JP2001503429A - (4R, 5S, 6S, 7R) -hexahydro-1- [5- (3-aminoindazole) methyl] -3-butyl-5,6-dihydroxy-4,7-bis [phenylmethyl] -2H-1, 3-Diazepin-2-ones and their use as HIV protease inhibitors - Google Patents

Abstract

(57) Abstract: The present invention provides a compound of the formula (I) or a pharmaceutically acceptable salt or prodrug thereof, which is useful as an inhibitor of HIV protease, and a pharmaceutical composition and a diagnostic kit containing the same. And methods of using it to treat a viral infection or as an assay standard or reagent.

Description

DETAILED DESCRIPTION OF THE INVENTION (4R, 5S, 6S, 7R) -hexahydro-1- [5- (3-aminoindazo Yl) methyl] -3-butyl-5,6-dihydroxy-4,7-bis [phenylmethyl [Tyl] -2H-1,3-diazepin-2-one and its HIV protease inhibitor Use as harmful agent                                 Technical field   The present invention relates to 1- (3-aminoin) which is widely useful as an HIV protease inhibitor. Pharmaceutical compositions containing dazol-5-yl) -3-butyl-cyclourea And diagnostic kits, for the treatment of viral infections, or with analytical standards or reagents And methods of using them.                                Background of the Invention   Human immunodeficiency virus (HIV) type 1 (HIV-1) or type 2 (HIV-2) ) Are two different retroviruses that are acquired immunodeficiency disorders It has been etiologically linked to the symptom group (AIDS). HIV seropositive, It is initially asymptomatic but usually presents with AIDS-related syndrome (ARC) followed by A It leads to IDS. Patients show severe immunosuppression, but this immunosuppression is Makes it more susceptible to opportunistic infections that can eventually become fatal.   The disease AIDS is the complex life of the HIV-1 or HIV-2 virus. The end result of the cycle. The life cycle of a virion is determined by the protective envelope of the virion Between the glycoprotein on the surface of CD4 and CD4 glycoprotein on lymphocytes Virions themselves bind to the host human T-4 lymphoid immune cells Begin. Upon binding, the virion strips off its glycoprotein coat and Invades the membrane and exposes its own RNA. The virion enzyme, reverse transcriptase, Responsible for the process of transcribing RNA to single-stranded DNA. The viral RNA is degraded and Is produced. This double-stranded DNA is incorporated into human cell genes, These genes are used for cell reproduction.   At this point, the human cell has incorporated the incorporated D using its own RNA polymerase. A reproduction process is performed to transcribe NA into viral RNA. Viral RNA Is translated into the precursor gag-pol fusion polyprotein. Then Polypro Thein is cleaved by the HIV protease enzyme and the mature viral protein Is generated. Thus, HIV protease can render viral particles sufficiently infectious Plays a role in regulating the cascade of cleavage phenomena leading to maturation of viruses are doing.   Most of the virion's life cycle is spent latently inside immune cells Puts a heavy burden on the typical human immune system response that kills invaded virions Take it. In addition, virus reverse, an enzyme used to create new virion particles Transcriptases are not very specific and can result in transcription errors, Glycoproteins on the surface of the virus protection envelope will be constantly changing. One sugar Antibodies specifically produced for a protein can play a role in another glycoprotein. To reduce the number of antibodies available to fight the virus Thus, such lack of specificity reduces the effectiveness of the immune system. Virus plays While continuing to give birth, the immune system continues to weaken. Finally, HIV is the body's immunity Freely controls most of the system, causing opportunistic infections, antivirals, immunostimulation Failure to administer the agent or both can result in death.   In the life cycle of a virus that has been identified as a potential target for antivirals There are at least three important points. (1) Virions and T-4 lymph Initial attachment to sphere or macrophage site, (2) viral RNA Transcription into DNA (reverse transcriptase, RT), and (3) new virus during reproduction Assembly of particles (ie, HIV aspartic protease or HIV protein) Aase).   The retroviral genome contains one or more polyprotein precursors, such as pol Protease responsible for the proteolysis of gene products and gag gene products It is hardened. Welllink Arch. Virol. Volume 98, page 1 (19 88). Retroviral proteases are most commonly gag precursors The body is processed into a core protein and the pol precursor is converted to reverse transcriptase and retroviral Treat with Rotase.   The assembly of infectious virions requires a precursor po Accurate processing of the protein is required. Produces protease-deficient virus In vitro mutagenesis produces immature core forms lacking infectivity. And is known. Crawford et al. Virol. 53 volumes, 899 pages (1985), Katoh et al., Virology 145, 280 (19). 85). Therefore, inhibition of retroviral protease is An attractive goal for viral therapy. Mitsuiya's Natur e See volume 325, p. 775 (1987).   The ability to inhibit viral proteases results in side effects compared to current therapies. Less used, more effective, less prone to drug resistance, prevents viral replication Therefore, a method for treating a viral disease such as AIDS can be provided. . As a result, three HIV protease inhibitors, namely Roche's Saki Nabil (saquinavir), Abbott's ritonavir (ritonav) ir) and Merck's indinavir are now commercially available And a number of potential protease inhibitors, such as Vertex's VX- 478, Nelfinavir of Agouron, Japan n Energy KNI-272 and Ciba-Geigy's CGP 6 1755 is in clinical trials.   Currently marketed protease inhibitors and protease inhibition during clinical trials Wide variety of potential HIV protease inhibitors as specified by the agent Compounds have been studied. One core, cyclic urea, has received considerable attention You. For example, PCT application WO 94/19329 to Lam et al. Cyclic ureas and methods for preparing these ureas are comprehensively described. Embodiment of the present invention The compounds fall within the scope of Lam et al, but are not explicitly disclosed therein.   Despite the success of current protease inhibitors, HIV patients still have a single protein It has been found that it can be resistant to zease inhibitors. Therefore, fighting HIV infection further Therefore, it is desirable to develop yet another protease inhibitor.                                Summary of the Invention   Accordingly, one object of the present invention is to provide a novel protease inhibitor. And   Another object of the present invention is to provide a pharmaceutically acceptable carrier and a therapeutically effective amount of a small amount. At least one compound of the present invention, or a pharmaceutically acceptable salt thereof, or a pharmaceutically acceptable salt thereof. By providing a pharmaceutical composition having a protease inhibitory activity including a lodrug form is there.   Another object of the present invention is to provide a therapeutically effective amount of at least one compound of the present invention, Requires treatment with a pharmaceutically acceptable salt or prodrug form thereof A novel method for treating HIV infection, comprising administering to a host. That is.   Another object of the invention is to provide (a) one of the compounds of the invention and (b) HIV reverse transcription One or more selected from the group consisting of enzyme inhibitors and HIV protease inhibitors Comprises administering a plurality of compounds to a host in need of a therapeutically effective combination. It is to provide a new method for treating HIV infection.   Another object of the present invention involves treating a bodily fluid sample with an effective amount of a compound of the present invention. And to provide a method for inhibiting HIV present in a body fluid sample.   Another object of the present invention is to provide a potential pharmaceutical HIV protease, HIV growth Standard in tests or assays to determine the ability to inhibit An effective amount of at least one compound of the present invention for use as an article or reagent. A kit or container containing the same.   The foregoing and other objects, which will become apparent from the detailed description below, are provided by the formula I A compound ofOr a pharmaceutically acceptable salt or prodrug form thereof is an effective protea This has been achieved by the present inventors' discovery that the compound is a lipase inhibitor.                       Detailed Description of the Preferred Embodiment   Thus, in a first embodiment, the present invention provides a novel compound of formula I Or a pharmaceutically acceptable salt or prodrug form thereof.   In a second embodiment, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutic agent. An effective amount of a compound of formula I or a pharmaceutically acceptable salt or prodola thereof. The present invention provides a novel pharmaceutical composition comprising an egg shape.   In a third embodiment, the invention provides a therapeutically effective amount of a compound of formula I or a compound thereof. A pharmaceutically acceptable salt or prodrug form of a host in need thereof A novel method for the treatment of HIV infection, comprising administering to a subject.   In a fourth embodiment, the invention provides a therapeutically effective amount of   (A) a compound of formula I, and   (B) the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors At least one compound selected from For the treatment of HIV infection, including co-administration to a host in need thereof. Provide a new way to:   In another preferred embodiment, the reverse transcriptase inhibitor is a nucleoside reverse transcriptase It is an elementary inhibitor.   In another more preferred embodiment, the nucleoside reverse transcriptase inhibitor is AZ T, 3TC, ddI, ddC, and d4T; Quinavir, Ritonavir, Indinavir, VX-478, Nelfinavir, KNI -272, CGP-61755, and U-103017.   In an even more preferred embodiment, the nucleoside reverse transcriptase inhibitor comprises A Selected from ZT and 3TC, wherein the protease inhibitor is saquinavir, ritonabi And indinavir.   Further, in another preferred embodiment, the nucleoside reverse transcriptase inhibitor is AZT.   Further, in another preferred embodiment, the protease inhibitor is indinavir. You.   In a fifth embodiment, the invention provides a therapeutically effective amount of:   (A) a compound of formula I;   (B) the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors At least one compound selected from the group consisting of one or more sterile containers And a pharmaceutical kit useful for treating HIV infection.   In a sixth embodiment, the present invention provides that a sample of a body fluid is treated with an effective amount of a compound of formula I. A novel method of inhibiting HIV present in a body fluid sample, comprising:   In a seventh embodiment, the present invention relates to a potential pharmaceutical HIV protease. Test or assay to determine the ability to inhibit HIV growth, or both An effective amount of the compound of formula I or II for use as a standard or reagent in the analysis. A novel kit or container comprising the compound is provided.                                   Definition   As used herein, the following terms and expressions have the indicated meanings. You. The compounds of the present invention contain an asymmetrically substituted carbon atom and may be optically active or It will be appreciated that they can be isolated as semi-forms. Racemic split or light Methods for preparing optically active forms, such as by synthesis from biologically active starting materials, are well known in the art. Well known. Unless a specific stereochemistry or isomer is specifically indicated , All chiral, diastereomeric, racemic, and all geometric Isomers are intended.   As used herein, “HIV reverse transcriptase inhibitors” refers to nucleosides and nucleosides. It refers to both HIV and non-nucleoside HIV reverse transcriptase (RT) inhibitors. Nucleus Examples of Osid RT inhibitors include AZT, ddC, ddl, d4T, and 3TC. Including, but not limited to. Examples of non-nucleoside RT inhibitors Include viviradine (Pharmacia and Upjohn U90152S), TIBO Derivatives, BI-RG-587, nevirapine, L-697,661 , LY 73497, and Ro 18,893 (Roche). It is not limited to them.   As used herein, an “HIV protease inhibitor” is an HIV protein inhibitor. A compound that inhibits ase. Examples include Saquinavir (Roche, Ro31- 8959), ritonavir (Abbott, ABT-538), indinavir (Merck, MK-639), VX-478 (Vertex / Glaxo Wellcome), Nelfinavir (A gouron, AG-1343), KNI-272 (Japan Energy), CGP-617 55 (Ciba-Geigy), and U-103017 (Pharmacia and Upjohn) However, the present invention is not limited to these. Additional examples include WO93 / 07128 WO94 / 19329, WO94 / 22840, and PCT Application No. US96 / 03 No. 426, including the cyclic protease inhibitors disclosed therein.   As used herein, "pharmaceutically acceptable salt" refers to the salt of the original compound. Derivatives of the disclosed compounds that have been modified by the manufacture of acid or base salts of To taste. Examples of pharmaceutically acceptable salts include mineral acids or basic residues such as amines. Includes salts of organic acids, alkali or organic salts of acidic residues such as carboxylic acids However, it is not limited to them. Pharmaceutically acceptable salts include, for example, Conventional non-toxic salts or salts of the original compound formed from non-toxic inorganic or organic acids Grade ammonium salts. For example, these conventional non-toxic salts include hydrochloric acid, bromide Salts derived from inorganic acids such as hydrogen acid, sulfuric acid, sulfamic acid, phosphoric acid, nitric acid, Acetic acid, propionic acid, succinic acid, glycolic acid, stearic acid, lactic acid, malic acid , Tartaric acid, citric acid, ascorbic acid, pamoic acid, maleic acid, Hydroxymaleic acid, phenylacetic acid, glutamic acid, benzoic acid, salicylic acid, Sulfanilic acid, 2-acetoxybenzoic acid, fumaric acid, toluenesulfonic acid, Organic acids such as tansulfonic acid, ethanedisulfonic acid, oxalic acid, isethionic acid And the salts prepared therefrom.   Pharmaceutically acceptable salts of the compounds of the present invention are those that contain a basic or acidic radical. Compounds can be synthesized from the compounds by conventional chemical methods. Usually such a salt Is prepared by converting the compound in free acid or base form into a stoichiometric amount of a suitable base or Prepared by reacting with acids in water or organic solvents, or a mixture of both it can. Generally, ether, ethyl acetate, ethanol, isopropanol, Is preferably a non-aqueous medium such as acetonitrile. A list of suitable salts can be found in Remlngt on's Pharmaceutical Sciences ", 17th Edition, Mack Publishing Company, Easton, PA, page 1418, 1985, the disclosure of which is incorporated herein by reference. Incorporated as   The phrase “pharmaceutically acceptable” is not subject to sound medical judgment, Without toxicity, irritation, allergic reactions, or other problems, or complications of For use in contact with human and animal tissues, in proportion to reasonable benefit / risk ratios To mean said compounds, materials, compositions and / or dosage forms which are suitable Used for   A “prodrug” is an in v when the prodrug is administered to a mammal. Means to include a covalently bonded carrier that releases the active parent drug of Formula I in ivo You. Prodrugs of the compounds of the present invention, for example compounds of formula (I), may be modified by routine procedures. Or a compound of the present invention so as to be cleaved either in vivo or in vivo. Prepared by modifying the functional groups present in Prodrugs include A hydroxy or amino group, which is cleaved when administered to a mammal, respectively; Compounds of the present invention that produce a free hydroxyl or amino group are included. Professional Examples of drugs include acetate of the alcohol and amine functions in the compounds of formula I. Derivatives of ter, formate or benzoate; alcohols in compounds of formula I Phosphate and dimethylglycine esters of amino and amine functions, amino Alkyl benzyl ester, amino alkyl ester and carboxyalkyl Examples include, but are not limited to, esters. As a further example Epoxide, -OCH_TwoSCH_TwoO- , -OC (= O) O-, -OCH_TwoO-, -OC (= S) O-, -OC (= O) C (= O) O-, -OC (CH_Three)_TwoO-, -OC ((CH_Two)_ThreeNH_Two) (CH_Three) O-, -OC (OCH_Three) (CH_TwoCH_TwoCH_Three) O- or -OS (= O) O- And the like.   "Stable compounds" and "stable structures" are those compounds of useful purity that are isolated from a reaction mixture. Means that the compound is robust enough to withstand the formulation into an effective therapeutic agent I do. Only stable compounds are contemplated in the present invention.   “Substituted” refers to one or more of the atoms indicated by the expression “substituted”. Means that multiple hydrogen atoms are replaced by a selection from the indicated group Provided that the substitution does not exceed the normal valency of the designated atom, It should give stable compounds. When the substitution is keto (ie, = 0), the atom The above two hydrogen atoms are replaced.   A "therapeutically effective amount" is defined as inhibiting HIV infection or causing HIV infection in a host. Amount of a compound of the invention or a compound claimed to be effective in treating a condition Is included. Synergistic combinations are preferred for compound combinations No. See, for example, Chou and Talalay, Adv. Enzyme Regul., Volume 22, 27-55 Pe As described in 1984, when multiple compounds are co-administered. The effect (in this case, inhibition of HIV replication) is that A synergistic effect occurs when the additive effect of administration alone is outweighed. In general, The synergistic effect is most clearly demonstrated at suboptimal compound concentrations. Synergy For use with less cytotoxicity, enhanced antiviral activity, or other Some of the beneficial combined effects manifest.   Other features of the present invention will become apparent in the exemplary embodiments set forth below. U. These are given as descriptions of the present invention and are intended to limit the present invention. It is not intended.                                  Example   Abbreviations used in the examples are defined as follows. Celsius temperature is "℃", double line is "D", double line of double line is "dd", equivalent or multiple equivalent is "eq", gram or Or "g" for multiple grams, "mg" for milligrams or multiple milligrams, "ML" for a bottle or multiple milliliters, "H" for hydrogen or multiple hydrogens, "Hr" for multiple or multiple hours, "m" for multiples, "M" for moles, minutes or multiple minutes Is "min", megahertz is "MHz", mass spectrometry is "MS", nuclear magnetic resonance spectroscopy Analysis is "nmr" or "NMR", triplet is "t", thin layer chromatography is "TLC".                                 Example 1        (4R, 5S, 6S, 7R) -hexahydro-1- [5- (3- Aminoindazole) methyl] -3-butyl-5,6-dihydroxy-4,7-   Preparation of bis [phenylmethyl] -2H-1,3-diazepin-2-one (I)   Compound A can be prepared by a well-known method. For example, Rossano (Tetr. Lett., 36:28 (1995), 4967, 49). The preparation method of compound A is described in Scheme 1 of page 68), and the contents are referred to. Hereby incorporated by reference herein. Example 6 of US Pat. No. 5,530,124 includes , An alternative method of preparing Compound A, the contents of which are incorporated herein by reference. Invite to   Part A: Compound 1 (10.0 g in 1,2-dichloroethane (100 mL) , 27.3 mmol) in a suspension of methyl triflate (3.4 mL, 30 mmol). l) was added. After refluxing overnight, the reaction was washed with saturated NaHCO_Three, Wash with saturated NaCl Clean, dry (Na_TwoSO_Four), Evaporation left 12.5 g of a yellow oil. Column chromatography (flash SiO_Two, 25% EtOAc / hexane) Yielded 7.86 g of a pale yellow oil which crystallized on standing. (75% yield). Melting point = 97-100C. MH⁺= 381.   Part B: 1 (10.0 g, 26.3 mmol) in anhydrous DMF (30 ml) To a solution of was added sodium hydride (1.58 g, 65.8 mmol). Reaction mixture The mixture was stirred at room temperature for 45 minutes before adding 1-iodobutamate in anhydrous DMF (10 ml). (9.68 g, 52.6 mmol) was added dropwise. After dropping, stir at room temperature Continued overnight. The reaction mixture was cooled to 0 ° C., methanol (5 ml) was added and excess The sodium hydride was quenched. The mixture was mixed with ethyl acetate (200 ml) and water ( 150 ml). The organic phase was separated, water (4 × 100 ml), salt Washed with water (100 ml) and dried over sodium sulfate. Flash chromatography Purification by chromatography (25% EtOAc / hexane) gave n-butylisourea 2 (10.5 g, 92% yield): MS (NH_Three-CI / DDIP) ( M + H⁺) 437.2 (100%),¹1 H NMR (300 MHz, CDCl_Three, 25 ° C) δ 7.23 (m, 10H), 4.19 (m, 3H), 3.64 (m, 1H). , 3.44 (s, 3H), 3.36 (m, 1H), 3.02 (m, 2H), 2. 76 (m, 2H), 2.04 (m, 1H), 1.52 (s, 3H), 1.49 ( s, 3H), 1.21 (m, 4H), 0.82 (t, J = 7.0 Hz, 3H).   Part C: (4R, 5S, 6S, 7R) -Hexahydro-1-[(3-cyano -4-fluorophenyl) methyl] -5,6-O-isopropylidene-4,7- Bis- (phenylmethyl) -3-butyl-2H-1,3-diacepin-2-one ( 3).  To a solution of 2 (5.0 g, 11.5 mmol) in acetonitrile (40 ml) , 4-fluoro-3-cyanobenzylbromide (3.68 g, 17.25 mm ol). The reaction mixture was refluxed overnight. After removing the solvent under reduced pressure, The residue was purified using flash chromatography (35% EtOAc / hexane). Purification provided the cyclic urea 3 as a white solid (4.5 g, 71% yield): MS (NH_Three-CI / DDIP) (M + H⁺) 556.3 (100%),¹H N MR (300MHz, CDCl_Three, 25 ° C) δ 7.41 (m, 1H), 7.28 (M, 7H), 7.13 (d, J = 9.2 Hz, 2H), 7.05 (t, J = 8 . 8 Hz, 1H), 6.95 (d, J = 9.2 Hz, 2H), 4.50 (d, J = 14.0 Hz, 1H), 4.07 (m, 2H), 3.70 (m, 3H), 3. 44 (t, J = 7.7 Hz, 1H), 2.90 (m, 4H), 2.12 (m, 1 H), 1.50 (s, 6H), 1.26 (m, 4H), 0.83 (t, J = 7. 0 Hz, 3H).   Part D: (4R, 5S, 6S, 7R) -hexahydro-1- [5- (3-A Minoindazole) methyl] -3-butyl-5,6-dihydroxy-4,7-bi S [phenylmethyl] -2H-1,3-diazepin-2-one (I)   To a solution of 3 (4.5 g, 8.11 mmol) in n-butanol (20 ml) , Hydrazine hydrate (0.81 g, 16.2 mmol) was added. 6 o'clock the mixture Reflux for a while. The solvent and excess hydrazine were removed under reduced pressure. Residue in anhydrous meta After dissolving in methanol (20 ml), 4M HCl dissolved in dioxane (2 ml) was added. added. The reaction mixture was stirred at room temperature for 2 hours. Remove the methanol and remove the residue with acetic acid Partitioned between ethyl (80 ml) and sodium bicarbonate (sat.) (50 ml) . The organic phase is separated, washed with water (2 × 50 ml) and with sodium sulfate (anh.) Let dry. Purification by flash chromatography gave I (3.0 g, yield 72). %) Was obtained as a white solid. 129-131 ° C, MS (NH_Three−CI / DDIP) (M + H⁺) 528.3 (100%), HRMS C₃₁H₃₇N_FiveO_Three+ Calculated value of 528.2975, measured value 528.2958,¹1 H NMR (3 00MHz, CD_ThreeOD, 25 ° C) δ 7.19 (m, 12H), 6.98 (d, J = 1.5 Hz, 2H), 4.74 (d, J = 13.9 Hz, 1H), 3.85 (Dd, J = 10.25, 4.76 Hz, 1H), 3.65 (m, 1H), 3. 56 (m, 4H), 3.15 (m, 2H), 2.96 (m, 3H), 2.07 ( m, 2H), 1.37 (m, 2H), 1.22 (m, 2H), 0.84 (t, J = 7.0, 3H).                                  Usefulness   The compounds of formula I have HIV protease inhibitory activity and Useful as an antiviral agent in the treatment of IV infections and related diseases . Compounds of formula I have HIV protease inhibitory activity and may be inhibitors of HIV growth. It is effective. For example, using the assays described below, Or the ability of a compound of the invention to inhibit infectivity, as a measure of viral growth or infectivity. Reveal in a standard assay.   Compounds of Formula I of the present invention contain, or are expected to be, exposed to HIV It is also useful for inhibiting HIV in ex vivo samples. Therefore, the book The invention compound comprises or is suspected of containing HIV or HIV. In body fluid samples (eg, serum or semen samples) suspected of being exposed to Can be used to inhibit HIV.   The compounds provided by the present invention may be used for viral clonal replication of a drug and / or HI Tests or assays to determine the ability to inhibit V protease, for example, As a reference or reference compound used in pharmaceutical research programs Useful. Therefore, the compounds of the present invention can be used as control compounds in these assays. As a reference or reference compound and as a standard for quality control . The compound of the present invention can be used as a standard kit or reference compound in a commercially available kit or container. Then can be provided for use.   Since the compound of the present invention shows specificity for HIV protease, The compound may also be used as a diagnostic in diagnostic assays for HIV protease detection. Useful. Therefore, assays (such as the assays described herein) Inhibition of protease activity by the compounds of the present invention in HIV protease and It will be an indicator that the HIV virus is present.   As used herein, “μg” means microgram and “mg” Milligram means “g” means gram, “μL” means microliter "ML" means milliliter, "L" means liter, "nM "Means nanomolar," μM "means micromolar," mM "means millimolar , “M” means mole, and “nm” means nanometer. "Sig "ma" represents Sigma-Aldrich Corp., St. Louis, MO.                          HIV RNA assay DNA plasmids and in vitro RNA transcripts :   Gag of BH10 (bp 113-1816) cloned into PTZ19R The plasmid pDAB72, which contains both the pol and pol sequences, was constructed by Erickson-Viitanen. other AIDS Research and Human Retroviruses, Vol. 5, p. 577, 1989 Thus prepared. T7 RNA polymerase and Riboprobe Gemini System II Prior to in vitro RNA transcript formation using Promega The mid was linearized with Bam HI. Synthesized RNA contains RNase-free D Treatment with Nase (Promega), phenol-chloroform extraction, and ethanol Purified by knol precipitation. RNA transcripts were dissolved in water and stored at -70 ° C . The concentration of RNA is A₂₆₀Asked from.probe :   Biotinylated capture probes are available from Applied Biosystems (California). Foster City, F.) DNA synthesizer, Cocuzza, Tet. Lett., 3 0, p. 6287, 1989, using a biotin-phosphoramidite reagent. After synthesis by adding biotin to the 5 'end of the oligonucleotide And purified by HPLC. gag biotinylated capture probe (5-biotin -CTAGCTCCCTGCTTGCCCCATACTA3 ') is a nucleotide sequence of HXB2. Complementary to nucleotide 889-912, pol biotinylated capture pro (5'-biotin-CCCTATCATTTTTGGTTTCCAT3 ') Was complementary to nucleotides 2374-2395 of HXB2. Reporter Alkali conjugated to oligonucleotide used as probe Phosphatase was prepared by Syngene (San Diego, CA) Was. pol reporter probe (5'CTGTCTTACTTTGATAAAAA CCTC3 ') is complementary to nucleotides 2403-2425 of HXB2. Was. gag reporter probe (5 'CCCAGTATTTGTCTACCAGC CTTCT3 ') was complementary to nucleotides 950-973 of HXB2. . All nucleotide positions are in the Genetics Computer Group Sequence Analysi GenBank Genetic Sequence Data Bank (Deve reau, Nucleic Acids Research, vol. 12, p. 387, 1984) is there. The reporter probe was 2 x SSC (0.3 M NaCl, 0.03 M Sodium enoate), 0.05 M Tris pH 8.8, 1 mg / mL B SA Prepared as a 0.5 μM stock. Biotinylated capture probe Prepared as 100 μM stock in water.Streptavidin coated plate:   Streptavidin coated plates are available from Du Pont Biotechnology Sy obtained from stem (Boston, Mass.).Cell and virus stocks :   MT-2 and MT-4 cells are 5% fetal bovine serum (F CS), 10% FCS for MT-4 cells, 2 mM L-glutamine and RPMI supplemented with 50 μg / mL gentamicin (all obtained from Gibco) Stored in 1640. HIV-1 RF grows in MT-4 cells in the same medium I let it. Virus stocks were prepared approximately 10 days after acute infection of MT-4 cells, and Stored as a recoat at -70 ° C. HIV-1 (RF) stock infectious titer , Measured by a plaque assay with MT-2 cells (see below), 1-3 × 1 0⁷PFU (plaque forming units) / mL. Virus list used for infection Aliquots of the packs were thawed only once.   When assessing antiviral efficacy, infected cells should be subcultured for one day prior to infection. did. On the day of infection, RPMI 1640, 5% FCS for bulk infection 5 × 10 inside^FiveResuspend cells / mL of cells and resuspend cells in microtiter plate. For staining, 2 × 10 5 in Dulbecco's modified Eagles medium supplemented with 5% FCS.⁶/ M L cells were resuspended. The virus was added and the culture was continued at 37 ° C. for 3 days.HIV RNA assay :   Cell lysates or purified RNA in 3M or 5M GED were Mix with ED and capture probe to recover guanidine isothiocyanate. The final concentration was 3M and the final concentration of biotin oligonucleotide was 30nM. Dense 1 in a closed U-bottom 96-well tissue culture plate (Nunc or Costar) at 37 ° C. Hybridization was performed for 6 to 20 hours. RNA hybridization The reaction was diluted 3-fold with deionized water and the final concentration of guanidine isothiocyanate was An aliquot (150 μL) was coated with streptavidin at a concentration of 1 M. Microtiter plate wells. Capture probe and cap Binding of the prober RNA hybrid to immobilized streptavidin After 2 hours at room temperature, DuPont ELISA plate wash buffer (phosphate buffered saline) The plate was washed six times with (PBS), 0.05% Tween 20). capture -Reporter for immobilized complex of probe and hybridized target RNA -The second hybridization of the probe is 4xSSC, 0.66% Triton X100, 6.66% deionized formamide, 1 mg / mL BSA and 5n Add 120 μL of hybridization cocktail containing M reporter probe Performed in washed streptavidin-coated wells . After 1 hour of hybridization at 37 ° C., the plate was washed an additional 6 times. Was. The activity of the immobilized alkaline phosphatase was measured using buffer δ (2.5 M Amine pH 8.9 (JBL Scientific), 10 mM MgCl_Two, 5 mM acetic acid Zinc dihydrate and 5 mM N-hydroxyethyl-ethylene-diamine-trivine Acid) with 100 μL of 0.2 mM 4-methylumbelliferyl phosphate Detected by addition. Plates were incubated at 37 ° C. Microplate Excitation at 365 nm and measurement of 450 nm fluorescence using a fluorimeter (Dynateck) did.Evaluation of compounds by microplate in HIV-1 infected MT-2 cells :   Compounds to be evaluated were dissolved in DMSO, twice the highest concentration tested and DM The medium was diluted so that the maximum concentration of SO was 2%. 3x run of compound in medium Serial dilutions were made directly in U-bottom microtiter plates (Nunc). Dilute compound After dilution, MT-2 cells (50 μL) were added and 5 × 10^Five(1 well 1 × 10 per^Five). Cells are CO_Two37 in the incubator Incubate with compound for 30 minutes at ° C. For evaluation of antiviral ability, HIV-1 Appropriate dilutions of the (RF) virus stock (50 μL) were added to cells and test compounds. Was added to the culture wells containing the dilutions. The final volume in each well was 200 μL. Was . For 8 wells per plate, add 50 μL of medium instead of virus, and Eight wells were infected without addition of antiviral compound. Compound toxicity For evaluation, parallel plates were cultured without virus infection. Was.   CO_TwoIn a humid chamber in an incubator, the cells were cultured at 37 ° C for 3 days. Later, all but 25 μL of medium per well were removed from the HIV infected plate Was. 37 μL of 5M GED containing biotinylated capture probe was added to each well. In addition to the sedimented cells in the medium and the remaining medium, 3M GED and 30 nM The final concentration of the capture probe was used. HI in capture probes and cell lysates Hybridization of VRNA is performed using a plate sealer (Costar). Seal and perform in the same microplate well used for virus culture. For 16-20 hours in a 37 ° C. incubator. Then, in each well The hybridization reaction was diluted 3-fold by adding distilled water. Transfer 50 μL to streptavidin-coated microtiter plate did. HIV RNA was quantified as described above. Will made during the infection To determine the amount of RNA, a well-known amount of p is added to the wells containing lysed uninfected cells. A standard curve prepared by adding DAB72 in vitro RNA transcript was used for each microtiter. This was performed for each plate.   To standardize the amount of virus inoculated used to evaluate the antiviral activity of the compound, Dilution of ills is performed by using dideoxycytidine (ddC) IC.₉₀Value (HIV RNA RNA The concentration of the compound needed to reduce the bell by 90%) is 0.2 μg / mL. I chose. IC of other antiviral compounds₉₀The value is higher even if the activity is higher than ddC. At a minimum, several stocks of HIV-1 (RF) are used according to this procedure. As a result, reproducibility was obtained. This virus concentration is approximately 3 × 10^FivePFU (measured by plaque assay on MT-2 cells) Always about 75% of the highest viral RNA level achieved with any virus inoculation Is generated. For HIV RNA assays, the net sig in the RNA assay Null (Signal of infected cell sample minus signal of uninfected cell sample) Net signal from infected, untreated cells on the same culture plate (8 Le From the average) to the IC₉₀The value was determined. Individual infections and R The success of the NA assay test was determined according to three criteria. Wooly Rus infection is equivalent to the signal generated by 2 ng of pDAB72 in vitro RNA transcript. It was necessary to provide a better or better RNA analysis signal. each IC of ddC measured in assay₉₀Values are between 0.1 and 0.3 μg / mL Must be. Finally, provided by effective protease inhibitors Flat levels of viral RNA are less than 10% of the levels resulting from uninhibited infection. Must be full. IC₉₀Is less than 1 μM, the compound is active Was considered.   For antiviral titer testing, add 2x concentrated compound solution to a row of wells first All operations on the microtiter plate after This was performed using us ProPette.Dosage and formulation   The antiviral compound of the present invention comprises an active drug and a site of action of the drug in a mammal, That is, each means of creating contact with the viral protease It can be administered as a treatment for Lus infection. These compounds are used for individual treatment Conventional rafts that can be used with pharmaceuticals, either as drug or therapeutic combinations It can also be administered by any means. The compounds can be administered alone Selected based on the selected route of administration and standard pharmaceutical practice It is preferably administered with a carrier.   The dose administered will depend on the pharmacodynamic properties of the particular drug and its mode of administration and Route; age, health and weight of the recipient; nature and extent of symptoms; concomitant treatment Depends on known factors such as the type of treatment; frequency of treatment; and the desired effect. Of course. The daily dose of the active ingredient is from about 0.001 to about It can be expected to be 1000 milligrams, but doses of about 0.1 to about 30 mg / kg are preferred. Good.   Dosage forms of the compositions suitable for administration may contain from about 1 mg to about 100 mg of active ingredient per unit. Minutes. In these pharmaceutical compositions, the active ingredient is usually based on the total weight of the composition. Therefore, it is present in an amount of about 0.5-95% by weight. Active ingredients include capsules, tablets and tablets And solid dosage forms such as powders and elixirs, syrups and suspensions. Liquid dosage forms can be administered orally. Parenteral in sterile liquid dosage form It can also be administered.   Gelatin capsules contain the active ingredients, and lactose, starch, cellulose derivatives, Includes powder carriers such as magnesium stearate and stearic acid. Similar diluent Can also be used to produce compressed tablets. Both tablets and capsules Can be manufactured as a sustained release product to provide continuous release of the drug over several hours it can. Compressed tablets should be sugar coated to mask the unpleasant taste and protect the tablets from the air. Or film coating, or selectively disintegrate in the gastrointestinal tract. Enteric coatings can also be made to break. Liquid dosage forms for oral administration Coloring and flavoring agents can be included to increase patient acceptance.   Generally, water, suitable oils, saline, dextrose (glucose) solutions, and And related sugar solutions, and propylene glycol or polyethylene glycol Glycols and the like are suitable carriers for parenteral solutions. Liquid for parenteral administration Include a water-soluble salt of the active ingredient, suitable stabilizing agents and, if necessary, buffer substances. It is preferred to include. Sodium bisulfite, sodium sulfite, or ascorbi Antioxidants, such as acids, alone or in combination, are also suitable stabilizers. Quen Acids and salts thereof, and sodium EDTA are also used. In addition, parenteral solutions The liquid consists of benzalkonium chloride, methyl- or propyl-paraben and chloro A preservative such as butanol can also be included. Suitable pharmaceutical carriers are known in the art. In Remington's Pharmaceutical Sciences, a standard reference book Has been described.   Pharmaceutical dosage forms useful for administration of the compounds of the present invention can be illustrated as follows.Capsule   100mg powdered active ingredient in standard two-piece hard gelatin capsules, milk 150 mg of sugar, 50 mg of cellulose, and 6 mg of magnesium stearate By filling, a large number of unit capsules can be prepared.Soft gelatin capsule   Prepare a mixture of the active ingredient with a digestible oil such as soybean oil, cottonseed oil or olive oil. Soft gel containing 100 mg of active ingredient injected into gelatin by positive displacement pump A Latin capsule can be formed. The capsule is then washed and dried I do.tablet   Dosage unit is 100 mg of active ingredient, 0.2 mg of colloidal silicon dioxide, steer 5 mg of magnesium phosphate, 275 mg of microcrystalline cellulose, starch 11 mg, and 98.8 mg of lactose in a number of tablets according to conventional procedures. Can be manufactured. Apply a suitable coating to improve palatability, Alternatively, absorption can be delayed.Suspension   5 mL each containing 25 mg of finely divided active ingredient, sodium carboxymethyl cell Loose 200 mg, sodium benzoate 5 mg, sorbitol solution, USP S. P . , 1.0 g, and 0.025 mg of vanillin, for oral administration Suspensions can be prepared.Injection   1.5% by weight of the active ingredient is stirred in a 10% by volume aqueous propylene glycol solution. By stirring, a parenteral composition suitable for administration by injection can be prepared. Wear. The solution is sterilized by commonly used techniques.Combination of components (a) and (b)   Each therapeutic agent component of the present invention is independent of any dosage form, as described above. And can be administered in various ways as described above. In the following description, component (b) refers to one or more of the aforementioned agents. Understood. Therefore, treat components (a) and (b) the same or independently In this case, each of the components (b) can be treated the same or independently.   Components (a) and (b) of the present invention can be combined as a single product In other words, mix together in one capsule, tablet, powder or liquid, etc.) Can be formulated. Components (a) and (b) can be combined into a single dosage unit If not formulated in the beginning, component (a) may be added simultaneously with component (b) or any They may be administered in order. For example, the component (a) of the present invention is administered first, followed by the component (B) may be administered or they may be administered in the reverse order. Component (b) Has two or more drugs, such as one RT inhibitor and one protease inhibitor. If included, these drugs may be administered together or in any order. You may. When not administered simultaneously, administration of components (a) and (b) takes about 1 hour. It is preferred to perform at intervals of less than. The route of administration of components (a) and (b) is oral. preferable. As used herein, oral drugs, oral inhibitors, oral compounds Terms such as an article refer to a compound that can be administered orally. Of components (a) and (b) Both have the same route (ie, for example, both orally) or the same dosage form It is preferred that they be administered by a different route, if desired (ie, for example, in combination). One component of the product may be administered orally, the other component may be administered intravenously) or different agents It can also be administered in form.   As will be appreciated by those skilled in the medical arts, the dosage of the combination therapy of the present invention will be Pharmacodynamic properties of different drugs and their mode and route of administration; age of recipient , Health and weight; nature and extent of symptoms; type of combination treatment; frequency of treatment; And the desired effect.   Appropriate dosages of components (a) and (b) of the present invention can Will be readily ascertainable by one skilled in the art. According to general guidelines, A typical daily dose would be from about 100 milligrams to about 1.5 grams of each component. component( When b) represents more than one compound, the usual daily doses will be each component of component (b) From about 100 milligrams to about 1.5 grams. According to general guidelines, the ingredients ( When the compounds of a) and (b) are administered in combination, the dose of each component is adjusted according to the HIV sensitivity. About 7 times the usual dose of the ingredient when administered alone as a single agent for the treatment of infections It can be reduced by 0 to 80%.   The combination product of the present invention combines multiple active ingredients in a single dosage unit, Can be formulated to minimize physical contact between them. Minimize contact For example, if the product is administered orally, one active ingredient may be You may also Combined use by enteric coating one active ingredient Not only is contact between the active ingredients minimized, but also the You can control the release of one of them so that it is not released in the stomach but in the intestine. it can.   When oral administration is desired, another embodiment of the present invention provides a combination product. Here, a sustained release effect is exhibited throughout the gastrointestinal tract, and physical contact between the combined active ingredients is performed. One of the active ingredients is coated with a sustained release material to minimize touch. further, Enteric-coated sustained-release components so that release of this component occurs only in the intestine You can also. Yet another approach involves separating the active ingredient further. One component is coated with a sustained-release and / or enteric polymer and the other Low viscosity hydroxypropyl methylcellulose or other suitable known in the art It may also include the formulation of concomitant products coated with different substances. Polymer Co Tinting helps create an additional barrier to interaction with other components. That prevent contact between components (a) and (b) by a coating or other substance In each formulation, contact between the individual agents of component (b) can also be prevented. .   The dosage form of the combination product of the present invention in which one active ingredient is enteric-coated is an enteric-coated Blended ingredients and other active ingredients together and then compressed into tablets Alternatively, the enteric-coated component is compressed into one tablet layer and the other active It can also be in tablet form for compression into another layer. Optionally, add two more layers One or more of the active ingredients may be separated so that the placebo layer is between the active ingredient layers. May be present. In addition, the dosage form of the present invention has one active The ingredients may be compressed into tablets or micro-tablets, granules, granules or non-peril ( Capsule dosage forms can be enteric coated as non-perils. The enteric coated microtablets, granules, granules or non-peripheries The capsules, or press into capsules with granules of other active ingredients. Shrink.   These and other methods for minimizing contact between the components of the combination products of the present invention are Administered in a single dosage form, simultaneously in separate dosage forms, or simultaneously in the same manner Regardless, based on the present disclosure, it will be apparent to those skilled in the art.   Useful for the treatment of HIV infection, wherein the component (a) is contained in one or more sterile containers. ) And one or more compounds of component (b). A pharmaceutical kit comprising the pharmaceutical composition of the above is also within the scope of the present invention. Container sterilization is an industry It can be carried out using ordinary sterilization methods well known to those skilled in the art. Component (a) and Component (b) may be in the same sterile container or in another sterile container. object Quality sterile containers include other containers, or, if desired, one or more multi-part containers. Can be taken. Component (a) and component (b) may be separate or as described above. In addition, they can be combined physically in a single dosage form or in a single dosage unit. For those skilled in the art As will be apparent, if desired, these kits may include, for example, one or more A variety of pharmaceutically acceptable carriers, such as additional vials for mixing the components Conventional pharmaceutical kit components can be included. Amount of ingredient administered, finger of administration Insert or label showing needle and / or guidelines for mixing ingredients Instructions for use can also be included in the kit.   Many modifications and variations of the present invention are possible in light of the above teachings. it is obvious. Therefore, within the scope of the appended claims, specifically described herein It will be appreciated that the invention may be practiced other than as described.

[Procedure of Amendment] Article 184-8, Paragraph 1 of the Patent Act [Submission date] October 26, 1998 (1998.10.26) [Correction contents]   The assembly of infectious virions requires a precursor po Accurate processing of the protein is required. Produces protease-deficient virus In vitro mutagenesis produces immature core forms lacking infectivity. And is known. Crawford et al. Virol. 53 volumes, 899 pages (1985), Katoh et al., Virology, 145, 280 (19). 85). Therefore, inhibition of retroviral protease is An attractive goal for viral therapy. Mitsuiya's Natur e, 325, 775 (1987).   The ability to inhibit viral proteases results in side effects compared to current therapies. Less used, more effective, less prone to drug resistance, prevents viral replication Therefore, a method for treating a viral disease such as AIDS can be provided. . As a result, three HIV protease inhibitors, namely Roche's Saki Nabil (saquinavir), Abbott's ritonavir (ritonav) ir) and Merck's indinavir are now commercially available And a number of potential protease inhibitors, such as Vertex's VX- 478, Nelfinavir of Agouron, Japan n Energy KNI-272 and Ciba-Geigy's CGP 6 1755 is in clinical trials.   Currently marketed protease inhibitors and protease inhibition during clinical trials Wide variety of potential HIV protease inhibitors as specified by the agent Compounds have been studied. One core, cyclic urea, has received considerable attention You. See, for example, PCT applications WO 94/19329 and WO 93 / No. 07128 includes the following formula:Cyclic ureas and methods for preparing these ureas are comprehensively described. Embodiment of the present invention The compounds fall within the scope of Lam et al, but are not explicitly disclosed therein.   J. Lam et al. Med. Chem. 1996, 39, 3514-352 On page 5, additional cyclic ureas are described. This publication contains various cyclic ureas Is disclosed, but no indazolemethyl-containing compound is described.   Despite the success of current protease inhibitors, HIV patients still have a single protein It has been found that it can be resistant to zease inhibitors. Therefore, fighting HIV infection further Therefore, it is desirable to develop yet another protease inhibitor.                                Summary of the Invention   Accordingly, one object of the present invention is to provide a novel protease inhibitor. And   Another object of the present invention is to provide a pharmaceutically acceptable carrier and a therapeutically effective amount of a small amount. At least one compound of the present invention, or a pharmaceutically acceptable salt thereof, or a pharmaceutically acceptable salt thereof. By providing a pharmaceutical composition having a protease inhibitory activity including a lodrug form is there.   Another object of the present invention is to provide a therapeutically effective amount of at least one compound of the present invention, Requires treatment with a pharmaceutically acceptable salt or prodrug form thereof A novel method for treating HIV infection, comprising administering to a host. That is.   Another object of the invention is to provide (a) one of the compounds of the invention and (b) HIV reverse transcription One or more selected from the group consisting of enzyme inhibitors and HIV protease inhibitors Comprises administering a plurality of compounds to a host in need of a therapeutically effective combination. It is to provide a new method for treating HIV infection.   Another object of the present invention involves treating a bodily fluid sample with an effective amount of a compound of the present invention. And to provide a method for inhibiting HIV present in a body fluid sample.   "Stable compounds" and "stable structures" are those compounds of useful purity that are isolated from a reaction mixture. Means that the compound is robust enough to withstand the formulation into an effective therapeutic agent I do. Only stable compounds are contemplated in the present invention.   “Substituted” refers to one or more of the atoms indicated by the expression “substituted”. Means that multiple hydrogen atoms are replaced by a selection from the indicated group Provided that the substitution does not exceed the normal valency of the designated atom, It should give stable compounds. When the substitution is keto (ie, = 0), the atom The above two hydrogen atoms are replaced.   A "therapeutically effective amount" is defined as inhibiting HIV infection or causing HIV infection in a host. Amount of a compound of the invention or a compound claimed to be effective in treating a condition Is included. Synergistic combinations are preferred for compound combinations No. See, for example, Chou and Talalay, Adv. Enzyme Regul., Volume 22, 27-55 Page, 1984, when multiple compounds are co-administered (In this case, inhibition of HIV replication) Synergy occurs when the additive effect of administration alone is outweighed. In general The synergistic effect is most clearly demonstrated at suboptimal compound concentrations. Synergy The effect is lower cytotoxicity, enhanced antiviral effect, or It manifests itself in several other beneficial combined effects.   Other features of the present invention will become apparent in the exemplary embodiments set forth below. U. These are given as explanations of the present invention.                                  Example                                The scope of the claims   1. Formula I or a pharmaceutically acceptable salt or prodrug form thereof So, The prodrug of Formula I is an epoxide, -OCH, in which two hydroxy groups are attached._Two SCH_TwoO-, -OC (= O) O-, -OCH_TwoO-, -OC (= S) O-, -O C (= O) C (= O) O-, -OC (CH_Three)_TwoO-, -OC ((CH_Two)_ThreeNH_Two ) (CH_Three) O-, -OC (OCH_Three) (CH_TwoCH_TwoCH_Three) O- or -OS (＝ O) A compound of the formula I or a compound forming an O- group A pharmaceutically acceptable salt or prodrug form thereof.   2. The compound of claim 1, wherein the compound is a compound of Formula I.   3. A pharmaceutically acceptable carrier and a therapeutically effective amount of the compound of claim 1. Or a pharmaceutically acceptable salt or prodrug form thereof. Pharmaceutical composition.   4. 4. The composition according to claim 3, wherein the compound is a compound of the formula I.   5. Formula I or a pharmaceutically acceptable salt or prodrug form thereof A use for the manufacture of a medicament for the treatment of HIV infection, The prodrug of Formula I is an epoxide, -OCH, in which two hydroxy groups are attached._Two SCH_TwoO-, -OC (= O) O-, -OCH_TwoO-, -OC (= S) O-, -O C (= O) C (= O) O-, -OC (CH_Three)_TwoO-, -OC ((CH_Two)_ThreeNH_Two ) (CH_Three) O-, -OC (OCH_Three) (CH_TwoCH_TwoCH_Three) O- or -OS (= O) Use which is a compound forming an O- group.   6. 6. Use according to claim 5, wherein the compound is a compound of formula I.   7. Use of a combination of (a) and (b) for the manufacture of a medicament for the treatment of HIV infection And   (A) is a compound of formula I or a pharmaceutically acceptable salt or prodrug thereof ShapeThe prodrug of Formula I is an epoxide, -OCH, in which two hydroxy groups are attached._Two SCH_TwoO-, -OC (= O) O-, -OCH_TwoO-, -OC (= S) O-, -O C (= O) C (= O) O-, -OC (CH_Three)_TwoO-, -OC ((CH_Two)_ThreeNH_Two ) (CH_Three) O-, -OC (OCH_Three) (CH_TwoCH_TwoCH_Three) O- or -OS (= O) a compound forming an O- group,   (B) group consisting of HIV reverse transcriptase inhibitor and HIV protease inhibitor At least one compound selected from Combination use characterized by that.   8. The use according to claim 7, wherein the compound is a compound of the formula I.   9. The reverse transcriptase inhibitor is a nucleoside reverse transcriptase inhibitor. The use according to claim 7.   10. The nucleoside reverse transcriptase inhibitor is AZT, 3TC, ddI, ddC, And d4T, wherein the protease inhibitor is saquinavir, ritonavir, Ndinavir, VX-478, Nelfinavir, KNI-272, CGP-617 10. The method according to claim 9, wherein the member is selected from the group consisting of U.55 and U-103017. Use of.   11. A nucleoside reverse transcriptase inhibitor is selected from AZT and 3TC; Rotase inhibitor is selected from saquinavir, ritonavir, and indinavir Use according to claim 10, characterized in that:   12. The nucleoside reverse transcriptase inhibitor is AZT. Use according to item 11.   13. 12. The method according to claim 11, wherein the protease inhibitor is indinavir. Use as described in.   14． A pharmaceutical kit useful for treating HIV infection, comprising a therapeutically effective amount of   (A) the compound of claim 1,   (B) the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors At least one compound selected from In one or more sterile containers.   15. 15. The composition according to claim 14, wherein component (a) is a compound of formula I. kit.

────────────────────────────────────────────────── ─── Continuation of front page    (81) Designated countries EP (AT, BE, CH, DE, DK, ES, FI, FR, GB, GR, IE, IT, L U, MC, NL, PT, SE), EA (AM, AZ, BY) , KG, KZ, MD, RU, TJ, TM), AM, AU , AZ, BA, BR, BY, CA, CN, CU, CZ, EE, HU, IL, JP, KG, KR, KZ, LC, L T, LV, MD, MX, NO, NZ, PL, RO, RU , SG, SI, SK, TJ, TM, UA, VN (72) Inventor Ram, Patrick, Jukuson.             United States 19317 Pennsylvania             Chad Ford Ridgeway, Oregon             Live 6 (54) [Title of the Invention] (4R, 5S, 6S, 7R) -Hexahydro-1- [5- (3-aminoindazole) methyl                     ] -3-Butyl-5,6-dihydroxy-4,7-bis [phenylmethyl] -2H-1,3-di                     Azepin-2-one and its use as HIV protease inhibitors

Claims (1)

[Claims] 1. A compound of formula I or a pharmaceutically acceptable salt or prodrug form thereof. 2. The compound of claim 1, wherein the compound is a compound of Formula I. 3. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of the compound of claim 1 or a pharmaceutically acceptable salt or prodrug form thereof. 4. 4. The composition according to claim 3, wherein the compound is a compound of the formula I. 5. A method for treating HIV infection, comprising administering a therapeutically effective amount of a compound of Formula I, or a pharmaceutically acceptable salt or prodrug form thereof, to a host in need of such treatment. 6. The method according to claim 5, wherein the compound is a compound of formula I. 7. A method of treating an HIV infection, comprising: (a) a compound of formula I or a pharmaceutically acceptable salt or prodrug form thereof, in a therapeutically effective amount; (B) administering in combination with at least one compound selected from the group consisting of an HIV reverse transcriptase inhibitor and an HIV protease inhibitor to a host in need of such treatment. A method of treating an HIV infection. 8. 8. The method according to claim 7, wherein the compound is a compound of formula I. 9. The method according to claim 7, wherein the reverse transcriptase inhibitor is a nucleoside reverse transcriptase inhibitor. 10. The nucleoside reverse transcriptase inhibitor is selected from AZT, 3TC, ddI, ddC, and d4T, and the protease inhibitor is saquinavir, ritonavir, indinavir, VX-478, nelfinavir, KNI-272, CGP-61755, and U- The method according to claim 9, wherein the method is selected from 103017. 11. 11. The method of claim 10, wherein the nucleoside reverse transcriptase inhibitor is selected from AZT and 3TC and the protease inhibitor is selected from saquinavir, ritonavir, and indinavir. 12. The method according to claim 11, wherein the nucleoside reverse transcriptase inhibitor is AZT. 13. The method according to claim 11, wherein the protease inhibitor is indinavir. 14． A pharmaceutical kit useful for the treatment of HIV infection, comprising a therapeutically effective amount of (a) the compound of claim 1, and (b) an HIV reverse transcriptase inhibitor and an HIV protease inhibitor. A pharmaceutical kit comprising at least one compound selected in one or more sterile containers. 15. 15. The kit according to claim 14, wherein component (a) is a compound of formula I.