NZ500592A

NZ500592A - 4,4-disubstituted-3,4-dihydro-2(1H)-quinazolinones useful as HIV reverse transcriptase inhibitors

Info

Publication number: NZ500592A
Application number: NZ500592A
Authority: NZ
Inventors: Jeffrey W Corbett; Soo Sung Ko
Original assignee: Du Pont Pharm Co
Priority date: 1997-04-09
Filing date: 1998-04-07
Publication date: 2001-09-28
Also published as: KR20010006146A; EA199900907A1; JP2002504095A; HUP0001446A2; AU734928B2; EP0973753A2; NO314936B1; HRP980143A2; EE9900452A; WO1998045276A3; TW587078B; BR9808513A; CN1252063A; NO994904L; SK137899A3; WO1998045276A2; EA001991B1; PL336305A1; IL132188A0; AU6796098A

Abstract

Compounds of formula (I) are useful as inhibitors of HIV reverse transcriptase. In formula (I); R1 is C1-3 alkyl substituted with 1-7 halogen; R2 is selected from C1-5 alkyl substituted with 1-2 R4, C2-5 alkenyl substituted with 1-2 R4, and C2-5 alkynyl substituted with 1 R4; R3, at each occurrence, is independently selected from C1-4 alkyl, OH, C1-4 alkoxy, F, Cl, Br, I, NR5R5a, NO2, CN, C(O)R6, NHC(O)R7 and NHC(O)NR5R5a; alternatively, if two R3's are present and are attached to adjacent carbons, then they may combine to form -OCH2O-; R4 is selected from C3-5 cycloalkyl substituted with 0-2 R3, phenyl substituted with 0-5 R3, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from O, N, and S, substituted with 0-2 R3; R5 and R5a are independently selected from H and C1-3 alkyl; R6 is selected from H, OH, C1-4 alkyl, C1-4 alkoxy, and NR5R5a; R7 is selected from C1-3 alkyl and C1-3 alkoxy; R8 is selected from H, C3-5 cycloalkyl, and C1-3 alkyl; and n is selected from 0, 1, 2, 3 and 4.

Description

<div class="application article clearfix" id="description"> WO 98/45276 PCT/US98/06733 title 4,4-DISUBSTITUTED-3,4-DIHYDRO-2(1H)-QUINAZOLINONES USEFUL AS HIV REVERSE TRANSCRIPTASE INHIBITORS FIELD OF THE INVENTION This invention relates generally to 4,4-disubstituted-3 , 4-dihydro-2(1H)-quinazolinones which are useful as inhibitors of HIV reverse transcriptase, pharmaceutical compositions and diagnostic kits comprising the same, methods of using the same for treating viral infection or as assay standards or reagents, and intermediates and processes for making the same. background of the invention Two distinct retroviruses, human immunodeficiency virus (HIV) type-1 (HIV-1) or type-2 (HIV-2), have been etiologically linked to the immunosuppressive disease, acquired immunodeficiency syndrome (AIDS). HIV seropositive individuals are initially asymptomatic but typically develop AIDS related complex (ARC) followed by AIDS. Affected individuals exhibit severe immunosuppression which predisposes them to debilitating and ultimately fatal opportunistic infections. The disease AIDS is the end result of an HIV-1 or HIV-2 virus following its own complex life cycle. The virion life cycle begins with the virion attaching itself to the host human T-4 lymphocyte immune cell through the bonding of a glycoprotein on the surface of the virion1s protective coat with the CD4 glycoprotein on the lymphocyte cell. Once attached, the virion sheds its glycoprotein coat, penetrates into the membrane of the host cell, and uncoats its RNA. The virion enzyme, reverse transcriptase, directs the process of transcribing the RNA into single-stranded DNA. The viral RNA is degraded and a second DNA strand is created. The now double-stranded DNA is integrated into the human cell * s genes and those genes are used for virus reproduction. Printed from Mimosa WO 98/45276 PCT/US98/06733 At this point, RNA polymerase transcribes the integrated DNA into viral RNA. The viral RNA is translated into the precursor gag-pol fusion polyprotein. The polyprotein is then cleaved by the HIV protease enzyme to yield the mature 5 viral proteins. Thus, HIV protease is responsible for regulating a cascade of cleavage events that lead to the virus particle's maturing into a virus that is capable of full infectivity. The typical human immune system response, killing the 10 invading virion, is taxed because the virus infects and kills the immune system's T cells. In addition, viral reverse transcriptase, the enzyme used in making a new virion particle, is not very specific, and causes transcription mistakes that result in continually changed glycoproteins on 15 the surface of the viral protective coat. This lack of specificity decreases the immune system's effectiveness because antibodies specifically produced against one glycoprotein may be useless against another, hence reducing the number of antibodies available to fight the virus. The 20 virus continues to reproduce while the immune response system continues to weaken. Eventually, the HIV largely holds free reign over the body's immune system, allowing opportunistic infections to set in and without the administration of antiviral agents, immunomodulators, or both, death may 25 result. There are at least three critical points in the virus's life cycle which have been identified as possible targets for antiviral drugs: (1) the initial attachment of the virion to the T-4 lymphocyte or macrophage site, (2) the transcription 30 of viral RNA to viral DNA (reverse transcriptase, RT) , and (3) the processing of gag-pol protein by HIV protease. Inhibition of the virus at the second critical point, the viral RNA to viral DNA transcription process, has provided a number of the current therapies used in treading 35 AIDS. This transcription must occur for the virion to reproduce because the virion's genes are encoded in RNA and the host cell reads only DNA. By introducing drugs that 2 Printed from Mimosa WO 98/45276 PCT/US98/06733 block the reverse transcriptase from completing the formation of viral DNA, HIV-1 replication can be stopped. A number of compounds that interfere with viral replication have been developed to treat AIDS. For example, 5 nucleoside analogs, such as 3'-azido-3'-deoxythymidine (AZT), 2',3'-dideoxycytidine (ddC), 21,3'-dideoxythymidinene (d4T), 2',3'-dideoxyinosine (ddl), and 21,3'-dideoxy-3'-thia-cytidine (3TC) have been shown to be relatively effective in halting HIV replication at the reverse transcriptase (RT) 10 stage. An active area of research is in the discovery of non-nucleoside HIV reverse transcriptase inhibitors. As an example, it has been found that certain benzoxazinones and quinazolinones are active in the inhibition of HIV reverse 15 transcriptase, the prevention or treatment of infection by HIV and the treatment of AIDS. U.S. 5,519,021 describe reverse transcriptase inhibitors which are benzoxazinones of the formula: h 20 wherein X is a halogen, Z may be O. EP 0,530,994 and WO 93/04047 describe HIV reverse transcriptase inhibitors which are quinazolinones of the formula A: wherein G is a variety of groups, R3 and R4 may be H, Z may be O, R2 may be unsubstituted alkyl, unsubstituted alkenyl, unsubstituted alkynyl, unsubstituted cycloalkyl, unsubstituted heterocycle, and optionally substituted aryl, 30 and R1 may be a variety of groups including substituted alkyl. 25 A 3 Printed from Mimosa WO 98/45276 PCT/US98/06733 WO 95/12583 also describes HIV reverse transcriptase inhibitors of formula A. In this publication, G is a variety of groups, R3 and R4 may be H, Z may be 0, R2 is substituted alkenyl or substituted alkynyl, and R1 is cycloalkyl, alkynyl, 5 alkenyl, or cyano. WO 95/13273 illustrates the asymmetric synthesis of one of the compounds of WO 95/12583, (S)-(-)-6-chloro-4-cyclopropyl-3,4-dihydro-4((2-pyridy)ethynyl)-2(IH)-quinazolinone. Synthetic procedures for making quinazolinones like 10 those described above are detailed in the following references: Houpis et al, Tetr. Lett. 1994, 35(37), 6811-6814; Tucker et al, J. Med. Chem. 1994, 37, 2437-2444; and, Huffman et al, J. Org. Chem. 1995, 60, 1590-1594. DE 4,320,347 illustrates quinazolinones of the formula: 15 wherein R is a phenyl, carbocyclic ring, or a heterocyclic ring. Compounds of this sort are not considered to be part of the present invention. Even with the current success of reverse transcriptase 20 inhibitors, it has been found that HIV patients can become resistant to a single inhibitor. Thus, it is desirable to develop additional inhibitors to further combat HIV infection. 25 SUMMARY OF THE INVENTION Accordingly, one object of the present invention is to provide novel reverse transcriptase inhibitors. It is another object of the present invention to provide a novel method for treating HIV infection which comprises 30 administering to a host in need of such treatment a therapeutically effective amount of at least one of the compounds of the present invention or a pharmaceutically acceptable salt form thereof. It is another object of the present invention to provide 35 a novel method for treating HIV infection which comprises 4 Printed from Mimosa WO 98/45276 PCT/US98/06733 administering to a host in need thereof a therapeutically effective combination of (a) one of the compounds of the present invention and (b) one or more compounds selected form the group consisting of HIV reverse transcriptase inhibitors 5 and HIV protease inhibitors. It is another object of the present invention to provide pharmaceutical compositions with reverse transcriptase inhibiting activity comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of at least 10 one of the compounds of the present invention or a pharmaceutically acceptable salt form thereof. It is another object of the present invention to provide a method of inhibiting HIV present in a body fluid sample which comprises treating the body fluid sample with an 15 effective amount of a compound of the present invention. It is another object of the present invention to provide a kit or container containing at least one of the compounds of the present invention in an amount effective for use as a standard or reagent in a test or assay for determining the 20 ability of a potential pharmaceutical to inhibit HIV reverse transcriptase, HIV growth, or both. These and other objects, which will become apparent during the following detailed description, have been achieved by the inventors' discovery that compounds of formula (I): wherein R1, R2, R3, and R8 are defined below, stereoisomeric forms, mixtures of stereoisomeric forms, or pharmaceutically 30 acceptable salt forms thereof, are effective reverse transcriptase inhibitors. DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS [1] Thus, in a first embodiment, the present invention 35 provides a novel compound of formula I: 25 H I 5 Printed from Mimosa WO 98/45276 PCT/US98/06733 I or a stereoisomer or pharmaceutically acceptable salt 5 thereof, wherein: R1 is Ci_3 alkyl substituted with 1-7 halogen; R2 is selected from C1-5 alkyl substituted with 1-2 R4, C2-5 10 alkenyl substituted with 1-2 R4, and C2-5 alkynyl substituted with 1 R4; R3, at each occurrence, is independently selected from Ci_4 alkyl, OH, Ci_4 alkoxy, F, Cl, Br, I, NR5R5a, NO2, CN, 15 C(0)R6, NHC(0)R7, and NHC(0)NR5R5a; alternatively, if two R3's are present and are attached to adjacent carbons, then they may combine to form -OCH2O-; 20 R4 is selected from C3-5 cycloalkyl substituted with 0-2 R3, phenyl substituted with 0-5 R3, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from 0, N, and S, substituted with 0-2 R3; 25 R5 and R5a are independently selected from H and C1-3 alkyl; R6 is selected from H, OH, Ci_4 alkyl, Ci_4 alkoxy, and NR5R5a; R7 is selected from Ci_3 alkyl and Ci_3 alkoxy; 30 R8 is selected from H, C3-5 cycloalkyl, and C1-3 alkyl; and, n is selected from 0, 1, 2, 3, and 4. 35 6 Printed from Mimosa WO 98/45276 PCT/US98/06733 [2] In a preferred embodiment, the present invention provides a novel compound of formula I, wherein: R1 is Ci_3 alkyl substituted with 1-7 halogen; 5 R2 is selected from C1-5 alkyl substituted with 1 R4, C2-5 alkenyl substituted with 1 R4, and C2-5 alkynyl substituted with 1 R4; 10 R3, at each occurrence, is independently selected from Ci_4 alkyl, OH, Ci_4 alkoxy, F, CI, Br, I, NR5R5a, NO2, CN, C(0)R6, NHC(0)R7, and NHC {0) NR5R5a; alternatively, if two R3's are present and are attached to 15 adjacent carbons, then they may combine to form -OCH2O-; R4 is selected from C3_s cycloalkyl substituted with 0-2 R3, phenyl substituted with 0-2 R3, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected 20 from O, N, and S, substituted with 0-1 R3; R5 and R5a are independently selected from H, CH3 and C2H5; R6 is selected from H, OH, CH3, C2H5, OCH3, OC2H5, and NR5R5a; 25 R7 is selected from CH3, C2H5, OCH3, and OC2H5; R8 is selected from H, cyclopropyl, CH3 and C2H5; and, 30 n is selected from 0, 1, 2, and 3. [3] In a more preferred embodiment, the present invention provides a novel compound of formula I, wherein: 35 R1 is selected from CF3, and C2F5; 7 Printed from Mimosa WO 98/45276 PCT/US98/06733 R2 is selected from C1-3 alkyl substituted with 1 R4, C2-3 alkenyl substituted with 1 R4, and C2-3 alkynyl substituted with 1 R4; 5 R3, at each occurrence, is independently selected from Ci_3 alkyl, OH, C1-3 alkoxy, F, Cl, Br, I, NR5R5a, N02, CN, C(0)R6, NHC(0)R7, and NHC (0)NR5R5a; alternatively, if two R3's are present and are attached to 10 adjacent carbons, then they may combine to form -OCH2O-; R4 is selected from 03.5 cycloalkyl substituted with 0-2 R3, phenyl substituted with 0-2 R3, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected 15 from O, N, and S, substituted with 0-1 R3; R5 and R^a are independently selected from H, CH3 and C2H5; R6 is selected from H, OH, CH3, C2H5, OCH3, OC2H5, and NR5R5a; 20 R7 is selected from CH3, C2H5, OCH3, and OC2H5; R8 is selected from H, CH3 and C2H5; and, 25 n is selected from 0, 1, and 2. 30 [4] In an even more preferred embodiment, the present invention provides a novel compound of formula I, wherein: R1 is CF3; r2 is selected from C3.-3 alkyl substituted with 1 R4, C2_3 alkenyl substituted with 1 R4, and C2-3 alkynyl 35 substituted with 1 R4; 8 Printed from Mimosa WO 98/45276 PCT/US98/06733 R3, at each occurrence, is independently selected from Ci_3 alkyl, OH, Ci_3 alkoxy, F, CI, NR5R5a, N02, CN, C(0)R5, NHC (0) R7, and NHC (0)NR5R5a; alternatively, if two R3's are present and are attached to adjacent carbons, then they may combine to form -OCH2O-; R4 is selected from cyclopropyl substituted with 0-1 R3, phenyl substituted with 0-2 R3, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from O, N, and S, substituted with 0-1 R3, wherein the heterocyclic system is selected from 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-furanyl, 3-furanyl, 2-thienyl, 3-thienyl, 2-oxazolyl, 2-thiazolyl, 4-isoxazolyl, and 2-imidazolyl; R5 and R5a are independently selected from H, CH3 and C2H5; R6 is selected from H, OH, CH3, C2H5, OCH3, OC2H5, and NR5R5a; R7 is selected from CH3, C2H5, OCH3, and OC2H5; R8 is selected from H, CH3 and C2H5; and, n is selected from 1 and 2. [5] In a further preferred embodiment, wherein the compound is of formula la [5] In a further preferred embodiment, wherein the compound is of formula lb: H la. 9 Printed from Mimosa WO 98/45276 PCT/US98/06733 Xb. 5 [7] In a further preferred embodiment, the compound of formula I is selected from: (+/-)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; 10 ( + /-) -6-Chloro-4- (2-pyridyl) ethynyl-4-trifluoromethyl-3 , 4-dihydro-2(IH)-quinazolinone; (+/-)-6-Chloro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro- 15 2(IH)-quinazolinone; ( + /-) -4-Cyclopropylethynyl-6-methoxy-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; 20 (+/-)-6-Methoxy-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; ( + /-) -6-Methoxy-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2 (IH) -quinazolinone,- 25 (+/-)-4-Cyclopropylethynyl-5,6-di fluoro-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; (+/-)-5,6-Difluoro-4-(2-pyridyl)ethynyl-4-trifluoromethyl- 30 3,4-dihydro-2(IH)-quinazolinone; (+/-) -5, 6-Difluoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; 10 Printed from Mimosa WO 98/45276 PCT/US98/06733 (+/-)-4-Cyclopropylethynyl-6-fluoro-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; (+/-)-6-Fluoro-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-5 dihydro-2(IH)-quinazolinone; (+/-)-6-Fluoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; 10 (+/-)-6-Fluoro-4-(2'-2-pyridyl)ethyl-4-trifluoromethyl-3 , 4-dihydro-2(IH)-quinazolinone; (+/-)-6-Fluoro-4-phenylethyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; 15 (-)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; (+)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4- 20 dihydro-2(IH)-quinazolinone; (+)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; 25 (-)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; (+)-4-E-Cyclopropylethenyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; and, 30 (-)-6-Chloro-4-E-cyclopropylethenyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; or a pharmaceutically acceptable salt thereof. 35 [8] In a second embodiment, the present invention provides a novel compound of formula II: 11 Printed from Mimosa WO 98/45276 PCT/US98/06733 II or a stereoisomer or pharmaceutically acceptable salt thereof, wherein: 5 R2 IS CsC-R4a; R3 is selected from C1.4 alkyl, OH, C1-4 alkoxy, F, cl, Br, I, NR5R5a, N02, CN, C(0)R6, NHC{0)R7, and NHC (0) NR5R5a; 10 R4a is selected from methyl, ethyl, n-propyl, i-propyl, i-butyl, t-butyl, and i-pentyl; R5 and R5a are independently selected from H and C1-3 alkyl; 15 R6 is selected from H, OH, C1-4 alkyl, C1-4 alkoxy, and NR5R5a; R7 is selected from C1-3 alkyl and C1-3 alkoxy; 20 R8 is selected from H, C3-5 cycloalkyl, and C1-3 alkyl; and, n is selected from 0, 1, 2, 3, and 4. 25 [9] In another preferred embodiment, the present invention provides a novel compound of formula II, wherein: R2 is C=C-R4a; 30 R3 is selected from Ci_4 alkyl, OH, Ci_4 alkoxy, F, Cl, Br, I, NR5R5a, N02, CN, C(0)R6, and NHC(0)R7; R4a is selected from methyl, ethyl, n-propyl, i-propyl, i-butyl, t-butyl, and i-pentyl; 35 12 Printed from Mimosa WO 98/45276 PCT/US98/06733 R5 and R5a are independently selected from H, CH3 and C2H5; R6 is selected from H, OH, CH3, C2H5, OCH3, OC2H5, and NR5R5a; R7 is selected from CH3, C2H5, OCH3, and OC2H5 ; R8 is selected from H, cyclopropyl, CH3 and C2H5; and, n is selected from 0, 1, and 2.

[10] In a further preferred embodiment, wherein the compound is of formula Ila Ila.

[11] In a further preferred embodiment, wherein the compound is of formula lib: lib.

[12] In another more preferred embodiment, the compound of formula II is selected from: (+/-)-6-Chloro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; (+/-)-6-Chloro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; 13 Printed from Mimosa WO 98/45276 PCT/US98/06733 1+/-)-4-Isopropylethynyl-6-methoxy-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; {+/-)-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-5 dihydro-2{IH)-quinazolinone; {+/-)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; 10 (+/-)-5,6-Difluoro-4-isopentyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; (+/-)-6-Fluoro-4-isopropylethynyl-4-trifluoromethyl-3, 4-dihydro-2(IH)-quinazolinone; 15 (+/-)-6-Fluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; (-)-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4- 20 dihydro-2(IH)-quinazolinone; (+)-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; 25 (-)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2{IH)-quinazolinone; and, (+)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; 30 or a pharmaceutically acceptable salt thereof. In a third embodiment, the present invention provides a 35 novel pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of a compound of formula I or II or pharmaceutically acceptable salt form thereof. 14 Printed from Mimosa WO 98/45276 PCT/US98/06733 In a fourth embodiment, the present invention provides a novel method for treating HIV infection which comprises 5 administering to a host in need of such treatment a therapeutically effective amount of a compound of formula I or II or pharmaceutically acceptable salt form thereof. 10 In a fifth embodiment, the present invention provides a novel method of treating HIV infection which comprises administering, in combination, to a host in need thereof a therapeutically effective amount of: (a) a compound of formula I or II; and, 15 (b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors. 20 In another preferred embodiment, the reverse transcriptase inhibitor is selected from AZT, 3TC, ddl, ddC, d4T, delavirdine, TIBO derivatives, BI-RG-587, nevirapine, L-697,661, LY 73497, Ro 18,893, loviride, trovirdine, MKC-442, and HBY 097, and the protease inhibitor is selected from 25 saquinavir, ritonavir, indinavir, VX-478, nelfinavir, KNI-272, CGP-61755, U-140690, and ABT-378. In an even more preferred embodiment, the reverse 30 transcriptase inhibitor is selected from AZT and 3TC and the protease inhibitor is selected from saquinavir, ritonavir, nelfinavir, and indinavir. 35 In a still further preferred ebodiment, the reverse transcriptase inhibitor is AZT. 15 Printed from Mimosa WO 98/45276 PCT/US98/06733 In another still further preferred embodiment, the protease inhibitor is indinavir. 5 In a sixth embodiment, the present invention provides a pharmaceutical kit useful for the treatment of HIV infection, which comprises a therapeutically effective amount of: (a) a compound of formula I or II; and, (b) at least one compound selected from the group 10 consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors, in one or more sterile containers. In a seventh embodiment, the present invention provides 15 a novel method of inhibiting HIV present in a body fluid sample which comprises treating the body fluid sample with an effective amount of a compound of formula I or II. 20 in a eighth embodiment, the present invention to provides a novel a kit or container comprising a compound of formula I or II in an amount effective for use as a standard or reagent in a test or assay for determining the ability of a potential pharmaceutical to inhibit HIV reverse 25 transcriptase, HIV growth, or both. DEFINITIONS As used herein, the following terms and expressions have the indicated meanings. It will be appreciated that the 30 compounds of the present invention contain an asymmetrically substituted carbon atom, and may be isolated in optically active or racemic forms. It is well known in the art how to prepare optically active forms, such as by resolution of racemic forms or by synthesis, from optically active starting 35 materials. All chiral, diastereomeric, racemic forms and all geometric isomeric forms of a structure are intended, unless the specific stereochemistry or isomer form is specifically indicated. 16 Printed from Mimosa WO 98/45276 PCT/US98/06733 The processes of the present invention are contemplated to be practiced on at least a multigram scale, kilogram scale, multikilogram scale, or industrial scale. Multigram scale, as used herein, is preferably the scale wherein at least one starting material is present in 10 grams or more, more preferably at least 50 grams or more, even more preferably at least 100 grams or more. Multikilogram scale, as used herein, is intended to mean the scale wherein more than one kilogram of at least one starting material is used. Industrial scale as used herein is intended to mean a scale which is other than a laboratory scale and which is sufficient to supply product sufficient for either clinical tests or distribution to consumers. As used herein, "alkyl" is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms. Examples of alkyl include, but are not limited to, methyl, ethyl, n-propyl, i-propyl, n-butyl, s-butyl, t-butyl, n-pentyl, and s-pentyl. "Haloalkyl" is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms, substituted with 1 or more halogen (for example -CVFW where v = 1 to 3 and w = 1 to (2v+l)). Examples of haloalkyl include, but are not limited to, trifluoromethyl, trichloromethyl, pentafluoroethyl, and pentachloroethyl. "Alkoxy" represents an alkyl group as defined above with the indicated number of carbon atoms attached through an oxygen bridge. Examples of alkoxy include, but are not limited to, methoxy, ethoxy, n-propoxy, i-propoxy, n-butoxy, s-butoxy, t-butoxy, n-pentoxy, and s-pentoxy. "Cycloalkyl" is intended to include saturated ring groups, such as cyclopropyl, cyclobutyl, or cyclopentyl. Alkenyl" is intended to include hydrocarbon chains of either a straight or branched configuration and one or more unsaturated carbon-carbon bonds which may occur in any stable point along the chain, such as ethenyl, propenyl and the like. "Alkynyl" is intended to include hydrocarbon chains of either a straight or branched configuration and one or more triple carbon-carbon bonds which may occur in any stable 17 Printed from Mimosa WO 98/45276 PCT/US98/06733 point along the chain, such as ethynyl, propynyl and the like. "Halo" or "halogen" as used herein refers to fluoro, chloro, bromo and iodo. "Counterion" is used to represent a small, negatively charged species such as chloride, bromide, hydroxide, acetate, sulfate and the like. As used herein, "aryl" or "aromatic residue" is intended to mean an aromatic moiety containing the specified number of carbon atoms, such as phenyl or naphthyl. As used herein, "carbocycle" or "carbocyclic residue" is intended to mean any stable 3- to 5- membered monocyclic ring, which may be saturated or partially unsaturated. Examples of such carbocyles include, but are not limited to, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, biphenyl, naphthyl, indanyl, adamantyl, or tetrahydronaphthyl (tetralin). As used herein, the term "heterocycle" or "heterocyclic system" is intended to mean a stable 5- to 6- membered monocyclic heterocyclic ring which is saturated partially unsaturated or unsaturated (aromatic), and which consists of carbon atoms and from 1 to 3 heteroatoms independently selected from the group consisting of N, 0 and S. The nitrogen and sulfur heteroatoms may optionally be oxidized. The heterocyclic ring may be attached to its pendant group at any heteroatom or carbon atom which results m a stable structure. The heterocyclic rings described herein may be substituted on carbon or on a nitrogen atom if the resulting compound is stable. If specifically noted, a nitrogen in the heterocycle may optionally be quaternized. It is preferred that when the total number of S and 0 atoms in the heterocycle exceeds 1, then these heteroatoms are not adjacent to one another. It is preferred that the total number of S and .0 atoms in the heterocycle is not more than 1. As used herein, the term "aromatic heterocyclic system" is intended to mean a stable 5- to 6- membered monocyclic heterocyclic aromatic ring which consists of carbon atoms and from 1 to 3 heterotams independently selected from the group consisting of N, 0 and S. It is preferred that the total 18 Printed from Mimosa WO 98/45276 PCT/US98/06733 number of S and 0 atoms in the aromatic heterocycle is not more than 1. Examples of heterocycles include, but are not limited to, 2-pyrrolidonyl, 2H-pyrrolyl, 4-piperidonyl, 6H-1,2,5-5 thiadiazmyl, 2H, 6H-1, 5,2-dithiazmyl, furanyl, furazanyl, imidazolidinyl, imidazolinyl, imidazolyl, isoxazolyl, morpholinyl, oxadiazolyl, 1,2,3-oxadiazolyl, 1,2,4-oxadiazolyl, 1,2,5-oxadiazolyl, 1,3,4-oxadiazolyl, oxazolidinyl., oxazolyl, piperazinyl, piperidinyl, 10 pteridinyl, piperidonyl, 4-piperidonyl, pteridinyl, purinyl, pyranyl, pyrazinyl, pyrazolidinyl, pyrazolinyl, pyrazolyl, pyridazinyl, pyridinyl, pyridyl, pyrimidinyl, pyrrolidinyl, pyrrolinyl, pyrrolyl, tetrahydrofuranyl, 6ff-l,2,5~ thiadiazinyl, 1,2,3-thiadiazolyl, 1,2,4-thiadiazolyl, 1,2,5-15 thiadiazolyl, 1,3,4-thiadiazolyl, thiazolyl, thienyl, thienothiazolyl, thienooxazolyl, thienoimidazolyl, thiophenyl, triazinyl, 1,2,3-triazolyl, 1,2,4-triazolyl, 1,2,5-triazolyl, and 1,3,4-triazolyl. Preferred heterocycles include, but are not limited to, pyridinyl, furanyl, thienyl, 20 pyrrolyl, pyrazolyl, imidazolyl, and oxazolidinyl. Also included are fused ring and spiro compounds containing, for example, the above heterocycles. As used herein, "hiv reverse transcriptase inhibitor" is intended to refer to both nucleoside and non-nucleoside 25 inhibitors of HIV reverse transcriptase (RT). Examples of nucleoside RT inhibitors include, but are not limited to, AZT, ddC, ddl, d4T, and 3TC. Examples of non-nucleoside RT inhibitors include, but are no limited to, delavirdine (Pharmacia and Upjohn U90152S), TIBO derivatives, BI-RG-587, 30 nevirapine (Boehringer Ingelheim), L-697,661, LY 73497, Ro 18,893 (Roche), loviride (Janssen), trovirdine (Lilly), MKC-442 (Triangle), and HBY 097 (Hoechst). As used herein, "HIV protease inhibitor" is intended to refer to compounds which inhibit HIV protease. Examples 35 include, but are not limited, saquinavir (Roche, Ro31-8959), ritonavir (Abbott, ABT-538), indinavir (Merck, MK-639), VX-478 (Vertex/Glaxo Wellcome), nelfinavir (Agouron, AG-1343), KNI-272 (Japan Energy), CGP-61755 (Ciba-Geigy), U-140690 19 Printed from Mimosa WO 98/45276 PCT/US98/06733 (Pharmacia and Upjohn), and ABT-378. Additional examples include the cyclic protease inhibitors disclosed in W093/07128, WO 94/19329, WO 94/22840, and PCT Application Number US96/03426. 5 As used herein, "pharmaceutically acceptable salts" refer to derivatives of the disclosed compounds wherein the parent compound is modified by making acid or base salts thereof. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid 10 salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like. The pharmaceutically acceptable salts include the conventional non-toxic salts or the quaternary ammonium salts of the parent compound formed, for example, from non-toxic 15 inorganic or organic acids. For example, such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like; and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, 20 stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, and the like. 25 The pharmaceutically acceptable salts of the present invention can be synthesized from the parent compound which contains a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with a 30 stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. Lists of suitable salts are found in Remington's Pharmaceutical 35 Sciences, 17th ed.. Mack Publishing Company, Easton, PA, 1985, p. 1418, the disclosure of which is hereby incorporated by reference. 20 Printed from Mimosa WO 98/45276 PCT/US98/06733 The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication commensurate with a reasonable benefit/risk ratio. "Prodrugs" are intended to include any covalently bonded carriers which release the active parent drug according to formula (I) or other formulas or compounds of the present invention in vivo when such prodrug is administered to a mammalian subject. Prodrugs of a compound of the present invention, for example formula (I), are prepared by modifying functional groups present in the compound in such a way that the modifications are cleaved, either in routine manipulation or in vivo, to the parent compound. Prodrugs include compounds of the present invention wherein the hydroxy or amino group is bonded to any group that, when the prodrug is administered to a mammalian subject, cleaves to form a free hydroxyl or free amino, respectively. Examples of prodrugs include, but are not limited to, acetate, formate and benzoate derivatives of alcohol and amine functional groups in the compounds of the present invention, and the like. "Stable compound" and "stable structure" are meant to indicate a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and formulation into an efficacious therapeutic agent. Only stable compounds are contempleted by the present invention. "Substituted" is intended to indicate that one or more hydrogens on the atom indicated in the expression using "substituted" is replaced with a selection from the indicated group(s), provided that the indicated atom's normal valency is not exceeded, and that the substitution results in a stable compound. When a substituent is keto (i.e., =0) group, then 2 hydrogens on the atom are replaced. 21 Printed from Mimosa WO 98/45276 PCT/US98/06733 "Therapeutically effective amount" is intended to include an amount of a compound of the present invention or an amount of the combination of compounds claimed effective to inhibit HIV infection or treat the symptoms of HIV 5 infection in a host. The combination of compounds is preferably a synergistic combination. Synergy, as described for example by Chou and Talalay, Adv. Enzyme Regul. 22:27-55 (1984), occurs when the effect (in this case, inhibition of HIV replication) of the compounds when administered in 10 combination is greater than the additive effect of the compounds when administered alone as a single agent. In general, a synergistic effect is most clearly demonstrated at suboptimal concentrations of the compounds. Synergy can be in terms of lower cytotoxicity, increased antiviral effect, 15 or some other beneficial effect of the combination compared with the individual components. SYNTHESIS The compounds of the present invention can be prepared 20 in a number of ways well known to one skilled in the art of organic synthesis. The compounds of the present invention can be synthesized using the methods described below, together with synthetic methods known in the art of synthetic organic chemistry, or variations thereon as appreciated by 25 those skilled in the art. Preferred methods include but are not limited to those methods described below. Each of the references cited below are hereby incorporated herein by reference. 22 Printed from Mimosa WO 98/45276 PCT/US98/06733 SCHEME 1 R' " 'C00H HN(CH3)0CH3 u A ch3 KV nh2 X* nh2 TMSC1, base RlMgX O rx nh2 Scheme 1 illustrates a method of preparing keto-anilines from an appropriately substituted 2-aminobenzoic acid. The acid is converted to its N-methoxy-N-methyl amide derivative which can then be displaced to obtain the R^-substituted ketone. The keto-anilines are useful intermediates for the presently claimed compounds. SCHEME 2 R- ^ I2, NaHC03 V nh2 n-BuLi CF3C02Et ■fee1 cAfC ec ^^nh2 6N-HC1 Me3CCOCl NaHC03 fet NH NH2 Scheme 2 describes another method of preparing keto-anilines, this time from an appropriately substituted aniline. After iodination and amine protection, a group such as trifluoromethyl can be introduced using a strong base and ethyl trifluoroacetate. Deprotection provides the keto-aniline. Additional means of preparing keto-anilines are known to one of skill in the art, e.g, Houpis et al, Tetr. Lett. 1994, 35(37), 6811-6814, the contents of which are hereby incorporated herein by reference. 23 Printed from Mimosa WO 98/45276 PCT/US98/06733 SCHEME 3 R^C0°" «B<CH,)OCH3 | R0^CON(OCH3)CHJ TrBr. DIPEA R|fCVC°NI0CH3'CH'reduction CH2C12 ^^N(H)Tr ^^N(H)Tr CF3 i O _3 V- ■» y CF3 TMS, TBAF WAoH oxidation jjS^V^CF3 THF (H) Tr ^^N(H)Tr Another method of making 2-trifluoroacetylanilines is shown in Scheme 3. After forming the protected aniline, the amide is then reduced and the trifluoromethyl group added. Oxidation with an oxidant, such as Mn02, provides the useful intermediate. SCHEME 4 10 H2 , Pd/C Using the general method detailed in Scheme 4, one can prepare compounds of the present invention. Keto-aniline 1, 24 Printed from Mimosa WO 98/45276 PCT/US98/06733 which may be prepared by the methods desribed in Schemes 1 and 2, is treated with trimethylsilyl isocyanate in dry tetrahydofuran in the presence of dimethylammopyridine followed by tetrabutylammonium fluoride to give the hydroxy-5 urea 2. The hydroxy-urea 2 is then dehydrated with a dehydrating agent such as 4A molecular sieves in refluxing toluene or xylenes to give the ketimine 3. A substituted acetylenic R2 group is added by treating the ketimine 3 with a lithium acetylide, which is prepared in a separate vessel 10 by reacting the corresponding substituted acetylene with n-butyllithium in dry tetrahydrofuran, to give the 4,4-disubstituted 3,4-dihydro-2(IH)-quinazolinone 4, a compound of formula I. The acetylenic bond of the compound 4 may be reduced, e.g., by catalytic hydrogenation, to give the 15 corresponding alkenyl group (not shown) or the saturated compound 5.. Other R2 groups may also be introduced by directly reacting the imine 3 with a lithiate R2Li or a Grrgnard reagent R2MgX in the presence or absence of Lewis acid 20 catalyst, such as BF3 etherate. See also Huffman et al, J. Org. Chem. 1995, 60, 1590-1594, the contents of which are hereby incorporated herein by reference. In certain instances, one enantiomer of a compound of Formula I or II may display superior activity compared with 25 the other. When required, separation of the racemic material can be achieved by HPLC using a chiral column as exemplified in Examples 27-34 (Scheme 4) or by a resolution using a resolving agent such as camphonic chloride as in Thomas J. Tucker, et al, J. Med. Chem. 1994, 37, 2437-2444. A chiral 30 compound of Formula I may also be directly synthesized using a chiral catalyst or a chiral ligand, e.g. Mark A. Huffman, et al, J. Org. Chem. 1995, 60, 1590-1594. Other features of the invention will become apparent in the course of the following descriptions of exemplary 35 embodiments which are given for illustration of the invention and are not intended to be limiting thereof. 25 Printed from Mimosa WO 98/45276 PCT/US98/06733 Examples Abbreviations used in the Examples are defined as follows: "°C" for degrees Celsius, "d" for doublet, "dd" for doublet of doublets, "eq" for equivalent or equivalents, "g" 5 for gram or grams, "mg" for milligram or milligrams, "mL" for milliliter or milliliters, "H" for hydrogen or hydrogens, "hr" for hour or hours, "m" for multiplet, "M" for molar, "min" for minute or minutes, "MHz" for megahertz, "MS" for mass spectroscopy, "nmr" or "NMR" for nuclear magnetic 10 resonance spectroscopy, "t" for triplet, "TLC" for thin layer chromatography, "EDAC" for 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride, "DIPEA" for diisopropylethylamine, "TBAF" for tetrabutylammonium fluoride, "LAH" for lithium aluminium hydride, and "TEA" for 15 triethylamine. Example 1 Prepration of ( + /-)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (R* = 20 Cyclopropyl) Ill-a IV-a Step 1. Synthesis of Il-a from I-a. 25 To a solution of compound I-a (4.55 g, 20.2 mmol) in anhydrous THF (40 mL) was added dimethylaminopyridine (0.25 g, 2.02 mmol) and trimethylsilyl isocyanate (6.05 g, 7.11 mL, 52.5 mmol). The mixture was stirred at room temperature for 26 Printed from Mimosa WO 98/45276 PCT/US98/06733 approximately 16 hours, then tetrabutylammonium fluoride (21 mL of 1 M solution in THF) was added. The thick slurry was diluted with additional THF (20 mL) and stirred at room temperature for 0.5 hours. The THF was removed under reduced 5 pressure, the residue was taken up m EtOAc (100 mL) and washed sequentially with 1 N HC1 (70 mL), saturated aqueous NaHC03 (70 mL) and saturated aqueous NaCl (50 mL). The organic phase was dried over MgSC>4, filtered and concentrated under reduced pressure to afford a light yellow solid. The 10 yellow color was removed upon trituration with hexanes to afford Ila (5.09 g, 94%) as a white solid: 1H NMR (300 MHz, acetone-dg) 8 9.06 (br s, 1 H) , 7.48 (s, 1 H), 7.40 (br s, 1 H) , 7.34 (dd, J = 8.8, 2.6 Hz, 1 H), 6.97 (d, J = 8.8 Hz, 1 H); 19F NMR (282 MHz, acetone-d6) 5 -86.33, -86.35; IR (KBr 15 Pellet) 1724, 1678, 1398, 1198, 1174 cm"1; MS (CI) m/e 266 (MH+, 100) . Step 2. Synthesis of Ill-a from Il-a. 20 A suspension of Il-a (5.09 g, 19.1 mmol) in toluene (150 mL) containing 4 A molecular sieves (approximately 100 mg) was heated at reflux for 16 hours. The resulting clear yellow solution was cooled to room temperature, the precipitated solids were dissolved in acetone and the 25 molecular sieves were removed by vacuum filtration. The filtrate was concentrated under reduced pressure, and triturated with hexanes to afford Ill-a (4.25 g, 89%) as a yellow solid; *H NMR (300 MHz, acetone-dg) 8 7.86-7.82 (m, 2 H) , 7.61 (d, J = 8.8 Hz, 1 H) ; 19F NMR (282 MHz, acetone-d6) 8 30 -67.88. Step 3. Synthesis of IV-a from Ilia. A solution of cyclopropylacetylene (13.0 mL of 30 wt% 35 solution in toluene/THF/hexanes, 59.0 mmol) in anhydrous THF (118 mL) was cooled to -78 °C, treated with n-BuLi (32.8 mL of 1.6 M solution in hexanes, 52.4 mmol), warmed to 0 °C in an ice bath, and aged for 0.5 h. To a solution of Ill-a 27 Printed from Mimosa WO 98/45276 PCT/US98/06733 (3.12 g, 12.6 mmol) in anhydrous THF (66 mL) at -78 °C was added the lithium acetylide over approximately 10 minutes. To this was added boron trifluoride etherate (0.89 g, 0.80 mL, 6.28 mmol), followed by removal of the cooling bath. The 5 reaction was allowed to reach room temperature and stirred at room temperature for 4 hours before quenching with 1 M citric acid (100 mL). The mixture was concentrated under reduced pressure to 1/2 original volume, diluted with EtOAc (200 mL), the aqueous phase was removed and the organic phase was 10 sequentially washed with saturated aqueous NaHC03 (100 mL) , and saturated aqueous NaCl (100 mL). The organic phase was dried over MgS04, filtered and concentrated under reduced pressure. The crude material was purified by flash chromatography (3% MeOH/CH2Cl2) to afford a thick yellow oil 15 from which was obtained crystalline IV-a (R4 = cyclopropyl) (3.85 g, 97%) as a white solid: mp 86.6-88 °C; !h NMR (300 MHz, acetone-d6) 8 8.95 (br s, 1 H), 7.51 (br s, 1 H), 7.43 (br s, 1 H), 7.40 (dd, J = 8.8, 2.4 Hz, 1 H), 7.02 (d, J = 8.8 Hz, 1 H), 1.49-1.41 (m, 1 H), 0.93-0.82 (m, 1 H), 0.77-20 0.74 (m, 1 H) ; 19F NMR (282 MHz, acetone-d6) 8 -82.96; IR (KBr Pellet) 1696, 1172 cm-1; MS (CI) m/e calc'd for C14H10CIF3N2O: 315.051201, found 315.051626; 315 (MH+, 51), 332 (M+NH4+, 100); Analysis calc'd for Ci4HioN2ClF30-0.25 H2O: C, 52.68; H, 3.32; N, 8.78; found: C, 52.61; H, 3.35; 25 N, 8.28. emubib 2 Preparation of (+/-)-6-Chloro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (R4 = 30 Isopropyl) A solution of Ill-a (50 mg, 0.201 mmol) was treated with the lithium acetylide derived from 3-methyl-1-butyne (62 mg, 93 mL, 0.905 mmol) according to the procedure of Step 3 of 35 Example 1. The resulting crude material was purified by flash chromatography (35% EtOAc/hexanes) to afford 26mg (41%) of the desired product: XH NMR (300 MHz, ) 8 9.08 (br s, 1 H) , 7.59 (br s, 1 H), 7.53 (br s, 1 H) , 7.40 (dd, J = 8.4, 28 Printed from Mimosa WO 98/45276 PCT/US98/06733 2.2 Hz, 1 H), 7.02 (d, J = 8.8 Hz, 1 H), 2.81-2.68 (m, 1 H), I.20 (dd, J = 6.6 Hz, 6H) ; 19F NMR (282 MHz, acetone-dg) 5 -83.05; MS (CI) m/e calc'd for C14H12CIF3N2O: 317.066851, found 317.069433; 317 (MH+, 43), 334 (M+NH4+, 100). 5 Example 3 Preparation of (+/-)-6-Chloro-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (R* = 2-Pyridyl) 10 A solution of Ill-a (100 mg, 0.402 mmol) was treated with the the lithium acetylide derived from 2-ethynylpyridine (0.19 g, 1.81 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC 15 (2.5% MeOH/CH2Cl2) to afford 85 mg (60%) of the desired product: mp 105 °C dec.; *H NMR (300 MHz, acetone-dg) 8 9.14 (br s, 1 H), 8.64-8.61 (m, 1 H), 7.89-7.84 (m, 2 H), 7.70-7.66 (m, 2 H), 7.48-7.43 (m, 2 H), 7.09 (d, J =8.8 Hz, 1 H); 19F NMR (282 MHz, acetone-d6) 8 -82.48; IR (KBr Pellet) 1704, 20 1430, 1186 cm"1; MS (CI) m/e calc'd for CigHi0ClF3N3O: 352.046450, found 352.046956; 352 (MH+, 100); Analysis calc'd for CigH9ClF3N30-0.125 H20: C, 54.3; H, 2.56; N, II.9; found: C, 54.71; H, 3.03; N, 11.3. 25 By amo 11=1 4 Preparation of (+/-)-6-Chloro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (R4 = Ethyl) 30 A solution of Ill-a (100 mg, 0.402 mmol) was treated with the the lithium acetylide derived from 1-butyne (109 mg, 2.01 mmol) according to the procedure of Step. 3 of Example 1. The resulting crude material was purified by HPLC (2.5% MeOH/CH2Cl2) to afford 79 mg (65%) of the desired product: *H 35 NMR (300 MHz, acetone-dg) 8 9.05 (br s, 1 H) , 7.54 (br s, 2 H) , 7.41-7.39 (m, 1 H), 7.02 (d, J= 8.4 Hz, 1 H), 2.36-2.32 (m, 2 H) , 2.18-1.13 (m, 3 H) ; 19F NMR (282 MHz, acetone-d6) 8 29 Printed from Mimosa WO 98/45276 PCT/US98/06733 -82.99; MS (CI) m/e calc'd for C13H10CIF3N2O: 303.051201, found 3 03.051882; 303 (MH+, 55), 320 (M+NH4+, 100). 5 Example 5 preparation of (+/-)-6-Chloro-4-phenylethynyl-4- trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (R* = Phenyl) A solution of Ill-a (100 mg, 0.402 mmol) was treated 10 with the the lithium acetylide derived from phenylacetylene (185 mg, 1.81 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5% MeOH/CH2Cl2> to afford 54 mg (38%) of the desired product: 1H NMR (300 MHz, acetone-dg) 5 9.07 (br s, 1 H), 15 7.74 (br s, 1 H), 7.67 (br s, 1 H), 7.62-7.58 (m, 2 H), 7.48-7.40 (m, 4H), 7.08 (d, J= 8.4 Hz, 1 H) ; 19F NMR (282 MHz, acetone-dg) 5 -82.67; IR (KBr Pellet) 1696, 1186 cm-1; MS (CI) m/e calc'd for C17H11CIF3N2O: 351.051201, found 351.051704; 351 (MH+, 51), 368 (M+NH4+, 100); Analysis calc'd 20 for C17H1.0CIF3N2O-O.25 H20: C, 57.48; H, 2.98; N, 7.89; found: C, 57.00; H, 3.03; N, 7.48. Bvampl a R Preparation of (+/-)-4-Cyclopropylethynyl-6-methoxy-4-25 trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (R4 = Cyclopropyl) Me Vll-a VHI-a 30 Step 1. Synthesis of Vl-a from V-a. 30 Printed from Mimosa WO 98/45276 PCT/US98/06733 A solution of V-a (0.50 g, 2.28 mmol) was treated with dimethylaminopyridine and trimethylsilyl isocyanate as described in Step 1 of Example 1 to afford 0.58 g (97%) of 5 the desired product: XH NMR (300 MHz, acetone-dg) 8 8.81 (br s, 1 H), 7.17 (br s, 1 H), 7.11 (br s, 1 H), 7.00-6.92 (m, 2 H), 6.83 (s, 1 H), 3.76 (s, 3 H); 19F NMR (282 MHz, acetone-dg) 8 -85.99. 10 Step 2. Synthesis of Vll-a from Vl-a. A solution of Vl-a (0.58 g, 2.21 mmol) was heated in toluene at reflux as described in Step 2 of Example 1 to afford 0.50 g (93%) of the desired product: 1H NMR (300 MHz, 15 acetone-d6) 8 7.52 (br s, 2 H), 7.27 (s, 1 H), 3.90 (s, 3 H)? 19F NMR (282 MHz, acetone-dg) 8 -68.08. Step 3. Synthesis of Vlll-a from Vll-a. 20 A solution of Vll-a (100 mg, 0.410 mmol) was treated with the the lithium acetylide derived from cyclopropylacetylene (0.41 mL of 30 wt% solution in toluene/THF/hexanes, 1.85 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was 25 purified by HPLC (2.5% MeOH/CH2Cl2) to afford 103 mg (81%) of the desired product: XH NMR (300 MHz, acetone-dg) 8 8.77 (br s, 1 H), 7.29 (br s, 1 H), 7.06 (br s, 1 H), 6.99-6.90 (m, 2 H) , 3.77 (s, 3 H), 1.46-1.38 (m, 1 H), 0.91-0.85 (m, 2 H), 0.79-0.72 (m, 2 H) ; 19F NMR (282 MHz, acetone-d6) 8 -82.61; 30 MS (CI) m/e calc'd for C15H14F3N2O2: 311.100738, found 311.099970; 311 (MH+, 100). 31 Printed from Mimosa WO 98/45276 PCT/US98/06733 Example 7 Preparation of (+/-)-4-lsopropylethynyl-6-methoxy-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (R4 = Isopropyl) 5 A solution of Vll-a (100 mg, 0.410 mmol) was treated with the the lithium acetylide derived from 3-methyl-1-butyne (126 mg, 0.19 mL, 1.85 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was 10 purified by flash chromatography (2.5% MeOH/CH2Cl2) to afford 30 mg (24%) of the desired product: mp 228-229 °C; !h NMR (300 MHz, acetone-dg) 5 8.72 (br s, 1 H) , 7.27 (br s, 1 H) , 7.10 (br s, 1 H), 7.00-6.91 (m, 2 H), 3.77 (s, 3 H), 2.73-2.67 (m, 1 H) , 1.20 (dd, J = 7.0, 1.5 Hz, 6 H) ; 19F NMR (282 15 MHz, acetone-d6) 8 -82.71; IR (KBr Pellet) 1696, 1428, 1190, 1176 cm-1; MS (CI) m/e calc'd for C15H16F3N2O2: 313.116388, found 313.115871; 313 (MH+- 100), 330 (M+NH4+, 15); Analysis calc'd for C15H15F3N2O2: C, 57.69; H, 4.84; N, 8.97; found: C, 57.74; H, 5.01; N, 8.57. 20 25 Bvawmle B Preparation of (+/-)-6-Methoxy-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (R4 = 2-Pyridyl) A solution of Vll-a (100 mg, 0.410 mmol) was treated with the the lithium acetylide derived from 2-ethynylpyridine (0.19 g, 1.85 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by 30 flash chromatography (2.5% MeOH/CH2Cl2) to afford 56 mg (39%) of the desired product: *H NMR (300 MHz, acetone-dg) 8 8.81 (br s, 1 H), 8.61 (d, J = 4.8 Hz, 1 H), 7.88-7.82 (m, 1 H), 7.66 (d, J =7.7 Hz, 1 H), 7.61 [br s, 1 H), 7.46-7.42 (m, 1 H), 7.23 (br s, 1 H), 7.06-6.97 (m, 2 H), 3.79 (s, 3 H) ; "F 35 NMR (282 MHz, acetone-dg) 8 -82.13; IR (KBr Pellet) 1698, 1518, 1464, 1430, 1244, 1208, 1184 cm"1; MS (CI) m/e calc'd for C17H13F3N3O2: 348.095987, found 348.095629; 348 (MH+, 32 Printed from Mimosa WO 98/45276 PCT/US98/06733 100); Analysis calc'd for C17H12F3N3O2 0.25 C3H6O: C, 58.92; H, 3.76; N, 11.61; found: C, 59.38; H, 4.04; N, 11.35. Example 9 5 Preparation of (+/-)-6-Methoxy-4-phenylethynyl-4- trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (R4 = Phenyl) A solution of Vll-a (100 mg, 0.410 mmol) was treated 10 with the the lithium acetylide derived from phenylacetylene (0.19 g, 1.85 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by flash chromatography (2.5% MeOH/CH2Cl2> to afford 34 mg (24%) of the desired product: mp 206.2-207.7 °C; XH NMR (300 MHz, 15 acetone-d6) 8 8.85 (br s, 1 H), 7.60-7.57 (m, 3 H), 7.49-7.39 (m, 3 H), 7.21 (br s, 1 H) , 7.05-6.96 (m, 2H), 3.79 (s, 3 H); 19F NMR (282 MHz, acetone-d6) 8 -82.32; IR (KBr Pellet) 1696, 1516, 1430, 1236, 1204, 1184, 1128 cm"1; MS (CI) m/e calc'd for Ci8Hi4F3N202: 347.100738, found 347.101482; 347 (MH+, 20 100), 364 (M+NH4+, 48); Analysis calc'd for C18H13F3N2O2: C, 62.43; H, 3.78; N, 8.10; found: C, 62.35; H, 3.58; N, 7.83 . 33 Printed from Mimosa WO 98/45276 PCT/US98/06733 Bvamplft 1 tl Preparation of (+/-)-4-Cyclopropylethynyl-5,6-difluoro-4-trxfluoromethyl-3,4-dihydro-2(IH)-quinazolinone (R4 = Cyclopropyl) f3c oh p a) TMSNCO V/^mh Xylenes tl f CF3 dmap/thf i b) TBAF/TH^ NH2 ix-a X-a 9F3 a. THF/n-BuLi/HCCR4 ^ F3 b. BF3-OEt2 F. 10% Pd/C H2 (1 atm) F. EtOH/EtOAc XIII-a Step 1. Synthesis of X-a from IX-a. 10 A solution of IX-a (6.46 g, 28.7 mmol) was treated with dimethylaminopyridine and trimethylsilyl isocyanate as described in Step 1 of Example 1 to afford 6.74 g (88%) of the desired product: % NMR (300 MHz, acetone-dg) 8 9.13 (br s, 1 H) , 7.45-7.32 (m, 2 H), 7.18 (br s, 1 H), 6.85-6.80 (m, 15 1 H) ; 19F NMR (282 MHz, acetone-d6) 5 -86.6 (d, 17.2, 3), -137.52-137.68 (m, 1), -148.47-148.59 (m, 1). Step 2. Synthesis of Xl-a from X-a. 20 A solution of X-a (6.74 g, 25.1 mmol) was heated in xylenes at reflux as described in Step 2 of Example 1, substituting xylenes for toluene, to afford 6.3 g (100%) of the desired product: XH NMR (300 MHz, acetone-dg) 8 7.92-7.83 (m, 1 H), 7.46-7.44 (m, 1 H) ; 19F NMR (282 MHz, acetone-d6) 8 25 -70.7 (d, 38.7, 3), -136.72 (s, 1), -146.47-146.57 (m, 1). Step 3. Synthesis of Xll-a from Xl-a. 34 Printed from Mimosa WO 98/45276 PCT/US98/06733 A solution of Xl-a (6.28 g, 25.1 mmol) was treated with the the lithium acetylide derived from cyclopropylacetylene (24.9 mL of 30 wt% solution in toluene/THF/hexanes, 0.113 5 mol) according to the procedure of Step 3 of Example 1. The resulting crude yellow oil was dissolved in acetone and concentrated under reduced pressure to deliver a yellow solid. Crystallization from acetone afforded 5.98 g (75%) of the desired material: mp 86.5-88.5 °C; 1H NMR (300 MHz, 10 acetone-dg) 8 9.01 (br s, 1 H), 7.46 (br s, 1 H), 7.44-7.35 (m, 1 H), 6.86-6.81 (m, 1 H), 1.41-1.37 (m, 1 H), 0.90-0.83 (m, 1 H), 0.74-0.69 (m, 1 H) ; 19F NMR (282 MHz, acetone-d6) 8 -83.3 (d, J = 12.9, 1), -136.04-136.23 (m, 1), -148.14-148.26 (m, 1); IR (KBr Pellet) 1706, 1516, 1442, 1246, 1214, 1196 15 cm"1; MS (CI) m/e calc'd for C14H10F5N2O: 317.071329, found 317.070836; 317 (MH+, 100), 334 (M+NH4\ 62); Analysis calc'd for C14H9F5N2O: C, 53.17; H, 2.88; N, 8.87; found: C, 53.30; H, 3.16; N, 8.53. 20 Example 11 Preparation of (+/-)-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (R4 = Isopropyl) 25 A solution of Xl-a (7.24 g, 28.9 mmol) was treated with the the lithium acetylide derived from 3-methyl-1-butyne (8.87 g, 13.3 mL, 0.130 mol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by flash chromatography (2.5% MeOH/CH2Cl2) to afford 30 a yellow oil. Crystallization from acetone afforded 6.77 g (74%) of the desired product: mp 79-80 °C; iH NMR (300 MHz, acetone-dg) 8 9.02 (br s, 1 H), 7.50 (br s, 1 H), 7.44-7.35 (m, 1 H), 6.87-6.82 (m, 1 H), 2.69-2.65 (m, 1 H), 1.17 (d, J = 7.0 Hz, 6H) ; 19F NMR (282 MHz, acetone-dg) 8 -83.4 (d, J = 35 12.9, 1), -135.79-135.94 (m, 1), -148.14-148.26 (m, 1); MS (CI) m/e calc'd for C14H12F5N2O: 319.086979, found 319.087376; 319 (MH+, 100), 336 (M+NH4+, 76). 35 Printed from Mimosa WO 98/45276 PCT/U S98/06733 Preparation of (+/-)-5,6-Difluoro-4-(2-pyridyl) ethynyl-4-trifluoromethyl-3, 4-dihydro-2 (IH) -quinazolinone (R4 = 2-Pyridyl) 5 A solution of Xl-a (100 mg, 0.400 mmol) was treated with the the lithium acetylide derived from 2-ethynylpyridine (0.19 g, 1.80 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by flash 10 chromatography (4% MeOH/CH2Cl2) to afford 83 mg (59%) of the desired product: mp 219-220 °C; 1H NMR (300 MHz, acetone-dg) 8 9.15 (br s, 1 H), 8.61 (d, J = 4.4 Hz, 1 H), 7.88-7.82 (m, 2H) , 7.63 (dd, J = 7.0, 1.1 Hz, 1 H), 7.47-7.42 (m, 2H), 6.94-6.88 (m, 1 H) ; 19F NMR (282 MHz, acetone-d6) 8 -82.8 (d, 15 J = 12.9, 3), -135.78-135.93 (m, 1), -147.86-147.98 (m, 1); IR (KBr Pellet) 1712, 1470, 1450, 1430, 1416, 1264, 1238, 1226, 1198, 1186 cm"1; MS (CI) m/e calc'd for C16H9F5N3O: 354.066578, found 354.067821; 354 (MH+, 100). 20 Example 13 Preparation of (+/-)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (R4 = 2-Ethyl) 25 A solution of Xl-a (100 mg, 0.400 mmol) was treated with the the lithium acetylide derived from 1-butyne (97 mg, 1.80 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5% MeOH/CH2Cl2) to afford 69 mg (57%) of the desired product: mp 30 191-194 °C; *H NMR (300 MHz, acetone-d6) 8 9.03 (br s, 1 H) , 7.50 (br s, 1 H), 7.45-7.35 (m, 1 H), 6.87-6.82 (m, 1 H), 2.34-2.27 (m, 2H) , 1.20-1.15 (m, 3 H) ; 19F NMR (282 MHz, acetone-d6) 5 -83.3 (d, J= 12.9, 3), -135.79-135.98 (m, 1), -148.16-148.29 (m, 1); IR (KBr Pellet) 1704, 1686, 1518, 35 1444, 1244, 1210, 1192, 1172 era"1; MS (CI) m/e calc'd for C13H10F5N2O: 305.071329, found 305.071146; 305 (MH+, 100); Analysis calc'd for C13H9F5N2O: C, 51.33; H, 2.98; N, 9.22; found: C, 51.00; H, 2.79; N, 8.99. 36 Printed from Mimosa WO 98/45276 PCT/US98/06733 Example 14 Preparation of (+/-)-5, 6-Dif luoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (R4 = 5 Phenyl) A solution of Xl-a (100 mg, 0.400 mmol) was treated with the the lithium acetylide derived from phenylacetylene (0.18 g, 0.20 mL, 1.80 mmol) according to the procedure of Step 3 10 of Example 1. The resulting crude material was purified by HPLC (2.5% MeOH/CH2Cl2) to afford 92 mg (65%) of the desired product: ^ NMR (300 MHz, acetone-dg) 8 9.14 (br s, 1 H) , 7.80 (br s, 1 H), 7.57-7.54 (m, 2H), 7.49-7.40 (m, 4H), 6.92-6.87 (m, 1 H) ; 19F NMR (282 MHz, acetone-dg) 8 -83.0 (d, J = 15 12.9, 3), -136.08-136.27 (m, 1), -147.87-148.00 (m, 1); MS (CI) m/e calc'd for C17H10F5N2O: 353.071329, found 353.071716; 353 (MH+, 42), 370 (M+NH4+, 100). Hiranmle IS 20 Preparation of (+/-)-5,6-Difluoro-4-isopentyl-4- trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (R4 = Isopropyl) Synthesis of Xlll-a from Xll-a. 25 A solution of XHI-a (R4 = isopropyl) (26 mg, 82 mmol) in ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10% Pd on carbon (35 mg) under H2 (1 atm) for 16 hours. The catalyst was removed by vacuum filtration through Celite and the 30 filter cake was washed with EtOAc. The combined filtrates were concentrated under reduced pressure to afford 26 mg (100%) of the desired material. No further purification was necessary: !h NMR (300 MHz, acetone-dg) 8 8.88 (br s, 1 H) , 7.41-7.31 (m, 1 H), 6.89-6.81 (m, 2H), 2.55-2.50 (m, 1 H), 35 1.64-1.45 (m, 2H), 1.06-1.02 (m, 1 H), 0.89 (dd, J = 6.6, 2.2 Hz, 6H) ; 19F NMR (282 MHz, acetone-dg) 8 -83.22 (d, J= 12.1, 3), -138.97-139.13 (m, 1), -148.46-148.58 (m, 1); IR (KBr Pellet) 1700, 1678, 1518, 1438, 1252, 1188, 1172 cm"1; MS 37 Printed from Mimosa WO 98/45276 PCT/US98/06733 (CI) m/e calc'd for C14H16F5N2O: 323.118280, found 323.116703; 323 (MH+, 100), 340 (M+NH4 + , 57). Example 16 5 Preparation of ( + /-)-4-Butyl-5,6-difluoro-4- trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (R4 = Ethyl) A solution of XHI-a (R4 = ethyl) (20 mg, 66 mmol) in 10 ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10% Pd on carbon under H2 according to the procedure of Example 15. Purification by HPLC (2.5% MeOH/CH2Cl2) afforded 12 mg (56%) of the desired product: *H NMR (300 MHz, acetone-dg) 8 8.89 (br s, 1 H), 7.41-7.32 (m, 1 H), 6.86-6.81 (m, 2H), 2.57-2.47 15 (m, 1 H), 1.56-1.15 (m, 5H), 0.88 (t, J= 7.3 Hz, 3 H); "F NMR (282 MHz, acetone-dg) 8 -83.19-83.24 (m, 1), -139.14 (s, 1), -148.49-148.62 (m, 1); MS (CI) m/e calc'd for C13H14F5N2O: 309.102629, found 309.103555; 309 (MH+, 100), 326 (M+NH4+, 62). 20 38 Printed from Mimosa WO 98/45276 PCT/US98/06733 Example 17 Preparation, of (+/-)-4-Cyclopropylethynyl-6-fluoro-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (R4 » Cyclopropyl) XIV-a XV-a XVI-a a. THF/n-BuLi/HCCR4 F3 b. BF3 OEt2 10% Pd/C H2 (1 atm)F EtOH/EtOAC XVI-a - XVII-a THP/CH3CCR4 F n-BuLi/0 °C XlX-a Step 1. Synthesis of XV-a from XlV-a. 10 A solution of Xlll-a (3.07 g, 14.8 mmol) was treated with dimethylaminopyridine and trimethylsilyl isocyanate as described in Step 1 of Example 1 to afford 2.81 g (76%) of the desired product. 15 Step 2. Synthesis of XVI-a from XV-a. A solution of XV-a (6.74 g, 25.1 mmol) was heated in toluene at reflux as described in Step 2 of Example 1 to afford 0.73 g (94%) of the desired product. 20 Step 3. Synthesis of XVII-a from XVI-a. 39 Printed from Mimosa WO 98/45276 PCT/US98/06733 A solution of XVI-a (100 mg, 0.431 mmol) was treated with the the lithium acetylide derived from cyclopropylacetylene (1.43 mL of 30 wt% solution in toluene/THF/hexanes, 1.94 mmol) according to the procedure of 5 Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5% MeOH/CH2Cl2) to afford 44 mg (34%) of the desired product: mp 155 °C; NMR (300 MHz, acetone-dg) 8 8.86 (br s, 1 H), 7.36 (br s, 1 H), 7.30-7.27 (m, 1 H), 7.22-7.15 (m, 1 H), 7.04-6.99 (m, 1 H), 1.47-1.42 (m, 1 H), 10 0.90-0.87 (m, 2 H), 0.76-0.75 (m, 2 H); 19F NMR (282 MHz, acetone-d6) 8 -82.86, -123.36-123.44; MS (CI) m/e calc'd for C14H11F4N2O: 299.080751, found 299.079976; 299 (MH+, 100). EX»™-p1 ° 1 S 15 Preparation of (+/-)-6-Fluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (R4 = Isopropyl) A solution of XVI-a (100 mg, 0.431 mmol) was treated 20 with the the lithium acetylide derived from 3-methyl-1-butyne (0.13 g, 0.20 mL, 1.94 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5% MeOH/CH2Cl2) to afford 24 mg (18%) of the desired product: mp 158 °C; ^-H NMR (300 MHz, acetone-dg) 25 8 9.07 (br s, 1 H), 7.60 (br s, 1 H), 7.32-7.30 (m, 1 H), 7.24-7.16 (m, 1 H), 7.05-6.99 (m, 1 H) , 2.77-2.67 (m, 1 H), 1.20 (dd, J = 7.0, 2.6 Hz, 6H) ; 19F NMR (282 MHz, acetone-dg) 8 -82.95, -123.41-123.49; MS (301) m/e calc'd for C14H13F4N2O: 301.096401, found 301.096235; 301 (MH+, 100). 30 Ex»"p1 a 1 *> Preparation of (+/-)-6-Fluoro-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (R4 = 2-Pyridyl) 35 A solution of XVI-a (100 mg, 0.431 mmol) was treated with the the lithium acetylide derived from 2-ethynylpyridine (0.20 g, 1.94 mmol) according to the procedure of Step 3 of 40 Printed from Mimosa WO 98/45276 PCT/US98/06733 Example 1. The resulting crude material was purified by HPLC (2.5% MeOH/CH2CI2) to afford 65 mg (45%) of the desired product: mp 155 °C; 1H NMR (300 MHz, acetone-dg) 8 9.02 (br s, 1 H), 8.60 (d, J = 4.0 Hz, 1 H), 7.87-7.78 (m, 2 H), 7.66 5 (d, J = 7.7 Hz, 1 H), 7.45-7.41 (m, 2 H), 7.26-7.20 (m, 1 H), 7.09-7.05 (m, 1 H); 19F NMR (282 MHz, acetone-dg) 8 -82.36, -122.94-123.02; MS (CI) m/e calc'd for C16H1.0F4N3O: 336.076000, found 336.074156; 336 (MH+, 25). 10 Example 20 Preparation of (+/-)-6-Fluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (R4 = Ethyl) 15 A solution of XVI-a (100 mg, 0.431 mmol) was treated with the the lithium acetylide derived from 1-butyne (0.10 g, 1.94 mmol) according to the procedure of Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5% MeOH/CH2Cl2) to afford 40 mg (33%) of the desired product: mp 20 190 °C; *H NMR (300 MHz, acetone-d6) 8 8.86 (br s, 1 H) , 7.38 (br s, 1 H), 7.34-7.31 (m, 1 H), 7.22-7.16 (m, 1 H) , 7.05-7.00 (m, 1 H), 2.04-2.01 (m, 2 H), 1.19-1.14 (m, 3 H); 19F NMR (282 MHz, acetone-d6) 8 -75.392, -123.42-123.50; MS (CI) m/e calc'd for C3.3H11F4N2O: 287.080751, found 287.080740; 25 287 (MH+, 100) . Eftfrmple .,21 Preparation of (+/-)-6-Fluoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (R4 = 30 Phenyl) A solution .of XVI-a (100 mg, 0.431 mmol) was treated with the the lithium acetylide derived from phenylacetylene (0.20 g, 0.21 mL, 1.94 mmol) according to the procedure of 35 Step 3 of Example 1. The resulting crude material was purified by HPLC (2.5% MeOH/CH2Cl2) to afford 41 mg (28%) of the desired product: mp 107 °C; ^-H NMR (300 MHz, acetone-dg) 8 9.00 (br s, 1 H), 7.69 (br s, 1 H) , 7.63-7.59 (m, 2 H) , 41 Printed from Mimosa WO 98/45276 PCT/US98/06733 7.50-7.40 (m, 4H) , 7.27-7.20 (m, 1 H) , 7.10-7.05 (m, 1 H); 19F NMR (282 MHz, acetone-d6) 8 -82.56, -122.99-123.07; MS (CI) m/e calc'd for C17H11F4N2O: 335.080751, found 335.082057; 335 (MH+, 74), 352 (M+NH4+, 100). 5 Example 22 Preparation of (+/-)-6-Fluoro-4-isopentyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (R4 = Xsopropyl) 10 Synthesis of XVIII-a from XVII-a. A solution of XVII-a (R4 = isopropyl) (26 mg, 87 mmol) m ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10% Pd 15 on carbon under H2 according to the procedure of Example 15 to afford 15 mg (58%) of the desired product. No further purification was necessary: mp 179 °C; 1H NMR (300 MHz, acetone-d6) 5 7.02-6.97 (m, 2 H), 6.80-6.76 (m, 1 H), 2.18- 2.09 (m, 2 H), 1.92-1.82 (m, 2 H), 1.52-1.45 (m, 1 H), 0.88-20 0.79 (m, 6 H) ; 19F NMR (282 MHz, acetone-d6) 5 -82.60, -123.72-123.84; MS (CI) m/e calc'd for Ci4Hi7F4N20: 305.127707, found 3 05.126790; 305 (MH\ 100). 25 Preparation of (+/-)-6-Fluoro-4-(2•-2-pyridyl)ethyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (R4 = 2-Pyridyl) A solution of XVII-a (R4 = 2-pyridyl) (33 mg, 99 mmol) 30 in ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10% Pd on carbon under H2 according to the procedure of Example 15 to afford 10 mg (30%) of the desired product. No further purification was necessary: mp 88 °C; 1H NMR (300 MHz, acetone-d6) 8 8.35 (d, J = 4.4 Hz, 1 H), 7.63 (dt, J" = 7.7, 35 1.5 Hz, 1 H), 7.20-7.13 (m, 3 H) , 7.04-6.98 (m, 1 H), 6.83-6.79 (m, 1 H), 2.84-2.78 (m, 1 H), 2.68-2.48 (m, 2 H), 2.27-2.06 (m, 1 H); 19F NMR (282 MHz, acetone-d6) 8 -82.58, 42 Printed from Mimosa WO 98/45276 PCT/US98/06733 -123.26-123.34; MS (CI) m/e calc'd for C16H14F4N3O: 340.107300, found 340.107719; 340 (MH+, 100). Bywmnlfl 24 5 Preparation of (+/-)-4-Butyl-6-fluoro-4- trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (R* = Ethyl) A solution of XVII-a (R4 = ethyl) (24 mg, 84 mmol) in 10 ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10% Pd on carbon under H2 according to the procedure of Example 15 to afford 24 mg (100%) of the desired product. No further purification was necessary: mp 198 °C; ^-H NMR (300 MHz, acetone-dg) 8 7.03-6.97 (m, 2 H), 6.80-6.76 (m, 1 H), 2.18- 15 2.11 (m, 1 H), 1.90-1.81 (m, 1 H), 1.30-1.19 (m, 3 H), 0.97-0.80 (m, 4 H) ; 19F NMR (282 MHz, acetone-d6) 8 -82.692, -123.78-123.86; MS (CI) m/e calc'd for Ci3Hi5F4N20: 291.112051, found 291.112227; 291 (MH+, 100). 20 Example 25 Preparation of (+/-)-6-Fluoro-4-phenylethyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (R4 = Phenyl) 25 A solution of XVII-a (R4 = phenyl) (30 mg, 90 mmol) in ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10% Pd on carbon under H2 according to the procedure of Example 15 to afford 20 mg (67%) of the desired product. No further purification was necessary: mp 98 °C; ^H NMR (300 MHz, 30 acetone-d6) 5 7.18-6.99 (m, 7H), 6.84-6.79 (m, 1 H), 2.68-2.6 (m, 1 H), 2.48-2.12 (m, 3 H) ; 19F NMR (282 MHz, acetone-d6) 8 -82.67, -123.24-123.32; MS (CI) m/e calc'd for Ci7Hi5F4N20: 339.112051, found 339.110781; 339 (MH+, 100). Printed from Mimosa WO 98/45276 PCT/US98/06733 Example 2 6 Preparation of (+/-)-6-Fluoro-4-methylpropargyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (R4 = Methyl) 5 Synthesis of XlX-a from XVI-a. A solution of 2-butyne (94 mg, 1.75 mmol) in anhydrous THF (3.5 mL) was cooled to 0 °C, treated with n-BuLi (0.97 mL 10 of 1.6 M solution in hexanes, 1.55 mmol), and aged for 0.5 h. To a solution of XVI-a (90 mg, 0.388 mmol) in anhydrous THF (1.9 mL) at -78 °C was added the lithium anion over 5 minutes, followed by boron trifluoride etherate (25 mL, 0.194 mmol). The cooling bath was removed and the mixture was 15 allowed to warm to room temperature. After 16 h at room temperature, quench by addition of 1 M citric acid (10 mL) , dilute with EtOAc (50 mL), separate phases and wash the organic phase sequentially with saturated aqueous NaHC03 (20 mL) and saturated aqueous NaCl (20 mL). The resulting 20 material was purified by HPLC (2.5% Me0H/CH2Cl2> to afford 10 mg (9%) of the desired product: mp 181 °C; ^-H NMR (300 MHz, acetone-dg) 8 8.91 (br s, 1 H), 7.27 (d, 8.4H), 7.18-7.08 (m, 1 H), 7.02-6.97 (m, 2 H), 3.29 (dd, J" =16.8, 2.6 Hz, 1 H), 3.00 (dd, J = 16.8, 2.2Hz, 1 H), 1.61-1.59 (m, 3 H); 19F NMR 25 (282 MHz, acetone-dg) 5 -81.86, -123.69-123.70; MS (CI) m/e calc'd for C13H11F4N2O: 287.080751, found 287.080340; 287 (MH+, 75), 304 (M+NH4+, 100). 44 Printed from Mimosa WO 98/45276 PCT/US98/06733 SCHEME 4: Chiral Resolution Chiral HPLC Separation 6-C1 6-MeO 5,6-diF 6-F Compound IV-a VlU-a Xll-a XVII-a 6-Cl 6-MeO 5,6-diF 6-F Compound IV-b VHI-b XH-b XVII-b 6-Cl 6-MeO 5,6-diF 6-F Compound IV-c VIII-c XII-c XVII-c 5 Bvamnl es 27 and 28 Preparation of (-)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (Example 27) and (+)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone 10 (Example 28) Resolution of IV-b,c from IV-a (R4 = Cyclopropyl) . Chiral HPLC utilizing a Chiralcel OD column, 3% 15 isopropanol, 5% CH2CI2 and 92% hexanes at ambient temperature with a 1.0 mL/min flow rate and detection at 250 nm afforded seperation of IV-b from IV-c with enantiomeric excesses of 99% and 99.4%, respectively. IV-b: mp 106-109 °C; [oc]d25 -60.34° (c=0.274, MeOH). IV-c: mpl05-107 °C; [a]D25 +58.33' 20 (c=0.288, MeOH). gymnplwft 29 and 30 Preparation of (+)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone 25 (Example 29) and (-)-4-Cyclopropylethynyl-5,6- difluoro-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (Example 30) Resolution of XII-b,c from Xll-a (R4 = Cyclopropyl). 45 Printed from Mimosa WO 98/45276 PCT/US98/06733 Chiral HPLC utilizing a Chiralpak AD column, 5% water and 95% methanol at ambient temperature with a 0.8 mL/min flow rate and detection at 250 nm afforded seperation of XII-5 b from XII-c with enantiomeric excesses of 100% and 99%, respectively. Xll-b: mp 187 °C; [a]D25 +1.46° (c=0.274, MeOH). XII-c: mp 187.5-188.8 °C; [a]D25 -1.45° (c=0.278, MeOH). 10 Wvawpl 83 31 and 32 Preparation of (-)-5,6-Difluoro-4-isopropylethynyl-4- trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (Example 31) and (+)-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone 15 (Example 32) Resolution of XII-b,c from Xll-a (R4 = Isopropyl). Chiral HPLC utilizing a Chiralpak AD column, 5% water 20 and 95% methanol at ambient temperature with a 0.5 mL/min flow rate and detection at 250 nm afforded seperation of XII-b from XII-c with enantiomeric excesses of 100% and 99%, respectively. XII-b: mp 155 °C; [<X]d25 -2.14° (c=0.280, MeOH). XII-c: 98 °C; [a]D25 +4.45° (c=0.292, MeOH). 25 R»»mp1 as 33 and 34 Preparation of (-)-5,6-Difluoro-4-ethylethynyl-4- trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (Example 33) and (+)-5,6-Difluoro-4-ethylethynyl-4-30 trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (Example 34) Resolution of XII-b,c from Xll-a (R4 = Ethyl). 35 Chiral HPLC utilizing a AS column, 20% ethanol and 80% hexanes at ambient temperature with a 1.0 mL/min flow rate and detection at 250 nm afforded seperation of XII-b from 46 Printed from Mimosa 10 WO 98/45276 PCT/US98/06733 XII-c with enantiomeric excesses of 100% and 99%, respectively. XII-b: mp 155-167 °c. XII-c: mp 157-159 °c. Rvmnpl gg 35 and 3 6 Preparation of 5,6-Difluoro-4-(2-hydroxyethyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (Example 35) and 5,6-Difluoro-4-(1-hydroxyethyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone (Example 36) LiCsCCH2CH2OTBS or LiCsCCH(OTBS)CH3 THF/BF3-OEt2 Compound R Ex. 35 CH2CH2OTBS Ex. 36 CH(OTBS)CH3 TBAF THF Compound R Ex. 35 CH2CH2OH Ex. 36 CH(0H)CH3 To a slurry of ketimine (300 mg, 1.20 mmol) in anhyd. THF (11 mL) at -78 °C was sequentially added a precooled (0 15 °C) solution of the silyl protected lithium acetylide (5.40 mmol) and BF3.0Et2 (0.60 mmol). The resulting mixture was stirred at rt overnight. The reaction was quenched by the addition of 1 M citric acid and diluted with EtOAc. The phases were separated, the organic phase was washed with 20 water, sat. aq. NaHC03 and sat. aq. NaCl. The organic extracts were dried over MgS04, filtered and concentrated. 47 Printed from Mimosa WO 98/45276 PCT/US98/06733 The material was purified by regular phase HPLC chromatography (41.4 mm Rainin Dynamax® column using 60 A silica @ 25 mL/min): 2.5% MeOH/CH2Cl2 for 24 min, increase to 30% MeOH/CH2Cl2 over 4 min, 3 0% MeOH/CH2Cl2 for 10 min, and 5 ramp back to 2.5% MeOH/CH2C12 over 2 min. The yield of the protected intermediates was 47% and 32%, respectively. Example 35-intermediate. Mp 62.9-64 °C; 1H NMR (300 MHz, acetone-dg) 5 8.98 (br s, IH) , 7.41-7.32 (m, 2H), 6.83- 6.78 (m, IH), 3.74 (t, J = 6.6 Hz, 2H), 2.47 (t, J = 6.6 Hz, 10 2H) , 0.81 (s, 9H), 0.00 (s, 6H); 19F NMR (282 MHz, acetone-dg) 8 -83.17, -135.16—135.31, -148.09 — 148.22; MS (CI) calc'd for C19H24F5N202Si: m/z 435.152723, found 435.151149; 435 (MH+, 94), 452 (M+NH4+, 100); Analysis calc'd for Ci9H23F5N202Si: C, 52.52; H, 5.35; N, 6.46; found: C, 15 52.65; H, 5.29; N, 6.31. Example 36-intermediate. 1H NMR (300 MHz, acetone-dg) 5 8.96 (br s, IH), 7.50 (br s, IH), 7.37-7.28 (m, IH), 6.79-6.74 (m, IH), 4.61 (q, J = 13.2, 6.6 Hz, IH), 1.30 (d, J = 6.6 Hz, 3H), 0.78 (s, 9H) , 0.01 (s, 6H) ; 19F NMR (282 MHz, 20 acetone-d6) d -82.88—82.95, -135.20—135.42, -148.06—148.23; MS (CI) calc'd for C19H24F5N202Si: m/z 435.152723, found 435.152927; 435 (MH+, 51), 452 (M+NH4+, 100); Analysis calc'd for ci9H23F5N202Si: C, 52.52; h, 5.35; n, 6.46; found: c, 52.54; h, 5.34; N, 6.69. 25 To a solution of the protected intermediate for Example 35 (0.56 mmol) in THF (1.1 mL) was added TBAF (0.62 mL of 1.0 M solution in THF). The resulting mixture was stirred at rt for 1 h, diluted with EtOAc, washed with 1 N HC1, sat. aq. NaHC03, and sat. aq. NaCl. The organic extract was dried over 30 MgS04, filtered and concentrated. The material was purified by regular phase HPLC chromatography (41.4 mm Rainin Dynamax® column using 60 A silica @ 25 mL/min) : 2.5% Me0H/CH2Cl2 for 24 min, increase to 30% Me0H/CH2Cl2 over 4 min, 30% MeOH/CH2Cl2 for 10 min, and ramp back to 2.5% MeOH/CH2Cl2 over 35 2 min. Example 35 was isolated in 82% yield. Example 35. Mp 190-192 °C; XH NMR (300 MHz, acetone-dg) 5 9.05 (br s, IH), 7.53 (br s, IH), 7.45-7.36 (m, IH) , 6.88-6.83 (m, IH), 4.01-3.98 (m, IH), 3.68-3.64 (m, 2H), 2.50 (t, 48 Printed from Mimosa WO 98/45276 PCT/US98/06733 J = 6.6 Hz, 2H); 19F NMR (282 MHz, acetone-d5) 8 -83.3, -135.68--135.88, -148.10 — 148.22; MS (CI) calc'd for C13H10F5N2O2: m/z 321.066244, found 321-066479; 321 (MH+, 100); Analysis calc'd for C3.3H9F5N2O2: C, 48.76; H, 2.83; N, 5 8.76; found: C, 49.05; H, 3.23; N, 8.38. Example 36 was synthesized in an analogous manner to deliver the title compound in 88% yield. Mp 190-191 °C; !h NMR (300 MHz, acetone-d6) 8 9.06 (br s, IH) , 7.56 (br s, IH) , 7.46-7.37 (m, IH) , 6.88-6.83 (m, IH), 4.58-4.57 (m, 2H), 1.39 10 (d, J = 5.5 Hz, 3H) ; 19F NMR (282 MHz, acetone-d6) 8 -83.15, -135.40, -135.60, -148.08—148.20; MS (CI) calc'd for C13H10F5N2O2: m/z 321.066244, found 321.065983; 321 (MH+, 58), 338 (M+NH4+, 100); Analysis calc'd for C13H9F5N2O2: C, 48.76; H, 2.83; N, 8.76; found: C, 48.84; H, 2.76; N, 8.63. 15 Example 37 Preparation of (+)-4-E-Cyclopropylethenyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(IH)- quinazolinone 20 To a solution of XII-b (200 mg, 0.632 mmol) in anhyd. THF (1.3 mL) at rt was added a solution of lithium aluminium hydride (1.3 mL of 1.0 M solution in THF). The resulting mixture was stirred at rt overnight. The reaction was 25 quenched by addition of 10% NaOH (3 mL) and water (3 mL). The mixture was diluted with EtOAc (30 mL) and the phases were separated. The organic phase was washed with sat. aq. NaCl, dried over MgS04, filtered and concentrated. The title compound was purified by regular phase HPLC (41.4 mm Rainin 30 Dynamax® column using 60 A silica): 2.5% MeOH/CH2Cl2 for 24 min, increase to 30% MeOH/CH2Cl2 over 4 min, 30% MeOH/CH2Cl2 for 10 min, and ramp back to 2.5% MeOH/CH2Cl2 over 2 min. Mp 80-83 °C; iH NMR (300 MHz, acetone-d6) d 9.07 (br s, IH) , 7.33 (q, J=8.8 Hz, IH), 6.94 (br s, IH), 6.84-6.79 (m, IH), 35 6.27 (dd, J = 15.6, 7.5 Hz, IH), 5.67 (dd, J = 15.2, 9.4 Hz, IH), 1.65-1.56 (m, IH), 0.80-0.71 (m, 2H), 0.50-0.42 (m, 2H); 19F NMR (282 MHz, acetone-d6) d -82.68, -135.05, -148.49; MS (CI) calc'd for C14H12F5N2O: m/z 319.086979, found 49 Printed from Mimosa WO 98/45276 PCT/US98/06733 5 10 15 20 50 Printed from Mimosa 319.087755; 319 (MH+, 100); [a]D20 +72.77° (c=0.382, MeOH); Analysis calc'd for C14H13F5N2O: C, 52.84; H, 3.48; N, 8.80; found: C, 53.02; H, 3.48; N, 8.61. a 3B Preparation of (-)-6-Chloro-4-E-cyclopropylethenyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone The title compound was prepared as described for Example 37 (starting from IV-b), except that it was purified using a Chiralcel OD column at 1.5 mL/min in 0.5% EtOH/20% CH2CI2/79.5% hexanes. Mp 87-89 °C; ^-H NMR (300 MHz, acetone-dg) d 9.08 (br s, IH) , 7.40-7.25 (m, 2H), 7.04-6.90 (m, 2H) , 6.28-6.18 (m, IH), 5.64-5.52 (m, IH) , 1.68-1.55 (m, IH), 0.83-0.71 (m, 2H), 0.53-0.41 (m, 2H) ; 19F NMR (282 MHz, acetone-dg) d -81.67; MS (CI) calc'd for C14H13CIF3N2O: m/z 317.066851, found 317.065857; 317 (MH+, 100); [a]D20 -6.81° (c=0.382, MeOH); Analysis calc'd for C14H12CIF3N2O . 0.27 C3HgO: C, 53.52; H, 4.13; N, 8.43; found: C, 53.90; H, 4.07; N, 8.80. WO 98/45276 Table 1* PCT/US98/06733 Ex. # R3 R1 R2 R8 m.p. (°C) Mass Spec 1 6-Cl cf3 CeC-cycPr H 86.6-88 332 (M+NH4+) 2 6-Cl cf3 CsC-iPr H 180 334 (M+NH4+) 3 6-Cl cf3 CsC-2-Pyridyl H 105 352 (MH+) 4 6-Cl cf3 CsC-Et H 217-219 303 (MH+) 5 6-Cl cf3 CsC-Ph H 104-107 368 (M+NH4+) 6 6-MeO cf3 CsC-cycPr H 208 311 (MH+) 7 6-MeO cf3 CsC-iPr H 228-229 313 (MH+) 8 6-MeO cf3 CsC-2-Pyridyl H 97-98 348 (MH+) 9 6-MeO cf3 CsC-Ph H 206.2-207.7 347 (MH+) 10 5,6-diF cf3 CsC-cycPr H 101 dec. 317 (MH+) 11 5,6-diF cf3 CsC-iPr H 79-80 319 (MH+) 12 5,6-diF cf3 C=C-2-Pyridyl H 219-220 354 (MH+) 13 5,6-diF cf3 C=C-Et H 191-194 305 (MH+) 14 5,6-diF cf3 C=C-Ph H 215-217 370 (M+NH4+) 15 5,6-diF cf3 ch2ch2ch (CH3) 2 H 192-193 323 (MH+) 16 5,6-diF cf3 ch2ch2ch2ch3 H 309 (MH+) 17 6-F cf3 CsC-cycPr H 155 299 (MH+) 18 6-F cf3 CsC-iPr H 158 301 (MH+) 19 6-F cf3 C=C-2-Pyridyl H 155 336 (MH+) 20 6-F cf3 CsC-Et H 190 287 (MH+) 21 6-F cf3 C=C-Ph H 107 352 (M+NH4+) 22 6-F cf3 CH2CH2CH(CH3)2 H 179 305 (MH+) 51 Printed from Mimosa WO 98/45276 PCT/US98/06733 23 6-f cf3 CH2CH2-2-Pyridyl H 88 340 (MH+) 24 6-f cf3 ch2ch2ch2ch3 H 198 291(MH+) 25 6-f cf3 CH2CH2Ph H 98 339 (MH+) 26 6-f cf3 CH2CsC-CH3 H 181 304 (M+NH4+) 27 (-) 6-Cl cf3 C=C-cycPr H 106-109 313 (M-) 28 ( + ) 6-Cl cf3 C=C-cycPr H 105-107 313 (M") 29 ( + ) 5,6-diF cf3 CsC-cycPr H 187 315 (M") 30 (-) 5,6-diF cf3 CsC-cycPr H 188-189 315 (M") 31 (-) 5,6-diF cf3 CsC-iPr H 155 317 (M~) 32 ( + ) 5,6-diF cf3 CsC-iPr H 98 317 (M~) 3 3 (—) 5,6-diF cf3 CsC-Et H 165-167 303 (M-) 34 ( + ) 5,6-diF cf3 CsC-Et H 157-159 303 (M") 35 5,6-diF cf3 ChCCH2CH2OH H 190-192 321 (MH+) 36 5,6-diF cf3 C=C-CH (OH) Me H 190-191 338 (M+NH4+) 37 (+) 5,6-diF cf3 C=C-cycPr (E) H 80-83 319 (MH+) 38 (-) 6-Cl cf3 C=C-cycPr (E) H 87-89 317 (MH+) *Unless otherwise indicated, stereochemisty is ( + /-) . 52 Printed from Mimosa WO 98/45276 PCT/US98/06733 Table 2* Ex. # R3 R1 R2 R8 1 6-Cl cf3 CSCCH2CH20H H 2 6-Cl cf3 C=C-CH{OH)Me H 3 6-Cl cf3 CsC-(2-Cl)Ph H 4 6-Cl cf3 C=C-(3-C1)Ph H 5 6-Cl cf3 C=C-(4-C1)Ph H 6 6-Cl cf3 C=C-(2-F)Ph H 7 6-Cl cf3 C=C-(3-F)Ph H 8 6-Cl cf3 C=C-(4-F)Ph H 9 6-Cl cf3 C=C-(2-OH)Ph H 10 6-Cl cf3 C=C-(3-OH)Ph H 11 6-Cl cf3 C=C-(4-OH)Ph H 12 6-Cl cf3 CsC-(2-OMe)Ph H 13 6-Cl cf3 CsC-(3-OMe)Ph H 14 6-Cl cf3 C=C-(4-OMe)Ph H 15 6-Cl cf3 C=C-(2-CN)Ph H 16 6-Cl cf3 C=C-(3-CN)Ph H 17 6-Cl cf3 C=C-(4-CN)Ph H 18 6-Cl cf3 C=C-(2-N02)Ph H 19 6-Cl cf3 C=C-(3-N02)Ph H 20 6-Cl cf3 C=C-(4-N02)Ph H 21 6-Cl cf3 C=C-(2-NH2)Ph H 22 6-Cl cf3 C=C-(3-NH2)Ph H 23 6-Cl cf3 CsC-(4-NH2)Ph H 24 6-Cl cf3 CsC-(2-NMe2)Ph H 25 6-Cl cf3 CsC-(3-NMe2)Ph H 26 6-Cl cf3 c=c-(4-NMe2)Ph H 27 6-Cl cf3 C=C-3-Pyridyl H 28 6-Cl cf3 CsC-4-Pyridyl H 53 Printed from Mimosa WO 98/45276 PCT/US98/06733 29 6-Cl cf3 C=C-2-furanyl H 30 6-Cl cf3 C=C-3-furanyl H 31 6-Cl cf3 C=C-2-thienyl H 32 6-Cl cf3 C=C-3-thienyl H 33 6-Cl cf3 C=C-2-oxazolyl H 34 6-Cl cf3 CsC-2-thiazolyl H 35 6-Cl cf3 CsC-4-isoxazolyl H 36 6-Cl cf3 CsC-2-imidazolyl H 37 6-Cl cf3 c=cch2ch2oh h 38 6-Cl cf3 C=C-CH(OH)Me H 39 6-Cl cf3 C=C-(2-Cl)Ph H 40 6-Cl cf3 C=C-(3-C1)Ph h 41 6-Cl cf3 C=C-(4-C1)Ph H 42 6-Cl cf3 C=C-(2-F)Ph H 43 6-Cl cf3 C=C-(3-F)Ph H 44 6-Cl cf3 C=C-(4-F)Ph h 45 6-Cl cf3 C=C-(2-OH)Ph H 46 6-Cl cf3 C=C-(3-OH)Ph H 47 6-Cl cf3 C=C-(4-OH)Ph H 48 6-Cl cf3 C=C-(2-OMe)Ph H 49 6-Cl cf3 C=C-(3-OMe)Ph H 50 6-Cl cf3 C=C-(4-OMe)Ph H 51 6-Cl cf3 C=C-(2-CN)Ph H 52 6-Cl cf3 C=C-(3-CN)Ph H 53 6-Cl cf3 C=C-(4-CN)Ph h 54 6-Cl cf3 C=C-{2-N02)Ph H 55 6-Cl cf3 C=C-(3-N02) Ph H 56 6-Cl cf3 C=C-(4-N02)Ph H 57 6-Cl cf3 C=C-(2-NH2)Ph H 58 6-Cl cf3 C=C-(3-NH2)Ph H 59 6-Cl cf3 C=C-(4-NH2)Ph H 60 6-Cl cf3 C=C-{2-NMe2)Ph H 61 6-Cl cf3 C=C-(3-NMe2)Ph H 62 6-Cl cf3 C=C-(4-NMe2)Ph H 54 Printed from Mimosa WO 98/45276 PCT/US98/06733 63 6-Cl cf3 C=C-3-Pyridyl H 64 6-Cl cf3 C=C-4-Pyridyl H 65 6-Cl cf3 C=C-2-furanyl H 66 6-Cl cf3 C=C-3-furanyl H 67 6-Cl cf3 C=C-2-thienyl H 68 6-Cl cf3 C=C-3-thienyl H 69 6-Cl cf3 C=C-2-oxazolyl H 70 6-Cl cf3 C=C-2-thiazolyl H 71 6-Cl cf3 C=C-4-isoxazolyl H 72 6-Cl cf3 C=C-2-imidazolyl H 73 6-Cl cf3 CH2CH2-cycPr H 74 6-Cl cf3 CH2CH2CH2CH2OH H 75 6-Cl cf3 CH2 CH2 -CH (OH) Me H 76 6-Cl cf3 CH2CH2-Ph H 77 6-Cl cf3 CH2CH2-(2-C1)Ph H 78 6-Cl cf3 CH2CH2-(3-Cl)Ph H 79 6-Cl cf3 CH2CH2-(4-C1)Ph H 80 6-Cl cf3 CH2CH2-(2-F)Ph H 81 6-Cl cf3 CH2CH2-(3-F)Ph H 82 6-Cl cf3 CH2CH2-(4-F)Ph H 83 6-Cl cf3 CH2 CH2-(2-OH)Ph H 84 6-Cl cf3 CH2CH2-(3-OH)Ph H 85 6-Cl cf3 CH2CH2~(4-OH)Ph H 86 6-Cl cf3 CH2CH2 - (2 -OMe) Ph H 87 6-Cl cf3 CH2CH2- (3-OMe) Ph H 88 6-Cl cf3 CH2CH2 - {4 -OMe) Ph H 89 6-Cl cf3 CH2CH2-(2-CN)Ph H 90 6-Cl cf3 CH2CH2-(3-CN)Ph H 91 6-Cl cf3 CH2 CH2-(4-CN)Ph H 92 6-Cl cf3 CH2CH2~(2-N02)Ph H 93 6-Cl cf3 CH2CH2—(3-N02)Ph H 94 6-Cl cf3 CH2CH2-{4-N02)Ph H 95 6-Cl cf3 CH2CH2-{2-NH2)Ph H 96 6-Cl cf3 CH2CH2-(3-NH2)Ph H 55 Printed from Mimosa WO 98/45276 PCT/US98/06733 97 6-Cl CFj CH2CH2-(4-NH2)Ph H 98 6-Cl cf3 CH2CH2-(2-NMe2)Ph H 99 6-Cl cf3 CH2CH2-(3-NMe2)Ph H 100 6-Cl cf3 CH2CH2-(4-NMe2)Ph H 101 6-Cl cf3 CH2CH2-2-Pyridyl H 102 6-Cl cf3 CH2CH2-3-Pyridyl H 103 6-Cl cf3 CH2CH2-4-Pyridyl H 104 6-Cl cf3 CH2 CH2-2-furany1 H 105 6-Cl cf3 CH2CH2-3 -furanyl H 106 6-Cl cf3 CH2CH2-4-furanyl H 107 6-Cl cf3 CH2CH2-3 -thienyl H 108 6-Cl cf3 CH2CH2-2-oxazolyl H 109 6-Cl cf3 CH2CH2-2-thiazolyl H 110 6-Cl cf3 CH2CH2-4-isoxazolyl H 111 6-Cl cf3 CH2CH2-2-imidazolyl H 112 6-Cl cf3 CsC-cycPr CH3 113 6-Cl cf3 C=C-Ph ch3 114 6-Cl cf3 CsC-2-Pyridyl ch3 115 6-Cl cf3 C=C-3-Pyridyl ch3 116 6-Cl cf3 CsC-4-Pyridyl ch3 117 6-Cl cf3 CsC-2-furanyl ch3 118 6-Cl cf3 C=C—3-furanyl ch3 119 6-Cl cf3 C=C-2-thienyl ch3 120 6-Cl cf3 C=C—3-thienyl ch3 121 6-Cl cf3 C=C-cycPr ch3 122 6-Cl cf3 C=C-Ph ch3 123 6-Cl cf3 C=C-2-Pyridyl ch3 124 6-Cl cf3 C=C-3-Pyridyl ch3 125 6-Cl cf3 C=C-4-Pyridyl ch3 126 6-Cl cf3 C=C-2-furanyl ch3 127 6-Cl cf3 C=C-3-furanyl ch3 128 6-Cl cf3 C=C-2-thienyl ch3 129 6-Cl cf3 C=C-3-thienyl ch3 130 6-Cl cf3 CH2CH2-cycPr ch3 56 Printed from Mimosa 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 6-Cl cf3 CH2CH2-Ph CH2CH2-2-Pyridyl CH2CH2-3-Pyridyl CH2CH2-4-Pyridyl ch2ch2-2-furanyl ch2ch2 -3 - furanyl CH2CH2-2-thienyl CH2CH2-3-thienyl CsC-cycPr CsC-Ph CsC-2-Pyridyl CsC-3-Pyridyl C=C-4-Pyridyl C=C-2-furanyl C=C-3-furanyl CsC-2-thienyl Csc-3-thienyl C=C-cycPr C=C-Ph C=C-2-Pyridyl C=C-3-Pyridyl C=C-4-Pyridyl C-C-2-furanyl c=c-3-furanyl C=C-2-thienyl C=C-3-thienyl ch2ch2-cycPr CH2CH2-Ph CH2CH2-2-Pyridyl CH2CH2-3 -Pyridyl CH2CH2-4-Pyridyl CH2CH2~2 - furanyl CH2 CH2 -3 - furanyl CH2 CH2 -2 - thi eny 1 57 Printed from Mimosa WO 98/45276 PCT/US98/06733 165 6-Cl cf3 ch2ch2-3-thienyl CH2CH3 166 6-MeO cf3 csCCH2ch2OH h 167 6-MeO cf3 C=C-CH(OH)Me H 168 6-MeO cf3 CsC-(2-Cl)Ph h 169 6-MeO cf3 C=C-(3-Cl)Ph h 170 6-MeO cf3 C=C-(4-Cl)Ph H 171 6-MeO cf3 CsC-(2-F)Ph H 172 6-MeO cf3 C=C-(3-F)Ph H 173 6-MeO cf3 CsC-(4-F) Ph H 174 6-MeO cf3 CsC-(2-OH)Ph H 175 6-MeO cf3 CsC-(3-OH)Ph H 176 6-MeO cf3 C=C-(4-OH)Ph H 177 6-MeO cf3 CsC-(2-OMe)Ph H 178 6-MeO cf3 CsC-(3-OMe)Ph H 179 6-MeO cf3 CsC—(4-OMe)Ph H 180 6-MeO cf3 C=C-(2-CN)Ph H 181 6-MeO cf3 CsC-(3-CN)Ph H 182 6-MeO cf3 C=C-(4-CN)Ph H 183 6-MeO cf3 CsC-(2-N02) Ph H 184 6-MeO cf3 C=C-(3-NO2)Ph H 185 6-MeO cf3 C=C—(4-N02)Ph H 186 6-MeO cf3 CsC-(2-NH2)Ph H 187 6-MeO cf3 CsC-(3-NH2)Ph H 188 6-MeO cf3 CsC-(4-NH2)Ph H 189 6-MeO cf3 CsC-(2-NMe2)Ph H 190 6-MeO cf3 CsC-(3-NMe2) Ph H 191 6-MeO cf3 CsC-(4-NMe2)Ph H 192 6-MeO cf3 CsC-3-Pyridyl H 193 6-MeO cf3 CsC-4-Pyridyl H 194 6-MeO CF3 CsC-2-furanyl H 195 6-MeO cf3 CsC-3-furanyl H 196 6-MeO cf3 CsC-2-thienyl H 197 6-MeO cf3 CsC-3-thienyl H 198 6-MeO cf3 C=C-2-oxazolyl H 58 Printed from Mimosa WO 98/45276 PCT/US98/06733 199 6-MeO cf3 C=C-2-thiazolyl H 200 6-MeO cf3 CsC-4-isoxazolyl H 201 6-MeO cf3 C=C-2-imidazolyl H 202 6-MeO cf3 C=CCH2CH2OH H 203 6-MeO cf3 C=C-CH(OH)Me H 204 6-MeO cf3 C=C-(2-Cl) Ph H 205 6-MeO cf3 C=C-(3-Cl)Ph H 206 6-MeO cf3 C=C-(4-C1)Ph H 207 6-MeO cf3 C=C-(2-F)Ph H 208 6-MeO cf3 C=C-(3-F)Ph H 209 6-MeO cf3 C=C-(4-F)Ph H 210 6-MeO cf3 C=C-(2-OH)Ph H 211 6-MeO cf3 C=C-(3-OH)Ph H 212 6-MeO cf3 C=C-(4-OH)Ph H 213 6-MeO cf3 C=C-(2-OMe)Ph H 214 6-MeO cf3 C=C-(3-OMe)Ph H 215 6-MeO cf3 C=C-{4-OMe)Ph H 216 6-MeO cf3 C=C-(2-CN) Ph H 217 6-MeO cf3 C=C-(3-CN) Ph H 218 6-MeO cf3 C=C-(4-CN)Ph H 219 6-MeO cf3 C=C-(2-NO2)Ph H 220 6-MeO cf3 C=C-(3-N02) Ph H 221 6-MeO cf3 C=C-(4-N02) Ph H 222 6-MeO cf3 C=C-(2-NH2)Ph H 223 6-MeO cf3 C=C-(3-NH2)Ph H 224 6-MeO cf3 C=C-(4-NH2) Ph H 225 6-MeO cf3 C=C-(2-NMe2) Ph H 226 6-MeO cf3 C=C-(3-NMe2)Ph H 227 6-MeO cf3 C=C-(4-NMe2)Ph H 228 6-MeO cf3 C=C-3-Pyridyl H 229 6-MeO cf3 C=C-4-Pyridyl H 230 6-MeO cf3 C=C-2-furanyl H 231 6-MeO cf3 C=C-3-furanyl H 232 6-MeO cf3 C=C-2-thienyl H 59 Printed from Mimosa WO 98/45276 PCT/US98/06733 233 6-MeO CF3 C=C-3-thienyl H 234 6-MeO cf3 C=C-2-oxazolyl H 235 6-MeO cf3 C=C-2-thiazolyl H 236 6-MeO cf3 C=C-4-isoxazolyl H 237 6-MeO CF3 C=C-2-imidazolyl H 238 6-MeO cf3 CH2CH2-cycPr H 239 6-MeO cf3 CH2CH2CH2CH2OH H 240 6-MeO cf3 CH2CH2-CH (OH) Me H 241 6-MeO cf3 CH2CH2-Ph H 242 6-MeO cf3 CH2CH2-(2-Cl)Ph H 243 6-MeO cf3 CH2CH2-(3-Cl)Ph H 244 6-MeO cf3 CH2CH2-(4-Cl)Ph H 245 6-MeO cf3 CH2CH2-(2-F)Ph H 246 6-MeO cf3 CH2CH2-(3-F)Ph H 247 6-MeO cf3 CH2CH2-(4-F)Ph H 248 6-MeO cf3 CH2CH2-(2-OH)Ph H 249 6-MeO cf3 CH2CH2-(3-OH)Ph H 250 6-MeO cf3 CH2CH2-(4-OH)Ph H 251 6-MeO cf3 CH2CH2 - (2 -OMe) Ph H 252 6-MeO cf3 CH2CH2-(3-OMe)Ph H 253 6-MeO cf3 CH2CH2-(4-OMe)Ph H 254 6-MeO cf3 CH2CH2-(2-CN)Ph H 255 6-MeO cf3 CH2CH2-(3-CN)Ph H 256 6-MeO cf3 CH2CH2-(4-CN)Ph H 257 6-MeO CF3 CH2CH2-(2-N02) Ph H 258 6-MeO cf3 CH2CH2-(3-NO2)Ph H 259 6-MeO cf3 CH2CH2-(4-N02)Ph H 260 6-MeO cf3 CH2CH2-(2-NH2)Ph H 261 6-MeO cf3 CH2CH2-(3-NH2)Ph H 262 6-MeO cf3 CH2CH2-(4-NH2)Ph H 263 6-MeO cf3 CH2CH2- (2-NMe2) Ph H 264 6-MeO cf3 CH2CH2- (3 -NMe2) Ph H 265 6-MeO cf3 CH2CH2 - (4 -NMe2) Ph H 266 6-MeO cf3 CH2CH2-2-Pyridyl H 60 Printed from Mimosa WO 98/45276 PCT/US98/06733 267 6-MeO cf3 CH2CH2-3 -Pyridyl H 268 6-MeO cf3 CH2CH2-4-Pyridyl H 269 6-MeO cf3 CH2CH2-2 - furanyl H 270 6-MeO cf3 CH2CH2-3 -furanyl H 271 6-MeO cf3 CH2CH2-4-furanyl H 272 6-MeO cf3 CH2CH2 - 3 - thi eny 1 H 273 6-MeO cf3 CH2CH2-2 -oxazolyl H 274 6-MeO cf3 CH2CH2-2-thiazolyl H 275 6-MeO cf3 CH2CH2-4-isoxazolyl h 276 6-MeO cf3 CH2 ch2 _2 - imidaz 0 ly 1 h 277 6-MeO cf3 CsC-eyePr CH3 278 6-MeO cf3 CsC-Ph ch3 279 6-MeO cf3 C=C-2-Pyridyl ch3 280 6-MeO cf3 C=C-3-Pyridyl ch3 281 6-MeO cf3 CsC-4-Pyridyl ch3 282 6-MeO cf3 CsC-2-furanyl ch3 283 6-MeO cf3 C=C-3-furanyl ch3 284 6-MeO cf3 CsC-2-thienyl ch3 285 6-MeO cf3 CsC-3-thienyl ch3 286 6-MeO cf3 C=C-cycPr ch3 287 6-MeO cf3 C=C-Ph ch3 288 6-MeO cf3 C=C-2-Pyridyl ch3 289 6-MeO cf3 C=C-3-Pyridyl ch3 290 6-MeO cf3 C=C-4-Pyridyl ch3 291 6-MeO cf3 C=C-2-furanyl ch3 292 6-MeO cf3 C=C-3-furanyl ch3 293 6-MeO cf3 C=C-2-thienyl ch3 294 6-MeO cf3 C=C-3-thienyl ch3 295 6-MeO cf3 CH2CH2-cycPr ch3 296 6-MeO cf3 CH2CH2-Ph ch3 297 6-MeO cf3 ch2ch2-2-Pyridyl ch3 298 6-MeO cf3 CH2CH2-3-Pyridyl ch3 299 6-MeO cf3 ch2ch2-4-Pyridyl ch3 300 6-MeO cf3 ch2ch2-2-furanyl ch3 61 Printed from Mimosa WO 98/45276 PCT/US98/06733 301 6-MeO cf3 CH2CH2-3-furanyl ch3 302 6-MeO cf3 ch2 CH2-2 - thi enyl ch3 303 6-MeO cf3 CH2CH2-3-thi enyl ch3 304 6-MeO cf3 CsC-cycPr ch2ch3 305 6-MeO cf3 C=C-Ph CH2CH3 306 6-MeO cf3 C=C-2-Pyridyl ch2ch3 307 6-MeO cf3 CsC-3-Pyridyl ch2ch3 308 6-MeO cf3 CsC-4-Pyridyl ch2ch3 309 6-MeO cf3 CsC-2-furanyl ch2ch3 310 6-MeO cf3 C=C-3-furanyl ch2ch3 311 6-MeO cf3 CsC-2-thienyl ch2ch3 312 6-MeO cf3 CsC-3-thienyl ch2ch3 313 6-MeO cf3 C=C-cycPr ch2ch3 314 6-MeO cf3 C=C-Ph ch2ch3 315 6-MeO cf3 C=C-2-Pyridyl ch2ch3 316 6-MeO cf3 C=C-3-Pyridyl ch2ch3 317 6-MeO cf3 C=C-4-Pyridyl ch2ch3 318 6-MeO cf3 C=C-2-furanyl ch2ch3 319 6-MeO cf3 C=C-3-furanyl ch2ch3 320 6-MeO cf3 C=C-2-thienyl ch2ch3 321 6-MeO cf3 C=C-3-thienyl ch2ch3 322 6-MeO cf3 CH2CH2-cycPr ch2ch3 323 6-MeO cf3 CH2CH2-Ph ch2ch3 324 6-MeO cf3 ch2ch2-2 - Pyridyl ch2ch3 325 6-MeO cf3 CH2CH2-3-Pyridyl ch2ch3 326 6-MeO cf3 CH2CH2-4-Pyridyl ch2ch3 327 6-MeO cf3 CH2 CH2 -2 - furanyl ch2ch3 328 6-MeO cf3 CH2 CH2 -3 - furanyl ch2ch3 329 6-MeO cf3 CH2 CH2 -2 - thi enyl ch2ch3 330 6-MeO cf3 CH2CH2-3 - thienyl ch2ch3 331 5,6-diF cf3 CsC-(2-Cl)Ph h 332 5,6-diF cf3 C=C-(3-Cl)Ph H 333 5,6-diF cf3 CsC-(4-Cl)Ph h 334 5,6-diF cf3 C=C-(2-F)Ph H 62 Printed from Mimosa WO 98/45276 PCT/US98/06733 335 5,6-diF cf3 CsC-(3-F)Ph H 336 5,6-diF cf3 CsC-(4-F)Ph H 337 5,6-diF cf3 CsC-(2-OH)Ph H 338 5,6-diF cf3 C=C-(3-OH)Ph H 339 5,6-diF cf3 CsC-(4-OH)Ph H 340 5,6-diF cf3 CsC-(2-OMe)Ph H 341 5,6-diF cf3 CsC-(3-OMe)Ph H 342 5,6-diF cf3 C=C-(4-OMe)Ph H 343 5,6-diF cf3 CsC-(2-CN)Ph H 344 5,6-diF cf3 CsC-(3-CN)Ph H 345 5,6-diF cf3 CsC-(4-CN)Ph H 346 5,6-diF cf3 CsC-(2-NO2)Ph H 347 5,6-diF cf3 C=C-(3-NO2) Ph H 348 5,6-diF cf3 CsC-{4-NO2)Ph H 349 5,6-diF cf3 CsC-(2-NH2) Ph H 350 5,6-diF cf3 C=C-(3-NH2) Ph H 351 5,6-diF cf3 CsC-(4-NH2) Ph H 352 5,6-diF cf3 CsC-(2-NMe2)Ph H 353 5, 6-diF cf3 CsC-(3-NMe2)Ph H 354 5,6-diF cf3 CsC-(4-NMe2)Ph H 355 5,6-diF cf3 CsC-3-Pyridyl H 356 5,6-diF cf3 CsC —4 - Pyridyl H 357 5,6-diF cf3 CsC-2-furanyl H 358 5,6-diF cf3 CsC-3-furanyl H 359 5,6-diF cf3 CsC-2-thienyl H 360 5,6-diF cf3 CsC-3-thienyl H 361 5,6-diF cf3 CsC-2-oxazolyl H 362 5,6-diF cf3 CsC-2-thiazolyl H 363 5,6-diF cf3 CsC-4-isoxazolyl H 364 5,6-diF cf3 CsC-2-imidazolyl H 365 5,6-diF cf3 C=C-(2-Cl)Ph H 366 5,6-diF cf3 C=C-(3-Cl)Ph H 367 5,6-diF cf3 C=C-(4-Cl)Ph H 368 5,6-diF cf3 C=C-(2-F)Ph H 63 Printed from Mimosa WO 98/45276 PCT/US98/06733 369 5,6-diF cf3 C=C-(3-F)Ph H 370 5,6-diF cf3 C=C-(4-F)Ph H 371 5, 6-diF cf3 C=C-(2-OH)Ph H 372 5,6-diF cf3 C=C-(3-OH) Ph H 373 5,6-diF cf3 C=C-(4-OH)Ph H 374 5,6-diF cf3 C=C-(2-OMe)Ph H 375 5,6-diF cf3 C=C-(3-OMe)Ph H 376 5,6-diF cf3 C=C-(4-OMe)Ph H 377 5,6-diF cf3 C=C-(2-CN)Ph H 378 5,6-diF cf3 C=C-(3-CN)Ph H 379 5, 6-diF cf3 C=C-(4-CN)Ph H 380 5,6-diF cf3 C=C-(2-N02)Ph H 381 5,6-diF cf3 C=C-(3-N02)Ph H 382 5,6-diF cf3 C=C-(4-N02)Ph H 383 5,6-diF cf3 C=C-(2-NH2) Ph H 384 5,6-diF cf3 C=C-(3-NH2)Ph H 385 5,6-diF cf3 C=C-(4-NH2)Ph H 386 5,6-diF cf3 C=C-(2-NMe2)Ph H 387 5,6-diF cf3 C=C-(3-NMe2)Ph H 388 5,6-diF cf3 C=C-(4-NMe2) Ph H 389 5, 6-diF cf3 C=C-3-Pyridyl H 390 5, 6-diF cf3 C=C-4-Pyridyl H 391 5,6-diF cf3 C=C-2-furanyl H 392 5,6-diF cf3 C=C-3-furanyl H 393 5,6-diF cf3 C=C-2-thienyl H 394 5, 6-diF cf3 C=C-3-thienyl H 395 5,6-diF cf3 C=C-2-oxazolyl H 396 5,6-diF cf3 C=C-2-thiazolyl H 397 5, 6-diF cf3 C=C-4-isoxazolyl H 398 5,6-diF cf3 C=C-2-imidazolyl H 399 5, 6-diF cf3 CH2CH2-cycPr H 400 5,6-diF cf3 CH2CH2CH2CH2OH H 401 5,6-diF cf3 CH2CH2 -CH (OH) Me H 402 5,6-diF cf3 CH2CH2-Ph H 64 Printed from Mimosa WO 98/45276 PCT/US98/06733 403 5,6-diF CF3 CH2CH2-(2-Cl)Ph H 404 5,6-diF cf3 CH2CH2-(3-Cl)Ph H 405 5,6-diF cf3 CH2CH2-(4-Cl)Ph H 406 5,6-diF cf3 CH2CH2-(2-F)Ph H 407 5,6-diF cf3 CH2CH2-(3-F)Ph H 408 5,6-diF cf3 CH2CH2-(4-F)Ph H 409 5, 6-diF CF3 CH2CH2-(2-OH)Ph H 410 5,6-diF cf3 CH2CH2-(3-OH)Ph H 411 5,6-diF cf3 CH2CH2-(4-OH)Ph H 412 5,6-diF cf3 CH2CH2-(2-OMe)Ph H 413 5,6-diF cf3 CH2CH2-(3-OMe)Ph H 414 5,6-diF cf3 CH2 CH2-(4-OMe)Ph H 415 5,6-diF cf3 CH2CH2-(2-CN)Ph H 416 5,6-diF cf3 CH2CH2-(3-CN) Ph H 417 5,6-diF cf3 CH2CH2-(4-CN)Ph H 418 5,6-diF cf3 CH2CH2-(2-N02)Ph H 419 5,6-diF cf3 CH2CH2-(3-N02)Ph H 420 5,6-diF cf3 CH2CH2-(4-N02)Ph H 421 5,6-diF cf3 CH2CH2-(2-NH2 j Ph H 422 5,6-diF cf3 CH2CH2-(3-NH2)Ph H 423 5,6-diF cf3 CH2CH2-(4-NH2)Ph H 424 5,6-diF cf3 CH2CH2-(2-NMe2)Ph H 425 5,6-diF cf3 CH2CH2-(3-NMe2)Ph H 426 5,6-diF cf3 CH2CH2-(4-NMe2)Ph H 427 5,6-diF cf3 CH2CH2-2-Pyridyl H 428 5,6-diF cf3 CH2CH2-3-Pyridyl H 429 5,6-diF cf3 CH2CH2-4-Pyridyl H 430 5,6-diF cf3 CH2CH2-2-furanyl H 431 5,6-diF cf3 CH2CH2-3-furanyl H 432 5,6-diF cf3 CH2CH2-2-thienyl H 433 5,6-diF cf3 CH2CH2-3-thienyl H 434 5,6-diF cf3 CH2CH2-2-oxazolyl H 435 5,6-diF cf3 ch2ch2-2-thiazolyl H 436 5,6-diF cf3 CH2CH2-4-isoxazolyl H 65 Printed from Mimosa WO 98/45276 PCT/US98/06733 437 5,6-diF cf3 CH2CH2-2-imidazolyl h 438 5,6-diF cf3 CsC-eyePr ch3 439 5,6-diF cf3 CsC-2-Pyridyl ch3 440 5,6-diF cf3 CsC-3-Pyridyl ch3 441 5,6-diF cf3 CsC-4-Pyridyl ch3 442 5,6-diF cf3 CsC-2-furanyl ch3 443 5, 6-diF cf3 OsC-3-furanyl ch3 444 5,6-diF cf3 CsC-2-thienyl ch3 445 5,6-diF cf3 CsC-3-thienyl ch3 446 5,6-diF cf3 C=C-cycPr ch3 447 5,6-diF cf3 C=C-2-Pyridyl ch3 448 5,6-diF cf3 C=C-3-Pyridyl ch3 449 5,6-diF cf3 C=c-4-Pyridyl ch3 450 5,6-diF cf3 C=C-2-furanyl ch3 451 5,6-diF cf3 C=C-3-furanyl ch3 452 5,6-diF cf3 C=C-2-thienyl ch3 453 5,6-diF cf3 C=C-3-thienyl ch3 454 5,6-diF cf3 CH2 CH2 -eye Pr ch3 455 5,6-diF cf3 CH2CH2-Ph ch3 456 5,6-diF cf3 CH2CH2-2-Pyridyl ch3 457 5,6-diF cf3 CH2CH2-3 -Pyridyl ch3 458 5,6-diF cf3 CH2CH2-4-Pyridyl ch3 459 5,6-diF cf3 ch2ch2 -2 - furanyl ch3 460 5,6-diF cf3 CH2CH2-3 - f urcinyl ch3 461 5,6-diF cf3 CH2CH2-2 - thi enyl ch3 462 5,6-diF cf3 CH2CH2-3 -thienyl ch3 463 5,6-diF cf3 CsC-eyePr ch2ch3 464 5,6-diF cf3 CsC-Ph ch2ch3 465 5,6-diF cf3 CsC-2-Pyridyl ch2ch3 466 5,6-diF cf3 C=c~3-Pyridyl ch2ch3 467 5, 6-diF cf3 CsC-4-Pyridyl ch2ch3 468 5, 6-diF cf3 CsC-2-furanyl ch2ch3 469 5,6-diF cf3 CsC-3-furanyl ch2ch3 470 5, 6-diF cf3 CsC-2-thienyl ch2ch3 66 Printed from Mimosa WO 98/45276 PCT/US98/06733 471 5,6-diF cf3 CsC-3 -thienyl CH2CH3 472 5,6-diF cf3 C=C-cycPr CH2CH3 473 5,6-diF cf3 C=C-Ph ch2ch3 474 5,6-diF cf3 c=c-2-Pyridyl ch2ch3 475 5,6-diF cf3 C=C-3-Pyridyl ch2ch3 476 5,6-diF cf3 c=c-4-Pyridyl CH2CH3 477 5,6-diF cf3 c=c-2-furanyl CH2CH3 478 5,6-diF cf3 C=C-3-furanyl CH2CH3 479 5,6-diF cf3 C=C-2-thienyl CH2CH3 480 5,6-diF cf3 C=C-3-thienyl CH2CH3 481 5,6-diF cf3 CH2CH2-cycPr CH2CH3 482 5,6-diF cf3 CH2CH2-Ph CH2CH3 483 5,6-diF cf3 CH2CH2-2 -Pyridyl CH2CH3 484 5,6-diF cf3 CH2CH2-3 -Pyridyl CH2CH3 485 5,6-diF cf3 CH2 CH2 - 4-Pyridyl ch2ch3 486 5,6-diF cf3 CH2CH2 -2 - furanyl ch2ch3 487 5,6-diF cf3 CH2CH2 -3 - furanyl ch2ch3 488 5,6-diF cf3 CH2CH2-2 - thienyl ch2ch3 489 5,6-diF cf3 CH2CH2-3 -thienyl CH2CH3 490 5,6-diCl cf3 CsC-(2-Cl)Ph H 491 5,6-diCl cf3 C=C-(3-Cl)Ph H 492 5,6-diCl cf3 C=C-(4-Cl)Ph H 493 5,6-diCl cf3 C=C-(2-F)Ph H 494 5,6-diCl cf3 CsC-(3-F)Ph H 495 5,6-diCl cf3 C=C-(4-F)Ph H 496 5,6-diCl cf3 CsC-(2-OH)Ph H 497 5,6-diCl cf3 CsC- (3-OH) Ph H 498 5,6-diCl cf3 CsC-(4-OH)Ph H 499 5,6-diCl cf3 CsC-(2-OMe)Ph H 500 5,6-diCl cf3 CsC-(3-OMe)Ph H 501 5,6-diCl cf3 CsC-(4-OMe)Ph H 502 5,6-diCl cf3 CsC-(2-CN)Ph H 503 5,6-diCl cf3 CsC-(3-CN)Ph H 504 5,6-diCl cf3 CsC-(4-CN)Ph H 67 Printed from Mimosa WO 98/45276 PCT/US98/06733 505 5,6-diCl cf3 C=C-(2-N02)Ph H 506 5,6-diCl cf3 CsC-(3-N02)Ph H 507 5,6-diCl cf3 C=C-(4-N02)Ph H 508 5,6-diCl cf3 CsC-(2-NH2)Ph H 509 5, 6-diCl cf3 CsC-(3-NH2)Ph H 510 5,6-diCl cf3 C=C-(4-NH2)Ph H 511 5,6-diCl cf3 CsC-(2-NMe2)Ph H 512 5,6-diCl cf3 CsC-(3-NMe2)Ph H 513 5,6-diCl cf3 C=C-(4-NMe2)Ph H 514 5,6-diCl cf3 CsC-3-Pyridyl H 515 5,6-diCl cf3 C=C-4-Pyridyl H 516 5,6-diCl cf3 CsC-2-furanyl H 517 5,6-diCl cf3 C=C-3-furanyl H 518 5,6-diCl cf3 C=C-2-thienyl H 519 5,6-diCl cf3 CsC-3-thienyl H 520 5,6-diCl cf3 CsC-2-oxazolyl H 521 5,6-diCl cf3 CsC-2-thiazolyl H 522 5,6-diCl cf3 CsC-4-isoxazolyl H 523 5,6-diCl cf3 GsC-2-imidazolyl H 524 5,6-diCl cf3 C=C-(2-Cl)Ph H 525 5,6-diCl cf3 C=C-(3-Cl)Ph H 526 5,6-diCl cf3 C=C-(4-Cl)Ph H 527 5,6-diCl cf3 C=C-(2-F) Ph H 528 5,6-diCl cf3 C=C-(3-F) Ph H 529 5,6-diCl cf3 C=C-(4-F)Ph H 530 5,6-diCl cf3 C=C-(2-OH)Ph H 531 5,6-diCl cf3 C=C-(3-OH)Ph H 532 5,6-diCl cf3 C=C-(4-OH)Ph H 533 5,6-diCl cf3 C=C-(2-OMe)Ph H 534 5,6-diCl cf3 C=C-(3-OMe)Ph H 535 5,6-diCl cf3 C=C-(4-OMe)Ph H 536 5,6-diCl cf3 C=C-(2-CN)Ph H 537 5,6-diCl cf3 C=C-(3-CN)Ph H 538 5,6-diCl cf3 C=C-(4-CN)Ph H 68 Printed from Mimosa WO 98/45276 PCT/US98/06733 539 5, 6-diCl cf3 C=C-(2-N02)Ph H 540 5, 6-diCl cf3 C=C-(3-N02)Ph H 541 5,6-diCl cf3 C=C-(4-N02)Ph H 542 5, 6-diCl cf3 C=C-(2-NH2)Ph H 543 5, 6-diCl cf3 C=C-(3-NH2)Ph H 544 5, 6-diCl cf3 C=C-{4-NH2)Ph H 545 5, 6-diCl cf3 C=C-(2-NMe2) Ph H 546 5,6-diCl cf3 C=C-(3-NMe2)Ph H 547 5,6-diCl cf3 C=C-(4-NMe2)Ph H 548 5, 6-diCl cf3 C=C-3-Pyridyl H 549 5, 6-diCl cf3 C=C-4-Pyridyl H 550 5,6-diCl cf3 C=C-2-furanyl H 551 5, 6-diCl cf3 C=C-3-furanyl H 552 5,6-diCl cf3 C=C-2-thienyl H 553 5, 6-diCl cf3 C=C-3-thienyl H 554 5,6-diCl cf3 C=C-2-oxazolyl H 555 5,6-diCl cf3 C=C-2-thiazolyl H 556 5, 6-diCl cf3 C=C-4-isoxazolyl H 557 5, 6-diCl cf3 C=C-2-imidazolyl H 558 5,6-diCl cf3 CH2CH2 -cycPr H 559 5,6-diCl cf3 CH2CH2CH2CH2OH H 560 5,6-diCl cf3 CH2CH2-CH(OH)Me H 561 5,6-diCl cf3 CH2CH2-Ph H 562 5,6-diCl cf3 CH2CH2-{2-Cl)Ph H 563 5,6-diCl cf3 CH2CH2-(3-Cl)Ph H 564 5, 6-diCl cf3 CH2CH2-(4-Cl)Ph H 565 5, 6-diCl cf3 CH2CH2-(2—F)Ph H 566 5,6-diCl cf3 CH2CH2-(3-F)Ph H 567 5, 6-diCl cf3 CH2CH2-(4-F)Ph H 568 5,6-diCl cf3 CH2CH2-(2-OH)Ph H 569 5,6-diCl cf3 CH2CH2-(3-OH)Ph H 570 5,6-diCl cf3 CH2CH2-(4-OH)Ph H 571 5,6-diCl cf3 CH2CH2 - (2 -OMe) Ph H 572 5,6-diCl cf3 CH2CH2- (3 -OMe) Ph H 69 Printed from Mimosa WO 98/45276 PCT/US98/06733 573 5,6-diCl cf3 574 5,6-diCl cf3 575 5,6-diCl cf3 576 5,6-diCl cf3 577 5,6-diCl cf3 578 5,6-diCl cf3 579 5,6-diCl cf3 580 5,6-diCl cf3 581 5,6-diCl cf3 582 5,6-diCl cf3 583 5,6-diCl cf3 584 5,6-diCl cf3 585 5,6-diCl cf3 586 5,6-diCl cf3 587 5,6-diCl cf3 588 5,6-diCl cf3 589 5,6-diCl cf3 590 5,6-diCl cf3 591 5,6-diCl cf3 592 5,6-diCl cf3 593 5,6-diCl cf3 594 5,6-diCl cf3 595 5,6-diCl cf3 596 5,6-diCl cf3 597 5,6-diCl cf3 598 5,6-diCl cf3 599 5, 6-diCl cf3 600 5,6-diCl cf3 601 5,6-diCl cf3 602 5,6-diCl cf3 603 5,6-diCl cf3 604 5,6-diCl cf3 605 5,6-diCl cf3 606 5, 6-diCl cf3 ch2ch2- (4-OMe)Ph H ch2ch2- - (2-CN)Ph H ch2ch2- - (3-CN)Ph H ch2ch2- - (4-CN)Ph H ch2ch2- (2-NO2)Ph H ch2ch2- (3-N02)Ph H ch2ch2- (4-N02)Ph H ch2ch2- ■ (2-NH2) Ph H ch2ch2- (3-NH2)Ph H ch2ch2- (4-NH2)Ph H ch2ch2- (2-NMe2)Ph H ch2ch2- (3-NMe2)Ph H ch2ch2- (4-NMe2)Ph H ch2ch2- •2-Pyridyl H ch2ch2- 3-Pyridyl h ch2ch2- •4-Pyridyl h ch2ch2- •2-furanyl h ch2ch2- •3-furanyl H ch2ch2- ■2-thienyl h ch2ch2- ■3-thienyl h CH2CH2-2 -oxaz olyl h ch2ch2-2 !-thiazolyl H CH2CH2-4- -isoxazolyl H ch2ch2-2 -imidazolyl h CsC -cycPr ch3 CsC-2 -Pyridyl ch3 CsC-3 -Pyridyl ch3 CsC-4 -Pyridyl ch3 CsC-2 -furanyl ch3 CsC-3 -furanyl ch3 CsC-2 -thienyl ch3 CsC-3 -thienyl ch3 C=C -cycPr ch3 C=C-2 -Pyridyl ch3 70 Printed from Mimosa WO 98/45276 PCT/US98/06733 607 5,6-diCl cf3 C=C-3-Pyridyl CH3 608 5,6-diCl cf3 C=C-4-Pyridyl ch3 609 5,6-diCl cf3 C=C-2-furanyl ch3 610 5,6-diCl cf3 C=C-3-furanyl ch3 611 5,6-diCl cf3 C=C-2-thienyl ch3 612 5,6-diCl cf3 C=C-3-thienyl ch3 613 5,6-diCl cf3 ch2ch2-cycPr ch3 614 5,6-diCl cf3 CH2CH2-Ph ch3 615 5,6-diCl cf3 CH2CH2-2-Pyridyl ch3 616 5,6-diCl cf3 CH2CH2-3-Pyridyl ch3 617 5,6-diCl cf3 CH2CH2-4-Pyridyl ch3 618 5,6-diCl cf3 CH2CH2-2 - furanyl ch3 619 5,6-diCl cf3 CH2CH2-3-furanyl ch3 620 5,6-diCl cf3 ch2ch2 -2-thienyl ch3 621 5,6-diCl cf3 CH2CH2-3 - thienyl ch3 622 5,6-diCl cf3 CsC-cycPr ch2ch3 623 5,6-diCl cf3 CsC-Ph ch2ch3 624 5,6-diCl cf3 CsC-2-Pyridyl ch2ch3 625 5,6-diCl cf3 C=C-3-Pyridyl ch2ch3 626 5,6-diCl cf3 CsC-4-Pyridyl ch2ch3 627 5,6-diCl cf3 CsC-2-furanyl ch2ch3 628 5,6-diCl cf3 CsC-3-furanyl ch2ch3 629 5,6-diCl cf3 CsC-2-thienyl ch2ch3 630 5,6-diCl cf3 CsC-3-thienyl ch2ch3 631 5,6-diCl cf3 C=C-cycPr ch2ch3 632 5,6-diCl cf3 C=C-Ph ch2ch3 633 5,6-diCl cf3 C=C-2-Pyridyl ch2ch3 634 5, 6-diCl cf3 C=C-3-Pyridyl ch2ch3 635 5,6-diCl cf3 C=C-4-Pyridyl ch2ch3 636 5,6-diCl cf3 C=C-2-furanyl ch2ch3 637 5,6-diCl cf3 C=C-3-furanyl ch2ch3 638 5,6-diCl cf3 C=C-2-thienyl ch2ch3 639 5,6-diCl cf3 C=C-3-thienyl ch2ch3 640 5,6-diCl cf3 ch2ch2-cycPr ch2ch3 71 Printed from Mimosa WO 98/45276 PCT/US98/06733 641 5,6-diCl cf3 642 5, 6-did cf3 643 5,6-diCl cf3 644 5,6-diCl cf3 645 5,6-diCl cf3 646 5,6-diCl cf3 647 5,6-diCl cf3 648 5,6-diCl cf3 649 6-f cf3 650 6-f cf3 651 6-f cf3 652 6-f cf3 653 6-f cf3 654 6-f cf3 655 6-f cf3 656 6-f cf3 657 6-f cf3 658 6-f cf3 659 6-f cf3 660 6-f cf3 661 6-f cf3 662 6-f cf3 663 6-f cf3 664 6-f cf3 665 6-f cf3 666 6-f cf3 667 6-f cf3 668 6-f cf3 669 6-f cf3 670 6-f cf3 671 6-f cf3 672 6-f cf3 673 6-f cf3 674 6-f cf3 CH2CH2-Ph CH2CH3 ch2ch2-2-Pyridyl ch2ch3 CH2CH2-3-Pyridyl ch2ch3 CH2CH2-4-Pyridyl ch2ch3 CH2CH2 -2 - furanyl ch2ch3 CH2CH2-3-furanyl ch2ch3 CH2CH2 -2 - thi enyl ch2ch3 CH2CH2-3-thienyl ch2ch3 CsCCH2CH2OH H C=C-CH(OH)Me H CsC-(2-Cl)Ph H CsC-(3-Cl)Ph H C=C-(4-C1)Ph H C=C-(2-F)Ph H C=C-(3-F)Ph H C=C-(4-F)Ph H CsC-(2-OH)Ph H C=C-(3-OH)Ph H CsC-(4-OH)Ph H CsC-{2-OMe)Ph H CsC-{3-OMe)Ph H CsC-{4-OMe)Ph H C=C-(2-CN)Ph H CsC-(3-CN)Ph H CsC-(4-CN)Ph H C=C-(2-N02)Ph H C=C-(3-N02)Ph H CsC-(4-N02)Ph H CsC-(2-NH2)Ph H C=C-(3-NH2)Ph H C=C-(4-NH2)Ph H C=c-(2-NMe2)Ph H C=C-(3-NMe2)Ph H c=c-(4-NMe2)Ph H 72 Printed from Mimosa WO 98/45276 PCT/US98/06733 675 6-f cf3 CsC-3-Pyridyl H 676 6-f cf3 CsC-4-Pyridyl H 677 6-f cf3 CsC-2-furanyl H 678 6-f cf3 CsC-3-furanyl H 679 6-f cf3 CsC-2-thienyl H 680 6-f cf3 CsC-3-thienyl H 681 6-f cf3 CsC-2-oxazolyl H 682 6-f cf3 CsC-2-thiazolyl H 683 6-f cf3 CsC-4-isoxazolyl h 684 6-f cf3 CsC-2-imidazolyl H 685 6-f cf3 c=cch2ch2oh h 686 6-f cf3 C=C-CH(OH)Me h 687 6-f cf3 C=C-(2-Cl)Ph H 688 6-f cf3 C=C-(3-Cl)Ph H 689 6-f cf3 C=C-(4-Cl)Ph H 690 6-f cf3 C=C-(2-F)Ph h 691 6-f cf3 C=C-(3-F) Ph H 692 6-F cf3 C=C-(4-F)Ph H 693 6-F cf3 C=C-(2-OH)Ph h 694 6-F cf3 C=C-(3-OH)Ph h 695 6-F cf3 C=C-(4-OH)Ph h 696 6-F cf3 C=C-(2-OMe)Ph H 697 6-F cf3 C=C-(3-OMe)Ph h 698 6-F cf3 C=C-(4-OMe)Ph h 699 6-f cf3 C=C-(2-CN)Ph h 700 6-f cf3 C=C-(3-CN)Ph H 701 6-F cf3 C=C-(4-CN)Ph h 702 6-f cf3 C=C-(2-N02) Ph H 703 6-F cf3 C=C-(3-N02) Ph H 704 6-f cf3 C=C-(4-N02)Ph H 705 6-f cf3 C=C-(2-NH2)Ph h 706 6-f cf3 C=C-(3-NH2) Ph h 707 6-F cf3 C=C-(4-NH2) Ph h 708 6-F cf3 C=C-(2-NMe2) Ph h 73 Printed from Mimosa WO 98/45276 PCT/US98/06733 709 6-f cf3 C=C-(3-NMe2) Ph H 710 6-f cf3 C=C-(4-NMe2)Ph H 711 6-f cf3 C=C-3-Pyridyl H 712 6-f cf3 C=C-4-Pyridyl H 713 6-f cf3 C=C-2-furanyl H 714 6-f cf3 C=C-3-furanyl H 715 6-f cf3 C=C-2-thienyl H 716 6-f cf3 C=C-3-thienyl H 717 6-f cf3 C=C-2-oxazolyl H 718 6-f cf3 C=C-2-thiazolyl H 719 6-f cf3 C=C-4-isoxazolyl H 720 6-f cf3 C=C-2-imidazolyl H 721 6-f cf3 CH2CH2-cycPr H 722 6-f cf3 CH2CH2CH2CH2OH H 723 6-f cf3 CH2CH2 -CH (OH) Me H 724 6-F cf3 CH2CH2-(2-Cl)Ph H 725 6-F cf3 CH2CH2-(3-Cl)Ph H 726 6-F cf3 CH2CH2-(4-C1)Ph H 727 6-f cf3 CH2CH2-(2-F)Ph H 728 6-f cf3 CH2CH2-{3-F)Ph H 729 6-F cf3 CH2CH2-(4-F)Ph H 730 6-F cf3 CH2CH2-(2-OH)Ph H 731 6-F cf3 CH2CH2-(3-OH)Ph H 732 6-F cf3 CH2CH2-(4-OH)Ph H 733 6-F cf3 CH2CH2- (2-OMe) Ph H 734 6-F cf3 CH2CH2- (3 -OMe) Ph H 735 6-f cf3 CH2CH2-(4-OMe)Ph H 736 6-F cf3 CH2CH2-(2-CN)Ph H 737 6-f cf3 CH2CH2-(3-CN)Ph H 738 6-f cf3 CH2CH2-(4-CN)Ph H 739 6-f cf3 CH2CH2-(2-N02)Ph H 740 6-f cf3 CH2CH2-(3-N02)Ph H 741 6-f cf3 CH2CH2-(4-N02)Ph H 742 6-F cf3 CH2CH2-(2-NH2)Ph H 74 Printed from Mimosa WO 98/45276 PCT/US98/06733 743 6-f cf3 CH2CH2-{3-NH2)Ph H 744 6-f cf3 CH2CH2 -(4-NH2)Ph H 745 6-f cf3 CH2CH2- {2 -NMe2) Ph H 746 6-f cf3 CH2CH2-(3-NMe2)Ph H 747 6-f cf3 CH2CH2-(4-NMe2)Ph H 748 6-f cf3 CH2CH2-3-Pyridyl H 749 6-f cf3 CH2CH2-4 -Pyridyl H 750 6-f cf3 CH2CH2 -2 - furanyl H 751 6-f cf3 CH2CH2-3-furanyl H 752 6-f cf3 CH2CH2 -2 - thienyl H 753 6-f cf3 CH2CH2 -3 - thi enyl H 754 6-f cf3 CH2CH2-2 -oxazolyl H 755 6-f cf3 CH2CH2-2-thiazolyl H 756 6-f cf3 CH2CH2-4-isoxazolyl H 757 6-f cf3 CH2CH2-2 - imidazolyl H 758 6-f cf3 CsC-cycPr CH3 759 6-f cf3 CsC-iPr ch3 760 6-f cf3 Csc-Pr ch3 761 6-f cf3 CsC-Bu ch3 762 6-f cf3 CsC-iBu ch3 763 6-f cf3 CsC-tBu ch3 764 6-f cf3 CsC-Et ch3 765 6-f cf3 CsC-Me ch3 766 6-f cf3 CsC-Ph ch3 767 6-f cf3 CsC-2-Pyridyl ch3 768 6-f cf3 CsC-3-Pyridyl ch3 769 6-f cf3 CsC-4-Pyridyl ch3 770 6-f cf3 CaC-2-furanyl ch3 771 6-f cf3 CsC-3-furanyl ch3 772 6-f cf3 CsC-2-thienyl ch3 773 6-f cf3 CsC-3-thienyl ch3 774 6-f cf3 C=C-cycPr ch3 775 6-f cf3 C=C-iPr ch3 776 6-f cf3 C=C-Pr ch3 75 Printed from Mimosa Ill 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 6-f cf3 C=C-Bu 6-f cf3 C=C-iBu 6-f cf3 C=C-tBu 6-f cf3 C=C-Et 6-f cf3 C=C-Me 6-f cf3 C=C-Ph 6-f cf3 C=C-2-Pyridyl 6-f cf3 C=C-3-Pyridyl 6-f cf3 C=C-4-Pyridyl 6-f cf3 C=C-2-furanyl 6-f cf3 C=C-3-furanyl 6-f cf3 C=C-2-thienyl 6-f cf3 C=C-3-thienyl 6-f cf3 ch2ch2-cycpr 6-f cf3 CH2CH2-Ph 6-f cf3 CH2CH2-2-Pyridyl 6-f cf3 CH2CH2-3-Pyridyl 6-f cf3 CH2CH2-4-Pyridyl 6-f cf3 ch2ch2-2-furanyl 6-f cf3 ch2ch2-3 - furanyl 6-f cf3 CH2CH2 -2 - thienyl 6-f cf3 ch2ch2-3-thienyl 6-f cf3 CsC-cycPr 6-f cf3 CsC-Ph 6-f cf3 CsC-2-Pyridyl 6-f cf3 C=C-3-Pyridyl 6-f cf3 CsC-4-Pyridyl 6-f cf3 C=C-2-furanyl 6-f cf3 CsC-3-furanyl 6-f cf3 CsC-2-thienyl 6-f cf3 CsC-3-thienyl 6-f cf3 C=C-cycPr 6-f cf3 C=C-Ph 6-f cf3 C=C-2-Pyridyl 76 Printed from Mimosa WO 98/45276 PCT/US98/06733 811 6-f cf3 C=C-3-Pyridyl ch2ch3 812 6-f cf3 C=C-4-Pyridyl ch2ch3 813 6-f cf3 C=C-2-furanyl ch2ch3 814 6-f cf3 C=C-3-furanyl ch2ch3 815 6-f cf3 C=C-2-thienyl CH2CH3 816 6-f cf3 C=C-3-thienyl ch2ch3 817 6-f cf3 ch2ch2-cycPr ch2ch3 818 6-f cf3 CH2CH2-Ph ch2ch3 819 6-f cf3 CH2CH2-2-Pyridyl CH2CH3 820 6-f cf3 CH2CH2-3-Pyridyl ch2ch3 821 6-f cf3 CH2CH2-4 -Pyridyl ch2ch3 822 6-f cf3 ch2ch2-2-furanyl ch2ch3 823 6-f cf3 ch2ch2-3 - furanyl ch2ch3 824 6-f cf3 CH2CH2-2-thienyl ch2ch3 825 6-f cf3 CH2CH2-3-thienyl ch2ch3 826 5-C1 cf3 C=C-cycPr H 827 5-C1 cf3 CsCCH2CH2OH H 828 5-C1 cf3 C=C-CH(OH)Me H 829 5-C1 cf3 CsC-Ph H 830 5-Cl cf3 CsC-(2-Cl)Ph H 831 5-Cl cf3 CsC-(3-Cl)Ph H 832 5-Cl cf3 CsC-(4-C1)Ph H 833 5-Cl cf3 C=c-(2-F) Ph H 834 5-Cl cf3 C=C-(3-F)Ph H 835 5-Cl cf3 C=C-(4-F)Ph H 836 5-Cl cf3 CsC-(2-OH)Ph H 837 5-Cl cf3 CsC-(3-OH)Ph H 838 5-Cl cf3 C=C-(4-OH)Ph H 839 5-Cl cf3 CsC-(2-OMe)Ph H 840 5-Cl cf3 C=C-{3-OMe)Ph H 841 5-Cl cf3 CsC-(4-OMe)Ph H 842 5-Cl cf3 C=C-(2-CN)Ph H 843 5-Cl cf3 C=C-(3-CN)Ph H 844 5-Cl cf3 CsC-(4-CN)Ph H 77 Printed from Mimosa WO 98/45276 PCT/US98/06733 845 5-Cl cf3 c=C-(2-N02)Ph H 846 5-Cl cf3 C=C-(3-N02)Ph H 847 5-Cl cf3 C=C-(4-N02)Ph H 848 5-Cl cf3 C=C-(2-NH2)Ph H 849 5-Cl cf3 C=C-(3-NH2)Ph H 850 5-Cl cf3 C=C-(4-NH2)Ph H 851 5-Cl cf3 C=C-(2-NMe2)Ph H 852 5-Cl cf3 CsC-(3-NMe2)Ph H 853 5-Cl cf3 C=C-(4-NMe2)Ph H 854 5-Cl cf3 CsC-2-Pyridyl H 855 5-Cl cf3 CsC-2-Pyridyl H 856 5-Cl cf3 C=C-3-Pyridyl H 857 5-Cl cf3 CsC-4-Pyridyl H 858 5-Cl cf3 C=C-2-furanyl H 859 5-Cl cf3 C=C-3-furanyl H 860 5-Cl cf3 CsC-2-thienyl H 861 5-Cl cf3 C=C-3-thienyl H 862 5-Cl cf3 CsC-2-oxazolyl H 863 5-Cl cf3 CsC-2-thiazolyl H 864 5-Cl cf3 CsC-4-isoxazolyl H 865 5-Cl cf3 CsC-2-imidazolyl H 866 5-Cl cf3 C=C-cycPr H 867 5-Cl cf3 C=CCH2CH2OH H 868 5-Cl cf3 C=C-CH(OH)Me H 869 5-Cl cf3 C=C-Ph H 870 5-Cl cf3 C=C-(2-Cl)Ph H 871 5-Cl cf3 C=C-(3-Cl)Ph H 872 5-Cl cf3 C=C-(4-C1)Ph H 873 5-Cl cf3 C=C-(2-F)Ph H 874 5-Cl cf3 C=C-(3-F)Ph H 875 5-Cl cf3 C=C-(4-F)Ph H 876 5-Cl cf3 C=C-(2-OH)Ph H 877 5-Cl cf3 C=C-(3-OH)Ph H 878 5-Cl cf3 C=C-(4-OH)Ph H 78 Printed from Mimosa WO 98/45276 PCT/US98/06733 879 5-Cl cf3 C=C-(2-OMe)Ph H 880 5-Cl cf3 C=C-(3-OMe)Ph H 881 5-Cl cf3 C=C-(4-OMe)Ph H 882 5-Cl cf3 C=C-(2-CN)Ph H 883 5-Cl cf3 C=C-(3-CN)Ph H 884 5-Cl cf3 C=C-(4-CN)Ph H 885 5-Cl cf3 C=C-(2-N02) Ph H 886 5-Cl cf3 C=C-(3-N02)Ph H 887 5-Cl cf3 C=C-{4-N02) Ph H 888 5-Cl cf3 C=C-(2-NH2) Ph H 889 5-Cl cf3 C=C-(3-NH2) Ph H 890 5-Cl cf3 C=C-(4-NH2) Ph H 891 5-Cl cf3 C=C-(2-NMe2) Ph H 892 5-Cl cf3 C=C-(3-NMe2) Ph H 893 5-Cl cf3 C=C-(4-NMe2)Ph H 894 5-Cl cf3 C=C-2-Pyridyl H 895 5-Cl cf3 C=C-2-Pyridyl H 896 5-Cl cf3 C=C-3-Pyridyl H 897 5-Cl cf3 C=C-4-Pyridyl H 898 5-Cl cf3 C=C-2-furanyl H 899 5-Cl cf3 C=C-3-furanyl H 900 5-Cl cf3 C=C-2-thienyl H 901 5-Cl cf3 C=C-3-thienyl H 902 5-Cl cf3 C=C-2-oxazolyl H 903 5-Cl cf3 C=C-2-thiazolyl H 904 5-Cl cf3 C=C-4-isoxazolyl H 905 5-Cl cf3 C=C-2-imidazolyl H 906 5-Cl cf3 CH2CH2-cycPr H 907 5-Cl cf3 ch2ch2ch2ch2oh H 908 5-Cl cf3 CH2CH2 -CH (OH) Me H 909 5-Cl cf3 CH2CH2Ph h 910 5-Cl cf3 CH2CH2-(2-Cl)Ph h 911 5-Cl cf3 CH2CH2-(3-Cl)Ph H 912 5-Cl cf3 CH2CH2-(4-Cl)Ph h 79 Printed from Mimosa WO 98/45276 PCT/US98/06733 913 5-Cl cf3 CH2CH2-(2-F)Ph H 914 5-Cl cf3 CH2CH2-(3-F)Ph H 915 5-Cl cf3 CH2CH2-(4-F)Ph H 916 5-Cl cf3 CH2 CH2-(2-OH)Ph H 917 5-Cl cf3 CH2CH2-(3-OH)Ph H 918 5-Cl cf3 CH2CH2-(4-OH)Ph H 919 5-Cl cf3 CH2 CH2-(2-OMe)Ph H 920 5-Cl cf3 CH2CH2-(3-OMe)Ph H 921 5-Cl cf3 CH2CH2-(4-OMe)Ph H 922 5-Cl cf3 CH2CH2-(2-CN)Ph H 923 5-Cl cf3 CH2CH2-(3-CN)Ph H 924 5-Cl cf3 CH2CH2-(4-CN)Ph H 925 5-Cl cf3 CH2CH2-(2-N02)Ph H 926 5-Cl cf3 CH2CH2-(3-N02)Ph H 927 5-Cl cf3 CH2CH2-(4-N02) Ph H 928 5-Cl cf3 CH2CH2-(2-NH2) Ph H 929 5-Cl cf3 CH2CH2-(3-NH2)Ph H 930 5-Cl cf3 CH2CH2-(4-NH2)Ph H 931 5-Cl cf3 CH2CH2-(2-NMe2)Ph H 932 5-Cl cf3 CH2CH2- {3 -NMe2) Ph H 933 5-Cl cf3 CH2CH2-(4-NMe2)Ph H 934 5-Cl cf3 CH2CH2-2-Pyridyl H 935 5-Cl cf3 CH2CH2-3 -Pyridyl H 936 5-Cl cf3 CH2CH2-4-Pyridyl H 937 5-Cl cf3 CH2CH2 -2 - furanyl H 938 5-Cl cf3 CH2CH2-3-furanyl H 939 5-Cl cf3 CH2CH2-2-thienyl H 940 5-Cl cf3 CH2CH2-3 - thienyl H 941 5-Cl cf3 CH2CH2-2-oxazolyl H 942 5-Cl cf3 CH2CH2-2-thiazolyl H 943 5-Cl cf3 CH2CH2-4-isoxazolyl H 944 5-Cl cf3 CH2CH2-2-imidazolyl H 945 5-Cl cf3 C=C-cycPr CH3 946 5-Cl cf3 CsC-Ph ch3 80 Printed from Mimosa 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 5-Cl cf3 CsC-2-Pyridyl CsC-3-Pyridyl CsC-4-Pyridyl CsC-2-furanyl C=C-3-furanyl CsC-2-thienyl CsC-3-thienyl C=C-cycPr C=C-Ph C=C-2-Pyridyl C=C-3-Pyridyl g=c-4-Pyridyl C=C-2-furanyl C=C-3-furanyl C=C-2-thienyl C=C-3-thienyl CH2CH2-cycPr CH2CH2-Ph CH2CH2-2-Pyridyl CH2CH2-3-Pyridyl CH2CH2-4-Pyridyl CH2CH2-2 - furanyl CH2CH2-3-furanyl CH2CH2-2-thi enyl CH2CH2-3-thienyl CsC-cycPr CsC-Ph CsC-2-Pyridyl CsC-3 -Pyridyl CsC-4-Pyridyl CsC-2 -furanyl CsC-3-furanyl CsC-2 -thi enyl CsC-3-thienyl 81 Printed from Mimosa 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 5-Cl cf3 C=C-cycPr 5-Cl cf3 C=C-Ph 5-Cl cf3 C=C-2-Pyridyl 5-Cl cf3 C=C-3-Pyridyl 5-Cl cf3 C=C-4-Pyridyl 5-Cl cf3 C=C-2-furanyl 5-Cl cf3 C=C-3-furanyl 5-Cl cf3 C=C-2-thienyl 5-Cl cf3 C=C-3-thienyl 5-Cl cf3 CH2CH2~cycPr 5-Cl cf3 CH2CH2-Ph 5-Cl cf3 CH2CH2-2-Pyridyl 5-Cl cf3 CH2CH2-3 - Pyridyl 5-Cl cf3 CH2CH2 - 4 - Pyridyl 5-Cl cf3 CH2CH2-2 - furanyl 5-Cl cf3 CH2CH2-3-furanyl 5-Cl cf3 CH2CH2-2-thienyl 5-Cl cf3 CH2CH2-3 - thienyl 5-F cf3 CsC-cycPr 5-F cf3 cscch2ch2oh 5-F cf3 C=C-CH(OH)Me 5-F cf3 CsC-Ph 5-F cf3 CsC-(2-Cl)Ph 5-F cf3 C=C-(3-Cl)Ph 5-F cf3 C=C-(4-C1)Ph 5-F cf3 C=C-(2-F)Ph 5-F cf3 C=C-(3-F)Ph 5-F cf3 C=C-(4-F)Ph 5-F cf3 CsC-(2-OH)Ph 5-F cf3 C=C-(3-OH)Ph 5-F cf3 C=C-(4-OH)Ph 5-F cf3 CsC-(2-OMe)Ph 5-F cf3 CsC-(3-OMe)Ph 5-F cf3 CsC-(4-OMe)Ph Printed from Mimosa 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 PCT/US98/06733 5-f cf3 C=C-(2-CN)Ph H 5-f cf3 C=C-(3-CN)Ph H 5-f cf3 C=C-(4-CN)Ph ^ H 5-f cf3 C=C-(2-NO2) Ph H 5-f cf3 C=C-(3-NO2)Ph H 5-f cf3 C=C-(4-N02)Ph H 5-f cf3 C=C-(2-NH2)Ph H 5-f cf3 C=C-(3-NH2)Ph H 5-f cf3 C=C-(4-NH2)Ph H 5-f cf3 C=C-(2-NMe2)Ph H 5-f cf3 CsC-(3-NMe2)Ph H 5-f cf3 C=C-(4-NMe2)Ph H 5-f cf3 CsC-2-Pyridyl H 5-f cf3 CsC-2-Pyridyl H 5-f cf3 Csc-3-Pyridyl H 5-f cf3 C=C-4-Pyridyl H 5-f cf3 C=C-2-furanyl H 5-f cf3 CsC-3-furanyl H 5-f cf3 ■ C^C-2-thienyl H 5-f cf3 C=C-3-thienyl H 5-f cf3 CsC-2-oxazolyl H 5-f cf3 C=C-2-thiazolyl H 5-f cf3 CsC-4-isoxazolyl H 5-f cf3 CsC-2-imidazolyl H 5-f cf3 C=C-cycPr h 5-f cf3 c=cch2ch2oh h 5-f cf3 C=C-CH(OH) Me H 5-f cf3 C=C-Ph h 5-f cf3 C=C-(2-Cl)Ph H 5-f cf3 C=C-(3-Cl)Ph h 5-f cf3 C=C-(4-C1)Ph h 5-F cf3 C=C-(2-F)Ph h 5-F cf3 C=C-(3-F)Ph h 5-f cf3 C=C-(4-F)Ph H 83 Printed from Mimosa WO 98/45276 PCT/US98/06733 1049 5-F cf3 C=C-(2-OH)Ph H 1050 5-F cf3 C=C-(3-OH)Ph H 1051 5-F cf3 C=C-(4-OH)Ph H 1052 5-F cf3 C=C-(2-OMe)Ph H 1053 5-F cf3 C=C-(3-OMe)Ph H 1054 5-F cf3 C=C-(4-OMe)Ph H 1055 5-F cf3 C=C-(2-CN)Ph H 1056 5-F cf3 C=C-(3-CN)Ph H 1057 5-F cf3 C=C-(4-CN)Ph H 1058 5-F cf3 C=C-(2-N02)Ph H 1059 5-F cf3 C=C-(3-N02) Ph H 1060 5-F cf3 C=C-(4-N02) Ph H 1061 5-F cf3 C=C-(2-NH2)Ph H 1062 5-F cf3 C=C-{3-NH2)Ph H 1063 5-F cf3 C=C-(4-NH2)Ph H 1064 5-F cf3 C=C-(2-NMe2) Ph H 1065 5-F cf3 C=C-(3-NMe2) Ph H 1066 5-F cf3 C=C-(4-NMe2)Ph H 1067 5-F cf3 C=C-2-Pyridyl H 1068 5-F cf3 C=C-2-Pyridyl H 1069 5-F cf3 C=C-3-Pyridyl H 1070 5-F cf3 C=C-4-Pyridyl H 1071 5-F cf3 C=C-2-furanyl H 1072 5-F cf3 C=C-3-furanyl H 1073 5-F cf3 C=C-2-thienyl H 1074 5-F cf3 C=C-3-thienyl H 1075 5-F cf3 C=C-2-oxazolyl H 1076 5-F cf3 C=C-2-thiazolyl H 1077 5-F cf3 C=C-4-isoxazolyl H 1078 5-F cf3 C=C-2-imidazolyl H 1079 5-F cf3 CH2CH2-cycPr H 1080 5-F cf3 CH2CH2CH2CH2OH H 1081 5-F cf3 CH2CH2 -CH (OH) Me H 1082 5-F cf3 CH2CH2Ph H 84 Printed from Mimosa 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 PCT/US98/06733 5-F cf3 CH2CH2-(2-Cl)Ph H 5-F cf3 CH2CH2-{3-Cl)Ph H 5-F cf3 CH2CH2-{4-Cl)Ph H 5-F cf3 CH2CH2-(2-F)Ph H 5-F cf3 CH2CH2-(3-F)Ph H 5-F cf3 CH2CH2-(4-F)Ph H 5-F cf3 CH2CH2-(2-OH)Ph H 5-F cf3 CH2CH2-(3-OH)Ph H 5-F cf3 CH2CH2-(4-OH)Ph H 5-F cf3 CH2CH2-(2-OMe)Ph H 5-F cf3 CH2CH2-(3-OMe)Ph H 5-F cf3 CH2CH2-(4-OMe)Ph H 5-F cf3 CH2CH2-(2-CN)Ph H 5-F cf3 CH2CH2-(3-CN)Ph H 5-F cf3 CH2CH2-(4-CN)Ph H 5-F cf3 CH2CH2-(2-N02)Ph H 5-F cf3 CH2CH2-(3-N02)Ph H 5-F cf3 CH2CH2-{4-N02)Ph H 5-F cf3 CH2CH2-(2-NH2) Ph H 5-F cf3 CH2CH2-(3-NH2)Ph H 5-F cf3 CH2CH2-{4-NH2) Ph H 5-F cf3 CH2 CH2-(2-NMe2)Ph H 5-F cf3 CH2CH2-(3-NMe2)Ph H 5-F cf3 CH2CH2-(4-NMe2)Ph H 5-F cf3 CH2 CH2-2-Pyridy1 H 5-F cf3 CH2CH2-3-Pyridyl H 5-F cf3 CH2CH2-4-Pyridyl H 5-F cf3 CH2CH2-2-furanyl H 5-F cf3 CH2CH2-3-furanyl H 5-F cf3 CH2CH2-2-thienyl H 5-F cf3 CH2CH2-3-thienyl H 5-F cf3 CH2CH2-2-oxazolyl H 5-F cf3 CH2CH2-2-thiazolyl H 5-F cf3 CH2CH2-4-isoxazolyl H 85 Printed from Mimosa WO 98/45276 PCT/US98/06733 1117 5-f cf3 1118 5-f cf3 1119 5-f cf3 1120 5-f cf3 1121 5-f cf3 1122 5-f cf3 1123 5-f cf3 1124 5-f cf3 1125 5-f cf3 1126 5-f cf3 1127 5-f cf3 1128 5-f cf3 1129 5-f cf3 1130 5-f cf3 1131 5-f cf3 1132 5-f cf3 1133 h 1 Lf) cf3 1134 5-f cf3 1135 5-f cf3 1136 5-f cf3 1137 5-f cf3 1138 5-f cf3 1139 5-f cf3 1140 5-f cf3 1141 5-f cf3 1142 5-f cf3 1143 5-f cf3 1144 5-f cf3 1145 5-f cf3 1146 5-f cf3 1147 5-f cf3 1148 5-f cf3 1149 5-f cf3 1150 5-f cf3 CH2CH2-2- imidazolyl H C=C-cycPr ch3 C=C-Ph ch3 C=C-2-Pyridyl ch3 C=C-3-Pyridyl ch3 C=C-4-Pyridyl ch3 CsC-2-furanyl ch3 C=C-3-furanyl ch3 CsC-2-thienyl ch3 CsC-3-thienyl ch3 C=C-cycPr ch3 C=C-Ph ch3 C=C-2-Pyridyl ch3 C=C-3-Pyridyl ch3 C=C-4-Pyridyl ch3 C=C-2-furanyl ch3 C=C-3-furanyl ch3 C=C-2-thienyl ch3 C=C-3-thienyl ch3 CH2CH2-cycPr ch3 CH2CH2-Ph ch3 ch2ch2-2-Pyridyl ch3 CH2CH2-3-Pyridyl ch3 CH2CH2-4-Pyridyl ch3 CH2CH2 -2 - furanyl ch3 CH2CH2-3-furanyl ch3 CH2CH2-2-thienyl ch3 CH2CH2-3 -thienyl ch3 C=C-cycPr ch2ch3 CsC-Ph ch2ch3 C=C-2-Pyridyl ch2ch3 G=c-3-pyridyl ch2ch3 CsC-4-Pyridyl ch2ch3 Csc-2 - furanyl ch2ch3 86 Printed from Mimosa WO 98/45276 PCT/US98/06733 1151 5-f cf3 C=C-3-furanyl ch2ch3 1152 5-f cf3 C=C-2-thienyl ch2ch3 1153 5-f cf3 CsC-3-thienyl ch2ch3 1154 5-f cf3 C=C-cycPr ch2ch3 1155 5-f cf3 C=C-Ph ch2ch3 1156 5-f cf3 C=C-2-Pyridyl ch2ch3 1157 5-f cf3 C=C-3-Pyridyl ch2ch3 1158 5-f cf3 C=C-4-Pyridyl ch2ch3 1159 5-f cf3 c=c-2-furanyl ch2ch3 1160 5-f cf3 C=C-3-furanyl ch2ch3 1161 5-f cf3 c=c-2-thienyl ch2ch3 1162 5-f cf3 C=C-3-thienyl ch2ch3 1163 5-f cf3 CH2CH2-cycPr ch2ch3 1164 5-f cf3 CH2CH2-Ph ch2ch3 1165 5-f cf3 CH2CH2-2-Pyridyl ch2ch3 1166 5-f cf3 CH2CH2-3-Pyridyl ch2ch3 1167 5-f cf3 CH2CH2-4-Pyridyl ch2ch3 1168 5-f cf3 CH2CH2-2-furanyl ch2ch3 1169 5-f cf3 CH2CH2-3 - furanyl ch2ch3 1170 5-f cf3 ch2ch2-2-thienyl ch2ch3 1171 5-f cf3 CH2CH2-3-thienyl ch2ch3 1172 5- -cl, 6- -f cf3 C=C-cycPr H 1173 5- -cl,6- -f cf3 CsC-Ph H 1174 5- -cl,6- -f cf3 CsC-2-Pyridyl H 1175 5- -cl, 6- -f cf3 CsC-3-Pyridyl h 1176 5- -cl,6- -f cf3 CsC-4-Pyridyl H 1177 5- -cl,6- -f cf3 CsC-2-furanyl H 1178 5- -cl,6- -f cf3 CsC-3-furanyl H 1179 5- -cl, 6- -f cf3 CsC-2-thienyl H 1180 5- -cl, 6- -f cf3 CsC-3-thienyl H 1181 5' -cl, 6- -f cf3 C=C-cycPr H 1182 5 -cl, 6- -f cf3 C=C-Ph h 1183 5 -cl, 6- -f cf3 C=C-2-Pyridyl H 1184 5 -cl, 6- -f cf3 C=C-3-Pyridyl H 87 Printed from Mimosa WO 98/45276 PCT/US98/06733 1185 5-Cl,6-f cf3 c=c-4-Pyridyl H 1186 5-Cl,6-f cf3 C=C-2-furanyl H 1187 5-Cl,6-f cf3 C=C-3-furanyl H 1188 5-Cl,6-f cf3 C=C-2-thienyl H 1189 5-Cl,6-f cf3 C=C-3-thienyl H 1190 5-Cl,6-f cf3 ch2ch2-cycPr H 1191 5-Cl,6-f cf3 CH2CH2-Ph H 1192 5-Cl,6-f cf3 CH2CH2-2-Pyridyl H 1193 5-Cl,6-f cf3 CH2CH2-3-Pyr idyl h 1194 5-Cl,6-f cf3 CH2CH2-4-Pyridyl h 1195 5-Cl,6-f cf3 CH2CH2-2 - furanyl h 1196 5-Cl,6-f cf3 CH2CH2 -3 - furanyl H 1197 5-Cl,6-f cf3 CH2CH2-2-thienyl H 1198 5-Cl,6-f cf3 CH2CH2-3-thienyl H 1199 5-Cl,6-f cf3 Csc-cycPr ch3 1200 5-Cl,6-f cf3 CsC-Ph ch3 1201 5-Cl,6-f cf3 CsC-2-Pyridyl ch3 1202 5-Cl,6-f cf3 CsC-3-Pyridyl ch3 1203 5-Cl,6-f cf3 CsC-4-Pyridyl ch3 1204 5-Cl,6-f cf3 C=C-2-furanyl ch3 1205 5-Cl,6-f cf3 CsC-3-furanyl ch3 1206 5-Cl,6-f cf3 C=C-2-thienyl ch3 1207 5-Cl,6-f cf3 CsC-3-thienyl ch3 1208 5-Cl,6-f cf3 C=C-cycPr ch3 1209 5-Cl,6-f cf3 C=C-Ph ch3 1210 5-Cl,6-f cf3 C=C-2-Pyridyl ch3 1211 5-Cl,6-f cf3 C=C-3-Pyridyl ch3 1212 5-Cl,6-f cf3 C=C-4-Pyridyl ch3 1213 5-Cl,6-f cf3 C=C-2-furanyl ch3 1214 5-Cl,6-f cf3 C=C-3-furanyl ch3 1215 5-Cl,6-f cf3 C=C-2-thienyl ch3 1216 5-Cl,6-f cf3 C=C-3-thienyl ch3 1217 5-Cl,6-f cf3 CH2CH2-cycPr ch3 1218 5-Cl,6-f cf3 CH2CH2-Ph ch3 88 Printed from Mimosa WO 98/45276 PCT/US98/06733 1219 5-Cl,6-f cf3 CH2CH2-2-Pyridyl ch3 1220 5-Cl,6-f cf3 CH2CH2-3-Pyridyl ch3 1221 5-Cl,6-f cf3 CH2CH2-4-Pyridyl ch3 1222 5-Cl,6-f cf3 ch2ch2-2-furanyl ch3 1223 5-Cl,6-f cf3 CH2CH2-3 - furanyl ch3 1224 5-Cl,6-f cf3 ch2 CH2 -2 - thi enyl ch3 1225 5-Cl,6-f cf3 CH2CH2-3 -thienyl ch3 1226 5-F,6-Cl cf3 C=C-cycPr H 1227 5-F,6-Cl cf3 CsC-Ph H 1228 5-F,6-Cl cf3 CsC-2-Pyridyl h 1229 5-F,6-Cl cf3 CsC-3-Pyridyl h 1230 5-F,6-Cl cf3 CsC-4-Pyridyl H 1231 5-F,6-Cl cf3 CsC-2-furanyl H 1232 5-F,6-Cl cf3 C=C-3-furanyl H 1233 5-F,6-Cl cf3 CsC-2-thienyl H 1234 5-F,6-Cl cf3 CsC-3-thienyl H 1235 5-F,6-Cl cf3 C=C-cycPr h 1236 5-F,6-Cl cf3 C=C-Ph H 1237 5-F,6-Cl cf3 C=C-2-Pyridyl H 1238 5-F,6-Cl cf3 C=C-3-Pyridyl H 1239 5-F,6-Cl cf3 C=C-4-Pyridyl H 1240 5-F,6-Cl cf3 C=C-2-furanyl H 1241 5-F,6-Cl cf3 C=C-3-furanyl h 1242 5-F,6-Cl cf3 C=C-2-thienyl H 1243 5-F,6-Cl cf3 C=C-3-thienyl H 1244 5-F,6-Cl cf3 CH2CH2-cycPr H 1245 5-F,6-Cl cf3 CH2CH2-Ph H 1246 5-F,6-Cl cf3 CH2CH2-2-Pyridyl H 1247 5-F,6-Cl cf3 ch2ch2-3-Pyridyl H 1248 5-F,6-Cl cf3 CH2CH2-4-Pyridyl H 1249 5-F,6-Cl cf3 CH2CH2 -2 - furanyl H 1250 5-F,6-Cl cf3 CH2CH2-3-furanyl H 1251 5-F,6-Cl cf3 CH2CH2 -2 - thienyl H 1252 5-F,6-Cl cf3 ch2ch2 -3 - thienyl H 89 Printed from Mimosa WO 98/45276 PCT/US98/06733 1253 5-F,6-Cl cf3 1254 5-F,6-Cl cf3 1255 5-F,6-Cl cf3 1256 5-F,6-Cl cf3 1257 5-F,6-Cl cf3 1258 5-F,6-Cl cf3 1259 5-F,6-Cl cf3 1260 5-F,6-Cl cf3 1261 5-F,6-Cl cf3 1262 5-F,6-Cl cf3 1263 5-F,6-Cl cf3 1264 5-F,6-Cl cf3 1265 5-F,6-Cl cf3 1266 5-F,6-Cl cf3 1267 5-F,6-Cl cf3 1268 5-F,6-Cl cf3 1269 5-F,6-Cl cf3 1270 5-F,6-Cl cf3 1271 5-F,6-Cl cf3 1272 5-F,6-Cl cf3 1273 5-F,6-Cl cf3 1274 5-F,6-Cl cf3 1275 5-F,6-Cl cf3 1276 5-F,6-Cl cf3 1277 5-F,6-Cl cf3 1278 5-F,6-Cl cf3 1279 5-F,6-Cl cf3 1280 6-Cl,8-F cf3 1281 6-Cl,8-F cf3 1282 6-Cl,8-F cf3 1283 6-Cl,8-F cf3 1284 6-Cl,8-F cf3 1285 6-Cl,8-F cf3 1286 6-Cl,8-F cf3 Csc-cycPr ch3 CHC-Ph ch3 C=C-2-Pyridyl ch3 C=C-3-Pyridyl ch3 C=C-4 -Pyridyl ch3 CsC-2-furanyl ch3 CsC-3-furanyl ch3 CsC-2-thienyl ch3 CsC-3-thienyl ch3 C=C-cycPr ch3 C=C-Ph ch3 C=C-2-Pyridyl ch3 C=C-3-Pyridyl ch3 C=C-4-Pyridyl ch3 C=C-2-furanyl ch3 C=C-3-furanyl ch3 C=C-2-thienyl ch3 C=C-3-thienyl ch3 CH2 CH2 -eye Pr ch3 CH2CH2-Ph ch3 CH2CH2-2-Pyridyl ch3 CH2CH2-3-Pyridyl ch3 CH2CH2-4-Pyridyl ch3 CH2CH2-2 - furanyl ch3 CH2CH2-3 - furanyl ch3 CH2CH2-2 - thienyl ch3 CH2CH2-3-thienyl ch3 CsC-eyePr h CsC-Ph h CsC-2-Pyridyl h CsC-3-Pyridyl H CsC-4-Pyridyl H CsC-2-furanyl H C=C-3-furanyl h 90 Printed from Mimosa WO 98/45276 PCT/US98/06733 1287 6-Cl,8-F cf3 CsC-2-thienyl H 1288 6-Cl,8-F cf3 CsC-3-thienyl H 1289 6-Cl,8-F cf3 C=C-cycPr H 1290 6-Cl,8-F cf3 C=C-Ph H 1291 6-Cl,8-F cf3 C=C-2-Pyridyl H 1292 6-Cl,8-F cf3 C=C-3-Pyridyl H 1293 6-Cl,8-F cf3 c=c-4-Pyridyl H 1294 6-Cl,8-F cf3 C=C-2-furanyl H 1295 6-Cl,8-F cf3 C=C-3-furanyl H 1296 6-Cl,8-F cf3 C=C-2-thienyl H 1297 6-Cl,8-F cf3 C=C-3-thienyl H 1298 6-Cl,8-F cf3 CH2CH2-cycPr H 1299 6-Cl,8-F cf3 CH2CH2-Ph H 1300 6-Cl,8-F cf3 CH2CH2-2 -Pyridyl H 1301 6-Cl,8-F cf3 CH2CH2 -3 - Pyridyl h 1302 6-Cl,8-F cf3 CH2CH2-4-Pyr idyl h 1303 6-Cl,8-F cf3 CH2CH2-2 - furanyl H 1304 6-Cl,8-F cf3 CH2CH2 -3 - furanyl h 1305 6-Cl,8-F cf3 CH2CH2 -2 - thienyl H 1306 6-Cl,8-F cf3 CH2CH2-3-thienyl h 1307 1 o H 03 *1 cf3 CsC-cycPr ch3 1308 6-Cl,8-F cf3 CsC-Ph ch3 1309 6-Cl,8-F cf3 CsC-2-Pyridyl ch3 1310 6-Cl,8-F cf3 CsC-3-Pyridyl ch3 1311 6-Cl,8-F cf3 CsC-4-Pyridyl ch3 1312 6-Cl,8-F cf3 CsC-2-furanyl ch3 1313 6-Cl,8-F cf3 CsC-3-furanyl ch3 1314 6-Cl,8-F cf3 CsC-2-thienyl ch3 1315 6-Cl,8-F cf3 CsC-3-thienyl ch3 1316 6-Cl,8-F cf3 C=C-cycPr ch3 1317 6-Cl,8-F cf3 C=C-Ph ch3 1318 6-Cl,8-F cf3 C=C-2-Pyridyl ch3 1319 6-Cl,8-F cf3 C=C-3-Pyridyl ch3 1320 6-Cl,8-F cf3 C=C-4-Pyridyl ch3 91 Printed from Mimosa WO 98/45276 PCT/US98/06733 1321 6- 1 CO f—1 O cf3 C=C-2-furanyl ch3 1322 6- ■Cl,8-f cf3 C=C-3-furanyl ch3 1323 6- -Cl,8-f cf3 C=C-2-thienyl ch3 1324 6- -Cl,8-f cf3 C=C-3-thienyl ch3 1325 6- -Cl,8-f cf3 CH2CH2~cycPr ch3 1326 6- -Cl,8-f cf3 CH2CH2-Ph ch3 1327 6- -Cl,8-f cf3 ch2ch2-2-Pyridyl ch3 1328 6- -Cl,8-f cf3 CH2CH2-3-Pyridyl ch3 1329 6- -Cl,8-f cf3 CH2 CH2 - 4 - Pyr idy 1 ch3 1330 6 -Cl,8-f cf3 CH2CH2 -2 - furanyl ch3 1331 6 o 00 cf3 CH2CH2 -3 -furanyl ch3 1332 6 -Cl,8-f cf3 CH2CH2-2-thi enyl ch3 1333 6 -Cl,8-f cf3 ch2ch2-3-thienyl ch3 1334 6-ch3 cf3 CsC-cycPr H 1335 6-ch3 cf3 CsC-Ph H 1336 6-ch3 cf3 CsC-2-Pyridyl H 1337 6-ch3 cf3 CsC-3-Pyridyl H 1338 6-ch3 cf3 C=C-4-Pyridyl h 1339 6-ch3 cf3 CsC-2-furanyl H 1340 6-ch3 cf3 CsC-3-furanyl H 1341 6-ch3 cf3 CsC-2-thienyl H 1342 6-ch3 cf3 CsC-3-thienyl H 1343 6-ch3 cf3 C=C-cycPr H 1344 6-ch3 cf3 C=C-Ph H 1345 6-ch3 cf3 C=C-2-Pyridyl h 1346 6-ch3 cf3 C=C-3-Pyridyl H 1347 6-ch3 cf3 C=C-4-Pyridyl H 1348 6-CH3 cf3 C=C-2-furanyl H 1349 6-ch3 cf3 C=C-3-furanyl H 1350 6-ch3 cf3 C=C-2-thienyl H 1351 6-ch3 cf3 C=C-3-thienyl h 1352 6-ch3 cf3 CH2CH2~cycPr H 1353 6-ch3 cf3 CH2CH2-Ph H 1354 6-ch3 cf3 CH2CH2-2-Pyridyl H 92 Printed from Mimosa WO 98/45276 PCT/US98/06733 1355 6-ch3 cf3 1356 6-ch3 cf3 1357 6-ch3 cf3 1358 6-ch3 cf3 1359 6-ch3 cf3 1360 6-ch3 cf3 1361 6-ch3 cf3 1362 6-ch3 cf3 1363 6-ch3 cf3 1364 6-ch3 cf3 1365 6-ch3 cf3 1366 6-ch3 cf3 1367 6-ch3 cf3 1368 6-ch3 cf3 1369 6-ch3 cf3 1370 6-ch3 cf3 1371 6-ch3 cf3 1372 6-ch3 cf3 1373 6-ch3 cf3 1374 6-ch3 cf3 1375 6-ch3 cf3 1376 6-ch3 cf3 1377 6-ch3 cf3 1378 6-ch3 cf3 1379 6-ch3 cf3 1380 6-ch3 cf3 1381 6-ch3 cf3 1382 6-ch3 cf3 1383 6-ch3 cf3 1384 6-ch3 cf3 1385 6-ch3 cf3 1386 6-ch3 cf3 1387 6-ch3 cf3 1388 6-coch3 cf3 CH2CH2-3 -Pyridyl H CH2CH2-4-Pyridyl H CH2CH2-2-furanyl H CH2CH2-3-furanyl H CH2CH2-2-thienyl H CH2 CH2-3-thienyl H C=C-cycPr CH3 Csc-Ph ch3 CsC-2-Pyridyl ch3 CsC-3-Pyridyl ch3 CsC-4-Pyridyl ch3 CsC-2-furanyl ch3 CsC-3-furanyl ch3 CsC-2-thienyl ch3 CsC-3-thienyl ch3 C=C-cycPr ch3 C=C-Ph ch3 C=C-2-Pyridyl ch3 C=C-3-Pyridyl ch3 C=C-4-Pyridyl ch3 C=C-2-furanyl ch3 C=C-3-furanyl CH3 C=C-2-thienyl ch3 C=C-3-thienyl ch3 CH2CH2-cycPr ch3 CH2CH2-Ph ch3 CH2CH2-2-Pyridyl ch3 CH2CH2-3-Pyridyl ch3 CH2CH2-4-Pyridyl ch3 CH2CH2-2 -furanyl ch3 CH2CH2-3 - furanyl ch3 CH2CH2-2-thienyl ch3 CH2CH2-3-thienyl ch3 CsC-cycPr H 93 Printed from Mimosa WO 98/45276 1389 6-coch3 cf3 1390 6-coch3 cf3 1391 6-coch3 cf3 1392 6-coch3 cf3 1393 6-coch3 cf3 1394 6-coch3 cf3 1395 6-coch3 cf3 1396 6-coch3 cf3 1397 6-NH2 cf3 1398 6-NH2 cf3 1399 6-nh2 cf3 1400 6-NH2 cf3 1401 6-nh2 cf3 1402 6-NH2 cf3 1403 6-nh2 cf3 1404 6-NH2 cf3 1405 6-NH2 cf3 1406 6-NMe2 cf3 1407 6-NMe2 cf3 1408 6-NMe2 cf3 1409 6-NMe2 cf3 1410 6-NMe2 cf3 1411 6-NMe2 cf3 1412 6-NMe2 cf3 1413 6-NMe2 cf3 1414 6-NMe2 cf3 1415 7-c1 cf3 1416 7-c1 cf3 1417 7-c1 cf3 1418 7-c1 cf3 1419 7-c1 cf3 1420 7-c1 cf3 1421 7-c1 cf3 1422 7-c1 cf3 PCT/US98/06733 CsC-Ph h C=C-2-Pyridyl h CsC-3-Pyridyl h CsC-4-Pyridyl h C=C-2-furanyl h C=C-3-furanyl h CsC-2-thienyl h CsC-3-thienyl h CsC-cycPr h CsC-Ph h CsC-2-Pyridyl h CsC-3-Pyridyl h CsC-4-Pyridyl h CsC-2-furanyl h C=C-3-furanyl h CsC-2-thienyl h C=C-3-thienyl h C=C-cycPr h CsC-Ph h CsC-2-Pyridyl h CsC-3-Pyridyl h CsC-4-Pyridyl h CsC-2-furanyl h CsC-3-furanyl h CsC-2-thienyl h CsC-3-thienyl h CsC-cycPr h CsC-Ph h CsC-2-Pyridyl h C=C-3-Pyridyl h C=C-4-Pyridyl h CsC-2-furanyl h CsC-3-furanyl h CsC-2-thienyl h Printed from Mimosa WO 98/45276 1423 7-C1 1424 5,6-OCH20- 1425 5,6-0CH20- 1426 5,6-0CH20- 1427 5,6-0CH20- 1428 5,6-och2o- 1429 5,6-0CH20- 1430 5,6-0CH20- 1431 5,6-0CH20- 1432 5,6-0CH20- 1433 5,6-0CH20- 1434 5,6-0CH20- 1435 5,6-0CH20- 1436 5,6-0CH20- 1437 5,6-0CH20- 1438 5,6-0CH20- 1439 5,6-0CH20- 1440 5,6-0CH20- 1441 5,6-0CH20- 1442 5,6-0CH20- 1443 5,6-0CH20- 1444 5,6-0CH20- 1445 5,6-0CH20- 1446 5,6-0CH20- 1447 5,6-0CH20- 1448 5,6-0CH20- 1449 5,6-0CH20- 1450 5,6-0CH20- 1451 5,6-0CH20- 1452 5,6-0CH20- 1453 5,6-0CH20- 1454 5,6-0CH20- 1455 5,6-0CH20- 1456 5,6-0CH20- PCT /US98/06733 cf3 C=C-3-thienyl H cf3 C=C-cycPr H cf3 CsCCH2CH2OH H cf3 C=C-CH(OH)Me H cf3 C=C-Ph H cf3 C=C-(2-Cl)Ph H cf3 CsC-(3-Cl)Ph H cf3 C=C-(4-C1)Ph H cf3 C=C-(2-F)Ph H cf3 C=C- (3 -F) Ph H cf3 C=C-(4-f)Ph H cf3 CsC-(2-OH)Ph H cf3 C=C-(3-OH)Ph H cf3 C=C-(4-OH)Ph H cf3 C^:- (2-OMe) Ph H cf3 CsC-(3-OMe)Ph H cf3 C^U-(4-OMe)Ph H cf3 CsC-(2-CN)Ph H cf3 C=C-(3-CN)Ph H cf3 CsC-(4-CN)Ph H cf3 CsC-(2-N02) Ph H cf3 C=C-(3-N02) Ph H cf3 CsC-(4-N02) Ph H cf3 C=C-(2-NH2) Ph H cf3 CsC-(3-NH2)Ph H cf3 CsC-(4-NH2) Ph H cf3 CsC-(2-NMe2) Ph H cf3 CsC- (3 -NMe2) Ph H cf3 C=C-(4-NMe2)Ph H cf3 CsC-2-Pyridyl H cf3 CsC-2-Pyridyl H cf3 CsC-3-Pyridyl H cf3 CsC-4-Pyridyl H cf3 CsC-2-furanyl H 95 Printed from Mimosa WO 98/45276 PCT/US98/06733 1457 5,6-0CH20- cf3 C=C-3-furanyl H 1458 5,6-0CH20- cf3 CsC-2-thienyl H 1459 5,6-0CH20- cf3 C=C-3-thi enyl H 1460 5,6-0CH2O- cf3 CsC-2-oxazolyl H 1461 5,6-0CH20- cf3 CsC-2-thiazolyl H 1462 5, 6-0CH20- cf3 CsC-4-isoxazolyl H 1463 5,6-0CH20- cf3 CsC-2-imidazolyl H 1464 6-coch3 cf3 C=C-cycPr H 1465 6-coch3 cf3 C=C-Ph H 1466 6-coch3 cf3 C=C-2-Pyridyl H 1467 6-coch3 cf3 C=C-3-Pyridyl H 1468 6-coch3 cf3 C=C-4-Pyridyl H 1469 6-coch3 cf3 C=C-2-furanyl H 1470 6-coch3 cf3 C=C-3-furanyl H 1471 6-coch3 cf3 C=C-2-thienyl H 1472 6-coch3 cf3 C=C-3-thienyl H 1473 6-NH2 cf3 C=C-cycPr H 1474 6-NH2 cf3 C=C-Ph H 1475 6-nh2 cf3 C=C-2-Pyridyl H 1476 6-NH2 cf3 C=C-3-Pyridyl H 1477 6-nh2 cf3 C=C-4-Pyridyl H 1478 6-nh2 cf3 C=C-2-furanyl H 1479 6-NH2 cf3 C=C-3-furanyl H 1480 6-NH2 cf3 C=C-2-thienyl H 1481 6-NH2 cf3 C=C-3-thienyl H 1482 6-NMe2 cf3 C=C-cycPr H 1483 6-NMe2 cf3 C=C-Ph H 1484 6-NMe2 cf3 C=C-2-Pyridyl H 1485 6-NMe2 cf3 C=C-3-Pyridyl H 1486 6-NMe2 cf3 C=C-4-Pyridyl H 1487 6-NMe2 cf3 C=C-2-furanyl H 1488 6-NMe2 cf3 C=C-3-furanyl H 1489 6-NMe2 cf3 C=C-2-thienyl H 1490 6-NMe2 cf3 C=C-3-thienyl H 96 Printed from Mimosa WO 98/45276 PCT/U S98/06733 1491 7-Cl cf3 C=C-cycPr H 1492 7-C1 cf3 C=C-Ph H 1493 7-Cl cf3 C=C-2-Pyridyl H 1494 7-Cl cf3 C=C-3-Pyridyl H 1495 7-Cl cf3 C=C-4-Pyridyl H 1496 7-Cl cf3 C=C-2-furanyl H 1497 7-Cl cf3 C=C-3-furanyl H 1498 7-Cl cf3 C=C-2-thienyl H 1499 7-Cl cf3 C=C-3-thienyl H 1500 5,6-0CH20- cf3 C=C-cycPr H 1501 5,6-0CH20- cf3 C=CCH2CH2OH H 1502 5,6-0CH20- cf3 C=C-CH(OH)Me H 1503 5,6-OCH20- cf3 C=C-Ph H 1504 5,6-0CH20- cf3 C=C-(2-Cl)Ph H 1505 5,6-0CH20- cf3 C=C-(3-Cl)Ph H 1506 5,6-0CH20- cf3 C=C-(4-C1)Ph H 1507 5,6-0CH20- cf3 C=C-(2-F)Ph H 1508 5,6-0CH20- cf3 C=C-(3-F)Ph H 1509 5,6-0CH20- cf3 C=C-(4-F) Ph H 1510 5,6-0CH20- cf3 C=C-(2-OH)Ph H 1511 5,6-0CH20- cf3 C=C-(3-OH)Ph H 1512 5,6-0CH20- cf3 C=C-(4-OH)Ph H 1513 5,6-0CH20- cf3 C=C-(2-OMe)Ph H 1514 5,6-0CH20- cf3 C=C-(3-OMe)Ph H 1515 5,6-0CH20- cf3 C=C-(4-OMe)Ph H 1516 5,6-0CH20- cf3 C=C-(2-CN)Ph H 1517 5,6-0CH20- cf3 C=C-(3-CN)Ph H 1518 5,6-0CH20- cf3 C=C-(4-CN)Ph H 1519 5,6-0CH20- cf3 C=C-(2-N02) Ph H 1520 5,6-och2o- cf3 C=C-(3-N02) Ph H 1521 5,6-0CH20- cf3 C=C-(4-N02) Ph H 1522 5,6-0CH20- cf3 C=C-(2-NH2) Ph H 1523 5,6-och2o- cf3 C=C-(3-NH2)Ph H 1524 5,6-0CH20- cf3 C=C-(4-NH2) Ph H 97 Printed from Mimosa WO 98/45276 PCT/US98/06733 1525 5,6-0CH20- cf3 C=C-(2-NMe2)Ph H 1526 5, 6-OCH20- cf3 C=C-(3-NMe2)Ph H 1527 5,6-0CH20- cf3 C=c-(4-NMe2)Ph H 1528 5,6-0CH20- cf3 C=C-2-Pyridyl H 1529 5, 6-0CH20- cf3 C=C-2-Pyridyl H 1530 5, 6-0CH20- cf3 C=C-3-Pyridyl H 1531 5,6-0CH20- cf3 C=C-4-Pyridyl H 1532 5, 6-0CH20- cf3 C=C-2-furanyl H 1533 5,6-0CH20- cf3 C=C-3-furanyl H 1534 5,6-0CH20- cf3 C=C-2-thienyl H 1535 5,6-0CH20- cf3 C=C-3-thienyl H 1536 5,6-0CH20- cf3 C=C-2-oxazolyl H 1537 5,6-0CH20- cf3 C=C-2-thiazolyl H 1538 5,6-0CH20- cf3 C=C-4-isoxazolyl H 1539 5,6-0CH2O- cf3 C=C-2-imidazolyl H 1540 5,6-0CH20- cf3 CH2CH2-cycPr H 1541 5,6-0CH20- cf3 CH2CH2CH2CH2OH H 1542 5,6-0CH2O- cf3 CH2CH2-CH (OH) Me H 1543 5,6-0CH20- cf3 CH2CH2Ph H 1544 5,6-0CH20- cf3 CH2CH2-(2-Cl)Ph H 1545 5,6-0CH20- cf3 CH2CH2-(3-Cl)Ph H 1546 5,6-0CH20- cf3 CH2CH2-(4-Cl)Ph H 1547 5,6-0CH2O- cf3 CH2CH2-(2-F)Ph H 1548 5,6-0CH20- cf3 CH2CH2-(3-F)Ph H 1549 5,6-0CH20- cf3 CH2CH2-(4-F)Ph H 1550 5,6-0CH20- cf3 CH2CH2-(2-OH)Ph H 1551 5,6-0CH20- cf3 CH2CH2 —(3-OH)Ph H 1552 5,6-0CH20- cf3 CH2CH2 - (4-OH) Ph H 1553 5,6-0CH2O- cf3 CH2CH2-(2-OMe)Ph H 1554 5,6-0CH20- cf3 CH2CH2-(3-OMe)Ph H 1555 5,6-0CH20- cf3 CH2CH2-(4-OMe)Ph H 1556 5,6-0CH20- cf3 CH2CH2-(2-CN)Ph H 1557 5,6-0CH20- cf3 CH2CH2- (3-CN) Ph H 1558 5,6-0CH20- cf3 CH2CH2-(4-CN)Ph H 98 Printed from Mimosa WO 98/45276 PCT/US98/06733 1559 5,6-0CH20- cf3 CH2CH2-(2-NO2) Ph H 1560 5,6-0CH2O- cf3 CH2CH2-(3-N02)Ph H 1561 5,6-0CH2O- cf3 CH2CH2-(4-N02)Ph H 1562 5,6-0CH20- cf3 CH2CH2-(2-NH2)Ph H 1563 5,6-0CH20- cf3 CH2CH2-(3-NH2)Ph H 1564 5,6-0CH20- cf3 CH2CH2-(4-NH2) Ph H 1565 5,6-och2o- cf3 CH2CH2-(2-NMe2)Ph H 1566 5,6-0CH20- cf3 CH2CH2-(3-NMe2)Ph H 1567 5,6-0CH20- cf3 CH2CH2-(4-NMe2)Ph H 1568 5,6-OCH20- cf3 CH2CH2-2-Pyridyl H 1569 5,6-0CH20- cf3 CH2CH2-3-Pyridyl H 1570 5,6-0CH20- cf3 CH2CH2-4-Pyridyl H 1571 5, 6-och2o- cf3 CH2CH2-2-furanyl H 1572 5,6-OCH20- cf3 CH2CH2-3 - furanyl H 1573 5, 6-OCH20- cf3 CH2CH2-2 - thienyl H 1574 5, 6-och2o- cf3 ch2ch2-3-thienyl h 1575 5,6-0CH20- cf3 CH2CH2-2 -oxazolyl h 1576 5,6-0CH20- cf3 CH2CH2-2-thiazolyl h 1577 5,6-0CH20- cf3 ch2ch2-4-isoxazolyl h 1578 5,6-OCH20- cf3 CH2CH2-2-imidazolyl h 1579 5,6-och2o- cf3 CsC-cycPr ch3 1580 5,6-och2o- cf3 CsC-Ph ch3 1581 5,6-0CH20- cf3 C=C-2-Pyridyl ch3 1582 5,6-0CH20- cf3 CS:-3- Pyridyl ch3 1583 5,6-OCH20- cf3 CsC-4-Pyridyl ch3 1584 5,6-0CH20- cf3 CsC-2-furanyl ch3 1585 5,6-OCH20- cf3 CsC-3-furanyl ch3 1586 5, 6-och2o- cf3 C=C-2 - thienyl ch3 1587 5, 6-0CH20- cf3 C=C-3 - thienyl ch3 1588 5,6-0CH20- cf3 C=C-cycPr ch3 1589 5, 6-OCH20- cf3 C=C-Ph ch3 1590 5,6-OCH20- cf3 C=C-2-Pyridyl ch3 1591 5,6-0CH20- cf3 C=C-3-Pyridyl ch3 1592 5,6-0CH20- cf3 C=C-4-Pyridyl ch3 99 Printed from Mimosa 1597 1598 1599 1600 1601 1602 1603 1604 1605 1606 1607 1608 1609 1610 1611 1612 1613 1614 1615 1616 1617 1618 1619 1620 1621 1622 1623 5,6- ■och2o- CF3 C=C-2-furanyl 5,6- -och2o- cf3 C=C-3-furanyl 5,6- -och2o- cf3 C=C-2-thienyl 5,6- -och2o- cf3 C=C-3-thienyl 5,6- •och2o- cf3 CH2CH2 -cycPr 5,6- -och2o- cf3 CH2CH2-Ph 5,6- -och2o- cf3 CH2CH2-2-Pyridyl 5,6- -och2o- cf3 CH2CH2-3-Pyridyl 5,6- -och2o- cf3 CH2CH2-4-Pyridyl 5,6- -och2o- cf3 CH2CH2 -2 - furanyl 5,6- -och2o- cf3 CH2CH2-3-furanyl 5,6- -och2o- cf3 CH2CH2 -2 - thi enyl 5,6- -och2o- cf3 CH2CH2-3-thienyl 5,6- -och2o- cf3 C=C-cycPr 5,6- -och2o- cf3 CsC-Ph 5,6- -och2o- CF3 C^C-2-Pyridyl 5,6- -och2o- cf3 CsC-3-Pyridyl 5,6- -och2o- cf3 CsC-4-Pyridyl 5,6- -och2o- cf3 CsC—2-furanyl 5,6- -och2o- cf3 C=C-3-furanyl 5,6- -och2o- cf3 CsC-2-thienyl 5,6- -och2o- cf3 C=C-3-thienyl 5,6- -och2o- cf3 C=C-cycPr 5,6- -och2o- cf3 C=C-Ph 5,6- -0ch20- cf3 C=C-2-Pyridyl 5,6- -och2o- cf3 C=C-3-Pyridyl 5,6 -och2o- CF3 C=C-4-Pyridyl 5,6 -och2o- cf3 C=C-2-furanyl 5,6' -och2o- cf3 C=C-3-furanyl 5,6 -och2o- cf3 C=C-2-thienyl 5,6 -och2o- cf3 C=C-3-thienyl 5,6 -och2o- cf3 CH2CH2~cycPr 5,6 -0CH20- cf3 CH2CH2-Ph 5,6 -och2o- cf3 CH2CH2-2 - Pyr idyl 100 Printed from Mimosa WO 98/45276 PCT/US98/06733 1627 5,6- -och2o- cf3 ch2ch2- -3 -Pyridyl ch2ch3 1628 5,6- -och2o- cf3 ch2ch2- -4' -Pyridyl ch2ch3 1629 5,6- -och2o- cf3 ch2ch2- -2 -furanyl ch2ch3 1630 5,6- -och2o- cf3 ch2ch2- -3 -furanyl ch2ch3 1631 5,6- -och2o- cf3 ch2ch2- -2 -thienyl ch2ch3 1632 5,6- -och2o- cf3 ch2ch2- -3 -thienyl ch2ch3 *Unless otherwise indicated, stereochemisty is (+/-). 101 Printed from Mimosa \ « 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 PCT/US98/06733 Table 3* R3 R1 R2 R8 6-Cl cf3 Csc-Pr h 6-Cl cf3 CsC-Bu h 6-Cl cf3 CsC-iBu h 6-Cl cf3 CsC-tBu h 6-Cl cf3 CsC-Me h 6-Cl cf3 ch2ch2CH2CH2ch3 h 6-Cl cf3 ch2ch2ch(ch3)2 H 6-Cl cf3 ch2ch2ch2ch3 H 6-Cl cf3 CH2CH2CH3 H 6-Cl cf3 CH2CH2-tBu H 6-Cl cf3 CH2CSC-CH3 H 6-Cl cf3 ch2csc-ch2ch3 h 6-Cl CF3 CsC-iPr ch3 6-Cl cf3 C=C-Pr ch3 6-Cl cf3 CsC-Bu ch3 6-Cl cf3 CsC-iBu ch3 6-Cl cf3 CsC-tBu ch3 6-Cl cf3 CsC-Et ch3 6-Cl cf3 CsC-Me ch3 6-Cl cf3 CH2csc-ch3 ch3 6-Cl cf3 ch2csc-CH2ch3 ch3 6-Cl cf3 ch2ch2ch(ch3)2 ch3 6-Cl cf3 ch2ch2ch2ch3 ch3 6-Cl cf3 CH2CH2ch3 ch3 6-Cl cf3 CH2CH2-tBu ch3 6-Cl cf3 CsC-iPr ch2ch3 6-Cl cf3 C=C-Pr ch2ch3 6-Cl cf3 CsC-Bu ch2ch3 102 Printed from Mimosa 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 PCT/US98/06733 6-Cl cf3 CsC-iBu ch2ch3 6-Cl cf3 CsC-tBu ch2ch3 6-Cl cf3 CsC-Et ch2ch3 6-Cl cf3 CsC-Me ch2ch3 6-Cl cf3 ch2cSc-ch3 ch2ch3 6-Cl cf3 ch2csc-CH2ch3 ch2ch3 6-Cl cf3 ch2ch2ch(ch3)2 ch2ch3 6-Cl cf3 ch2ch2ch2ch3 ch2ch3 6-Cl cf3 ch2ch2ch3 ch2ch3 6-Cl cf3 CH2CH2-tBu ch2ch3 6-MeO cf3 CsC-Pr h 6-MeO cf3 CsC-Bu h 6-MeO cf3 C=C-iBu h 6-MeO cf3 C=C-tBu H 6-MeO cf3 CsC-Et H 6-MeO cf3 CsC-Me h 6-MeO cf3 ch2csc-ch3 H 6-MeO cf3 ch2c=c-ch2ch3 H 6-MeO cf3 ch2ch2ch2ch2ch3 H 6-MeO cf3 ch2ch2ch (ch3) 2 H 6-MeO cf3 ch2ch2ch2ch3 H 6-MeO cf3 ch2ch2ch3 H 6-MeO cf3 CH2CH2-tBu H 6-MeO cf3 CH2C2C-CH3 H 6-MeO cf3 ch2cSc-CH2ch3 H 6-MeO cf3 CsC-iPr ch3 6-MeO cf3 CsC-Pr ch3 6-MeO cf3 CsC-Bu ch3 6-MeO cf3 C=C-iBu ch3 6-MeO cf3 CsC-tBu ch3 6-MeO cf3 CsC-Et ch3 6-MeO cf3 CsC-Me ch3 6-MeO cf3 CH2cSc-ch3 ch3 6-MeO cf3 ch2c=c-ch2ch3 ch3 103 Printed from Mimosa WO 98/45276 PCT/US98/06733 63 6-MeO cf3 CH2CH2CH(CH3)2 ch3 64 6-MeO cf3 ch2ch2ch2ch3 ch3 65 6-MeO cf3 ch2ch2ch3 ch3 66 6-MeO cf3 CH2CH2-tBu ch3 67 6-MeO cf3 CsC-iPr ch2ch3 68 6-MeO cf3 CsC-Pr ch2ch3 69 6-MeO cf3 CsC-Bu ch2ch3 70 6-MeO cf3 CsC-iBu ch2ch3 71 6-MeO cf3 CsC-tBu ch2ch3 72 6-MeO cf3 CsC-Et ch2ch3 73 6-MeO cf3 C=C-Me ch2ch3 74 6-MeO cf3 CH2CsC-CH3 ch2ch3 75 6-MeO cf3 CH2CSC-CH2CH3 ch2ch3 76 6-MeO cf3 CH2CH2CH (CH3) 2 ch2ch3 77 6-MeO cf3 CH2CH2CH2CH3 ch2ch3 78 6-MeO cf3 CH2CH2CH3 ch2ch3 79 6-MeO cf3 CH2CH2-tBu ch2ch3 80 5,6-diF cf3 C=C-Pr h 81 5,6-diF cf3 CsC-Bu H 82 5,6-diF cf3 CsC-iBu h 83 5,6-diF cf3 CsC-tBu H 84 5,6-diF cf3 CsC-Me H 85 5,6-diF cf3 CH2C=C-CH3 H 86 5,6-diF cf3 ch2c=c-ch2ch3 H 87 5,6-diF cf3 ch2ch2ch2ch2ch3 H 88 5,6-diF cf3 ch2ch2ch3 H 89 5,6-diF cf3 CH2CH2-tBu h 90 5,6-diF cf3 CsC-iPr ch3 91 5,6-diF cf3 CsC-Pr ch3 92 5,6-diF cf3 CsC-Bu ch3 93 5,6-diF cf3 CsC-iBu ch3 94 5,6-diF cf3 CsC-tBu ch3 95 5,6-diF cf3 CsC-Et ch3 96 5,6-diF cf3 CsC-Me ch3 104 Printed from Mimosa WO 98/45276 PCT/US98/06733 97 5,6-diF cf3 CsC-Ph ch3 98 5,6 -diF cf3 ch2c=c-ch3 ch3 99 5,6-diF cf3 ch2csc-ch2ch3 ch3 100 5,6-diF cf3 ch2ch2ch (ch3) 2 ch3 101 5,6-diF cf3 ch2ch2ch2ch3 ch3 102 5,6-diF cf3 ch2ch2ch3 ch3 103 5,6-diF cf3 CH2CH2-tBu ch3 104 5,6-diF cf3 CsC-iPr ch2ch3 105 5,6-diF cf3 C=C-Pr ch2ch3 106 5,6-diF cf3 CsC-Bu ch2ch3 107 5,6-diF cf3 C=C-iBu ch2ch3 108 5,6-diF cf3 CsC-tBu ch2ch3 109 5,6-diF cf3 CsC-Et ch2ch3 110 5,6-diF cf3 CsC-Me ch2ch3 111 5,6-diF cf3 CH2CsC-CH3 ch2ch3 112 5,6-diF cf3 CH2C=C-CH2CH3 ch2ch3 113 5,6-diF cf3 CH2CH2CH(CH3)2 ch2ch3 114 5,6-diF cf3 ch2ch2ch2ch3 ch2ch3 115 5,6-diF cf3 ch2ch2ch3 ch2ch3 116 5,6-diF cf3 CH2CH2-tBu ch2ch3 117 6-F cf3 CsC-Pr h 118 6-F cf3 CsC-Bu H 119 6-F cf3 CsC-iBu H 120 6-F cf3 CsC-tBu H 121 6-F cf3 CsC-Me H 122 6-F cf3 CH2CsC-CH2CH3 H 123 6-F cf3 CH2CH2CH2CH2CH3 H 124 6-f cf3 ch2ch2ch3 h 125 6-F cf3 CH2CH2-tBu h 126 6-f cf3 CsC-iPr ch3 127 6-F cf3 CsC-Pr ch3 128 6-f cf3 CsC-Bu ch3 129 6-f cf3 CsC-iBu ch3 130 6-f cf3 CsC-tBu ch3 105 Printed from Mimosa WO 98/45276 PCT/US98/06733 131 6-f cf3 CsC-Et ch3 132 6-f cf3 C=C-Me ch3 133 6-f cf3 ch2c=c-ch3 ch3 134 6-f cf3 ch2c=c-ch2ch3 ch3 135 6-f cf3 ch2ch2ch (ch3) 2 ch3 136 6-f cf3 ch2ch2ch2ch3 ch3 137 6-f cf3 ch2ch2ch3 ch3 138 6-f cf3 CH2CH2-tBu ch3 139 6-f cf3 C=C-iPr ch2ch3 140 6-f cf3 CsC-Pr ch2ch3 141 6-f cf3 CsC-Bu ch2ch3 142 6-f cf3 CsC-iBu ch2ch3 143 6-f cf3 CsC-tBu ch2ch3 144 6-f cf3 CsC-Et ch2ch3 145 6-f cf3 CsC-Me ch2ch3 146 6-f cf3 CH2cSc-ch3 ch2ch3 147 6-f cf3 ch2c=c-ch2ch3 ch2ch3 148 6-f cf3 ch2ch2ch (ch3) 2 ch2ch3 149 6-f cf3 ch2ch2ch2ch3 ch2ch3 150 6-f cf3 ch2ch2ch3 ch2ch3 151 6-f cf3 CH2CH2-tBu ch2ch3 152 5-Cl cf3 CsC-iPr H 153 5-Cl cf3 CsC-Pr h 154 5-Cl cf3 CsC-Bu h 155 5-Cl cf3 CsC-iBu h 156 5-Cl cf3 CsC-tBu h 157 5-Cl cf3 C=C-Et h 158 5-Cl cf3 CsC-Me h 159 5-Cl cf3 CH2csc-ch3 h 160 5-Cl cf3 ch2cSc-CH2ch3 h 161 5-Cl cf3 ch2ch2ch2ch2ch3 h 162 5-Cl cf3 ch2ch2ch (ch3) 2 h 163 5-Cl cf3 ch2ch2ch2ch3 H 164 5-Cl cf3 ch2ch2ch3 H 106 Printed from Mimosa 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 PCT/US98/06733 5-Cl CF3 ch2ch2-tBu H 5-Cl cf3 CsC-iPr ch3 5-Cl cf3 CsC-Pr ch3 5-Cl cf3 CsC-Bu ch3 5-Cl cf3 CsC-iBu ch3 5-Cl cf3 CsC-tBu ch3 5-Cl cf3 CsC-Et ch3 5-Cl cf3 CsC-Me ch3 5-Cl cf3 CH2CsC-CH3 ch3 5-Cl cf3 CH2CsC-CH2CH3 ch3 5-Cl cf3 ch2ch2ch (ch3) 2 ch3 5-Cl cf3 CH2CH2CH2CH3 ch3 5-Cl cf3 ch2ch2ch3 ch3 5-Cl cf3 CH2CH2-tBu ch3 5-Cl cf3 CsC-iPr ch2ch3 5-Cl cf3 CsC-Pr ch2ch3 5-Cl cf3 CsC-Bu ch2ch3 5-Cl cf3 CsC-iBu ch2ch3 5-Cl cf3 CsC-tBu ch2ch3 5-Cl cf3 CsC-Et ch2ch3 5-Cl cf3 CsC-Me ch2ch3 5-Cl cf3 ch2c=c-ch3 ch2ch3 5-Cl cf3 CH2csc-ch2ch3 ch2ch3 5-Cl cf3 ch2ch2ch(ch3)2 ch2ch3 5-Cl cf3 ch2ch2ch2ch3 ch2ch3 5-Cl cf3 ch2ch2ch3 CH2CH3 5-Cl cf3 CH2CH2-tBu ch2ch3 5-F cf3 CsC-iPr H 5-F cf3 CsC-Pr h 5-F cf3 CsC-Bu h 5-F cf3 CsC-iBu h 5-F cf3 CsC-tBu H 5-f cf3 CsC-Et H 5-F cf3 CsC-Me 107 H Printed from Mimosa WO 98/45276 PCT/US98/06733 199 5-f cf3 200 5-f cf3 201 5-f cf3 202 5-f cf3 203 5-f cf3 204 5-f cf3 205 5-f cf3 206 5-f cf3 207 5-f cf3 208 5-f cf3 209 5-f cf3 210 5-f cf3 211 5-f cf3 212 5-f cf3 213 5-f cf3 214 5-f cf3 215 5-f cf3 216 5-f cf3 217 5-f cf3 218 5-f cf3 219 5-f cf3 220 5-f cf3 221 5-f cf3 222 5-f cf3 223 5-f cf3 224 5-f cf3 225 5-f cf3 226 5-f cf3 227 5-f cf3 228 5-f cf3 229 5-f cf3 230 5-f cf3 231 5-f cf3 232 5-Cl,6-f cf3 CH2CsC-CH3 H CH2CsC-CH2CH3 H CH2CH2CH2CH2CH3 h CH2CH2CH (CH3) 2 H CH2ch2ch2CH3 H ch2ch2ch3 H CH2CH2"tBu H CsC-iPr ch3 CsC-Pr ch3 CHC-Bu ch3 CsC-iBu ch3 CsC-tBu ch3 CsC-Et ch3 CsC-Me ch3 CH2CsC-CH3 ch3 CH2CsC-CH2CH3 ch3 CH2CH2CH(CH3)2 ch3 ch2ch2ch2ch3 ch3 CH2CH2CH3 ch3 ch2ch2-tBu ch3 CsC-iPr ch2ch3 C=C-Pr ch2ch3 CsC-Bu ch2ch3 CsC-iBu ch2ch3 CsC-tBu ch2ch3 CsC-Et ch2ch3 CsC-Me ch2ch3 CH2CsC-CH3 ch2ch3 CH2CsC-CH2CH3 ch2ch3 CH2CH2CH(CH3)2 ch2ch3 ch2ch2ch2ch3 ch2ch3 ch2ch2ch3 ch2ch3 CH2CH2-tBu ch2ch3 CsC-iPr h 108 Printed from Mimosa WO 98/45276 233 5-Cl,6-f cf3 C=C-Pr H 234 5-Cl,6-f cf3 CsC-Bu H 235 5-Cl,6-f cf3 C=C-iBu H 236 5-Cl,6-f cf3 C=C-tBu H 237 5-Cl,6-f cf3 CsC-Et H 238 5-Cl,6-f cf3 CsC-Me H 239 5-Cl,6-f cf3 CH2CsC-CH3 H 240 5-Cl,6-f cf3 ch2csc-ch2ch3 H 241 5-Cl,6-f cf3 CH2CH2CH (CH3) 2 H 242 5-Cl,6-f cf3 ch2ch2ch2ch3 H 243 5-Cl,6-f cf3 CH2CH2CH3 H 244 5-Cl,6-f cf3 CH2ch2-tBu H 245 5-Cl,6-f cf3 CsC-iPr ch3 246 5-Cl,6-f cf3 CsC-Pr ch3 247 5-Cl,6-f cf3 CsC-Bu ch3 248 5-Cl,6-f cf3 CsC-iBu ch3 249 5-Cl,6-f cf3 CsC-tBu ch3 250 5-Cl,6-f cf3 CsC-Et ch3 251 5-Cl,6-f cf3 CsC-Me ch3 252 5-Cl,6-f cf3 CH2CsC-CH3 ch3 253 5-Cl,6-f cf3 CH2CsC-CH2CH3 ch3 254 5-Cl,6-f cf3 CH2CH2CH (CH3 ) 2 ch3 255 5-Cl,6-f cf3 ch2ch2ch2ch3 ch3 256 5-Cl,6-f cf3 ch2ch2ch3 ch3 257 5-Cl,6-f cf3 CH2CH2-tBu ch3 258 6-Cl,8-F cf3 CsC-iPr H 259 6-Cl,8-F cf3 CsC-Pr H 260 6-Cl,8-F cf3 CsC-Bu H 261 6-Cl,8-F cf3 CsC-iBu H 262 6-Cl,8-F cf3 CsC-tBu H 263 6-Cl,8-F cf3 CsC-Et H 264 6-Cl,8-F cf3 CsC-Me H 265 6-Cl,8-F cf3 CH2CsC-CH3 H 266 6-Cl,8-F cf3 ch2csc-ch2ch3 H 109 Printed from Mimosa WO 98/45276 267 6- ■Cl, 8-F 268 6- 0 H 00 1 269 6- •Cl, 8-F 270 6- ■Cl, 8-F 271 6- -Cl, 8-F 272 6- -Cl, 8-F 273 6- -Cl,8-F 274 6- -Cl,8-F 275 6- -Cl,8-F 276 6- -Cl,8-F 277 6- -Cl,8-F 278 6- -Cl,8-F 279 6 CO H a 280 6 -Cl,8-F 281 6 -Cl,8-F 282 6 -Cl,8-F 283 6 -Cl,8-F 284 6-CH3 285 6-CH3 286 6-ch3 287 6-CH3 288 6-CH3 289 6-CH3 290 6-ch3 291 6-CH3 292 6-ch3 293 6-CH3 294 6-ch3 295 6-CH3 296 6-CH3 297 6-CH3 298 6-ch3 299 6-CH3 300 6-CH3 cf3 ch2ch2ch(ch3>2 h cf3 ch2ch2ch2ch3 h cf3 ch2ch2ch3 h CF3 CH2CH2-tBU H CF3 CsC-iPr CH3 CF3 CsC-Pr CH3 CF3 C=C-Bu ch3 CF3 CsC-iBu CH3 cf3 CsC-tBu CH3 CF3 CsC-Et CH3 CF3 csC-Me CH3 CF3 CH2CsC-CH3 CH3 CF3 CH2CsC-CH2CH3 CH3 cf3 ch2ch2ch (ch3) 2 ch3 cf3 ch2ch2ch2ch3 ch3 cf3 ch2ch2ch3 ch3 CF3 CH2CH2-tBu CH3 cf3 CsC-iPr h cf3 CsC-Pr h cf3 CsC—Bu h cf3 CsC-iBu h cf3 CsC-tBu H CF3 CsC-Et H cf3 CsC-Me H cf3 CH2CsC-CH3 H cf3 CH2CsC-CH2CH3 h cf3 CH2CH2CH (CH3) 2 h cf3 ch2ch2ch2ch3 h cf3 ch2ch2ch3 h cf3 CH2CH2-tBu H cf3 CsC-iPr ch3 cf3 CsC-Pr ch3 cf3 CsC-Bu ch3 cf3 CsC-iBu ch3 110 Printed from Mimosa WO 98/45276 PCT/US98/06733 301 6-ch3 cf3 CsC-tBu ch3 3 02 6-ch3 cf3 CsC-Et ch3 303 6-ch3 cf3 CsC-Me ch3 304 6-ch3 cf3 ch2csc-ch3 ch3 3 05 6-ch3 cf3 ch2csc-CH2ch3 ch3 306 6-ch3 cf3 ch2ch2ch (ch3) 2 ch3 307 6-ch3 cf3 ch2ch2ch2ch3 ch3 308 6-CH3 cf3 ch2ch2ch3 ch3 309 6-ch3 cf3 CH2CH2-tBu ch3 310 6-COCH3 cf3 CsC-iPr H 311 6-coch3 cf3 CsC-Pr H 312 6-coch3 cf3 CsC-Bu H 313 6-coch3 cf3 CsC-iBu H 314 6-COCH3 cf3 CsC-tBu H 315 6-coch3 cf3 CsC-Et H 316 6-COCH3 cf3 CsC-Me H 317 6-nh2 cf3 CsC-iPr H 318 6-NH2 cf3 Csc-Pr H 319 6-nh2 cf3 CsC-Bu H 320 6-nh2 cf3 CsC-iBu H 321 6-NH2 cf3 CsC-tBu H 322 6-NH2 cf3 CsC-Et H 323 6-NH2 cf3 CsC-Me H 324 6-NMe2 cf3 CsC-iPr H 325 6-NMe2 cf3 CsC-Pr H 326 6-NMe2 cf3 CsC-Bu H 327 6-NMe2 cf3 CsC-iBu H 328 6-NMe2 cf3 CsC-tBu H 329 6-NMe2 cf3 CsC-Et H 330 6-NMe2 cf3 CsC-Me H 331 7-Cl cf3 CsC-iPr H 332 7-Cl cf3 CsC-Pr H 333 7-Cl cf3 CsC-Bu H 334 7-Cl cf3 CsC-iBu H 111 Printed from Mimosa WO 98/45276 PCT/US98/06733 335 7-Cl cf3 C=C-tBu H 336 7-Cl cf3 CsC-Et H 337 7-Cl cf3 CsC-Me H *Unless otherwise indicated, stereochemisty is (+/-). 112 Printed from Mimosa WO 98/45276 PCT/US98/06733 Utility The compounds of this invention possess reverse transcriptase inhibitory activity, m particular, HIV inhibitory efficacy. The compounds of formula (I) possess 5 HIV reverse transcriptase inhibitory activity and are therefore useful as antiviral agents for the treatment of HIV infection and associated diseases. The compounds of formula (I) possess HIV reverse transcriptase inhibitory activity and are effective as inhibitors of HIV growth. The ability of 10 the compounds of the present invention to inhibit viral growth or infectivity is demonstrated in standard assay of viral growth or infectivity, for example, using the assay described below. The compounds of formula (I) of the present invention 15 are also useful for the inhibition of HIV in an ex vivo sample containing HIV or expected to be exposed to HIV. Thus, the compounds of the present invention may be used to inhibit HIV present in a body fluid sample (for example, a serum or semen sample) which contains or is suspected to 20 contain or be exposed to HIV. The compounds provided by this invention are also useful as standard or reference compounds for use in tests or assays for determining the ability of an agent to inhibit viral clone replication and/or HIV reverse transcriptase, for 25 example in a pharmaceutical research program. Thus, the compounds of the present invention may be used as a control or reference compound in such assays and as a quality control standard. The compounds of the present invention may be provided in a commercial kit or container for use as such 30 standard or reference compound. Since the compounds of the present invention exhibit specificity for HIV reverse transcriptase, the compounds of the present invention may also be useful as diagnostic reagents in diagnostic assays for the detection of HIV 35 reverse transcriptase. Thus, inhibition of the reverse transcriptase activity in an assay (such as the assays described herein) by a compound of the present invention 113 Printed from Mimosa WO 98/45276 PCT/US98/06733 would be indicative of the presence of HIV reverse transcriptase and HIV virus. As used herein "p.g" denotes microgram, "mg" denotes milligram, "g" denotes gram, "|iL" denotes microliter, "mL" 5 denotes milliliter, "L" denotes liter, "nM" denotes nanomolar, "|XM" denotes micromolar, "mM" denotes millimolar, "M" denotes molar and "nm" denotes nanometer. "Sigma" stands for the Sigma-Aldrich Corp. of St. Louis, MO. 10 HIV RNA Assay DNA Plasmids and in vitro RNA transcripts; Plasmid pDAB 72 containing both gag and pol sequences of BH10 (bp 113-1816) cloned into PTZ 19R was prepared according 15 to Erickson-Viitanen et al. AIDS Research and Human Retroviruses 1989, 5, 577. The plasmid was linearized with Bam HI prior to the generation of in vitro RNA trcinscripts using the Riboprobe Gemini system II kit (Promega) with T7 RNA polymerase. Synthesized RNA was purified by treatment 20 with RNase free DNAse (Promega), phenol-chloroform extraction, and ethanol precipitation. RNA transcripts were dissolved in water, and stored at -70°C. The concentration of RNA was determined from the A260- 25 Probes: Biotinylated capture probes were purified by HPLC after synthesis on an Applied Biosystems (Foster City, CA) DNA synthesizer by addition of biotin to the 5' terminal end of the oligonucleotide, using the biotin-phosphoramidite reagent 30 of Cocuzza, Tet. Lett. 1989, 30, 6287. The gag biotinylated capture probe (5-biotin-CTAGCTCCCTGCTTGCCCATACTA 3 ') was complementary to nucleotides 889-912 of HXB2 and the pol biotinylated capture probe (5'-biotin -CCCTATCATTTTTGGTTTCCAT 3* ) was complementary to nucleotides 2374-2395 of HXB2. 35 Alkaline phosphatase conjugated oligonucleotides used as reporter probes were prepared by Syngene (San Diego, CA.) . The pol reporter probe (5' CTGTCTTACTTTGATAAAACCTC 3') was complementary to nucleotides 2403-2425 of HXB2. The gag 114 Printed from Mimosa WO 98/45276 PCT/US98/06733 reporter probe (5' CCCAGTATTTGTCTACAGCCTTCT 3') was complementary to nucleotides 950-973 of HXB2. All nucleotide positions are those of the GenBank Genetic Sequence Data Bank as accessed through the Genetics Computer Group Sequence 5 Analysis Software Package (Devereau Nucleic Acids Research 1984, 12, 387). The reporter probes were prepared as 0.5 |4M stocks in 2 x SSC (0.3 M NaCl, 0.03 M sodium citrate), 0.05 M Tris pH 8.8, 1 mg/mL BSA. The biotinylated capture probes were prepared as 100 |iM stocks in water. 10 Streptavidin coated plates; Streptavidin coated plates were obtained from Du Pont Biotechnology Systems (Boston, MA). 15 Cells and virus stocks; MT-2 and MT-4 cells were maintained in RPMI 1640 supplemented with 5% fetal calf serum (FCS) for MT-2 cells or 10% FCS for MT-4 cells, 2 mM L-glutamine and 50 jig/mL gentamycin, all from Gibco. HIV-1 RF was propagated in MT-4 20 cells in the same medium. Virus stocks were prepared approximately 10 days after acute infection of MT-4 cells and stored as aliquots at -70°C. Infectious titers of HIV-1(RF) stocks were 1-3 x 107 PFU (plaque forming units)/mL as measured by plaque assay on MT-2 cells (see below). Each 25 aliquot of virus stock used for infection was thawed only once. For evaluation of antiviral efficacy, cells to be infected were subcultured one day prior to infection. On the day of infection, cells were resuspended at 5 x 10^ cells/mL 30 in RPMI 1640, 5% FCS for bulk infections or at 2 x lO^/ml in Dulbecco's modified Eagles medium with 5% FCS for infection in microtiter plates. Virus was added and culture continued for 3 days at 37°C. 35 HIV RNA assay. Cell lysates or purified RNA in 3 M or 5 M GED were mixed with 5 M GED and capture probe to a final guanidinium isothiocyanate concentration of 3 M and a final biotin 115 Printed from Mimosa WO 98/45276 PCT/US98/06733 oligonucleotide concentration of 30 nM. Hybridization was carried out in sealed U bottom 96 well tissue culture plates (Nunc or Costar) for 16-20 hours at 37°C. RNA hybridization reactions were diluted three-fold with deionized water to a final guanidinium isothiocyanate concentration of 1 M and aliquots (150 jiL) were transferred to streptavidin coated microtiter plates wells. Binding of capture probe and capture probe-RNA hybrid to the immobilized streptavidin was allowed to proceed for 2 hours at room temperature, after which the plates were washed 6 times with DuPont ELISA plate wash buffer (phosphate buffered saline(PBS), 0.05% Tween 20.) A second hybridization of reporter probe to the immobilized complex of capture probe and hybridized target RNA was carried out in the washed streptavidin coated well by addition of 120 |il of a hybridization cocktail containing 4 X SSC, 0.66% Triton X 100, 6.66% deionized formamide, 1 mg/mL BSA and 5 nM reporter probe. After hybridization for one hour at 37°C, the plate was again washed 6 times. Immobilized alkaline phosphatase activity was detected by addition of 100 px, of 0.2 mM 4-methylumbelliferyl phosphate (MUBP, JBL Scientific) in bufferS (2.5 M diethanolamine pH 8.9 (JBL Scientific), 10 mM MgCl2/ 5 mM zinc acetate dihydrate and 5 mM N-hydroxyethyl-ethylene-diamine-triacetic acid). The plates were incubated at 37°C. Fluorescence at 450 nM was measured using a microplate fluorometer (Dynateck) exciting at 365 nM. Microplate based compound evaluation in HIV-1 infected MT-2 cells; Compounds to be evaluated were dissolved in DMSO and diluted in culture medium to twice the highest concentration to be tested and a maximum DMSO concentration of 2%. Further r three-fold serial dilutions of the compound in culture medium were performed directly in U bottom microtiter plates (Nunc). After compound dilution, MT-2 cells (50 jiL) were added to a final concentration of 5 x 10^ per mL (1 x 10^ per well). Cells were incubated with compounds for 30 minutes at 37°C in a C02 incubator. For evaluation of antiviral potency, an 116 Printed from Mimosa WO 98/45276 PCT/US98/06733 appropriate dilution of HIV-1 (RF) virus stock. (50 |IL) was added to culture wells containing cells and dilutions of the test compounds. The final volume in each well was 200 |IL. Eight wells per plate were left uninfected with 50 |iL of 5 medium added in place of virus, while eight wells were infected in the absence of any antiviral compound. For evaluation of compound toxicity, parallel plates were cultured without virus infection. After 3 days of culture at 37°C in a humidified chamber 10 inside a C02 incubator, all but 25 |IL of medium/well was removed from the HIV infected plates. Thirty seven |IL of 5 M GED containing biotinylated capture probe was added to the settled cells and remaining medium in each well to a final concentration of 3 M GED and 3 0 nM capture probe. 15 Hybridization of the capture probe to HIV RNA in the cell lysate was carried out in the same microplate well used for virus culture by sealing the plate with a plate sealer (Costar), and incubating for 16-20 hrs in a 37°C incubator. Distilled water was then added to each well to dilute the 20 hybridization reaction three-fold and 150 |Hi of this diluted mixture was transferred to a streptavidin coated microtiter plate. HIV RNA was quantitated as described above. A standard curve, prepared by adding known amounts of pDAB 72 in vitro RNA transcript to wells containing lysed uninfected 25 cells, was run on each microtiter plate in order to determine the amount of viral RNA made during the infection. In order to standardize the virus inoculum used in the evaluation of compounds for antiviral activity, dilutions of virus were selected which resulted in an ic90 value 30 (concentration of compound required to reduce the HIV RNA level by 90%) for dideoxycytidine (ddC) of 0.2 |J.g/mL. ic90 values of other antiviral compounds, both more and less potent than ddC, were reproducible using several stocks of HIV-1 (RF) when this procedure was followed. This 35 concentration of virus corresponded to ~3 x 10^ pfu (measured by plaque assay on MT-2 cells) per assay well and typically produced approximately 75% of the maximum viral RNA level achievable at any virus inoculum. For the HIV RNA assay, 117 Printed from Mimosa WO 98/45276 PCT/US98/06733 ic90 values were determined from the percent reduction of net signal (signal from infected cell samples minus signal from uninfected cell samples) in the RNA assay relative to the net signal from infected, untreated cells on the same culture 5 plate (average of eight wells). Valid performance of individual infection and RNA assay tests was judged according to three criteria. It was required that the virus infection should result in an RNA assay signal equal to or greater than the signal generated from 2 ng of pDAB 72 in vitro RNA 10 transcript. The ic90 for ddC, determined in each assay run, should be between 0.1 and 0.3 jlg/mL. Finally, the plateau level of viral RNA produced by an effective reverse transcriptase inhibitor should be less than 10% of the level achieved in an uninhibited infection. A compound was 15 considered active if its IC90 was found to be less than 20jiM. For antiviral potency tests, all manipulations in microtiter plates, following the initial addition of 2X concentrated compound solution to a single row of wells, were performed using a Perkin Elmer/Cetus ProPette. 20 Protein Binding and Mutant Resistance In order to characterize NNRTI analogs for their clinical efficacy potential the effect of plasma proteins on antiviral potency and measurements of antiviral potency 25 against wild type and mutant variants of HIV which carry amino acid changes in the known binding site for NNRTIs were examined. The rationale for this testing strategy is two fold: 1. Many drugs are extensively bound to plasma proteins. 30 Although the binding affinity for most drugs for the major components of human plasma, namely, human serum albumin (HSA) or alpha-l-acid glycoprotein (AAG), is low, these major components are present in high concentration in the blood. Only free or unbound drug is available to cross the infected 35 cell membrane for interaction with the target site (i.e., HIV-1 reverse transcriptase, HIV-1 RT) . Therefore, the effect of added HSA+AAG on the antiviral potency in tissue culture more closely reflects the potency of a given compound 118 Printed from Mimosa WO 98/45276 PCT/US98/06733 m the clinical setting. The concentration of compound required for 90% inhibition of virus replication as measured in a sensitive viral RNA-based detection method is designated the IC90. The fold increase in apparent IC90 for test 5 compounds in the presence or added levels of HSA and AAG that reflect in vivo concentrations (45 mg/ml HSA, 1 mg/ml AAG) was then calculated. The lower the fold increase, the more compound will be available to interact with the target site. 2. The combination of the high rate of virus 10 replication in the infected individual and the poor fidelity of the viral RT results in the production of a quasi-species or mixtures of HIV species in the infected individual. These species will include a majority wild type species, but also mutant variants of HIV and the proportion of a given mutant 15 will reflect its relative fitness and replication rate. Because mutant variants including mutants with changes in the amino acid sequence of the viral RT likely pre-exist in the infected individual's quasi-species, the overall potency observed in the clinical setting will reflect the ability of 20 a drug to inhibit not only wild type HIV-1, but mutant variants as well. We thus have constructed, in a known genetic background, mutant variants of HIV-1 which carry amino acid substitutions at positions thought to be involved in NNRTI binding, and measured the ability of test compounds 25 to inhibit replication of these mutant viruses. The concentration of compound required for 90% inhibition of virus replication as measured in a sensitive viral RNA-based detection method is designated the IC90. It is desirable to have a compound which has high activity against a variety of 30 mutants. Dosage and Formulation The antiviral compounds of this invention can be administered as treatment for viral infections by any means 35 that produces contact of the active agent with the agent's site of action, i.e., the viral reverse transcriptase, in the body of a mammal. They can be administered by any conventional means available for use in conjunction with 119 Printed from Mimosa WO 98/45276 PCT/US98/06733 pharmaceuticals, either as individual therapeutic agents or in a combination of therapeutic agents. They can be administered alone, but preferably are administered with a pharmaceutical carrier selected on the basis of the chosen 5 route of administration and standard pharmaceutical practice. The dosage administered will, of course, vary depending upon known factors, such as the pharmacodynamic characteristics of the particular agent and its mode and route of administration; the age, health and weight of the 10 recipient; the nature and extent of the symptoms; the kind of concurrent treatment; the frequency of treatment; and the effect desired. A daily dosage of active ingredient can be expected to be about 0.001 to about 1000 milligrams per kilogram of body weight, with the preferred dose being about 15 0.1 to about 30 mg/kg. Dosage forms of compositions suitable for administration contain from about 1 mg to about 100 mg of active ingredient per unit. In these pharmaceutical compositions the active ingredient will ordinarily be present in an amount of about 20 0.5-95% by weight based on the total weight of the composition. The active ingredient can be administered orally in solid dosage forms, such as capsules, tablets and powders, or in liquid dosage forms, such as elixirs, syrups and suspensions. It can also be administered parenterally, 25 in sterile liquid dosage forms. Gelatin capsules contain the active ingredient and powdered carriers, such as lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like. Similar diluents can be used to make compressed tablets. 30 Both tablets and capsules can be manufactured as sustained release products to provide for continuous release of medication over a period of hours. Compressed tablets can be sugar coated or film coated to mask any unpleasant taste and protect the tablet from the atmosphere, or enteric coated for 35 selective disintegration in the gastrointestinal tract. Liquid dosage forms for oral administration can contain coloring and flavoring to increase patient acceptance. 120 Printed from Mimosa WO 98/45276 PCT/US98/06733 In general, water, a suitable oil, saline, aqueous dextrose (glucose), and related sugar solutions and glycols such as propylene glycol or polyethylene glycols are suitable carriers for parenteral solutions. Solutions for parenteral 5 administration preferably contain a water soluble salt of the active ingredient, suitable stabilizing agents, and if necessary, buffer substances. Antioxidizing agents such as sodium bisulfite, sodium sulfite, or ascorbic acid, either alone or combined, are suitable stabilizing agents. Also 10 used are citric acid and its salts, and sodium EDTA. In addition, parenteral solutions can contain preservatives, such as benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol. Suitable pharmaceutical carriers are described in Remington's Pharmaceutical Sciences, supra, a 15 standard reference text an this field. Useful pharmaceutical dosage-forms for administration of the compounds of this invention can be illustrated as follows: 20 Capsules A large number of unit capsules can be prepared by filling standard two-piece hard gelatin capsules each with 100 mg of powdered active ingredient, 150 mg of lactose, 50 mg of cellulose, and 6 mg magnesium stearic. 25 Soft Gelatin Capsules A mixture of active ingredient in a digestible oil such as soybean oil, cottonseed oil or olive oil can be prepared and injected by means of a positive displacement pump into 30 gelatin to form soft gelatin capsules containing 100 mg of the active ingredient. The capsules should then be washed and dried. Tablets 35 A large number of tablets can be prepared by conventional procedures so that the dosage unit is 100 mg of active ingredient, 0.2 mg of colloidal silicon dioxide, 5 milligrams of magnesium stearate, 275 mg of microcrystalline 121 Printed from Mimosa WO 98/45276 PCT/US98/06733 cellulose, 11 mg of starch and 98.8 mg of lactose. Appropriate coatings may be applied to increase palatability or delay absorption. 5 Suspension An aqueous suspension can be prepared for oral administration so that each 5 mL contain 25 mg of finely divided active ingredient, 200 mg of sodium carboxymethyl cellulose, 5 mg of sodium benzoate, 1.0 g of sorbitol 10 solution, U.S.P., and 0.025 mg of vanillin. Injectable A parenteral composition suitable for administration by injection can be prepared by stirring 1.5% by weight of 15 active ingredient in 10% by volume propylene glycol and water. The solution is sterilized by commonly used techniques. Combination of components (a) and (b) 20 Each therapeutic agent component of this invention can independently be in any dosage form, such as those described above, and can also be administered in various ways, as described above. In the following description component (b) is to be understood to represent one or more agents as 25 described previously. Thus, if components (a) and (b) are to be treated the same or independently, each agent of component (b) may also be treated the same or independently. Components (a) and (b) of the present invention may be formulated together, in a single dosage unit (that is, 30 combined together in one capsule, tablet, powder, or liquid, etc.) as a combination product. When component (a) and (b) are not formulated together in a single dosage unit, the component (a) may be administered at the same time as component (b) or in any order; for example component (a) of 35 this invention may be administered first, followed by administration of component (b), or they may be administered in the revserse order. If component (b) contains more that one agent, e.g., one RT inhibitor and one protease inhibitor, 122 Printed from Mimosa WO 98/45276 PCT/US98/06733 these agents may be administered together or in any order. When not administered at the same time, preferably the administration of component (a) and (b) occurs less than about one hour apart. Preferably, the route of 5 administration of component (a) and (b) is oral. The terms oral agent, oral inhibitor, oral compound, or the like, as used herein, denote compounds which may be orally administered. Although it is preferable that component (a) and component (b) both be administered by the same route 10 (that is, for example, both orally) or dosage form, if desired, they may each be administered by different routes (that is, for example, one component of the combination product may be administered orally, and another component may be administered intravenously) or dosage forms. 15 As is appreciated by a medical practitioner skilled in the art, the dosage of the combination therapy of the invention may vary depending upon various factors such as the pharmacodynamic characteristics of the particular agent and its mode and route of administration, the age, health and 20 weight of the recipient, the nature and extent of the symptoms, the kind of concurrent treatment, the frequency of treatment, and the effect desired, as described above. The proper dosage of components (a) and (b) of the present invention will be readily ascertainable by a medical 25 practitioner skilled in the art, based upon the present disclosure. By way of general guidance, typically a daily dosage may be about 100 milligrams to about 1.5 grams of each component, if component (b) represents more than one compound, then typically a daily dosage may be about 100 30 milligrams to about 1.5 grams of each agent of component (b). By way of general guidance, when the compounds of component (a) and component (b) are administered in combination, the dosage amount of each component may be reduced by about 70-80% relative to the usual dosage of the component when it is 35 administered alone as a single agent for the treatment of HIV infection, in view of the synergistic effect of the combination. 123 Printed from Mimosa WO 98/45276 PCT/US98/06733 The combination products of this invention may be formulated such that, although the active ingredients are combined in a single dosage unit, the physical contact between the active ingredients is minimized. In order to 5 minimize contact, for example, where the product is orally administered, one active ingredient may be enteric coated. By enteric coating one of the active ingredients, it is possible not only to minimize the contact between the combined active ingredients, but also, it is possible to 10 control the release of one of these components in the gastrointestinal tract such that one of these components is not released in the stomach but rather is released in the intestines. Another embodiment of this invention where oral administration is desired provides for a combination product 15 wherein one of the active ingredients is coated with a sustained-release material which effects a sustained-release throughout the gastrointestinal tract and also serves to minimize physical contact between the combined active ingredients. Furthermore, the sustained-released component 20 can be additionally enteric coated such that the release of this component occurs only in the intestine. Still another approach would involve the formulation of a combination product in which the one component is coated with a sustained and/or enteric release polymer, and the other component is 25 also coated with a polymer such as a lowviscosity grade of hydroxypropyl methylcellulose or other appropriate materials as known in the art, in order to further separate the active components. The polymer coating serves to form an additional barrier to interaction with the other component. In each 30 formulation wherein contact is prevented between components (a) and (b) via a coating or some other material, contact may also be prevented between the individual agents of component (b) . Dosage forms of the combination products of the present 35 invention wherein one active ingredient is enteric coated can be in the form of tablets such that the enteric coated component and the other active ingredient are blended together and then compressed into a tablet or such that the 124 Printed from Mimosa WO 98/45276 PCT/US98/06733 enteric coated component is compressed into one tablet layer and the other active ingredient is compressed into an additional layer. Optionally, in order to further separate the two layers, one or more placebo layers may be present 5 such that the placebo layer is between the layers of active ingredients. In addition, dosage forms of the present invention can be in the form of capsules wherein one active ingredient is compressed into a tablet or in the form of a plurality of microtablets, particles, granules or non-perils, 10 which are then enteric coated. These enteric coated microtablets, particles, granules or non-perils are then placed into a capsule or compressed into a capsule along with a granulation of the other active ingredient. These as well as other ways of minimizing contact 15 between the components of combination products of the present invention, whether administered in a single dosage form or administered in separate forms but at the same time or concurrently by the same manner, will be readily apparent to those skilled in the art, based on the present disclosure. 20 Pharmaceutical kits useful for the treatment of HIV infection, which comprise a therapeutically effective amount of a pharmaceutical composition comprising a compound of component (a) and one or more compounds of component (b) , in one or more sterile containers, are also within the ambit of 25 the present invention. Sterilization of the container may be carried out using conventional sterilization methodology well known to those skilled in the art. Component (a) and component (b) may be in the same sterile container or in separate sterile containers. The sterile containers of 30 materials may comprise separate containers, or one or more multi-part containers, as desired. Component (a) and component (b), may be separate, or physically combined into a single dosage form or unit as described above. Such kits may further include, if desired, one or more of various 35 conventional pharmaceutical kit components, such as for example, one or more pharmaceutically acceptable carriers, additional vials for mixing the components, etc., as will be readily apparent to those skilled in the art. Instructions, 125 Printed from Mimosa * 359 5 either as inserts or as labels, indicating quantities of the components to be administered, guidelines for administration, and/or guidelines for mixing the components, may also be included in the kit. Obviously, numerous modifications and variations of the present invention are possible in light of the above teachings. It is therefore to be understood that within the scope of the appended claims, the invention may be practiced otherwise than as specifically described herein. Where the terms "comprise", "comprises", "comprised" or "comprising" are used in this specification, they are to be interpreted as specifying the presence of the stated features, integers, steps or components referred to, but not to preclude the presence or addition of one or more other feature, integer, step, component or group thereof. 126 </div>

Claims

<div class="application article clearfix printTableText" id="claims"> WO 98/45276 PCT/US98/06733 WHAT 13 CLAIMED AS MEW AND DESIRED TO BE SECURED BY LETTER PATENT OP UNITED STATES IS;

1. A compound of formula (I): or a stereoisomer or pharmaceutically acceptable salt thereof, wherein: 10 R1 is Ci_3 alkyl substituted with 1-7 halogen; R2 is selected from C1-5 alkyl substituted with 1-2 R4, c2-5 alkenyl substituted with 1-2 R4, and c2-5 alkynyl 15 substituted with 1 R4; R3, at each occurrence, is independently selected from Ci_4 alkyl, OH, C1-4 alkoxy, F, Cl, Br, I, NR5R5a, N02, CN, C(0)R6, NHC (O)R7, and NHC (0)NR5R5a; 20 alternatively, if two R3's are present and are attached to adjacent carbons, then they may combine to form -och2o-; R4 is selected from c3-5 cycloalkyl substituted with 0-2 R3, 25 phenyl substituted with 0-5 R3, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from O, N, and S, substituted with 0-2 R3; R5 and R5a are independently selected from H and C1-3 alkyl; 30 R6 is selected from H, OH, Ci_4 alkyl, C1-4 alkoxy, and NR5R5a; R7 is selected from C1-3 alkyl and C1-3 alkoxy; 35 R8 is selected from H, 03-5 cycloalkyl, and Ci_3 alkyl; and, 127 Printed from Mimosa WO 98/45276 PCT/US98/06733 n is selected from 0, 1, 2, 3, and 4. 5 2. A compound according to Claim 1, wherein: R1 is Ci_3 alkyl substituted with 1-7 halogen; R2 is selected from Ci_s alkyl substituted with 1 R4, C2-5 10 alkenyl substituted with 1 R4, and c2-5 alkynyl substituted with 1 R4; R3, at each occurrence, is independently selected from C1-4 alkyl, OH, Ci_4 alkoxy, F, Cl, Br, I, NR5R5a, N02, CN, 15 C(0)R6, NHC(O)R7, and NHC(O)NR^R5a; alternatively, if two R3's are present and are attached to adjacent carbons, then they may combine to form -0CH20-; 20 R4 is selected from C3_s cycloalkyl substituted with 0-2 R3, phenyl substituted with 0-

2 R3, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from O, N, and S, substituted with 0-1 R3; 25 R5 and RSa are independently selected from H, ch3 and c2h5; R5 is selected from H, OH, CH3, c2h5, och3, OC2H5, and NR5R5a; R7 is selected from CH3, c2h5, och3, and oc2h5; 30 R8 is selected from H, cyclopropyl, CH3 and C2H5; and, n is selected from 0, 1, 2, and 3. 35

3. A compound according to Claim 2, wherein: R1 is selected from cf3, and c2f5; 128 Printed from Mimosa WO 98/45276 PCT/US98/06733 R2 is selected from C1-3 alkyl substituted with 1 R4, c2-3 alkenyl substituted with 1 R4, and c2-3 alkynyl substituted with 1 R4; 5 R3, at each occurrence, is independently selected from Ci_3 alkyl, OH, C1-3 alkoxy, F, Cl, Br, I, NR5R5a, N02, CN, C(0)R6, NHC(0)R7, and NHC (0)NR5R5a; 10 alternatively, if two R3's are present and are attached to adjacent carbons, then they may combine to form -och2o-; R4 is selected from 03-5 cycloalkyl substituted with 0-2 R3, phenyl substituted with 0-2 R3, and a 5-6 membered 15 heterocyclic system containing 1-3 heteroatoms selected from 0, N, and S, substituted with 0-1 R3; R5 and R5a are independently selected from H, ch3 and c2h5; 20 R6 is selected from H, OH, CH3, c2h5, och3, oc2h5, and NR5R5a; R7 is selected from ch3, c2h5, och3, and oc2h5; R8 is selected from H, ch3 and C2H5; and, 25 n is selected from 0, 1, and 2. 30

4. A compound according to Claim 3, wherein: R1 is CF3; r2 is selected from Ci_3 alkyl substituted with 1 r4, c2-3 alkenyl substituted with 1 R4, and C2-3 alkynyl 35 substituted with 1 R4; 129 Printed from Mimosa ' > " 1 W V „•' / R3, at each occurrence, is independently selected from Ci_3 alkyl, OH, C1-3 alkoxy, F, Cl, NR5R5a, NO2, CN, C(0)R6, NHC (0) R7, and NHC(0)NR5R5a; 5 alternatively, if two R3's are present and are attached to adjacent carbons, then they may combine to form -och2o-; R4 is selected from cyclopropyl substituted with 0-1 R3, phenyl substituted with 0-2 R3, and a 5-6 membered 10 heterocyclic system containing 1-3 heteroatoms selected from O, N, and S, substituted with 0-1 R3, wherein the heterocyclic system is selected from 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-furanyl, 3-furanyl, 2-thienyl, 3-thienyl, 2-oxazolyl, 2-thiazolyl, 4-isoxazolyl, and 2-15 imidazolyl; R5 and R5a are independently selected from H, ch3 and c2h5; r6 is selected from H, OH, CH3, C2H5, och3, oc2h5, and NR5R5a; 20 R7 is selected from ch3, c2h5, och3, and oc2h5; R8 is selected from H, ch3 and c2h5; and, 25 n is selected from 1 and 2.

5. A compound according to Claim 4, wherein the compound is of formula la: K J* V d8 ("•fCCX 30 H la.

6. A compound according to Claim 4, wherein tt INTELLECTUAL PROPERTY 35 compound is of formula lb: office of N.Z. 130 1 2 MAR 2001 received WO 98/45276 PCT/US98/06733 lb. 5

7. A compound according to Claim 1, wherein the compound is selected from: (+/-)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; 10 (+/-)-6-Chloro-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; (+/-)-6-Chloro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro- 15 2(IH)-quinazolinone; (+/-)-4-Cyclopropylethynyl-6-methoxy-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; 20 (+/-)-6-Methoxy-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; (+/-)-6-Methoxy-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; 25 (+/-)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; (+/-)-5,6-Difluoro-4-(2-pyridyl)ethynyl-4-trifluoromethyl- 30 3,4-dihydro-2(IH)-quinazolinone; (+/-)-5,6-Difluoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; 131 Printed from Mimosa WO 98/45276 PCT/US98/06733 (+/-)-4-Cyclopropylethynyl-6-fluoro-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; (+/-)-6-Fluoro-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-5 dihydro-2(IH)-quinazolinone; (+/-)-6-Fluoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; 10 (+/-)-6-Fluoro-4-(2'-2-pyridyl)ethyl-4-trifluoromethyl-3, 4-dihydro-2(IH)-quinazolinone; (+/-)-6-Fluoro-4-phenylethyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; 15 (-)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; (+)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4- 20 dihydro-2(IH)-quinazolinone; (+)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; 25 (-)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; (+)-E-4-Cyclopropylethenyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; and, 30 (-)-6-Chloro-4-E-cyclopropylethenyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; or a pharmaceutically acceptable salt thereof. 35

8. A compound according of formula II: 132 Printed from Mimosa WO 98/45276 PCT/US98/06733 10 IS II or a stereoisomer or pharmaceutically acceptable salt thereof, wherein: R2 is C=C-R4a; R3 is selected from Ci_4 alkyl, OH, Ci-4 alkoxy, F, Cl, Br, I, NR5R5a, NO2, CN, c(0)R5, NHC (O) R7, and NHC (0)NR5R5a; R4a is selected from methyl, ethyl, n-propyl, i-propyl, i-butyl, t-butyl, and i-pentyl; R5 and R5a are independently selected from H and Ci_3 alkyl; R6 is selected from H, OH, Ci_4 alkyl, Ci_4 alkoxy, and NR5R5a; R7 is selected from Ci_3 alkyl and Cx-3 alkoxy; 20 r8 is selected from H, C3_5 cycloalkyl, and Ci_3 alkyl; and, n is selected from 0, 1, 2, 3, and 4. 25

9. A compound according to Claim 8, wherein: R2 is C=C-R4a; R3 is selected from C1-4 alkyl, OH, Ci_4 alkoxy, F, Cl, Br, I, 30 NR5R5a, no2, CN, C(0)Re, and NHC(0)R7; R4a is selected from methyl, ethyl, n-propyl, i-propyl, i-butyl, t-butyl, and i-pentyl; 35 R5 and R5a are independently selected from H, ch3 and c2h5; 133 Printed from Mimosa WO 98/45276 PCT/US98/06733 R6 is selected from H, OH, CH3, C2H5, 0CH3, 0C2H5, and NR5R5a; R7 is selected from CH3, C2H5, 0CH3, and oc2h5 ; 5 R8 is selected from H, cyclopropyl, ch3 and C2H5; and, n is selected from 0, 1, and 2. 10

10. A compound according to Claim 9, wherein the compound is of formula Ila: Ila. 15

11. A compound according to Claim 9, wherein the compound is of formula lib: 20 lib.

12. A compound according to Claim 8, wherein the compound is selected from: 25 (+/-)-6-Chloro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; (+/-)-6-Chloro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-30 2(IH)-quinazolinone; 134 Printed from Mimosa . ( + /-)-4-Isopropylethynyl-6-methoxy-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; (+/-)-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-5 dihydro-2(IH)-quinazolinone; (+/-)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; 10 (+/-)-5,6-Difluoro-4-isopentyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; (+/-)-6-Fluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; 15 (+/-)-6-Fluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; (-)-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4- 20 dihydro-2(IH)-quinazolinone; (+)-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; 25 (-)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; and, (+)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(IH)-quinazolinone; 30 or a pharmaceutically acceptable salt thereof. 35 135 intellectual property office of n.z. 1 2 MAR 2001 received -136-

13 A compound according to claim 7, wherein the compound is chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1 H)-quinazolinone, or a pharmaceutically acceptable salt form thereof 5

14 A compound according to claim 7, wherein the compound is (+/-)-6- chloro-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(1 H)-quinazolinone, or a pharmaceutically acceptable salt form thereof

15 A compound according to claim 7, wherein the compound is (+/-)-6-10 chloro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(1 H)-quinazolinone, or a pharmaceutically acceptable salt form thereof

16 A compound according to claim 7, wherein the compound is (+/-)-4-cyclopropylethynyl-6-methoxy-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone, 15 or a pharmaceutically acceptable salt form thereof

17 A compound according to claim 7, wherein the compound is (+/-)-6-methoxy-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone, or a pharmaceutically acceptable salt form thereof 20

18 A compound according to claim 7, wherein the compound is (+/-)-6-methoxy-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(1 H)-quinazolinone, or a pharmaceutically acceptable salt form thereof 25

19. A compound according to claim 7, wherein the compound is (+/-)-4-cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazohnone, or a pharmaceutically acceptable salt form thereof

20 A compound according to claim 7, wherein the compound is (+/-)-5,6- 30 difluoro-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(1 H)-quinazolinone, or a pharmaceutically acceptable salt form thereof intellectual property office of n.z. 1 2 MAR 2001 received 08/03/01 ,cfop850 claims, 136 -137 is; ^ /n ]£- J I I f Li y \j tj)

21 A compound according to claim 7, wherein the compound is (+/-)-5,6- difluoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(1 H)-quinazolinone, or a pharmaceutically acceptable salt form thereof 5

22 A compound according to claim 7, wherein the compound is (+/-)-4- cyclopropylethynyl-6-fluoro-4-trifluoromethyl-3,4-dihydro-2(1 H)-quinazolinone, or a pharmaceutically acceptable salt form thereof

23 A compound according to claim 7, wherein the compound is (+/-)-6-10 fluoro-4-(2-pyridyl) ethynyl-4-trifluoromethyl-3,4-dihydro-2(1 H)-quinazolinone, or a pharmaceutically acceptable salt form thereof

24 A compound according to claim 7, wherein the compound is (+/-)-6-fluoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(1 H)-quinazolinone, or a 15 pharmaceutically acceptable salt form thereof

25 A compound according to claim 7, wherein the compound is (+/-)-6-fluoro-4-(2'-2-pyridyl)ethyl-4-trifluoromethyl-3,4-dihydro-2(1 H)-quinazolinone, or a pharmaceutically acceptable salt form thereof 20

26 A compound according to claim 7, wherein the compound is (+/-)-6-fluoro-4-phenylethyl-4-trifluoromethyl-3,4-dihydro-2(1 H)-quinazolinone, or a pharmaceutically acceptable salt form thereof 25

27. A compound according to claim 7, wherein the compound is (-)-6- chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1 H)-quinazolinone, or a pharmaceutically acceptable salt form thereof

28 A compound according to claim 7, wherein the compound is (+)-6- 30 chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1 H)-quinazolinone, or a pharmaceutically acceptable salt form thereof intellectual property office of n.z. 1 2 MAR 2001 received 08/03/01 ,cfop850 claims, 137 -138-

29 A compound according to claim 7, wherein the compound is- (+)-4-cyclopropylethynyl-5, 6-difluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone, or a pharmaceutically acceptable salt form thereof

30 A compound according to claim 7, wherein the compound is (-)-4-cyclopropylethynyl-5, 6-difluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone, or a pharmaceutically acceptable salt form thereof

31 A compound according to claim 7, wherein the compound is (+)-E-4-cyclopropylethenyl-5, 6-difluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone, or a pharmaceutically acceptable salt form thereof

32 A compound according to claim 7, wherein the compound is (-)-6-chloro-4-E-cyclopropylethenyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone, or a pharmaceutically acceptable salt form thereof

33 A pharmaceutical composition, comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of a compound of any one of claims 1-32 or a pharmaceutically acceptable salt form thereof

34 A method for treating HIV infection, comprising administering to a non-human host in need of such treatment a therapeutically effective amount of a compound of any one of claims 1-32, or a pharmaceutically acceptable salt form thereof

35 A method of treating HIV infection which comprises administering, in combination, to a non-human host in need thereof a therapeutically effective amount of (a) a compound of any one of claims 1 -32 or stereoisomeric forms, mixtures of stereoisomeric forms, or pharmaceutically acceptable salts thereof, and, (b) at least one compound selected from the grou HIV reverse transcriptase inhibitors and HIV protease inhibitors |>|fi?a?^OSLO(fROPERTY office of n.z. 1 2 MAR 2001 received 08/03/01 ,cfop850 claims, 138 f -139-

36 A method according to claim 35, wherein the reverse transcriptase inhibitor is selected from AZT, 3TC, ddl, ddC, d4T, delavirdine, TIBO derivatives, BI-RG-587, nevirapine, L-697, 661, LY 73497, Ro 18,893, loviride, trovirdine, MKC-442, and HBY 097, and the protease inhibitor is selected from saquinavir, 5 ritonavir, indinavir, VX-478, nelfinavir, KNI-272, CGP-61755, U-140690, and ABT-378

37 A method according to claim 36, wherein the reverse transcriptase inhibitor is selected from AZT and 3TC and the protease inhibitor is selected from 10 saquinavir, nelfinavir, ritonavir, and indinavir

38 A pharmaceutical kit useful for the treatment of HIV infection, which comprises a therapeutically effective amount of (a) a compound of any one of claims 1 -32 or stereoisomeric forms, 15 mixtures of stereoisomeric forms, or pharmaceutically acceptable salts thereof, and (b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors, in one or more sterile containers 20

39 The use of a compound of any one of claims 1 to 32, or a pharmaceutically acceptable salt thereof, in the preparation of a medicament for the treatment of HIV infection 25

40 A compound according to any one of claims 1 to 32, a pharmaceutical composition of claim 33, a method of any one of claims 34 to 37; a pharmaceutical kit of claim 38, or the use of claim 39, wherein the pharmaceutically acceptable salt is selected from hydrochloric acid salt, hydrobromic acid salt, sulfuric acid salt, phosphoric acid salt, acetic acid salt, succinic acid salt, glycolic acid salt, 30 stearic acid salt, lactic acid salt, malic acid salt, tartaric acid salt, citric acid salt, ascorbic acid salt, maleic acid salt, fumaric acid salt, toluenesulfonic acid salt, methanesulfomc acid salt, and oxalic acid salt ,.,ra,„T„„ d0AdC[)tv intellectual property office of n.z. 1 2 MAR 2001 received 08/03/01 ,cfop850 claims, 139 -140-

41 A compound of formula (I) according to any one of claims 1 to 32, substantially as herein described with reference to any one of the Examples

42. A pharmaceutical composition of claim 33, substantially as herein 5 described with reference to any one of the Examples

43. A method of claim 36 or claim 37, which method is substantially as herein described with reference to any one of the Examples. 10

44 A pharmaceutical kit of claim 38, substantially as herein described with reference to any one of the Examples

45. The use of claim 39, substantially as herein described with reference to any one of the Examples 15 DATED this 19th day of June, 2001 20 DUPONT PHARMACEUTICALS COMPANY By their Patent Attorneys- intellectual property office of n.z. 2 5 m 2001 recebved 19/06/01,cfop850 speci.140 END </div>