EP0973753A2 - 4,4-disubstituted-3,4-dihydro-2(1h)-quinazolinones useful as hiv reverse transcriptase inhibitors - Google Patents

4,4-disubstituted-3,4-dihydro-2(1h)-quinazolinones useful as hiv reverse transcriptase inhibitors

Info

Publication number
EP0973753A2
EP0973753A2 EP98913401A EP98913401A EP0973753A2 EP 0973753 A2 EP0973753 A2 EP 0973753A2 EP 98913401 A EP98913401 A EP 98913401A EP 98913401 A EP98913401 A EP 98913401A EP 0973753 A2 EP0973753 A2 EP 0973753A2
Authority
EP
European Patent Office
Prior art keywords
dihydro
pyridyl
quinazolinone
trifluoromethyl
och
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP98913401A
Other languages
German (de)
French (fr)
Inventor
Jeffrey W. Corbett
Soo Sung Ko
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Bristol Myers Squibb Pharma Co
Original Assignee
DuPont Merck Pharmaceutical Co
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by DuPont Merck Pharmaceutical Co filed Critical DuPont Merck Pharmaceutical Co
Publication of EP0973753A2 publication Critical patent/EP0973753A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D239/00—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/06—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/18—Antivirals for RNA viruses for HIV
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D239/00—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings
    • C07D239/70—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings condensed with carbocyclic rings or ring systems
    • C07D239/72—Quinazolines; Hydrogenated quinazolines
    • C07D239/78—Quinazolines; Hydrogenated quinazolines with hetero atoms directly attached in position 2
    • C07D239/80—Oxygen atoms

Definitions

  • TITLE 4 4-DISUBSTITUTED-3 , 4-DIHYDRO-2 (IH) -QUINAZOLINONES USEFUL AS HIV REVERSE TRANSCRIPTASE INHIBITORS
  • This invention relates generally to 4, 4-disubstituted- 3 , 4-dihydro-2 (IH) -quinazolinones which are useful as inhibitors of HIV reverse transcriptase, pharmaceutical compositions and diagnostic kits comprising the same, methods of using the same for treating viral infection or as assay standards or reagents, and intermediates and processes for making the same.
  • HIV seropositive individuals are initially asymptomatic but typically develop AIDS related complex (ARC) followed by AIDS. Affected individuals exhibit severe immunosuppression which predisposes them to debilitating and ultimately fatal opportunistic infections .
  • ARC AIDS related complex
  • the disease AIDS is the end result of an HIV-1 or HIV-2 virus following its own complex life cycle.
  • the virion life cycle begins with the virion attaching itself to the host human T-4 lymphocyte immune cell through the bonding of a glycoprotein on the surface of the virion ' s protective coat with the CD4 glycoprotein on the lymphocyte cell. Once attached, the virion sheds its glycoprotein coat, penetrates into the membrane of the host cell, and uncoats its RNA.
  • the virion enzyme, reverse transcriptase directs the process of transcribing the RNA into single-stranded DNA.
  • the viral RNA is degraded and a second DNA strand is created.
  • the now double-stranded DNA is integrated into the human cell's genes and those genes are used for virus reproduction. At this point, RNA polymerase transcribes the integrated DNA into viral RNA.
  • HIV protease is responsible for regulating a cascade of cleavage events that lead to the virus particle's maturing into a virus that is capable of full infectivity.
  • the typical human immune system response killing the invading virion, is taxed because the virus infects and kills the immune system's T cells.
  • viral reverse transcriptase the enzyme used in making a new virion particle, is not very specific, and causes transcription mistakes that result in continually changed glycoproteins on the surface of the viral protective coat. This lack of specificity decreases the immune system's effectiveness because antibodies specifically produced against one glycoprotein may be useless against another, hence reducing the number of antibodies available to fight the virus .
  • the virus continues to reproduce while the immune response system continues to weaken. Eventually, the HIV largely holds free reign over the body's immune system, allowing opportunistic infections to set in and without the administration of antiviral agents, immunomodulators , or both, death may result.
  • virus 's life cycle There are at least three critical points in the virus ' s life cycle which have been identified as possible targets for antiviral drugs: (1) the initial attachment of the virion to the T-4 lymphocyte or macrophage site, (2) the transcription of viral RNA to viral DNA (reverse transcriptase, RT) , and (3) the processing of gag-pol protein by HIV protease.
  • nucleoside analogs such as 3 ' -azido-3 ' -deoxythymidine (AZT), 2 ' , 3 ' -dideoxycytidine (ddC) , 2 ' , 3 ' -dideoxythymidinene (d4T) , 2 ' , 3 ' -dideoxyinosine (ddl) , and 2 ' , 3 ' -dideoxy-3 ' -thia- cytidine (3TC) have been shown to be relatively effective in halting HIV replication at the reverse transcriptase (RT) stage.
  • RT reverse transcriptase
  • An active area of research is in the discovery of non- nucleoside HIV reverse transcriptase inhibitors .
  • certain benzoxazinones and quinazolinones are active in the inhibition of HIV reverse transcriptase, the prevention or treatment of infection by HIV and the treatment of AIDS.
  • Z may be 0.
  • EP 0,530,994 and WO 93/04047 describe HIV reverse transcriptase inhibitors which are quinazolinones of the formula A:
  • G is a variety of groups
  • R 3 and R 4 may be H
  • Z may be O
  • R 2 may be unsubstituted alkyl, unsubstituted alkenyl, unsubstituted alkynyl, unsubstituted cycloalkyl, unsubstituted heterocycle, and optionally substituted aryl
  • R 1 may be a variety of groups including substituted alkyl.
  • WO 95/12583 also describes HIV reverse transcriptase inhibitors of formula A.
  • G is a variety of groups, R 3 and R 4 may be H, Z may be 0, R 2 is substituted alkenyl or substituted alkynyl, and R 1 is cycloalkyl, alkynyl, alkenyl, or cyano.
  • WO 95/13273 illustrates the asymmetric synthesis of one of the compounds of WO 95/12583, (S)- ⁇ -)-6- chloro-4-cyclopropyl-3 , 4-dihydro-4 ( (2-pyridy) ethynyl) -2 (IH) - quinazolinone .
  • R is a phenyl, carbocyclic ring, or a heterocyclic ring.
  • Compounds of this sort are not considered to be part of the present invention.
  • one object of the present invention is to provide novel reverse transcriptase inhibitors .
  • compositions with reverse transcriptase inhibiting activity comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of at least one of the compounds of the present invention or a pharmaceutically acceptable salt form thereof.
  • R 1 , R 2 , R 3 , and R 8 are defined below, stereoisomeric forms, mixtures of stereoisomeric forms, or pharmaceutically acceptable salt forms thereof, are effective reverse transcriptase inhibitors .
  • the present invention provides a novel compound of formula I:
  • R 1 is C ⁇ - 3 alkyl substituted with 1-7 halogen
  • R 2 is selected from C 1 - 5 alkyl substituted with 1-2 R 4 , C 2 - 5 alkenyl substituted with 1-2 R 4 , and C 2 - 5 alkynyl substituted with 1 R 4 ;
  • R 3 at each occurrence, is independently selected from C 1 -. 4 alkyl, OH, C 1 -. 4 alkoxy, F, Cl, Br, I, NR 5 R 5a , N0 2 , CN, C(0)R 6 , NHC(0)R 7 , and NHC (0)NR 5 R 5a ;
  • R 4 is selected from C 3 - 5 cycloalkyl substituted with 0-2 R 3 , phenyl substituted with 0-5 R 3 , and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from 0, N, and S, substituted with 0-2 R 3 ;
  • R 5 and R 5a are independently selected from H and C 1 -. 3 alkyl
  • R 6 is selected from H, OH, C 1 -. 4 alkyl, C 1 - 4 alkoxy, and NR 5 R 5a ;
  • R 7 is selected from C 1 -. 3 alkyl and C ⁇ _ 3 alkoxy
  • R 8 is selected from H, C 3 - 5 cycloalkyl, and C 1 - 3 alkyl; and,
  • n is selected from 0 , 1 , 2 , 3 , and 4.
  • R 1 is C ⁇ _ 3 alkyl substituted with 1-7 halogen
  • R 2 is selected from C 1 -. 5 alkyl substituted with 1 R 4 , C 2 - 5 alkenyl substituted with 1 R 4 , and C 2 - 5 alkynyl substituted with 1 R 4 ;
  • R 3 at each occurrence, is independently selected from C 1 -. 4 alkyl, OH, C 1 - 4 alkoxy, F, Cl, Br, I, NR 5 R 5a , N0 2 , CN, C(0)R 6 , NHC ⁇ 0)R 7 , and NHC (0)NR 5 R 5 ;
  • R 4 is selected from C 3 - 5 cycloalkyl substituted with 0-2 R 3 , phenyl substituted with 0-2 R 3 , and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from 0, N, and S, substituted with 0-1 R 3 ;
  • R 5 and R a are independently selected from H, CH 3 and C 2 H 5 ;
  • R 6 selected from H, OH, CH 3 , C 2 H 5 , OCH 3 , 0C 2 H 5 , and NR 5 R 5a ;
  • R 7 is selected from CH 3 , C 2 H 5 , OCH 3 , and OC 2 H 5 ;
  • R 8 is selected from H, cyclopropyl, CH 3 and C 2 H 5 ;
  • n is selected from 0, 1, 2, and 3.
  • the present invention provides a novel compound of formula I, wherein:
  • R 1 is selected from CF 3 , and C 2 F 5 ;
  • R 2 is selected from C 1 -. 3 alkyl substituted with 1 R 4 , C 2 - 3 alkenyl substituted with 1 R 4 , and C 2 - 3 alkynyl substituted with 1 R 4 ;
  • R 3 at each occurrence, is independently selected from C 1 -. 3 alkyl, OH, C 1 - 3 alkoxy, F, Cl, Br, I, NR 5 R 5 , NO 2 , CN, C(0)R 6 , NHC(0)R 7 , and NHC (0)NR 5 R 5a ;
  • R 4 is selected from C 3 - 5 cycloalkyl substituted with 0-2 R 3 , phenyl substituted with 0-2 R 3 , and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from 0, N, and S, substituted with 0-1 R 3 ;
  • R 5 and R 5a are independently selected from H, CH 3 and C 2 H 5 ;
  • R6 is selected from H, OH, CH 3 , C 2 H 5 , OCH 3 , OC 2 H 5 , and NR 5 R 5a ;
  • R 7 is selected from CH 3 , C 2 H 5 , OCH 3 , and OC 2 H 5 ;
  • R 8 is selected from H, CH 3 and C 2 H 5 ;
  • n is selected from 0, 1, and 2.
  • the present invention provides a novel compound of formula I, wherein:
  • R 1 is CF 3 ;
  • R 2 is selected from C 1 - 3 alkyl substituted with 1 R 4 , C 2 - 3 alkenyl substituted with 1 R 4 , and C 2 - 3 alkynyl substituted with 1 R 4 ;
  • R 3 at each occurrence, is independently selected from C 1 -. 3 alkyl, OH, C 1 - 3 alkoxy, F, Cl, NR 5 R 5a , N0 2 , CN, C(0)R 6 , NHC(0)R 7 , and NHC (0)NR 5 R 5a ;
  • R 4 is selected from cyclopropyl substituted with 0-1 R 3 , phenyl substituted with 0-2 R 3 , and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from 0, N, and S, substituted with 0-1 R 3 , wherein the heterocyclic system is selected from 2-pyridyl, 3- pyridyl, 4-pyridyl, 2-furanyl, 3-furanyl, 2-thienyl, 3- thienyl, 2-oxazolyl, 2-thiazolyl, 4-isoxazolyl, and 2- imidazolyl;
  • R 5 and R 5a are independently selected from H, CH 3 and C 2 H 5 ;
  • R6 i selected from H, OH, CH 3 , C 2 H 5 , OCH 3 , OC 2 H 5 , and NR 5 R 5a ;
  • R 7 is selected from CH 3 , C 2 H 5 , OCH 3 , and OC 2 H 5 ;
  • R 8 is selected from H, CH 3 and C 2 H 5 ;
  • n is selected from 1 and 2.
  • the compound of formula I is selected from:
  • (+/-) -4-Cyclopropylethynyl-6-methoxy-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
  • the present invention provides a novel compound of formula II :
  • R 2 is C ⁇ C-R 4a ;
  • R 3 is selected from C 1 - 4 alkyl, OH, C 1 - 4 alkoxy, F, Cl, Br, I, NR 5 R 5 , N0 2 , CN, C(0)R 6 , NHC(0)R 7 , and NHC (0)NR 5 R 5a ;
  • R 4a is selected from methyl, ethyl, n-propyl, i-propyl, i-butyl, t-butyl, and i-pentyl;
  • R 5 and R 5a are independently selected from H and C1- 3 alkyl
  • R 6 is selected from H, OH, C 1 - 4 alkyl, C 1 - 4 alkoxy, and NR 5 R 5a ;
  • R 7 is selected from C 1 -. 3 alkyl and C 1 -. 3 alkoxy;
  • R 8 is selected from H, C 3 -. 5 cycloalkyl, and C 1 - 3 alkyl; and,
  • n is selected from 0, 1, 2, 3, and 4.
  • the present invention provides a novel compound of formula II, wherein:
  • R 2 is C ⁇ C-R 4a ;
  • R 3 is selected from C 1 -. 4 alkyl, OH, C 1 - 4 alkoxy, F, Cl, Br, I, NR 5 R 5a , N0 2 , CN, C(0)R 6 , and NHC(0)R 7 ;
  • R a is selected from methyl, ethyl, n-propyl, i-propyl, i-butyl, t-butyl, and i-pentyl; R 5 and R 5a are independently selected from H, CH 3 and C 2 H 5 ;
  • R 6 is selected from H, OH, CH 3 , C 2 H 5 , OCH 3 , OC 2 H 5 , and NR 5 R 5a ;
  • R 7 is selected from CH 3 , C 2 H 5 , OCH 3 , and OC 2 H 5 ;
  • R8 i s selected from H, cyclopropyl, CH 3 and C 2 H 5 ;
  • n is selected from 0, 1, and 2.
  • the compound of formula II is selected from:
  • the present invention provides a novel pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of a compound of formula I or II or pharmaceutically acceptable salt form thereof.
  • the present invention provides a novel method for treating HIV infection which comprises administering to a host in need of such treatment a therapeutically effective amount of a compound of formula I or II or pharmaceutically acceptable salt form thereof.
  • the present invention provides a novel method of treating HIV infection which comprises administering, in combination, to a host in need thereof a therapeutically effective amount of :
  • the reverse transcriptase inhibitor is selected from AZT, 3TC, ddl, ddC, d4T, delavirdine, TIBO derivatives, BI-RG-587, nevirapine, L- 697,661, LY 73497, Ro 18,893, loviride, trovirdine, MKC-442, and HBY 097, and the protease inhibitor is selected from saquinavir, ritonavir, indinavir, VX-478, nelfinavir, KNI- 272, CGP-61755, U-140690, and ABT-378.
  • the reverse transcriptase inhibitor is selected from AZT and 3TC and the protease inhibitor is selected from saquinavir, ritonavir, nelfinavir, and .indinavir.
  • the reverse transcriptase inhibitor is AZT.
  • the protease inhibitor is indinavir.
  • the present invention provides a pharmaceutical kit useful for the treatment of HIV infection, which comprises a therapeutically effective amount of:
  • the present invention provides a novel method of inhibiting HIV present in a body fluid sample which comprises treating the body fluid sample with an effective amount of a compound of formula I or II .
  • the present invention to provides a novel a kit or container comprising a compound of formula I or II in an amount effective for use as a standard or reagent in a test or assay for determining the ability of a potential pharmaceutical to inhibit HIV reverse transcriptase, HIV growth, or both.
  • the compounds of the present invention contain an asymmetrically substituted carbon atom, and may be isolated in optically active or racemic forms . It is well known in the art how to prepare optically active forms, such as by resolution of racemic forms or by synthesis, from optically active starting materials. All chiral, diastereomeric, racemic forms and all geometric isomeric forms of a structure are intended, unless the specific stereochemistry or isomer form is specifically indicated.
  • the processes of the present invention are contemplated to be practiced on at least a multigra scale, kilogram scale, multikilogram scale, or industrial scale.
  • Multigram scale is preferably the scale wherein at least one starting material is present in 10 grams or more, more preferably at least 50 grams or more, even more preferably at least 100 grams or more.
  • Multikilogram scale is intended to mean the scale wherein more than one kilogram of at least one starting material is used.
  • Industrial scale as used herein is intended to mean a scale which is other than a laboratory scale and which is sufficient to supply product sufficient for either clinical tests or distribution to consumers.
  • alkyl is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms .
  • alkyl include, but are not limited to, methyl, ethyl, n- propyl, i-propyl, n-butyl, s-butyl, t-butyl, n-pentyl, and s- pentyl.
  • haloalkyl examples include, but are not limited to, trifluoromethyl, trichloromethyl , pentafluoroethyl, and pentachloroethyl .
  • Alkoxy represents an alkyl group as defined above with the indicated number of carbon atoms attached through an oxygen bridge. Examples of alkoxy include, but are not limited to, methoxy, ethoxy, n-propoxy, i-propoxy, n-butoxy, s-butoxy, t-butoxy, n-pentoxy, and s- pentoxy.
  • Cycloalkyl is intended to include saturated ring groups, such as cyclopropyl, cyclobutyl, or eye1openty1.
  • Alkenyl is intended to include hydrocarbon chains of either a straight or branched configuration and one or more unsaturated carbon-carbon bonds which may occur in any stable point along the chain, such as ethenyl, propenyl and the like.
  • Alkynyl is intended to include hydrocarbon chains of either a straight or branched configuration and one or more triple carbon-carbon bonds which may occur in any stable point along the chain, such as ethynyl, propynyl and the like.
  • Halo or "halogen” as used herein refers to fluoro, chloro, bromo and iodo.
  • Counterion is used to represent a small, negatively charged species such as chloride, bromide, hydroxide, acetate, sulfate and the like.
  • aryl or “aromatic residue” is intended to mean an aromatic moiety containing the specified number of carbon atoms, such as phenyl or naphthyl.
  • carbocycle or “carbocyclic residue” is intended to mean any stable 3- to 5- membered monocyclic ring, which may be saturated or partially unsaturated. Examples of such carbocyles include, but are not limited to, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, biphenyl, naphthyl, indanyl, adamantyl, or tetrahydronaphthyl (tetralin) .
  • heterocycle or “heterocyclic system” is intended to mean a stable 5- to 6- membered monocyclic heterocyclic ring which is saturated partially unsaturated or unsaturated (aromatic) , and which consists of carbon atoms and from 1 to 3 heteroatoms independently selected from the group consisting of N, 0 and S.
  • the nitrogen and sulfur heteroatoms may optionally be oxidized.
  • the heterocyclic ring may be attached to its pendant group at any heteroatom or carbon atom which results in a stable structure.
  • the heterocyclic rings described herein may be substituted on carbon or on a nitrogen atom if the resulting compound is stable. If specifically noted, a nitrogen in the heterocycle may optionally be quaternized.
  • the term "aromatic heterocyclic system” is intended to mean a stable 5- to 6- membered monocyclic heterocyclic aromatic ring which consists of carbon atoms and from 1 to 3 heterotams independently selected from the group consisting of N, 0 and S. It is preferred that the total number of S and 0 atoms in the aromatic heterocycle is not more than 1.
  • heterocycles include, but are not limited to, 2-pyrrolidonyl, 2H-pyrrolyl, 4-piperidonyl, 6H-1,2,5- thiadiaziny1 , 2H, ⁇ H-1 , 5 , 2 -dithiaziny1 , furanyl , furazanyl , imidazolidinyl, imidazolinyl, imidazolyl, isoxazolyl, morpholinyl, oxadiazolyl, 1, 2, 3-oxadiazolyl, 1,2,4- oxadiazolyl, 1, 2 , 5-oxadiazolyl, 1, 3 , 4-oxadiazolyl, oxazolidinyl .
  • oxazolyl piperazinyl, piperidinyl, pteridinyl, piperidonyl, 4-piperidonyl, pteridinyl, purinyl, pyranyl, pyrazinyl, pyrazolidinyl, pyrazolinyl, pyrazolyl, pyridazinyl, pyridinyl, pyridyl, pyrimidinyl, pyrrolidinyl, pyrroliny1 , pyrrolyl , tetrahydrofuranyl , 6H-1 , 2,5- thiadiazinyl, 1, 2 , 3-thiadiazolyl, 1, 2 , 4-thiadiazolyl, 1,2,5- thiadiazolyl, 1, 3 , 4-thiadiazolyl, thiazolyl, thienyl, thienothiazolyl, thienooxazolyl, thienoimidazolyl, thioph
  • Preferred heterocycles include, but are not limited to, pyridinyl, furanyl, thienyl, pyrrolyl, pyrazolyl, imidazolyl, and oxazolidinyl. Also included are fused ring and spiro compounds containing, for example, the above heterocycles.
  • HIV reverse transcriptase inhibitor is intended to refer to both nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT) .
  • nucleoside RT inhibitors include, but are not limited to, AZT, ddC, ddl, d4T, and 3TC.
  • non-nucleoside RT inhibitors include, but are no limited to, delavirdine (Pharmacia and Upjohn U90152S) , TIBO derivatives, BI-RG-587, nevirapine (Boehringer Ingelheim), L-697,661, LY 73497, Ro
  • HIV protease inhibitor is intended to refer to compounds which inhibit HIV protease. Examples include, but are not limited, saquinavir (Roche, Ro31-8959), ritonavir (Abbott, ABT-538) , indinavir (Merck, MK-639) , VX- 478 (Vertex/Glaxo Wellcome) , nelfinavir (Agouron, AG-1343), KNI-272 (Japan Energy) , CGP-61755 (Ciba-Geigy) , U-140690 (Pharmacia and Upjohn), and ABT-378.
  • pharmaceutically acceptable salts refer to derivatives of the disclosed compounds wherein the parent compound is modified by making acid or base salts thereof.
  • pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like.
  • the pharmaceutically acceptable salts include the conventional non-toxic salts or the quaternary ammonium salts of the parent compound formed, for example, from non-toxic inorganic or organic acids.
  • such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like; and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic , phenylacetic , glutamic, benzoic, salicylic, sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, and the like.
  • inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like
  • organic acids such as acetic, propionic, succinic, glycolic, stearic,
  • the pharmaceutically acceptable salts of the present invention can be synthesized from the parent compound which contains a basic or acidic moiety by conventional chemical methods.
  • such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. Lists of suitable salts are found in Remington 's Pharmaceutical Sciences, 17th ed. , Mack Publishing Company, Easton, PA,
  • phrases "pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication commensurate with a reasonable benefit/risk ratio .
  • Prodrugs are intended to include any covalently bonded carriers which release the active parent drug according to formula (I) or other formulas or compounds of the present invention in vivo when such prodrug is administered to a mammalian subject.
  • Prodrugs of a compound of the present invention for example formula (I) , are prepared by modifying functional groups present in the compound in such a way that the modifications are cleaved, either in routine manipulation or in vivo, to the parent compound.
  • Prodrugs include compounds of the present invention wherein the hydroxy or amino group is bonded to any group that, when the prodrug is administered to a mammalian subject, cleaves to form a free hydroxyl or free amino, respectively.
  • prodrugs include, but are not limited to, acetate, formate and benzoate derivatives of alcohol and amine functional groups in the compounds of the present invention, and the like.
  • “Stable compound” and “stable structure” are meant to indicate a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and formulation into an efficacious therapeutic agent. Only stable compounds are contempleted by the present invention.
  • “Substituted” is intended to indicate that one or more hydrogens on the atom indicated in the expression using “substituted” is replaced with a selection from the indicated group (s) , provided that the indicated atom's normal valency is not exceeded, and that the substitution results in a stable compound.
  • “Therapeutically effective amount” is intended to include an amount of a compound of the present invention or an amount of the combination of compounds claimed effective to inhibit HIV infection or treat the symptoms of HIV infection in a host.
  • the combination of compounds is preferably a synergistic combination. Synergy, as described for example by Chou and Talalay, Adv.
  • Enzyme Regul. 22:27-55 (1984) occurs when the effect (in this case, inhibition of HIV replication) of the compounds when administered in combination is greater than the additive effect of the compounds when administered alone as a single agent.
  • a synergistic effect is most clearly demonstrated at suboptimal concentrations of the compounds. Synergy can be in terms of lower cytotoxicity, increased antiviral effect, or some other beneficial effect of the combination compared with the individual components .
  • the compounds of the present invention can be prepared in a number of ways well known to one skilled in the art of organic synthesis .
  • the compounds of the present invention can be synthesized using the methods described below, together with synthetic methods known in the art of synthetic organic chemistry, or variations thereon as appreciated by those skilled in the art. Preferred methods include but are not limited to those methods described below.
  • Each of the references cited below are hereby incorporated herein by reference .
  • Scheme 1 illustrates a method of preparing keto-anilines from an appropriately substituted 2-aminobenzoic acid.
  • the acid is converted to its N-methoxy-N-methyl amide derivative which can then be displaced to obtain the R ⁇ -substituted ketone.
  • the keto-anilines are useful intermediates for the presently claimed compounds.
  • Scheme 2 describes another method of preparing keto- anilines, this time from an appropriately substituted aniline.
  • a group such as trifluoromethyl can be introduced using a strong base and ethyl trifluoroacetate. Deprotection provides the keto- aniline.
  • Additional means of preparing keto-anilines are known to one of skill in the art, e.g, Houpis et al, Tetr. Lett. 1994, 35 (37) , 6811-6814, the contents of which are hereby incorporated herein by reference.
  • SCHEME 3 Houpis et al, Tetr. Lett. 1994, 35 (37) , 6811-6814, the contents of which are hereby incorporated herein by reference.
  • Keto-aniline 1 which may be prepared by the methods desribed in Schemes 1 and 2, is treated with trimethylsilyl isocyanate in dry tetrahydofuran in the presence of dimethylaminopyridine followed by tetrabutylammonium fluoride to give the hydroxy- urea 2 .
  • the hydroxy-urea 2 is then dehydrated with a dehydrating agent such as 4A molecular sieves in refluxing toluene or xylenes to give the ketimine 3.
  • a dehydrating agent such as 4A molecular sieves in refluxing toluene or xylenes
  • a lithium acetylide which is prepared in a separate vessel by reacting the corresponding substituted acetylene with n- butyllithium in dry tetrahydrofuran, to give the 4,4- disubstituted 3 , 4-dihydro-2 (IH) -quinazolinone __, a compound of formula I .
  • the acetylenic bond of the compound 4 may be reduced, e.g., by catalytic hydrogenation, to give the corresponding alkenyl group (not shown) or the saturated compound 5..
  • R 2 groups may also be introduced by directly reacting the imine 3. with a lithiate R 2 Li or a Grignard reagent R 2 MgX in the presence or absence of Lewis acid catalyst, such as BF 3 etherate. See also Huffman et al, J. Org. Chem. 1995, 60, 1590-1594, the contents of which are hereby incorporated herein by reference.
  • one enantiomer of a compound of Formula I or II may display superior activity compared with the other.
  • separation of the racemic material can be achieved by HPLC using a chiral column as exemplified in Examples 27-34 (Scheme 4) or by a resolution using a resolving agent such as camphonic chloride as in Thomas J. Tucker, et al, J. Med. Chem. 1994, 37, 2437-2444.
  • a chiral compound of Formula I may also be directly synthesized using a chiral catalyst or a chiral ligand, e.g. Mark A. Huffman, et al, J. Org. Chem . 1995, 60, 1590-1594.
  • Step 1 Synthesis of Vl-a from V-a.
  • a solution of V-a (0.50 g, 2.28 mmol) was treated with dimethylaminopyridine and trimethylsilyl isocyanate as described in Step 1 of Example 1 to afford 0.58 g (97%) of the desired product:
  • 1 H NMR 300 MHz, acetone-d 6 ) ⁇ 8.81 (br s, 1 H) , 7.17 (br s, 1 H) , 7.11 (br s, 1 H) , 7.00-6.92 (m, 2 H) , 6.83 (s, 1 H) , 3.76 (s, 3 H) ;
  • Step 3 Synthesis of Xll-a from Xl-a.
  • a solution of XI-a (6.28 g, 25.1 mmol) was treated with the the lithium acetylide derived from cyclopropylacetylene (24.9 mL of 30 wt% solution in toluene/THF/hexanes, 0.113 mol) according to the procedure of Step 3 of Example 1.
  • the resulting crude yellow oil was dissolved in acetone and concentrated under reduced pressure to deliver a yellow solid. Crystallization from acetone afforded 5.98 g (75%) of the desired material: mp 86.5-88.5 °C; ⁇ ⁇ .
  • NMR 300 MHz, acetone-d 6 ) ⁇ 9.01 (br s, 1 H) , 7.46 (br s, 1 H) , 7.44-7.35
  • Step 1 Synthesis of XV-a from XlV-a.
  • Step 3 Synthesis of XVII-a from XVI-a.
  • a solution of XVI-a (100 mg, 0.431 mmol) was treated with the the lithium acetylide derived from cyclopropylacetylene (1.43 mL of 30 wt% solution in toluene/THF/hexanes, 1.94 mmol) according to the procedure of Step 3 of Example 1.
  • the material was purified by regular phase HPLC chromatography (41.4 mm Rainin Dynamax® column using 60 A silica @ 25 mL/min): 2.5% MeOH/CH 2 Cl 2 for 24 min, increase to 30% MeOH/CH 2 Cl 2 over 4 min, 30% MeOH/CH 2 Cl2 for 10 min, and ramp back to 2.5% MeOH/CH2Cl2 over 2 min.
  • the yield of the protected intermediates was 47% and 32%, respectively.
  • Example 36 was synthesized in an analogous manner to deliver the title compound in 88% yield.
  • Example 37 The title compound was prepared as described for Example 37 (starting from IV-b) , except that it was purified using a Chiralcel OD column at 1.5 mL/min in 0.5% EtOH/20% CH 2 Cl 2 /79.5% hexanes. Mp 87-89 °C; ⁇ -H NMR (300 MHz, acetone- dg) d 9.08 (br s, IH) , 7.40-7.25 (m, 2H) , 7.04-6.90 (m, 2H) ,
  • stereochemisty is (+/-) .
  • OJ J J LO LO to to to to to to to to to to to t- F> I- 1 H P» O O o o o o o O o ⁇ P- LO to H O VO 00 -J cn L ⁇ ⁇ P- LO to O VO 00 ⁇ J cn L ⁇ OJ tO P» VO 00 o ⁇ i L ⁇ ⁇ P- LO to P 1

Landscapes

  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Molecular Biology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • AIDS & HIV (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Plural Heterocyclic Compounds (AREA)
  • Nitrogen Condensed Heterocyclic Rings (AREA)

Abstract

The present invention relates to 4,4-disubstituted-3,4-dihydro-2(1H)-quinazolines of formula (I), or stereoisomeric forms, stereoisomeric mixtures, or pharmaceutically acceptable salt forms thereof, which are useful as inhibitors of HIV reverse transcriptase, and to pharmaceutical compositions and diagnostic kits comprising the same, and methods of using the same for treating viral infection or as an assay standard or reagent.

Description

TITLE 4 , 4-DISUBSTITUTED-3 , 4-DIHYDRO-2 (IH) -QUINAZOLINONES USEFUL AS HIV REVERSE TRANSCRIPTASE INHIBITORS
FIELD OF THE INVENTION This invention relates generally to 4, 4-disubstituted- 3 , 4-dihydro-2 (IH) -quinazolinones which are useful as inhibitors of HIV reverse transcriptase, pharmaceutical compositions and diagnostic kits comprising the same, methods of using the same for treating viral infection or as assay standards or reagents, and intermediates and processes for making the same.
BACKGROUND OF THE INVENTION
Two distinct retroviruses , human immunodeficiency virus (HIV) type-1 (HIV-1) or type-2 (HIV-2), have been etiologically linked to the immunosuppressive disease, acquired immunodeficiency syndrome (AIDS) . HIV seropositive individuals are initially asymptomatic but typically develop AIDS related complex (ARC) followed by AIDS. Affected individuals exhibit severe immunosuppression which predisposes them to debilitating and ultimately fatal opportunistic infections . The disease AIDS is the end result of an HIV-1 or HIV-2 virus following its own complex life cycle. The virion life cycle begins with the virion attaching itself to the host human T-4 lymphocyte immune cell through the bonding of a glycoprotein on the surface of the virion ' s protective coat with the CD4 glycoprotein on the lymphocyte cell. Once attached, the virion sheds its glycoprotein coat, penetrates into the membrane of the host cell, and uncoats its RNA. The virion enzyme, reverse transcriptase, directs the process of transcribing the RNA into single-stranded DNA. The viral RNA is degraded and a second DNA strand is created. The now double-stranded DNA is integrated into the human cell's genes and those genes are used for virus reproduction. At this point, RNA polymerase transcribes the integrated DNA into viral RNA. The viral RNA is translated into the precursor gag-pol fusion polyprotein. The polyprotein is then cleaved by the HIV protease enzyme to yield the mature viral proteins. Thus, HIV protease is responsible for regulating a cascade of cleavage events that lead to the virus particle's maturing into a virus that is capable of full infectivity.
The typical human immune system response, killing the invading virion, is taxed because the virus infects and kills the immune system's T cells. In addition, viral reverse transcriptase, the enzyme used in making a new virion particle, is not very specific, and causes transcription mistakes that result in continually changed glycoproteins on the surface of the viral protective coat. This lack of specificity decreases the immune system's effectiveness because antibodies specifically produced against one glycoprotein may be useless against another, hence reducing the number of antibodies available to fight the virus . The virus continues to reproduce while the immune response system continues to weaken. Eventually, the HIV largely holds free reign over the body's immune system, allowing opportunistic infections to set in and without the administration of antiviral agents, immunomodulators , or both, death may result.
There are at least three critical points in the virus ' s life cycle which have been identified as possible targets for antiviral drugs: (1) the initial attachment of the virion to the T-4 lymphocyte or macrophage site, (2) the transcription of viral RNA to viral DNA (reverse transcriptase, RT) , and (3) the processing of gag-pol protein by HIV protease.
Inhibition .of the virus at the second critical point, the viral RNA to viral DNA transcription process, has provided a number of the current therapies used in treading AIDS. This transcription must occur for the virion to reproduce because the virion 's genes are encoded in RNA and the host cell reads only DNA. By introducing drugs that block the reverse transcriptase from completing the formation of viral DNA, HIV-1 replication can be stopped.
A number of compounds that interfere with viral replication have been developed to treat AIDS. For example, nucleoside analogs, such as 3 ' -azido-3 ' -deoxythymidine (AZT), 2 ' , 3 ' -dideoxycytidine (ddC) , 2 ' , 3 ' -dideoxythymidinene (d4T) , 2 ' , 3 ' -dideoxyinosine (ddl) , and 2 ' , 3 ' -dideoxy-3 ' -thia- cytidine (3TC) have been shown to be relatively effective in halting HIV replication at the reverse transcriptase (RT) stage.
An active area of research is in the discovery of non- nucleoside HIV reverse transcriptase inhibitors . As an example, it has been found that certain benzoxazinones and quinazolinones are active in the inhibition of HIV reverse transcriptase, the prevention or treatment of infection by HIV and the treatment of AIDS.
U.S. 5,519,021 describe reverse transcriptase inhibitors which are benzoxazinones of the formula:
wherein X is a halogen, Z may be 0.
EP 0,530,994 and WO 93/04047 describe HIV reverse transcriptase inhibitors which are quinazolinones of the formula A:
A wherein G is a variety of groups, R3 and R4 may be H, Z may be O, R2 may be unsubstituted alkyl, unsubstituted alkenyl, unsubstituted alkynyl, unsubstituted cycloalkyl, unsubstituted heterocycle, and optionally substituted aryl, and R1 may be a variety of groups including substituted alkyl. WO 95/12583 also describes HIV reverse transcriptase inhibitors of formula A. In this publication, G is a variety of groups, R3 and R4 may be H, Z may be 0, R2 is substituted alkenyl or substituted alkynyl, and R1 is cycloalkyl, alkynyl, alkenyl, or cyano. WO 95/13273 illustrates the asymmetric synthesis of one of the compounds of WO 95/12583, (S)-<-)-6- chloro-4-cyclopropyl-3 , 4-dihydro-4 ( (2-pyridy) ethynyl) -2 (IH) - quinazolinone .
Synthetic procedures for making quinazolinones like those described above are detailed in the following references: Houpis et al, Tetr. Lett . 1994, 35 (37) , 6811-
6814; Tucker et al, J. Med. Chem. 1994, 37, 2437-2444; and,
Huffman et al, J. Org. Chem. 1995, 60, 1590-1594.
DE 4,320,347 illustrates quinazolinones of the formula:
wherein R is a phenyl, carbocyclic ring, or a heterocyclic ring. Compounds of this sort are not considered to be part of the present invention.
Even with the current success of reverse transcriptase inhibitors, it has been found that HIV patients can become resistant to a single inhibitor. Thus, it is desirable to develop additional inhibitors to further combat HIV infection.
SUMMARY OF THE INVENTION
Accordingly, one object of the present invention is to provide novel reverse transcriptase inhibitors .
It is another object of the present invention to provide a novel method for treating HIV infection which comprises administering to a host in need of such treatment a therapeutically effective amount of at least one of the compounds of the present invention or a pharmaceutically acceptable salt form thereof .
It is another object of the present invention to provide a novel method for treating HIV infection which comprises administering to a host in need thereof a therapeutically effective combination of (a) one of the compounds of the present invention and (b) one or more compounds selected form the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors .
It is another object of the present invention to provide pharmaceutical compositions with reverse transcriptase inhibiting activity comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of at least one of the compounds of the present invention or a pharmaceutically acceptable salt form thereof.
It is another object of the present invention to provide a method of inhibiting HIV present in a body fluid sample which comprises treating the body fluid sample with an effective amount of a compound of the present invention.
It is another object of the present invention to provide a kit or container containing at least one of the compounds of the present invention in an amount effective for use as a standard or reagent in a test or assay for determining the ability of a potential pharmaceutical to inhibit HIV reverse transcriptase, HIV growth, or both.
These and other objects, which will become apparent during the following detailed description, have been achieved by the inventors' discovery that compounds of formula (I):
I wherein R1, R2, R3 , and R8 are defined below, stereoisomeric forms, mixtures of stereoisomeric forms, or pharmaceutically acceptable salt forms thereof, are effective reverse transcriptase inhibitors .
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS [1] Thus, in a first embodiment, the present invention provides a novel compound of formula I:
I or a stereoisomer or pharmaceutically acceptable salt thereof, wherein:
R1 is Cχ-3 alkyl substituted with 1-7 halogen;
R2 is selected from C1-5 alkyl substituted with 1-2 R4, C2-5 alkenyl substituted with 1-2 R4, and C2-5 alkynyl substituted with 1 R4;
R3, at each occurrence, is independently selected from C1-.4 alkyl, OH, C1-.4 alkoxy, F, Cl, Br, I, NR5R5a, N02, CN, C(0)R6, NHC(0)R7, and NHC (0)NR5R5a;
alternatively, if two R3 ' s are present and are attached to adjacent carbons, then they may combine to form -OCH2O-;
R4 is selected from C3-5 cycloalkyl substituted with 0-2 R3 , phenyl substituted with 0-5 R3 , and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from 0, N, and S, substituted with 0-2 R3 ;
R5 and R5a are independently selected from H and C1-.3 alkyl;
R6 is selected from H, OH, C1-.4 alkyl, C1-4 alkoxy, and NR5R5a;
R7 is selected from C1-.3 alkyl and Cχ_3 alkoxy;
R8 is selected from H, C3-5 cycloalkyl, and C1-3 alkyl; and,
n is selected from 0 , 1 , 2 , 3 , and 4. [2] In a preferred embodiment, the present invention provides a novel compound of formula I, wherein:
R1 is Cι_3 alkyl substituted with 1-7 halogen;
R2 is selected from C1-.5 alkyl substituted with 1 R4, C2-5 alkenyl substituted with 1 R4, and C2-5 alkynyl substituted with 1 R4;
R3, at each occurrence, is independently selected from C1-.4 alkyl, OH, C1-4 alkoxy, F, Cl, Br, I, NR5R5a, N02 , CN, C(0)R6, NHC{0)R7, and NHC (0)NR5R5 ;
alternatively, if two R3 ' s are present and are attached to adjacent carbons, then they may combine to form -OCH2O-;
R4 is selected from C3-5 cycloalkyl substituted with 0-2 R3 , phenyl substituted with 0-2 R3 , and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from 0, N, and S, substituted with 0-1 R3;
R5 and Ra are independently selected from H, CH3 and C2H5;
R 6 s selected from H, OH, CH3 , C2H5, OCH3, 0C2H5, and NR5R5a ;
R7 is selected from CH3, C2H5, OCH3 , and OC2H5;
R8 is selected from H, cyclopropyl, CH3 and C2H5; and,
n is selected from 0, 1, 2, and 3.
[3] In a more preferred embodiment, the present invention provides a novel compound of formula I, wherein:
R1 is selected from CF3, and C2F5; R2 is selected from C1-.3 alkyl substituted with 1 R4, C2-3 alkenyl substituted with 1 R4, and C2-3 alkynyl substituted with 1 R4;
R3, at each occurrence, is independently selected from C1-.3 alkyl, OH, C1-3 alkoxy, F, Cl, Br, I, NR5R5 , NO2, CN, C(0)R6, NHC(0)R7, and NHC (0)NR5R5a;
alternatively, if two R3 ' s are present and are attached to adjacent carbons, then they may combine to form -OCH2O-;
R4 is selected from C3-5 cycloalkyl substituted with 0-2 R3 , phenyl substituted with 0-2 R3 , and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from 0, N, and S, substituted with 0-1 R3 ;
R5 and R5a are independently selected from H, CH3 and C2H5;
R6 is selected from H, OH, CH3, C2H5, OCH3, OC2H5, and NR5R5a;
R7 is selected from CH3, C2H5, OCH3 , and OC2H5;
R8 is selected from H, CH3 and C2H5; and,
n is selected from 0, 1, and 2.
[4] In an even more preferred embodiment, the present invention provides a novel compound of formula I, wherein:
R1 is CF3;
R2 is selected from C1-3 alkyl substituted with 1 R4, C2-3 alkenyl substituted with 1 R4, and C2-3 alkynyl substituted with 1 R4; R3 , at each occurrence, is independently selected from C1-.3 alkyl, OH, C1-3 alkoxy, F, Cl, NR5R5a, N02 , CN, C(0)R6, NHC(0)R7, and NHC (0)NR5R5a;
alternatively, if two R3 ' s are present and are attached to adjacent carbons, then they may combine to form -OCH2O-;
R4 is selected from cyclopropyl substituted with 0-1 R3 , phenyl substituted with 0-2 R3 , and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from 0, N, and S, substituted with 0-1 R3 , wherein the heterocyclic system is selected from 2-pyridyl, 3- pyridyl, 4-pyridyl, 2-furanyl, 3-furanyl, 2-thienyl, 3- thienyl, 2-oxazolyl, 2-thiazolyl, 4-isoxazolyl, and 2- imidazolyl;
R5 and R5a are independently selected from H, CH3 and C2H5;
R6 is selected from H, OH, CH3 , C2H5, OCH3, OC2H5, and NR5R5a;
R7 is selected from CH3, C2H5, OCH3, and OC2H5;
R8 is selected from H, CH3 and C2H5; and,
n is selected from 1 and 2.
[5] In a further preferred embodiment, wherein the compound is of formula Ia
Ia.
[5] In a further preferred embodiment, wherein the compound is of formula lb: lb .
[7] In a further preferred embodiment, the compound of formula I is selected from:
(+/-) -6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3 ,4- dihydro-2 (IH) -quinazolinone;
(+/-) -6-Chloro-4- (2-pyridyl) ethynyl-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+/-) -6-Chloro-4-phenylethynyl-4-trifluoromethyl-3 , 4-dihydro- 2 ( IH) -quinazolinone;
(+/-) -4-Cyclopropylethynyl-6-methoxy-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+/-) -6-Methoxy-4- (2-pyridyl) ethynyl-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+/-) -6-Methoxy-4-phenylethynyl-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+/-) -4-Cyclopropylethynyl-5, 6-difluoro-4-trifluoromethyl-
3 , 4-dihydro-2 (IH) -quinazolinone;
(+/-) -5, 6-Difluo-ro-4- (2-pyridyl) ethynyl-4-trifluoromethyl- 3 , 4-dihydro-2 (IH) -quinazolinone;
(+/-) -5, 6-Difluoro-4-phenylethynyl-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone; (+/-) -4-Cyclopropylethynyl-6-fluoro-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+/-) -6-Fluoro-4- (2-pyridyl) ethynyl-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone ;
(+/-) -6-Fluoro-4-phenylethynyl-4-trifluoromethyl-3, 4-dihydro- 2 (IH) -quinazolinone;
(+/-) -6-Fluoro-4-(2 ' -2-pyridyl) ethyl-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+/-) -6-Fluoro-4-phenylethyl-4-trifluoromethyl-3 , 4-dihydro-
2 (IH) -quinazolinone;
(-) -6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+) -6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+) -4-Cyclopropylethynyl-5, 6-difluoro-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(-) -4-Cyclopropylethynyl-5, 6-difluoro-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+) -4-E-Cyclopropylethenyl-5, 6-difluoro-4-trifluoromethyl-
3 , 4-dihydro-2 (IH) -quinazolinone; and,
(-) -6-Chloro-4-E-cyclopropylethenyl-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
or a pharmaceutically acceptable salt thereof .
[8] In a second embodiment, the present invention provides a novel compound of formula II :
II or a stereoisomer or pharmaceutically acceptable salt thereof, wherein:
R2 is C≡C-R4a;
R3 is selected from C1-4 alkyl, OH, C1-4 alkoxy, F, Cl, Br, I, NR5R5 , N02, CN, C(0)R6, NHC(0)R7, and NHC (0)NR5R5a;
R4a is selected from methyl, ethyl, n-propyl, i-propyl, i-butyl, t-butyl, and i-pentyl;
R5 and R5a are independently selected from H and C1-3 alkyl;
R6 is selected from H, OH, C1-4 alkyl, C1-4 alkoxy, and NR5R5a;
R7 is selected from C1-.3 alkyl and C1-.3 alkoxy;
R8 is selected from H, C3-.5 cycloalkyl, and C1-3 alkyl; and,
n is selected from 0, 1, 2, 3, and 4.
[9] In another preferred embodiment, the present invention provides a novel compound of formula II, wherein:
R2 is C≡C-R4a;
R3 is selected from C1-.4 alkyl, OH, C1-4 alkoxy, F, Cl, Br, I, NR5R5a, N02, CN, C(0)R6, and NHC(0)R7;
Ra is selected from methyl, ethyl, n-propyl, i-propyl, i-butyl, t-butyl, and i-pentyl; R5 and R5a are independently selected from H, CH3 and C2H5;
R6 is selected from H, OH, CH3 , C2H5, OCH3 , OC2H5, and NR5R5a;
R7 is selected from CH3 , C2H5, OCH3 , and OC2H5;
R8 is selected from H, cyclopropyl, CH3 and C2H5; and,
n is selected from 0, 1, and 2.
[10] In a further preferred embodiment, wherein the compound is of formula Ila
Ila.
[11] In a further preferred embodiment, wherein the compound is of formula lib:
lib.
[12] In another more preferred embodiment, the compound of formula II is selected from:
(+/-) -6-Chloro-4-isopropylethynyl-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+/-) -6-Chloro-4-ethylethynyl-4-trifluoromethyl-3 , 4-dihydro- 2 (IH) -quinazolinone; (+/-) -4-Isopropylethynyl-6-methoxy-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+/-) -5, 6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3, 4- dihydro-2 (IH) -quinazolinone;
(+/-) -5, 6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3 ,4- dihydro-2 (IH) -quinazolinone;
(+/-) -5, 6-Difluoro-4-isopentyl-4-trifluoromethyl-3, 4-dihydro- 2 (IH) -quinazolinone;
(+/-) -6-Fluoro-4-isopropylethynyl-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+/-) -6-Fluoro-4-ethylethynyl-4-trifluoromethyl-3 , 4-dihydro-
2 (IH) -quinazolinone;
(-) -5, 6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+) -5, 6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(-) -5, 6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3, 4- dihydro-2 (IH) -quinazolinone; and,
(+) -5, 6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3, 4- dihydro-2 (IH) -quinazolinone;
or a pharmaceutically acceptable salt thereof.
In a third embodiment, the present invention provides a novel pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of a compound of formula I or II or pharmaceutically acceptable salt form thereof. In a fourth embodiment, the present invention provides a novel method for treating HIV infection which comprises administering to a host in need of such treatment a therapeutically effective amount of a compound of formula I or II or pharmaceutically acceptable salt form thereof.
In a fifth embodiment, the present invention provides a novel method of treating HIV infection which comprises administering, in combination, to a host in need thereof a therapeutically effective amount of :
(a) a compound of formula I or II; and, (b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors .
In another preferred embodiment, the reverse transcriptase inhibitor is selected from AZT, 3TC, ddl, ddC, d4T, delavirdine, TIBO derivatives, BI-RG-587, nevirapine, L- 697,661, LY 73497, Ro 18,893, loviride, trovirdine, MKC-442, and HBY 097, and the protease inhibitor is selected from saquinavir, ritonavir, indinavir, VX-478, nelfinavir, KNI- 272, CGP-61755, U-140690, and ABT-378.
In an even more preferred embodiment, the reverse transcriptase inhibitor is selected from AZT and 3TC and the protease inhibitor is selected from saquinavir, ritonavir, nelfinavir, and .indinavir.
In a still further preferred ebodi ent, the reverse transcriptase inhibitor is AZT. In another still further preferred embodiment, the protease inhibitor is indinavir.
In a sixth embodiment, the present invention provides a pharmaceutical kit useful for the treatment of HIV infection, which comprises a therapeutically effective amount of:
(a) a compound of formula I or II; and,
(b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors, in one or more sterile containers.
In a seventh embodiment, the present invention provides a novel method of inhibiting HIV present in a body fluid sample which comprises treating the body fluid sample with an effective amount of a compound of formula I or II .
In a eighth embodiment, the present invention to provides a novel a kit or container comprising a compound of formula I or II in an amount effective for use as a standard or reagent in a test or assay for determining the ability of a potential pharmaceutical to inhibit HIV reverse transcriptase, HIV growth, or both.
DEFINITIONS As used herein, the following terms and expressions have the indicated meanings . It will be appreciated that the compounds of the present invention contain an asymmetrically substituted carbon atom, and may be isolated in optically active or racemic forms . It is well known in the art how to prepare optically active forms, such as by resolution of racemic forms or by synthesis, from optically active starting materials. All chiral, diastereomeric, racemic forms and all geometric isomeric forms of a structure are intended, unless the specific stereochemistry or isomer form is specifically indicated. The processes of the present invention are contemplated to be practiced on at least a multigra scale, kilogram scale, multikilogram scale, or industrial scale. Multigram scale, as used herein, is preferably the scale wherein at least one starting material is present in 10 grams or more, more preferably at least 50 grams or more, even more preferably at least 100 grams or more. Multikilogram scale, as used herein, is intended to mean the scale wherein more than one kilogram of at least one starting material is used. Industrial scale as used herein is intended to mean a scale which is other than a laboratory scale and which is sufficient to supply product sufficient for either clinical tests or distribution to consumers.
As used herein, "alkyl" is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms . Examples of alkyl include, but are not limited to, methyl, ethyl, n- propyl, i-propyl, n-butyl, s-butyl, t-butyl, n-pentyl, and s- pentyl. "Haloalkyl" is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms, substituted with 1 or more halogen (for example -CVFW where v = 1 to 3 and w = 1 to (2v+l)). Examples of haloalkyl include, but are not limited to, trifluoromethyl, trichloromethyl , pentafluoroethyl, and pentachloroethyl . "Alkoxy" represents an alkyl group as defined above with the indicated number of carbon atoms attached through an oxygen bridge. Examples of alkoxy include, but are not limited to, methoxy, ethoxy, n-propoxy, i-propoxy, n-butoxy, s-butoxy, t-butoxy, n-pentoxy, and s- pentoxy. "Cycloalkyl" is intended to include saturated ring groups, such as cyclopropyl, cyclobutyl, or eye1openty1. Alkenyl" is intended to include hydrocarbon chains of either a straight or branched configuration and one or more unsaturated carbon-carbon bonds which may occur in any stable point along the chain, such as ethenyl, propenyl and the like. "Alkynyl" is intended to include hydrocarbon chains of either a straight or branched configuration and one or more triple carbon-carbon bonds which may occur in any stable point along the chain, such as ethynyl, propynyl and the like.
"Halo" or "halogen" as used herein refers to fluoro, chloro, bromo and iodo. "Counterion" is used to represent a small, negatively charged species such as chloride, bromide, hydroxide, acetate, sulfate and the like.
As used herein, "aryl" or "aromatic residue" is intended to mean an aromatic moiety containing the specified number of carbon atoms, such as phenyl or naphthyl. As used herein, "carbocycle" or "carbocyclic residue" is intended to mean any stable 3- to 5- membered monocyclic ring, which may be saturated or partially unsaturated. Examples of such carbocyles include, but are not limited to, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, biphenyl, naphthyl, indanyl, adamantyl, or tetrahydronaphthyl (tetralin) .
As used herein, the term "heterocycle" or "heterocyclic system" is intended to mean a stable 5- to 6- membered monocyclic heterocyclic ring which is saturated partially unsaturated or unsaturated (aromatic) , and which consists of carbon atoms and from 1 to 3 heteroatoms independently selected from the group consisting of N, 0 and S. The nitrogen and sulfur heteroatoms may optionally be oxidized. The heterocyclic ring may be attached to its pendant group at any heteroatom or carbon atom which results in a stable structure. The heterocyclic rings described herein may be substituted on carbon or on a nitrogen atom if the resulting compound is stable. If specifically noted, a nitrogen in the heterocycle may optionally be quaternized. It is preferred that when the total number of S and O atoms in the heterocycle exceeds 1, then these heteroatoms are not adjacent to one another. It is preferred that the total number of S and .0 atoms in the heterocycle is not more than 1. As used herein, the term "aromatic heterocyclic system" is intended to mean a stable 5- to 6- membered monocyclic heterocyclic aromatic ring which consists of carbon atoms and from 1 to 3 heterotams independently selected from the group consisting of N, 0 and S. It is preferred that the total number of S and 0 atoms in the aromatic heterocycle is not more than 1.
Examples of heterocycles include, but are not limited to, 2-pyrrolidonyl, 2H-pyrrolyl, 4-piperidonyl, 6H-1,2,5- thiadiaziny1 , 2H, βH-1 , 5 , 2 -dithiaziny1 , furanyl , furazanyl , imidazolidinyl, imidazolinyl, imidazolyl, isoxazolyl, morpholinyl, oxadiazolyl, 1, 2, 3-oxadiazolyl, 1,2,4- oxadiazolyl, 1, 2 , 5-oxadiazolyl, 1, 3 , 4-oxadiazolyl, oxazolidinyl . , oxazolyl, piperazinyl, piperidinyl, pteridinyl, piperidonyl, 4-piperidonyl, pteridinyl, purinyl, pyranyl, pyrazinyl, pyrazolidinyl, pyrazolinyl, pyrazolyl, pyridazinyl, pyridinyl, pyridyl, pyrimidinyl, pyrrolidinyl, pyrroliny1 , pyrrolyl , tetrahydrofuranyl , 6H-1 , 2,5- thiadiazinyl, 1, 2 , 3-thiadiazolyl, 1, 2 , 4-thiadiazolyl, 1,2,5- thiadiazolyl, 1, 3 , 4-thiadiazolyl, thiazolyl, thienyl, thienothiazolyl, thienooxazolyl, thienoimidazolyl, thiophenyl, triazinyl, 1, 2 , 3-triazolyl, 1, 2 , 4-triazolyl, 1, 2, 5-triazolyl, and 1, 3 , 4-triazolyl . Preferred heterocycles include, but are not limited to, pyridinyl, furanyl, thienyl, pyrrolyl, pyrazolyl, imidazolyl, and oxazolidinyl. Also included are fused ring and spiro compounds containing, for example, the above heterocycles.
As used herein, "HIV reverse transcriptase inhibitor" is intended to refer to both nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT) . Examples of nucleoside RT inhibitors include, but are not limited to, AZT, ddC, ddl, d4T, and 3TC. Examples of non-nucleoside RT inhibitors include, but are no limited to, delavirdine (Pharmacia and Upjohn U90152S) , TIBO derivatives, BI-RG-587, nevirapine (Boehringer Ingelheim), L-697,661, LY 73497, Ro
18,893 (Roche), loviride (Janssen) , trovirdine (Lilly), MKC- 442 (Triangle) , .and HBY 097 (Hoechst) .
As used herein, "HIV protease inhibitor" is intended to refer to compounds which inhibit HIV protease. Examples include, but are not limited, saquinavir (Roche, Ro31-8959), ritonavir (Abbott, ABT-538) , indinavir (Merck, MK-639) , VX- 478 (Vertex/Glaxo Wellcome) , nelfinavir (Agouron, AG-1343), KNI-272 (Japan Energy) , CGP-61755 (Ciba-Geigy) , U-140690 (Pharmacia and Upjohn), and ABT-378. Additional examples include the cyclic protease inhibitors disclosed in WO93/07128, WO 94/19329, WO 94/22840, and PCT Application Number US96/03426. As used herein, "pharmaceutically acceptable salts" refer to derivatives of the disclosed compounds wherein the parent compound is modified by making acid or base salts thereof. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like. The pharmaceutically acceptable salts include the conventional non-toxic salts or the quaternary ammonium salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. For example, such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like; and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic , phenylacetic , glutamic, benzoic, salicylic, sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, and the like. The pharmaceutically acceptable salts of the present invention can be synthesized from the parent compound which contains a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. Lists of suitable salts are found in Remington 's Pharmaceutical Sciences, 17th ed. , Mack Publishing Company, Easton, PA,
1985, p. 1418, the disclosure of which is hereby incorporated by reference. The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication commensurate with a reasonable benefit/risk ratio .
"Prodrugs" are intended to include any covalently bonded carriers which release the active parent drug according to formula (I) or other formulas or compounds of the present invention in vivo when such prodrug is administered to a mammalian subject. Prodrugs of a compound of the present invention, for example formula (I) , are prepared by modifying functional groups present in the compound in such a way that the modifications are cleaved, either in routine manipulation or in vivo, to the parent compound. Prodrugs include compounds of the present invention wherein the hydroxy or amino group is bonded to any group that, when the prodrug is administered to a mammalian subject, cleaves to form a free hydroxyl or free amino, respectively. Examples of prodrugs include, but are not limited to, acetate, formate and benzoate derivatives of alcohol and amine functional groups in the compounds of the present invention, and the like. "Stable compound" and "stable structure" are meant to indicate a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and formulation into an efficacious therapeutic agent. Only stable compounds are contempleted by the present invention.
"Substituted" is intended to indicate that one or more hydrogens on the atom indicated in the expression using "substituted" is replaced with a selection from the indicated group (s) , provided that the indicated atom's normal valency is not exceeded, and that the substitution results in a stable compound. When a substituent is keto (i.e., =0) group, then 2 hydrogens on the atom are replaced. "Therapeutically effective amount" is intended to include an amount of a compound of the present invention or an amount of the combination of compounds claimed effective to inhibit HIV infection or treat the symptoms of HIV infection in a host. The combination of compounds is preferably a synergistic combination. Synergy, as described for example by Chou and Talalay, Adv. Enzyme Regul. 22:27-55 (1984), occurs when the effect (in this case, inhibition of HIV replication) of the compounds when administered in combination is greater than the additive effect of the compounds when administered alone as a single agent. In general, a synergistic effect is most clearly demonstrated at suboptimal concentrations of the compounds. Synergy can be in terms of lower cytotoxicity, increased antiviral effect, or some other beneficial effect of the combination compared with the individual components .
SYNTHESIS The compounds of the present invention can be prepared in a number of ways well known to one skilled in the art of organic synthesis . The compounds of the present invention can be synthesized using the methods described below, together with synthetic methods known in the art of synthetic organic chemistry, or variations thereon as appreciated by those skilled in the art. Preferred methods include but are not limited to those methods described below. Each of the references cited below are hereby incorporated herein by reference .
SCHEME 1
TMSC1 , base RiMgX
Scheme 1 illustrates a method of preparing keto-anilines from an appropriately substituted 2-aminobenzoic acid. The acid is converted to its N-methoxy-N-methyl amide derivative which can then be displaced to obtain the R^-substituted ketone. The keto-anilines are useful intermediates for the presently claimed compounds.
SCHEME 2
Scheme 2 describes another method of preparing keto- anilines, this time from an appropriately substituted aniline. After iodination and amine protection, a group such as trifluoromethyl can be introduced using a strong base and ethyl trifluoroacetate. Deprotection provides the keto- aniline. Additional means of preparing keto-anilines are known to one of skill in the art, e.g, Houpis et al, Tetr. Lett. 1994, 35 (37) , 6811-6814, the contents of which are hereby incorporated herein by reference. SCHEME 3
Another method of making 2-trifluoroacetylanilines is shown in Scheme 3. After forming the protected aniline, the amide is then reduced and the trifluoromethyl group added. Oxidation with an oxidant, such as Mnθ2 , provides the useful intermediate .
SCHEME
Using the general method detailed in Scheme 4, one can prepare compounds of the present invention. Keto-aniline 1, which may be prepared by the methods desribed in Schemes 1 and 2, is treated with trimethylsilyl isocyanate in dry tetrahydofuran in the presence of dimethylaminopyridine followed by tetrabutylammonium fluoride to give the hydroxy- urea 2 . The hydroxy-urea 2 is then dehydrated with a dehydrating agent such as 4A molecular sieves in refluxing toluene or xylenes to give the ketimine 3.- A substituted acetylenic R2 group is added by treating the ketimine 3. with a lithium acetylide, which is prepared in a separate vessel by reacting the corresponding substituted acetylene with n- butyllithium in dry tetrahydrofuran, to give the 4,4- disubstituted 3 , 4-dihydro-2 (IH) -quinazolinone __, a compound of formula I . The acetylenic bond of the compound 4 may be reduced, e.g., by catalytic hydrogenation, to give the corresponding alkenyl group (not shown) or the saturated compound 5..
Other R2 groups may also be introduced by directly reacting the imine 3. with a lithiate R2Li or a Grignard reagent R2MgX in the presence or absence of Lewis acid catalyst, such as BF3 etherate. See also Huffman et al, J. Org. Chem. 1995, 60, 1590-1594, the contents of which are hereby incorporated herein by reference.
In certain instances, one enantiomer of a compound of Formula I or II may display superior activity compared with the other. When required, separation of the racemic material can be achieved by HPLC using a chiral column as exemplified in Examples 27-34 (Scheme 4) or by a resolution using a resolving agent such as camphonic chloride as in Thomas J. Tucker, et al, J. Med. Chem. 1994, 37, 2437-2444. A chiral compound of Formula I may also be directly synthesized using a chiral catalyst or a chiral ligand, e.g. Mark A. Huffman, et al, J. Org. Chem . 1995, 60, 1590-1594.
Other features of the invention will become apparent in the course of the following descriptions of exemplary embodiments which are given for illustration of the invention and are not intended to be limiting thereof . Examples Abbreviations used in the Examples are defined as follows: "°C" for degrees Celsius, "d" for doublet, "dd" for doublet of doublets, "eq" for equivalent or equivalents, "g" for gram or grams, "mg" for milligram or milligrams, "mL" for milliliter or milliliters, "H" for hydrogen or hydrogens, "hr" for hour or hours, "m" for multiplet, "M" for molar, "min" for minute or minutes, "MHz" for megahertz, "MS" for mass spectroscopy, "nmr" or "NMR" for nuclear magnetic resonance spectroscopy, "t" for triplet, "TLC" for thin layer chromatography, "EDAC" for 1- (3-dimethylaminopropyl) -3- ethylcarbodiimide hydrochloride, "DIPEA" for diisopropylethylamine, "TBAF" for tetrabutylammonium fluoride, "LAH" for lithium aluminium hydride, and "TEA" for triethylamine .
Example 1 Prepration of (+/- ) -6-Chloro-4-cyclopropylethynyl-4- trifluoromθthyl-3, 4-dihydro-2 (IH) -quinazolinone (R4
Cyclopropyl)
Ill-a IV- a
Step 1. Synthesis of Il-a from I-a.
To a solution of compound I-a (4.55 g, 20.2 mmol) in anhydrous THF (40 mL) was added dimethylaminopyridine (0.25 g, 2.02 mmol) and trimethylsilyl isocyanate (6.05 g, 7.11 mL, 52.5 mmol) . The mixture was stirred at room temperature for approximately 16 hours, then tetrabutylammonium fluoride (21 mL of 1 M solution in THF) was added. The thick slurry was diluted with additional THF (20 mL) and stirred at room temperature for 0.5 hours . The THF was removed under reduced pressure, the residue was taken up in EtOAc (100 mL) and washed sequentially with 1 N HCl (70 mL) , saturated aqueous NaHC03 (70 mL) and saturated aqueous NaCl (50 mL) . The organic phase was dried over MgS04, filtered and concentrated under reduced pressure to afford a light yellow solid. The yellow color was removed upon trituration with hexanes to afford Ila (5.09 g, 94%) as a white solid: XH NMR (300 MHz, acetone-d6) δ 9.06 (br s, 1 H) , 7.48 (s, 1 H) , 7.40 (br s, 1
H) , 7.34 (dd, J = 8.8, 2.6 Hz, 1 H) , 6.97 (d, J = 8.8 Hz, 1 H) ; 19F NMR (282 MHz, acetone-d6) δ -86.33, -86.35; IR (KBr Pellet) 1724, 1678, 1398, 1198, 1174 cm"1; MS (CI) m/e 266 (MH+, 100) .
Step 2. Synthesis of Ill-a from Il-a.
A suspension of Il-a (5.09 g, 19.1 mmol) in toluene (150 mL) containing 4 A molecular sieves (approximately 100 mg) was heated at reflux for 16 hours . The resulting clear yellow solution was cooled to room temperature, the precipitated solids were dissolved in acetone and the molecular sieves were removed by vacuum filtration. The filtrate was concentrated under reduced pressure, and triturated with hexanes to afford Ill-a (4.25 g, 89%) as a yellow solid: !H NMR (300 MHz, acetone-d6) δ 7.86-7.82 (m, 2 H) , 7.61 (d, J" = 8.8 Hz, 1 H) ; 19F NMR (282 MHz, acetone-d6) δ -67.88.
Step 3. Synthesis of IV-a from Ilia.
A solution of cyclopropylacetylene (13.0 mL of 30 wt% solution in toluene/THF/hexanes, 59.0 mmol) in anhydrous THF (118 mL) was cooled to -78 °C, treated with n-BuLi (32.8 mL of 1.6 M solution in hexanes, 52.4 mmol), warmed to 0 °C in an ice bath, and aged for 0.5 h. To a solution of Ill-a (3.12 g, 12.6 mmol) in anhydrous THF (66 mL) at -78 °C was added the lithium acetylide over approximately 10 minutes. To this was added boron trifluoride etherate (0.89 g, 0.80 mL, 6.28 mmol), followed by removal of the cooling bath. The reaction was allowed to reach room temperature and stirred at room temperature for 4 hours before quenching with 1 M citric acid (100 mL) . The mixture was concentrated under reduced pressure to 1/2 original volume, diluted with EtOAc (200 mL) , the aqueous phase was removed and the organic phase was sequentially washed with saturated aqueous NaHCθ3 (100 mL) , and saturated aqueous NaCl (100 mL) . The organic phase was dried over MgS04, filtered and concentrated under reduced pressure. The crude material was purified by flash chromatography (3% MeOH/CH2Cl2) to afford a thick yellow oil from which was obtained crystalline IV-a (R4 = cyclopropyl)
(3.85 g, 97%) as a white solid: mp 86.6-88 °C; XH NMR (300 MHz, acetone-d6) δ 8.95 (br s, 1 H) , 7.51 (br s, 1 H) , 7.43
(br s, 1 H) , 7.40 (dd, J = 8.8, 2.4 Hz, 1 H) , 7.02 (d, J = 8.8 Hz, 1 H) , 1.49-1.41 (m, 1 H) , 0.93-0.82 (m, 1 H) , 0.77- 0.74 (m, 1 H) ; 19F NMR (282 MHz, acetone-d6) δ -82.96; IR
(KBr Pellet) 1696, 1172 cm"1; MS (CI) m/e calc ' d for C14H10CIF3N2O: 315.051201, found 315.051626; 315 (MH+, 51), 332 (M+NH +, 100); Analysis calc'd for Ci4Hι0N2ClF3θ-0.25 H20: C, 52.68; H, 3.32; N, 8.78; found: C, 52.61; H, 3.35; N, 8.28.
Example 2 Preparation of (+/-) -6-Chloro-4-isopropylethynyl-4- trifluoromθthyl-3, 4-dihydro-2 (IH) -quinazolinone (R4 = Isopropyl)
A solution of Ill-a (50 mg, 0.201 mmol) was treated with the lithium acetylide derived from 3-methyl-l-butyne (62 mg, 93 mL, 0.905 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by flash chromatography (35% EtOAc/hexanes) to afford 26mg (41%) of the desired product: E NMR (300 MHz, ) δ 9.08 (br s, 1
H) , 7.59 (br s, 1 H) , 7.53 (br s, 1 H) , 7.40 (dd, J = 8.4, 2.2 Hz, 1 H) , 7.02 (d, J = 8.8 Hz, 1 H) , 2.81-2.68 (m, 1 H) , 1.20 (dd, J = 6.6 Hz, 6H) ; 19F NMR (282 MHz, acetone-d6) δ -83.05; MS (CI) m/e calc'd for C14H12CIF3N2O: 317.066851, found 317.069433; 317 (MH+, 43), 334 (M+NH4\ 100) .
Example 3 Preparation of (+/-) -6-Chloro-4- (2-pyridyl) ethynyl-4- trif luoromethyl -3, 4 -dihydro- 2 (IH) -quinazolinone (R4 =
2 -Pyridyl)
A solution of Ill-a (100 mg, 0.402 mmol) was treated with the the lithium acetylide derived from 2-ethynylpyridine (0.19 g, 1.81 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5% MeOH/CH2Cl2) to afford 85 mg (60%) of the desired product: mp 105 °C dec; XH NMR (300 MHz, acetone-d6) δ 9.14 (br s, 1 H) , 8.64-8.61 (m, 1 H) , 7.89-7.84 (m, 2 H) , 7.70- 7.66 (m, 2 H) , 7.48-7.43 (m, 2 H) , 7.09 (d, J= 8.8 Hz, 1 H) ; 19F NMR (282 MHz, acetone-d6) δ -82.48; IR (KBr Pellet) 1704, 1430, 1186 cm"1; MS (CI) m/e calc'd for C16H10CIF3N3O:
352.046450, found 352.046956; 352 (MH+, 100); Analysis calc'd for Cι6H9ClF3N3O-0.125 H20: C, 54.3; H, 2.56; N, 11.9; found: C, 54.71; H, 3.03; N, 11.3.
Example 4
Preparation of (+/-) -6-Chloro-4-ethylethynyl-4- trifluoromethyl-3,4-dihydro-2 (IH) -quinazolinone (R4 =
Ethyl)
A solution of Ill-a (100 mg, 0.402 mmol) was treated with the the lithium acetylide derived from 1-butyne (109 mg, 2.01 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5% MeOH/CH2Cl2) to afford 79 mg (65%) of the desired product: λE NMR (300 MHz, acetone-d6) δ 9.05 (br s, 1 H) , 7.54 (br s, 2
H) , 7.41-7.39 (m, 1 H) , 7.02 (d, J" = 8.4 Hz, 1 H) , 2.36-2.32 (m, 2 H) , 2.18-1.13 (m, 3 H) ; 19F NMR (282 MHz, acetone-d6) δ -82.99; MS (CI) m/e calc'd for C13H10CIF3N2O: 303.051201, found 303.051882; 303 (MH+, 55) , 320 (M+NH +, 100) .
Example 5 Preparation of (+/- ) -6-Chloro-4-phenylethynyl-4- trifluoromethyl-3,4-dihydro-2 (IH) -quinazolinone (R4 =
Phenyl)
A solution of Ill-a (100 mg, 0.402 mmol) was treated with the the lithium acetylide derived from phenylacetylene (185 mg, 1.81 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5% MeOH/CH2Cl2) to afford 54 mg (38%) of the desired product: XH NMR (300 MHz, acetone-d6) δ 9.07 (br s, 1 H) , 7.74 (br s, 1 H) , 7.67 (br s, 1 H) , 7.62-7.58 (m, 2 H) , 7.48- 7.40 (m, 4H) , 7.08 (d, J = 8.4 Hz, 1 H) ; 19F NMR (282 MHz, acetone-d6) δ -82.67; IR (KBr Pellet) 1696, 1186 cm-1; MS
(CI) m/e calc'd for C17H11CIF3N2O: 351.051201, found 351.051704; 351 (MH+, 51), 368 (M+NH4 +, 100) ; Analysis calc'd for Cι7HιoClF3N20-0.25 H20: C, 57.48; H, 2.98; N, 7.89; found: C, 57.00; H, 3.03; N, 7.48.
Example 6 Preparation of (+/-) -4-Cyclopropylethynyl-6-methoxy-4- trif luoromethyl-3,4-dihydro-2 (IH) -quinazolinone (R4 =
Cyclopropyl)
Vll-a VHI-a
Step 1. Synthesis of Vl-a from V-a. A solution of V-a (0.50 g, 2.28 mmol) was treated with dimethylaminopyridine and trimethylsilyl isocyanate as described in Step 1 of Example 1 to afford 0.58 g (97%) of the desired product: 1H NMR (300 MHz, acetone-d6) δ 8.81 (br s, 1 H) , 7.17 (br s, 1 H) , 7.11 (br s, 1 H) , 7.00-6.92 (m, 2 H) , 6.83 (s, 1 H) , 3.76 (s, 3 H) ; 19F NMR (282 MHz, acetone- d6) δ -85.99.
Step 2. Synthesis of Vll-a from Vl-a.
A solution of Vl-a (0.58 g, 2.21 mmol) was heated in toluene at reflux as described in Step 2 of Example 1 to afford 0.50 g (93%) of the desired product: 1H NMR (300 MHz, acetone-d6) δ 7.52 (br s, 2 H) , 7.27 (s, 1 H) , 3.90 (s, 3 H) ; 19F NMR (282 MHz, acetone-d6) δ -68.08.
Step 3. Synthesis of VHI-a from Vll-a.
A solution of Vll-a (100 mg, 0.410 mmol) was treated with the the lithium acetylide derived from cyclopropylacetylene (0.41 mL of 30 wt% solution in toluene/THF/hexanes, 1.85 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5% MeOH/CH2Cl ) to afford 103 mg (81%) of the desired product: ^ NMR (300 MHz, acetone-d6) δ 8.77 (br s, 1 H) , 7.29 (br s, 1 H) , 7.06 (br s, 1 H) , 6.99-6.90 (m, 2 H) , 3.77 (s, 3 H) , 1.46-1.38 ( , 1 H) , 0.91-0.85 (m, 2 H) , 0.79-0.72 (m, 2 H) ; 19F NMR (282 MHz, acetone-d6) δ -82.61; MS (CI) m/e calc'd for C15H14F3N2O2 : 311.100738, found 311.099970; 311 (MH+, 100). Example 7 Preparation of ( +/ - ) -4 -lsopropylethynyl-6-mβthoxy-4 - trifluoromethyl- 3 , 4 -dihydro-2 ( IH ) -quinazolinone (R4 =
Isopropyl )
A solution of Vll-a (100 mg, 0.410 mmol) was treated with the the lithium acetylide derived from 3-methyl-l-butyne (126 mg, 0.19 mL, 1.85 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by flash chromatography (2.5% MeOH/CH2Cl2) to afford 30 mg (24%) of the desired product: mp 228-229 °C; XH NMR (300 MHz, acetone-d6) δ 8.72 (br s, 1 H) , 7.27 (br s, 1 H) ,
7.10 (br s, 1 H) , 7.00-6.91 (m, 2 H) , 3.77 (s, 3 H) , 2.73- 2.67 (m, 1 H) , 1.20 (dd, J = 7.0, 1.5 Hz, 6 H) ; 19F NMR (282 MHz, acetone-d6) δ -82.71; IR (KBr Pellet) 1696, 1428, 1190,
1176 cm"1; MS (CI) m/e calc'd for C3.5H16F3N2O2 : 313.116388, found 313.115871; 313 (MH+- 100), 330 (M+NH +, 15); Analysis calc'd for C15H15F3N2O2 : C, 57.69; H, 4.84; N, 8.97; found: C, 57.74; H, 5.01; N, 8.57.
Example 8
Preparation of (+/- ) -6-Methoxy-4- (2-pyridyl) ethynyl-4- trifluoromβthyl-3,4-dihydro-2 (IH) -quinazolinone (R4 =
2 -Pyridyl)
A solution of Vll-a (100 mg, 0.410 mmol) was treated with the the lithium acetylide derived from 2-ethynylpyridine (0.19 g, 1.85 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by flash chromatography (2.5% MeOH/CH2Cl2) to afford 56 mg (39%) of the desired product: 1H NMR (300 MHz, acetone-dg) δ 8.81
(br s, 1 H) , 8.61 (d, J = 4.8 Hz, 1 H) , 7.88-7.82 (m, 1 H) ,
7.66 (d, J = 7.7 Hz, 1 H) , 7.61 (br s, 1 H) , 7.46-7.42 (m, 1
H) , 7.23 (br s, 1 H) , 7.06-6.97 (m, 2 H) , 3.79 (s, 3 H) ; 19F NMR (282 MHz, acetone-d6) δ -82.13; IR (KBr Pellet) 1698,
1518, 1464, 1430, 1244, 1208, 1184 cm"1; MS (CI) m/e calc'd for C17H13F3N3O2 : 348.095987, found 348.095629; 348 (MH+, 100) ; Analysis calc'd for C17H12F3N3O2 • 0.25 C3H60: C, 58.92; H, 3.76; N, 11.61; found: C, 59.38; H, 4.04; N, 11.35.
Example 9 Preparation of (+/- ) -6-Methoxy-4-phenylethynyl-4- trif luoromethyl- 3, 4-dihydro-2 (IH) -quinazolinone (R4 =
Phenyl)
A solution of Vll-a (100 mg, 0.410 mmol) was treated with the the lithium acetylide derived from phenylacetylene (0.19 g, 1.85 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by flash chromatography (2.5% MeOH/CH2Cl ) to afford 34 mg (24%) of the desired product: mp 206.2-207.7 °C; λ NMR (300 MHz, acetone-dδ) δ 8.85 (br s, 1 H) , 7.60-7.57 (m, 3 H) , 7.49-7.39
(m, 3 H) , 7.21 (br s, 1 H) , 7.05-6.96 (m, 2H) , 3.79 (s, 3 H) ; 19F NMR (282 MHz, acetone-d6) δ -82.32; IR (KBr Pellet) 1696,
1516, 1430, 1236, 1204, 1184, 1128 cm"1; MS (CI) m/e calc'd for C18H14F3N2O2 : 347.100738, found 347.101482; 347 (MH+, 100), 364 (M+NH+, 48); Analysis calc'd for C18H13F3N2O2 : C, 62.43; H, 3.78; N, 8.10; found: C, 62.35; H, 3.58; N, 7.83.
Example 10
Preparation of ( + / - ) -4 -Cyclopropylethynyl - 5 , 6 - dif luoro-4 - trif luoromethyl - 3 , 4 -dihydro- 2 ( IH ) - quinazolinone (R4 = Cyclopropyl )
Step 1. Synthesis of X-a from IX-a.
A solution of IX-a (6.46 g, 28.7 mmol) was treated with dimethylaminopyridine and trimethylsilyl isocyanate as described in Step 1 of Example 1 to afford 6.74 g (88%) of the desired product: 1H NMR (300 MHz, acetone-dδ) δ 9.13 (br s, 1 H) , 7.45-7.32 (m, 2 H) , 7.18 (br s, 1 H) , 6.85-6.80 (m, 1 H) ; 19F NMR (282 MHz, acetone-d6) δ -86.6 (d, 17.2, 3),
-137.52-137.68 (m, 1), -148.47-148.59 ( , 1).
Step 2. Synthesis of Xl-a from X-a.
A solution of X-a (6.74 g, 25.1 mmol) was heated in xylenes at reflux as described in Step 2 of Example 1, substituting xylenes for toluene, to afford 6.3 g (100%) of the desired product: ^-H NMR (300 MHz, acetone-d6) δ 7.92-7.83 (m, 1 H) , 7.46-7.44 (m, 1 H) ; 19F NMR (282 MHz, acetone-d6) δ -70.7 (d, 38.7, 3), -136.72 (s, 1), -146.47-146.57 (m, 1).
Step 3. Synthesis of Xll-a from Xl-a. A solution of XI-a (6.28 g, 25.1 mmol) was treated with the the lithium acetylide derived from cyclopropylacetylene (24.9 mL of 30 wt% solution in toluene/THF/hexanes, 0.113 mol) according to the procedure of Step 3 of Example 1. The resulting crude yellow oil was dissolved in acetone and concentrated under reduced pressure to deliver a yellow solid. Crystallization from acetone afforded 5.98 g (75%) of the desired material: mp 86.5-88.5 °C; λΗ. NMR (300 MHz, acetone-d6) δ 9.01 (br s, 1 H) , 7.46 (br s, 1 H) , 7.44-7.35
(m, 1 H) , 6.86-6.81 (m, 1 H) , 1.41-1.37 (m, 1 H) , 0.90-0.83 (m, 1 H) , 0.74-0.69 (m, 1 H) ; 19F NMR (282 MHz, acetone-d6) δ
-83.3 (d, J = 12.9, 1), -136.04-136.23 (m, 1), -148.14-148.26 (m, 1); IR (KBr Pellet) 1706, 1516, 1442, 1246, 1214, 1196 cm"1; MS (CI) m/e calc'd for C14H10F5N2O: 317.071329, found 317.070836; 317 (MH+, 100), 334 (M+NH4 +, 62); Analysis calc'd for C14H9F5N2O: C, 53.17; H, 2.88; N, 8.87; found: C, 53.30; H, 3.16; N, 8.53.
Example 11
Preparation of (+/-) -5, 6-Difluoro-4-isopropylethynyl- 4-trifluoromethyl-3 , 4-dihydro-2 ( IH) -quinazolinone (R4
= Isopropyl)
A solution of Xl-a (7.24 g, 28.9 mmol) was treated with the the lithium acetylide derived from 3-methyl-1-butyne (8.87 g, 13.3 mL, 0.130 mol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by flash chromatography (2.5% MeOH/CH2Cl2) to afford a yellow oil. Crystallization from acetone afforded 6.77 g (74%) of the desired product: mp 79-80 °C; ^-H NMR (300 MHz, acetone-d6) δ 9.02 (br s, 1 H) , 7.50 (br s, 1 H) , 7.44-7.35
(m, 1 H) , 6.87-6.82 (m, 1 H) , 2.69-2.65 (m, 1 H) , 1.17 (d, J = 7.0 Hz, 6H) ; 19F NMR (282 MHz, acetone-d6) δ -83.4 (d, J = 12.9, 1), -135.79-135.94 (m, 1), -148.14-148.26 (m, 1); MS (CI) m/e calc'd for C14H12F5N2O: 319.086979, found 319.087376; 319 (MH+, 100), 336 (M+NH4 +, 76). Example 12
Preparation of ( +/ - ) - 5 , 6 -Dif luoro-4 - ( 2 - pyridyl ) ethynyl - 4 -trif luoromethyl - 3 , 4 -dihydro- 2 ( IH ) - quinazolinone ( R4 = 2 -Pyridyl )
A solution of Xl-a (100 mg, 0.400 mmol) was treated with the the lithium acetylide derived from 2-ethynylpyridine (0.19 g, 1.80 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by flash chromatography (4% MeOH/CHCl ) to afford 83 mg (59%) of the desired product: mp 219-220 °C; XH NMR (300 MHz, acetone-d6) δ 9.15 (br s, 1 H) , 8.61 (d, J = 4.4 Hz, 1 H) , 7.88-7.82 (m,
2H) , 7.63 (dd, J-= 7.0, 1.1 Hz, 1 H) , 7.47-7.42 (m, 2H) , 6.94-6.88 (m, 1 H) ; 19F NMR (282 MHz, acetone-d6) δ -82.8 (d, J = 12.9, 3), -135.78-135.93 (m, 1), -147.86-147.98 (m, 1) ; IR (KBr Pellet) 1712, 1470, 1450, 1430, 1416, 1264, 1238, 1226, 1198, 1186 cm-1; MS (CI) m/e calc'd for CK5H9F5N3O: 354.066578, found 354.067821; 354 (MH+, 100).
Example 13
Preparation of (+/-) -5, 6-Difluoro-4-ethylethynyl-4- trifluoromethyl-3, 4-dihydro-2 (IH) -quinazolinone (R4 =
2 -Ethyl)
A solution of Xl-a (100 mg, 0.400 mmol) was treated with the the lithium acetylide derived from 1-butyne (97 mg, 1.80 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5% MeOH/CH2Cl2) to afford 69 mg (57%) of the desired product: mp 191-194 °C; 3-H NMR (300 MHz, acetone-d6) δ 9.03 (br s, 1 H) ,
7.50 (br s, 1 H) , 7.45-7.35 ( , 1 H) , 6.87-6.82 (m, 1 H) , 2.34-2.27 (m, 2H) , 1.20-1.15 ( , 3 H) ; 19F NMR (282 MHz, acetone-d6) δ -83.3 (d, J = 12.9, 3), -135.79-135.98 (m, 1),
-148.16-148.29 (m, 1); IR (KBr Pellet) 1704, 1686, 1518, 1444, 1244, 1210, 1192, 1172 cm"1; MS (CI) m/e calc'd for C13H10F5N2O: 305.071329, found 305.071146; 305 (MH+, 100); Analysis calc'd for C13H9F5N2O: C, 51.33; H, 2.98; N, 9.22; found: C, 51.00; H, 2.79; N, 8.99. Example 14 Preparation of (+/- ) -5, 6-Dif luoro-4-phenylethynyl-4- trif luoromethyl-3, 4-dihydro-2 (IH) -quinazolinone (R4 = Phenyl)
A solution of Xl-a (100 mg, 0.400 mmol) was treated with the the lithium acetylide derived from phenylacetylene (0.18 g, 0.20 mL, 1.80 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5% MeOH/CH2Cl2) to afford 92 mg (65%) of the desired product: λK NMR (300 MHz, acetone-dδ) δ 9.14 (br s, 1 H) ,
7.80 (br s, 1 H) , 7.57-7.54 (m, 2H) , 7.49-7.40 (m, 4H) , 6.92- 6.87 (m, 1 H) ; 19F NMR (282 MHz, acetone-d6) δ -83.0 (d, J- = 12.9, 3), -136.08-136.27 (m, 1), -147.87-148.00 (m, 1); MS (CI) m/e calc'd for C17H10F5N2O: 353.071329, found 353.071716; 353 (MH+, 42), 370 (M+NH4 +, 100) .
Example 15 Preparation of (+/- ) -5, 6-Dif luoro-4-isopentyl-4- trif luoromethyl -3,4 -dihydro- 2 (IH) -quinazolinone (R4 =
Isopropyl)
Synthesis of XHI-a from Xll-a.
A solution of XHI-a (R4 = isopropyl) (26 mg, 82 mmol) in ethanol (1 mL) and EtOAc (0.5 L) was treated with 10% Pd on carbon (35 mg) under H2 (1 atm) for 16 hours. The catalyst was removed by vacuum filtration through Celite and the filter cake was washed with EtOAc. The combined filtrates were concentrated under reduced pressure to afford 26 mg (100%) of the desired material. No further purification was necessary: E NMR (300 MHz, acetone-d6) δ 8.88 (br s, 1 H) ,
7.41-7.31 (m, 1 H) , 6.89-6.81 (m, 2H) , 2.55-2.50 (m, 1 H) , 1.64-1.45 (m, 2H) , 1.06-1.02 (m, 1 H) , 0.89 (dd, J = 6.6, 2.2 Hz, 6H) ; 19F NMR (282 MHz, acetone-dδ) δ -83.22 (d, J = 12.1,
3), -138.97-139.13 (m, 1), -148.46-148.58 (m, 1); IR (KBr Pellet) 1700, 1678, 1518, 1438, 1252, 1188, 1172 cm"1; MS (CI) m/e calc'd for C14H16F5N2O: 323.118280, found 323.116703; 323 (MH+, 100) , 340 (M+NH +, 57) .
Example 16 Preparation of (+/-) -4-Butyl-5, 6-dif luoro-4- trif luoromethyl-3, 4-dihydro-2 (IH) -quinazolinone (R4 =
Ethyl)
A solution of XHI-a (R4 = ethyl) (20 mg, 66 mmol) in ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10% Pd on carbon under H2 according to the procedure of Example 15. Purification by HPLC (2.5% MeOH/CH2Cl2) afforded 12 mg (56%) of the desired product: 1H NMR (300 MHz, acetone-dδ) δ 8.89
(br s, 1 H) , 7.41-7.32 (m, 1 H) , 6.86-6.81 (m, 2H) , 2.57-2.47 (m, 1 H) , 1.56-1.15 (m, 5H) , 0.88 (t, J= 7.3 Hz, 3 H) ; 19F NMR (282 MHz, acetone-d6) δ -83.19-83.24 (m, 1), -139.14 (s,
1), -148.49-148.62 (m, 1); MS (CI) m/e calc'd for C13H14F5N2O: 309.102629, found 309.103555; 309 (MH+, 100), 326 (M+NH+, 62) .
Example 17 Preparation of (+/- ) -4-Cyclopropylethynyl-6-fluoro-4- trifluoromethyl-3, 4-dihydro-2 (IH) -quinazolinone (R4 ■■
Cyclopropyl)
XIV- XV-a XVI-a
XlX-a
Step 1. Synthesis of XV-a from XlV-a.
A solution of XHI-a (3.07 g, 14.8 mmol) was treated with dimethylaminopyridine and trimethylsilyl isocyanate as described in Step 1 of Example 1 to afford 2.81 g (76%) of the desired product.
Step 2. Synthesis of XVI-a from XV-a.
A solution of XV-a (6.74 g, 25.1 mmol) was heated in toluene at reflux as described in Step 2 of Example 1 to afford 0.73 g (94%) of the desired product.
Step 3. Synthesis of XVII-a from XVI-a. A solution of XVI-a (100 mg, 0.431 mmol) was treated with the the lithium acetylide derived from cyclopropylacetylene (1.43 mL of 30 wt% solution in toluene/THF/hexanes, 1.94 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5% MeOH/CH2Cl2) to afford 44 mg (34%) of the desired product: mp 155 °C; 1H NMR (300 MHz, acetone-dg) δ 8.86 (br s, 1 H) , 7.36 (br s, 1 H) , 7.30-7.27 (m, 1 H) ,
7.22-7.15 (m, 1 H) , 7.04-6.99 (m, 1 H) , 1.47-1.42 (m, 1 H) , 0.90-0.87 (m, 2 H) , 0.76-0.75 (m, 2 H) ; 19F NMR (282 MHz, acetone-d6) δ -82.86, -123.36-123.44; MS (CI) m/e calc'd for C14H11F4N2O: 299.080751, found 299.079976; 299 (MH+, 100).
Exam le IB Preparation of (+/- ) -6-Fluoro-4-isopropylethynyl-4- trifluoromethyl-3, 4-dihydro-2 (IH) -quinazolinone (R4 =
Isopropyl)
A solution of XVI-a (100 mg, 0.431 mmol) was treated with the the lithium acetylide derived from 3-methyl-1-butyne (0.13 g, 0.20 mL, 1.94 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5% MeOH/CH2Cl2) to afford 24 mg (18%) of the desired product: mp 158 °C; ^ NMR (300 MHz, acetone-d6) δ 9.07 (br s, 1 H) , 7.60 (br s, 1 H) , 7.32-7.30 (m, 1 H) ,
7.24-7.16 (m, 1 H) , 7.05-6.99 (m, 1 H) , 2.77-2.67 (m, 1 H) , 1.20 (dd, J = 7.0, 2.6 Hz, 6H) ; 19F NMR (282 MHz, acetone-d6) δ -82.95, -123.41-123.49; MS (301) m/e calc'd for C14H13F4N2O: 301.096401, found 301.096235; 301 (MH+, 100).
Example 19 Preparation of (+/-) -6-Fluoro-4- (2-pyridyl) ethynyl-4- trifluoromethyl-3 , 4-dihydro-2 (IH) -quinazolinone (R4 =
2 -Pyridyl)
A solution of XVI-a (100 mg, 0.431 mmol) was treated with the the lithium acetylide derived from 2-ethynylpyridine (0.20 g, 1.94 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5% MeOH/CH2Cl2) to "afford 65 mg (45%) of the desired product: mp 155 °C; lR NMR (300 MHz, acetone-dg) δ 9.02 (br s, 1 H) , 8.60 (d, J = 4.0 Hz, 1 H) , 7.87-7.78 (m, 2 H) , 7.66 (d, J = 7.7 Hz, 1 H) , 7.45-7.41 (m, 2 H) , 7.26-7.20 (m, 1 H) , 7.09-7.05 (m, 1 H) ; 19F NMR (282 MHz, acetone-dg) δ -82.36,
-122.94-123.02; MS (CI) m/e calc'd for CιgHιoF4N30: 336.076000, found 336.074156; 336 (MH+, 25).
Example 20
Preparation of (+/- ) -6-Fluoro-4-ethylethynyl-4- trifluoromethyl-3 , 4-dihydro-2 (IH) -quinazolinone (R4 =
Ethyl)
A solution of XVI-a (100 mg, 0.431 mmol) was treated with the the lithium acetylide derived from 1-butyne (0.10 g, 1.94 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5% MeOH/CH2Cl2) to afford 40 mg (33%) of the desired product: mp 190 °C; XH NMR (300 MHz, acetone-dg) δ 8.86 (br s, 1 H) , 7.38
(br s, 1 H) , 7.34-7.31 (m, 1 H) , 7.22-7.16 (m, 1 H) , 7.05- 7.00 (m, 1 H) , 2.04-2.01 (m, 2 H) , 1.19-1.14 (m, 3 H) ; 19F NMR (282 MHz, acetone-dg) δ -75.392, -123.42-123.50; MS (CI) m/e calc'd for C13H11F4N2O: 287.080751, found 287.080740; 287 (MH+, 100) .
Example 21 Preparation of (+/-) -6-Fluoro-4-phenylethynyl-4- trifluoromethyl-3 , 4-dihydro-2 ( IH) -quinazolinone (R4 = Phenyl)
A solution .of XVI-a (100 mg, 0.431 mmol) was treated with the the lithium acetylide derived from phenylacetylene (0.20 g, 0.21 mL, 1.94 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5% MeOH/CHCl ) to afford 41 mg (28%) of the desired product: mp 107 °C; ^-H NMR (300 MHz, acetone-dg) δ 9.00 (br s, 1 H) , 7.69 (br s, 1 H) , 7.63-7.59 (m, 2 H) , 7.50-7.40 (m, 4H) , 7.27-7.20 (m, 1 H) , 7.10-7.05 (m, 1 H) ; 19F NMR (282 MHz, acetone-dg) δ -82.56, -122.99-123.07; MS (CI) m/e calc'd for C17H11F4N2O: 335.080751, found 335.082057; 335 (MH+, 74) , 352 (M+NH4 +, 100) .
Example 22
Preparation of (+/-) -6-Fluoro-4-isopentyl-4- trifluoromethyl-3, 4-dihydro-2 (IH) -quinazolinone (R4 =
Isopropyl)
Synthesis of XVIII-a from XVII-a.
A solution of XVII-a (R4 = isopropyl) (26 mg, 87 mmol) in ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10% Pd on carbon under H2 according to the procedure of Example 15 to afford 15 mg (58%) of the desired product. No further purification was necessary: mp 179 °C; 1H NMR (300 MHz, acetone-dg) δ 7.02-6.97 (m, 2 H) , 6.80-6.76 (m, 1 H) , 2.18-
2.09 (m, 2 H) , 1.92-1.82 (m, 2 H) , 1.52-1.45 (m, 1 H) , 0.88- 0.79 (m, 6 H) ; 19F NMR (282 MHz, acetone-dg) δ -82.60,
-123.72-123.84; MS (CI) m/e calc'd for C14H17F4N2O:
305.127707, found 305.126790; 305 (MH+, 100).
Example 23 Preparation of ( +/- ) -6-Fluoro-4- (2 • -2-pyridyl) ethyl-4- trif luoromethyl-3, 4-dihydro-2 (IH) -quinazolinone (R4 =
2 -Pyridyl)
A solution of XVII-a (R4 = 2-pyridyl) (33 mg, 99 mmol) in ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10% Pd on carbon under H2 according to the procedure of Example 15 to afford 10 mg (30.%) of the desired product. No further purification was necessary: mp 88 °C; 1H NMR (300 MHz, acetone-dg) δ 8.35 (d, J = 4.4 Hz, 1 H) , 7.63 (dt, J" = 7.7, 1.5 Hz, 1 H) , 7.20-7.13 (m, 3 H) , 7.04-6.98 (m, 1 H) , 6.83- 6.79 (m, 1 H) , 2.84-2.78 (m, 1 H) , 2.68-2.48 (m, 2 H) , 2.27- 2.06 (m, 1 H) ; 19F NMR (282 MHz, acetone-dg) δ -82.58, -123 . 26-123 . 34 ; MS ( CI ) m/e calc ' d for CιgHi4F N30 : 340 . 107300 , found 340 . 107719 ; 340 (MH+ , 100 ) .
Example 24 Preparation of ( +/ - ) -4-Butyl-6-f luoro-4- trif luoromethyl- 3 , 4 -dihydro-2 ( IH) -quinazolinone (R4 =
Ethyl )
A solution of XVII-a (R4 = ethyl) (24 mg, 84 mmol) in ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10% Pd on carbon under H2 according to the procedure of Example 15 to afford 24 mg (100%) of the desired product. No further purification was necessary: mp 198 °C; 1H NMR (300 MHz, acetone-dg) δ 7.03-6.97 (m, 2 H) , 6.80-6.76 (m, 1 H) , 2.18- 2.11 (m, 1 H) , 1.90-1.81 (m, 1 H) , 1.30-1.19 (m, 3 H) , 0.97- 0.80 (m, 4 H) ; 19F NMR (282 MHz, acetone-dg) δ -82.692,
-123.78-123.86; MS (CI) m/e calc'd for C13H15F4N2O:
291.112051, found 291.112227; 291 (MH+, 100).
Example 25
Preparation of (+/-) -6-Fluoro-4-phenylethyl-4- trifluoromethyl-3, 4-dihydro-2 (IH) -quinazolinone (R4 =
Phenyl)
A solution of XVII-a (R4 = phenyl) (30 mg, 90 mmol) in ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10% Pd on carbon under H2 according to the procedure of Example 15 to afford 20 mg (67%) of the desired product. No further purification was necessary: mp 98 °C; ^-H NMR (300 MHz, acetone-dg) δ 7.18-6.99 (m, 7H) , 6.84-6.79 (m, 1 H) , 2.68-2.60 (m, 1 H) , 2.48-2.12 (m, 3 H) ; 19F NMR (282 MHz, acetone-dg) δ -82.67, -123.24-123.32; MS (CI) m/e calc'd for C17H15F4N2O: 339.112051, found 339.110781; 339 (MH+, 100). Example 2 6
Preparation of (+/- ) -6-Fluoro-4-methylpropargyl-4- trifluoromethyl-3, 4-dihydro-2 (IH) -quinazolinone (R4 =
Methyl)
Synthesis of XlX-a from XVI-a.
A solution of 2-butyne (94 mg, 1.75 mmol) in anhydrous THF (3.5 mL) was cooled to 0 °C, treated with n-BuLi (0.97 mL of 1.6 M solution in hexanes, 1.55 mmol), and aged for 0.5 h. To a solution of XVI-a (90 mg, 0.388 mmol) in anhydrous THF (1.9 mL) at -78 °C was added the lithium anion over 5 minutes, followed by boron trifluoride etherate (25 mL, 0.194 mmol) . The cooling bath was removed and the mixture was allowed to warm to room temperature. After 16 h at room temperature, quench by addition of 1 M citric acid (10 mL) , dilute with EtOAc (50 mL) , separate phases and wash the organic phase sequentially with saturated aqueous NaHCθ3 (20 mL) and saturated aqueous NaCl (20 mL) . The resulting material was purified by HPLC (2.5% MeOH/CHCl2) to afford 10 mg (9%) of the desired product: mp 181 °C; ^-H NMR (300 MHz, acetone-dg) δ 8.91 (br s, 1 H) , 7.27 (d, 8.4H), 7.18-7.08 (m,
1 H) , 7.02-6.97 (m, 2 H) , 3.29 (dd, J = 16.8, 2.6 Hz, 1 H) , 3.00 (dd, J = 16.8, 2.2 Hz, 1 H) , 1.61-1.59 (m, 3 H) ; 19F NMR (282 MHz, acetone-d6) δ -81.86, -123.69-123.70; MS (CI) m/e calc'd for C13H11F4N2O: 287.080751, found 287.080340; 287 (MH+, 75), 304 (M+NH+, 100).
SCHEME 4 : Chiral Resolution
Chiral HPLC Separation
_SJ_ Compound _EJ Compound iJ_ Compound
6-C1 IV-a 6-C1 IV- b 6-C1 IV-c 6-MeO VHI-a 6-MeO VHI-b 6-MeO VIII-c 5 , 6-diF Xll-a 5 , 6-diF Xll-b 5,6-diF XII-c 6-F XVII-a 6-F XVII -b 6-F XVII-c
Rya ples 27 and 28
Preparation of ( -) -6-Chloro-4-cyclopropylethynyl-4- trifluoromethyl-3 , 4-dihydro-2 ( IH) -quinazolinone
(Example 27) and (+) -6-Chloro-4-cyclopropylethynyl-4- trifluoromethyl-3, 4-dihydro-2 (IH) -quinazolinone
(Example 28)
Resolution of IV-b,c from IV-a (R4 = Cyclopropyl) .
Chiral HPLC utilizing a Chiralcel OD column, 3% isopropanol, 5% CH2CI2 and 92% hexanes at ambient temperature with a 1.0 mL/min flow rate and detection at 250 nm afforded seperation of IV-b from IV-c with enantiomeric excesses of 99% and 99.4%, respectively. IV-b: mp 106-109 °C; [α]D 25 -60.34° (c=0.274, MeOH). IV-c: mpl05-107 °C; [0t]D 25 +58.33° (c=0.288, MeOH) .
Examples 29 and 30
Preparation of (+) -4-Cyclopropylethynyl-5, 6-difluoro-
4-trifluoromethyl-3, 4-dihydro-2 (IH) -quinazolinone
(Example 29) and (-) -4-Cyclopropylethynyl-5, 6- difluoro-4-trifluoromethyl-3, 4-dihydro-2 (IH) - quinazolinone (Example 30)
Resolution of XII-b,c from Xll-a (R4 = Cyclopropyl) Chiral HPLC utilizing a Chiralpak AD column, 5% water and 95% methanol at ambient temperature with a 0.8 mL/min flow rate and detection at 250 nm afforded seperation of XII- b from XII-c with enantiomeric excesses of 100% and 99%, respectively. Xll-b: mp 187 °C; [α]D 25 +1.46° (c=0.274, MeOH) . XII-c: mp 187.5-188.8 °C; [α]D 25 -1.45° (c=0.278, MeOH) .
Examples 31 and 32
Preparation of (-) -5, 6-Dif luoro-4-isopropylethynyl-4- trif luoromethyl-3 , 4-dihydro-2 ( IH) -quinazolinone (Example 31) and (+) -5, 6-Dif luoro-4-isopropylethynyl- 4-trif luoromethyl-3 , 4-dihydro-2 ( IH) -quinazolinone (Example 32)
Resolution of XII-b,c from Xll-a (R4 = Isopropyl) .
Chiral HPLC utilizing a Chiralpak AD column, 5% water and 95% methanol at ambient temperature with a 0.5 mL/min flow rate and detection at 250 nm afforded seperation of XII- b from XII-c with enantiomeric excesses of 100% and 99%, respectively. Xll-b: mp 155 °C; [α]D 25 -2.14° (c=0.280, MeOH) . XII-c: 98 °C; [α]D 25 +4.45° (c=0.292, MeOH) .
Examples 33 and 34
Preparation of ( -) -5, 6-Dif luoro-4-ethylethynyl-4- trif luoromethyl -3,4 -dihydro- 2 (IH) -quinazolinone
(Example 33) and (+) -5, 6-Dif luoro-4-ethylethynyl-4- trif luoromethyl-3, -dihydro-2 (IH) -quinazolinone
(Example 34)
Resolution of XII-b,c from Xll-a (R4 = Ethyl).
Chiral HPLC utilizing a AS column, 20% ethanol and 80% hexanes at ambient temperature with a 1.0 mL/min flow rate and detection at 250 nm afforded seperation of Xll-b from XII-c with enantiomeric excesses of 100% and 99%, respectively. Xll-b: mp 165-167 °C . XII-c: mp 157-159 °C .
Examples 35 and 36
Preparation of 5 , 6-Dif luoro-4- (2-hydroxyethyl) ethynyl •
4 -trif luoromethyl-3, 4-dihydro-2 (IH) -quinazolinone
(Example 35) and 5, 6-Dif luoro-4- (1- hydroxyethyl) ethynyl-4-trif luoromethyl-3 , 4-dihydro-
2 (IH) -quinazolinone (Example 36)
Compound Ex. 35 CH2CH2OTBS Ex. 36 CH(OTBS)CH3
Compound Ex. 35 CH2CH2OH Ex. 36 CH(0H)CH3
To a slurry of ketimine (300 mg, 1.20 mmol) in anhyd. THF (11 mL) at -78 °C was sequentially added a precooled (0 °C) solution of the silyl protected lithium acetylide (5.40 mmol) and BF3.0Et2 (0.60 mmol) . The resulting mixture was stirred at rt overnight. The reaction was quenched by the addition of 1 M citric acid and diluted with EtOAc. The phases were separated, the organic phase was washed with water, sat. aq. NaHC03 and sat. aq. NaCl. The organic extracts were dried over MgS04, filtered and concentrated. The material was purified by regular phase HPLC chromatography (41.4 mm Rainin Dynamax® column using 60 A silica @ 25 mL/min): 2.5% MeOH/CH2Cl2 for 24 min, increase to 30% MeOH/CH2Cl2 over 4 min, 30% MeOH/CH2Cl2 for 10 min, and ramp back to 2.5% MeOH/CH2Cl2 over 2 min. The yield of the protected intermediates was 47% and 32%, respectively.
Example 35-intermediate . Mp 62.9-64 °C; XH NMR (300 MHz, acetone-d6) δ 8.98 (br s, IH) , 7.41-7.32 (m, 2H) , 6.83-
6.78 (m, IH) , 3.74 (t, J = 6.6 Hz, 2H) , 2.47 (t, J = 6.6 Hz, 2H) , 0.81 (s, 9H) , 0.00 (s, 6H) ; 19F NMR (282 MHz, acetone- dg) δ -83.17, -135.16—135.31, -148.09—148.22; MS (CI) calc'd for C19H24F5N202Si : m/z 435.152723, found 435.151149; 435 (MH+, 94), 452 (M+NH4+, 100); Analysis calc'd for Ci9H23F5N2θ2Si: C, 52.52; H, 5.35; N, 6.46; found: C, 52.65; H, 5.29; N, 6.31.
Example 36-intermediate. 1H NMR (300 MHz, acetone-dg) δ
8.96 (br s, IH) , 7.50 (br s, IH) , 7.37-7.28 (m, IH) , 6.79- 6.74 (m, IH) , 4.61 (q, J = 13.2, 6.6 Hz, IH) , 1.30 (d, J = 6.6 Hz, 3H) , 0.78 (s, 9H) , 0.01 (s, 6H) ; 19F NMR (282 MHz, acetone-dg) d -82.88—82.95, -135.20—135.42, -148.06—148.23;
MS (CI) calc'd for C19H24F5N202Si : m/z 435.152723, found 435.152927; 435 (MH+, 51), 452 (M+NH4+, 100); Analysis calc'd for Cι9H23F5N2θ2Si: C, 52.52; H, 5.35; N, 6.46; found: C, 52.54; H, 5.34; N, 6.69. To a solution of the protected intermediate for Example 35 (0.56 mmol) in THF (1.1 mL) was added TBAF (0.62 mL of 1.0 M solution in THF) . The resulting mixture was stirred at rt for 1 h, diluted with EtOAc, washed with 1 N HCl, sat. aq. NaHCθ3, and sat. aq. NaCl. The organic extract was dried over MgSθ4, filtered and concentrated. The material was purified by regular phase HPLC chromatography (41.4 mm Rainin Dynamax® column using 60 A silica @ 25 mL/min) : 2.5% MeOH/CH2Cl for 24 min, increase to 30% MeOH/CH2Cl2 over 4 min, 30% MeOH/CH2Cl2 for 10 min, and ramp back to 2.5% MeOH/CH2Cl2 over 2 min. Example 35 was isolated in 82% yield.
Example 35. Mp 190-192 °C; H NMR (300 MHz, acetone-d6) δ 9.05 (br s, IH) , 7.53 (br s, IH) , 7.45-7.36 (m, IH) , 6.88- 6.83 (m, IH) , 4.01-3.98 (m, IH) , 3.68-3.64 (m, 2H) , 2.50 (t, J = 6.6 Hz, 2H) ; 19F NMR (282 MHz, acetone-d6) δ -83.3,
-135.68—135.88, -148.10—148.22; MS (CI) calc'd for C13H10F5 2O2 : m/z 321.066244, found 321.066479; 321 (MH+, 100); Analysis calc'd for C13H9F5N2O2 : C, 48.76; H, 2.83; N, 8.76; found: C, 49.05; H, 3.23; N, 8.38.
Example 36 was synthesized in an analogous manner to deliver the title compound in 88% yield. Mp 190-191 °C; ^-H NMR (300 MHz, acetone-dg) δ 9.06 (br s, IH) , 7.56 (br s, IH) ,
7.46-7.37 (m, IH) , 6.88-6.83 (m, IH) , 4.58-4.57 (m, 2H) , 1.39 (d, J = 5.5 Hz, 3H) ; 19F NMR (282 MHz, acetone-d6) δ -83.15,
-135.40, -135.60, -148.08—148.20; MS (CI) calc'd for C13H10F5N2O2 : m/z 321.066244, found 321.065983; 321 (MH+, 58), 338 (M+NH4+, 100); Analysis calc'd for C13H9F5N2O2 : C, 48.76; H, 2.83; N, 8.76; found: C, 48.84; H, 2.76; N, 8.63.
Example 37
Preparation of (+) -4-E-Cyclopropylethenyl-5, 6- difluoro-4-trifluoromethyl-3, 4-dihydro-2 (IH) - quinazolinone
To a solution of Xll-b (200 mg, 0.632 mmol) in anhyd. THF (1.3 mL) at rt was added a solution of lithium aluminium hydride (1.3 mL of 1.0 M solution in THF) . The resulting mixture was stirred at rt overnight. The reaction was quenched by addition of 10% NaOH (3 mL) and water (3 mL) . The mixture was diluted with EtOAc (30 mL) and the phases were separated. The organic phase was washed with sat. aq. NaCl, dried over MgS04, filtered and concentrated. The title compound was purified by regular phase HPLC (41.4 mm Rainin Dynamax® column using 60 A silica): 2.5% MeOH/CH2Cl2 for 24 min, increase to 30% MeOH/CH2Cl2 over 4 min, 30% MeOH/CH2Cl2 for 10 min, and ramp back to 2.5% MeOH/CH2Cl2 over 2 min. Mp 80-83 °C; 1H NMR (300 MHz, acetone-d6) d 9.07 (br s, IH) ,
7.33 (q, J=8.8 Hz, IH) , 6.94 (br s, IH) , 6.84-6.79 (m, IH) , 6.27 (dd, J = 15.6, 7.5 Hz, IH) , 5.67 (dd, J = 15.2, 9.4 Hz, IH) , 1.65-1.56 (m, IH) , 0.80-0.71 (m, 2H) , 0.50-0.42 (m, 2H) ; 19F NMR (282 MHz, acetone-d6) d -82.68, -135.05, -148.49; MS
(CI) calc'd for C14H12F5N2O: m/z 319.086979, found 319.087755; 319 (MH+, 100); [α]D 20 +72.77° (c=0.382, MeOH); Analysis calc'd for C14H11F5N2O: C, 52.84; H, 3.48; N, 8.80; found: C, 53.02; H, 3.48; N, 8.61.
Example 38
Preparation of ( -) -6-Chloro-4-E-cyclopropylethenyl-4- trif luoromethyl-3, 4-dihydro-2 (IH) -quinazolinone
The title compound was prepared as described for Example 37 (starting from IV-b) , except that it was purified using a Chiralcel OD column at 1.5 mL/min in 0.5% EtOH/20% CH2Cl2/79.5% hexanes. Mp 87-89 °C; ^-H NMR (300 MHz, acetone- dg) d 9.08 (br s, IH) , 7.40-7.25 (m, 2H) , 7.04-6.90 (m, 2H) ,
6.28-6.18 (m, IH) , 5.64-5.52 (m, IH) , 1.68-1.55 (m, IH) , 0.83-0.71 (m, 2H) , 0.53-0.41 (m, 2H) ; 19F NMR (282 MHz, acetone-dg) d -81.67; MS (CI) calc'd for C14H13CIF3N2O: m/z 317.066851, found 317.065857; 317 (MH+, 100); [α]D 20 -6.81° (c=0.382, MeOH); Analysis calc'd for C14H12CIF3N2O . 0.27 C3HgO: C, 53.52; H, 4.13; N, 8.43; found: C, 53.90; H, 4.07; N, 8.80.
*Unless otherwise indicated, stereochemisty is (+/-) .
Table 2 *
Ex . # R3 R1 R2 R8
1 6-C1 CF3 C≡CCH2CH2OH H
2 6-C1 CF3 C≡C-CH(OH)Me H
3 6-C1 CF3 C≡C-(2-Cl)Ph H
4 6-C1 CF3 C≡C-(3-Cl)Ph H
5 6-C1 CF3 C≡C-(4-Cl)Ph H
6 6-C1 CF3 C≡C-(2-F)Ph H
7 6-C1 CF3 C≡C-(3-F)Ph H
8 6-C1 CF3 C≡C-(4-F)Ph H
9 6-C1 CF3 C≡C-(2-OH)Ph H
10 6-C1 CF3 C≡C-(3-OH)Ph
11 6-C1 CF3 C≡C-(4-OH)Ph H
12 6-C1 CF3 C≡C-(2-OMe)Ph H
13 6-C1 CF3 C≡C-(3-OMe)Ph H
14 6-C1 CF3 C≡C-(4-OMe)Ph H
15 6-C1 CF3 C≡C-(2-CN)Ph H
16 6-C1 CF3 C≡C-(3-CN)Ph H
17 6-C1 CF3 C≡C-(4-CN)Ph H
18 6-C1 CF3 C≡C-(2-N02)Ph H
19 6-C1 CF3 C≡C-(3-N02)Ph H
20 6-C1 CF3 C≡C-(4-N02)Ph H
21 6-C1 CF3 C≡C-(2-NH2)Ph H
22 6-C1 CF3 C≡C-(3-NH2)Ph H
23 6-C1 CF3 C≡C-(4-NH2)Ph
24 6-C1 CF3 C≡C-(2-NMe2)Ph H
25 6-C1 CF3 C≡C-(3-NMe2)Ph H
26 6-C1 CF3 C≡C-(4-NMe2)Ph H
27 6-C1 CF3 c≡C-3-Pyridyl
28 6-C1 CF3 c≡C-4-Pyridyl H -C1 CF3 C≡C-2 -f uranyl H -C1 CF3 C≡C-3-f uranyl H -C1 CF3 C≡C-2-thienyl H -C1 CF3 C≡C-3 -thienyl H -C1 CF3 C≡C-2 -oxazolyl H -C1 CF3 C≡C-2 -thiazolyl H -C1 CF3 C≡C-4-isoxazolyl H -C1 CF3 C≡C-2 -imidazolyl H -C1 CF3 C=CCH2CH2OH H -C1 CF3 C=C-CH(OH)Me H -C1 CF3 C=C-(2-Cl)Ph H -C1 CF3 C=C-(3-Cl)Ph H -C1 CF3 C=C-(4-Cl)Ph H -C1 CF3 C=C-(2-F)Ph H -C1 CF3 C=C-(3-F)Ph H -C1 CF3 C=C-(4-F)Ph H -C1 CF3 C=C-(2-OH)Ph H -C1 CF3 C=C-(3-OH)Ph H -C1 CF3 C=C-(4-OH)Ph H -C1 CF3 C=C-(2-OMe)Ph H -C1 CF3 C=C-(3-OMe)Ph H -C1 CF3 C=C-(4-OMe)Ph H -C1 CF3 C=C-(2-CN)Ph H -C1 CF3 C=C-(3-CN)Ph H -C1 CF3 C=C-(4-CN)Ph H -C1 CF3 C=C-(2-N02)Ph H -C1 CF3 C=C-(3-N02)Ph H -C1 CF3 C=C-(4-Nθ2)Ph H -C1 CF3 C=C-(2-NH2)Ph H -C1 CF3 C=C-(3-NH2)Ph H -C1 CF3 C=C-(4-NH2)Ph H -C1 CF3 C=C-(2-NMe2)Ph H -C1 CF3 C=C-(3-NMe2)Ph H -C1 CF3 C=C-(4-NMe2)Ph H -C1 CF3 C=C-3 -Pyridyl H -C1 CF3 C=C-4 -Pyridyl H -C1 CF3 C=C-2-f ranyl H -C1 CF3 C=C-3-f uranyl H -C1 CF3 C=C-2 -thienyl H -C1 CF3 C=C-3 -thienyl H -C1 CF3 C=C-2-oxazolyl H -C1 CF3 C=C-2-thiazolyl H -C1 CF3 C=C-4-isoxazolyl H -C1 CF3 C=C-2 -imidazolyl H -C1 CF3 CH2CH2-cycPr H -C1 CF3 CH2CH2CH2CH2OH H -C1 CF3 CH2CH2-CH(OH)Me H -C1 CF3 CH2CH2-Ph H -C1 CF3 CH2CH2-(2-Cl)Ph H -C1 CF3 CH2CH2-(3-Cl)Ph H -C1 CF3 CH2CH2-(4-Cl)Ph H -C1 CF3 CH2CH2-(2-F)Ph H -C1 CF3 CH2CH2-(3-F)Ph H -C1 CF3 CH2CH2-(4-F)Ph H -C1 CF3 CH2CH2-(2-OH)Ph H -C1 CF3 CH CH2-(3-OH)Ph H -C1 CF3 CH2CH2-(4-OH)Ph H -C1 CF3 CH2CH2-(2-OMe)Ph H -C1 CF3 CH2CH2-(3-OMe)Ph H -C1 CF3 CH2CH2- ( 4 -OMe ) Ph H -C1 CF3 CH2CH2-(2-CN)Ph H -C1 CF3 CH2CH2-(3-CN)Ph H -C1 CF3 CH2CH2-(4-CN)Ph H -C1 CF3 CH2CH2-(2-N02)Ph H -C1 CF3 CH2CH -(3-Nθ2)Ph H -C1 CF3 CH2CH2-(4-N02)Ph H -C1 CF3 CH2CH2-(2-NH2)Ph H -C1 CF3 CH2CH2-(3-NH2)Ph H 97 6-C1 CF3 CH CH2-(4-NH2)Ph H
98 6-C1 CF3 CH2CH2-(2-NMe2)Ph H
99 6-C1 CF3 CH2CH2-(3-NMe2)Ph H
100 6-C1 CF3 CH2CH2-(4-NMe2)Ph H
101 6-C1 CF3 CH2CH2 -2 -Pyridyl H
102 6-C1 CF3 CH2CH2-3 -Pyridyl H
103 6-C1 CF3 CH2CH2 - -Pyridyl H
104 6-C1 CF3 CH2CH2-2-furanyl H
105 6-C1 CF3 CH2CH2 -3 -f uranyl H
106 6-C1 CF3 CH2CH2-4-f uranyl H
107 6-C1 CF3 CH2CH2 -3 -thienyl H
108 6-C1 CF3 CH2CH2-2-oxazolyl H
109 6-C1 CF3 CH2CH2-2-thiazolyl H
110 6-C1 CF3 CH2CH2-4-isoxazolyl H
111 6-C1 CF3 CH2CH2 -2 -imidazolyl H
112 6-C1 CF3 C≡C-cycPr CH3
113 6-C1 CF3 C≡C-Ph CH3
114 6-C1 CF3 C≡C-2 -Pyridyl CH3
115 6-C1 CF3 C≡C-3 -Pyridyl CH3
116 6-C1 CF3 C≡C-4-Pyridyl CH3
117 6-C1 CF3 C≡C-2 -f uranyl CH3
118 6-C1 CF3 C≡C-3 - f uranyl CH3
119 6-C1 CF3 C≡C-2 - thienyl CH3
120 6-C1 CF3 C≡C-3 -thienyl CH3
121 6-C1 CF3 C=C-cycPr CH3
122 6-C1 CF3 C=C-Ph CH3
123 6-C1 CF3 C=C-2 -Pyridyl CH3
124 6-C1 CF3 C=C-3 -Pyridyl CH3
125 6-C1 CF3 C=C-4-Pyridyl CH3
126 6-C1 CF3 C=C-2-f uranyl CH3
127 6-C1 CF3 C=C-3-f uranyl CH3
128 6-C1 CF3 C=C-2 -thienyl CH3
129 6-C1 CF3 C=C-3 -thienyl CH3
130 6-C1 CF3 CH2CH2-cycPr CH3 131 6-C1 CF3 CH2CH2-Ph CH3
132 6-C1 CF3 CH2CH2-2-Pyridyl CH3
133 6-C1 CF3 CH2CH2-3-Pyridyl CH3
134 6-C1 CF3 CH2CH -4-Pyridyl CH3
135 6-C1 CF3 CH2CH -2-furanyl CH3
136 6-C1 CF3 CH2CH2-3-furanyl CH3
137 6-C1 CF3 CH2CH -2-thienyl CH3
138 6-C1 CF3 CH2CH2-3-thienyl CH3
139 6-C1 CF3 C≡C-cycPr CH2CH3
140 6-C1 CF3 C≡C-Ph CH2CH3
141 6-C1 CF3 C≡C-2-Pyridyl CH2CH3
142 6-C1 CF3 C≡C-3-Pyridyl CH2CH3
143 6-C1 CF3 C≡C-4-Pyridyl CH2CH3
144 6-C1 F3 C≡C-2-furanyl CH2CH3
145 6-C1 CF3 C≡C-3-furanyl CH2CH3
146 6-C1 CF3 C≡C-2-thienyl CH2CH3
147 6-C1 CF3 c≡C-3-thienyl CH2CH3
148 6-C1 CF3 C=C-cycPr CH2CH3
149 6-C1 CF3 C=C-Ph CH2CH3
150 6-C1 CF3 C=C-2-Pyridyl CH2CH3
151 6-C1 CF3 C=C-3-Pyridyl CH2CH3
152 6-C1 CF3 C=C-4-Pyridyl CH2CH3
153 6-C1 CF3 C=C-2-furanyl CH2CH3
154 6-C1 CF3 C=C-3-furanyl CH2CH3
155 6-C1 CF3 C=C-2-thienyl CH2CH3
156 6-C1 CF3 C=C-3-thienyl CH2CH3
157 6-C1 CF3 CH2CH2-cycPr CH2CH3
158 6-C1 CF3 CH2CH2-Ph CH2CH3
159 6-C1 CF3 CH2CH2-2-Pyridyl CH2CH3
160 6-C1 CF3 CHCH2-3-Pyridyl CH2CH3
161 6-C1 CF3 CH2CH2-4-Pyridyl CH2CH3
162 6-C1 CF3 CH2CH2-2-furanyl CH2CH3
163 6-C1 CF3 CH2CH2-3-furanyl CH2CH3
164 6-C1 CF3 CH2CH2-2-thienyl CH2CH3 165 6-C1 CF3 CH2CH2-3-thieny1 CH2CH3
166 6-MeO CF3 C≡CCH2CH2OH H
167 6-MeO CF3 C≡C-CH(OH)Me H
168 6-MeO CF3 C≡C-(2-Cl)Ph H
169 6-MeO CF3 C≡C-(3-Cl)Ph H
170 6-MeO CF3 C≡C-(4-Cl)Ph H
171 6-MeO CF3 C≡C-(2-F)Ph H
172 6-MeO CF3 C≡C-(3-F)Ph H
173 6-MeO CF3 C≡C-(4-F)Ph H
174 6-MeO CF3 C≡C-(2-OH)Ph H
175 6-MeO CF3 C≡C-(3-OH)Ph H
176 6-MeO CF3 C≡C-(4-OH)Ph H
177 6-MeO CF3 C≡C-(2-OMe)Ph H
178 6-MeO CF3 C≡C-(3-OMe)Ph H
179 6-MeO CF3 C≡C-(4-OMe)Ph H
180 6-MeO CF3 C≡C-(2-CN)Ph H
181 6-MeO CF3 C≡C-(3-CN)Ph H
182 6-MeO CF3 C≡C-(4-CN)Ph H
183 6-MeO CF3 C≡C-(2-N02)Ph H
184 6-MeO CF3 C≡C-(3-N02)Ph H
185 6-MeO CF3 C≡C-(4-N02)Ph H
186 6-MeO CF3 C≡C-(2-NH2)Ph H
187 6-MeO CF3 C≡C-(3-NH2)Ph H
188 6-MeO CF3 C≡C-(4-NH2)Ph H
189 6-MeO CF3 C≡C-(2-NMe2)Ph H
190 6-MeO CF3 C≡C- (3-NMe2) Ph H
191 6-MeO CF3 C≡C-(4-NMe2)Ph H
192 6-MeO CF3 C≡C-3-Pyridyl H
193 6-MeO CF3 C≡C-4-Pyridyl H
194 6-MeO CF3 C≡C-2-furanyl H
195 6-MeO CF3 C≡C-3-furany1 H
196 6-MeO CF3 C≡C-2-thienyl H
197 6-MeO CF3 C≡C-3-thienyl H
198 6-MeO CF3 C≡C-2-oxazolyl H 199 6-MeO CF3 C≡C-2 -thiazolyl H
200 6-MeO CF3 C≡C-4-isoxazolyl H
201 6-MeO CF3 C≡C-2 -imidazolyl H
202 6-MeO CF3 C=CCH2CH2OH H
203 6-MeO CF3 C=C-CH(OH)Me H
204 6-MeO CF3 C=C-(2-Cl)Ph H
205 6-MeO CF3 C=C-(3-Cl)Ph H
206 6-MeO CF3 C=C-(4-Cl)Ph H
207 6-MeO CF3 C=C-(2-F)Ph H
208 6-MeO CF3 C=C-(3-F)Ph H
209 6-MeO CF3 C=C-(4-F)Ph H
210 6-MeO CF3 C=C-(2-OH)Ph H
211 6-MeO CF3 C=C-(3-OH)Ph H
212 6-MeO CF3 C=C-(4-OH)Ph H
213 6-MeO CF3 C=C-(2-OMe)Ph H
214 6-MeO CF3 C=C-(3-OMe)Ph H
215 6-MeO CF3 C=C-(4-OMe)Ph H
216 6-MeO CF3 C=C-(2-CN)Ph H
217 6-MeO CF3 C=C-(3-CN)Ph H
218 6-MeO CF3 C=C-(4-CN)Ph H
219 6-MeO CF3 C=C-(2-N02)Ph H
220 6-MeO CF3 C=C-(3-N02)Ph H
221 6-MeO CF3 C=C-(4-N02)Ph H
222 6-MeO CF3 C=C-(2-NH2)Ph H
223 6-MeO CF3 C=C-(3-NH2)Ph H
224 6-MeO CF3 C=C-(4-NH2)Ph H
225 6-MeO CF3 C=C-(2-NMe2)Ph H
226 6-MeO CF3 C=C-(3-NMe2)Ph H
227 6-MeO CF3 C=C-(4-NMe2)Ph H
228 6-MeO CF3 C=C-3 -Pyridyl H
229 6-MeO CF3 C=C-4 -Pyridyl H
230 6-MeO CF3 C=C-2-f uranyl H
231 6-MeO CF3 C=C-3-f uranyl H
232 6-MeO CF3 C=C-2 -thienyl H 233 6-MeO CF3 C=C-3- thienyl H
234 6-MeO CF3 C=C-2 -oxazolyl H
235 6-MeO CF3 C=C-2-thiazolyl H
236 6-MeO CF3 C=C-4-isoxazolyl H
237 6-MeO CF3 C=C-2 -imidazolyl H
238 6-MeO CF3 CH2CH2-cycPr H
239 6-MeO CF3 CH2CH2CH2CH2OH H
240 6-MeO CF3 CH2CH2-CH(OH)Me H
241 6-MeO CF3 CH2CH2-Ph H
242 6-MeO CF3 CH2CH2-(2-Cl)Ph H
243 6-MeO CF3 CH2CH2-(3-Cl)Ph H
244 6-MeO CF3 CH2CH2-(4-Cl)Ph H
245 6-MeO CF3 CH2CH2-(2-F)Ph H
246 6-MeO CF3 CH2CH2-(3-F)Ph H
247 6-MeO CF3 CH2CH2-(4-F)Ph H
248 6-MeO CF3 CH2CH -(2-OH)Ph H
249 6-MeO CF3 CH CH2-(3-OH)Ph H
250 6-MeO CF3 CH2CH2-(4-OH)Ph H
251 6-MeO CF3 CH2CH2-(2-OMe)Ph H
252 6-MeO CF3 CH2CH2-(3-OMe)Ph H
253 6-MeO CF3 CH2CH2-(4-OMe)Ph H
254 6-MeO CF3 CH2CH2-(2-CN)Ph H
255 6-MeO CF3 CH2CH2-(3-CN)Ph H
256 6-MeO CF3 CH2CH2-(4-CN)Ph H
257 6-MeO CF3 CH CH2-(2-N02)Ph H
258 6-MeO CF3 CH2CH2-(3-N02)Ph H
259 6-MeO CF3 CH2CH2-(4-N02)Ph H
260 6-MeO CF3 CH2CH2-(2-NH2)Ph H
261 6-MeO CF3 CH2CH2-(3-NH2)Ph H
262 6-MeO CF3 CH2CH2-(4-NH2)Ph H
263 6-MeO CF3 CH2CH2-(2-NMe2)Ph H
264 6-MeO CF3 CH2CH2-(3-NMe2)Ph H
265 6-MeO CF3 CH CH2- ( 4-NMe2 ) Ph H
266 6-MeO CF3 CH2CH2-2 -Pyridyl H 267 6 -MeO CF3 CH2CH2 -3 -Pyridyl H
268 6-MeO CF3 CH CH2 -4 -Pyridyl H
269 6 -MeO CF3 CH2CH2 -2 - f uranyl H
270 6-MeO CF3 CH2CH2 -3 - f uranyl H
271 6-MeO CF3 CH2CH2-4 -furanyl H
272 6-MeO CF3 CH2CH2 -3 -thienyl H
273 6-MeO CF3 CH2CH2-2 -oxazolyl H
274 6-MeO CF3 CH2CH2-2 -thiazolyl H
275 6-MeO CF3 CH2CH2-4 -isoxazolyl H
276 6-MeO CF3 CH2CH2-2 -imidazolyl H
277 6-MeO CF3 C≡C-cycPr CH3
278 6 -MeO CF3 C≡C-Ph CH3
279 6 -MeO CF3 C≡C-2 -Pyridyl CH3
280 6 -MeO CF3 C≡C-3 -Pyridyl CH3
281 6-MeO CF3 C≡C-4-Pyridyl CH3
282 6-MeO CF3 C≡C-2 - f uranyl CH3
283 6-MeO CF3 C≡C-3 - f uranyl CH3
284 6-MeO CF3 C≡C-2 -thienyl CH3
285 6-MeO CF3 C≡C-3 -thienyl CH3
286 6-MeO CF3 C=C-cycPr CH3
287 6-MeO CF3 C=C-Ph CH3
288 6-MeO CF3 C=C-2 -Pyridyl CH3
289 6-MeO CF3 C=C-3 -Pyridyl CH3
290 6-MeO CF3 C=C-4 -Pyridyl CH3
291 6-MeO CF3 C=C-2-f uranyl CH3
292 6-MeO CF3 C=C-3 -f uranyl CH3
293 6-MeO CF3 C=C-2 - thienyl CH3
294 6-MeO CF3 C=C-3 -thienyl CH3
295 6-MeO CF3 CH2CH2-cycPr CH3
296 6-MeO CF3 CH2CH2-Ph CH3
297 6-MeO CF3 CH2CH2 -2 -Pyridyl CH3
298 6-MeO CF3 CH2CH2-3 -Pyridyl CH3
299 6-MeO CF3 CH2CH2-4-Pyridyl CH3
300 6-MeO CF3 CH2CH2 -2 - fur any 1 CH3 LO LO LO LO LO OJ LO 00 u> LO J LO LO J J LO LO LO 0J LO 0J OJ LO LO LO LO LO LO LO OJ LO 0J 0J LO
OJ J J LO LO to to to to to to to to to to t-» F> I-1 H P» O O o o o o o O o ιP- LO to H O VO 00 -J cn LΠ ιP- LO to O VO 00 ^J cn LΠ OJ tO P» VO 00 o σi LΠ ιP- LO to P1
o O O O O O O o o o o o
HJ o HJ o hc oc o o o O O O O O O O O O O O
HJ HJ HI HJ HJ HJ HJ HJ HJ HJ H] HJ HJ HJ HJ HJ H| HJ HJ HJ HJ HJ HJ H] HJ HJ HJ HJ HJ HJ
335 5,6-diF CF3 C≡C-(3-F)Ph H
336 5,6-diF CF3 C≡C-(4-F)Ph H
337 5,6-diF CF3 C≡C-(2-OH)Ph H
338 5,6-diF CF3 C≡C-(3-OH)Ph H
339 5,6-diF CF3 C≡C-(4-OH)Ph H
340 5,6-diF CF3 C≡C-(2-OMe)Ph H
341 5,6-diF CF3 C≡C-(3-OMe)Ph H
342 5,6-diF CF3 C≡C-(4-OMe)Ph H
343 5,6-diF CF3 C≡C-(2-CN)Ph H
344 5,6-diF CF3 C≡C-(3-CN)Ph H
345 5,6-diF CF3 C≡C-(4-CN)Ph H
346 5,6-diF CF3 C≡C-(2-N02)Ph H
347 5,6-diF CF3 C≡C-(3-N02)Ph H
348 5,6-diF CF3 C≡C-(4-N0 )Ph H
349 5,6-diF CF3 C≡C-(2-NH2)Ph H
350 5,6-diF CF3 C≡C-(3-NH2)Ph H
351 5,6-diF CF3 C≡C-(4-NH2)Ph H
352 5,6-diF CF3 C≡C-(2-NMe2)Ph H
353 5,6-diF CF3 C-≡C- ( 3 -NMe2 ) Ph H
354 5,6-diF CF3 C≡C-(4-NMe2)Ph H
355 5,6-diF CF3 C≡C-3 -Pyridyl H
356 5,6-diF CF3 G≡C-4-Pyridyl H
357 5,6-diF CF3 C-≡C-2-f uranyl H
358 5,6-diF CF3 C≡C-3 -f uranyl H
359 5,6-diF CF3 C≡C-2 -thienyl H
360 5,6-diF CF3 C≡C-3 -thienyl H
361 5,6-diF CF3 C≡C-2 -oxazolyl H
362 5,6-diF CF3 C≡C-2-thiazolyl H
363 5,6-diF CF3 C≡C-4-isoxazolyl H
364 5,6-diF CF3 C≡C-2 -imidazolyl H
365 5,6-diF CF3 C=C-(2-Cl)Ph H
366 5,6-diF CF3 C=C-(3-Cl)Ph H
367 5,6-diF CF3 C=C-(4-Cl)Ph H
368 5,6-diF CF3 C=C-(2-F)Ph H 369 5,6-diF CF3 C=C-(3-F)Ph H
370 5,6-diF CF3 C=C-(4-F)Ph H
371 5,6-diF CF3 C=C-(2-OH)Ph H
372 5,6-diF CF3 C=C-(3-OH)Ph H
373 5,6-diF CF3 C=C-(4-OH)Ph H
374 5,6-diF CF3 C=C-(2-OMe)Ph H
375 5,6-diF CF3 C=C-(3-OMe)Ph H
376 5,6-diF CF3 C=C-(4-OMe)Ph H
377 5,6-diF CF3 C=C-(2-CN)Ph H
378 5,6-diF CF3 C=C-(3-CN)Ph H
379 5,6-diF CF3 C=C-(4-CN)Ph H
380 5,6-diF CF3 C=C-(2-N02)Ph H
381 5,6-diF CF3 C=C-(3-N02)Ph H
382 5,6-diF CF3 C=C-(4-N02)Ph H
383 5,6-diF CF3 C=C-(2-NH2)Ph H
384 5,6-diF CF3 C=C-(3-NH2)Ph H
385 5,6-diF CF3 C=C-(4-NH2)Ph H
386 5,6-diF CF3 C=C-(2-NMe2)Ph H
387 5,6-diF CF3 C=C-(3-NMe2)Ph H
388 5,6-diF CF3 C=C-(4-NMe2)Ph H
389 5,6-diF CF3 C=C-3 -Pyridyl H
390 5,6-diF CF3 C=C-4 -Pyridyl H
391 5,6-diF CF3 C=C-2 - f uranyl H
392 5,6-diF CF3 C=C -3 -f uranyl H
393 5,6-diF CF3 C=C-2 -thienyl H
394 5,6-diF CF3 C=C-3 -thienyl H
395 5,6-diF CF3 C=C-2 -oxazolyl H
396 5,6-diF CF3 C=C-2-thiazolyl H
397 5,6-diF CF3 C=C-4-isoxazolyl H
398 5,6-diF CF3 C=C-2 -imidazolyl H
399 5,6-diF CF3 CH2CH2-cycPr H
400 5,6-diF CF3 CH2CH2CH2CH2OH H
401 5,6-diF CF3 CH2CH2-CH(OH)Me H
402 5,6-diF CF3 CH2CH2-Ph H 403 5, 6-diF CF3 CH CH2-(2-Cl)Ph H
404 5,6-diF CF3 CH2CH2-(3-Cl)Ph H
405 5,6-diF CF3 CH2CH2-(4-Cl)Ph H
406 5,6-diF CF CH2CH2-(2-F)Ph H
407 5,6-diF CF3 CH2CH2-(3-F)Ph H
408 5,6-diF CF3 CH2CH2-(4-F)Ph H
409 5,6-diF CF3 CH2CH2-(2-OH)Ph H
410 5,6-diF CF3 CH2CH2-(3-OH)Ph H
411 5,6-diF CF3 CH2CH2-(4-OH)Ph H
412 5,6-diF CF3 CH CH2-(2-OMe)Ph H
413 5,6-diF CF3 CH2CH2-(3-OMe)Ph H
414 5,6-diF CF3 CH2CH2-(4-OMe)Ph H
415 5,6-diF CF3 CH CH2-(2-CN)Ph H
416 5,6-diF CF3 CH2CH2-(3-CN)Ph H
417 5,6-diF CF3 CH2CH2-(4-CN)Ph H
418 5,6-diF CF3 CH2CH2-(2-N02)Ph H
419 5,6-diF CF3 CH2CH2-(3-N02)Ph H
420 5,6-diF CF3 CH2CH2-(4-N02)Ph H
421 5,6-diF CF3 CH2CH2-(2-NH2)Ph H
422 5,6-diF CF3 CH2CH2-(3-NH2)Ph H
423 5,6-diF CF3 CH2CH2-(4-NH2)Ph H
424 5,6-diF CF3 CH2CH - ( 2 -NMe2 ) Ph H
425 5,6-diF CF3 CH2CH2-(3-NMe2)Ph H
426 5,6-diF CF3 CH2CH2-(4-NMe2)Ph H
427 5,6-diF CF3 CH2CH2 -2 -Pyridyl H
428 5,6-diF CF3 CH2CH2-3 -Pyridyl H
429 5,6-diF CF3 CH2CH2 -4 -Pyridyl H
430 5,6-diF CF3 CH2CH2 -2 -f uranyl H
431 5,6-diF CF3 CH2CH2 -3 -f uranyl H
432 5,6-diF CF3 CH2CH2-2-thienyl H
433 5,6-diF CF3 CH CH2 -3 -thienyl H
434 5,6-diF CF3 CH2CH2-2 -oxazolyl H
435 5,6-diF CF3 CH2CH -2-thiazolyl H
436 5,6-diF CF3 CH2CH2-4-isoxazolyl H 437 5,6-diF CF3 CH CH2-2 -imidazolyl H
438 5,6-diF CF3 C≡C-cycPr CH3
439 5,6-diF CF3 C≡C-2 -Pyridyl CH3
440 5,6-diF CF3 C≡C-3 -Pyridyl CH3
441 5,6-diF CF3 C≡C-4-Pyridyl CH3
442 5,6-diF CF3 C≡C-2 - fur any 1 CH3
443 5,6-diF CF3 C≡C-3 - f uranyl CH3
444 5,6-diF CF3 C≡C-2 -thienyl CH3
445 5,6-diF CF3 C≡C-3 -thienyl CH3
446 5,6-diF CF3 C=C-cycPr CH3
447 5,6-diF CF3 C=C-2 -Pyridyl CH3
448 5,6-diF CF3 C=C-3 -Pyridyl CH3
449 5,6-diF CF3 C=C-4 -Pyridyl CH3
450 5,6-diF CF3 C=C-2-f uranyl CH3
451 5,6-diF CF3 C=C-3-f uranyl CH3
452 5,6-diF CF3 C=C-2 -thienyl CH3
453 5,6-diF CF3 C=C-3 -thienyl CH3
454 5,6-diF CF3 CH2CH2-cycPr CH3
455 5,6-diF CF3 CH2CH2-Ph CH3
456 5,6-diF CF3 CH2CH2-2 -Pyridyl CH3
457 5,6-diF CF3 CH2CH2-3 -Pyridyl CH3
458 5,6-diF CF3 CH2CH2-4-Pyridyl CH3
459 5,6-diF CF3 CH2CH2 -2 - f uranyl CH3
460 5,6-diF CF3 CH2CH2 -3 - f uranyl CH3
461 5,6-diF CF3 CH2CH2-2 -thienyl CH3
462 5,6-diF CF3 CH2CH2-3 -thienyl CH3
463 5,6-diF CF3 C≡C-cycPr CH2CH3
464 5,6-diF CF3 C≡C-Ph CH2CH3
465 5,6-diF CF3 C≡C-2 -Pyridyl CH2CH3
466 5,6-diF CF3 C≡C-3 -Pyridyl CH2CH3
467 5,6-diF CF3 C≡C-4-Pyridyl CH2CH3
468 5,6-diF CF3 C≡C-2 -f uranyl CH2CH3
469 5,6-diF CF3 C≡C-3 -f uranyl CH2CH3
470 5,6-diF CF3 C≡C-2 -thienyl CH2CH3 471 5,6-diF CF3 C≡C-3-thienyl CH2CH3
472 5,6-diF CF3 C=C-cycPr CH2CH3
473 5,6-diF CF3 C=C-Ph CH2CH3
474 5,6-diF CF3 C=C-2-Pyridyl CH2CH3
475 5,6-diF CF3 C=C-3-Pyridyl CH2CH3
476 5,6-diF CF3 C=C-4-Pyridyl CH2CH3
477 5,6-diF CF3 C=C-2-furanyl CH2CH3
478 5,6-diF CF3 C=C-3-furanyl CH2CH3
479 5,6-diF CF3 C=C-2-thienyl CH2CH3
480 5,6-diF CF3 C=C-3-thienyl CH2CH3
481 5,6-diF CF3 CH2CH2-cycPr CH2CH3
482 5,6-diF CF3 CH2CH2-Ph CH2CH3
483 5,6-diF CF3 CH2CH2-2-Pyridyl CH2CH3
484 5,6-diF CF3 CH2CH2-3-Pyridyl CH2CH3
485 5,6-diF CF3 CH2CH2-4-Pyridyl CH2CH3
486 5,6-diF CF3 CH2CH2-2-furanyl CH2CH3
487 5,6-diF CF3 CH2CH2-3-furanyl CH2CH3
488 5,6-diF CF3 CH2CH2-2-thienyl CH2CH3
489 5,6-diF CF3 CH2CH2-3-thienyl CH2CH3
490 5,6-diCl CF3 C≡C-(2-Cl)Ph H
491 5,6-diCl CF3 C≡C-(3-Cl)Ph H
492 5,6-diCl CF3 C≡C-(4-Cl)Ph H
493 5,6-diCl CF3 C≡C-(2-F)Ph H
494 5,6-diCl CF3 C≡C-(3-F)Ph H
495 5,6-diCl CF3 C≡C-(4-F)Ph H
496 5,6-diCl CF3 C≡C-(2-OH)Ph H
497 5,6-diCl CF3 C≡C-(3-OH)Ph H
498 5,6-diCl CF3 C≡C-(4-OH)Ph H
499 5,6-diCl CF3 C≡C-(2-OMe)Ph H
500 5,6-diCl CF3 C≡C-(3-OMe)Ph H
501 5,6-diCl CF3 C≡C-(4-OMe)Ph H
502 5,6-diCl CF3 C≡C-(2-CN)Ph H
503 5,6-diCl CF3 C≡C-(3-CN)Ph H
504 5,6-diCl CF3 C≡C-(4-CN)Ph H 505 5, 6-diCl CF3 C≡C-(2-N02)Ph H
506 5, 6-diCl CF3 C≡C-(3-N02)Ph H
507 5, 6-diCl CF3 C≡C-(4-N02)Ph H
508 5, 6-diCl CF3 C≡C-(2-NH2)Ph H
509 5, 6-diCl CF3 C≡C-(3-NH2)Ph H
510 5, 6-diCl CF3 C≡C-(4-NH2)Ph H
511 5, 6-diCl CF3 C≡C- ( 2 -NMe2 ) Ph H
512 5, 6-diCl CF3 C≡C- ( 3 -NMe2 ) Ph H
513 5, 6-diCl CF3 C≡C-(4-NMe2)Ph H
514 5 6-diCl CF3 C≡C-3 -Pyridyl H
515 5 6-diCl CF3 C≡C- A- Pyridyl H
516 5 6-diCl CF3 C≡C-2 -f uranyl H
517 5 6-diCl CF3 C≡C-3 - uranyl H
518 5 6-diCl CF3 C≡C-2 -thienyl H
519 5 6-diCl CF3 C≡C-3 -thienyl H
520 5 6-diCl CF3 C≡C-2 -oxazolyl H
521 5 6-diCl CF3 C≡C-2 -thiazolyl H
522 5 6-diCl CF3 C≡C-4-isoxazolyl H
523 5 6-diCl CF3 C≡C-2 -imidazolyl H
524 5 6-diCl CF3 C=C-(2-Cl)Ph H
525 5 6-diCl CF3 C=C-(3-Cl)Ph H
526 5 6-diCl CF3 C=C-(4-Cl)Ph H
527 5 , 6-diCl CF3 C=C-(2-F)Ph H
528 5 , 6-diCl CF3 C=C-(3-F)Ph H
529 5 , 6-diCl CF3 C=C-(4-F)Ph H
530 5 , 6-diCl CF3 C=C-(2-OH)Ph H
531 5 , 6-diCl CF3 C=C-(3-OH)Ph H
532 5 , 6-diCl CF3 C=C-(4-OH)Ph H
533 5 , 6-diCl CF3 C=C-(2-OMe)Ph H
534 5 , 6-diCl CF3 C=C-(3-OMe)Ph H
535 5 , 6-diCl CF3 C=C-(4-OMe)Ph H
536 5 , 6-diCl CF3 C=C-(2-CN)Ph H
537 5 , 6-diCl CF3 C=C-(3-CN)Ph H
538 5 , 6-diCl CF3 C=C-(4-CN)Ph H 539 5,6-diCl CF3 C=C-(2-N02)Ph H
540 5,6-diCl CF3 C=C-(3-N02)Ph H
541 5,6-diCl CF3 C=C-(4-N02)Ph H
542 5,6-diCl CF3 C=C-(2-NH2)Ph H
543 5,6-diCl CF3 C=C-(3-NH2)Ph H
544 5,6-diCl CF3 C=C-(4-NH2)Ph H
545 5,6-diCl CF3 C=C-(2-NMe2)Ph H
546 5,6-diCl CF3 C=C-(3-NMe2)Ph H
547 5,6-diCl CF3 C=C-(4-NMe2)Ph H
548 5,6-diCl CF3 C=C-3 -Pyridyl H
549 5,6-diCl CF3 C=C-4- Pyridyl H
550 5,6-diCl CF3 C=C-2-f uranyl H
551 5,6-diCl CF3 C=C-3-f uranyl H
552 5,6-diCl CF3 C=C-2 -thienyl H
553 5,6-diCl CF3 C=C-3 -thienyl H
554 5,6-diCl CF3 C=C-2 -oxazolyl H
555 5,6-diCl CF3 C=C-2-thiazolyl H
556 5,6-diCl CF3 C=C-4-isoxazolyl H
557 5,6-diCl CF3 C=C-2- imidazolyl H
558 5,6-diCl CF3 CH2CH2-cycPr H
559 5,6-diCl CF3 CH2CH2CH2CH2OH H
560 5,6-diCl CF3 CH2CH2-CH(OH)Me H
561 5,6-diCl CF3 CH2CH2-Ph H
562 5,6-diCl CF3 CH2CH2-(2-Cl)Ph H
563 5,6-diCl CF3 CH2CH2-(3-Cl)Ph H
564 5,6-diCl CF3 CH2CH2-(4-Cl)Ph H
565 5,6-diCl CF3 CH2CH2-(2-F)Ph H
566 5,6-diCl CF3 CH2CH2-(3-F)Ph H
567 5,6-diCl CF3 CH2CH2-(4-F)Ph H
568 5,6-diCl CF3 CH2CH2-(2-OH)Ph H
569 5,6-diCl CF3 CH2CH2-(3-OH)Ph H
570 5,6-diCl CF3 CH2CH2-(4-OH)Ph H
571 5,6-diCl CF3 CH2CH2-(2-OMe)Ph H
572 5,6-diCl CF3 CH2CH2-(3-OMe)Ph H 573 5,6-diCl CF3 CH2CH - (4-OMe) Ph H
574 5,6-diCl CF3 CH2CH2-(2-CN)Ph H
575 5,6-diCl CF3 CH2CH2-(3-CN)Ph H
576 5,6-diCl CF3 CH2CH2-(4-CN)Ph H
577 5,6-diCl CF3 CH CH2-(2-N02)Ph H
578 5,6-diCl CF3 CH2CH2-(3-N02)Ph H
579 5,6-diCl CF3 CH2CH2-(4-N02)Ph H
580 5,6-diCl CF3 CH2CH2-(2-NH2)Ph H
581 5,6-diCl CF3 CH2CH2-(3-NH2)Ph H
582 5,6-diCl CF3 CH2CH2-(4-NH2)Ph H
583 5,6-diCl CF3 CH2CH2 - ( 2 -NMe2 ) Ph H
584 5,6-diCl CF3 CH2CH2 - ( 3 -NMe2 ) Ph H
585 5,6-diCl CF3 CH2CH2-(4-NMe2)Ph H
586 5,6-diCl CF3 CH2CH2-2-Pyridyl H
587 5,6-diCl CF3 CH2CH2-3-Pyridyl H
588 5,6-diCl CF3 CH2CH -4-Pyridyl H
589 5,6-diCl CF3 CH2CH2-2-furanyl H
590 5,6-diCl CF3 CH2CH2-3-furanyl H
591 5,6-diCl CF3 CH2CH2-2-thienyl H
592 5,6-diCl CF3 CH2CH2-3-thienyl H
593 5,6-diCl CF3 CH2CH2-2-oxazolyl H
594 5,6-diCl CF3 CH2CH-2-thiazolyl H
595 5,6-diCl CF3 CH2CH2-4-isoxazolyl H
596 5,6-diCl CF3 CH2CH2-2-imidazolyl H
597 5,6-diCl CF3 C≡C-cycPr H3
598 5,6-diCl CF3 C≡C-2-Pyridyl 3
599 5,6-diCl CF3 C≡C-3-Pyridyl CH3
600 5,6-diCl CF3 C≡C-4-Pyridyl H3
601 5,6-diCl CF3 C≡C-2-furanyl CH3
602 5,6-diCl CF3 C≡C-3-furanyl CH3
603 5,6-diCl CF3 C≡C-2-thienyl CH3
604 5,6-diCl CF3 C≡C-3-thienyl CH3
605 5,6-diCl CF3 C=C-cycPr CH3
606 5,6-diCl CF3 C=C-2-Pyridyl CH3 607 5,6-diCl CF3 C=C-3-Pyridyl CH3
608 5,6-diCl CF3 C=C-4-Pyridyl CH3
609 5,6-diCl CF3 C=C-2-furanyl CH3
610 5,6-diCl CF3 C=C-3-furanyl CH3
611 5,6-diCl CF3 C=C-2-thienyl CH3
612 5,6-diCl CF3 C=C-3-thienyl CH3
613 5,6-diCl CF3 CH2CH2-cycPr CH3
614 5,6-diCl CF3 CH2CH2-Ph CH3
615 5,6-diCl CF3 CH2CH2-2-Pyridyl CH3
616 5,6-diCl CF3 CH2CH2-3-Pyridyl CH3
617 5,6-diCl CF3 CH2CH2-4-Pyridyl CH3
618 5,6-diCl CF3 CH2CH2-2-furanyl CH3
619 5,6-diCl CF3 CHCH2-3-furanyl CH3
620 5,6-diCl CF3 CH2CH2-2-thienyl CH3
621 5,6-diCl CF3 CH2CH2-3-thienyl CH3
622 5,6-diCl CF3 C≡C-cycPr CH2CH3
623 5,6-diCl CF3 C≡C-Ph CH2CH3
624 5,6-diCl CF3 C≡C-2-Pyridyl CH2CH3
625 5,6-diCl CF3 C≡C-3-Pyridyl CH2CH3
626 5,6-diCl CF3 C≡C-4-Pyridyl CH2CH3
627 5,6-diCl CF3 C≡C-2-furanyl CH2CH3
628 5,6-diCl CF3 C≡C-3-furanyl CH2CH3
629 5,6-diCl CF3 C≡C-2-thienyl CH2CH3
630 5,6-diCl CF3 C≡C-3-thienyl CH2CH3
631 5,6-diCl CF3 C=C-cycPr CH2CH3
632 5,6-diCl CF3 C=C-Ph CH2CH3
633 5,6-diCl CF3 C=C-2-Pyridyl CH2CH3
634 5,6-diCl CF3 C=C-3-Pyridyl CH2CH3
635 5,6-diCl CF3 C=C-4-Pyridyl CH2CH3
636 5,6-diCl CF3 C=C-2-furanyl CH2CH3
637 5,6-diCl CF3 C=C-3-furanyl CH2CH3
638 5,6-diCl CF3 C=C-2-thienyl CH2CH3
639 5,6-diCl CF3 C=C-3-thienyl CH2CH3
640 5,6-diCl CF3 CH2CH2-cycPr CH2CH3 641 5,6-diCl CF3 CH2CH2-Ph CH2CH3
642 5,6-diCl CF3 CH2CH2-2 -Pyridyl CH2CH3
643 5,6-diCl CF3 CH2CH2-3 -Pyridyl CH2CH3
644 5,6-diCl CF3 CH2CH2-4-Pyridyl CH CH3
645 5,6-diCl CF3 CH2CH2-2-furanyl CH2CH3
646 5,6-diCl CF3 CH2CH2-3 -furanyl CH2CH3
647 5,6-diCl CF3 CH CH2-2 -thienyl CH2CH3
648 5,6-diCl CF3 CH2CH2-3 -thienyl CH2CH3
649 6-F CF3 C≡CCH2CH2OH H
650 6-F CF3 C≡C-CH(OH)Me H
651 6-F CF3 C≡C-(2-Cl)Ph H
652 6-F CF3 C≡C-(3-Cl)Ph H
653 6-F CF3 C=c-(4-Cl)Ph H
654 6-F CF3 C≡C-(2-F)Ph H
655 6-F CF3 C≡C-(3-F)Ph H
656 6-F CF3 C≡C-(4-F)Ph H
657 6-F CF3 C≡C-(2-OH)Ph H
658 6-F CF3 C-≡C-(3-OH)Ph H
659 6-F CF3 C≡C- (4-OH) Ph H
660 6-F CF3 C≡C-(2-OMe)Ph H
661 6-F CF3 C≡C-(3-OMe)Ph H
662 6-F CF3 C≡C-(4-OMe)Ph H
663 6-F CF3 C≡C-(2-CN)Ph H
664 6-F CF3 C≡C-(3-CN)Ph H
665 6-F CF3 C≡C-(4-CN)Ph H
666 6-F CF3 C≡C-(2-N02)Ph H
667 6-F CF3 C≡C-(3-N02)Ph H
668 6-F CF3 C≡C-(4-N02)Ph H
669 6-F CF3 C≡C-(2-NH2)Ph H
670 6-F CF3 C≡C-(3-NH2)Ph H
671 6-F CF3 C≡C-(4-NH2)Ph H
672 6-F CF3 C≡C-(2-NMe2)Ph H
673 6-F CF3 C≡C- ( 3-NMe )Ph H
674 6-F CF3 C≡C-(4-NMe2)Ph H 675 6-F CF3 C≡C-3 -Pyridyl H
676 6-F CF3 C≡C-4 -Pyridyl H
677 6-F CF3 C≡C-2 -f uranyl H
678 6-F CF3 C≡C-3 -f uranyl H
679 6-F CF3 C≡C-2 -thienyl H
680 6-F CF3 C≡C-3 -thienyl H
681 6-F CF3 C≡C-2 -oxazolyl H
682 6-F CF3 C≡C-2 -thiazolyl H
683 6-F CF3 C≡C-4-isoxazolyl H
684 6-F CF3 C≡C-2 -imidazolyl H
685 6-F CF3 C=CCH2CH2OH H
686 6-F CF3 C=C-CH(0H)Me H
687 6-F CF3 C=C-(2-Cl)Ph H
688 6-F CF3 C=C-(3-Cl)Ph H
689 6-F CF3 C=C-(4-Cl)Ph H
690 6-F CF3 C=C-(2-F)Ph H
691 6-F CF3 C=C-(3-F)Ph H
692 6-F CF3 C=C-(4-F)Ph H
693 6-F CF3 C=C-(2-OH)Ph H
694 6-F CF3 C=C-(3-OH)Ph H
695 6-F CF3 C=C-(4-0H)Ph H
696 6-F CF3 C=C-(2-OMe)Ph H
697 6-F CF3 C=C-(3-OMe)Ph H
698 6-F CF3 C=C-(4-OMe)Ph H
699 6-F CF3 C=C-(2-CN)Ph H
700 6-F CF3 C=C-(3-CN)Ph H
701 6-F CF3 C=C-(4-CN)Ph H
702 6-F CF3 C=C-(2-N02)Ph H
703 6-F CF3 C=C-(3-N02)Ph H
704 6-F CF3 C=C-(4-N02)Ph H
705 6-F CF3 C=C-(2-NH2)Ph H
706 6-F CF3 C=C-(3-NH2)Ph H
707 6-F CF3 C=C-(4-NH2)Ph H
708 6-F CF3 C=C-(2-NMe2)Ph H 709 6-F CF3 C=C- ( 3 -NMe ) Ph H
710 6-F CF3 C=C-(4-NMe2)Ph H
711 6-F CF3 C=C-3 -Pyridyl H
712 6-F CF3 C=C-4 -Pyridyl H
713 6-F CF3 C=C-2-f uranyl H
714 6-F CF3 C=C-3-f uranyl H
715 6-F CF3 C=C-2 -thienyl H
716 6-F CF3 C=C-3 -thienyl H
717 6-F CF3 C=C-2-oxazolyl H
718 6-F CF3 C=C-2-thiazolyl H
719 6-F CF3 C=C-4-isoxazolyl H
720 6-F CF3 C=C-2- imidazolyl H
721 6-F CF3 CH2CH2~cycPr H
722 6-F CF3 CH2CH2CH2CH2OH H
723 6-F CF3 CH2CH2-CH(OH)Me H
724 6-F CF3 CH2CH -(2-Cl)Ph H
725 6-F CF3 CH2CH2-(3-Cl)Ph H
726 6-F CF3 CH2CH2-(4-Cl)Ph H
727 6-F CF3 CH2CH2-(2-F)Ph H
728 6-F CF3 CH2CH2-(3-F)Ph H
729 6-F CF3 CH2CH2-(4-F)Ph H
730 6-F CF3 CH2CH2-(2-OH)Ph H
731 6-F CF3 CH2CH2-(3-OH)Ph H
732 6-F CF3 CH2CH2-(4-OH)Ph H
733 6-F CF3 CH2CH2-(2-OMe)Ph H
734 6-F CF3 CH2CH2-(3-OMe)Ph H
735 6-F CF3 CH2CH2-(4-OMe)Ph H
736 6-F CF3 CH CH2-(2-CN)Ph H
737 6-F CF3 CH2CH -(3-CN)Ph H
738 6-F CF3 CH2CH2-(4-CN)Ph H
739 6-F CF3 CH2CH2-(2-N02)Ph H
740 6-F CF3 CH2CH2-(3-N0 )Ph H
741 6-F CF3 CH2CH2-(4-N02)Ph H
742 6-F CF3 CH2CH2-(2-NH2)Ph H 743 6-F CF3 CH2CH2-(3-NH2)Ph H
744 6-F CF3 CH2CH2-(4-NH2)Ph H
745 6-F CF3 CH2CH2-(2-NMe2)Ph H
746 6-F CF3 CH CH2-(3-NMe2)Ph H
747 6-F CF3 CH2CH2-(4-NMe2)Ph H
748 6-F CF3 CH2CH2 -3 -Pyridyl H
749 6-F CF3 CH CH -4 -Pyridyl H
750 6-F CF3 CH2CH2 -2 - f uranyl H
751 6-F CF3 CH2CH2-3-f uranyl H
752 6-F CF3 CH CH2-2-thienyl H
753 6-F CF3 CH2CH2 -3 -thienyl H
754 6-F CF3 CH2CH2-2 -oxazolyl H
755 6-F CF3 CH CH -2-thiazolyl H
756 6-F CF3 CH2CH2-4-isoxazolyl H
757 6-F CF3 CH2CH2-2 -imidazolyl H
758 6-F CF3 C≡C-cycPr CH3
759 6-F CF3 C≡C-iPr CH3
760 6-F CF3 C≡C-Pr CH3
761 6-F CF3 C≡C-Bu CH3
762 6-F CF3 C≡C-iBu CH3
763 6-F CF3 C≡C-tBu CH3
764 6-F CF3 C≡C-Et CH3
765 6-F CF3 C≡C -Me CH3
766 6-F CF3 C≡C-Ph CH3
767 6-F CF3 C≡C-2 -Pyridyl CH3
768 6-F CF3 C≡C-3 -Pyridyl CH3
769 6-F CF3 C≡C-4-Pyridyl CH3
770 6-F CF3 C≡C-2 -f uranyl CH3
771 6-F CF3 C≡C-3 - f uranyl CH3
772 6-F CF3 C≡C-2 -thienyl CH3
773 6-F CF3 C≡C-3 -thienyl CH3
774 6-F CF3 C=C-cycPr CH3
775 6-F CF3 C=C-iPr CH3
776 6-F CF3 C=C-Pr CH3 111 6-F CF3 C=C-Bu CH3
778 6-F CF3 C=C-iBu CH3
779 6-F CF3 C=C-tBu CH3
780 6-F CF3 C=C-Et CH3
781 6-F CF3 C=C-Me CH3
782 6-F CF3 C=C-Ph CH3
783 6-F CF3 C=C-2-Pyridyl CH3
784 6-F CF3 C=C-3-Pyridyl CH3
785 6-F CF3 C=C-4-Pyridyl CH3
786 6-F CF3 C=C-2-furanyl CH3
787 6-F CF3 C=C-3-furanyl CH3
788 6-F CF3 C=C-2-thienyl CH3
789 6-F CF3 C=C-3-thienyl CH3
790 6-F CF3 CH2CH2-cycPr CH3
791 6-F CF3 CH2CH2-Ph CH3
792 6-F CF3 CH2CH2-2-Pyridyl CH3
793 6-F CF3 CH2CH2-3-Pyridyl CH3
794 6-F CF3 CH2CH2-4-Pyridyl CH3
795 6-F CF3 CH2CH2-2-furanyl CH3
796 6-F CF3 CH2CH2-3-furanyl CH3
797 6-F CF3 CH2CH2-2-thienyl CH3
798 6-F CF3 CH2CH2-3-thienyl CH3
799 6-F F3 C≡C-cycPr CH2CH3
800 6-F CF3 C≡C-Ph CH2CH
801 6-F CF3 C≡C-2-Pyridyl CH2CH3
802 6-F CF3 C≡C-3-Pyridyl CH2CH3
803 6-F CF3 C≡C-4-Pyridyl CH2CH3
804 6-F CF3 C≡C-2-furanyl CH2CH3
805 6-F CF3 C≡C-3-furanyl CH2CH3
806 6-F CF3 C≡C-2-thienyl CH2CH3
807 6-F CF3 C≡C-3-thienyl CH2CH3
808 6-F CF3 C=C-cycPr CH2CH3
809 6-F CF3 C=C-Ph CH2CH3
810 6-F CF3 C=C-2-Pyridyl CH2CH3 811 6-F CF3 C=C-3 -Pyridyl CH2CH3
812 6-F CF3 C=C-4 -Pyridyl CH2CH3
813 6-F CF3 C=C -2 -f uranyl CH2CH3
814 6-F CF3 C=C-3-f uranyl CH2CH3
815 6-F CF3 C=C-2 -thienyl CH2CH3
816 6-F CF3 C=C-3 -thienyl CH2CH3
817 6-F CF3 CH2CH2-cycPr CH2CH3
818 6-F CF3 CH2CH2-Ph CH2CH3
819 6-F CF3 CH2CH2-2 -Pyridyl CH2CH3
820 6-F CF3 CH2CH2-3 -Pyridyl CH2CH3
821 6-F CF3 CH2CH2-4-Pyridyl CH2CH3
822 6-F CF3 CH2CH2 -2 - f uranyl CH2CH3
823 6-F CF3 CH2CH -3 -f uranyl CH2CH3
824 6-F CF3 CH2CH2-2 -thienyl CH2CH3
825 6-F CF3 CH2CH2-3 -thienyl CH2CH3
826 5-C1 CF3 C≡C-cycPr H
827 5-C1 CF3 C≡CCH2CH2OH H
828 5-C1 CF3 C≡C-CH(OH)Me H
829 5-C1 CF3 C≡C-Ph H
830 5-C1 CF3 C≡C-(2-Cl)Ph H
831 5-C1 CF3 C≡C-(3-Cl)Ph H
832 5-C1 CF3 C≡C-(4-Cl)Ph H
833 5-C1 CF3 C≡C-(2-F)Ph H
834 5-C1 CF3 C≡C-(3-F)Ph H
835 5-C1 CF3 C≡C-(4-F)Ph H
836 5-C1 CF3 C≡C-(2-OH)Ph H
837 5-C1 CF3 C≡C-(3-OH)Ph H
838 5-C1 CF3 C≡C-(4-OH)Ph H
839 5-C1 CF3 C≡C-(2-OMe)Ph H
840 5-C1 CF3 C≡C-(3-OMe)Ph H
841 5-C1 CF3 C≡C-(4-OMe)Ph H
842 5-C1 CF3 C≡C-(2-CN)Ph H
843 5-C1 CF3 C≡C-(3-CN)Ph H
844 5-C1 CF3 C≡C-(4-CN)Ph H 845 5-C1 CF3 C≡C-(2-N02)Ph H
846 5-C1 CF3 C≡C-(3-N02)Ph H
847 5-C1 CF3 C≡C-(4-N02)Ph H
848 5-C1 CF3 C≡C-(2-NH2)Ph H
849 5-C1 CF3 C≡C-(3-NH2)Ph H
850 5-C1 CF3 C≡C-(4-NH2)Ph H
851 5-C1 CF3 C≡C-(2-NMe )Ph H
852 5-C1 CF3 C≡C- ( 3 -NMe2 ) Ph H
853 5-C1 CF3 C≡C-(4-NMe2)Ph H
854 5-C1 CF3 C≡C-2 -Pyridyl H
855 5-C1 CF3 C≡C-2 -Pyridyl H
856 5-C1 CF3 C≡C-3 -Pyridyl H
857 5-C1 CF3 C≡C-4 -Pyridyl H
858 5-C1 CF3 C≡C-2 -f uranyl H
859 5-C1 CF3 C≡C-3 -f uranyl H
860 5-C1 CF3 C≡C-2 -thienyl H
861 5-C1 CF3 C≡C-3 -thienyl H
862 5-C1 CF3 C≡C-2 -oxazolyl H
863 5-C1 CF3 C≡C-2 - thiazolyl H
864 5-C1 CF3 C≡C-4-isoxazolyl H
865 5-C1 CF3 C≡C-2 -imidazolyl H
866 5-C1 CF3 C=C-cycPr H
867 5-C1 CF3 C=CCH2CH2OH H
868 5-C1 CF3 C=C-CH(OH)Me H
869 5-C1 CF3 C=C-Ph H
870 5-C1 CF3 C=C-(2-Cl)Ph H
871 5-C1 CF3 C=C-(3-Cl)Ph H
872 5-C1 CF3 C=C-(4-Cl)Ph H
873 5-Cl CF3 C=C-(2-F)Ph H
874 5-C1 CF3 C=C-(3-F)Ph H
875 5-Cl CF3 C=C-(4-F)Ph H
876 5-Cl CF3 C=C-(2-OH)Ph H
877 5-Cl CF3 C=C-(3-OH)Ph H
878 5-Cl CF3 C=C-(4-OH)Ph H 879 5-Cl CF3 C=C-(2-OMe)Ph H
880 5-Cl CF3 C=C-(3-OMe)Ph H
881 5-Cl CF3 C=C-(4-OMe)Ph H
882 5-Cl CF3 C=C-(2-CN)Ph H
883 5-Cl CF3 C=C-(3-CN)Ph H
884 5-Cl CF3 C=C-(4-CN)Ph H
885 5-Cl CF3 C=C-(2-N02)Ph H
886 5-Cl CF3 C=C-(3-N02)Ph H
887 5-Cl CF3 C=C-(4-N0 )Ph H
888 5-Cl CF3 C=C-(2-NH2)Ph H
889 5-Cl CF3 C=C-(3-NH2)Ph H
890 5-Cl CF3 C=C-(4-NH2)Ph H
891 5-Cl CF3 C=C-(2-NMe2)Ph H
892 5-Cl CF3 C=C- ( 3 -NMe2 ) Ph H
893 5-Cl CF3 C=C-(4-NMe2)Ph H
894 5-Cl CF3 C=C-2 -Pyridyl H
895 5-Cl CF3 C=C-2 -Pyridyl H
896 5-Cl CF3 C=C-3 -Pyridyl H
897 5-Cl CF3 C=C-4 -Pyridyl H
898 5-Cl CF3 C=C-2-f uranyl H
899 5-Cl CF3 C=C-3-f uranyl H
900 5-Cl CF3 C=C-2- thienyl H
901 5-Cl CF3 C=C-3 -thienyl H
902 5-Cl CF3 C=C-2 -oxazolyl H
903 5-Cl CF3 C=C-2-thiazolyl H
904 5-Cl CF3 C=C-4-isoxazolyl H
905 5-Cl CF3 C=C-2 -imidazolyl H
906 5-Cl CF3 CH2CH2-cycPr H
907 5-Cl CF3 CH2CH2CH2CH2θH H
908 5-Cl CF3 CH2CH -CH(OH)Me H
909 5-Cl CF3 CH2CH2Ph H
910 5-Cl CF CH2CH2-(2-Cl)Ph H
911 5-Cl CF3 CH2CH2-(3-Cl)Ph H
912 5-Cl CF3 CH2CH2-(4-Cl)Ph H ro ro t-~
VO
©
90
O 0*.
H tn tn tn υ u u e.
VO
--•
V. ro •<# m vo r- oo en o x-A CM ro m vo t 00 cn o rH CM ro < in vo r- 00 cn o x-A CM ro <# in vo
00 H x-A rH iH CM CM CM CM CM CM CM CM CM CM ro ro n ro ro ro n r ro ro
ON "* -* <# - ■ P -tf cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn cn
947 5-Cl CF3 C≡C-2-Pyridyl CH3
948 5-Cl CF3 C≡C-3-Pyridyl CH3
949 5-Cl CF3 C≡C-4-Pyridyl CH3
950 5-Cl CF3 C≡C-2-furanyl H3
951 5-Cl CF3 C≡C-3-furanyl CH3
952 5-Cl F3 C≡C-2-thienyl CH3
953 5-Cl CF3 C≡C-3-thienyl CH3
954 5-Cl CF3 C=C-cycPr CH3
955 5-Cl CF3 C=C-Ph CH3
956 5-Cl CF3 C=C-2-Pyridyl CH3
957 5-Cl CF3 C=C-3-Pyridyl CH3
958 5-Cl CF3 C=C-4-Pyridyl CH3
959 5-Cl CF3 C=C-2-furanyl CH3
960 5-Cl CF3 C=C-3-furanyl CH3
961 5-Cl CF3 C=C-2-thienyl CH3
962 5-Cl CF3 C=C-3-thienyl CH3
963 5-Cl CF3 CH2CH2-cycPr CH3
964 5-Cl CF3 CH2CH2-Ph CH3
965 5-Cl CF3 CH2CH2-2-Pyridyl CH3
966 5-Cl CF3 CH2CH2-3-Pyridyl CH3
967 5-Cl CF3 CH2CH2-4-Pyridyl CH3
968 5-Cl CF3 CH2CH2-2-furanyl CH3
969 5-Cl CF3 CH2CH2-3-furanyl CH3
970 5-Cl CF3 CH2CH2-2-thienyl CH3
971 5-Cl CF3 CH2CH2-3-thienyl CH3
972 5-Cl CF3 C≡C-cycPr CH2CH3
973 5-Cl CF3 C≡C-Ph CH2CH3
974 5-Cl CF3 c≡C-2-Pyridyl CH2CH3
975 5-Cl CF3 C≡C-3-Pyridyl CH2CH3
976 5-Cl CF3 C≡C-4-Pyridyl CH2CH3
977 5-Cl CF3 C≡C-2-furanyl CH2CH3
978 5-Cl CF3 C≡C-3-furanyl CH2CH3
979 5-Cl CF3 C≡C-2-thienyl CH2CH3
980 5-Cl CF3 C≡C-3-thienyl CH2CH3 981 5-Cl CF3 C=C-cyc r CH2CH3
982 5-Cl CF3 C=C-Ph CH2CH3
983 5-Cl CF3 C=C-2-Pyridyl CH2CH3
984 5-Cl CF3 C=C-3-Pyridyl CH2CH3
985 5-Cl CF3 C=C-4-Pyridyl CH2CH3
986 5-Cl CF3 C=C-2-furanyl CHCH3
987 5-Cl CF3 C=C-3-furanyl CH2CH3
988 5-Cl CF3 C=C-2-thienyl CH2CH3
989 5-Cl CF3 C=C-3-thienyl CH2CH3
990 5-Cl CF3 CH2CH2-cycPr CH2CH3
991 5-Cl CF3 CH2CH2-Ph CH2CH3
992 5-Cl CF3 CH2CH2-2-Pyridyl CHCH3
993 5-Cl CF3 CHCH2-3-Pyridyl CH2CH3
994 5-Cl CF3 CH2CH2-4-Pyridyl CH2CH3
995 5-Cl CF3 CH2CH2-2-furanyl CH2CH3
996 5-Cl CF3 CH2CH2-3-furanyl CH2CH3
997 5-Cl CF3 CH2CH2-2-thienyl CH2CH3
998 5-Cl CF3 CH2CH2-3-thienyl CH2CH3
999 5-F CF3 C≡C-cycPr H
1000 5-F CF3 C≡CCH2CH2OH H
1001 5-F CF3 C≡C-CH(OH)Me H
1002 5-F CF3 C≡C-Ph H
1003 5-F CF3 C≡C-(2-Cl)Ph H
1004 5-F CF3 C≡C-(3-Cl)Ph H
1005 5-F CF3 C≡C-(4-Cl)Ph H
1006 5-F CF3 C≡C-(2-F)Ph H
1007 5-F CF3 C≡C-(3-F)Ph H
1008 5-F CF3 C≡C-(4-F)Ph H
1009 5-F CF3 C≡C-(2-OH)Ph H
1010 5-F CF3 C≡C-(3-OH)Ph H
1011 5-F CF3 C≡C-(4-OH)Ph H
1012 5-F CF3 C≡C-(2-OMe)Ph H
1013 5-F CF3 C≡C-(3-OMe)Ph H
1014 5-F CF3 C≡C-(4-OMe)Ph H 1015 5-F CF3 C≡C-(2-CN)Ph H
1016 5-F CF3 C≡C-(3-CN)Ph H
1017 5-F CF3 C≡C-(4-CN)Ph H
1018 5-F CF3 C≡C-(2-Nθ2)Ph H
1019 5-F CF3 C≡C-(3-N02)Ph H
1020 5-F CF3 C≡C-(4-N02)Ph H
1021 5-F CF3 C≡C-(2-NH2)Ph H
1022 5-F CF3 C-≡C-(3-NH2)Ph H
1023 5-F CF3 C≡C-(4-NH2)Ph H
1024 5-F CF3 C-≡C-(2-NMe2)Ph H
1025 5-F CF3 C≡C-(3-NMe2)Ph H
1026 5-F CF3 C≡C-(4-NMe2)Ph H
1027 5-F CF3 C≡C-2 -Pyridyl H
1028 5-F CF3 C≡C-2 -Pyridyl H
1029 5-F CF3 C≡C-3 -Pyridyl H
1030 5-F CF3 C≡C-4 -Pyridyl H
1031 5-F CF3 C≡C-2 - f uranyl H
1032 5-F CF3 C≡C-3 -f uranyl H
1033 5-F CF3 C≡C-2 -thienyl H
1034 5-F CF3 C≡C - 3 - thi eny 1 H
1035 5-F CF3 C≡C-2 -oxazolyl H
1036 5-F CF3 C≡C-2 -thiazolyl H
1037 5-F CF3 C≡C-4 -isoxazolyl H
1038 5-F CF3 C≡C-2 -imidazolyl H
1039 5-F CF3 C=C-cycPr H
1040 5-F CF3 C=CCH2CH2OH H
1041 5-F CF3 C=C-CH(OH)Me H
1042 5-F CF3 C=C-Ph H
1043 5-F CF3 C=C-(2-Cl)Ph H
1044 5-F CF3 C=C-(3-Cl)Ph H
1045 5-F CF3 C=C-(4-Cl)Ph H
1046 5-F CF3 C=C-(2-F)Ph H
1047 5-F CF3 C=C-(3-F)Ph H
1048 5-F CF3 C=C-(4-F)Ph H 1049 5-F CF3 C=C-(2-OH)Ph H
1050 5-F CF3 C=C-(3-OH)Ph H
1051 5-F CF3 C=C-(4-OH)Ph H
1052 5-F CF3 C=C-(2-OMe)Ph H
1053 5-F CF3 C=C-(3-OMe)Ph H
1054 5-F CF3 C=C-(4-OMe)Ph H
1055 5-F CF3 C=C-(2-CN)Ph H
1056 5-F CF3 C=C-(3-CN)Ph H
1057 5-F CF3 C=C-(4-CN)Ph H
1058 5-F CF3 C=C-(2-Nθ2)Ph H
1059 5-F CF3 C=C-(3-N02)Ph H
1060 5-F CF3 C=C-(4-N02)Ph H
1061 5-F CF3 C=C-(2-NH2)Ph H
1062 5-F CF3 C=C- ( 3 -NH2 ) Ph H
1063 5-F CF3 C=C-(4-NH2)Ph H
1064 5-F CF3 C=C-(2-NMe2)Ph H
1065 5-F CF3 C=C-(3-NMe2)Ph H
1066 5-F CF3 C=C-(4-NMe2)Ph H
1067 5-F CF3 C=C-2 -Pyridyl H
1068 5-F CF3 C=C-2 -Pyridyl H
1069 5-F CF3 C=C-3 -Pyridyl H
1070 5-F CF3 C=C-4-Pyridyl H
1071 5-F CF3 C=C-2-f uranyl H
1072 5-F CF3 C=C-3-f uranyl H
1073 5-F CF3 C=C-2 -thienyl H
1074 5-F CF3 C=C-3 -thienyl H
1075 5-F CF3 C=C-2 -oxazolyl H
1076 5-F CF3 C=C-2-thiazolyl H
1077 5-F CF3 C=C-4-isoxazolyl H
1078 5-F CF3 C=C-2 -imidazolyl H
1079 5-F CF3 CH2CH2-cycPr H
1080 5-F CF3 CH2CH2CH2CH2OH H
1081 5-F CF3 CH2CH2-CH(OH)Me H
1082 5-F CF3 CH2CH2Ph H ro ro vo ©
00
H μ -4 »-C --ι H H -H] H H Ε υ c-,
ro <tf in vo t 00 en o x-A CM ro ^ in VD r- 00 cn o x-A CM ro <tf in VD r~ 00 cn O CM CO - 1 in VD
00 oo 00 00 00 00 00 00 cn cn cn cn cn σi σ σi σi cn o O O o O o O o o o rH rH rH rH rH H
O o o o o o o o o o o o o o o o o x-A rH rH rH x-A rH H H H rH H H H rH x-A x-A rH x-A
O x-A x-A rH x-A x-A x-A H x-A x-A rH H H x-A rH rH x-A rH H rH rH rH rH H x-A x-A rH x-A x-A x-A x-A x-A
1117 5 -F CF3 CH2CH2 -2 -imidazolyl H
1118 5 -F CF3 C≡C-cycPr CH3
1119 5-F CF3 C≡C-Ph CH3
1120 5-F CF3 C≡C-2 -Pyridyl CH3
1121 5-F CF3 C≡C-3 -Pyridyl CH3
1122 5 -F CF3 C≡C-4 -Pyridyl CH3
1123 5-F CF3 C≡C-2 - f uranyl CH3
1124 5-F CF3 C≡C-3 -f uranyl CH3
1125 5-F CF3 C≡C-2 -thienyl CH3
1126 5 -F CF3 C≡C-3 -thienyl CH3
1127 5-F CF3 C=C-cycPr CH3
1128 5-F CF3 C=C-Ph CH3
1129 5-F CF3 C=C-2 -Pyridyl CH3
1130 5-F CF3 C=C-3 -Pyridyl CH3
1131 5-F CF3 C=C-4 -Pyridyl CH3
1132 5-F CF3 C=C-2 - f uranyl CH3
1133 5-F CF3 C=C-3 -f uranyl CH3
1134 5-F CF3 C=C-2 -thienyl CH3
1135 5-F CF3 C=C-3 -thienyl CH3
1136 5-F CF3 CH2CH2-cycPr CH3
1137 5-F CF3 CH2CH2-Ph CH3
1138 5-F CF3 CH2CH2-2 -Pyridyl CH3
1139 5-F CF3 CH2CH2 -3 -Pyridyl CH3
1140 5-F CF3 CH2CH2 -4 -Pyridyl CH3
1141 5-F CF3 CH2CH2 -2 - f uranyl CH3
1142 5-F CF3 CH2CH2 -3 -f uranyl CH3
1143 5-F CF3 CH2CH2-2 -thienyl CH3
1144 5-F CF3 CH2CH2 -3 -thienyl CH3
1145 5-F CF3 C≡C-cycPr CH2CH3
1146 5-F CF3 C≡C-Ph CH2CH3
1147 5-F CF3 C≡C-2 -Pyridyl CH2CH3
1148 5-F CF3 C≡C-3 -Pyridyl CH2CH3
1149 5-F CF3 C≡C- 4 -Pyridyl CH2CH3
1150 5-F CF3 C≡C-2 - f uranyl CH2CH3 1151 5-F CF3 C≡C-3-furanyl CH2CH3
1152 5-F CF3 C≡C-2-thienyl CH2CH3
1153 5-F CF3 C≡C-3-thienyl CH2CH3
1154 5-F CF3 C=C-cycPr CH2CH3
1155 5-F CF3 C=C-Ph CH2CH3
1156 5-F CF3 C=C-2-Pyridyl CH2CH3
1157 5-F CF3 C=C-3-Pyridyl CH2CH3
1158 5-F CF3 C=C-4-Pyridyl CH2CH3
1159 5-F CF3 C=C-2-furanyl CH2CH3
1160 5-F CF3 C=C-3-furanyl CH2CH3
1161 5-F CF3 C=C-2-thienyl CH2CH3
1162 5-F CF3 C=C-3-thienyl CH2CH3
1163 5-F CF3 CH2CH2-cycPr CH2CH3
1164 5-F CF3 CH2CH2-Ph CH2CH3
1165 5-F CF3 CH2CH2-2-Pyridyl CH2CH3
1166 5-F CF3 CH2CH2-3-Pyridyl CH2CH3
1167 5-F CF3 CH2CH2-4-Pyridyl CH2CH3
1168 5-F CF3 CH2CH2-2-f ranyl CH2CH3
1169 5-F CF3 CH2CH2-3-furanyl CH2CH3
1170 5-F CF3 CH2CH2-2-thienyl CH2CH3
1171 5-F CF3 CH2CH2-3-thienyl CH2CH3
1172 5- -Cl,6- -F CF3 C≡C-cycPr H
1173 5- -Cl,6- -F CF3 C≡C-Ph H
1174 5- -Cl,6- -F CF3 C≡C-2-Pyridyl H
1175 5- -Cl,6- -F CF3 C≡C-3-Pyridyl H
1176 5- -Cl,6- -F CF3 C≡C-4-Pyridyl H
1177 5- -Cl,6- -F CF3 C≡C-2-furanyl H
1178 5- -Cl,6- -F CF3 C≡C-3-furanyl H
1179 5- -Cl,6- -F CF3 C≡C-2-thienyl H
1180 5- -Cl,6- -F CF3 C≡C-3-thienyl H
1181 5- -Cl,6- -F CF3 C=C-cycPr H
1182 5- -Cl,6- -F CF3 C=C-Ph H
1183 5- -Cl,6- -F CF3 C=C-2-Pyridyl H
1184 5- -Cl,6- -F CF3 C=C-3-Pyridyl H --, ! ^ --j P--i HH HH HH H HH H^ υ u u u u u u u u u u u u u u u u u u u u
rH r-A r-A rH rH x-A rH
ro ro ro ro ro ro ro ro ro ro ro fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa U U U U U u U U U U u U U U U U U U U U U U U U U U U U U U U U U U
fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa
I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I VD vo vo vo VD VD vo vo VD vo VD vo vo VD VD vo vo vo VD VD vo vo vo vo vo vo VD vo vo vo VD VD vo VD rH rH rH r-i r-A u u u U U U U U U U U U U U U U U U U U U U U U U U U U U U u u
I I I I I I I I I I I I I I I I I I I I I I I I u I u I I I in in m in m in in in in m in in in m m in in m in m in m m in in in in m m m m in m in
O m VD r~ 00 cn O rH CM ro * m yo r- cn O rH CM ro m VO r- 00 cn O CM ro ^ in VO --* 00
00 00 00 00
SO en cn cn cn cn cn cn σi cn cn O O o o o O o O O H H H x-A x-A H x-A rH rH H x-A x-A rH x-A rH rH x-A rH CM CM CM CM CM CM CM CM CM CM CN CM CM CM CM CM CM CM CM
H rH rH x-A rH rH rH x-A x-A rH x-A rH H x-A rH rH rH H rH x-A rH rH rH rH H rH rH H rH
1219 5-Cl, 6-F CF3 CH2CH -2-Pyridyl CH3
1220 5-Cl, 6-F CF3 CH2CH2-3-Pyridyl CH3
1221 5-Cl, 6-F CF3 CH2CH -4-Pyridyl CH3
1222 5-Cl, 6-F CF3 CH2CH -2-furany1 CH3
1223 5-Cl, 6-F CF CH2CH2-3 -furanyl CH3
1224 5-Cl, 6-F CF3 CH2CH2-2-thienyl CH3
1225 5-Cl, 6-F CF3 CH2CH2-3-thienyl CH3
1226 5-F.6-C1 CF3 C≡C-cycPr H
1227 5-F,6-Cl CF3 C≡C-Ph H
1228 5-F.6-C1 CF3 C≡C-2-Pyridyl H
1229 5-F.6-C1 CF3 C≡C-3-Pyridyl H
1230 5-F.6-C1 CF3 C≡C-4-Pyridyl H
1231 5-F,6-Cl CF3 C≡C-2-furanyl H
1232 5-F,6-Cl CF3 C≡C-3-furanyl H
1233 5-F.6-C1 CF3 C≡C-2-thienyl H
1234 5-F,6-Cl CF3 C≡C-3-thienyl H
1235 5-F,6-Cl CF3 C=C-cyc r H
1236 5-F,6-Cl CF3 C=C-Ph H
1237 5-F,6-Cl CF3 C=C-2-Pyridyl H
1238 5-F,6-Cl CF3 C=C-3-Pyridyl H
1239 5-F,6-Cl CF3 C=C-4-Pyridyl H
1240 5-F,6-Cl CF3 C=C-2-furanyl H
1241 5-F,6-Cl CF3 C=C-3-furanyl H
1242 5-F, 6-C1 CF3 C=C-2-thienyl H
1243 5-F,6-Cl CF3 C=C-3-thienyl H
1244 5-F,6-Cl CF3 CH2CH2~cycPr H
1245 5-F,6-Cl CF3 CH2CH2-Ph H
1246 5-F,6-Cl CF3 CH2CH2-2-Pyridyl H
1247 5-F,6-Cl CF3 CH2CH2-3-Pyridyl H
1248 5-F,6-Cl CF3 CH2CH2-4-Pyridyl H
1249 5-F,6-Cl CF3 CH2CH2-2-furanyl H
1250 5-F,6-Cl CF3 CH2CH2-3-furanyl H
1251 5-F,6-Cl CF3 CH2CH2-2-thienyl H
1252 5-F,6-Cl CF3 CH2CH2-3-thienyl H ro ro t o ©
00 CΛ ro ro ro ro ro ro ro ro ro
H tn tn tn tn tn tn tn tn tn tn u u u u u u u u u u υ u u u u u u u u u u u u u u u u u
ro ro ro co ro ro ro ro ro ro ro ro ro ro ro ro ro ro ro fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa
U u U U U u U U U U u u u U u U U U U U U U U U u u u u u u u u u
rH rH H H rH fa fa fa fa fa fa fa
U U U U U U U U U U U U U U U U U U U U U U U U U U U
I I I I I I I I I I I I I I I I I I I oo oo oo oo oo oo oo vo o vo vo vo vo vo vo vo vo vo vo vo vo vo vo VD vo vo vo VD vo vo vo vo vo vo r-A x-A x-A r-A r-A r-A rH fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa
I I I I I I I I I I I I I I I I u u u u u u u in in in in in in in in m in in in m m in in in m m in in in in m in in in
t rs J ro ^ in VO r oo cn o rH CM ro m VD t- 00 cn O x-A CM ro «* m VD t> 00 cn o x-A CM ro -* in vo o in in in in m in in vo VO VO VO vo VD VD vo VO VO r- t~- r» r- r~ r- r- t- r-» o 00 00 00 00 00 00 00
CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CN CM CM CM CN CM CM CM CM CM CM CM CM CM CN CM CM CM CM rH rH rH rH rH rH rH rH rH H x-A rH H H rH rH H x-A x-A rH x-A x-A rH x-A x-A rH H x-A x-A H rH x-A rH H O
1287 6-Cl,8-F CF C≡C-2-thienyl H
1288 6-Cl,8-F CF3 C≡C-3-thienyl H
1289 6-Cl,8-F CF3 C=C-cycPr H
1290 6-Cl,8-F CF3 C=C-Ph H
1291 6-Cl,8-F CF3 C=C-2-Pyridyl H
1292 6-Cl,8-F CF3 C=C-3-Pyridyl H
1293 6-Cl,8-F CF3 C=C-4-Pyridyl H
1294 6-Cl,8-F CF3 C=C-2-furanyl H
1295 6-Cl,8-F CF3 C=C-3-furanyl H
1296 6-Cl,8-F CF3 C=C-2-thienyl H
1297 6-Cl,8-F CF3 C=C-3-thienyl H
1298 6-Cl,8-F CF3 CH2CH2~cycPr H
1299 6-Cl,8-F CF3 CH2CH2-Ph H
1300 6-Cl,8-F CF3 CH2CH2-2-Pyridyl H
1301 6-Cl,8-F CF3 CH2CH2-3-Pyridyl H
1302 6-Cl,8-F CF3 CH2CH2-4-Pyridyl H
1303 6-Cl,8-F CF3 CH2CH2-2-f ranyl H
1304 6-Cl,8-F CF3 CH2CH2-3-furanyl H
1305 6-Cl,8-F CF3 CH2CH-2-thienyl H
1306 6-Cl,8-F CF3 CH2CH2-3-thienyl H
1307 6-Cl,8-F CF3 C≡C-cycPr CH3
1308 6-Cl,8-F CF3 C≡C-Ph CH3
1309 6-Cl,8-F CF3 C≡C-2-Pyridyl CH3
1310 6-Cl,8-F CF3 C≡C-3-Pyridyl CH3
1311 6-Cl,8-F CF3 C≡C-4-Pyridyl CH3
1312 6-Cl,8-F CF3 C≡C-2-furanyl CH3
1313 6-Cl,8-F CF3 C≡C-3-furany1 CH3
1314 6-Cl,8-F CF3 C≡C-2-thienyl CH3
1315 6-Cl,8-F CF3 C≡C-3-thienyl CH3
1316 6-Cl,8-F CF3 C=C-cycPr CH3
1317 6-Cl,8-F CF3 C=C-Ph CH3
1318 6-Cl,8-F CF3 C=C-2-Pyridyl CH3
1319 6-Cl,8-F CF3 C=C-3-Pyridyl CH3
1320 6-Cl,8-F CF3 C=C-4-Pyridyl CH3 ro ro t~ o ©
u u u u u u u u c ro ro ro ro ro ro ro ro ro ro ro ro ro ro co co ro ro ro ro ro ro ro ro ro ro ro ro ro fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa
U U U U U U U U U U U u U U υ U U U U U U U U U U U U U u U U u υ u
fa fa fa fa fa fa fa fa fa fa fa fa fa
1 1 1 1 1 1 1 1 ro ro ro ro ro ro to ro ro ro ro ro ro ro ro ro ro ro ro oo co 00 oo oo 00 00 00 00 oo 00 tn tn tn tn tn tn tn tn tn tn tn tn t tn tn tn tn tn tn tn tn rH rH rH rH rH rH rH H rH rH u u u u u u u u u u u u u u u u
1 1 u u u u u
U u 1 1 1 1 1 1 | U | U | u 1 u U | u U
1 u U
1 | u U | vo o vo VD vo vo vo vo vo vo vo vo vo vo vo vo vo VO vo vo VO vo vo vo vo
t rH ro in r- 00 cn o ro in t 00 cn O rH ro in vo 00 σi o rH ro
00 ro ro ro ro ro ro ro ro ro ro jl in in in in in ro ro ro ro ro ro ro ro ro ro ro ro ro ro ro ro ro ro ro n r ro ro ro ro ro ro ro ro ro ro ro ro ro o rH rH rH H rH rH rH rH x-A rH rH rH x-A rH rH rH H rH rH rH H x-A rH H x-A
ro ro r^ o
ro ro ro o ro ro ro ro ro ro ro ro ro ro ro ro ro ro tn tn tn tn tn rn tn tn tn tn tn tn tn tn tn tn tn tn tn tn tn tn tn tn tn tn tn tn tn tn tn tn tn u u u u u u u u u u u u u u u u u u u u υ u u u u u u tn υ 0.
u vo vo vo VD vo vo vo vo vo vo vo vo vo vo VD vo o VD vo VD VO o vo vo VO vo vo vo vo vo vo vo 1 vo
VO f-
*
— in vo r- CO cn o rH CM ro "vji in vo t-- oo cn O rH CM ro "* tn vo r CO cn o rH CM ro ^i in VO r~ CO
00 m in m m in vo VO VD vo vo vo vo vo vo vo r- c-- -- r-- --- r- -^ r r- r- 00 00 CO CO CO 00 CO 00 00 ro ro ro ro ro ro ro ro ro ro ro ro ro ro ro ro ro ro ro ro ro ro ro ro ro ro ro ro ro ro ro ro ro ro o rH rH rH rH rH rH rH rH rH x-A x-A x-A x-A x-A rH rH rH H rH rH H rH H rH H <H x-A x-A H H rH rH rH x-A
1389 6 -COCH3 CF3 C≡C-Ph H
1390 6 -COCH3 CF3 C≡C-2 -Pyridyl H
1391 6-COCH3 CF3 C≡C-3 -Pyridyl H
1392 6-COCH3 CF3 C≡C-4-Pyridyl H
1393 6-COCH3 CF3 C≡C-2 - f uranyl H
1394 6 -COCH3 CF3 C≡C-3 -f uranyl H
1395 6-COCH3 CF3 C≡C-2 -thienyl H
1396 6-COCH3 CF3 C≡C-3 -thienyl H
1397 6-NH2 CF3 C≡C-cycPr H
1398 6-NH2 CF3 C≡C-Ph H
1399 6 -NH2 CF3 C≡C-2 -Pyridyl H
1400 6-NH2 CF3 C≡C-3 -Pyridyl H
1401 6 -NH2 CF3 C≡C-4 -Pyridyl H
1402 6 -NH2 CF3 C≡C-2 - f uranyl H
1403 6-NH2 CF3 C≡C-3 - f uranyl H
1404 6-NH2 CF3 C≡C-2 -thienyl H
1405 6 -NH2 CF3 C≡C-3 -thienyl H
1406 6-NMe CF3 C≡C-cycPr H
1407 6-NMe2 CF3 C≡C-Ph H
1408 6-NMe CF3 C≡C-2 -Pyridyl H
1409 6-NMe2 CF3 C≡C-3 -Pyridyl H
1410 6-NMe2 CF3 C≡C-4-Pyridyl H
1411 6-NMe2 CF3 C≡C-2 - f uranyl H
1412 6-NMe2 CF3 C≡C-3 - f uranyl H
1413 6-NMe2 CF3 C≡C-2 - thienyl H
1414 6- Me2 CF3 C≡C-3 -thienyl H
1415 7-C1 CF3 C≡C-cycPr H
1416 7-C1 CF3 C≡C-Ph H
1417 7-C1 CF3 C≡C-2 -Pyridyl H
1418 7 -C1 CF3 C≡C-3 -Pyridyl H
1419 7-C1 CF3 C≡C-4 -Pyridyl H
1420 7-C1 CF3 C≡C-2 - f uranyl H
1421 7-C1 CF3 C≡C-3 - f uranyl H
1422 7-C1 CF3 C≡C-2 -thienyl H 1423 7-C1 CF3 C≡C-3 -thienyl H
1424 5,6-OCH20- CF3 C≡C-cycPr H
1425 5,6-OCH20- CF3 C≡CCH2CH2OH H
1426 5,6-OCH20- CF3 C≡C-CH(OH)Me H
1427 5,6-0CH20- CF3 C≡C-Ph H
1428 5,6-OCH20- CF3 C≡C-(2-Cl)Ph H
1429 5,6-OCH20- CF3 C≡C-(3-Cl)Ph H
1430 5,6-OCH20- CF3 C≡C-(4-Cl)Ph H
1431 5,6-OCH20- CF3 C=sC-(2-F)Ph H
1432 5,6-OCH20- CF3 C-≡C-(3-F)Ph H
1433 5,6-0CH2O- CF3 C≡C-(4-F)Ph H
1434 5,6-OCH20- CF3 C≡C-(2-OH)Ph H
1435 5,6-OCH20- CF3 C≡C-(3-OH)Ph H
1436 5,6-OCH20- CF3 C≡C-(4-OH)Ph H
1437 5,6-OCH 0- CF3 C≡C-(2-OMe)Ph H
1438 5,6-OCH20- CF3 C≡C-(3-OMe)Ph H
1439 5,6-OCH20- CF3 C≡C-(4-OMe)Ph H
1440 5,6-OCH20- CF3 C≡C-(2-CN)Ph H
1441 5,6-OCH20- CF3 C≡C-(3-CN)Ph H
1442 5,6-OCH20- CF3 C≡C-(4-CN)Ph H
1443 5,6-OCH20- CF3 C≡C-(2-N02)Ph H
1444 5,6-OCH20- CF3 C≡C-(3-N02)Ph H
1445 5,6-OCH20- CF3 C≡C-(4-N02)Ph H
1446 5,6-OCH20- CF3 C-^:-(2-NH2)Ph H
1447 5,6-OCH20- CF3 C-≡C-(3-NH2)Ph H
1448 5,6-OCH20- CF3 C≡C-(4-NH2)Ph H
1449 5,6-OCH20- CF3 C-sC-(2-NMe2)Ph H
1450 5,6-0CH2O- CF3 C-sC- ( 3 - Me2 ) Ph H
1451 5,6-OCH20- CF3 C≡C-(4-NMe2)Ph H
1452 5,6-OCH20- CF3 C≡C-2 -Pyridyl H
1453 5,6-OCH20- CF3 C≡C-2 -Pyridyl H
1454 5,6-OCH20- CF3 C≡C-3 -Pyridyl H
1455 5,6-OCH20- CF3 C≡C-4-Pyridyl H
1456 5,6-OCH 0- CF3 C≡C-2 - f uranyl H 1457 5, 6-OCH20- CF3 C≡C-3 -f uranyl H
1458 5, 6-OCH 0- CF3 C≡C-2 -thienyl H
1459 5,6-OCH20- CF3 C≡C-3 -thienyl H
1460 5,6-OCH 0- CF3 C≡C-2 -oxazolyl H
1461 5,6-0CH20- CF3 C≡C-2 -thiazolyl H
1462 5,6-OCH20- CF3 C≡C-4-isoxazolyl H
1463 5,6-OCH20- CF3 C≡C-2 -imidazolyl H
1464 6-COCH3 CF3 C=C-cycPr H
1465 6-COCH3 CF3 C=C-Ph H
1466 6-COCH3 CF3 C=C-2 -Pyridyl H
1467 6-COCH3 CF3 C=C-3 -Pyridyl H
1468 6-COCH3 CF3 C=C-4 -Pyridyl H
1469 6-COCH3 CF3 C=C-2-f uranyl H
1470 6-COCH3 CF3 C=C-3-f uranyl H
1471 6-COCH3 CF3 C=C-2- thienyl H
1472 6-COCH3 CF3 C=C-3 -thienyl H
1473 6-NH2 CF3 C=C-cycPr H
1474 6-NH2 CF3 C=C-Ph H
1475 6-NH2 CF3 C=C-2 -Pyridyl H
1476 6-NH2 CF3 C=C-3 -Pyridyl H
1477 6-NH2 CF3 C=C-4 -Pyridyl H
1478 6-NH2 CF3 C=C-2-f uranyl H
1479 6-NH2 CF3 C=C-3-f uranyl H
1480 6-NH2 CF3 C=C-2 -thienyl H
1481 6-NH2 CF3 C=C-3 -thienyl H
1482 6-NMe2 CF3 C=C-cycPr H
1483 6-NMe2 CF3 C=C-Ph H
1484 6- e2 CF3 C=C-2 -Pyridyl H
1485 6- Me2 CF3 C=C-3 -Pyridyl H
1486 6- e2 CF3 C=C-4 -Pyridyl H
1487 6- MΘ2 CF3 C=C-2-f uranyl H
1488 6-NMe2 CF3 C=C -3 -f uranyl H
1489 6- MΘ2 CF3 C=C-2 -thienyl H
1490 6-NMΘ2 CF3 C=C-3 -thienyl H 1491 7-C1 CF3 C=C-cycPr H
1492 7-C1 CF3 C=C-Ph H
1493 7-C1 CF3 C=C-2-Pyridyl H
1494 7-C1 CF3 C=C-3-Pyridyl H
1495 7-C1 CF3 C=C-4-Pyridyl H
1496 7-C1 CF3 C=C-2-furanyl H
1497 7-C1 CF3 C=C-3-furanyl H
1498 7-C1 CF3 C=C-2-thienyl H
1499 7-C1 CF3 C=C-3-thienyl H
1500 5,6-OCH20- CF3 C=C-cycPr H
1501 5,6-OCH20- CF3 C=CCH2CH2OH H
1502 5,6-OCH20- CF3 C=C-CH(OH)Me H
1503 5,6-OCH20- CF3 C=C-Ph H
1504 5,6-OCH20- CF3 C=C-(2-Cl)Ph H
1505 5,6-OCH20- CF3 C=C-(3-Cl)Ph H
1506 5,6-OCH20- CF3 C=C-(4-Cl)Ph H
1507 5,6-OCH20- CF3 C=C-(2-F)Ph H
1508 5,6-OCH20- CF3 C=C-(3-F)Ph H
1509 5,6-OCH20- CF3 C=C-(4-F)Ph H
1510 5,6-OCH20- CF3 C=C-(2-OH)Ph H
1511 5,6-OCH20- CF3 C=C-(3-OH)Ph H
1512 5,6-OCH20- CF3 C=C-(4-OH)Ph H
1513 5,6-OCH20- CF3 C=C-(2-OMe)Ph H
1514 5,6-OCH20- CF3 C=C-(3-OMe)Ph H
1515 5,6-OCH20- CF3 C=C-(4-OMe)Ph H
1516 5,6-OCH20- CF3 C=C-(2-CN)Ph H
1517 5,6-OCH20- CF3 C=C-(3-CN)Ph H
1518 5,6-OCH20- CF3 C=C-(4-CN)Ph H
1519 5,6-OCH20- CF3 C=C-(2-N02)Ph H
1520 5,6-OCH20- CF3 C=C- (3-N02) Ph H
1521 5,6-OCH20- CF3 C=C-(4-N02)Ph H
1522 5,6-OCH20- CF3 C=C-(2-NH2)Ph H
1523 5,6-OCH20- CF3 C=C-(3-NH2)Ph H
1524 5,6-OCH20- CF3 C=C-(4-NH2)Ph H 1525 5,6-0CH20- CF3 C=C-(2-NMe )Ph H
1526 5,6-OCH20- CF3 C=C-(3-NMe2)Ph H
1527 5,6-0CH20- CF3 C--C-(4-NMe2)Ph H
1528 5,6-OCH20- CF3 C=C-2 -Pyridyl H
1529 5,6-OCH20- CF3 C=C-2 -Pyridyl H
1530 5,6-OCH20- CF3 C=C-3 -Pyridyl H
1531 5,6-OCH20- CF3 C=C-4 -Pyridyl H
1532 5,6-OCH20- CF3 C=C-2-f uranyl H
1533 5,6-OCH20- CF3 C=C-3-f uranyl H
1534 5,6-OCH20- CF3 C=C-2- thienyl H
1535 5,6-OCH20- CF3 C=C-3 -thienyl H
1536 5,6-OCH20- CF3 C=C-2 -oxazolyl H
1537 5,6-OCH 0- CF3 C=C-2-thiazolyl H
1538 5,6-OCH20- CF3 C=C-4-isoxazolyl H
1539 5,6-OCH20- CF3 C=C-2- imidazolyl H
1540 5,6-OCH20- CF3 CH2CH2-cycPr H
1541 5,6-OCH20- CF3 CH2CH2CH2CH2OH H
1542 5,6-0CH2O- CF3 CH2CH2-CH(OH)Me H
1543 5,6-OCH20- CF3 CH2CH2Ph H
1544 5,6-OCH20- CF3 CH2CH2-(2-Cl)Ph H
1545 5,6-OCH20- CF3 CH2CH2-(3-Cl)Ph H
1546 5,6-OCH20- CF3 CH2CH -(4-Cl)Ph H
1547 5,6-OCH20- CF3 CH2CH2-(2-F)Ph H
1548 5,6-OCH20- CF3 CH2CH2-(3-F)Ph H
1549 5,6-OCH20- CF3 CH2CH2-(4-F)Ph H
1550 5,6-OCH20- CF3 CH2CH2-(2-OH)Ph H
1551 5,6-OCH20- CF3 CH2CH2-(3-OH)Ph H
1552 5,6-OCH20- CF3 CH2CH2-(4-OH)Ph H
1553 5,6-OCH20- CF3 CH2CH2-(2-OMe)Ph H
1554 5,6-OCH20- CF3 CH2CH2-(3-OMe)Ph H
1555 5,6-OCH20- CF3 CH2CH2-(4-OMe)Ph H
1556 5,6-OCH20- CF3 CH2CH2-(2-CN)Ph H
1557 5,6-OCH20- CF3 CH2CH2-(3-CN)Ph H
1558 5,6-OCH20- CF3 CH2CH2-(4-CN)Ph H 1559 5,,66-OCH20- CF3 CH2CH2-(2-N02)Ph H 1560 5 , 6-OCH20- CF3 CH2CH2-(3-N02)Ph H 1561 5 , 6-OCH20- CF3 CH2CH2-(4-N02)Ph H 1562 5 , 6-OCH20- CF3 CH2CH2-(2-NH2)Ph H 1563 5 , 6-OCH20- CF3 CH2CH2-(3-NH2)Ph H 1564 5 , 6-OCH20- CF3 CH2CH2 - ( 4 -NH2 ) Ph H 1565 5 , 6-OCH2O- CF3 CH2CH2- ( 2 -NMe2 ) Ph H 1566 5 , 6-OCH20- CF3 CH2CH2- ( 3 -NMe2 ) Ph H 1567 5 , 6-OCH20- CF3 CH2CH2- ( 4 -NMe2 ) Ph H 1568 5 , 6-OCH20- CF3 CH2CH2 -2 -Pyridyl H 1569 5 , 6-OCH20- CF3 CH2CH2 -3 -Pyridyl H 1570 5 , 6-OCH20- CF3 CH2CH2-4-Pyridyl H 1571 5 , 6-OCH20- CF3 CH2CH -2 -f uranyl H 1572 5 , 6-OCH20- CF3 CH2CH2 -3 -f uranyl H 1573 5 , 6-OCH20- CF3 CH2CH2 -2 -thienyl H 1574 5 , 6-OCH20- CF3 CH2CH2 -3 -thienyl H 1575 5 , 6-OCH20- CF3 CH2CH2-2-oxazolyl H 1576 5 , 6-OCH20- CF3 CH2CH2-2-thiazolyl H 1577 5 , 6-OCH20- CF3 CH2CH2-4-isoxazolyl H 1578 5 , 6-OCH20- CF3 CH2CH2-2-imidazolyl H 1579 5 , 6-OCH20- CF3 C-≡C-cycPr CH3 1580 5 , 6-OCH20- CF3 C≡C-Ph CH3 1581 5,6-OCH20- CF3 C≡C-2 -Pyridyl CH3 1582 5,6-OCH20- CF3 C≡C-3 -Pyridyl CH3 1583 5,6-OCH20- CF3 C≡C-4 -Pyridyl C 3 1584 5,6-OCH20- CF3 C≡C-2 -f uranyl CH3 1585 5,6-OCH20- CF3 C≡C-3 -f uranyl CH3 1586 5,6-OCH20- CF3 C≡C-2 -thienyl H3 1587 5,6-OCH20- CF3 C≡C-3 -thienyl CH3 1588 5,6-OCH20- CF3 C=C-cycPr CH3 1589 5,6-OCH20- CF3 C=C-Ph CH3 1590 5,6-OCH20- CF3 C=C-2 -Pyridyl CH3 1591 5,6-OCH20- CF3 C=C-3 -Pyridyl CH3 1592 5,6-OCH20- CF3 C=C-4 -Pyridyl CH3 1593 5,6-OCH20- CF3 C=C-2 - f uranyl CH3
1594 5,6-OCH20- CF3 C=C-3-f uranyl CH3
1595 5,6-OCH20- CF3 C=C-2 -thienyl CH3
1596 5,6-OCH20- CF3 C=C-3- thienyl CH3
1597 5,6-OCH20- CF3 CH2CH2~cycPr CH3
1598 5,6-OCH20- CF3 CH2CH2-Ph CH3
1599 5,6-OCH20- CF3 CH2CH2-2-Pyridyl CH3
1600 5,6-OCH20- CF3 CH2CH2 -3 -Pyridyl CH3
1601 5,6-OCH20- CF3 CH2CH2 -4 -Pyridyl CH3
1602 5,6-OCH20- CF3 CH CH2 -2 -f uranyl CH3
1603 5,6-OCH20- CF3 CH2CH2 -3 -f uranyl CH3
1604 5,6-OCH20- CF3 CH2CH2-2 -thienyl CH3
1605 5,6-OCH20- CF3 CH2CH2 -3 -thienyl CH3
1606 5,6-OCH20- CF3 C≡C-cycPr CH2CH3
1607 5,6-OCH20- CF3 C≡C-Ph CH2CH3
1608 5,6-0CH2O- CF3 C≡C-2 -Pyridyl CH2CH3
1609 5,6-OCH20- CF3 C≡C-3 -Pyridyl CH2CH3
1610 5,6-OCH20- CF3 C≡C-4-Pyridyl CH2CH3
1611 5,6-OCH20- CF3 C≡C-2 - f uranyl CH2CH3
1612 5,6-OCH20- CF3 C≡C-3 - f uranyl CH2CH3
1613 5,6-OCH20- CF3 C≡C-2- thienyl CH2CH3
1614 5,6-OCH20- CF3 C≡C-3 -thienyl CH2CH3
1615 5,6-OCH20- CF3 C=C-cycPr CH2CH3
1616 5,6-OCH20- CF3 C=C-Ph CH2CH3
1617 5,6-OCH20- CF3 C=C-2- Pyridyl CH2CH3
1618 5,6-OCH20- CF3 C=C-3 -Pyridyl CH2CH3
1619 5,6-OCH20- CF3 C=C-4 -Pyridyl CH2CH3
1620 5,6-OCH20- CF3 C=C -2 -f uranyl CH2CH3
1621 5,6-OCH20- CF3 C=C-3-f uranyl CH2CH3
1622 5,6-OCH20- CF3 C=C-2 -thienyl CH2CH3
1623 5,6-OCH20- CF3 C=C-3 -thienyl CH2CH3
1624 5,6-OCH20- CF3 CH2CH2-cycPr CH2CH3
1625 5,6-OCH20- CF3 CH2CH2-Ph CH2CH3
1626 5,6-OCH20- CF3 CH2CH2 -2 -Pyridyl CH2CH3 1627 5,6-OCH20- CF3 CH2CH2-3 -Pyridyl CH2CH3
1628 5,6-OCH20- CF3 CH2CH2 -4 -Pyridyl CH2CH3
1629 5,6-OCH20- CF3 CH2CH2 -2 -f uranyl CH2CH3
1630 5,6-OCH20- CF3 CH2CH2 -3 -f uranyl CH2CH3
1631 5,6-OCH20- CF3 CH2CH2-2 -thienyl CH2CH3
1632 5,6-OCH20- CF3 CH2CH2 -3 -thienyl CH2CH3
^Unless otherwise indicated, stereochemisty is (+/-)
ro ro
H υ cu ro ro ro tn tn tn co ^ M υ
PH u H HuH Hu uMH PuH uW uH uH uH uMH MuH uPH tn u u tn tn tn u u u
fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa
PH u u u u u u u u u u u u u u u u u u u u u u u u u u u
rH rH rH rH rH rH rH r-A r-A rH -A r-A u u U U U u U u U U U u U
VO vo vo VO VD VO VO vo vo vo VO VO VO VO VO vo vo vo vo VO vo VO vo VO VO VD vo o
VO in vo 00 cn O H CM ro •>* in vo t- 00 rH rH CM CM CM CM CM CM CM CM CM
-C1 CF3 C≡C-iBu CH2CH3 -C1 CF3 C≡C-tBu CH2CH3 -C1 CF3 C≡C-Et CH2CH3 -C1 CF3 C≡C -Me CH2CH3 -C1 CF3 CH2C≡C-CH3 CH2CH3 -C1 CF3 CH2C≡C-CH2CH3 CH2CH3 -C1 CF3 CH2CH2CH (CH3 ) 2 CH2CH3 -C1 CF3 CH2CH2CH2CH3 CH2CH3 -C1 CF3 CH2CH2CH3 CH2CH3 -C1 CF3 CH2CH2-tBu CH2CH3 -MeO CF3 C≡C-Pr H -MeO CF3 C≡C-Bu H -MeO CF3 C≡C-iBu H -MeO CF3 C≡C-tBu H -MeO CF3 C≡C-Et H -MeO CF3 C≡C -Me H -MeO CF3 CH2C≡C-CH3 H -MeO CF3 CH2C≡C-CH2CH3 H -MeO CF3 CH2CH2CH2CH2CH3 H -MeO CF3 CH2CH2CH (CH3 ) 2 H -MeO CF3 CH2CH2CH2CH3 H -MeO CF3 CH2CH2CH3 H -MeO CF3 CH2CH2-tBu H -MeO CF3 CH2C≡C-CH3 H -MeO CF3 CH2C≡C-CH2CH3 H -MeO CF3 C≡C-iPr CH3 -MeO CF3 C≡C-Pr CH3 -MeO CF3 C≡C-Bu CH3 -MeO CF3 C≡C-iBu CH3 -MeO CF3 C≡C-tBu CH3 -MeO CF3 C≡C-Et CH3 -MeO CF3 C≡C-Me CH3 -MeO CF3 CH2C≡C-CH3 CH3 -MeO CF3 CH2C≡C-CH2CH3 CH3 -MeO CF3 CH2CH2CH(CH3)2 CH3 -MeO CF3 CH2CH2CH2CH3 CH3 -MeO CF3 CH2CH2CH3 CH3 -MeO CF3 CH2CH2-tBu CH3 -MeO CF3 C≡C-iPr CH2CH3 -MeO CF3 C≡C-Pr CH2CH3 -MeO CF3 C≡C-Bu CH2CH3 -MeO CF3 C≡C-iBu CH2CH3 -MeO CF3 C≡C-tBu CH2CH3 -MeO CF3 C≡C-Et CH2CH3 -MeO CF3 C≡C -Me CH2CH3 -MeO CF3 CH2C≡C-CH3 CH2CH3 -MeO CF3 CH2C≡C-CH2CH3 CH CH3 -MeO CF3 CH2CH2CH(CH3)2 CH2CH3 -MeO CF3 CH2CH2CH2CH3 CH2CH3 -MeO CF3 CH2CH2CH3 CH2CH3 -MeO CF3 CH2CH2-tBu CH2CH3 ,6-diF CF3 C≡C-Pr H ,6-diF CF3 C≡C-Bu H ,6-diF CF3 C≡C-iBu H ,6-diF CF3 C≡C-tBu H ,6-diF CF3 C≡C -Me H ,6-diF CF3 CH2C≡C-CH3 H ,6-diF CF3 CH2C≡C-CH2CH3 H ,6-diF CF3 CH2CH2CH2CH2CH3 H ,6-diF CF3 CH2CH2CH3 H ,6-diF CF3 CH2CH2-tBu H ,6-diF CF3 C≡C-iPr CH3 ,6-diF CF3 C≡C-Pr CH3 ,6-diF CF3 C≡C-Bu CH3 ,6-diF CF3 C≡C-iBu CH3 ,6-diF CF3 C≡C-tBu CH3 ,6-diF CF3 C≡C-Et CH3 ,6-diF CF3 C≡C -Me CH3 97 5,6-diF CF3_ C≡C-Ph CH3
98 5,6-diF CF3 CH2C≡C-CH3 CH3
99 5,6-diF CF3 CH C≡C-CH2CH3 CH3
100 5,6-diF CF3 CH2CH2CH(CH3)2 CH3
101 5,6-diF CF3 CH2CH2CH2CH3 CH3
102 5,6-diF CF3 CH2CH2CH3 CH3
103 5,6-diF CF3 CH2CH2-tBu CH3
104 5,6-diF CF3 C≡C-iPr CH2CH3
105 5,6-diF CF3 C-≡C-Pr CH2CH3
106 5,6-diF CF3 C≡C-Bu CH2CH3
107 5,6-diF CF3 C≡C-iBu CH2CH3
108 5,6-diF CF3 C≡C-tBu CH2CH3
109 5,6-diF CF3 C≡C-Et CH2CH3
110 5,6-diF CF3 C≡C -Me CH2CH3
111 5,6-diF CF3 CH2C≡C-CH3 CH2CH3
112 5,6-diF CF3 CH2C≡C-CH2CH3 CH2CH3
113 5,6-diF CF3 CH2CH2CH(CH3)2 CH2CH3
114 5,6-diF CF3 CH2CH2CH2CH3 CH2CH3
115 5,6-diF CF3 CH2CH2CH3 CH2CH3
116 5,6-diF CF3 CH CH2-tBu CH CH3
117 6-F CF3 C≡C-Pr H
118 6-F CF3 C≡C-Bu H
119 6-F CF3 C≡C-iBu H
120 6-F CF3 C≡C-tBu H
121 6-F CF3 C≡C-Me H
122 6-F CF3 CH2C≡C-CH2CH3 H
123 6-F CF3 CH2CH2CH2CH2CH-S H
124 6-F CF3 CH2CH2CH3 H
125 6-F CF3 CH2CH2-tBu H
126 6-F CF3 C≡C-iPr CH3
127 6-F CF3 C-≡C-Pr CH3
128 6-F CF3 C≡C-Bu CH3
129 6-F CF3 C≡C-iBu CH3
130 6-F CF3 C≡C-tBu CH3 ro ro o ©
00
ON
u u u u u u u u u u u u u
ro o ro
fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa u u u u u u u u u u u u u u u u u u u u u u u u u u u u u u u u u
fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa rH rH rH H r-f rH rH rH rH rH rH rH rH U U U U U u U U U U u u u vo vo vo vo vo vo vo vo O vo vo VO VO vo VO vo vo vo VD VD <-£> in in in in in m in in in in m m in t~
-n rH ro in vo r- 00 σv o rH CM ro in vo 00
00 en o rH CM ro in vo co cn CM ro ro ro ro ro ro ro ro ro ro • fi •sji in in in in in in in m in vo vo VO vo vo
0 rH rH rH rH rH x-A rH rH x-A rH rH rH rH rH rH rH rH rH rH x-A
ro ro t~ o ©
00
ON CΛ
H υcu
u u u u u u u u u u u u u u u u u u u u u u u u u u u u u u u u u u
iH rH rH rH rH rH rH rH rH rH rH rH rH rH lH rH rH rH rH rH rH rH rH rH rH rH iH
U U U U U U U U U U U U U U U U U U U U U U U U U U U fa fa fa fa fa fa fa I I I I I I I I I I I I I I I I I I I I I I I I I I I ιn ιn ιn ιn ιn Ln ιn ιn ιn ιn ιn ιn tn m ι-0 -n -n ιn ι/i Ln Ln -n ιn tn ιn ιn -n in m m in in in m
VO t^
«* in vo r- oo cn n cn cn cn x-A H H x-A rA
ro ro o
00 (»
H υ cu ro ro ro ro ro ro ro ro ro ro ro ro ro ro ro to ro o ro ro ro ro tn tn tn tn tn tή tn tn tn tn tn tn tn - |--H μ--ι π-ι μ-H tn tn tn tn tn tn tή tn tn X tn tn tή u u u u u u u u u u u u u u u u u u u u u u u u u u tn tn tn tn tn tn tn tn tn tή tn tή tn tn u u u u u u u u u u u u u
ro ro tn ro ro CO ro
fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa l u u u u u u u u u u u u u u u u u u u u u u fa u fa fa fa fa fa fa fa fa fa fa fa fa u U U U u u U U U U u U U
cn o o O O O o o o o o rH rH H H H CM CM CM CM CM CM CM CM CM CM ro ro n
CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CN CM CM CM CM
233 5-Cl, 6-F CF3 C≡C-Pr H
234 5-Cl, 6-F CF3 C≡C-Bu H
235 5-Cl, 6-F CF3 C≡C-iBu H
236 5-Cl, 6-F CF3 C≡C-tBu H
237 5-Cl, 6-F CF3 C≡C-Et H
238 5-Cl, 6-F CF3 C≡C -Me H
239 5-Cl, 6-F CF3 CH C≡C-CH3 H
240 5-Cl, 6-F CF3 CH2C≡C-CH2CH3 H
241 5-Cl, 6-F CF3 CH2CH2CH(CH3)2 H
242 5-Cl, 6-F CF3 CH2CH2CH2CH3 H
243 5-Cl, 6-F CF3 CH2CH2CH3 H
244 5-Cl, 6-F CF3 CH2CH2-tBu H
245 5-Cl, 6-F CF3 C≡C-iPr CH3
246 5-Cl, 6-F CF3 C≡C-Pr CH3
247 5-Cl, 6-F CF3 C≡C-Bu CH3
248 5-Cl, 6-F CF3 C-≡C-iBu CH3
249 5-Cl, 6-F CF3 C≡C-tBu CH3
250 5-Cl, 6-F CF3 C≡C-Et CH3
251 5-Cl, 6-F CF3 C≡C-Me CH3
252 5-Cl, 6-F CF3 CH2C≡C-CH3 CH3
253 5-Cl, 6-F CF3 CH2C≡C-CH2CH3 CH3
254 5-Cl, 6-F CF3 CH2CH2CH(CH3)2 CH3
255 5-Cl, 6-F CF3 CH2CH2CH2CH3 CH3
256 5-Cl, 6-F CF3 CH2CH2CH3 CH3
257 5-Cl, 6-F CF3 CH CH2-tBu CH3
258 6-C1.8-F CF3 C≡C-iPr H
259 6-Cl,8-F CF3 C≡C-Pr H
260 6-Cl,8-F CF3 C≡C-Bu H
261 6-Cl,8-F CF3 C≡C-iBu H
262 6-Cl,8-F CF3 C≡C-tBu H
263 6-Cl,8-F CF3 C≡C-Et H
264 6-Cl,8-F CF3 C≡C-Me H
265 6-Cl,8-F CF3 CH2C≡C-CH3 H
266 6-Cl,8-F CF3 CH2C≡C-CH CH3 H IO to to to to to to t to to to to to to to to to to to to to to to to to to to to to to to to to to o VD VO VO vo vo vo vo vo vo vo 00 00 00 00 00 00 00 00 00 00 -o I -J ^- o 1 -o -J -o o cn cn cn o VD 00 -J cn in ιP- OJ to P» o VD 00 -o cn in *- LO to H o VD 00 ^J cn in iP- 00 to P> o VD 00 •o
σi cn cn cn cn cn σ cn cn σi cn cn cn cn cn cn cn σ. cn cn cn cn cn cn cn σ σ cn cn cn σi cn cn cn I I I I I I I I I I I I I I I I I
O O O O O O O O O O O O O O O O O o O O O O O O O O O O O O O O O FI P, F' P' P' P, FJ PJ FJ PJ PJ PJ PJ PJ PJ F' P'
X tn tn tn X tn X tn tn tn tn tn tn tn tn tn tn 00 00 00 00 oo 00 oo 00 00 00 00 oo CO oo 00 oo 00
HJ HJ HJ HJ HJ HJ HJ HJ HJ HJ HJ HJ HJ HJ HJ HJ HJ
O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O o
HJ
301 6-CH3 CF3 C≡C-tBu CH3
302 6-CH3 CF3 C≡C-Et CH3
303 6-CH3 CF3 C≡C-Me CH3
304 6-CH3 CF3 CH2C≡C-CH3 CH3
305 6-CH3 CF3 CH2C≡C-CH2CH3 CH3
306 6-CH3 CF3 CH2CH2CH(CH3)2 CH3
307 6-CH3 CF3 CH2CH2CH2CH3 CH3
308 6-CH3 CF3 CH2CH2CH3 CH3
309 6-CH3 CF3 CH2CH2-tBu CH3
310 6-COCH3 CF3 C≡C-iPr H
311 6-COCH3 CF3 C≡C-Pr H
312 6-COCH3 CF3 C≡C-Bu H
313 6-COCH3 CF3 C≡C-iBu H
314 6-COCH3 CF3 C≡C-tBu H
315 6-COCH3 CF3 C≡C-Et H
316 6-COCH3 CF3 C≡C-Me H
317 6-NH2 CF3 C≡C-iPr H
318 6-NH2 CF3 C≡C-Pr H
319 6-NH2 CF3 C≡C-Bu H
320 6-NH2 CF3 C≡C-iBu H
321 6-NH2 CF3 C≡C-tBu H
322 6-NH2 CF3 C≡C-Et H
323 6-NH2 CF3 C≡C-Me H
326 6- Me2 CF3 C≡C-Bu H
327 6- MΘ2 CF3 C≡C-iBu H
328 6-NMe2 CF3 C≡C-tBu H
329 6-N e2 CF3 C≡C-Et H
330 6-NMe2 CF3 C≡C-Me H
331 7-C1 CF3 C≡C-iPr H
332 7-C1 CF3 C≡C-Pr H
333 7-C1 CF3 C≡C-Bu H
334 7-C1 CF3 C≡C-iBu H 335 7-C1 CF3 C≡C-tBu H
336 7-C1 CF3 C≡C-Et H
337 7-C1 CF3 C≡C-Me H
*Unless otherwise indicated, stereochemisty is (+/-)
Utility The compounds of this invention possess reverse transcriptase inhibitory activity, in particular, HIV inhibitory efficacy. The compounds of formula (I) possess HIV reverse transcriptase inhibitory activity and are therefore useful as antiviral agents for the treatment of HIV infection and associated diseases . The compounds of formula (I) possess HIV reverse transcriptase inhibitory activity and are effective as inhibitors of HIV growth. The ability of the compounds of the present invention to inhibit viral growth or infectivity is demonstrated in standard assay of viral growth or infectivity, for example, using the assay described below.
The compounds of formula (I) of the present invention are also useful for the inhibition of HIV in an ex vivo sample containing HIV or expected to be exposed to HIV. Thus, the compounds of the present invention may be used to inhibit HIV present in a body fluid sample (for example, a serum or semen sample) which contains or is suspected to contain or be exposed to HIV.
The compounds provided by this invention are also useful as standard or reference compounds for use in tests or assays for determining the ability of an agent to inhibit viral clone replication and/or HIV reverse transcriptase, for example in a pharmaceutical research program. Thus, the compounds of the present invention may be used as a control or reference compound in such assays and as a quality control standard. The compounds of the present invention may be provided in a commercial kit or container for use as such standard or reference compound.
Since the compounds of the present invention exhibit specificity for HIV reverse transcriptase, the compounds of the present invention may also be useful as diagnostic reagents in diagnostic assays for the detection of HIV reverse transcriptase. Thus, inhibition of the reverse transcriptase activity in an assay (such as the assays described herein) by a compound of the present invention would be indicative of the presence of HIV reverse transcriptase and HIV virus .
As used herein "μg" denotes microgram, "mg" denotes milligram, "g" denotes gram, "μL" denotes microliter, "mL" denotes milliliter, "L" denotes liter, "nM" denotes nanomolar, "μM" denotes micromolar, "mM" denotes millimolar, "M" denotes molar and "nm" denotes nanometer. "Sigma" stands for the Sigma-Aldrich Corp. of St. Louis, MO.
HIV RNA Assay
DNA Plasmids and in vitro RNA transcripts;
Plasmid pDAB 72 containing both gag and pol sequences of BH10 (bp 113-1816) cloned into PTZ 19R was prepared according to Erickson-Viitanen et al . AIDS Research and Human
Retroviruses 1989, 5, 577. The plasmid was linearized with Bam HI prior to the generation of in vitro RNA transcripts using the Riboprobe Gemini system II kit (Promega) with T7 RNA polymerase. Synthesized RNA was purified by treatment with RNase free DNAse (Promega) , phenol-chloroform extraction, and ethanol precipitation. RNA transcripts were dissolved in water, and stored at -70°C. The concentration of RNA was determined from the A260-
Probes t
Biotinylated capture probes were purified by HPLC after synthesis on an Applied Biosystems (Foster City, CA) DNA synthesizer by addition of biotin to the 5 ' terminal end of the oligonucleotide, using the biotin-phosphoramidite reagent of Cocuzza, Tet. Lett . 1989, 30, 6287. The gag biotinylated capture probe (5-biotin-CTAGCTCCCTGCTTGCCCATACTA 3') was complementary to nucleotides 889-912 of HXB2 and the pol biotinylated capture probe (5' -biotin -CCCTATCATTTTTGGTTTCCAT 3' ) was complementary to nucleotides 2374-2395 of HXB2. Alkaline phosphatase conjugated oligonucleotides used as reporter probes were prepared by Syngene (San Diego, CA.) . The pol reporter probe (5 ' CTGTCTTACTTTGATAAAACCTC 3 ' ) was complementary to nucleotides 2403-2425 of HXB2. The gag reporter probe ( 5 ' CCCAGTATTTGTCTACAGCCTTCT 3 ' ) was complementary to nucleotides 950-973 of HXB2. All nucleotide positions are those of the GenBank Genetic Sequence Data Bank as accessed through the Genetics Computer Group Sequence Analysis Software Package (Devereau Nucleic Acids Research 1984, 12, 387) . The reporter probes were prepared as 0.5 μM stocks in 2 x SSC (0.3 M NaCl, 0.03 M sodium citrate), 0.05 M Tris pH 8.8, 1 mg/mL BSA. The biotinylated capture probes were prepared as 100 μM stocks in water.
Streptavidin coated plates;
Streptavidin coated plates were obtained from Du Pont Biotechnology Systems (Boston, MA) .
Cells and virus stocks;
MT-2 and MT-4 cells were maintained in RPMI 1640 supplemented with 5% fetal calf serum (FCS) for MT-2 cells or 10% FCS for MT-4 cells, 2 mM -glutamine and 50 μg/mL gentamycin, all from Gibco. HIV-1 RF was propagated in MT-4 cells in the same medium. Virus stocks were prepared approximately 10 days after acute infection of MT-4 cells and stored as aliquots at -70°C. Infectious titers of HIV-l(RF) stocks were 1-3 x IO7 PFU (plaque forming units) /mL as measured by plaque assay on MT-2 cells (see below) . Each aliquot of virus stock used for infection was thawed only once.
For evaluation of antiviral efficacy, cells to be infected were subcultured one day prior to infection. On the day of infection, cells were resuspended at 5 x 10^ cells/mL in RPMI 1640, 5% FCS for bulk infections or at 2 x 106/mL in Dulbecco ' s modified Eagles medium with 5% FCS for infection in microtiter plates . Virus was added and culture continued for 3 days at 37°C.
HIV RNA assay;
Cell lysates or purified RNA in 3 M or 5 M GED were mixed with 5 M GED and capture probe to a final guanidinium isothiocyanate concentration of 3 M and a final biotin oligonucleotide concentration of 30 nM. Hybridization was carried out in sealed U bottom 96 well tissue culture plates (Nunc or Costar) for 16-20 hours at 37°C. RNA hybridization reactions were diluted three-fold with deionized water to a final guanidinium isothiocyanate concentration of 1 M and aliquots (150 μL) were transferred to streptavidin coated microtiter plates wells. Binding of capture probe and capture probe-RNA hybrid to the immobilized streptavidin was allowed to proceed for 2 hours at room temperature, after which the plates were washed 6 times with DuPont ELISA plate wash buffer (phosphate buffered saline (PBS), 0.05% Tween 20.) A second hybridization of reporter probe to the immobilized complex of capture probe and hybridized target RNA was carried out in the washed streptavidin coated well by addition of 120 μl of a hybridization cocktail containing 4 X SSC, 0.66% Triton X 100, 6.66% deionized formamide, 1 mg/rtιL BSA and 5 nM reporter probe. After hybridization for one hour at 37 C, the plate was again washed 6 times. Immobilized alkaline phosphatase activity was detected by addition of 100 μL of 0.2 mM 4-methylumbelliferyl phosphate
(MUBP, JBL Scientific) in buffer δ (2.5 M diethanolamine pH 8.9
(JBL Scientific), 10 mM MgCl2/ 5 mM zinc acetate dihydrate and 5 mM N-hydroxyethyl-ethylene-diamine-triacetic acid) . The plates were incubated at 37°C. Fluorescence at 450 nM was measured using a microplate fluorometer (Dynateck) exciting at 365 nM.
Microplate based compound evaluation in HIV-1 infected MT-2 cells; Compounds to be evaluated were dissolved in DMSO and diluted in culture medium to twice the highest concentration to be tested and a maximum DMSO concentration of 2% . Further three-fold serial dilutions of the compound in culture medium were performed directly in U bottom microtiter plates (Νunc) . After compound dilution, MT-2 cells (50 μL) were added to a final concentration of 5 x 10^ per mL (1 x 10^ per well) . Cells were incubated with compounds for 30 minutes at 37°C in a Cθ2 incubator. For evaluation of antiviral potency, an appropriate dilution of HIV-1 (RF) virus stock (50 μL) was added to culture wells containing cells and dilutions of the test compounds. The final volume in each well was 200 μL. Eight wells per plate were left uninfected with 50 μL of medium added in place of virus , while eight wells were infected in the absence of any antiviral compound. For evaluation of compound toxicity, parallel plates were cultured without virus infection.
After 3 days of culture at 37°C in a humidified chamber inside a C02 incubator, all but 25 μL of medium/well was removed from the HIV infected plates. Thirty seven μL of 5 M GED containing biotinylated capture probe was added to the settled cells and remaining medium in each well to a final concentration of 3 M GED and 30 nM capture probe. Hybridization of the capture probe to HIV RNA in the cell lysate was carried out in the same microplate well used for virus culture by sealing the plate with a plate sealer (Costar) , and incubating for 16-20 hrs in a 37°C incubator. Distilled water was then added to each well to dilute the hybridization reaction three-fold and 150 μL of this diluted mixture was transferred to a streptavidin coated microtiter plate. HIV RNA was quantitated as described above. A standard curve, prepared by adding known amounts of pDAB 72 in vitro RNA transcript to wells containing lysed uninfected cells, was run on each microtiter plate in order to determine the amount of viral RNA made during the infection.
In order to standardize the virus inoculum used in the evaluation of compounds for antiviral activity, dilutions of virus were selected which resulted in an IC90 value (concentration of compound required to reduce the HIV RNA level by 90%) for dideoxycytidine (ddC) of 0.2 μg/mL. IC90 values of other antiviral compounds, both more and less potent than ddC, were reproducible using several stocks of HIV-1 (RF) when this procedure was followed. This concentration of virus corresponded to ~3 x 10^ PFU (measured by plaque assay on MT-2 cells) per assay well and typically produced approximately 75% of the maximum viral RNA level achievable at any virus inoculum. For the HIV RNA assay, IC90 values were determined from the percent reduction of net signal (signal from infected cell samples minus signal from uninfected cell samples) in the RNA assay relative to the net signal from infected, untreated cells on the same culture plate (average of eight wells) . Valid performance of individual infection and RNA assay tests was judged according to three criteria. It was required that the virus infection should result in an RNA assay signal equal to or greater than the signal generated from 2 ng of pDAB 72 in vitro RNA transcript. The IC90 for ddC, determined in each assay run, should be between 0.1 and 0.3 μg/mL. Finally, the plateau level of viral RNA produced by an effective reverse transcriptase inhibitor should be less than 10% of the level achieved in an uninhibited infection. A compound was considered active if its IC90 was found to be less than 20μM. For antiviral potency tests, all manipulations in microtiter plates, following the initial addition of 2X concentrated compound solution to a single row of wells, were performed using a Perkin Elmer/Cetus ProPette.
Protein Binding and Mutant Resistance In order to characterize NNRTI analogs for their clinical efficacy potential the effect of plasma proteins on antiviral potency and measurements of antiviral potency against wild type and mutant variants of HIV which carry amino acid changes in the known binding site for NNRTIs were examined. The rationale for this testing strategy is two fold:
1. Many drugs are extensively bound to plasma proteins. Although the binding affinity for most drugs for the major components of human plasma, namely, human serum albumin (HSA) or alpha-1-acid glycoprotein (AAG) , is low, these major components are present in high concentration in the blood. Only free or unbound drug is available to cross the infected cell membrane for interaction with the target site (i.e., HIV-1 reverse transcriptase, HIV-1 RT) . Therefore, the effect of added HSA+AAG on the antiviral potency in tissue culture more closely reflects the potency of a given compound in the clinical setting. The concentration of compound required for 90% inhibition of virus replication as measured in a sensitive viral RNA-based detection method is designated the IC90. The fold increase in apparent IC90 for test compounds in the presence or added levels of HSA and AAG that reflect in vivo concentrations (45 mg/ml HSA, 1 mg/ml AAG) was then calculated. The lower the fold increase, the more compound will be available to interact with the target site. 2. The combination of the high rate of virus replication in the infected individual and the poor fidelity of the viral RT results in the production of a quasi-species or mixtures of HIV species in the infected individual. These species will include a majority wild type species, but also mutant variants of HIV and the proportion of a given mutant will reflect its relative fitness and replication rate.
Because mutant variants including mutants with changes in the amino acid sequence of the viral RT likely pre-exist in the infected individual's quasi-species, the overall potency observed in the clinical setting will reflect the ability of a drug to inhibit not only wild type HIV-1, but mutant variants as well. We thus have constructed, in a known genetic background, mutant variants of HIV-1 which carry amino acid substitutions at positions thought to be involved in NNRTI binding, and measured the ability of test compounds to inhibit replication of these mutant viruses. The concentration of compound required for 90% inhibition of virus replication as measured in a sensitive viral RNA-based detection method is designated the IC90. It is desirable to have a compound which has high activity against a variety of mutants.
Dosage and Formulation
The antiviral compounds of this invention can be administered as treatment for viral infections by any means that produces contact of the active agent with the agent's site of action, i.e., the viral reverse transcriptase, in the body of a mammal . They can be administered by any conventional means available for use in conjunction with pharmaceuticals , either as individual therapeutic agents or in a combination of therapeutic agents . They can be administered alone, but preferably are administered with a pharmaceutical carrier selected on the basis of the chosen route of administration and standard pharmaceutical practice. The dosage administered will, of course, vary depending upon known factors, such as the pharmacodynamic characteristics of the particular agent and its mode and route of administration; the age, health and weight of the recipient; the nature and extent of the symptoms; the kind of concurrent treatment; the frequency of treatment; and the effect desired. A daily dosage of active ingredient can be expected to be about 0.001 to about 1000 milligrams per kilogram of body weight, with the preferred dose being about 0.1 to about 30 mg/kg.
Dosage forms of compositions suitable for administration contain from about 1 mg to about 100 mg of active ingredient per unit . In these pharmaceutical compositions the active ingredient will ordinarily be present in an amount of about 0.5-95% by weight based on the total weight of the composition. The active ingredient can be administered orally in solid dosage forms, such as capsules, tablets and powders, or in liquid dosage forms, such as elixirs, syrups and suspensions. It can also be administered parenterally, in sterile liquid dosage forms.
Gelatin capsules contain the active ingredient and powdered carriers, such as lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like. Similar diluents can be used to make compressed tablets . Both tablets and capsules can be manufactured as sustained release products to provide for continuous release of medication over a period of hours . Compressed tablets can be sugar coated or film coated to mask any unpleasant taste and protect the tablet from the atmosphere, or enteric coated for selective disintegration in the gastrointestinal tract. Liquid dosage forms for oral administration can contain coloring and flavoring to increase patient acceptance. In general, water, a suitable oil, saline, aqueous dextrose (glucose) , and related sugar solutions and glycols such as propylene glycol or polyethylene glycols are suitable carriers for parenteral solutions . Solutions for parenteral administration preferably contain a water soluble salt of the active ingredient, suitable stabilizing agents, and if necessary, buffer substances. Antioxidizing agents such as sodium bisulfite, sodium sulfite, or ascorbic acid, either alone or combined, are suitable stabilizing agents. Also used are citric acid and its salts, and sodium EDTA. In addition, parenteral solutions can contain preservatives, such as benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol . Suitable pharmaceutical carriers are described in Remington 's Pharmaceutical Sciences, supra, a standard reference text in this field.
Useful pharmaceutical dosage-forms for administration of the compounds of this invention can be illustrated as follows :
Capsules
A large number of unit capsules can be prepared by filling standard two-piece hard gelatin capsules each with
100 mg of powdered active ingredient, 150 mg of lactose, 50 mg of cellulose, and 6 mg magnesium stearic.
Soft Gelatin Capsules
A mixture of active ingredient in a digestible oil such as soybean oil, cottonseed oil or olive oil can be prepared and injected by means of a positive displacement pump into gelatin to form soft gelatin capsules containing 100 mg of the active ingredient . The capsules should then be washed and dried.
Tablets A large number of tablets can be prepared by conventional procedures so that the dosage unit is 100 mg of active ingredient, 0.2 mg of colloidal silicon dioxide, 5 milligrams of magnesium stearate, 275 mg of macrocrystalline cellulose, 11 mg of starch and 98.8 mg of lactose. Appropriate coatings may be applied to increase palatability or delay absorption.
Suspension
An aqueous suspension can be prepared for oral administration so that each 5 mL contain 25 mg of finely divided active ingredient, 200 mg of sodium carboxymethyl cellulose, 5 mg of sodium benzoate, 1.0 g of sorbitol solution, U.S. P., and 0.025 mg of vanillin.
Injectable
A parenteral composition suitable for administration by injection can be prepared by stirring 1.5% by weight of active ingredient in 10% by volume propylene glycol and water. The solution is sterilized by commonly used techniques .
Combination of components (a) and (b) Each therapeutic agent component of this invention can independently be in any dosage form, such as those described above, and can also be administered in various ways, as described above. In the following description component (b) is to be understood to represent one or more agents as described previously. Thus, if components (a) and (b) are to be treated the same or independently, each agent of component (b) may also be treated the same or independently.
Components (a) and (b) of the present invention may be formulated together, in a single dosage unit (that is, combined together in one capsule, tablet, powder, or liquid, etc.) as a combination product. When component (a) and (b) are not formulated together in a single dosage unit, the component (a) may be administered at the same time as component (b) or in any order; for example component (a) of this invention may be administered first, followed by administration of component (b) , or they may be administered in the revserse order. If component (b) contains more that one agent, e.g., one RT inhibitor and one protease inhibitor, these agents may be administered together or in any order. When not administered at the same time, preferably the administration of component (a) and (b) occurs less than about one hour apart. Preferably, the route of administration of component (a) and (b) is oral. The terms oral agent, oral inhibitor, oral compound, or the like, as used herein, denote compounds which may be orally administered. Although it is preferable that component (a) and component (b) both be administered by the same route (that is, for example, both orally) or dosage form, if desired, they may each be administered by different routes (that is, for example, one component of the combination product may be administered orally, and another component may be administered intravenously) or dosage forms. As is appreciated by a medical practitioner skilled in the art, the dosage of the combination therapy of the invention may vary depending upon various factors such as the pharmacodynamic characteristics of the particular agent and its mode and route of administration, the age, health and weight of the recipient, the nature and extent of the symptoms, the kind of concurrent treatment, the frequency of treatment, and the effect desired, as described above.
The proper dosage of components (a) and (b) of the present invention will be readily ascertainable by a medical practitioner skilled in the art, based upon the present disclosure. By way of general guidance, typically a daily dosage may be about 100 milligrams to about 1.5 grams of each component. If component (b) represents more than one compound, then typically a daily dosage may be about 100 milligrams to about 1.5 grams of each agent of component (b) . By way of general guidance, when the compounds of component (a) and component (b) are administered in combination, the dosage amount of each component may be reduced by about 70- 80% relative to the usual dosage of the component when it is administered alone as a single agent for the treatment of HIV infection, in view of the synergistic effect of the combination. The combination products of this invention may be formulated such that, although the active ingredients are combined in a single dosage unit, the physical contact between the active ingredients is minimized. In order to minimize contact, for example, where the product is orally administered, one active ingredient may be enteric coated. By enteric coating one of the active ingredients, it is possible not only to minimize the contact between the combined active ingredients, but also, it is possible to control the release of one of these components in the gastrointestinal tract such that one of these components is not released in the stomach but rather is released in the intestines . Another embodiment of this invention where oral administration is desired provides for a combination product wherein one of the active ingredients is coated with a sustained-release material which effects a sustained-release throughout the gastrointestinal tract and also serves to minimize physical contact between the combined active ingredients. Furthermore, the sustained-released component can be additionally enteric coated such that the release of this component occurs only in the intestine. Still another approach would involve the formulation of a combination product in which the one component is coated with a sustained and/or enteric release polymer, and the other component is also coated with a polymer such as a lowviscosity grade of hydroxypropyl methylcellulose or other appropriate materials as known in the art, in order to further separate the active components . The polymer coating serves to form an additional barrier to interaction with the other component. In each formulation wherein contact is prevented between components
(a) and (b) via a coating or some other material, contact may also be prevented between the individual agents of component
(b) .
Dosage forms of the combination products of the present invention wherein one active ingredient is enteric coated can be in the form of tablets such that the enteric coated component and the other active ingredient are blended together and then compressed into a tablet or such that the enteric coated component is compressed into one tablet layer and the other active ingredient is compressed into an additional layer. Optionally, in order to further separate the two layers, one or more placebo layers may be present such that the placebo layer is between the layers of active ingredients. In addition, dosage forms of the present invention can be in the form of capsules wherein one active ingredient is compressed into a tablet or in the form of a plurality of microtablets, particles, granules or non-perils, which are then enteric coated. These enteric coated microtablets, particles, granules or non-perils are then placed into a capsule or compressed into a capsule along with a granulation of the other active ingredient.
These as well as other ways of minimizing contact between the components of combination products of the present invention, whether administered in a single dosage form or administered in separate forms but at the same time or concurrently by the same manner, will be readily apparent to those skilled in the art, based on the present disclosure. Pharmaceutical kits useful for the treatment of HIV infection, which comprise a therapeutically effective amount of a pharmaceutical composition comprising a compound of component (a) and one or more compounds of component (b) , in one or more sterile containers, are also within the ambit of the present invention. Sterilization of the container may be carried out using conventional sterilization methodology well known to those skilled in the art. Component (a) and component (b) may be in the same sterile container or in separate sterile containers . The sterile containers of materials may comprise separate containers, or one or more multi-part containers, as desired. Component (a) and component (b) , may be separate, or physically combined into a single dosage form or unit as described above. Such kits may further include, if desired, one or more of various conventional pharmaceutical kit components, such as for example, one or more pharmaceutically acceptable carriers, additional vials for mixing the components , etc . , as will be readily apparent to those skilled in the art. Instructions, either as inserts or as labels, indicating quantities of the components to be administered, guidelines for administration, and/or guidelines for mixing the components, may also be included in the kit.
Obviously, numerous modifications and variations of the present invention are possible in light of the above teachings. It is therefore to be understood that within the scope of the appended claims, the invention may be practiced otherwise than as specifically described herein.

Claims

WHAT IS CLAIMED AS NEW AND DESIRED TO BE SECURED BY LETTER PATENT OF UNITED STATES IS;
1. A compound of formula (I) :
I or a stereoisomer or pharmaceutically acceptable salt thereof, wherein:
R1 is C╬╣-3 alkyl substituted with 1-7 halogen;
R2 is selected from C1-5 alkyl substituted with 1-2 R4, C2-5 alkenyl substituted with 1-2 R4, and C2-5 alkynyl substituted with 1 R4;
R3, at each occurrence, is independently selected from C1-4 alkyl, OH, C1-4 alkoxy, F, Cl, Br, I, NR5R5a, N02, CN, C(0)R6, NHC(0)R7, and NHC (0)NR5R5a;
alternatively, if two R3's are present and are attached to adjacent carbons, then they may combine to form -OCH2O-;
R4 is selected from C3-5 cycloalkyl substituted with 0-2 R3 , phenyl substituted with 0-5 R3, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from O, N, and S, substituted with 0-2 R3 ;
R5 and R5a are independently selected from H and C1-3 alkyl;
R6 is selected from H, OH, C1-4 alkyl, C1-4 alkoxy, and NR5R5a;
R7 is selected from C1-3 alkyl and C1-.3 alkoxy;
R8 is selected from H, C3-.5 cycloalkyl, and C1-3 alkyl; and, n is selected from 0, 1, 2, 3, and 4.
2. A compound according to Claim 1, wherein:
R1 is C╬╣-3 alkyl substituted with 1-7 halogen;
R2 is selected from C1-.5 alkyl substituted with 1 R4, C2-.5 alkenyl substituted with 1 R4, and C2-5 alkynyl substituted with 1 R4;
R3, at each occurrence, is independently selected from C1-.4 alkyl, OH, C1-.4 alkoxy, F, Cl, Br, I, NR5R5a, N02, CN, C(0)R6, NHC(0)R7, and NHC (0)NR5R5a;
alternatively, if two R3 ' s are present and are attached to adjacent carbons, then they may combine to form -OCH20-;
R4 is selected from C3_5 cycloalkyl substituted with 0-2 R3, phenyl substituted with 0-2 R3, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from O, N, and S, substituted with 0-1 R3 ;
R5 and R5a are independently selected from H, CH3 and C2H5;
R6 is selected from H, OH, CH3, C2H5, OCH3, OC2H5, and NR5R5a;
R7 is selected from CH3, C2H5, OCH3, and OC2H5;
R8 s selected from H, cyclopropyl, CH3 and C2H5; and,
n is selected from 0, 1, 2, and 3.
3. A compound according to Claim 2, wherein:
R1 is selected from CF3, and C2F5; R2 is selected from C1-3 alkyl substituted with 1 R4, C2_3 alkenyl substituted with 1 R4 , and C2-3 alkynyl substituted with 1 R4;
R3, at each occurrence, is independently selected from C1-.3 alkyl, OH, C╬╣_3 alkoxy, F, Cl, Br, I, NR5R5a, N02, CN,
C(0)R6, NHC(0)R7, and NHC (0)NR5R5 ;
alternatively, if two R3's are present and are attached to adjacent carbons, then they may combine to form -OCH2O-;
R4 is selected from C3-5 cycloalkyl substituted with 0-2 R3, phenyl substituted with 0-2 R3 , and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from 0, N, and S, substituted with 0-1 R3;
R5 and R5a are independently selected from H, CH3 and C2H5;
R6 is selected from H, OH, CH3, C2H5, OCH3, OC2H5, and NR5R5 ;
R7 is selected from CH3, C2H5, OCH3 , and OC2H5;
R8 s selected from H, CH3 and C2H5; and,
n is selected from 0, 1, and 2.
4. A compound according to Claim 3, wherein:
R1 is CF ;
R2 is selected from C1-3 alkyl substituted with 1 R4, C2-3 alkenyl substituted with 1 R4, and C2-3 alkynyl substituted with 1 R4; R3, at each occurrence, is independently selected from C╬╣_3 alkyl, OH, C1-3 alkoxy, F, Cl, NR5R5a, N02, CN, C(0)R6, NHC(0)R7, and NHC (0)NR5R5a;
alternatively, if two R3 ' s are present and are attached to adjacent carbons, then they may combine to form -OCH20-;
R4 is selected from cyclopropyl substituted with 0-1 R3 , phenyl substituted with 0-2 R3, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from 0, N, and S, substituted with 0-1 R3 , wherein the heterocyclic system is selected from 2-pyridyl, 3- pyridyl, 4-pyridyl, 2-furanyl, 3-furanyl, 2-thienyl, 3- thienyl, 2-oxazolyl, 2-thiazolyl, 4-isoxazolyl, and 2- imidazolyl;
R5 and R5a are independently selected from H, CH3 and C2H5;
R6 is selected from H, OH, CH3, C2H5, 0CH3, OC2H5, and NR5R5a;
R7 is selected from CH3, C2H5, OCH3 , and OC2H5;
R8 is selected from H, CH3 and C2H5; and,
n is selected from 1 and 2.
5. A compound according to Claim 4 , wherein the compound is of formula la:
Ia.
6. A compound according to Claim 4, wherein the compound is of formula la: lb .
7. A compound according to Claim 1 , wherein the compound is selected from:
(+/-) -6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+/-) -6-Chloro-4- (2-pyridyl) ethynyl-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+/-) -6-Chloro-4-phenylethynyl-4-trifluoromethyl-3 , 4-dihydro- 2 (IH) -quinazolinone;
(+/-) -4-Cyclopropylethynyl-6-methoxy-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+/-) -6-Methoxy-4- (2-pyridyl) ethynyl-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+/-) -6-Methoxy-4-phenylethynyl-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+/-) -4-Cyclopropylethynyl-5, 6-difluoro-4-trifluoromethyl-
3 , 4-dihydro-2 (IH) -quinazolinone;
(+/-) -5, 6-Difluoro-4- (2-pyridyl) ethynyl-4-trifluoromethyl- 3 , 4-dihydro-2 (IH) -quinazolinone;
(+/-) -5, 6-Difluoro-4-phenylethynyl-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone; (+/-) -4-Cyclopropylethynyl-6-fluoro-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+/-) -6-Fluoro-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3, 4- dihydro-2 (IH) -quinazolinone;
(+/-) -6-Fluoro-4-phenylethynyl-4-trifluoromethyl-3 , 4-dihydro- 2 (IH) -quinazolinone;
(+/-)-6-Fluoro-4- (2' -2-pyridyl) ethyl-4-trifluoromethyl-3, 4- dihydro-2 (IH) -quinazolinone;
(+/-) -6-Fluoro-4-phenylethyl-4-trifluoromethyl-3 , 4-dihydro-
2 (IH) -quinazolinone;
(-) -6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+) -6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+) -4-Cyclopropylethynyl-5, 6-difluoro-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(-) -4-Cyclopropylethynyl-5, 6-difluoro-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+) -E-4-Cyclopropylethenyl-5, 6-difluoro-4-trifluoromethyl- 3 , 4-dihydro-2 (IH) -quinazolinone; and,
(-) -6-Chloro-4-E-cyclopropylethenyl-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
or a pharmaceutically acceptable salt thereof.
8. A compound according of formula II:
II or a stereoisomer or pharmaceutically acceptable salt thereof , wherein:
R2 is CΓëíC-R4a;
R3 is selected from C1-.4 alkyl, OH, C1-.4 alkoxy, F, Cl, Br, I, NR5R5a, N02, CN, C(0)R6, NHC(0)R7, and NHC (0)NR5R5 ;
R4a is selected from methyl, ethyl, n-propyl, i-propyl, i-butyl, t-butyl, and i-pentyl;
R5 and R5a are independently selected from H and C╬╣-3 alkyl;
R6 is selected from H, OH, C1-4 alkyl, C1-4 alkoxy, and NR5R5a;
R7 is selected from C╬╣_3 alkyl and C╬╣-3 alkoxy;
R8 is selected from H, C3_5 cycloalkyl, and C╬╣_3 alkyl; and,
n is selected from 0, 1, 2, 3, and 4.
9. A compound according to Claim 8, wherein:
R2 is CΓëíC-R4a;
R3 is selected from C1-4 alkyl, OH, C1-.4 alkoxy, F, Cl, Br, I, NR5R5a, N02, CN, C(0)R6, and NHC(0)R7;
Ra is selected from methyl, ethyl, n-propyl, i-propyl, i-butyl, t-butyl, and i-pentyl;
R5 and R5a are independently selected from H, CH3 and C2H5; R6 is selected from H, OH, CH3 , C2H5, OCH3, OC2H5, and NR5R5a;
R7 is selected from CH3, C2H5, OCH3 , and OC2H5;
R8 is selected from H, cyclopropyl, CH3 and C2H5; and,
n is selected from 0, 1, and 2.
10. A compound according to Claim 9, wherein the compound is of formula Ila:
Ila.
11. A compound according to Claim 9, wherein the compound is of formula lib:
lib.
12. A compound according to Claim 8 , wherein the compound is selected from:
(+/-) -6-Chloro-4-isopropylethynyl-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+/-) -6-Chloro-4-ethylethynyl-4-trifluoromethyl-3 , 4-dihydro- 2 (IH) -quinazolinone; (+/-) -4-Isopropylethynyl-6-methoxy-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+/-) -5, 6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+/-) -5, 6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+/-) -5, 6-Difluoro-4-isopentyl-4-trifluoromethyl-3, 4-dihydro- 2 (IH) -quinazolinone;
(+/-) -6-Fluoro-4-isopropylethynyl-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+/-) -6-Fluoro-4-ethylethynyl-4-trifluoromethyl-3 , 4-dihydro-
2 (IH) -quinazolinone;
(-) -5, 6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(+) -5, 6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3 , 4- dihydro-2 (IH) -quinazolinone;
(-) -5, 6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3, 4- dihydro-2 (IH) -quinazolinone; and,
(+) -5, 6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3, 4- dihydro-2 (IH) -quinazolinone;
or a pharmaceutically acceptable salt thereof .
13. A pharmaceutical composition, comprising: a pharmaceutically acceptable carrier and a therapeutically effective amount of a compound of one of Claims 1-12 or a pharmaceutically acceptable salt form thereof.
14. A method for treating HIV infection, comprising: administering to a host in need of such treatment a therapeutically effective amount of a compound of one of Claims 1-12, or a pharmaceutically acceptable salt form thereof .
15. A method of treating HIV infection which comprises administering, in combination, to a host in need thereof a therapeutically effective amount of :
(a) a compound of one of Claims 1-12 or stereoisomeric forms, mixtures of stereoisomeric forms, or pharmaceutically acceptable salts thereof; and, (b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors .
16. A method according to Claim 15, wherein the reverse transcriptase inhibitor is selected from AZT, 3TC, ddl, ddC, d4T, delavirdine, TIBO derivatives, BI-RG-587, nevirapine, L- 697,661, LY 73497, Ro 18,893, loviride, trovirdine, MKC-442, and HBY 097, and the protease inhibitor is selected from saquinavir, ritonavir, indinavir, VX-478, nelfinavir, KNI- 272, CGP-61755, U-140690, and ABT-378.
17. A method according to Claim 16, wherein the reverse transcriptase inhibitor is selected from AZT and 3TC and the protease inhibitor is selected from saquinavir, nelfinavir, ritonavir, and indinavir.
18. A pharmaceutical kit useful for the treatment of HIV infection, which comprises a therapeutically effective amount of : (a) a compound of one of Claims 1-12 or stereoisomeric forms, mixtures of stereoisomeric forms, or pharmaceutically acceptable salts thereof; and,
(b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors, in one or more sterile containers.
EP98913401A 1997-04-09 1998-04-07 4,4-disubstituted-3,4-dihydro-2(1h)-quinazolinones useful as hiv reverse transcriptase inhibitors Withdrawn EP0973753A2 (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US83854097A 1997-04-09 1997-04-09
US838540 1997-04-09
US7132298P 1998-01-14 1998-01-14
US71322P 1998-01-14
PCT/US1998/006733 WO1998045276A2 (en) 1997-04-09 1998-04-07 4,4-disubstituted-3,4-dihydro-2(1h)-quinazolinones useful as hiv reverse transcriptase inhibitors

Publications (1)

Publication Number Publication Date
EP0973753A2 true EP0973753A2 (en) 2000-01-26

Family

ID=26752095

Family Applications (1)

Application Number Title Priority Date Filing Date
EP98913401A Withdrawn EP0973753A2 (en) 1997-04-09 1998-04-07 4,4-disubstituted-3,4-dihydro-2(1h)-quinazolinones useful as hiv reverse transcriptase inhibitors

Country Status (19)

Country Link
EP (1) EP0973753A2 (en)
JP (1) JP2002504095A (en)
KR (1) KR20010006146A (en)
CN (1) CN1252063A (en)
AR (1) AR012340A1 (en)
AU (1) AU734928B2 (en)
BR (1) BR9808513A (en)
CA (1) CA2284996A1 (en)
EA (1) EA001991B1 (en)
EE (1) EE9900452A (en)
HR (1) HRP980143A2 (en)
HU (1) HUP0001446A3 (en)
IL (1) IL132188A0 (en)
NO (1) NO314936B1 (en)
NZ (1) NZ500592A (en)
PL (1) PL336305A1 (en)
SK (1) SK137899A3 (en)
TW (1) TW587078B (en)
WO (1) WO1998045276A2 (en)

Families Citing this family (46)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999050253A1 (en) * 1998-03-27 1999-10-07 Du Pont Pharmaceuticals Company 4,4-disubstituted-3,4-dihydro-2(1h)-quinazolinthione derivatives, their preparation and their use as hiv reverse transcriptase inhibitors
WO2000021565A1 (en) 1998-10-13 2000-04-20 Du Pont Pharmaceuticals Company Selective eradication of virally-infected cells by combined use of a cytotoxic agent and an antiviral agent
US6225317B1 (en) * 1998-11-19 2001-05-01 Dupont Pharmaceuticals Company Crystalline (-)-6-chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone
HRP990359A2 (en) * 1998-11-19 2000-08-31 Du Pont Pharm Co A process for the preparation of quinazolinones
US6175009B1 (en) 1999-11-18 2001-01-16 Dupont Pharmaceuticals Company Process for the preparation of quinazolinones
AU1782301A (en) * 1999-11-23 2001-06-04 Smithkline Beecham Corporation 3,4-dihydro-(1h)quinazolin-2-one compounds as csbp/p39 kinase inhibitors
US6759410B1 (en) 1999-11-23 2004-07-06 Smithline Beecham Corporation 3,4-dihydro-(1H)-quinazolin-2-ones and their use as CSBP/p38 kinase inhibitors
AU2001249161A1 (en) * 2000-03-23 2001-10-03 Bristol-Myers Squibb Pharma Company Asymmetric synthesis of quinazolin-2-ones useful as hiv reverse transcriptase inhibitors
US6555686B2 (en) * 2000-03-23 2003-04-29 Bristol-Myers Squibb Pharma Asymmetric synthesis of quinazolin-2-ones useful as HIV reverse transcriptase inhibitors
US6596729B2 (en) 2000-07-20 2003-07-22 Bristol-Myers Squibb Company Tricyclic-2-pyridone compounds useful as HIV reverse transcriptase inhibitors
ZA200300255B (en) 2000-07-20 2004-09-28 Bristol Myers Squibb Pharma Co Tricyclic 2-pyridone compounds useful as HIV reverse transcriptase inhibitors.
US8641644B2 (en) 2000-11-21 2014-02-04 Sanofi-Aventis Deutschland Gmbh Blood testing apparatus having a rotatable cartridge with multiple lancing elements and testing means
US7025774B2 (en) 2001-06-12 2006-04-11 Pelikan Technologies, Inc. Tissue penetration device
US9795747B2 (en) 2010-06-02 2017-10-24 Sanofi-Aventis Deutschland Gmbh Methods and apparatus for lancet actuation
US9226699B2 (en) 2002-04-19 2016-01-05 Sanofi-Aventis Deutschland Gmbh Body fluid sampling module with a continuous compression tissue interface surface
US9427532B2 (en) 2001-06-12 2016-08-30 Sanofi-Aventis Deutschland Gmbh Tissue penetration device
US8702624B2 (en) 2006-09-29 2014-04-22 Sanofi-Aventis Deutschland Gmbh Analyte measurement device with a single shot actuator
US9795334B2 (en) 2002-04-19 2017-10-24 Sanofi-Aventis Deutschland Gmbh Method and apparatus for penetrating tissue
US9314194B2 (en) 2002-04-19 2016-04-19 Sanofi-Aventis Deutschland Gmbh Tissue penetration device
US9248267B2 (en) 2002-04-19 2016-02-02 Sanofi-Aventis Deustchland Gmbh Tissue penetration device
US8579831B2 (en) 2002-04-19 2013-11-12 Sanofi-Aventis Deutschland Gmbh Method and apparatus for penetrating tissue
US8784335B2 (en) 2002-04-19 2014-07-22 Sanofi-Aventis Deutschland Gmbh Body fluid sampling device with a capacitive sensor
US7198606B2 (en) 2002-04-19 2007-04-03 Pelikan Technologies, Inc. Method and apparatus for a multi-use body fluid sampling device with analyte sensing
US7547287B2 (en) 2002-04-19 2009-06-16 Pelikan Technologies, Inc. Method and apparatus for penetrating tissue
US20050020517A1 (en) * 2002-12-16 2005-01-27 Boehringer Ingelheim Pharmaceuticals, Inc. Treatment of HIV infection through combined administration of tipranavir and capravirine
US8574895B2 (en) 2002-12-30 2013-11-05 Sanofi-Aventis Deutschland Gmbh Method and apparatus using optical techniques to measure analyte levels
WO2006001797A1 (en) 2004-06-14 2006-01-05 Pelikan Technologies, Inc. Low pain penetrating
EP1671096A4 (en) 2003-09-29 2009-09-16 Pelikan Technologies Inc Method and apparatus for an improved sample capture device
US9351680B2 (en) 2003-10-14 2016-05-31 Sanofi-Aventis Deutschland Gmbh Method and apparatus for a variable user interface
WO2005065414A2 (en) 2003-12-31 2005-07-21 Pelikan Technologies, Inc. Method and apparatus for improving fluidic flow and sample capture
US8828203B2 (en) 2004-05-20 2014-09-09 Sanofi-Aventis Deutschland Gmbh Printable hydrogels for biosensors
US9775553B2 (en) 2004-06-03 2017-10-03 Sanofi-Aventis Deutschland Gmbh Method and apparatus for a fluid sampling device
EP1765194A4 (en) 2004-06-03 2010-09-29 Pelikan Technologies Inc Method and apparatus for a fluid sampling device
WO2009126900A1 (en) 2008-04-11 2009-10-15 Pelikan Technologies, Inc. Method and apparatus for analyte detecting device
US9375169B2 (en) 2009-01-30 2016-06-28 Sanofi-Aventis Deutschland Gmbh Cam drive for managing disposable penetrating member actions with a single motor and motor and control system
US8440693B2 (en) 2009-12-22 2013-05-14 Novartis Ag Substituted isoquinolinones and quinazolinones
US8965476B2 (en) 2010-04-16 2015-02-24 Sanofi-Aventis Deutschland Gmbh Tissue penetration device
CN102060786A (en) * 2011-01-20 2011-05-18 天津大学 4-(substituted-1,3-diyne)-4-(trifluoromethyl)-3,4-dihydro substituted quinazoline-2-ketone compound as well as preparation method and application thereof
US9839684B2 (en) * 2011-04-06 2017-12-12 Biovaxim Limited Pharmaceutical compositions comprising inactivated HIV viral particles and non-pathogenic lactobacilli for the induction of antigen-specific immunotolerance
US9365576B2 (en) 2012-05-24 2016-06-14 Novartis Ag Pyrrolopyrrolidinone compounds
US9403827B2 (en) 2013-01-22 2016-08-02 Novartis Ag Substituted purinone compounds
WO2014115080A1 (en) 2013-01-22 2014-07-31 Novartis Ag Pyrazolo[3,4-d]pyrimidinone compounds as inhibitors of the p53/mdm2 interaction
EA029312B1 (en) 2013-05-27 2018-03-30 Новартис Аг Imidazopyrrolidinone derivatives and their use in the treatment of diseases
ES2656471T3 (en) 2013-05-28 2018-02-27 Novartis Ag Pyrazolo-pyrrolidin-4-one derivatives as BET inhibitors and their use in the treatment of diseases
AU2014272700B2 (en) 2013-05-28 2016-12-01 Novartis Ag Pyrazolo-pyrrolidin-4-one derivatives and their use in the treatment of disease
US9550796B2 (en) 2013-11-21 2017-01-24 Novartis Ag Pyrrolopyrrolone derivatives and their use as BET inhibitors

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2436792A (en) * 1991-08-16 1993-03-16 Merck & Co., Inc. Quinazoline derivatives as inhibitors of hiv reverse transcriptase
IL102764A0 (en) * 1991-08-16 1993-01-31 Merck & Co Inc Quinazoline derivatives,and pharmaceutical compositions containing them
HUT71401A (en) * 1992-05-07 1995-11-28 Merck & Co Inc New quinazolines as inhibitors of hiv reverse transcriptase
US5519021A (en) * 1992-08-07 1996-05-21 Merck & Co., Inc. Benzoxazinones as inhibitors of HIV reverse transcriptase
DE4320347A1 (en) * 1993-06-19 1994-12-22 Boehringer Mannheim Gmbh Quinazoline derivatives and medicaments containing them
GB2281297A (en) * 1993-08-27 1995-03-01 Merck & Co Inc Quinazoline compounds
WO1995012583A1 (en) * 1993-11-05 1995-05-11 Merck & Co., Inc. New quinazolines as inhibitors of hiv reverse transcriptase
US5434152A (en) * 1993-11-08 1995-07-18 Merck & Co., Inc. Asymmetric synthesis of (S)-(-)-6-chloro-4- cyclopropyl-3,4-dihydro-4-[(2-pyridyl)ethynyl]-2(1H)-quinazolinone

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9845276A2 *

Also Published As

Publication number Publication date
WO1998045276A2 (en) 1998-10-15
KR20010006146A (en) 2001-01-26
EA001991B1 (en) 2001-10-22
HRP980143A2 (en) 1999-02-28
IL132188A0 (en) 2001-03-19
EA199900907A1 (en) 2000-04-24
HUP0001446A2 (en) 2001-05-28
NO994904L (en) 1999-12-01
HUP0001446A3 (en) 2001-11-28
SK137899A3 (en) 2000-05-16
NO314936B1 (en) 2003-06-16
BR9808513A (en) 2000-05-23
CN1252063A (en) 2000-05-03
AR012340A1 (en) 2000-10-18
CA2284996A1 (en) 1998-10-15
NZ500592A (en) 2001-09-28
JP2002504095A (en) 2002-02-05
NO994904D0 (en) 1999-10-08
WO1998045276A3 (en) 1999-01-14
EE9900452A (en) 2000-04-17
AU734928B2 (en) 2001-06-28
PL336305A1 (en) 2000-06-19
AU6796098A (en) 1998-10-30
TW587078B (en) 2004-05-11

Similar Documents

Publication Publication Date Title
AU734928B2 (en) 4,4-disubstituted-3,4-dihydro-2(1H)-quinazolinones useful as HIV reverse transcriptase inhibitors
EP1222186A2 (en) Condensed naphthyridines as hiv reverse transcriptase inhibitors
US6124302A (en) 4,4-disubstituted-3,4-dihydro-2(1H)-quinazolinones useful as HIV reverse transcriptase inhibitors
EP1474424A1 (en) Tricyclic 2-pyrimidone compounds useful as hiv reverse transcriptase inhibitors
WO2002085365A1 (en) Tricyclic compounds useful as hiv reverse transcriptase inhibitors
US6127375A (en) 4,4-disubstituted-3,4-dihydro-2(1H)-quinazolinthiones useful as HIV reverse transcriptase inhibitors
US6204262B1 (en) 1,3-Benzodiazepin-2-ones and 1,3-Benzoxazepin-2-ones useful as HIV reverse transcriptase inhibitors
US6090821A (en) Substituted quinolin-2 (1H)-ones useful as HIV reverse transcriptase inhibitors
US6946469B2 (en) Cyanamide, alkoxyamino, and urea derivatives of 4,4-disubstituted-3,4-dihydro-2(1H)-quinazolinones as HIV reverse transcriptase inhibitors
JP2001514256A (en) 5,5-Disubstituted-1,5-dihydro-4,1-benzoxazepin-2 (3H) -ones useful as HIV reverse transcriptase inhibitors
US20040063734A1 (en) 4,4-Disubstituted-3,4-dihydro-2 (1H)-quinazoliniones useful as HIV reverse transcriptase inhibitors
US6265406B1 (en) Substituted quinolin-2 (1H) -ones useful as HIV reverse transcriptase inhibitors
US6462037B1 (en) 1,4-benzodiazepin-2-ones useful as HIV reverse transcriptase inhibitors
AU7371301A (en) 4,4-disubstituted-3,4-dihydro-2-)1H)- quinazolinones useful as HIV reverse transcriptase inhibitors
CZ352499A3 (en) 4,4-disubstituted-3,4-dihydro-2 (1H)-quinazolinones suitable as inhibitors of HIV reverse transcriptase
US7015214B2 (en) Cyanamide, alkoxyamino, and urea derivatives of 1,3-benzodiazepine as HIV reverse transcriptase inhibitors
MXPA99008909A (en) 4,4-disubstituted-3,4-dihydro-2(1h)-quinazolinones useful as hiv reverse transcriptase inhibitors
AU2002254652A1 (en) Tricyclic compounds useful as HIV reverse transcriptase inhibitors
AU2003203047A1 (en) Tricyclic 2-pyrimidone compounds useful as HIV reverse transcriptase inhibitors

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19990923

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LI LU NL PT SE

AX Request for extension of the european patent

Free format text: LT PAYMENT 19990923;LV PAYMENT 19990923;RO PAYMENT 19990923;SI PAYMENT 19990923

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: BRISTOL-MYERS SQUIBB PHARMA COMPANY

17Q First examination report despatched

Effective date: 20021025

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: BRISTOL-MYERS SQUIBB PHARMA COMPANY

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20051107