H
165 5-C1 CF3 CHZCH2-tBu H
166 5-C1 CF3 C=C-iPr CH3 167 5-C1 CF3 C=C-Pr CH3 268 5-C1 CF3 C-C-Bu CH3 169 5-C1 CF3 C-C-iBu CH3 170 5-C1 CF3 C=C-tBu CH3 171 5-C1 CF3 C=C-Et CH3 172 5-C1 CF3 C~-Me CH3 173 5-C1 CF3 CHIC=C-CH3 CH3 174 5-C1 CF3 CHZC--_C-CHZCH3 CH3 175 5-C1 CF3 CH2CH2CH(CH3)2 CH3 178 5-C1 CF3 CH2CH2-tBu CH3 179 5-C1 CF3 C~-iPr CH2CH3 180 5-C1 CF3 C~-Pr CH2CH3 181 5-C1 CF3 C~-Bu CH2CH3 182 5-C1 CF3 C~-iBu CH2CH3 183 5-C1 CF3 C~-tBu CH2CH3 184 5-C1 CF3 C~-Et CH2CH3 185 5-C1 CF3 C~-Me CH2CH3 188 5-C1 CF3 CH2CH2CH(CH3)2 CH2CH3 189 5-C1 CF3 CH2CHZCH2CHg CH2CH3 191 5-C1 CF3 CH2CH2-tBu CH2CH3 192 5-F CF3 C~-iPr H
193 5-F CF3 C~-Pr H
194 5-F CF3 C~-Bu H
195 5-F CF3 C=C-iBu H
296 5-F CF3 C=C-tBu H
197 5-F CF3 C~-Et H
198 5-F CF3 C~-Me H
WO 98/45276 PCT/US98/Ob733 200 5-F CF3 CH2C=C-CH2CH3 H
202 5-F CF3 CH2CH2CH(CH3)2 H
205 5-F CF3 CH2CH2-tBu H
206 5-F CF3 C=C-iPr CH3 207 5-F CF3 C-C-Pr CH3 208 5-F CF3 C=_C-Bu CH3 209 5-F CF3 C~-iBu CH3 210 5-F CF3 C-C-tBu CH3 211 5-F CF3 C=C-Et CH3 212 5-F CF3 C=C-Me CH3 213 5-F CF3 CHIC=C-CH3 CH3 214 5-F CF3 CH2C=C-CH2CH3 CH3 215 5-F CF3 CH2CH2CH(CH3)2 CH3 218 5-F CF3 CH2CH2-tBu CH3 219 5-F CF3 C=C-iPr CH2CH3 220 5-F CF3 C=C-Pr CH2CH3 221 5-F CF3 C=C-Bu CH2CH3 222 5-F CF3 C=C-iBu CH2CH3 223 5-F CF3 C=C-tBu CHZCH3 224 5-F CF3 C~-Et CH2CH3 225 5-F CF3 C~-Me CH2CH3 226 5-F CF3 CH2C=C-CH3 CH2CH3 228 5-F CF3 CH2CH2CH(CH3)2 CH2CH3 231 5-F CF3 CH2CH2-tBu CH2CH3 232 5-C1,6-F CF3 C=_C-iPr H
r ,.
233 5-C1,6-F CF3 C=C-Pr H
234 5-C1,6-F CF3 C---C-Bu H
235 5-C1,6-F CF3 C-C-iBu H
236 5-C1,6-F CF3 C=_C-tBu H
237 5-C1,6-F CF3 C=C-Et H
238 5-C1,6-F CF3 C=C-Me H
239 5-C1,6-F CF3 CH2C---C-CH3 H
240 5-C1,6-F CF3 CH2C=C-CH2CH3 H
241 5-C1,6-F CF3 CH2CH2CH(CH3?2 H
242 5-C1,6-F CF3 CH2CHZCH2CH3 H
243 5-C1,6-F CF3 CH2CH2CH3 H
244 5-C1,6-F CF3 CH2CH2-tBu H
245 5-C1,6-F CF3 C~-iPr CH3 246 5-C1,6-F CF3 C=-C-Pr CH3 247 5-C1,6-F CF3 C~-Bu CH3 248 5-C1,6-F CF3 C=C-iBu CH3 249 5-C1,6-F CF3 C~-tBu CH3 250 5-C1,6-F CF3 C---C-Et CH3 251 5-C1,6-F CF3 ~-Me CH3 252 5-C1,6-F CF3 CH2C=C-CH3 CH3 253 5-C1,6-F CF3 CH2C=C-CH2CH3 CH3 254 5-C1,6-F CF3 CH2CH2CH(CH3)2 CH3 255 5-C1,6-F CF3 CH2CH2CH2CH3 CH3 256 5-C1,6-F CF3 CH2CH2CH3 CH3 257 5-C1,6-F CF3 CH2CH2-tBu CH3 258 6-C1,8-F CF3 C-C-iPr H
259 6-C1,8-F CF3 C=C-Pr H
260 6-C1,8-F CF3 C=C-Bu H
261 6-C1,8-F CF3 C~-iBu H
262 6-C1,8-F CF3 C-C-tBu H
263 6-C1,8-F CF3 C-C-Et H
264 6-C1,8-F CF3 C~-Me H
265 6-C1,8-F CF3 CHIC=C-CH3 H
266 6-C1,8-F CF3 CH2C=C-CH2CH3 H
267 6-C1,8-F CF3 CHZCH2CH(CH3)2 H
268 6-C1,8-F CF3 CH2CHZCH2CH3 H
269 6-C1,8-F CF3 CHZCH2CH3 H
270 6-C1,8-F CF3 CH2CH2-tBu H
271 6-C1,8-F CF3 C=C-iPr CH3 272 6-C1,8-F CF3 C--_C-Pr CH3 273 6-C1,8-F CF3 C=C-Bu CH3 274 6-C1,8-F CF3 C~-iBu CH3 275 6-C1,8-F CF3 C~-tBu CH3 276 6-C1.8-F CF3 C=C-Et CH3 277 6-C1,8-F CF3 C~-Me CH3 278 6-C1.8-F CF3 CH2C=C-CH3 CH3 279 6-C1,8-F CF3 CH2C=C-CH2CH3 CH3 280 6-C1,8-F CF3 CH2CH2CH(CH3)2 CH3 281 6-C1,8-F CF3 CH2CHZCH2CH3 CH3 282 6-C1,8-F CF3 CH2CH2CH3 CH3 283 6-C1,8-F CF3 CH2CH2-tBu CH3 284 6-CH3 CF3 C~-iPr H
285 6-CH3 CF3 C-C-Pr H
286 6-CH3 CF3 C~-Bu H
287 6-CH3 CF3 C=C-iBu H
288 6-CH3 CF3 C=C-tBu H
289 6-CH3 CF3 C~-Et H
290 6-CH3 CF3 C=C-Me H
291 6-CH3 CF3 CH2C=C-CH3 H
292 6-CH3 CF3 CH2C=C-CHZCH3 H
293 6-CH3 CF3 CH2CH2CH(CH3)z H
296 6-CH3 CF3 CHZCH2-tBu H
297 6-CH3 CF3 C~-iPr CH3 298 6-CH3 CF3 C=C-Pr CH3 299 6-CH3 CF3 C-C-Bu CH3 300 6-CH3 CF3 C~-iBu CH3 WO 98/45276 PCTlUS98/06733 301 6-CH3 CF3 C-C-tBu CH3 302 6-CH3 CF3 C=C-Et CH3 303 6-CH3 CF3 C=C-Me CH3 304 6-CH3 CF3 CH2C=C-CH3 CH3 306 6-CH3 CF3 CH2CH2CH(CH3)2 CH3 309 6-CH3 CF3 CH2CH2-tBu CH3 310 6-COCH3 CF3 C=C-iPr H
311 6-COCH3 CF3 C~-Pr H
312 6-COCH3 CF3 C---C-Bu H
313 6-COCH3 CF3 C=C-iBu H
314 6-COCH3 CF3 C=C-tBu H
315 6-COCH3 CF3 C~-Et H
316 6-COCH3 CF3 C=C-Me H
317 6-NH2 CF3 C=C-iPr H
318 6-NH2 CF3 C~-Pr H
319 6-NH2 CF3 C~-Bu H
320 6-NHZ CF3 C~-iBu H
321 6-NH2 CF3 C=C-tBu H
322 6-NHZ CF3 C~-Et H
323 6-NH2 CF3 C=C-Me H
324 6-NMe2 CF3 C=C-iPr H
325 6-NMe2 CF3 C~-Pr H
326 6-NMe2 CF3 C~-Bu H
327 6-NMe2 CF3 C~-iHu H
328 6-NMe2 CF3 C~-tBu H
329 6-NMe2 CF3 C =C-Et H
330 6-NMe2 CF3 C~-Me H
331 7-C1 CF3 C=C-iPr H
332 7-C1 CF3 C~-Pr H
333 7-C1 CF3 C=C-Bu H
334 7-C1 CF3 C=C-iBu H
335 7-C1 CF3 C-C-tBu 336 7-C1 CF3 C=C-Et 337 7-C1 CF3 C=C-Me *Unless othenaise indicated, stereochemisty is (+/-).
Utility The compounds of this invention possess reverse transcriptase inhibitory activity, in particular, HIV
inhibitory efficacy. The compounds of formula (I) possess HIV reverse transcriptase inhibitory activity and are therefore useful as antiviral agents for the treatment of HIV
infection and associated diseases. The compounds of formula (I) possess HIV reverse transcriptase inhibitory activity and are effective as inhibitors of HIV growth. The ability of the compounds of the present invention to inhibit viral growth or infectivity is demonstrated in standard assay of viral growth or infectivity, for example, using the assay described below.
The compounds of formula (I) of the present invention are also useful for the inhibition of HIV in an ex vivo sample containing HIV or expected to be exposed to HIV.
Thus, the compounds of the present invention may be used to inhibit HIV present in a body fluid sample (for example, a serum or semen sample) which contains or is suspected to contain or be exposed to HIV.
The compounds provided by this invention are also useful as standard or reference compounds for use in tests or assays for determining the ability of an agent to inhibit viral clone replication and/or HIV reverse transcriptase, for example in a pharmaceutical research program. Thus, the compounds of the present invention may be used as a control or reference compound in such assays and as a quality control standard. The compounds of the present invention may be provided in a commercial kit or container for use as such standard or reference compound.
Since the compounds of the present invention exhibit specificity for HIV reverse transcriptase, the compounds of the present invention may also be useful as diagnostic reagents in diagnostic assays for the detection of HIV
. 35 reverse transcriptase. Thus, inhibition of the reverse transcriptase activity in an assay (such as the assays described herein) by a compound of the present invention would be indicative of the presence of HIV reverse transcriptase and HIV virus.
As used herein "~tg" denotes microgram, "mg" denotes milligram, "g" denotes gram, "~L" denotes microliter, "mL"
S denotes milliliter, "L" denotes liter, "nM" denotes nanomolar, "E.~M" denotes micromolar, "mM" denotes millimolar, "M" denotes molar and "nm" denotes nanometer. "Sigma" stands for the Sigma-Aldrich Corp. of St. Louis, MO.
HIV RNA Assav DNA Plasmids and in vitro RNA transcri,~ts:
Plasmid pDAB 72 containing both gag and pol sequences of BH10 (bp 113-1816) cloned into PTZ 19R was prepared according to Erickson-Viitanen et al. AIDS Research arid Human Retroviruses 1989, 5, 577. The plasmid was linearized with Bam HI prior to the generation of in vitro RNA transcripts using the Riboprobe Gemini system II kit (Promega) with T?
RNA polymerase. Synthesized RNA was purified by treatment with RNase free DNAse (Promega), phenol-chloroform extraction, and ethanol precipitation. RNA transcripts were dissolved in water, and stored at -70°C. The concentration of RNA was determined from the A260 2S Probes Biotinylated capture probes were purified by HPLC after synthesis on an Applied Biosystems (Foster City, CA) DNA
synthesizer by addition of biotin to the 5' terminal end of the oligonucleotide, using the biotin-phosphoramidite reagent of Cocuzza, Tet. Lett. 1989, 30, 6287. The gag biotinylated capture probe (5-biotin-CTAGCTCCCTGCTTGCCCATACTA 3') was complementary to nucleotides 889-912 of HXB2 and the pol biotinylated capture probe (S'-biotin -CCCTATCATTTTTGGTTTCCAT
3' ) was complementary to nucleotides 2374-2395 of HXB2.
Alkaline phosphatase conjugated oligonucleotides used as reporter probes were prepared by Syngene (San Diego, CA.).
The pol reporter probe (5' CTGTCTTACTTTGATAAAACCTC 3') was complementary to nucleotides 2403-2425 of HXB2. The gag r ,.
reporter probe (5' CCCAGTATTTGTCTACAGCCTTCT 3') was complementary to nucleotides 950-973 of HXB2. All nucleotide positions are those of the GenBank Genetic Sequence Data Bank as accessed through the Genetics Computer Group Sequence Analysis Software Package (Devereau Nucleic Acids Research 1984, 12, 387). The reporter probes were prepared as 0.5 ~1.M
stocks in 2 x SSC (0.3 M NaCl, 0.03 M sodium citrate), 0.05 M
Tris pH 8.8, 1 mg/mL BSA. The biotinylated capture probes were prepared as 100 ~tM stocks in water.
Streptavidin coated pl es:
Streptavidin coated plates were obtained from Du Pont Biotechnology Systems (Boston, MA).
c~e7 ~ s and virus stocks:
MT-2 and MT-4 cells were maintained in RPMI 1640 supplemented with 5~ fetal calf serum (FCS) for MT-2 cells or 10~ FCS for MT-4 cells, 2 mM z-glutamine and 50 ~1g/mL
gentamycin, all from Gibco. HIV-1 RF was propagated in MT-4 cells in the same medium. Virus stocks were prepared approximately 10 days after acute infection of MT-4 cells and stored as aliquots at -70°C. Infectious titers of HIV-1(RF) stocks were 1-3 x 107 PFU (plaque forming units)/mL as measured by plaque assay on MT-2 cells (see below). Each aliquot of virus stock used for infection was thawed only once.
For evaluation of antiviral efficacy, cells to be infected were subcultured one day prior to infection. On the day of infection, cells were resuspended at 5 x 105 cells/mL
in RPMI 1640, 5~ FCS for bulk infections or at 2 x 106/mL in Dulbecco's modified Eagles medium with 5~ FCS for infection in microtiter plates. Virus was added and culture continued for 3 days at 37°C.
HIV RNA assav:
Cell lysates or purified RNA in 3 M or 5 M GED were mixed with 5 M GED and capture probe to a final guanidinium isothiocyanate concentration of 3 M and a final biotin oligonucleotide concentration of 30 nM. Hybridization was carried out in sealed U bottom 96 well tissue culture plates (Nunc or Costar) for 16-20 hours at 37°C. RNA hybridization reactions were diluted three-fold with deionized water to a final guanidinium isothiocyanate concentration of 1 M and aliquots (150 ~tL) were transferred to streptavidin coated microtiter plates wells. Binding of capture probe and capture probe-RNA hybrid to the immobilized streptavidin was allowed to proceed for 2 hours at room temperature, after which the plates were washed 6 times with DuPont ELISA plate wash buffer (phosphate buffered saline(PBS), 0.05 Tween 20.) A second hybridization of reporter probe to the in~unobilized complex of capture probe and hybridized target RNA was carried out in the washed streptavidin coated well by addition of I20 ~.1 of a hybridization cocktail containing 4 X
SSC, 0.66 Triton X 100, 6.66 deionized formamide, 1 mg/mL
BSA and 5 nM reporter probe. After hybridization for one hour at 37°C, the plate was again washed 6 times.
Immobilized alkaline phosphatase activity was detected by addition of 100 N.L of 0.2 mM 4-methylumbelliferyl phosphate (MUBP, JBL Scientific) in buffer 8(2.5 M diethanolamine pH 8.9 (JBL Scientific), 10 mM MgCl2, 5 mM zinc acetate dihydrate and 5 mM N-hydroxyethyl-ethylene-diamine-triacetic acid).
The plates were incubated at 37°C. Fluorescence at 450 nM
was measured using a microplate fluorometer (Dynateck) exciting at 365 nM.
Mi~rot~late based compound evaluation in HIV-1 infected MT-2 c 1 s:
Compounds to be evaluated were dissolved in DMSO and diluted in culture medium to twice the highest concentration to be tested and a maximum DMSO concentration of 2~. Further three-fold serial dilutions of the compound in culture medium were performed directly in U bottom microtiter plates (Nunc).
After compound dilution, MT-2 cells (SO N,L) were added to a final concentration of 5 x 105 per mL (1 x 105 per well).
Cells were incubated with compounds for 30 minutes at 37°C in a C02 incubator. For evaluation of antiviral potency, an appropriate dilution of HIV-1 (RF) virus stock (50 ~,L) was added to culture wells containing cells and dilutions of the test compounds. The final volume in each well was 200 ~.L.
. Eight wells per plate were left uninfected with 50 ~1L of medium added in place of virus, while eight wells were infected in the absence of any antiviral compound. For evaluation of compound toxicity, parallel plates were cultured without virus infection.
After 3 days of culture at 37°C in a humidified chamber inside a C02 incubator, all but 25 ~,L of medium/well was removed from the HIV infected plates. Thirty seven ~.L of 5 M
GED containing biotinylated capture probe was added to the settled cells and remaining medium in each well to a final concentration of 3 M GED and 30 nM capture probe.
Hybridization of the capture probe to HIV RNA in the cell lysate was carried out in the same microplate well used for virus culture by sealing the plate with a plate sealer (Costar), and incubating for 16-20 hrs in a 37°C incubator.
Distilled water was then added to each well to dilute the hybridization reaction three-fold and 150 ~.L of this diluted mixture was transferred to a streptavidin coated microtiter plate. HIV RNA was quantitated as described above. A
standard curve, prepared by adding known amounts of pDAB 72 in vitro RNA transcript to wells containing lysed uninfected cells, was run on each microtiter plate in order to determine the amount of viral RNA made during the infection.
In order to standardize the virus inoculum used in the evaluation of compounds for antiviral activity, dilutions of virus were selected which resulted in an IC90 value (concentration of compound required to reduce the HIV RNA
level by 90$) for dideoxycytidine (ddC) of 0.2 ~,g/mL. IC90 values of other antiviral compounds, both more and less potent than ddC, were reproducible using several stocks of HIV-1 (RF) when this procedure was followed. This concentration of virus corresponded to -3 x 105 PFU (measured by plaque assay on MT-2 cells) per assay well and typically produced approximately 75~k of the maximum viral RNA level achievable at any virus inoculum. For the HIV RNA assay, ICgO values were determined from the percent reduction of net signal (signal from infected cell samples minus signal from uninfected cell samples) in the RNA assay relative to the net signal from infected, untreated cells on the same culture plate (average of eight wells). Valid performance of individual infection and RNA assay tests was judged according to three criteria. It was required that the virus infection should result in an RNA assay signal equal to or greater than the signal generated from 2 ng of pDAB 72 in vitro RNA
transcript. The IC9p for ddC, determined in each assay run, should be between 0.1 and 0.3 E.tg/mL. Finally, the plateau level of viral RNA produced by an effective reverse transcriptase inhibitor should be less than 10~ of the level achieved in an uninhibited infection. A compound was considered active if its ICgQ was found to be less than 20~.tM.
For antiviral potency tests, all manipulations in microtiter plates, following the initial addition of 2X
concentrated compound solution to a single row of wells, were performed using a Perkin Elmer/Cetus ProPette.
as Protein Binding and Mutant Resistance In order to characterize NNRTI analogs for their clinical efficacy potential the effect of plasma proteins on antiviral potency and measurements of antiviral potency against wild type and mutant variants of HIV which carry amino acid changes in the known binding site for NNRTIs were examined. The rationale for this testing strategy is two fold:
1. Many drugs are extensively bound to plasma proteins.
Although the binding affinity for most drugs for the major components of human plasma, namely, human serum albumin (HSA) or alpha-1-acid glycoprotein (AAG), is low, these major components are present in high concentration in the blood.
Only free or unbound drug is available to cross the infected cell membrane for interaction with the target site (i.e., HIV-1 reverse transcriptase, HIV-1 RT?. Therefore, the effect of added HSA+AAG on the antiviral potency in tissue culture more closely reflects the potency of a given compound in the clinical setting. The concentration of compound required for 90~ inhibition of virus replication as measured in a sensitive viral RNA-based detection method is designated the IC90. The fold increase in apparent IC90 for test compounds in the presence or added levels of HSA and AAG that reflect in vivo concentrations (45 mg/ml HSA, 1 mg/ml AAG) was then calculated. The lower the fold increase, the more compound will be available to interact with the target site.
2. The combination of the high rate of virus replication in the infected individual and the poor fidelity of the viral RT results in the production of a quasi-species or mixtures of HIV species in the infected individual. These species will include a majority wild type species, but also mutant variants of HIV and the proportion of a given mutant will reflect its relative fitness and replication rate.
Because mutant variants including mutants with changes in the amino acid sequence of the viral RT likely pre-exist in the infected individual's quasi-species, the overall potency observed in the clinical setting will reflect the ability of a drug to inhibit not only wild type HIV-1, but mutant variants as well. We thus have constructed, in a known genetic background, mutant variants of HIV-1 which carry amino acid substitutions at positions thought to be involved in NNRTI binding, and measured the ability of test compounds to inhibit replication of these mutant viruses. The concentration of compound required for 90~ inhibition of virus replication as measured in a sensitive viral RNA-based detection method is designated the IC90. It is desirable to have a compound which has high activity against a variety of mutants.
Dosaae and Formulation ' The antiviral compounds of this invention can be administered as treatment for viral infections by any means that produces contact of the active agent with the agent's site of action, i.e., the viral reverse transcriptase, in the body of a mammal. They can be administered by any conventional means available for use in conjunction with pharmaceuticals, either as individual therapeutic agents or in a combination of therapeutic agents. They can be administered alone, but preferably are administered with a pharmaceutical carrier selected on the basis of the chosen route of administration and standard pharmaceutical practice.
The dosage administered will, of course, vary depending upon known factors, such as the pharmacodynamic characteristics of the particular agent and its mode and route of administration; the age, health and weight of the recipient; the nature and extent of the symptoms; the kind of concurrent treatment; the frequency of treatment; and the effect desired. A daily dosage of active ingredient can be expected to be about 0.001 to about 1000 milligrams per kilogram of body weight, with the preferred dose being about 0.1 to about 30 mg/kg.
Dosage forms of compositions suitable for administration contain from about 1 mg to about 100 mg of active ingredient per unit. In these pharmaceutical compositions the active ingredient will ordinarily be present in an amount of about 0.5-95~ by weight based on the total weight of the composition. The active ingredient can be administered orally in solid dosage forms, such as capsules, tablets and powders, or in liquid dosage forms, such as elixirs, syrups and suspensions. It can also be administered parenterally, in sterile liquid dosage forms.
Gelatin capsules contain the active ingredient and powdered carriers, such as lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like.
Similar diluents can be used to make compressed tablets.
Both tablets and capsules can be manufactured as sustained release products to provide for continuous release of medication over.a period of hours. Compressed tablets can be sugar coated or film coated to mask any unpleasant taste and protect the tablet from the atmosphere, or enteric coated for selective disintegration in the gastrointestinal tract.
Liquid dosage forms for oral administration can contain coloring and flavoring to increase patient acceptance.
In general, water, a suitable oil, saline, aqueous dextrose (glucose), and related sugar solutions and glycols such as propylene glycol or polyethylene glycols are suitable carriers for parenteral solutions. Solutions for parenteral S administration preferably contain a water soluble salt of the active ingredient, suitable stabilizing agents, and if necessary, buffer substances. Antioxidizing agents such as sodium bisulfite, sodium sulfite, or ascorbic acid, either alone or combined, are suitable stabilizing agents. Also used are citric acid and its salts, and sodium EDTA. In addition, parenteral solutions can contain preservatives, such as benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol. Suitable pharmaceutical carriers are described in Rernington's Pharmaceutical Sciences, supra, a standard reference text in this field.
Useful pharmaceutical dosage-forms for administration of the compounds of this invention can be illustrated as follows:
Capsules A large number of unit capsules can be prepared by filling standard two-piece hard gelatin capsules each with 100 mg of powdered active ingredient, I50 mg of lactose, 50 mg of cellulose, and 6 mg magnesium stearic.
Soft Gelatin Capsules A mixture of active ingredient in a digestible oil such as soybean oil, cottonseed oil or olive oil can be prepared and injected by means of a positive displacement pump into gelatin to form soft gelatin capsules containing 100 mg of the active ingredient. The capsules should then be washed and dried.
T a A large number of tablets can be prepared by conventional procedures so that the dosage unit is 100 mg of active ingredient, 0.2 mg of colloidal silicon dioxide, 5 milligrams of magnesium stearate, 275 mg of microcrystalline cellulose, 11 mg of starch and 98.8 mg of lactose.
Appropriate coatings may be applied to increase palatability or delay absorption.
Sust~ension An aqueous suspension can be prepared for oral administration so that each 5 mL contain 25 mg of finely divided active ingredient, 200 mg of sodium carboxymethyl cellulose, 5 mg of sodium benzoate, 1.0 g of sorbitol solution, U.S.P., and 0.025 mg of vanillin.
In~ectable A parenteral composition suitable for administration by injection can be prepared by stirring 1.5~ by weight of active ingredient in 10~ by volume propylene glycol and water. The solution is sterilized by commonly used techniques.
C9mbination of components (a1 and lb) Each therapeutic agent component of this invention can independently be in any dosage form, such as those described above, and can also be administered in various ways, as described above. In the following description component (b) is to be understood to represent one or more agents as described previously. Thus, if components (a) and (b) are to be treated the same or independently, each agent of component (b) may also be treated the same or independently.
Components (a) and (b) of the present invention may be formulated together, in a single dosage unit (that is, combined together in one capsule, tablet, powder, or liquid, etc.) as a combination product. Vdhen component (a) and (b) are not formulated together in a single dosage unit, the component (a) may be administered at the same time as component (b) or in any order; for example component (a) of this invention may be administered first, followed by administration of component (b), or they may be administered in the revserse order. If component (b) contains more that one agent, e.g., one RT inhibitor and one protease inhibitor, r i these agents may be administered together or in any order.
V~Then not administered at the same time, preferably the administration of component (a) and (b) occurs less than about one hour apart. Preferably, the route of administration of component (a) and (b) is oral. The terms oral agent, oral inhibitor, oral compound, or the like, as used herein, denote compounds which may be orally administered. Although it is preferable that component (a) and component (b) both be administered by the same route (that is, for example, both orally) or dosage form, if desired, they may each be administered by different routes (that is, for example, one component of the combination product may be administered orally, and another component may be administered intravenously) or dosage forms.
As is appreciated by a medical practitioner skilled in the art, the dosage of the combination therapy of the invention may vary depending upon various factors such as the pharmacodynamic characteristics of the particular agent and its mode and route of administration, the age, health and weight of the recipient, the nature and extent of the symptoms, the kind of concurrent treatment, the frequency of treatment, and the effect desired, as described above.
The proper dosage of components (a) and (b) of the present invention will be readily ascertainable by a medical practitioner skilled in the art, based upon the present disclosure. By way of general guidance, typically a daily dosage may be about 100 milligrams to about 1.5 grams of each component. If component (b) represents more than one compound, then typically a daily dosage may be about 100 milligrams to about 1.5 grams of each agent of component (b).
By way of general guidance, when the compounds of component (a) and component (b) are administered in combination, the dosage amount of each component may be reduced by about 70-80~ relative to the usual dosage of the component when it is administered alone as a single agent for the treatment of HIV
infection, in view of the synergistic effect of the combination.
The combination products of this invention may be formulated such that, although the active ingredients are combined in a single dosage unit, the physical contact between the active ingredients is minimized. In order to minimize contact, for example, where the product is orally administered, one active ingredient may be enteric coated.
By enteric coating one of the active ingredients, it is possible not only to minimize the contact between the combined active ingredients, but also, it is possible to control the release of one of these components in the gastrointestinal tract such that one of these components is not released in the stomach but rather is released in the intestines. Another embodiment of this invention where oral administration is desired provides for a combination product wherein one of the active ingredients is coated with a sustained-release material which effects a sustained-release throughout the gastrointestinal tract and also serves to minimize physical contact between the combined active ingredients. Furthermore, the sustained-released component can be additionally enteric coated such that the release of this component occurs only in the intestine. Still another approach would involve the formulation of a combination product in which the one component is coated with a sustained and/or enteric release polymer, and the other component is also coated with a polymer such as a lowviscosity grade of hydroxypropyl methylcellulose or other appropriate materials as known in the art, in order to further separate the active components. The polymer coating serves to form an additional barrier to interaction with the other component. In each forniulation wherein contact is prevented between components (a) and (b) via a coating or some other material, contact may also be prevented between the individual agents of component (b) .
Dosage forms of the combination products of the present invention wherein one active ingredient is enteric coated can be in the form of tablets such that the enteric coated component and the other active ingredient are blended together and then compressed into a tablet or such that the r enteric coated component is compressed into one tablet layer and the other active ingredient is compressed into an additional layer. Optionally, in order to further separate the two layers, one or more placebo layers may be present such that the placebo layer is between the layers of active ingredients. In addition, dosage forms of the present invention can be in the form of capsules wherein one active ingredient is compressed into a tablet or in the form of a plurality of microtablets, particles, granules or non-perils, which are then enteric coated. These enteric coated microtablets, particles, granules or non-perils are then placed into a capsule or compressed into a capsule along with a granulation of the other active ingredient.
These as well as other ways of minimizing contact between the components of combination products of the present invention, whether administered in a single dosage form or administered in separate forms but at the same time or concurrently by the same manner, will be readily apparent to those skilled in the art, based on the present disclosure.
Pharmaceutical kits useful for the treatment of HIV
infection, which comprise a therapeutically effective amount of a pharmaceutical composition comprising a compound of component (a) and one or more compounds of component (b), in one or more sterile containers, are also within the ambit of the present invention. Sterilization of the container may be carried out using conventional sterilization methodology well known to those skilled in the art. Component (a) and component (b) may be in the same sterile container or in separate sterile containers. The sterile containers of materials may comprise separate containers, or one or more multi-part containers, as desired. Component (a) and component (b), may be separate, or physically combined into a single dosage form or unit as described above. Such kits may further include, if desired, one or more of various conventional pharmaceutical kit components, such as for example, one or more pharmaceutically acceptable carriers, additional vials for mixing the components, etc., as will be readily apparent to those skilled in the art. Instructions, either as inserts or as labels, indicating quantities of the components to be administered, guidelines for administration, and/or guidelines for mixing the components, may also be included in the kit.
S Obviously, numerous modifications and variations of the present invention are possible in light of the above teachings. It is therefore to be understood that within the scope of the appended claims, the invention may be practiced othervuise than as specifically described herein.
Claims (18)
LETTER PATENT OF UNITED STATES IS:
1. A compound of formula (I):
or a stereoisomer or pharmaceutically acceptable salt thereof, wherein:
R1 is C1-3 alkyl substituted with 1-7 halogen;
R2 is selected from C1-5 alkyl substituted with 1-2 R4, C2-5 alkenyl substituted with 1-2 R4, and C2-5 alkynyl substituted with 1 R4;
R3, at each occurrence, is independently selected from C1-4 alkyl, OH, C1-4 alkoxy, F, Cl, Br, I, NR5R5a, NO2, CN, C(O)R6, NHC(O)R7, and NHC(O)NR5R5a;
alternatively, if two R3's are present and are attached to adjacent carbons, then they may combine to form -OCH2O-;
R4 is selected from C3-5 cycloalkyl substituted with 0-2 R3, phenyl substituted with 0-5 R3, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from O, N, and S, substituted with 0-2 R3;
R5 and R5a are independently selected from H and C1-3 alkyl;
R6 is selected from H, OH, C1-4 alkyl, C1-4 alkoxy, and NR5R5a;
R7 is selected from C1-3 alkyl and C1-3 alkoxy;
R8 is selected from H, C3-5 cycloalkyl, and C1-3 alkyl; and, n is selected from 0, 1, 2, 3, and 4.
or a stereoisomer or pharmaceutically acceptable salt thereof, wherein:
R1 is C1-3 alkyl substituted with 1-7 halogen;
R2 is selected from C1-5 alkyl substituted with 1-2 R4, C2-5 alkenyl substituted with 1-2 R4, and C2-5 alkynyl substituted with 1 R4;
R3, at each occurrence, is independently selected from C1-4 alkyl, OH, C1-4 alkoxy, F, Cl, Br, I, NR5R5a, NO2, CN, C(O)R6, NHC(O)R7, and NHC(O)NR5R5a;
alternatively, if two R3's are present and are attached to adjacent carbons, then they may combine to form -OCH2O-;
R4 is selected from C3-5 cycloalkyl substituted with 0-2 R3, phenyl substituted with 0-5 R3, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from O, N, and S, substituted with 0-2 R3;
R5 and R5a are independently selected from H and C1-3 alkyl;
R6 is selected from H, OH, C1-4 alkyl, C1-4 alkoxy, and NR5R5a;
R7 is selected from C1-3 alkyl and C1-3 alkoxy;
R8 is selected from H, C3-5 cycloalkyl, and C1-3 alkyl; and, n is selected from 0, 1, 2, 3, and 4.
2. A compound according to Claim 1, wherein:
R1 is C1-3 alkyl substituted with 1-7 halogen;
R2 is selected from C1-5 alkyl substituted with 1 R4, C2-5 alkenyl substituted with 1 R4, and C2-5 alkynyl substituted with 1 R4;
R3, at each occurrence, is independently selected from C1-4 alkyl, OH, C1-4 alkoxy, F, Cl, Br, I, NR5R5a, NO2, CN, C(O)R6, NHC(O)R7, and NHC(O)NR5R5a;
alternatively, if two R3's are present and are attached to adjacent carbons, then they may combine to form -OCH2O-;
R4 is selected from C3-5 cycloalkyl substituted with 0-2 R3, phenyl substituted with 0-2 R3, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from O, N, and S, substituted with 0-1 R3;
R5 and R5a are independently selected from H, CH3 and C2H5;
R6 is selected from H, OH, CH3, C2H5, OCH3, OC2H5, and NR5R5a;
R7 is selected from CH3, C2H5, OCH3, and OC2H5;
R8 is selected from H, cyclopropyl, CH3 and C2H5; and, n is selected from 0, 1, 2, and 3.
R1 is C1-3 alkyl substituted with 1-7 halogen;
R2 is selected from C1-5 alkyl substituted with 1 R4, C2-5 alkenyl substituted with 1 R4, and C2-5 alkynyl substituted with 1 R4;
R3, at each occurrence, is independently selected from C1-4 alkyl, OH, C1-4 alkoxy, F, Cl, Br, I, NR5R5a, NO2, CN, C(O)R6, NHC(O)R7, and NHC(O)NR5R5a;
alternatively, if two R3's are present and are attached to adjacent carbons, then they may combine to form -OCH2O-;
R4 is selected from C3-5 cycloalkyl substituted with 0-2 R3, phenyl substituted with 0-2 R3, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from O, N, and S, substituted with 0-1 R3;
R5 and R5a are independently selected from H, CH3 and C2H5;
R6 is selected from H, OH, CH3, C2H5, OCH3, OC2H5, and NR5R5a;
R7 is selected from CH3, C2H5, OCH3, and OC2H5;
R8 is selected from H, cyclopropyl, CH3 and C2H5; and, n is selected from 0, 1, 2, and 3.
3. A compound according to Claim 2, wherein:
R1 is selected from CF3, and C2F5;
R2 is selected from C1-3 alkyl substituted with 1 R4, C2-3 alkenyl substituted with 1 R4, and C2-3 alkynyl substituted with 1 R4;
R3, at each occurrence, is independently selected from C1-3 alkyl, OH, C1-3 alkoxy, F, Cl, Br, I, NR5R5a, NO2, CN, C(O)R6, NHC(O)R7, and NHC(O)NR5R5a;
alternatively, if two R3's are present and are attached to adjacent carbons, then they may combine to form -OCH2O-;
R4 is selected from C3-5 cycloalkyl substituted with 0-2 R3, phenyl substituted with 0-2 R3, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from O, N, and S, substituted with 0-1 R3;
R5 and R5a are independently selected from H, CH3 and C2H5;
R6 is selected from H, OH, CH3, C2H5, OCH3, OC2H5, and NR5R5a;
R7 is selected from CH3, C2H5, OCH3, and OC2H5;
R8 is selected from H, CH3 and C2H5; and, n is selected from 0, 1, and 2.
R1 is selected from CF3, and C2F5;
R2 is selected from C1-3 alkyl substituted with 1 R4, C2-3 alkenyl substituted with 1 R4, and C2-3 alkynyl substituted with 1 R4;
R3, at each occurrence, is independently selected from C1-3 alkyl, OH, C1-3 alkoxy, F, Cl, Br, I, NR5R5a, NO2, CN, C(O)R6, NHC(O)R7, and NHC(O)NR5R5a;
alternatively, if two R3's are present and are attached to adjacent carbons, then they may combine to form -OCH2O-;
R4 is selected from C3-5 cycloalkyl substituted with 0-2 R3, phenyl substituted with 0-2 R3, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from O, N, and S, substituted with 0-1 R3;
R5 and R5a are independently selected from H, CH3 and C2H5;
R6 is selected from H, OH, CH3, C2H5, OCH3, OC2H5, and NR5R5a;
R7 is selected from CH3, C2H5, OCH3, and OC2H5;
R8 is selected from H, CH3 and C2H5; and, n is selected from 0, 1, and 2.
4. A compound according to Claim 3, wherein:
R1 is CF3;
R2 is selected from C1-3 alkyl substituted with 1 R4, C2-3 alkenyl substituted with 1 R4, and C2-3 alkynyl substituted with 1 R4;
R3, at each occurrence, is independently selected from C1-3 alkyl, OH, C1-3 alkoxy, F, Cl, NR5R5a, NO2, CN, C(O)R6, NHC(O)R7, and NHC(O)NR5R5a;
alternatively, if two R3's are present and are attached to adjacent carbons, then they may combine to form -OCH2O-;
R4 is selected from cyclopropyl substituted with 0-1 R3, phenyl substituted with 0-2 R3, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from O, N, and S, substituted with 0-1 R3, wherein the heterocyclic system is selected from 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-furanyl, 3-furanyl, 2-thienyl, 3-thienyl, 2-oxazolyl, 2-thiazolyl, 4-isoxazolyl, and 2-imidazolyl;
R5 arid R5a are independently selected from H, CH3 and C2H5;
R6 is selected from H, OH, CH3, C2H5, OCH3, OC2H5, and NR5R5a.
R7 is selected from CH3, C2H5, OCH3, and OC2H5;
R8 is selected from H, CH3 and C2H5; and, n is selected from 1 and 2.
R1 is CF3;
R2 is selected from C1-3 alkyl substituted with 1 R4, C2-3 alkenyl substituted with 1 R4, and C2-3 alkynyl substituted with 1 R4;
R3, at each occurrence, is independently selected from C1-3 alkyl, OH, C1-3 alkoxy, F, Cl, NR5R5a, NO2, CN, C(O)R6, NHC(O)R7, and NHC(O)NR5R5a;
alternatively, if two R3's are present and are attached to adjacent carbons, then they may combine to form -OCH2O-;
R4 is selected from cyclopropyl substituted with 0-1 R3, phenyl substituted with 0-2 R3, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from O, N, and S, substituted with 0-1 R3, wherein the heterocyclic system is selected from 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-furanyl, 3-furanyl, 2-thienyl, 3-thienyl, 2-oxazolyl, 2-thiazolyl, 4-isoxazolyl, and 2-imidazolyl;
R5 arid R5a are independently selected from H, CH3 and C2H5;
R6 is selected from H, OH, CH3, C2H5, OCH3, OC2H5, and NR5R5a.
R7 is selected from CH3, C2H5, OCH3, and OC2H5;
R8 is selected from H, CH3 and C2H5; and, n is selected from 1 and 2.
5. A compound according to Claim 4, wherein the compound is of formula Ia:
6. A compound according to Claim 4, wherein the compound is of formula Ia:
7. A compound according to Claim 1, wherein the compound is selected from:
(+/-)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Chloro-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Chloro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-4-Cyclopropylethynyl-6-methoxy-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Methoxy-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Methoxy-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(LH)-quinazolinone;
(+/-)-5,6-Difluoro-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-5,6-Difluoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-4-Cyclopropylethynyl-6-fluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-(2'-2-pyridyl)ethyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-phenylethyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(-)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(-)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+)-E-4-Cyclopropylethenyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone; and, (-)-6-Chloro-4-E-cyclopropylethenyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
or a pharmaceutically acceptable salt thereof.
(+/-)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Chloro-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Chloro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-4-Cyclopropylethynyl-6-methoxy-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Methoxy-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Methoxy-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(LH)-quinazolinone;
(+/-)-5,6-Difluoro-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-5,6-Difluoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-4-Cyclopropylethynyl-6-fluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-(2'-2-pyridyl)ethyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-phenylethyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(-)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(-)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+)-E-4-Cyclopropylethenyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone; and, (-)-6-Chloro-4-E-cyclopropylethenyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
or a pharmaceutically acceptable salt thereof.
8. A compound according of formula II:
or a stereoisomer or pharmaceutically acceptable salt thereof, wherein:
R2 is C=C-R4a;
R3 is selected from C1-4 alkyl, OH, C1-4 alkoxy, F, Cl, Br, I, NR5R5a, NO2, CN, C(O)R6, NHC(O)R7, and NHC(O)NR5R5a;
R4a is selected from methyl, ethyl, n-propyl, i-propyl, i-butyl, t-butyl, and i-pentyl;
R5 and R5a are independently selected from H and C1-3 alkyl;
R6 is selected from H, OH, C1-4 alkyl, C1-4 alkoxy, and NR5R5a;
R7 is selected from C1-3 alkyl and C1-3 alkoxy;
R8 is selected from H, C3-5 cycloalkyl, and C1-3 alkyl; and, n is selected from 0, 1, 2, 3, and 4.
or a stereoisomer or pharmaceutically acceptable salt thereof, wherein:
R2 is C=C-R4a;
R3 is selected from C1-4 alkyl, OH, C1-4 alkoxy, F, Cl, Br, I, NR5R5a, NO2, CN, C(O)R6, NHC(O)R7, and NHC(O)NR5R5a;
R4a is selected from methyl, ethyl, n-propyl, i-propyl, i-butyl, t-butyl, and i-pentyl;
R5 and R5a are independently selected from H and C1-3 alkyl;
R6 is selected from H, OH, C1-4 alkyl, C1-4 alkoxy, and NR5R5a;
R7 is selected from C1-3 alkyl and C1-3 alkoxy;
R8 is selected from H, C3-5 cycloalkyl, and C1-3 alkyl; and, n is selected from 0, 1, 2, 3, and 4.
9. A compound according to Claim 8, wherein:
R2 is C=C-R4a;
R3 is selected from C1-4 alkyl, OH, C1-4 alkoxy, F, Cl, Br, I, NR5R5a, NO2 , CN, C(O)R6, and NHC(O)R7;
R4a is selected from methyl, ethyl, n-propyl, i-propyl, i-butyl, t-butyl, and i-pentyl;
R5 and R5a are independently selected from H, CH3 and C2H5;
R6 is selected from H, OH, CH3, C2H5, OCH3, OC2H5, and NR5R5a;
R7 is selected from CH3, C2H5, OCH3, and OC2H5;
R8 is selected from H, cyclopropyl, CH3 and C2H5; and, n is selected from 0, 1, and 2.
R2 is C=C-R4a;
R3 is selected from C1-4 alkyl, OH, C1-4 alkoxy, F, Cl, Br, I, NR5R5a, NO2 , CN, C(O)R6, and NHC(O)R7;
R4a is selected from methyl, ethyl, n-propyl, i-propyl, i-butyl, t-butyl, and i-pentyl;
R5 and R5a are independently selected from H, CH3 and C2H5;
R6 is selected from H, OH, CH3, C2H5, OCH3, OC2H5, and NR5R5a;
R7 is selected from CH3, C2H5, OCH3, and OC2H5;
R8 is selected from H, cyclopropyl, CH3 and C2H5; and, n is selected from 0, 1, and 2.
10. A compound according to Claim 9, wherein the compound is of formula IIa:
11. A compound according to Claim 9, wherein the compound is of formula IIb:
12. A compound according to Claim 8, wherein the compound is selected from:
(+/-)-6-Chloro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Chloro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone;
(+/-)-4-Isopropylethynyl-6-methoxy-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-5,6-Difluoro-4-isopentyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(-)-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+)-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(-)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone; and, (+)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
or a pharmaceutically acceptable salt thereof.
(+/-)-6-Chloro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Chloro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone;
(+/-)-4-Isopropylethynyl-6-methoxy-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-5,6-Difluoro-4-isopentyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(-)-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+)-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(-)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone; and, (+)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
or a pharmaceutically acceptable salt thereof.
13. A pharmaceutical composition, comprising: a pharmaceutically acceptable carrier and a therapeutically effective amount of a compound of one of Claims 1-12 or a pharmaceutically acceptable salt form thereof.
14. A method for treating HIV infection, comprising:
administering to a host in need of such treatment a therapeutically effective amount of a compound of one of Claims 1-12, or a pharmaceutically acceptable salt form thereof.
administering to a host in need of such treatment a therapeutically effective amount of a compound of one of Claims 1-12, or a pharmaceutically acceptable salt form thereof.
15. A method of treating HIV infection which comprises administering, in combination, to a host in need thereof a therapeutically effective amount of:
(a) a compound of one of Claims 1-12 or stereoisomeric forms, mixtures of stereoisomeric forms, or pharmaceutically acceptable salts thereof; and, (b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV
protease inhibitors.
(a) a compound of one of Claims 1-12 or stereoisomeric forms, mixtures of stereoisomeric forms, or pharmaceutically acceptable salts thereof; and, (b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV
protease inhibitors.
16. A method according to Claim 15, wherein the reverse transcriptase inhibitor is selected from AZT, 3TC, ddI, ddC, d4T, delavirdine, TIBO derivatives, BI-RG-587, nevirapine, L-697,661, LY 73497, Ro 18,893, loviride, trovirdine, MKC-442, and HBY 097, and the protease inhibitor is selected from saquinavir, ritonavir, indinavir, VX-478, nelfinavir, KNI-272, CGP-61755, U-140690, and ABT-378.
17. A method according to Claim 16, wherein the reverse transcriptase inhibitor is selected from AZT and 3TC and the protease inhibitor is selected from saquinavir, nelfinavir, ritonavir, and indinavir.
18. A pharmaceutical kit useful for the treatment of HIV infection, which comprises a therapeutically effective amount of:
(a) a compound of one of Claims 1-12 or stereoisomeric forms, mixtures of stereoisomeric forms, or pharmaceutically acceptable salts thereof; and, (b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV
protease inhibitors, in one or more sterile containers.
(a) a compound of one of Claims 1-12 or stereoisomeric forms, mixtures of stereoisomeric forms, or pharmaceutically acceptable salts thereof; and, (b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV
protease inhibitors, in one or more sterile containers.
Applications Claiming Priority (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US83854097A | 1997-04-09 | 1997-04-09 | |
| US08/838540 | 1997-04-09 | ||
| US7132298P | 1998-01-14 | 1998-01-14 | |
| US60/071322 | 1998-01-14 | ||
| PCT/US1998/006733 WO1998045276A2 (en) | 1997-04-09 | 1998-04-07 | 4,4-disubstituted-3,4-dihydro-2(1h)-quinazolinones useful as hiv reverse transcriptase inhibitors |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2284996A1 true CA2284996A1 (en) | 1998-10-15 |
Family
ID=26752095
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002284996A Abandoned CA2284996A1 (en) | 1997-04-09 | 1998-04-07 | 4,4-disubstituted-3,4-dihydro-2(1h)-quinazolinones useful as hiv reverse transcriptase inhibitors |
Country Status (19)
| Country | Link |
|---|---|
| EP (1) | EP0973753A2 (en) |
| JP (1) | JP2002504095A (en) |
| KR (1) | KR20010006146A (en) |
| CN (1) | CN1252063A (en) |
| AR (1) | AR012340A1 (en) |
| AU (1) | AU734928B2 (en) |
| BR (1) | BR9808513A (en) |
| CA (1) | CA2284996A1 (en) |
| EA (1) | EA001991B1 (en) |
| EE (1) | EE9900452A (en) |
| HR (1) | HRP980143A2 (en) |
| HU (1) | HUP0001446A3 (en) |
| IL (1) | IL132188A0 (en) |
| NO (1) | NO314936B1 (en) |
| NZ (1) | NZ500592A (en) |
| PL (1) | PL336305A1 (en) |
| SK (1) | SK137899A3 (en) |
| TW (1) | TW587078B (en) |
| WO (1) | WO1998045276A2 (en) |
Families Citing this family (46)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU3199099A (en) * | 1998-03-27 | 1999-10-18 | Du Pont Pharmaceuticals Company | 4,4-disubstituted-3,4-dihydro-2(1h)-quinazolinthione derivatives, their preparation and their use as hiv reverse transcriptase inhibitors |
| AU6508899A (en) | 1998-10-13 | 2000-05-01 | Du Pont Pharmaceuticals Company | Selective eradication of virally-infected cells by combined use of a cytotoxic agent and an antiviral agent |
| US6225317B1 (en) * | 1998-11-19 | 2001-05-01 | Dupont Pharmaceuticals Company | Crystalline (-)-6-chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone |
| AU1821900A (en) * | 1998-11-19 | 2000-06-05 | Du Pont Pharmaceuticals Company | Process for the preparation of quinazolinones |
| US6175009B1 (en) | 1999-11-18 | 2001-01-16 | Dupont Pharmaceuticals Company | Process for the preparation of quinazolinones |
| US6759410B1 (en) | 1999-11-23 | 2004-07-06 | Smithline Beecham Corporation | 3,4-dihydro-(1H)-quinazolin-2-ones and their use as CSBP/p38 kinase inhibitors |
| DE60023025T2 (en) | 1999-11-23 | 2006-07-13 | Smithkline Beecham Corp. | 3,4-DIHYDRO- (1H) CHINAZOLIN-2-ON COMPOUNDS AS CSBP / P39 KINASE INHIBITORS |
| US6555686B2 (en) * | 2000-03-23 | 2003-04-29 | Bristol-Myers Squibb Pharma | Asymmetric synthesis of quinazolin-2-ones useful as HIV reverse transcriptase inhibitors |
| AU2001249161A1 (en) * | 2000-03-23 | 2001-10-03 | Bristol-Myers Squibb Pharma Company | Asymmetric synthesis of quinazolin-2-ones useful as hiv reverse transcriptase inhibitors |
| ZA200300255B (en) | 2000-07-20 | 2004-09-28 | Bristol Myers Squibb Pharma Co | Tricyclic 2-pyridone compounds useful as HIV reverse transcriptase inhibitors. |
| US6596729B2 (en) * | 2000-07-20 | 2003-07-22 | Bristol-Myers Squibb Company | Tricyclic-2-pyridone compounds useful as HIV reverse transcriptase inhibitors |
| US8641644B2 (en) | 2000-11-21 | 2014-02-04 | Sanofi-Aventis Deutschland Gmbh | Blood testing apparatus having a rotatable cartridge with multiple lancing elements and testing means |
| US7041068B2 (en) | 2001-06-12 | 2006-05-09 | Pelikan Technologies, Inc. | Sampling module device and method |
| US9795747B2 (en) | 2010-06-02 | 2017-10-24 | Sanofi-Aventis Deutschland Gmbh | Methods and apparatus for lancet actuation |
| US9226699B2 (en) | 2002-04-19 | 2016-01-05 | Sanofi-Aventis Deutschland Gmbh | Body fluid sampling module with a continuous compression tissue interface surface |
| US9427532B2 (en) | 2001-06-12 | 2016-08-30 | Sanofi-Aventis Deutschland Gmbh | Tissue penetration device |
| US7713214B2 (en) | 2002-04-19 | 2010-05-11 | Pelikan Technologies, Inc. | Method and apparatus for a multi-use body fluid sampling device with optical analyte sensing |
| US7547287B2 (en) | 2002-04-19 | 2009-06-16 | Pelikan Technologies, Inc. | Method and apparatus for penetrating tissue |
| US8784335B2 (en) | 2002-04-19 | 2014-07-22 | Sanofi-Aventis Deutschland Gmbh | Body fluid sampling device with a capacitive sensor |
| US9248267B2 (en) | 2002-04-19 | 2016-02-02 | Sanofi-Aventis Deustchland Gmbh | Tissue penetration device |
| US9314194B2 (en) | 2002-04-19 | 2016-04-19 | Sanofi-Aventis Deutschland Gmbh | Tissue penetration device |
| US8579831B2 (en) | 2002-04-19 | 2013-11-12 | Sanofi-Aventis Deutschland Gmbh | Method and apparatus for penetrating tissue |
| US9795334B2 (en) | 2002-04-19 | 2017-10-24 | Sanofi-Aventis Deutschland Gmbh | Method and apparatus for penetrating tissue |
| US8702624B2 (en) | 2006-09-29 | 2014-04-22 | Sanofi-Aventis Deutschland Gmbh | Analyte measurement device with a single shot actuator |
| AU2003295940A1 (en) * | 2002-12-16 | 2004-07-29 | Boehringer Ingelheim Pharmaceuticals, Inc. | Treatment of hiv infection through combined administration of tipranavir and capravirine |
| US8574895B2 (en) | 2002-12-30 | 2013-11-05 | Sanofi-Aventis Deutschland Gmbh | Method and apparatus using optical techniques to measure analyte levels |
| WO2006001797A1 (en) | 2004-06-14 | 2006-01-05 | Pelikan Technologies, Inc. | Low pain penetrating |
| US8282576B2 (en) | 2003-09-29 | 2012-10-09 | Sanofi-Aventis Deutschland Gmbh | Method and apparatus for an improved sample capture device |
| US9351680B2 (en) | 2003-10-14 | 2016-05-31 | Sanofi-Aventis Deutschland Gmbh | Method and apparatus for a variable user interface |
| EP1706026B1 (en) | 2003-12-31 | 2017-03-01 | Sanofi-Aventis Deutschland GmbH | Method and apparatus for improving fluidic flow and sample capture |
| EP1751546A2 (en) | 2004-05-20 | 2007-02-14 | Albatros Technologies GmbH & Co. KG | Printable hydrogel for biosensors |
| WO2005120365A1 (en) | 2004-06-03 | 2005-12-22 | Pelikan Technologies, Inc. | Method and apparatus for a fluid sampling device |
| US9775553B2 (en) | 2004-06-03 | 2017-10-03 | Sanofi-Aventis Deutschland Gmbh | Method and apparatus for a fluid sampling device |
| US9386944B2 (en) | 2008-04-11 | 2016-07-12 | Sanofi-Aventis Deutschland Gmbh | Method and apparatus for analyte detecting device |
| US9375169B2 (en) | 2009-01-30 | 2016-06-28 | Sanofi-Aventis Deutschland Gmbh | Cam drive for managing disposable penetrating member actions with a single motor and motor and control system |
| US8440693B2 (en) | 2009-12-22 | 2013-05-14 | Novartis Ag | Substituted isoquinolinones and quinazolinones |
| US8965476B2 (en) | 2010-04-16 | 2015-02-24 | Sanofi-Aventis Deutschland Gmbh | Tissue penetration device |
| CN102060786A (en) * | 2011-01-20 | 2011-05-18 | 天津大学 | 4-(substituted-1,3-diyne)-4-(trifluoromethyl)-3,4-dihydro substituted quinazoline-2-ketone compound as well as preparation method and application thereof |
| JP6054370B2 (en) * | 2011-04-06 | 2016-12-27 | バイオヴァクシム・リミテッド | Pharmaceutical composition for preventing and / or treating HIV disease in humans |
| JP6171003B2 (en) | 2012-05-24 | 2017-07-26 | ノバルティス アーゲー | Pyrrolopyrrolidinone compounds |
| WO2014115077A1 (en) | 2013-01-22 | 2014-07-31 | Novartis Ag | Substituted purinone compounds |
| US9556180B2 (en) | 2013-01-22 | 2017-01-31 | Novartis Ag | Pyrazolo[3,4-d]pyrimidinone compounds as inhibitors of the P53/MDM2 interaction |
| KR20160012194A (en) | 2013-05-27 | 2016-02-02 | 노파르티스 아게 | Imidazopyrrolidinone derivatives and their use in the treatment of disease |
| WO2014191906A1 (en) | 2013-05-28 | 2014-12-04 | Novartis Ag | Pyrazolo-pyrrolidin-4-one derivatives as bet inhibitors and their use in the treatment of disease |
| AU2014272700B2 (en) | 2013-05-28 | 2016-12-01 | Novartis Ag | Pyrazolo-pyrrolidin-4-one derivatives and their use in the treatment of disease |
| AU2014351413B2 (en) | 2013-11-21 | 2017-06-01 | Novartis Ag | Pyrrolopyrrolone derivatives and their use as BET inhibitors |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| IL102764A0 (en) * | 1991-08-16 | 1993-01-31 | Merck & Co Inc | Quinazoline derivatives,and pharmaceutical compositions containing them |
| AU2436792A (en) * | 1991-08-16 | 1993-03-16 | Merck & Co., Inc. | Quinazoline derivatives as inhibitors of hiv reverse transcriptase |
| WO1993022292A1 (en) * | 1992-05-07 | 1993-11-11 | Merck & Co., Inc. | New quinazolines as inhibitors of hiv reverse transcriptase |
| US5519021A (en) * | 1992-08-07 | 1996-05-21 | Merck & Co., Inc. | Benzoxazinones as inhibitors of HIV reverse transcriptase |
| DE4320347A1 (en) * | 1993-06-19 | 1994-12-22 | Boehringer Mannheim Gmbh | Quinazoline derivatives and medicaments containing them |
| GB2281297A (en) * | 1993-08-27 | 1995-03-01 | Merck & Co Inc | Quinazoline compounds |
| AU1046895A (en) * | 1993-11-05 | 1995-05-23 | Merck & Co., Inc. | New quinazolines as inhibitors of hiv reverse transcriptase |
| US5434152A (en) * | 1993-11-08 | 1995-07-18 | Merck & Co., Inc. | Asymmetric synthesis of (S)-(-)-6-chloro-4- cyclopropyl-3,4-dihydro-4-[(2-pyridyl)ethynyl]-2(1H)-quinazolinone |
-
1998
- 1998-03-19 HR HR60/071,322A patent/HRP980143A2/en not_active Application Discontinuation
- 1998-04-06 AR ARP980101558A patent/AR012340A1/en not_active Application Discontinuation
- 1998-04-07 SK SK1378-99A patent/SK137899A3/en unknown
- 1998-04-07 HU HU0001446A patent/HUP0001446A3/en unknown
- 1998-04-07 PL PL98336305A patent/PL336305A1/en unknown
- 1998-04-07 EE EEP199900452A patent/EE9900452A/en unknown
- 1998-04-07 KR KR1019997009225A patent/KR20010006146A/en not_active Application Discontinuation
- 1998-04-07 EA EA199900907A patent/EA001991B1/en not_active IP Right Cessation
- 1998-04-07 BR BR9808513-1A patent/BR9808513A/en not_active IP Right Cessation
- 1998-04-07 AU AU67960/98A patent/AU734928B2/en not_active Ceased
- 1998-04-07 NZ NZ500592A patent/NZ500592A/en unknown
- 1998-04-07 JP JP54297198A patent/JP2002504095A/en active Pending
- 1998-04-07 CA CA002284996A patent/CA2284996A1/en not_active Abandoned
- 1998-04-07 WO PCT/US1998/006733 patent/WO1998045276A2/en not_active Application Discontinuation
- 1998-04-07 CN CN98803974A patent/CN1252063A/en active Pending
- 1998-04-07 IL IL13218898A patent/IL132188A0/en unknown
- 1998-04-07 EP EP98913401A patent/EP0973753A2/en not_active Withdrawn
- 1998-04-15 TW TW087105365A patent/TW587078B/en active
-
1999
- 1999-10-08 NO NO19994904A patent/NO314936B1/en not_active IP Right Cessation
Also Published As
| Publication number | Publication date |
|---|---|
| BR9808513A (en) | 2000-05-23 |
| CN1252063A (en) | 2000-05-03 |
| HUP0001446A2 (en) | 2001-05-28 |
| AU6796098A (en) | 1998-10-30 |
| NZ500592A (en) | 2001-09-28 |
| PL336305A1 (en) | 2000-06-19 |
| HUP0001446A3 (en) | 2001-11-28 |
| AR012340A1 (en) | 2000-10-18 |
| NO994904D0 (en) | 1999-10-08 |
| KR20010006146A (en) | 2001-01-26 |
| EE9900452A (en) | 2000-04-17 |
| EP0973753A2 (en) | 2000-01-26 |
| IL132188A0 (en) | 2001-03-19 |
| HRP980143A2 (en) | 1999-02-28 |
| NO314936B1 (en) | 2003-06-16 |
| EA199900907A1 (en) | 2000-04-24 |
| SK137899A3 (en) | 2000-05-16 |
| AU734928B2 (en) | 2001-06-28 |
| EA001991B1 (en) | 2001-10-22 |
| WO1998045276A3 (en) | 1999-01-14 |
| NO994904L (en) | 1999-12-01 |
| TW587078B (en) | 2004-05-11 |
| WO1998045276A2 (en) | 1998-10-15 |
| JP2002504095A (en) | 2002-02-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU734928B2 (en) | 4,4-disubstituted-3,4-dihydro-2(1H)-quinazolinones useful as HIV reverse transcriptase inhibitors | |
| US6124302A (en) | 4,4-disubstituted-3,4-dihydro-2(1H)-quinazolinones useful as HIV reverse transcriptase inhibitors | |
| WO2003062238A1 (en) | Tricyclic 2-pyrimidone compounds useful as hiv reverse transcriptase inhibitors | |
| EP1379248A1 (en) | Tricyclic compounds useful as hiv reverse transcriptase inhibitors | |
| US6127375A (en) | 4,4-disubstituted-3,4-dihydro-2(1H)-quinazolinthiones useful as HIV reverse transcriptase inhibitors | |
| US6204262B1 (en) | 1,3-Benzodiazepin-2-ones and 1,3-Benzoxazepin-2-ones useful as HIV reverse transcriptase inhibitors | |
| US6489320B1 (en) | 5, 5-disubstituted-1, 5-dihydro-4, 1-benzoxazepin-2 (3H)-ones useful as HIV reverse transcriptase inhibitors | |
| US6090821A (en) | Substituted quinolin-2 (1H)-ones useful as HIV reverse transcriptase inhibitors | |
| US6946469B2 (en) | Cyanamide, alkoxyamino, and urea derivatives of 4,4-disubstituted-3,4-dihydro-2(1H)-quinazolinones as HIV reverse transcriptase inhibitors | |
| US20040063734A1 (en) | 4,4-Disubstituted-3,4-dihydro-2 (1H)-quinazoliniones useful as HIV reverse transcriptase inhibitors | |
| US6462037B1 (en) | 1,4-benzodiazepin-2-ones useful as HIV reverse transcriptase inhibitors | |
| US6265406B1 (en) | Substituted quinolin-2 (1H) -ones useful as HIV reverse transcriptase inhibitors | |
| US7015214B2 (en) | Cyanamide, alkoxyamino, and urea derivatives of 1,3-benzodiazepine as HIV reverse transcriptase inhibitors | |
| AU7371301A (en) | 4,4-disubstituted-3,4-dihydro-2-)1H)- quinazolinones useful as HIV reverse transcriptase inhibitors | |
| CZ352499A3 (en) | 4,4-disubstituted-3,4-dihydro-2 (1H)-quinazolinones suitable as inhibitors of HIV reverse transcriptase | |
| MXPA99008909A (en) | 4,4-disubstituted-3,4-dihydro-2(1h)-quinazolinones useful as hiv reverse transcriptase inhibitors | |
| AU2002254652A1 (en) | Tricyclic compounds useful as HIV reverse transcriptase inhibitors | |
| AU2003203047A1 (en) | Tricyclic 2-pyrimidone compounds useful as HIV reverse transcriptase inhibitors |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| EEER | Examination request | ||
| FZDE | Discontinued |