JP2002536298A - Bis-amino acid sulfonamide containing N-terminally substituted benzyl group as HIV protease inhibitor - Google Patents

Abstract

The present invention generally relates to bis-amino acids, including substituted benzylamines of formula (I) or their stereoisomers, stereoisomeric mixtures, or pharmaceutically acceptable salts thereof, useful as HIV protease inhibitors The invention relates to sulfonamides, pharmaceutical compositions and diagnostic kits comprising the same, methods of using the same as therapeutic standards or reagents for treating viral infections, or intermediates and methods for purifying the same. Embedded image

Description

DETAILED DESCRIPTION OF THE INVENTION

FIELD OF THE INVENTION The present invention generally relates to bis-amino acid sulfonamides containing substituted benzylamines useful as HIV protease inhibitors, pharmaceutical compositions and diagnostic kits containing the same, and treating viral infections Or its use as an assay standard or reagent.

BACKGROUND OF THE INVENTION Two different retroviruses, human immunodeficiency virus (HIV) type 1 (HIV
Type-1) or type-2 (HIV-2) has been etiologically associated with an immunosuppressive disease, acquired immunodeficiency syndrome (AIDS). HIV seropositive patients are initially asymptomatic but generally present with AIDS-related syndrome (ARC), followed by AIDS. Infected patients exhibit a severe immunosuppressive state and are predisposed to opportunistic infections that weaken and ultimately die.

[0003] AIDS is a disease associated with HIV-1 or HIV- with a unique and complex life cycle.
The end result of two viruses. The life cycle of this virion is based on the binding of the glycoprotein on the surface of the virion protective membrane to the CD4 glycoprotein on lymphocyte cells.
Virions themselves begin by attaching to host human T-4 lymphocyte immune cells. Once attached, the virions shed their glycoprotein membranes, penetrate into the host cell's membrane, and expose their RNA. Virion enzyme, reverse transcriptase,
Transcription to a single-stranded DNA proceeds. The viral RNA is degraded and the second DNA
A chain is created. This double-stranded DNA is then integrated into human cellular genes, and these genes are used for viral replication.

[0004] At this point, RNA polymerase transcribes the incorporated DNA into viral RNA. This viral RNA is translated into the precursor gag-pol fusion polyprotein. This polyprotein is then cleaved by the HIV protease enzyme to produce a mature viral protein. Thus, HIV protease is responsible for controlling the cleavage cascade that matures viral particles into fully infectious viruses.

[0005] The general human immune system response to kill invaded virions is burdensome as the virus infects and kills the immune system T cells. In addition, the viral reverse transcriptase, the enzyme used to form new virion particles, is not very specific and causes transcriptional errors, resulting in constant glycoproteins on the surface of the viral protective membrane. Change. This lack of specificity reduces the effectiveness of the immune system, and therefore, antibodies useful for fighting the virus, since antibodies specifically produced for one glycoprotein are useless for others. Will be reduced. The immune response system continues to weaken while virus replication continues. Eventually, HIV controls the body's immune system almost freely, causing opportunistic infections,
Failure to administer antivirals, immunomodulators, or both can result in death.

[0006] The life cycle of the virus, which has been recognized as a potential target for antiviral agents, is at least three important points: (1) initial attachment of virions to T-4 lymphocyte or macrophage sites, (2) ) Transcription of viral RNA to viral DNA (reverse transcriptase, RT) and (3) processing of gag-pol protein by HIV protease.

[0007] The retroviral genome encodes a protease that is responsible for the proteolytic process of one or more polyprotein precursors, such as the pol and gag gene products. We
llink, Arch. Virol. 98 1 (1988). Retroviral proteases usually process gag precursors into nucleoproteins,
The ol precursor is also processed to reverse transcriptase and retroviral protease.

[0008] Accurate processing of the precursor polyprotein by retroviral protease is required for assembly of infectious virions. Mutagenesis that produces a protease-deficient virus in vitro is known to result in the generation of an immature karyotype lacking infectivity. Crawford et al. J. Virol. 53 899 (1
985), Katoh et al. , Virology 145 280 (1
985). Therefore, retroviral protease inhibition is a good target for antivirus. Mitsuya, Nature 325 775
(1987).

[0009] A wide variety of compounds are being studied as potential HIV protease inhibitors, as currently marketed or evidenced by protease inhibitors in clinical trials. Hydroxyethylamino-sulfonamide has been in the spotlight as one topical topic. For example, PCT applications WO94 / 05639, WO94 / 0
4492, WO 95/06030, and WO 96/28464 generally have the formula

[0010]

Embedded image

[0011] Sulfonamides and methods for their preparation are described. While some of the compounds of the present invention fall within the general description of some of the above references,
It is not specifically disclosed, presented or claimed.

[0012] Despite the recent success of protease inhibitors, it has been discovered that HIV patients may become resistant to a single protease inhibitor. Therefore, H
There is a need for the development of other protease inhibitors that overcome IV infection.

[0013] Accordingly, one object of the present invention is to provide a novel protease inhibitor.

Another object of the present invention is to provide an HIV infection comprising administering a therapeutically effective amount of at least one compound of the present invention or a pharmaceutically acceptable salt thereof to a host in need of such treatment. Is to provide a new treatment method.

Another object of the present invention is to provide a therapeutically effective amount of (a) one of the compounds of the present invention and (b)
To provide a novel method of treating HIV infection comprising administering to a host in need of such treatment one or more compounds selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors It is.

Another object of the invention is a pharmaceutical composition having reverse transcriptase inhibitory activity, comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of at least one compound of the invention or a pharmaceutically acceptable salt thereof. It is to provide things.

Another object of the present invention is to provide a method of inhibiting HIV present in a body fluid sample, comprising treating the body fluid sample with an effective amount of a compound of the present invention.

Another object of the present invention is to provide an effective amount of a book for use as a standard or reagent in a test or assay that measures the ability of a drug to inhibit HIV protease, HIV growth or both. It is to provide a kit or container comprising at least one compound of the invention.

These and other objects which will become apparent in the following detailed description are compounds of formula (I) wherein R ¹ , R ² and R ³ are defined below,

[0020]

Embedded image

[0021] The inventors have discovered that stereoisomeric forms, mixtures of stereoisomeric forms, or their pharmaceutically acceptable salt forms are effective protease inhibitors.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS [1] Thus, in a first embodiment, the present invention provides novel compounds of Formula I, or pharmaceutically acceptable salt forms thereof,

[0023]

Embedded image

Wherein R ¹ is F, R ² is F or H, R ³ is 4-aminophenyl, 3-aminophenyl, 2,3-dihydrobenzofuran-5-yl, and 1,3 -Benzodioxol-5-yl.

[2] In a preferred embodiment, the present invention provides a novel compound of formula II.

[0026]

Embedded image

[3] In a further preferred embodiment, the present invention provides a novel compound of formula IIa

[0028]

Embedded image

[4] In a further preferred embodiment, the present invention provides a novel compound of formula IIa
Wherein R ³ is 3-aminophenyl.

[5] In another more preferred embodiment, the present invention provides novel compounds of formula IIa, wherein R ³ is 4-aminophenyl.

[6] In yet another preferred embodiment, the present invention provides a novel compound of formula Ha wherein R ³ is 2,3-dihydrobenzofuran-5-yl or 1,3-benzodioxy Sole-5-yl.

[7] In yet another preferred embodiment, the present invention provides novel compounds of formula IIb.

[0033]

Embedded image

[8] In yet another preferred embodiment, the invention provides novel compounds of formula IIb, wherein R ³ is 3-aminophenyl.

[9] In another more preferred embodiment, the invention provides novel compounds of formula IIb, wherein R ³ is 4-aminophenyl.

[10] In yet another preferred embodiment, the present invention provides a novel compound of formula IIa, wherein R ³ is 2,3-dihydrobenzofuran-5-yl or 1,3-benzodioxy Sole-5-yl.

[11] In yet another preferred embodiment, the present invention provides novel compounds of formula IIc.

[0038]

Embedded image

[12] In yet another preferred embodiment, the present invention provides novel compounds of formula IIc, wherein R ³ is 3-aminophenyl.

[13] In another more preferred embodiment, the invention provides novel compounds of formula IIc, wherein R ³ is 4-aminophenyl.

[14] In yet another preferred embodiment, the invention provides novel compounds of formula IIc, wherein R ³ is 2,3-dihydrobenzofuran-5-yl or 1,3-benzodioxy Sole-5-yl.

[15] In yet another preferred embodiment, the present invention provides novel compounds of formula III.

[0043]

Embedded image

[16] In yet another preferred embodiment, the present invention provides novel compounds of formula IIIa.

[0045]

Embedded image

[17] In yet another preferred embodiment, the present invention provides novel compounds of formula IV.

[0047]

Embedded image

[18] In yet another preferred embodiment, the present invention provides novel compounds of formula IVa.

[0049]

Embedded image

In another embodiment, the present invention provides novel pharmaceutical compositions comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof.

In another embodiment, the present invention provides a novel method of treating HIV, comprising administering a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof to a host in need of such treatment. I will provide a.

[0052] In another embodiment, the invention provides a therapeutically effective amount of (a) a compound of formula I, and (b) at least one selected from the group consisting of an HIV reverse transcriptase inhibitor and an HIV protease inhibitor. There is provided a method of treating HIV infection, comprising administering the compounds in combination to a host in need thereof.

In another preferred embodiment, the reverse transcriptase inhibitor is AZT, ddC, ddI, d
4T, 3TC, Delavirbin, Efavirenz, Nevirapine, Ro18893,
Trovirdine, MKC-442, HBY097, AC
T, UC-781, UC-782, RD4-2025, and MEN10979
Selected from the group consisting of: saquinavir, ritonavir, indinavir, amprenavir, nelfinavir, palinavir,
BMS-232623, GS3333, KNI-413, KNI-272, LG
-71350, CGP-61755, PD173606, PD177298, P
D178390, PD178392, U-140690, and ABT-378
Selected from the group

In a further preferred embodiment, the reverse transcriptase inhibitor is AZT, efavirenz,
And 3TC, and the protease inhibitor is selected from the group of saquinavir, ritonavir, nelfinavir, and indinavir.

[0055] In a further preferred embodiment, the reverse transcriptase inhibitor is AZT.

[0056] In a further preferred embodiment, the reverse transcriptase inhibitor is ritonavir.

In another preferred embodiment, component (b) is an HIV reverse transcriptase inhibitor and HI
V protease inhibitor.

In another preferred embodiment, component (b) is two different HIV reverse transcriptase inhibitors.

In another embodiment, the present invention provides a therapeutically effective amount of (a) a compound of formula I, and (b) an HIV reverse transcriptase inhibitor and an HI in one or more sterile containers.
There is provided a pharmaceutical composition useful for treating HIV infection, comprising at least one compound selected from the group consisting of V protease inhibitors.

In another embodiment, the present invention provides a novel method of inhibiting HIV present in a body fluid sample, comprising treating the body fluid sample with an effective amount of a compound of formula I.

In a ninth embodiment, the invention is useful for use as a standard or reagent in a test or assay that measures the ability of a drug to inhibit HIV protease, HIV proliferation, or both. Novel kits or containers are provided which contain an effective amount of a compound of formula I.

Definitions As used herein, the following terms and expressions have the indicated meanings. The compounds of the present invention contain asymmetrically substituted carbon atoms and can be isolated as optically active or racemic forms. Methods for preparing optically active forms, such as by resolution or synthesis of racemates from optically active starting materials, are well known to those skilled in the art. Unless a particular stereochemical form or isomer is specifically indicated, all chiral, diastereomeric, racemic, and geometric isomer forms of a structure are intended to be included.

The method of the invention is intended to be performed at least on a scale of several grams, on a kilogram scale, on a several kilogram scale, or on an industrial scale. As used herein, a few gram scale preferably means a scale in which at least one starting material is present in at least 10 grams, more preferably at least 50 grams, even more preferably at least 100 grams. As used herein, a few kilogram scale is intended to mean a scale that uses at least one starting material in one kilogram or more. As used herein, industrial scale, unlike laboratory scale, is intended to mean scale sufficient to provide sufficient product for either clinical trials or sale to consumers.

The present invention is intended to include all isotopes of atoms occurring in the present compounds. Isotopes include those atoms having the same atomic number but different atomic weights. By way of non-limiting general example, hydrogen isotopes include tritium and deuterium. Carbon isotopes include C-13 and C-14.

As used herein, “HIV reverse transcriptase inhibitor” is intended to refer to both nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT).
Examples of nucleoside RT inhibitors include, but are not limited to, AZT, ddC, ddI,
d4T, and 3TC. Examples of non-nucleoside RT inhibitors include, but are not limited to, delavirubin (Pharmacia and UpJohn, U90
152S), efavirenz (Dupont), nevirapine (Boehringer)
Ingelheim), Ro 18,893 (Roche), Trovirzine (L
illy), MKC-442 (Triangle), HBY097 (Hoech)
st), HBY1293 (Hoechst), ACT (Korean Rese
Rach Institute), UC-781 (Rega Institute)
e), UC-782 (Rega Institute), RD4-2020 (T
osoh Co Ltd. ), And MEN10979 (Menarini F
armaceutici).

As used herein, “HIV protease inhibitor” is intended to mean a compound that inhibits HIV protease. Examples include, but are not limited to, saquinavir (Roche, Ro31-8959), ritonavir (Abbott, ABT-5).
38), indinavir (Merck, MK-639), amprenavir (Ver
tex / Glaxo Wellcome), Nelfinavir (Agouron,
AG-1343), Parinavir (Boehringer Ingelheim)
, BMS-232623 (Bristol-Myers Squibb), GS
3333 (Gilead Sciences), KNI-413 (Japan
Energy), KNI-272 (Japan Energy), LG-713
50 (LG Chemical), CGP-61755 (Ciba-Geigy)
), PD173606 (Park Davis), PD177298 (Par
ke Davis), PD178390 (Parke Davis), PD17
8392 (Parke Davis), tipranavir (tipranavir)
(Pharmacia and Upjohn, U-140690), DMP-
450 (DuPont) and ABT-378.

As used herein, “pharmaceutically acceptable salt” refers to a disclosed compound derivative wherein the parent compound has been modified by forming an acid or base salt thereof. Examples of pharmaceutically acceptable salts include, but are not limited to, inorganic or organic acid salts of bases such as amines, and inorganic or organic acid salts of acid groups such as carboxylic acids. The pharmaceutically acceptable salts include the usual non-toxic or quaternary ammonium salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. For example, such common non-toxic salts include salts derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, and nitric acids, and acetic, propionic, and succinic acids. , Glycolic acid, stearic acid, lactic acid, malic acid, tartaric acid, citric acid, ascorbic acid, pamoic acid, maleic acid, hydroxymaleic acid, phenylacetic acid, glutamic acid, benzoic acid, salicylic acid, sulfanilic acid, 2-acetoxybenzoic acid, fumaric acid Included are salts prepared from organic acids such as acids, toluenesulfonic acid, methanesulfonic acid, ethanedisulfonic acid, oxalic acid, and isethionic acid.

The pharmaceutically acceptable salts of the present invention can be synthesized from the parent compound that contains a basic or acidic moiety by conventional chemical methods. Generally, such salts will react the free acid or free base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or an organic solvent or a mixture of the two. And non-aqueous solvents such as ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are generally preferred. Examples of suitable salts are described in "Remington's Ph.," The disclosure of which is incorporated herein by reference.
armaceutical Sciences, 17th Edition, Mack Publi
shing Company, Easton, PA, 1985, p. 1418.

The phrase “pharmaceutically acceptable” is used herein to mean, within the scope of sound medical judgment and, depending on a reasonable profit / loss ratio, excessive toxicity, inflammation, allergic response, or other problems or Used to indicate compounds, materials, compositions, and / or dosage forms suitable for use in contact with human and animal tissues without complications.

“Prodrug” refers to an active parent compound of formula (I) or another formula or a compound of the invention, when administered to a mammalian subject, in vivo.
And a covalently bonded carrier that is released at A prodrug of the compound of the invention,
For example, Formula (I) may be used to modify the functional groups present on a compound by conventional procedures or in vivo.
Prepared by modifying the modification to be cleaved to the parent compound at any of o. Prodrugs include compounds of the present invention that are cleaved to form free hydroxyl or free amino groups, respectively, when a prodrug of the present invention in which a hydroxyl group or an amino group is bound to any group is administered to a mammalian subject. Is included. Examples of prodrugs include, but are not limited to, acetate, formate and benzoate derivatives of the alcohol and amine functions of the compounds of the present invention.

“Stable compound” and “stable structure” refer to a compound that is robust enough to be purified from a reaction mixture to a useful degree of purity and to be formulated into an effective therapeutic agent. means. Only stabilizing compounds are considered in the present invention.

“Substituted” means that one or more hydrogens on the atom indicated in the expression using “substituted” are replaced by substitutions without exceeding the stated normal valency. Means substituted with one selected from the designated group (s), provided that a stable compound results. When the substituent is a keto group (ie, ＯO), two hydrogens on the atom have been replaced.

A “therapeutically effective amount” is an amount of a compound of the present invention or a combined amount of the claimed compounds effective to inhibit HIV infection in the host or treat symptoms of HIV infection. Shall be included. This combination of compounds is preferably a synergistic combination. Synergy is described, for example, in Chou and Talalay, Adv. E
nzyme Regul. 22: 27-55 (1984), the effect of a compound when administered in combination (in this case, inhibition of HIV replication) is less than the additive effect of a compound when administered alone. It appears when it exceeds even. In general, synergy is most clearly demonstrated at suboptimal concentrations of the compound. Synergy can be a combined effect compared to the individual components with respect to reduced cytotoxicity, increased antiviral effect, or some other effective effect.

One diastereomer of a compound of Formula I may exhibit superior activity compared to others. If necessary, Thomas J. et al. Tucker, et
al, J. et al. Med. Chem. As in 1994, 37, 2437-2444,
Separation of the racemate can be carried out by HPLC using a chiral column or by decomposition using a decomposing agent such as camphor chloride. Asymmetric compounds of the formula I can also be synthesized directly using asymmetric catalysts or asymmetric ligands, see for example Mark A. et al. Huffman, et al. Org. Chem. 19
95, 60, 1590-1594.

Other features of the present invention will become apparent in the following description of exemplary embodiments, which are intended to be illustrative of the invention and not limiting.

EXAMPLES The abbreviations used in the examples are defined as follows. “° C.” is Celsius, “d” is a double line, “dd” is a double line of a double line, “eq” is equivalent or equivalent (s), “g” is gram or gram (s), “mg”. "Is milligrams or milligrams
, “ML” is milliliter or milliliter (s), “H” is hydrogen or hydrogen (s), “hr” is time or time (s), “m” is multiplet, “M” is mole, “min” Is minutes or minutes, "MHz" is megahertz, "MS" is mass spectrometry, "nmr" or "NMR" is nuclear magnetic resonance spectrum, "t" is triplet, and "TLC" is thin layer chromatography.

[0077]

Embedded image

1B N- [3 (S)-[N, N-bis (phenylmethyl) amino] -2 (S) dissolved in toluene (1 L), water (500 mL) and CH ₂ Cl ₂ (400 mL)
) -Hydroxy-4-phenylbutyl] -N-isobutylamine oxalate 1A
(127.6 g, 251 mmol) in NaOH (50% aqueous solution, 44.5).
g) was added. After stirring for 10 minutes, the reaction mixture was extracted with toluene. The combined organic layers were washed with brine, dried (MgSO ₄₎ and the solvent was removed under reduced pressure. The residue was dissolved in THF (1 L), cooled to 0 ° C., and triethylamine (2
8.15 g, 278 mmol) and di-tert-butyl dicarbonate (5
5.23 g, 253 mmol). The solution was warmed to room temperature and stirred overnight. The solvent was removed under reduced pressure and the residue was dissolved with EtOAc (1 L), washed with water, 5% citric acid, water, saturated NaHCO ₃ , brine and dried (MgSO ₄ ). The solvent was removed under reduced pressure to give the carbamate 1B, which was used directly without further purification. _{CIMS (NH 3) m / z} : 517 (M + H +, 100%).

To crude 1B (estimated 251 mmol) dissolved in 1C methanol (500 mL),
Palladium hydroxide on carbon (20%, 10 g) was added. The suspension was placed in a pearl bottle and filled with hydrogen (55 psi). After shaking overnight, the reaction mixture was filtered through celite and the solvent was concentrated under reduced pressure. The resulting solid was recrystallized (EtOAc / hexane) to give amine 1C as a white solid (56.6 g,
67% (two _{steps)): CIMS (NH 3)} m / z: 337 (M + H +, 100%)
.

N-carbobenzyloxy-L-ter dissolved in 1D DMF (250 mL)
N-Hydroxybenzotriazole (38.6 g, 285 mmol) and EDC (35.7 g, 186) were added to t-leucine (47.5 g, 179 mmol) at 0 ° C.
mmol) was added. After stirring for 1.5 hours, the solution was added to DMF (200 mL
To a suspension of 1C (56.6 g, 167 mmol) and 4-methylmorpholine (52.9 g, 521 mmol). The reaction mixture was warmed to room temperature. After stirring overnight, N, N-dimethylethylenediamine (4 mL) was added, the solution was stirred for 1.5 hours and the solvent was removed under reduced pressure. The residue was treated with EtOAc (
1 L), washed with water, 5% acetic acid, water, saturated NaHCO ₃ , and brine,
Dried (MgSO ₄ ). The solvent was removed under reduced pressure and 1D (97.5 g, 100
%) And used without further purification. _{CIMS (NH 3) m / z} : 584 (M
+ H ⁺ , 100%).

1E 1D (97.5 g, 167 mmol) dissolved in methanol (300 mL)
) Is added to palladium hydroxide on carbon (20%, 10 g). The suspension is placed in a pearl bottle and filled with hydrogen (55 psi). After shaking overnight, the reaction mixture is filtered through celite and the solvent is removed under reduced pressure. The resulting solid was recrystallized (EtOAc / hexane) to give amine 1E as a white solid (72
. 8g, 97%). _{CIMS (NH 3) m / z} : 450 (M + H +, 100%).

Amine 1E dissolved in 1F EtOAc (400 mL) and water (270 mL)
(43.8 g, 97.6 mmol) in a solution of KHCO ₃ (27.7 g, 276
mmol) and chloroacetyl chloride (12.4 g, 111 mmol) were added. After stirring for 3 hours, EtOAc (1 L) was added and the solution was washed with water, 5% citric acid, water, saturated NaHCO ₃ , brine and dried (MgSO ₄ ). The solvent was removed under reduced pressure to give 1F as a white solid (51.0 g, 99%). CIMS
_{(NH 3) m / z:} 526 (M + H +, 100%).

1F (33.8 g, 64.2 mmol) in 1 G EtOAc (600 mL)
4) HCl in dioxane (80 mL, 320 mmol)
Was added and the reaction mixture was stirred for 6 hours. The solvent was removed under reduced pressure and the resulting solid was triturated with cold ether to give hydrochloride salt 1G (28.75 g, 97%). CIM
_{S (NH 3) m / z} : 426 (M + H +, 100%).

1G (32.0) dissolved in 1H THF (350 mL) and water (450 mL)
g, to a solution of _{69.2mmol), K 2 CO 3 (} 56.7g, 411mmol) and 4-nitrobenzenesulfonyl chloride (16.9 g, 76.0 mmol)
Was added. After stirring for 4 hours, water was added and the suspension was extracted with EtOAc.
The combined organic layers were washed with brine, 5% citric acid, water, saturated NaHCO ₃ , brine and dried (MgSO ₄ ). The solvent was removed under reduced pressure and the resulting solid was recrystallized (EtOAc / hexane) to give the sulfonamide 1H as a white solid (
35.8 g, 85%). _{CIMS (NH 3) m / z} : 611 (M + H +, 100%
).

Chloride 1H (16.0 g, 26.1 mm) dissolved in 1I THF (200 mL)
ol) in a solution of 3-fluorobenzylamine (20.0 g, 160 mmol)
Was added and the reaction mixture was refluxed overnight. The solvent was removed under reduced pressure and the residue was
c, washed with water, brine and dried (MgSO ₄ ). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 4% methanol / CH ₂ Cl ₂ ) to give amine 1I as a white solid (16.3 g, 89%). CIMS (
_{NH 3) m / z: 700} (M + H +, 100%).

1I (14.6 g, 20.8 mmol) dissolved in methanol (500 mL)
)), Palladium hydroxide on carbon (20%, 1.5 g) was added and the reaction mixture was filled with hydrogen. After stirring for 3 hours, the mixture was filtered through celite and the solvent was removed under reduced pressure. The residue was chromatographed (silica gel, 5% methanol /
CH ₂ Cl ₂ ) to give the amine as a white solid (13.2 g, 95%).
Free base dissolved in ether (300 mL) and EtOAc (100 mL)
11.68 g, 17.4 mmol) in a solution of 1N HCl in ether (
(37 mL, 37 mmol) was added. The resulting suspension was stirred for 15 minutes and filtered to give bishydrochloride 1 as a white solid (12.5 g, 96%). CIMS
_{(NH 3) m / z:} 670 (M + H +, 100%).

[0087]

Embedded image

Chloride 1H (16.0 g, 26.1 mm) dissolved in 2A THF (200 mL)
ol) in a solution of 3,5-difluorobenzylamine (25.0 g, 174 mm).
ol) was added and the reaction mixture was refluxed overnight. The solvent was removed under reduced pressure and the residue
Dissolved in tOAc, washed with water, brine and dried (MgSO ₄ ). The solvent was removed under reduced pressure, and the residue was chromatographed (silica gel, 4% methanol / CH ₂ Cl ₂ ).
To give amine 2A as a white solid (15.2 g, 81%). CIMS
_{(NH 3) m / z:} 718 (M + H +, 100%).

2A (15.2 g, 21.2 mmol) dissolved in methanol (500 mL)
)), Palladium hydroxide on carbon (20%, 1.5 g) was added and the reaction mixture was filled with hydrogen. After stirring for 4 hours, the mixture was filtered through celite and the solvent was removed under reduced pressure. The residue was chromatographed (silica gel, 5% methanol /
CH ₂ Cl ₂ ) to give the amine as a white solid (10.3 g, 71%).
To a solution of the free base in ether (300 mL) and EtOAc (100 mL) was added 1N HCl in ether (32 mL, 32 mmol). The resulting suspension was stirred for 15 minutes, filtered and bishydrochloride 2 as a white solid.
I got _{CIMS (NH 3) m / z} : 688 (M + H +, 100%).

[0090]

Embedded image

Chloride 1H (300 mg, 0.49 mmol) dissolved in 3A THF (4 mL)
) In the solution of 2,5-difluorobenzylamine (1.2 g, 8.5 mmol)
Was added and the reaction mixture was refluxed for 4 hours. The reaction mixture was diluted with EtOAc, washed with water, brine, dried (MgSO _4). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give amine 3A as a white solid (270 mg, 77%). CIMS (NH ₃ ) m
/ Z: 718 (M + H ⁺ , 100%).

3A (260 mg, 0.36 mmol) dissolved in methanol (25 mL)
To a solution of was added palladium hydroxide on carbon (20%, 50 mg) and the reaction mixture was filled with hydrogen. After stirring for 1 hour, the mixture was filtered through celite and the solvent was removed under reduced pressure. The residue is chromatographed (silica gel, 5% methanol / C
H ₂ Cl ₂ ) to give the amine as a white solid (226 mg, 91%). To a solution of the free base in ether (30 mL) and EtOAc (10 mL) was added 4N HCl (0.2 mL, 0.8 mmol) in dioxane. The resulting suspension was stirred for 15 minutes, filtered and bishydrochloride 3 as a white solid.
I got _{CIMS (NH 3) m / z} : 688 (M + H +, 100%).

[0093]

Embedded image

Chloride 1H (300 mg, 0.49 mmol) dissolved in 4A THF (4 mL)
) In the solution of 2,6-difluorobenzylamine (1.2 g, 8.5 mmol)
Was added and the reaction mixture was refluxed for 4 hours. The reaction mixture was diluted with EtOAc, washed with water, brine, dried (MgSO _4). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give amine 4A as a white solid (306 mg, 87%). CIMS (NH ₃ ) m / z
: 718 (M + H ⁺ , 100%).

4A (295 mg, 0.41 mmol) dissolved in methanol (25 mL)
To a solution of was added palladium hydroxide on carbon (20%, 50 mg) and the reaction mixture was filled with hydrogen. After stirring for 1 hour, the mixture was filtered through celite and the solvent was removed under reduced pressure. The residue is chromatographed (silica gel, 5% methanol / C
H ₂ Cl ₂ ) to give the amine as a white solid (228 mg, 81%). To a solution of the free base in ether (30 mL) and EtOAc (10 mL) was added 4N HCl (0.2 mL, 0.8 mmol) in dioxane. The resulting suspension was stirred for 15 minutes, filtered and bishydrochloride 4 as a white solid.
I got _{CIMS (NH 3) m / z} : 688 (M + H +, 100%).

[0096]

Embedded image

Salt 1G dissolved in 5A THF (300 mL) and water (400 mL) (28.
8 g, 62.1 mmol) in a solution of K ₂ CO ₃ (51.4 g, 370 mmol).
And 3-nitrobenzenesulfonyl chloride (15.14 g, 68.3 mmol
l) was added. After stirring for 4 hours, water was added and the suspension was extracted with EtOAc. The combined organic layers were washed with brine, 5% citric acid, water, saturated NaHCO ₃ , brine and dried (MgSO ₄ ). The solvent was removed under reduced pressure and the resulting solid was triturated with EtOAc and hexane to give sulfonamide 5A as a white solid (32.1 g, 85%). _{CIMS (NH 3) m / z} : 611 (M + H +, 1
00%).

Chloride 5A (16.0 g, 26.1 mm) dissolved in 5B THF (200 mL)
ol) in a solution of 3-fluorobenzylamine (17.0 g, 135 mmol)
Was added and the reaction mixture was refluxed overnight. The solvent was removed under reduced pressure and the residue was
c, washed with water, brine and dried (MgSO ₄ ). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 4% methanol / CH ₂ Cl ₂ ) to give amine 5B as a white solid (16.0 g, 87%). CIMS (
_{NH 3) m / z: 700} (M + H +, 100%).

5B (12.0 g, 17.22 mmol) dissolved in methanol (400 mL)
To the solution of 1), palladium hydroxide on carbon (20%, 1.25 g) was added and the reaction mixture was filled with hydrogen. After stirring for 3 hours, the mixture was filtered through celite,
The solvent was removed under reduced pressure. The residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give the amine as a white solid (11.2 g, 97%
). To a solution of the free base in ether (400 mL) and EtOAc (75 mL) was added IN HCl (36 mL, 36 mmol) in ether. The resulting suspension was stirred for 15 minutes and filtered to give bis hydrochloride 5 as a white solid. _{CIMS (NH 3) m / z} : 670 (M + H +, 100%).

[0100]

Embedded image

Chloride 5A (16.0 g, 26.1 mm) dissolved in 6A THF (200 mL)
ol) in a solution of 3,5-difluorobenzylamine (25.0 g, 174 mm).
ol) was added and the reaction mixture was refluxed overnight. The solvent was removed under reduced pressure and the residue
Dissolved in tOAc, washed with water, brine and dried (MgSO ₄ ). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 3.5% methanol / CH ₂ C).
l ₂ ) to give the amine 6A as a white solid (15.6 g, 83%). C
_{IMS (NH 3) m / z} : 718 (M + H +, 100%).

6A (14.4 g, 20.0 mmol) dissolved in methanol (500 mL)
)), Palladium hydroxide on carbon (20%, 1.5 g) was added and the reaction mixture was filled with hydrogen. After stirring for 4 hours, the mixture was filtered through celite and the solvent was removed under reduced pressure. The residue was chromatographed (silica gel, 5% methanol /
CH ₂ Cl ₂ ) to give the amine as a white solid (12.5 g, 91%).
Free base (9.57 g, 13.9 mmol) dissolved in ether (300 mL)
To a solution of 1N HCl in ether (31 mL, 31 mmol) was added. The resulting suspension was stirred for 20 minutes and filtered to give bis hydrochloride 6 as a white solid (9.9 g, 94%). _{CIMS (NH 3) m / z} : 688 (M + H +,
100%).

[0103]

Embedded image

7 N- [2R-hydroxy-3-[[(2,3-
Dihydro2,3-dihydrobenzofuran-5-yl) sulfonyl] (2-methyl
Propyl) amino] -1S- (phenylmethyl) propyl] -2S-[(chloro
Acetyl) amino] -3,3-dimethylbutanamide 7A (100 mg, 0.1
6 mmol), 3-fluorobenzylamine (550 mg, 4.4 mmol)
Was added and the reaction mixture was refluxed for 6 hours. Dilute the reaction mixture with EtOAc
, Water (4x), brine and dried (MgSO4)._Four). Solvent removed under reduced pressure
And the residue is chromatographed (silica gel, 5% methanol / CH)_TwoCl_Two)
The amine 1I was obtained as a white solid (91 mg, 79%). Ether (25
solution of the free base (91 mg, 0.13 mmol) in
4N HCl (0.05 mL, 0.20 mmol) dissolved in toluene was added. 10
After stirring for minutes, the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered.
The hydrochloride 7 was obtained as a white solid (72 mg, 65%). CIMS (NH _Three ) M / z: 697 (M + H⁺, 100%).

[0105]

Embedded image

To a solution of 7A (100 mg, 0.16 mmol) in 8 THF (2 mL) was added 3,5-difluorobenzylamine (605 mg, 4.2 mmol) and the reaction mixture was refluxed for 6 hours. Dilute the reaction mixture with EtOAc and add water (
4 ×), washed with brine and dried (MgSO ₄ ). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give the amine as a white solid (83 mg, 70%). To a solution of the free base (83 mg, 0.11 mmol) in ether (25 mL) was added 4N HCl (0.05 mL, 0.20 mmol) in dioxane. After stirring for 10 minutes, the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give hydrochloride 8 as a white solid (65 mg, 75%). Analysis _{(C 37 H 49 N 4 O} 6 S 1 F 2 Cl 1): Calculated: C, 59.15; H, 6.45 ; N, 7.47. Found: C, 58.90; H, 6.51; N, 7.21.

[0107]

Embedded image

To a solution of 7A (100 mg, 0.16 mmol) in 9 THF (2 mL) was added 2,5-difluorobenzylamine (610 mg, 4.3 mmol) and the reaction mixture was refluxed for 6 hours. The reaction mixture was diluted with EtOAc,
Washed with water (4 ×), brine and dried (MgSO ₄ ). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give the amine as a white solid (110 mg, 93%). Ether (25 mL
To a solution of the free base (110 mg, 0.15 mmol) dissolved in 4) was added 4N HCl (0.05 mL, 0.20 mmol) dissolved in dioxane. After stirring for 10 minutes, the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give hydrochloride 9 as a white solid (76 mg, 66%). CIMS (NH ₃
) M / z: 715 (M + H ⁺ , 100%).

[0109]

Embedded image

To a solution of 7A (100 mg, 0.16 mmol) in 10 THF (2 mL) was added 2,6-difluorobenzylamine (600 mg, 4.2 mmol) and the reaction mixture was refluxed for 6 hours. The reaction mixture was diluted with EtOAc, water (4 ×), washed with brine, dried (MgSO _4). The solvent is removed under reduced pressure,
The residue is chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ )
The amine was obtained as a white solid (103 mg, 87%). Ether (25 mL)
To a solution of the free base (103 mg, 0.14 mmol) dissolved in dioxane was added 4N HCl (0.05 mL, 0.20 mmol) dissolved in dioxane. After stirring for 10 minutes, the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give hydrochloride 10 as a white solid (82 mg, 76%). CIMS (NH ₃
) M / z: 715 (M + H ⁺ , 100%).

[0111]

Embedded image

11 N- [2R-Hydroxy-3-[[((1,3
-Benzodioxol-5-yl) sulfonyl] (2-methylpropyl) amino] -1S- (phenylmethyl) propyl] -2S-[(chloroacetyl) amino] -3,3-dimethylbutanamide 11A (750 mg) , 1.23 mmol), 3-fluorobenzylamine (1.1 g, 8.8 mmol) was added and the reaction mixture was stirred overnight. The reaction mixture was diluted with EtOAc, water (4 ×), washed with brine, dried (MgSO _4). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give the amine as a white solid (532 mg, 62%). To a solution of the free base (532 mg, 0.76 mmol) in ether (100 mL) was added 4N dissolved in dioxane.
HCl (0.22 mL, 0.88 mmol) was added. After stirring for 10 minutes, the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give hydrochloride 11 as a white solid (417 mg, 75%). _{CIMS (NH 3) m / z} :
699 (M + H ⁺ , 100%).

[0113]

Embedded image

To a solution of 11A (2.0 g, 3.27 mmol) in 12 THF (7 mL) was added 3,5-difluorobenzylamine (2.42 mg, 16.9 mmol).
Was added and the reaction mixture was refluxed for 5 hours. The reaction mixture was diluted with EtOAc, water (4 ×), washed with brine, dried (MgSO _4). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give the amine as a white solid (2.26 g, 97%). Ether (100
To a solution of the free base (1.8 g, 2.51 mmol) dissolved in 4 mL) was added 4N HCl (0.66 mL, 2.67 mmol) dissolved in dioxane. 10
After stirring for minutes, the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give hydrochloride 12 as a white solid (1.65 g, 87%). CIMS (
_{NH 3) m / z: 717} (M + H +, 100%). Analysis results (C ₃₆ H ₄₇ N ₄ O ₇ S ₁
F ₂ Cl _1): Calculated: C, 57.40; H, 6.17 ; N, 7.45. Measured value:
C, 57.25; H, 6.25; N, 7.24.

[0115]

Embedded image

To a solution of 11A (750 mg, 1.23 mmol) in 13 THF (2 mL) was added 2,5-difluorobenzylamine (1.2 g, 8.5 mmol) and the reaction mixture was refluxed for 6 hours. did. The reaction mixture was diluted with EtOAc, water (4 ×), washed with brine, dried (MgSO _4). The solvent is removed under reduced pressure,
The residue is chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ )
The amine was obtained as a white solid (702 mg, 80%). Ether (100 mL
To a solution of the free base (702 mg, 0.98 mmol) dissolved in 4) was added 4N HCl (0.3 mL, 1.2 mmol) dissolved in dioxane. After stirring for 10 minutes, the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give hydrochloride 13 as a white solid (586 mg, 79%). CIMS (NH ₃
) M / z: 717 (M + H ⁺ , 100%).

[0117]

Embedded image

To a solution of 11A (750 mg, 1.23 mmol) in 14 THF (2 mL) was added 2,6-difluorobenzylamine (1.2 g, 8.3 mmol) and the reaction mixture was refluxed for 6 hours. did. The reaction mixture was diluted with EtOAc, water (4 ×), washed with brine, dried (MgSO _4). The solvent is removed under reduced pressure,
The residue is chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ )
The amine was obtained as a white solid (717 mg, 81%). Ether (100 mL
To a solution of the free base (717 mg, 1.00 mmol) dissolved in 4) was added 4N HCl (0.3 mL, 1.2 mmol) dissolved in dioxane. After stirring for 10 minutes, the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give hydrochloride 14 as a white solid (663 mg, 88%). CIMS (NH ₃
) M / z: 717 (M + H ⁺ , 100%).

[0119]

Embedded image

To a solution of 11A (750 mg, 1.23 mmol) in 15 THF (2 mL) was added 3,4-difluorobenzylamine (1.2 g, 8.3 mmol) and the reaction mixture was refluxed for 3 hours did. The reaction mixture was diluted with EtOAc, water (4 ×), washed with brine, dried (MgSO _4). The solvent is removed under reduced pressure,
The residue is chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ )
The amine was obtained as a white solid (760 mg, 86%). Ether (100 mL
To a solution of the free base (760 mg, 1.06 mmol) dissolved in 4) was added 4N HCl (0.3 mL, 1.2 mmol) dissolved in dioxane. After stirring for 10 minutes, the resulting solid was filtered to give hydrochloride 15 as a white solid (730m
g, 91%). _{CIMS (NH 3) m / z} : 717 (M + H +, 100%).

[0121]

Embedded image

To a solution of 11A (750 mg, 1.23 mmol) in 16 THF (2 mL) was added 2,4-difluorobenzylamine (1.2 g, 8.3 mmol) and the reaction mixture was refluxed for 6 hours. did. The reaction mixture was diluted with EtOAc, water (4 ×), washed with brine, dried (MgSO _4). The solvent is removed under reduced pressure,
The residue is chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ )
The amine was obtained as a white solid (693 mg, 79%). Ether (100 mL
To a solution of the free base (693 mg, 0.97 mmol) dissolved in) was added 4N HCl (0.3 mL, 1.2 mmol) dissolved in dioxane. After stirring for 10 minutes, the resulting solid was filtered to give hydrochloride 16 as a white solid (638).
mg, 88%). _{CIMS (NH 3) m / z} : 717 (M + H +, 100%).

[0123]

Embedded image

To a solution of 11A (500 mg, 0.82 mmol) in 17 THF (2 mL) was added 4-fluorobenzylamine (1.0 g, 8.0 mmol),
The reaction mixture was stirred overnight. Dilute the reaction mixture with EtOAc and add water (4 ×)
Washed with brine and dried (MgSO ₄ ). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give the amine as a white solid (470 mg, 82%). To a solution of the free base (400 mg, 0.57 mmol) in ether (30 mL) was added 4N HCl (0.18 mL, 0.7 mmol) in dioxane. After stirring for 15 minutes, the resulting solid was filtered to give hydrochloride 17 as a white solid (413 mg, 98
%). _{CIMS (NH 3) m / z} : 699 (M + H +, 100%).

Use The compounds of formula (I) have HIV protease inhibitory activity and
It is useful as an antiviral in the treatment of infectious diseases and related diseases. formula(
The compound of I) has HIV protease inhibitory activity and is effective as an inhibitor of HIV proliferation. The ability of the invention to inhibit virus growth or infectivity is demonstrated using standard assays for virus growth or infectivity, such as those described below.

The compounds of formula (I) of the present invention are also useful for inhibiting HIV in ex vivo samples that contain or are predicted to be exposed to HIV. Accordingly, the compounds of the present invention can be used to inhibit HIV present in a body fluid sample containing HIV, or containing HIV or suspected of being exposed to HIV (eg, a serum or semen sample). It is.

The compounds provided by the present invention are also useful as standards or reference compounds for use in tests or assays that measure the ability of an agent to inhibit viral clonal replication and / or HIV protease, eg, in a pharmaceutical research program. It is. Thus, the compounds of the present invention can be used as standard or reference compounds in such assays, and as quality control standards. The compounds of the present invention can be provided in commercially available kits or containers for use as such standard or reference compounds.

Since the compounds of the present invention show specificity for HIV protease, the compounds of the present invention can also be useful as diagnostic reagents in diagnostic assays that detect HIV protease. Accordingly, by inhibiting a compound of the invention from inhibiting protease activity in an assay (such as the assays described herein), H
It will be shown that IV protease and HIV virus are present.

As used herein, “μg” means microgram, “mg” means milligram, “g” means gram, “μL” means microliter, and “m
“L” means milliliter, “L” means liter, “nM” means nonamol, “μM” means micromol, “mM” means millimol,
"M" means mole and "nm" means nonameter. "Sigma" is Sigma-Aldrich Corp., St. Louis, MO. Represents

HIV RNA Assay DNA Plasmids and In Vitro RNA Transcripts: gag of BH10 (bp 113-1816) cloned into PTZ19R
Plasmid pDAB72, which contains both the pol and pol sequences, was
iitan et al. AIDS Research and Huma
n Retroviruses 1989, 5, 577. This plasmid was transformed into Riboprobe Gemi with T7 RNA polymerase.
In vitro RN using the ni System II kit (Promega)
Prior to formation of the A transcript, it was linearized with Bam HI. Synthetic RNA is RNas
The DNA was treated with e-free DNAse (Promega), extracted with phenol-chloroform, precipitated with ethanol, and purified. RNA transcripts were dissolved in water and stored at -70 ° C. The concentration of RNA was determined from the A _260.

Probes: Biotinylated capture probes were purified on an Applied Biosystems (Foster City, Calif.) DNA synthesizer using a Cocuz.
za, Tet. Lett. The biotin was added to the 5 'end of the oligonucleotide using the biotin-phosphoramidate reagent of 1989, 30, 6287 and synthesized, and then purified by HPLC. gag biotinylated capture probe (5-biotin-
CTAGCTCCCTGCTTGCCCCATACTA3 ') was complementary to nucleotides 889-912 of HXB2, and the pol biotinylated capture probe (5'-biotin-CCCTATCATTTTTGGTTTCCAT3') was complementary to nucleotides 2374-2395 of HXB2. Alkaline phosphatase conjugate oligonucleotides used as reporter probes were manufactured by Syngene (San Diego, CA). The pol reporter probe (5'CTGTCTTACTTTGATAAAACCTC3 ') was complementary to nucleotides 2403-2425 of HXB2. The gag reporter probe (5 'CCCAGTATTTGTCTACAGCCCTTCT 3') is HXB2
At nucleotides 950-973. All nucleotide positions are G
enetics Computer Group Sequence Anal
ysis Software Package (Deverau Nucle
ic Acids Research 1984,12,387) from GenBank Genetic Sequence Data Bank. The reporter probe was 2 × SSC (NaCl 0.3 M, sodium citrate 0.03 M), Tris 0.05 M pH 8.8, BSA 1 mg /
The solution was dissolved in mL to prepare a 0.5 μM stock solution. The biotinylated capture probe was dissolved in water and prepared as a 100 μM stock solution.

Streptavidin-coated plates: Streptavidin-coated plates were obtained from Dupont Biotechnology System (Boston, Mass.).

Cell and virus stocks: MT-2 and MT-4 cells are 5% fetal calf serum (FC
S) or in the case of MT-4 cells, maintained in RPMI 1640 supplemented with 10% FCS, 2 mM L-glutamine and 50 μg / mL gentamicin, all of which were obtained from Gibco. HIV-1 RF was grown in MT-4 cells in the same medium. A virus stock was prepared about 10 days after acute infection of MT-4 cells,
Aliquots were stored at -70 ° C. The infectious titer of the HIV-1 (RF) strain is M
1-3x as measured by plaque assay on T-2 cells (see below)
10 ⁷ PFU was (plaque forming units) / mL. Aliquots of the virus stocks used for infection were thawed only once.

When assessing the antiviral effect, infected cells were subcultured for one day before infection. On the day of infection, cells were transfected with 5 × 10 ^{5 in} RPMI 1640 or FCS
Cells were resuspended in cells / mL at 2 × 10 ⁶ / mL in Dulbecco's modified Eagle's medium containing 5% FCS for infections in microtiter plates. The culture was continued for 3 days at 37 ° C. with the addition of virus.

HIV RNA Assay: Cell lysate or purified RNA dissolved in GED 3M or 5M was mixed with GED5M and capture probe to give a final guanidium isothiocyanate concentration of 3M and a final biotin oligonucleotide concentration of 30nM. Hybridizations were performed in sealed U-bottom 96-well tissue culture plates (Nunc or Costar) at 37 ° C. for 16-20 hours. The RNA hybridization reaction was diluted three-fold with deionized water to a final guanidinium isothiocyanate concentration of 1 M and an aliquot (150 μM) was transferred to a well of a streptavidin-coated microtiter plate. After allowing the binding of the capture probe and capture probe-RNA hybrid to immobilized streptavidin to proceed for 2 hours at room temperature, the plates were washed with DuPont ELISA plate wash buffer (phosphate buffered saline (PBS), 0.05% Tween). Washed 6 times in 20). A second hybridization of the reporter probe to the capture probe and the immobilized complex of the hybridized target RNA was performed in washed streptavidin-coated wells in 4 × SSC, 0.66% Triton X100, 6.66% deionized formamide. , 120 μl of a hybridization cocktail containing 1 mg / mL BSA and 5 nM reporter probe. 37
After hybridization for 1 hour at C, the plate was washed again six times. Immobilized alkaline phosphatase activity was measured using buffer δ (diethanolamine 2.5 M, pH 8).
. 9 (JBL Scientific), 10 mM MgCl ₂ , 5 mM zinc acetate dihydrate and 5 mM N-hydroxyethyl-ethylene-diamine-triacetic acid
4-methylumbelliferyl phosphate (MUBP, JBL Sc
entific) was detected by adding 100 μL of 0.2 mM. The plate was incubated at 37 ° C. Microplate fluorometer photometer (D
(ynatec) was used to excite at 365 nM and measure the fluorescence at 450 nM.

Evaluation of compounds by microplate in HIV-1 infected MT-2 cells: The compounds to be evaluated were dissolved in DMSO and twice the highest concentration tested and DMS
The medium was diluted so that the maximum concentration of O was 2%. In addition, 3
Two-fold serial dilutions were performed directly in U-bottom microtiter plates (Nunc). After compound dilution, MT-2 cells (50 μL) were added and 5 × 10 ⁵ per mL.
(1 × 10 ⁵ per well) to a final concentration. Cells were incubated with compounds for 30 minutes at 37 ° C. in a CO ₂ incubator. To evaluate antiviral potency, appropriate dilutions (50 μL) of the HIV-1 (RF) virus stock were added to culture wells containing dilutions of cells and test compounds. The final volume in each well was 200 μL. 8 wells per plate have 50 media instead of virus
μL was added and left uninfected, and 8 wells were infected without the antiviral compound. To assess compound toxicity, corresponding plates were cultured without virus infection.

After culturing at 37 ° C. for 3 days in a humid chamber in a CO ₂ incubator,
All but L medium / well was removed from the HIV infected plate. 35 μL of GED5M containing the biotinylated capture probe was added to the sedimented cells and residual medium in each well,
Final concentrations were 3M GED and 30 nM capture probe. H in cell lysate
Hybridization between the IV RNA and the capture probe was performed in a microplate well similar to that used for virus culture, using a plate sealer (Costar).
The plate was sealed and incubated in a 37 ° C. incubator for 16-20 hours. Then, distilled water was added to each well to dilute the hybridization reaction solution three-fold, and 150 μL of the diluted solution was transferred to a streptavidin-coated microtiter plate. HIV RNA was measured as described above. To determine the amount of viral RNA produced during infection, a known amount of pDAB72 was
A calibration curve generated by adding the troRNA transcript to the wells containing uninfected cell lysate was performed for each microtiter plate.

[0138] In order to standardize the virus inoculum used to assess the antiviral activity of the compounds, diluted in virus dideoxycytidine IC ₉₀ values (ddC) (HIV
Compound concentration required to reduce RNA levels by 90%) is 0.2 μg / mL
Was chosen to be IC ₉₀ values of other antiviral compounds, even activity higher or lower than ddC, were reproducible using several strains of HIV-1 (RF) when following this procedure. This virus concentration is approximately 3 × 1 per assay well.
0 ⁵ PFU in response (measured by plaque assay on MT-2 cells), usually produced about 75 percent of even feasible viral RNA highest level in any virus inoculum. In the HIV RNA assay, the net signal from the infected, untreated cells in the same culture plate (average of 8 wells) versus the net signal from the untreated cells (signal from infected cell sample minus signal from uninfected cell sample) in RNA assay The IC ₉₀ was determined from the percent reduction in Effective performance of individual infection and RNA assay tests was judged on three criteria. Viral infection is pDAB72 in
It was necessary to provide an RNA assay signal that was equal to or greater than the signal generated from 2 ng of the in vitro RNA transcript. The IC ₉₀ for ddC determined in each assay run must be between 0.1 and 0.3 μg / mL. Finally, the plato-level of viral RNA generated with an effective protease inhibitor must be less than 10% of the level achieved with uninhibited infection.
Compounds were considered active if the IC ₉₀ was found to be less than 1 μM.

For the antiviral titer test, all manipulations on microtiter plates after the 2 × concentrated compound solution was first added to a single row of wells were performed on a Perkin E
Performed using 1mer / Cetus ProPette.

Dosage and Formulation The antiviral compounds of the present invention comprise an active agent and a site of action of the agent in a mammal,
That is, it can be administered to treat a viral infection by any means that results in contact with the viral protease. These compounds can be administered as individual therapeutic agents or in combination with therapeutic agents by any conventional means useful for use in connection with a medicament. These compounds can be administered alone, but can be administered with a selected pharmaceutical carrier based on the chosen route of administration and standard pharmaceutical practice.

Of course, the dosage will depend on known factors, such as the pharmacodynamic properties of the particular agent and its mode and route of administration, the age, health and weight of the recipient, the nature and extent of the symptoms, the nature of the combination treatment. It will vary based on the type, frequency of treatment, and the desired effect. The daily dose of the active ingredient is from about 0.001 to about 100 per kilogram of body weight
The preferred dose is about 0.1 to about 30 mg / kg, although it can be expected to be 0 milligrams.

Dosage forms of compositions suitable for administration contain from about 1 mg to about 100 mg of active ingredient per unit. In these pharmaceutical compositions, the active ingredient will ordinarily be present in an amount of about 0.5-95% by weight relative to the total weight of the composition. The active ingredient can be administered orally in solid dosage forms such as capsules, tablets and powders, or in liquid dosage forms such as elixirs, syrups and suspensions. It can also be administered parenterally in sterile liquid dosage forms.

Gelatin capsules contain the active ingredient and powdered carriers, such as lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like. Similar diluents can be used to form compressed tablets. Both tablets and capsules can be manufactured as sustained release products to provide for continuous release of medication over a period of hours. Compressed tablets may be sugar-coated or film-coated to prevent unpleasant taste and protect the tablets from the atmosphere, or may be provided with an enteric coating to selectively disintegrate in the gastrointestinal tract. Liquid dosage forms for oral administration can contain coloring or flavoring to increase patient acceptance.

In general, water, suitable oils, saline, aqueous dextrose (glucose) solutions, and related sugar solutions and glycols such as propylene glycol or polyethylene glycol are suitable parenteral solution carriers. The liquid for parenteral administration preferably contains a water-soluble salt of the active ingredient, a suitable stabilizer, and if necessary, a buffer substance.
Antioxidants, such as sodium bisulfite, sodium sulfite, or ascorbic acid, alone or in combination, are also suitable stabilizers. Also used are citric acid and its salts and sodium EDTA. In addition, parenteral solutions can contain preservatives, such as benzalkonium chloride, methyl or propylparaben, and chlorobutanol. For suitable pharmaceutical carriers, reference is made to “R”, a standard reference book in the art.
emington's Pharmaceutical Sciences, supra.

Useful pharmaceutical dosage forms of the compounds of the present invention can be illustrated as follows.

Capsules In a standard two-piece hard gelatin capsule, 100 mg of the powdered active ingredient, lactose 1
Numerous unit capsules can be prepared by filling 50 mg, cellulose 50 mg and magnesium stearate 6 mg.

Soft Gelatin Capsules A mixture of an active ingredient with a digestible oil, such as soybean oil, cottonseed oil or olive oil, is prepared and injected into the gelatin using a positive displacement pump to form soft gelatin capsules containing 100 mg of the active ingredient. . The capsule must then be washed and dried.

Tablets A number of tablets are prepared by conventional procedures so that the dosage unit is 100 mg of active ingredient, 0.2 mg of colloidal silicon dioxide, 5 mg of magnesium stearate, 275 mg of microcrystalline cellulose, 11 mg of starch and 98.8 mg of lactose. . Proper coating may enhance palatability or delay absorption.

Suspension 25 mg each of 5 mL of finely divided active ingredient, 200 mg of sodium carboxymethylcellulose, 5 mg of sodium benzoate, sorbite solution (USP)
Aqueous suspensions for oral administration can be prepared to contain 1.0 g and 0.0025 mg crocodile.

Injectables Parenteral compositions suitable for administration by injection can be prepared by stirring 1.5% by weight of active ingredient in 10% by volume propylene glycol and water.
The solution is sterilized by commonly used techniques.

Combination of Components (a) and (b) Each therapeutic component of the present invention can be made independent in any dosage form as described above, and can be administered by various methods as described above. it can. In the following description, component (b) is considered to represent one or more of the aforementioned agents. Thus, when treating with components (a) and (b) simultaneously or independently, it is also possible to treat with each agent of component (b) either simultaneously or independently.

The components (a) and (b) of the present invention are formulated together in a single dosage unit (ie, together in one capsule, tablet, powder or liquid, etc.) as a combination product It is possible to When components (a) and (b) are not formulated together as a single dosage unit, component (a) can be administered simultaneously with component (b) or in any order, for example, according to the present invention. It is possible to administer component (a) first and then administer component (b), or vice versa. When component (b) comprises two or more drugs, for example one RT inhibitor and one protease inhibitor, these drugs can be administered together or in any order. When not administered simultaneously, administration of components (a) and (b) is about 1
It is preferable to carry out at intervals of less than time. The preferred route of administration of components (a) and (b) is oral. As used herein, the terms oral preparation, oral inhibitor, oral compound, and the like, refer to a compound that can be administered orally. Preferably, both components (a) and (b) are administered by the same route (ie, for example, both orally) or in the same dosage form, but if desired, each can be administered by a different route (ie, For example, one component of the combination product may be administered orally and the other component intravenously), or it may be administered in different dosage forms.

As will be appreciated by those skilled in the art, the dose of the combination treatment of the present invention will depend on the pharmacological properties of the particular agent and its mode of administration and form, age of the recipient, It can vary according to various factors such as health and weight, the nature and extent of the symptoms, the type of combination treatment, the frequency of treatment, and the effect desired.

Appropriate dosages of components (a) and (b) of the present invention will be readily ascertainable by one skilled in the art based on the present disclosure. According to general guidelines, the daily dose of each component can usually be from 100 milligrams to about 1.5 grams. When component (b) is more than one component, usually the daily dose of each agent of component (b) can be from about 100 milligrams to about 1.5 grams. According to general guidelines, when administering the compounds of component (a) and component (b) in combination,
The dosage of each component is about 70-80%, in terms of synergistic effect of the combination, compared to the normal dose of the component when administered alone as a single agent for the treatment of HIV infection. It is possible to reduce to

The combination products of the present invention combine multiple active ingredients into a single dosage unit, but can be formulated such that physical contact between the active ingredients is minimized. To minimize contact, for example, when the product is administered orally, it is possible for one active ingredient to be enteric coated. By enteric coating one of the active ingredients, not only can the contact between the combined active ingredients be minimized, but also one of these ingredients is released in the intestine rather than in the stomach. As such, it is possible to control the release of one of these components in the gastrointestinal tract. In another embodiment of the present invention where oral administration is desired, a sustained release of one of the active ingredients that provides sustained release throughout the gastrointestinal tract and also helps to minimize physical contact between the combined active ingredients. Provide a combination product coated with a toxic substance. In addition, the sustained release component can be further enteric coated so that release of the component occurs only in the intestine. In still other approaches, one component is coated with a sustained release and / or enteric polymer to further separate the active component, while the other component is also a low viscosity grade hydroxypropyl methylcellulose or known in the art. Formulation of combination products coated with other suitable materials. This polymer coating also serves to create an additional barrier to interaction with other components. In each formulation, where a coating or some other substance prevents contact between components (a) and (b), the components (
It is also possible to prevent contact between the individual drugs in b).

[0156] The dosage form of the combination product of the present invention in which one active ingredient is enteric coated can be prepared by mixing the enteric coating ingredient and the other active ingredients together and then compressing them into tablets or by mixing the enteric coating ingredient with one. It can be in tablet form such that it is compressed into one tablet layer and the other active ingredient is compressed into another layer. Optionally, to further separate the two layers, one or more placebo layers can be present such that the placebo layer is between the layers of the active ingredient. In addition, the dosage forms of the present invention may be in the form of capsules wherein the active ingredient is compressed into tablets, or as a plurality of microtablets, granules, granules or non-peril and then enteric coated Can be These enteric-coated microtablets, granules, granules or nonperyl are then encapsulated or compressed into capsules with granules of other active ingredients.

These and other methods of minimizing contact between the components of the combination products of the present invention include:
Whether administered in a single dosage form, or in different dosage forms but simultaneously, or in a similar manner, one of ordinary skill in the art will readily appreciate based on the present disclosure.

A medicament useful for treating HIV infection, comprising a therapeutically effective amount of a pharmaceutical composition comprising a compound of component (a) and one or more component (b) in one or more sterile containers. Kits are also within the scope of the present invention. Sterilization of the container can be performed using conventional sterilization methods well known to those skilled in the art. Component (a) and component (b) can be in the same sterile container or different sterile containers. Sterile containers for this material can include different containers, if desired, or one or more portions. Component (a) and component (b) can be separate or physically combined in a single dosage form or unit dose unit, as described above.
As will be readily appreciated by those skilled in the art, such kits may further include, if desired, one or more pharmaceutically acceptable carriers, such as additional vials for mixing the components. Alternatively, it can include a plurality of different conventional pharmaceutical kit components. Instructions for use, such as inserts or labels indicating the amount of ingredient to be administered, administration guidelines and / or guidelines for mixing the ingredients, can also be included in the kit.

Obviously, many modifications and variations of the present invention are possible in light of the above teachings. Therefore, it will be understood that, within the scope of the appended claims, the specification may be practiced other than as specifically described herein.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61K 31/513 A61K 31/513 31/536 31/536 31/7072 31/7072 38/00 45/00 45 / 00 A61P 31/18 A61P 31/18 43/00 121 43/00 121 C12N 9/99 // C12N 9/99 A61K 37/02 (81) Designated country EP (AT, BE, CH, CY, DE, DK , ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), AU, BR, CA, CN, CZ, EE, HU, IL, IN, JP, KR, LT, LV, MX, NO, NZ, PL, RO, SG, SI, SK, TR, UA, VN, ZA F term (reference) 4C084 AA02 AA07 AA19 BA01 BA08 BA14 BA31 BA32 CA59 DC32 DC43 MA02 NA14 ZB331 ZC202 ZC551 ZC75 2 4C086 AA01 AA02 AA03 BC30 BC50 BC72 BC82 GA07 GA08 GA10 GA12 GA16 MA01 MA02 MA03 MA04 MA10 NA14 ZB33 ZC20 ZC55 ZC75 4H045 AA10 BA11 BA50 DA56 EA29 FA10

Claims (24)

[Claims] 1. A compound of the following formula I or a pharmaceutically acceptable salt thereof. Embedded image Wherein R ¹ is F, R ² is F or H, and R ³ is 4-aminophenyl, 3-aminophenyl, 2,3-dihydrobenzofuran-5-yl, and 1,
It is selected from the group of 3-benzodioxol-5-yl. ] 2. The compound of formula II The compound according to claim 1, wherein 3. The compound of formula IIa 3. The compound according to claim 2, wherein 4. The method according to claim 3, wherein R ³ is 3-aminophenyl.
The compound according to the above. 5. The method according to claim ^{3, wherein} R ³ is 4-aminophenyl.
The compound according to the above. 6. The method according to claim 6, wherein R ³ is 2,3-dihydrobenzofuran-5-yl or 1,
The compound according to claim 3, which is 3-benzodioxol-5-yl. 7. The compound of formula IIb 3. The compound according to claim 2, wherein 8. The method according to claim 7, wherein R ³ is 3-aminophenyl.
The compound according to the above. 9. The method according to claim 7, wherein R ³ is 4-aminophenyl.
The compound according to the above. 10. The method according to claim 10, wherein R ³ is 2,3-dihydrobenzofuran-5-yl or 1
The compound according to claim 7, which is, 3-benzodioxol-5-yl. 11. The compound of formula IIc 3. The compound according to claim 2, wherein 12. The compound according to claim 11, wherein R ³ is 3-aminophenyl. 13. The compound according to claim 11, wherein R ³ is 4-aminophenyl. 14. R ³ is 2,3-dihydrobenzofuran-5-yl or 1
The compound according to claim 11, which is 2,3-benzodioxol-5-yl. 15. The compound of formula III The compound according to claim 1, wherein 16. The compound of formula IIIa The compound according to claim 15, which is: 17. The compound of formula IV The compound according to claim 1, wherein 18. The compound of formula IVa 18. The compound according to claim 17, wherein 19. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of a compound according to any one of claims 1 to 19. 20. Administering a therapeutically effective amount of a compound according to any one of claims 1 to 19 or a pharmaceutically acceptable salt thereof to a host in need of such treatment. A method for treating HIV infection, characterized by the following: 21. A therapeutically effective amount of (a) a compound or stereoisomer, stereoisomer mixture, or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 19, and (b) A method for treating HIV infection, comprising administering at least one compound selected from the group consisting of an HIV reverse transcriptase inhibitor and an HIV protease inhibitor in combination with a host in need thereof. . 22. The method of claim 22, wherein the reverse transcriptase inhibitor is AZT, ddC, ddI, d4.
T, 3TC, delavirubin, efavirenz, nevirapine, Ro18893, trovirgin, MKC-442, HBY097, ACT, UC-781, UC-7
82, RD4-2025, and MEN10979, wherein the protease inhibitor is selected from the group consisting of saquinavir, ritonavir, indinavir, amprenavir,
Nelfinavir, Parinavir, BMS-232623, GS3333, KNI-
413, KNI-272, LG-71350, CGP-61755, PD173
606, PD177298, PD178390, PD178392, U-140
690, and ABT-378.
The method described in. 23. The reverse transcriptase inhibitor is selected from the group of AZT, efavirenz, and 3TC, and the protease inhibitor is selected from the group of saquinavir, ritonavir, nelfinavir, and indinavir. Item 23. The method according to Item 22. 24. The method according to claim 21, wherein compound (b) is ritonavir.