KR20010101478A - Bis-Amino Acid Sulfonamides Containing N-Terminally a Substituted Benzyl Group as HIV Protease Inhibitors - Google Patents

Abstract

The present invention provides a bis-amino acid sulfonamide having a substituted benzyl amine of formula (I) or a stereoisomeric form, stereoisomer mixture, or pharmaceutically acceptable salt form thereof, useful as an HIV protease inhibitor, pharmaceutical compositions and diagnostic kits comprising the same, It relates to methods of use thereof for the treatment of viral infections or as assay standards or reagents, as well as intermediates and methods of preparation thereof.

<Formula I>

Description

Bis-Amino Acid Sulfonamides Containing N-Terminally a Substituted Benzyl Group as HIV Protease Inhibitors}

Two other retroviruses, human immunodeficiency virus (HIV) type-1 (HIV-1) or type-2 (HIV-2), are etiologically associated with acquired immunodeficiency syndrome (AIDS), an immunosuppressive disease. Individuals who are HIV seropositive initially have no asymptomatic symptoms, but typically progress through AIDS-related syndrome (ARC) to AIDS. Infected individuals have a severe immunosuppressive response that weakens them and ultimately causes a fatal opportunistic infection.

Disease AIDS is the end result of HIV-1 or HIV-2 after a complex life cycle. The virion's life cycle begins with virion attaching to the lymphocyte cells by binding the glycoprotein on its protective coat surface to the CD4 glycoprotein on host human T-4 lymphocyte immune cells. Once attached, the virion takes off its glycoprotein coat, penetrates into the membrane of the host cell, and de-extracts its RNA. Reverse transcriptase, a virion enzyme, directs the process of transcribing this RNA into single-stranded DNA. Viral RNA is degraded and produces a second DNA strand. Double-stranded DNA is now integrated into human cell genes, using their genes for viral reproduction.

At this time, the RNA polymerase transfers the integrated DNA into the viral RNA. Viral RNA is translated into the precursor gag-pol fusion polyprotein. This polyprotein is then cleaved by HIV protease enzymes to produce mature viral proteins. In other words, the HIV protease is responsible for controlling the multiple stages of the cleavage process that lead to the maturation of viral particles into a virus with full infectivity.

Because the virus infects and kills T cells of the immune system, the typical human immune system response that kills invading virions is overused. In addition, viral reverse transcriptase, the enzyme used to make new virion particles, is not very specific, resulting in transcriptional errors that continue to change the glycoprotein on the surface of the viral protective coat. This lack of specificity lowers the effectiveness of the immune system because antibodies produced specifically for one glycoprotein lack the number of antibodies that can fight the virus by dancing for another. The virus continues to reproduce while the immune response system continues to weaken. Eventually, HIV prevails over the body's immune system, causing opportunistic infections and death unless antiviral agents, immunomodulators, or both are administered.

There are at least three important points in the life cycle of a virus identified as a possible target of an antiviral agent: (1) initial attachment of virions to T-4 lymphocytes or macrophage sites, (2) viral RNA to viral DNA Transcription (reverse transcriptase, RT) and (3) processing of the gag-pol protein by HIV protease.

The genome of a retrovirus encodes a protease responsible for proteolytic processing of one or more polyprotein precursors, such as the pol and gag gene products. Wellink, Arch. Virol. 98 1 (1998). Retroviral proteases most commonly process gag precursors into core proteins and also pol precursors into reverse transcriptase and retroviral proteases.

Accurate processing of the precursor polyprotein by retroviral proteases is necessary for the assembly of infectious virions. In vitro mutagenesis producing protease-deficient viruses has been shown to result in the production of immature core forms that lack infectivity. Crawford et al., J. Virol. 53 899 (1985) and Katoh et al., Virology 145 280 (1985). Thus, retroviral protease inhibition provides an interesting target for antiviral treatment. See Mitsuya, Nature 325 775 (1987).

As demonstrated by the protease inhibitors currently commercially available and used in clinical trials, a wide range of compounds have been studied as potential HIV protease inhibitors. One key point is that hydroxyethylamino-sulfonamide has received considerable attention. For example, PCT applications WO94 / 05639, WO94 / 04492, WO95 / 06030 and WO96 / 28464 generally describe sulfonamides of the general formula and methods for their preparation. Some of the compounds of the present invention appear to be included in the general description of some of these publications, but these publications do not specifically disclose, suggest, or claim these compounds.

Although there have been success stories of protease inhibitors these days, it has been found that HIV patients may develop resistance to a single protease inhibitor. Thus, there is a need for the development of additional protease inhibitors that can further combat HIV infection.

Summary of the Invention

It is therefore an object of the present invention to provide novel protease inhibitors.

It is another object of the present invention to provide a novel method of treating HIV infection comprising administering to a host in need thereof a therapeutically effective amount of one or more compounds of the invention or a pharmaceutically acceptable salt form thereof. .

Another object of the present invention is to provide a therapeutically effective amount of a combination of (a) one of the compounds of the invention and (b) a compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors for the treatment of HIV infection. Provided is a novel method for treating HIV infection, comprising administering to a host.

Another object of the present invention is to provide a pharmaceutical composition having a protease inhibitory activity, comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of at least one compound of the invention or a pharmaceutically acceptable salt form thereof.

Another object of the present invention is to provide a method for inhibiting HIV present in a body fluid, comprising treating the body fluid sample with an effective amount of a compound of the invention.

Another object of the invention is an effective amount of at least one compound of the invention for use as a standard or reagent in a test or assay for determining potential pharmaceutical ability to inhibit HIV protease, HIV growth, or both. It provides a kit or a container containing.

These and other objects, which will become apparent from the following detailed description, have been achieved by the inventors of the present invention that the compounds of formula (I), their stereoisomeric forms, mixtures of stereoisomeric forms, or pharmaceutically acceptable salt forms thereof are effective in protease inhibition. .

Wherein R ¹ , R ² and R ³ are defined below.

The present invention relates generally to bis-amino acid sulfonamides having substituted benzyl amines useful as HIV protease inhibitors, to pharmaceutical compositions and diagnostic kits comprising them, and to methods of using them for the treatment of viral infections or as assay standards or reagents. .

[1] In a first embodiment, the present invention provides a novel compound of formula (I) or a pharmaceutically acceptable salt form thereof.

<Formula I>

Wherein R ¹ is F, R ² is F or H, R ³ is 4-aminophenyl, 3-aminophenyl, 2,3-dihydrobenzofuran-5-yl and 1,3-benzodioxol -5- days from the group.

[2] In a preferred embodiment, the present invention provides a novel compound of formula II.

[3] In a more preferred embodiment, the present invention provides a novel compound of formula IIa.

In a more preferred embodiment, the present invention provides a novel compound of formula (IIa) wherein R ³ is 3-aminophenyl.

[5] In a more preferred embodiment, the present invention provides a novel compound of formula (IIa) wherein R ³ is 4-aminophenyl.

[6] In a more preferred embodiment, the present invention provides a novel compound of formula (IIa) wherein R ³ is 2,3-dihydrobenzofuran-5-yl or 1,3-benzodioxol-5-yl.

In a more preferred embodiment, the present invention provides a novel compound of formula IIb.

In a more preferred embodiment, the present invention provides a novel compound of formula (IIb) wherein R ³ is 3-aminophenyl.

In a more preferred embodiment, the present invention provides a novel compound of formula (IIb) wherein R ³ is 4-aminophenyl.

In a more preferred embodiment, the present invention provides a novel compound of formula (IIb) wherein R ³ is 2,3-dihydrobenzofuran-5-yl or 1,3-benzodioxol-5-yl.

In a more preferred embodiment, the present invention provides a novel compound of formula IIc.

In a more preferred embodiment, the present invention provides a novel compound of formula (IIc) wherein R ³ is 3-aminophenyl.

In a more preferred embodiment, the present invention provides a novel compound of formula (IIc) wherein R ³ is 4-aminophenyl.

In a more preferred embodiment, the present invention provides a novel compound of formula (IIc) wherein R ³ is 2,3-dihydrobenzofuran-5-yl or 1,3-benzodioxol-5-yl.

In a more preferred embodiment, the present invention provides a novel compound of formula III.

In a more preferred embodiment, the present invention provides a novel compound of formula IIIa.

In a more preferred embodiment, the present invention provides a novel compound of formula IV.

In a more preferred embodiment, the present invention provides a novel compound of formula IVa.

In another embodiment, the present invention provides novel pharmaceutical compositions comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of a compound of formula (I) or a pharmaceutically acceptable salt form thereof.

In another embodiment, the present invention provides a novel method for treating HIV infection comprising administering to a host in need thereof a therapeutically effective amount of a compound of formula (I) or a pharmaceutically acceptable salt form thereof.

In another embodiment, the invention provides a therapeutically effective amount of at least one compound selected from the group consisting of (a) a compound of Formula (I) and (b) an HIV reverse transcriptase inhibitor and an HIV protease inhibitor to a patient in need of treatment for an HIV infection. Provided are novel methods of treating HIV infection, including co-administration.

In another preferred embodiment, the reverse transcriptase inhibitor is AZT, ddC, ddI, d4T, 3TC, delavirdine, efavirenz, nevirapine, Ro 18,893, trovirdine , MKC-422, HBY 097, ACT, UC-781, UC-782, RD4-2025 and MEN 10979, wherein the protease inhibitors are saquinavir, ritonavir, indinaavi Indinavir, amprenavir, nelfinavir, palinavir, BMS-232623, GS3333, KNI-413, KNI-272, LG-71350, CGP-61755, PD 173606 , PD 177298, PD 178390, PD 178392, U-140690 and ABT-378.

In a still more preferred embodiment, the reverse transcriptase inhibitor is selected from the group of AZT, epavirenz and 3TC, and the protease inhibitor is selected from the group of saquinavir, ritonavir, lpinavir and indinavir.

In a still more preferred embodiment, the reverse transcriptase inhibitor is AZT.

In a still more preferred embodiment, the protease inhibitor is ritonavir.

In an even more preferred embodiment, component (b) is an HIV reverse transcriptase inhibitor and an HIV protease inhibitor.

In an even more preferred embodiment, component (b) is two different HIV reverse transcriptase inhibitors.

In another embodiment, the present invention comprises a therapeutically effective amount of HIV in at least one sterile container comprising (a) a compound of formula (I) and (b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors Pharmaceutical compositions useful for the treatment of infections are provided.

In another embodiment, the present invention provides a novel method of inhibiting HIV present in a bodily fluid sample, comprising treating the bodily fluid sample with an effective amount of a compound of Formula (I).

In a ninth embodiment, the present invention comprises an effective amount of a compound of formula (I) for use as a standard or reagent in a test or assay to determine potential pharmaceutical ability to inhibit HIV protease, HIV growth, or both It provides a new kit or container.

<Definition>

As used herein, the following terms and expressions have the meanings indicated. It will be appreciated that the compounds of the present invention have substituted asymmetric carbon atoms and can be isolated in optically active form or in racemic mixtures. Methods of preparing optically active forms from optically active starting materials by partitioning or in the form of racemic mixtures are well known in the art. Unless specifically stated in detail stereochemical or isomeric forms, structures of all chiral forms, diastereomeric forms, racemic mixture forms and all geometric isomeric forms are intended.

The method of the present invention is contemplated to be carried out on a multigram scale, kilogram scale, multi kilogram scale or industrial scale. As used herein, the multigram scale is a scale in which at least one starting material is present preferably at least 10 grams, more preferably at least 50 grams, even more preferably at least 100 grams. Multi-kilogram scale as used herein is intended to mean a scale in which at least one starting material is at least 1 kilogram. Industrial scale as used herein is intended to mean a scale that provides sufficient product for clinical trials or consumer distribution, except for the laboratory scale.

The present invention is intended to include all isotopes occurring in the compounds of the present invention. Isotopes include those elements having the same atomic number but different mass numbers. As a general example, isotopes of hydrogen include, but are not limited to, tritium and deuterium. Isotopes of carbon include C-13 and C-14.

As used herein, “HIV reverse transcriptase inhibitor” is intended to refer to both nucleoside and nonnucleoside inhibitors of HIV reverse transcriptase (RT). Examples of nucleoside RT inhibitors include, but are not limited to, AZT, ddC, ddI, d4T and 3TC. Examples of non-nucleotide RT inhibitors include delavirdine (Pharmacia and Upjohn, U90125S), efarvirenz (DuPont), nevirapine (Boehringer Ingelheim), Ro 18,893 ( Roche), Trovirdin (Lilly), MKC-442 (Triangle), HBY 097 (Hoechst), HBY 1293 (Hest), ACT (Korean Research Institute )), UC-781 (Rega Institute), UC-782 (Rega Institute), RD4-2025 (Tosoh Co. Ltd.), and MEN 10979 (Menarini Parmastisi ( Menarini Famaceutici)), but is not limited to such.

As used herein, "HIV protease inhibitor" is intended to denote a compound that inhibits HIV protease. Examples include Saquinavir (Roche, Ro31-8959), Litonavir (Abbott, ABT-538), Indinavir (Merck, MK-639), Amprenavir (Vertex / Glaxo Welcome ( Vertex / Glaxo Wellcome)), Nelpinavir (Agouron, AG-1343), Palinavir (Wellinger Ingelheim), BMS-232623 (Bristol-Myers Squibb), GS3333 (Gilead Sciences), KNI-413 (Japan Energy), KNI-272 (Japan Energy), LG-71350 (LG Chemical), CGP-61755 (Shiba-Geigi (Ciba-Geigy)), PD 173606 (Parke Davis), PD 177298 (Parque Davis), PD 178390 (Parque Davis), PD 178392 (Parque Davis), Tipranavir (Pharmacia and Upzone, U-140690) ), DMP-450 (DuPont) and ABT-378, but are not limited thereto.

As used herein, “pharmaceutically acceptable salts” refers to derivatives of the disclosed compounds wherein the parent compound is modified by the preparation of an acid salt or base salt of the parent compound. Examples of pharmaceutically acceptable salts include inorganic or organic acid salts of basic residues such as amines; Alkali salts or organic salts of acidic residues such as carboxylic acids, and the like, but are not limited thereto. Pharmaceutically acceptable salts include, for example, conventional non-toxic salts or quaternary ammonium salts of the parent compound formed from non-toxic inorganic or organic acids. Examples of such conventional non-toxic salts include salts derived from inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, sulfamic acid, phosphoric acid, nitric acid, and the like; And acetic acid, propionic acid, succinic acid, glycolic acid, stearic acid, lactic acid, malic acid, tartaric acid, citric acid, ascorbic acid, pamoic acid, maleic acid, hydroxymaleic acid, phenylacetic acid, glutamic acid, benzoic acid, salicylic acid, sulfanic acid, 2-acetic acid Salts prepared from organic acids such as oxybenzoic acid, fumaric acid, toluenesulfonic acid, methanesulfonic acid, ethane disulfonic acid, oxalic acid, isethionic acid and the like.

Pharmaceutically acceptable salts of the present invention can be synthesized from the parent compound containing basic or acidic moieties by conventional chemical methods. In general, these salts are free acids or bases of these compounds in water or in an organic solvent, or in a mixture of the two (typically a non-aqueous medium such as ether, ethyl acetate, ethanol, isopropanol or acetonitrile). It can be prepared by reacting the form with stoichiometric amounts of the appropriate base or acid. A list of suitable salts is disclosed in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, PA, 1985, p. 1418.

The phrase “pharmaceutically acceptable” herein is intended for use in contact with human and animal tissue without causing excessive toxicity, irritation, allergic reactions, or other problems and complications in which the benefit / risk ratio is moderate within the scope of good medical judgment. It is used to represent suitable compounds, substances, compositions and / or dosage forms.

A "prodrug" is intended to include any covalently bonded carrier which, when administered to a mammalian subject, releases the active parent drug according to formula I or another formula or a compound of the invention in vivo. It is intended. Prodrugs of compounds of the present invention (e.g., formula (I)) are prepared by modifying the functional groups in the compound in a general manner or in a modified manner that cleaves into the parent compound in vivo. Prodrugs include compounds of the invention wherein a hydroxyl group or an amino group, which is cleaved when the prodrug is administered to a mammalian subject, forms a free hydroxyl group or a free amino group, respectively, to any group.

Examples of prodrugs include, but are not limited to, acetate, formate and benzoate derivatives of alcoholic and amine functional groups in the compounds of the invention.

"Stable compound" and "stable structure" are intended to refer to a compound that is rigid enough to be isolated from the reaction mixture and formulation into an effective therapeutic agent with a useful degree of purity. Only stable compounds are considered in the present invention.

"Substituted" means that one or more hydrogens on the element represented by the expression "substituted" have been selected and replaced from the indicated group (s), provided that it cannot exceed the standard valence of the indicated element and that Becomes stable. If the substituent is a keto group (ie = O), then two hydrogens on the element are replaced.

A "therapeutically effective amount" is intended to include an amount of a compound of the invention or an amount of a combination of claimed compounds effective to inhibit HIV infection or to treat a syndrome of HIV infection in a host. The combination of compounds is preferably a combination showing a synergistic effect. See, eg, Chou and Talalay, Adv. Enzyme Regul. 22: 27-55 (1884), the synergistic effect is the effect of the addition of the compound when the effect of the compound when administered in combination (in this case, inhibition of HIV replication) is administered alone as a single agent. Appears when larger. In general, synergism is most clearly demonstrated at partial optimal concentrations of compounds. Synergistic effects are seen in terms of low cytotoxicity, elevated antiviral effect, or some other benefit effect of the combination compared to the individual components.

One diastereomer of the compound of formula (I) may exhibit good activity when compared to the other. If desired, the cleavage of the racemic material can be achieved by HPLC using a chiral column or by cleavage using a splitting agent such as camphor chloride (Thomas J. Tucker, et al., J. Med. Chem). 1994, 37, 2437-2444). Chiral compounds of formula (I) can also be synthesized directly using chiral catalysts or chiral ligands (eg, Mark A. Huffman, et al., J. Org. Chem. 1995, 60, 1590-1594).

Other features of the present invention will become apparent from the description of the following exemplary embodiments, which are given for the purpose of illustration of the invention and do not limit the invention.

Abbreviations used in the examples are defined as follows; "℃" is Celsius, "d" is doublet, "dd" is doublet of doublet, "eq" is equivalent, "g" is gram, "mg" is milligram, "mL" is milliliter, "H" "H" is hydrogen or hydrogens, "hr" is hour, "m" is multiplet, "M" is mole, "min" is minute, "MHz" is megahertz, "MS" is mass spectroscopy, "nmr" or "NMR" is nuclear magnetic resonance spectroscopy, "t" is triplet, and "TLC" is thin film chromatography.

<Example 1>

1B: N- [3 (S)-[N, N-bis (phenylmethyl) amino] -2 (R) -hydride in toluene (1 L), water (500 mL) and CH ₂ Cl ₂ (400 mL) To a solution of oxy-4-phenylbutyl] -N-isobutylamineoxalate 1A (127.6 g, 251 mmol) was added NaOH (50% aqueous, 44.5 g). After stirring for 10 minutes, the reaction mixture was extracted with toluene. The combined organic layers were washed with brine, dried over magnesium sulfate and the solvent was removed under reduced pressure. The residue was taken up in THF (1 L), cooled to 0 ° C. and treated with triethylamine (28.15 g, 278 mmol) and di-tert-butyl dicarbonate (55.23 g, 253 mmol). The solution was allowed to warm to room temperature and stirred overnight. The solvent was removed under reduced pressure and the residue was taken up in EtOAc (1 L) and washed with water, 5% citric acid, water, saturated NaHCO ₃ , brine and dried over magnesium sulfate. The solvent was removed under reduced pressure to give carbamate 1B, which was used directly without further purification. CIMS (NH ₃ ) m / z: 517 (M + H ⁺ , 100%)

1C: To a solution of crude 1B (possibly 251 mmol) in methanol (500 mL) was added palladium hydroxide on carbon (20%, 10 g). The suspension was placed in a parr bottle and filled with hydrogen (55 psi). After shaking overnight, the reaction mixture was filtered through Celite and the solvent was removed under reduced pressure. The resulting solid was recrystallized (EtOAc / hexanes) to give amine 1C as a white solid (56.6 g, 67% (2 steps)): CIMS (NH ₃ ) m / z: 337 (M + H ⁺ , 100 %)

1D: N-hydroxybenzotriazole (38.6 g, 285 mmol) and EDC (in a solution of N-carbobenzyloxy-L-tert-leucine (47.5 g, 179 mmol) in DMF (250 mL) at 0 ° C. 35.7 g, 186 mmol) was added. After stirring for 1.5 hours, the solution was added to a suspension of 1C (56.6 g, 167 mmol) and 4-methylmorpholine (52.9 g, 521 mmol) in DMF (200 mL). The reaction mixture was allowed to warm to room temperature. After stirring overnight, N, N-dimethylethylenediamine (4 mL) was added, the solution was stirred for 1.5 h and the solvent was removed under reduced pressure. The residue was taken up in EtOAc (1 L) and washed with water, 5% citric acid, water, saturated NaHCO ₃ , brine and dried over magnesium sulfate. The solvent was removed under reduced pressure to give 1D (97.5 g, 100%), which was used without further purification. CIMS (NH ₃ ) m / z: 584 (M + H ⁺ , 100%)

1E: To a solution of 1D (97.5 g, 167 mmol) in methanol (300 mL) was added palladium hydroxide on carbon (20%, 10 g). This suspension was placed in a Parr bottle and filled with hydrogen (55 psi). After shaking overnight, the reaction mixture was filtered through celite and the solvent was removed under reduced pressure. The resulting solid was recrystallized (EtOAc / hexane) to give amine 1E as a white solid (72.8 g, 97%): CIMS (NH ₃ ) m / z: 450 (M + H ⁺ , 100%)

1F: To a solution of amine 1E (43.8 g, 97.6 mmol) in EtOAc (400 mL) and water (270 mL) was added KHCO ₃ (27.7 g, 276 mmol) and chloroacetyl chloride (12.4 g, 111 mmol). After stirring for 3 hours, EtOAc (1 L) was added and the solution was washed with water, 5% citric acid, water, saturated NaHCO ₃ , brine and dried over magnesium sulfate. The solvent was removed under reduced pressure to give 1F as a white solid (51.0 g, 99%): CIMS (NH ₃ ) m / z: 526 (M + H ⁺ , 100%)

1G: To a solution of 1F (33.8 g, 64.2 mmol) in EtOAc (600 mL) was added 4N HCl in dioxane (80 mL, 320 mmol) and the reaction mixture was stirred for 6 h. The solvent was removed under reduced pressure and the resulting solid was triturated with cold ether to give hydrochloride salt 1G (28.75 g, 97%): CIMS (NH ₃ ) m / z: 426 (M + H ⁺ , 100 %)

1H: K ₂ CO ₃ (56.7 g, 411 mmol) and 4-nitrobenzenesulfonyl chloride (16.9 g, 76.0) in a solution of salt 1G (32.0 g, 69.2 mmol) in THF (350 mL) and water (450 mL) mmol) was added. After stirring for 4 hours, water was added and the suspension was extracted with EtOAc. The combined organic layers were washed with brine, 5% citric acid, water, saturated NaHCO ₃ , brine and dried over magnesium sulfate. The solvent was removed under reduced pressure and the resulting solid was recrystallized (EtOAc / hexane) to give sulfonamide 1H as a white solid (35.8 g, 85%). CIMS (NH ₃ ) m / z: 611 (M + H ⁺ , 100%).

1I: To a solution of chloride 1H (16.0 g, 26.1 mmol) in THF (200 mL) was added 3-fluorobenzylamine (20.0 g, 160 mmol) and the reaction mixture was refluxed overnight. The solvent was removed under reduced pressure and the residue was taken up in EtOAc, washed with water, brine and dried over magnesium sulfate. The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 4% methanol / CH ₂ Cl ₂ ) to give amine 1I as a white solid (16.3 g, 89%). CIMS (NH ₃ ) m / z: 700 (M + H ⁺ , 100%).

1: To a solution of 1I (14.6 g, 20.8 mmol) in methanol (500 mL) was added palladium hydroxide on carbon (20%, 1.5 g) and the reaction mixture was charged with hydrogen. After stirring for 3 hours, the mixture was filtered through celite and the solvent was removed under reduced pressure. The residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give amine as a white solid (13.2 g, 95%). To a solution of free base (11.68 g, 17.4 mmol) in ether (300 mL) and EtOAc (100 mL) was added 1N HCl in ether (37 mL, 37 mmol). The resulting suspension was stirred for 15 minutes and filtered to give bis-hydrochloride salt 1 as a white solid (12.5 g, 96%): CIMS (NH ₃ ) m / z: 670 (M + H ⁺ , 100% )

<Example 2>

2A: To a solution of chloride 1H (16.0 g, 26.1 mmol) in THF (200 mL) was added 3,5-difluorobenzylamine (25.0 g, 174 mmol) and the reaction mixture was refluxed overnight. The solvent was removed under reduced pressure and the residue was taken up in EtOAc, washed with water, brine and dried over magnesium sulfate. The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 4% methanol / CH ₂ Cl ₂ ) to give amine 2A as a white solid (15.2 g, 81%). CIMS (NH ₃ ) m / z: 718 (M + H ⁺ , 100%).

2: To a solution of 2A (15.2 g, 21.2 mmol) in methanol (500 mL) was added palladium hydroxide on carbon (20%, 1.5 g) and the reaction mixture was charged with hydrogen. After stirring for 4 hours, the mixture was filtered through celite and the solvent was removed under reduced pressure. The residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give amine as a white solid (10.3 g, 71%). To a solution of free base in ether (300 mL) and EtOAc (100 mL) was added 1N HCl in ether (32 mL, 32 mmol). The resulting suspension was stirred for 15 minutes and filtered to give bis-hydrochloride salt 2 as a white solid: CIMS (NH ₃ ) m / z: 688 (M + H ⁺ , 100%).

<Example 3>

3A: To a solution of chloride 1H (300 mg, 0.49 mmol) in THF (4 mL) was added 2,5-difluorobenzylamine (1.2 g, 8.5 mmol) and the reaction mixture was refluxed for 4 h. The reaction mixture was diluted with EtOAc, washed with water, brine and dried over magnesium sulfate. The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give amine 3A as a white solid (270 mg, 77%). CIMS (NH ₃ ) m / z: 718 (M + H ⁺ , 100%)

3: To a solution of 3A (260 mg, 0.36 mmol) in methanol (25 mL) was added palladium hydroxide on carbon (20%, 50 mg) and the reaction mixture was charged with hydrogen. After stirring for 1 hour, the mixture was filtered through celite and the solvent was removed under reduced pressure. The residue was chromatographed (silica gel, 5% methanol / CHCl ₂ ) to afford amine as a white solid (226 mg, 91%). To a solution of free base in ether (30 mL) and EtOAc (10 mL) was added 4N HCl in dioxane (0.2 mL, 0.8 mmol). The resulting suspension was stirred for 15 minutes and filtered to give bis-hydrochloride salt 3 as a white solid: CIMS (NH ₃ ) m / z: 688 (M + H ⁺ , 100%).

<Example 4>

4A: To a solution of chloride 1H (300 mg, 0.49 mmol) in THF (4 mL) was added 2,6-difluorobenzylamine (1.2 g, 8.5 mmol) and the reaction mixture was refluxed for 4 hours. The reaction mixture was diluted with EtOAc, washed with water, brine and dried over magnesium sulfate. The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give amine 4A as a white solid (306 mg, 87%). CIMS (NH ₃ ) m / z: 718 (M + H ⁺ , 100%).

4: To a solution of 4A (295 mg, 0.41 mmol) in methanol (25 mL) was added palladium hydroxide on carbon (20%, 50 mg) and the reaction mixture was charged with hydrogen. After stirring for 1 hour, the mixture was filtered through celite and the solvent was removed under reduced pressure. The residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give amine as a white solid (228 mg, 81%). To a solution of free base in ether (30 mL) and EtOAc (10 mL) was added 4N HCl in dioxane (0.2 mL, 0.8 mmol). The resulting suspension was stirred for 15 minutes and filtered to afford bis-hydrochloride salt 4 as a white solid: CIMS (NH ₃ ) m / z: 688 (M + H ⁺ , 100%).

Example 5

5A: K ₂ CO ₃ (51.4 g, 370 mmol) and 3-nitrobenzenesulfonyl chloride (15.14 g, 68.3) in a solution of salt 1G (28.8 g, 62.1 mmol) in THF (300 mL) and water (400 mL) mmol) was added. After stirring for 4 hours, water was added and the suspension was extracted with EtOAc. The combined organic layers were washed with brine, 5% citric acid, water, saturated NaHCO ₃ , brine and dried over magnesium sulfate. The solvent was removed under reduced pressure and the resulting solid was triturated with EtOAc and hexanes to give sulfonamide 5A as a white solid (32.1 g, 85%). CIMS (NH ₃ ) m / z: 611 (M + H ⁺ , 100%).

5B: To a solution of chloride 5A (16.0 g, 26.1 mmol) in THF (200 mL) was added 3-fluorobenzylamine (17.0 g, 135 mmol) and the reaction mixture was refluxed overnight. The solvent was removed under reduced pressure and the residue was taken up in EtOAc, washed with water, brine and dried over magnesium sulfate. The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 4% methanol / CH ₂ Cl ₂ ) to give amine 5B as a white solid (16.0 g, 87%). CIMS (NH ₃ ) m / z: 700 (M + H ⁺ , 100%).

5: To a solution of 5B (12.0 g, 17.22 mmol) in methanol (400 mL) was added palladium hydroxide on carbon (20%, 1.25 g) and the reaction mixture was charged with hydrogen. After stirring for 3 hours, the mixture was filtered through celite and the solvent was removed under reduced pressure. The residue was chromatographed (silica gel, 5% methanol / CHCl ₂ ) to give amine as a white solid (11.2 g, 97%). To a solution of free base in ether (400 mL) and EtOAc (75 mL) was added 1N HCl in ether (36 mL, 36 mmol). The resulting suspension was stirred for 15 minutes and filtered to afford bis-hydrochloride 5 as a white solid. CIMS (NH ₃ ) m / z: 670 (M + H ⁺ , 100%).

<Example 6>

6A: To a solution of chloride 5A (16.0 g, 26.1 mmol) in THF (200 mL) was added 3,5-difluorobenzylamine (25.0 g, 174 mmol) and the reaction mixture was stirred for 2 h and overnight It was refluxed. The solvent was removed under reduced pressure and the residue was taken up in EtOAc, washed with water, brine and dried over magnesium sulfate. The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 3.5% methanol / CH ₂ Cl ₂ ) to give amine 6A as a white solid (15.6 g, 83%). CIMS (NH ₃ ) m / z: 718 (M + H ⁺ , 100%).

6: To a solution of 6A (14.4 g, 20.0 mmol) in methanol (500 mL) was added palladium hydroxide on carbon (20%, 1.5 g) and the reaction mixture was charged with hydrogen. After stirring for 4 hours, the mixture was filtered through celite and the solvent was removed under reduced pressure. The residue was chromatographed (silica gel, 5% methanol / CH 2 Cl 2) to give amine as a white solid (12.5 g, 91%). To a solution of free base (9.57 g, 13.9 mmol) in ether (300 mL) was added 1N HCl in ether (31 mL, 31 mmol). The resulting suspension was stirred for 20 minutes and filtered to afford bis-hydrochloride salt 6 as a white solid (9.9 g, 94%). CIMS (NH ₃ ) m / z: 688 (M + H ⁺ , 100%).

<Example 7>

7: N- [2R-hydroxy-3-[[(2,3-dihydro2,3-dihydrobenzofuran-5-yl) sulfonyl] (2-methylpropyl) amino in THF (2 mL) ] -1S- (phenylmethyl) propyl] -2S-[(chloroacetyl) amino] -3,3-dimethylbutanamide 7A (100 mg, 0.16 mmol) in 3-fluorobenzylamine (550 mg, 4.4 mmol) was added and the reaction mixture was refluxed for 6 h. The reaction mixture was diluted with EtOAc, washed four times with water and brine and dried over magnesium sulfate. The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give amine as a white solid (91 mg, 79%). To a solution of free base (91 mg, 0.13 mmol) in ether (25 mL) was added 4N HCl in dioxane (0.05 mL, 0.20 mmol). After stirring for 10 minutes, the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give hydrochloride salt 7 as a white solid (72 mg, 65%): CIMS (NH ₃ ) m / z: 697 (M + H ⁺ , 100%).

<Example 8>

8: To a solution of 7A (100 mg, 0.16 mmol) in THF (2 mL) was added 3,5-difluorobenzylamine (605 mg, 4.2 mmol) and the reaction mixture was refluxed for 6 hours. The reaction mixture was diluted with EtOAc, washed four times with water and brine and dried over magnesium sulfate. The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give amine as a white solid (83 mg, 70%). To a solution of free base (83 mg, 0.11 mmol) in ether (25 mL) was added 4N HCl in dioxane (0.05 mL, 0.20 mmol). After stirring for 10 minutes, the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give hydrochloride salt 8 as a white solid (65 mg, 75%): Assay (C ₃₇ H ₄₉ N ₄ O ₆ S ₁ F ₂ Cl ₁ ): Theoretical: C, 59.15; H, 6. 45; N, 7.47. Found: C, 58.90; H, 6.51; N, 7.21.

Example 9

9: To a solution of 7A (100 mg, 0.16 mmol) in THF (2 mL) was added 2,5-difluorobenzylamine (610 mg, 4.3 mmol) and the reaction mixture was refluxed for 6 hours. The reaction mixture was diluted with EtOAc, washed four times with water and brine and dried over magnesium sulfate. The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give amine as a white solid (110 mg, 93%). To a solution of free base (110 mg, 0.15 mmol) in ether (25 mL) was added 4N HCl in dioxane (0.05 mL, 0.20 mmol). After stirring for 10 minutes, the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give hydrochloride salt 9 as a white solid (76 mg, 66%): CIMS (NH ₃ ) m / z: 715 (M + H ⁺ , 100%).

<Example 10>

10: To a solution of 7A (100 mg, 0.16 mmol) in THF (2 mL) was added 2,6-difluorobenzylamine (600 mg, 4.2 mmol) and the reaction mixture was refluxed for 6 hours. The reaction mixture was diluted with EtOAc, washed four times with water and brine and dried over magnesium sulfate. The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give amine as a white solid (103 mg, 87%). To a solution of free base (103 mg, 0.14 mmol) in ether (25 mL) was added 4N HCl in dioxane (0.05 mL, 0.20 mmol). After stirring for 10 minutes, the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give hydrochloride salt 10 as a white solid (82 mg, 76%): CIMS (NH ₃ ) m / z: 715 (M + H ⁺ , 100%).

<Example 11>

11: N- [2R-hydroxy-3-[[(1,3-benzodioxol-5-yl) sulfonyl] (2-methylpropyl) amino] -1S- (phenylmethyl in THF (2 mL) To a solution of) propyl] -2S-[(chloroacetyl) amino] -3,3-dimethylbutanamide 11A (750 mg, 1.23 mmol) was added 3-fluorobenzylamine (1.1 g, 8.8 mmol) and the reaction was carried out. The mixture was stirred overnight. The reaction mixture was diluted with EtOAc, washed four times with water and brine and dried over magnesium sulfate. The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give amine as a white solid (532 mg, 62%). To a solution of free base (532 mg, 0.76 mmol) in ether (100 mL) was added 4N HCl in dioxane (0.22 mL, 0.88 mmol). After stirring for 10 minutes, the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give hydrochloride salt 11 as a white solid (417 mg, 75%): CIMS (NH ₃ ) m / z: 699 (M + H ⁺ , 100%).

<Example 12>

12: To a solution of 11A (2.0 g, 3.27 mmol) in THF (7 mL) was added 3,5-difluorobenzylamine (2.42 g, 16.9 mmol) and the reaction mixture was refluxed for 5 hours. The reaction mixture was diluted with EtOAc, washed four times with water and brine and dried over magnesium sulfate. The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give amine as a white solid (2.26 g, 97%). To a solution of free base (1.8 g, 2.51 mmol) in ether (100 mL) was added 4N HCl in dioxane (0.66 mL, 2.67 mmol). After stirring for 10 minutes, the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give benzylamine salt 12 as a white solid (1.65 g, 87%): CIMS (NH ₃ ) m / z: 717 (M + H ⁺ , 100%). Anal (C ₃₆ H ₄₇ N ₄ O ₇ S ₁ F ₂ Cl ₁ ): Theoretical: C, 57.40; H, 6. 17; N, 7.45. Found: C, 57.25; H, 6. 25; N, 7.24.

Example 13

13: To a solution of 11A (750 mg, 1.23 mmol) in THF (2 mL) was added 2,5-difluorobenzylamine (1.2 g, 8.5 mmol) and the reaction mixture was refluxed for 6 hours. The reaction mixture was diluted with EtOAc, washed four times with water and brine and dried over magnesium sulfate. The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give amine as a white solid (702 mg, 80%). To a solution of free base (702 mg, 0.98 mmol) in ether (100 mL) and EtOAc (25 mL) was added 4N HCl in dioxane (0.3 mL, 1.2 mmol). After stirring for 10 minutes, the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give hydrochloride salt 13 as a white solid (586 mg, 79%): CIMS (NH ₃ ) m / z: 717 (M + H ⁺ , 100%).

<Example 14>

14: To a solution of 11A (750 mg, 1.23 mmol) in THF (2 mL) was added 2,6-difluorobenzylamine (1.2 g, 8.3 mmol) and the reaction mixture was refluxed for 6 hours. The reaction mixture was diluted with EtOAc, washed four times with water and brine and dried over magnesium sulfate. The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give amine as a white solid (717 mg, 81%). To a solution of free base (717 mg, 1.00 mmol) in ether (100 mL) was added 4N HCl in dioxane (0.3 mL, 1.2 mmol). After stirring for 10 minutes, the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give hydrochloride salt 14 as a white solid (663 mg, 88%): CIMS (NH ₃ ) m / z: 717 (M + H ⁺ , 100%).

<Example 15>

15: To a solution of 11A (750 mg, 1.23 mmol) in THF (2 mL) was added 3,4-difluorobenzylamine (1.2 g, 8.3 mmol) and the reaction mixture was refluxed for 3 hours. The reaction mixture was diluted with EtOAc, washed four times with water and brine and dried over magnesium sulfate. The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give amine as a white solid (760 mg, 86%). To a solution of free base (760 mg, 1.06 mmol) in ether (100 mL) was added 4N HCl in dioxane (0.3 mL, 1.2 mmol). After stirring for 10 minutes, the resulting solid was filtered to give hydrochloride salt 15 as white solid (730 mg, 91%): CIMS (NH ₃ ) m / z: 717 (M + H ⁺ , 100%).

<Example 16>

16: To a solution of 11A (750 mg, 1.23 mmol) in THF (2 mL) was added 2,4-difluorobenzylamine (1.2 g, 8.3 mmol) and the reaction mixture was refluxed for 6 hours. The reaction mixture was diluted with EtOAc, washed four times with water and brine and dried over magnesium sulfate. The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give amine as a white solid (693 mg, 79%). To a solution of free base (693 mg, 0.97 mmol) in ether (100 mL) was added 4N HCl in dioxane (0.3 mL, 1.2 mmol). After stirring for 10 minutes, the resulting solid was filtered to give hydrochloride salt 16 as a white solid (638 mg, 88%): CIMS (NH ₃ ) m / z: 717 (M + H ⁺ , 100%) .

<Example 17>

17: To a solution of 11A (500 mg, 0.82 mmol) in THF (2 mL) was added 4-fluorobenzylamine (1.0 g, 8.0 mmol) and the reaction mixture was stirred overnight. The reaction mixture was diluted with EtOAc, washed four times with water and brine and dried over magnesium sulfate. The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give amine as a white solid (470 mg, 82%). To a solution of free base (400 mg, 0.57 mmol) in ether (30 mL) was added 4N HCl in dioxane (0.18 mL, 0.7 mmol). After stirring for 15 minutes, the resulting solid was filtered to give hydrochloride salt 17 as a white solid (413 mg, 98%): CIMS (NH ₃ ) m / z: 699 (M + H ⁺ , 100%) .

<Usability>

Compounds of formula (I) have HIV protease inhibitory activity and are therefore useful as antiviral agents for the treatment of HIV infection and related diseases. Compounds of formula (I) have HIV protease inhibitory activity and are effective as HIV growth inhibitors. The ability of the compounds of the invention to inhibit viral growth or infectivity is demonstrated by standard assays for viral growth or infectivity, for example the assays described below.

The compounds of formula I of the present invention are also useful for inhibiting HIV in in vitro samples that contain or are expected to be exposed to HIV. Thus, the compounds of the present invention can be used to inhibit HIV that contains HIV, is suspected of containing HIV, or is present in a bodily fluid sample (eg, serum or semen sample) exposed to HIV.

Compounds provided by the present invention are also useful as standard or reference compounds for use in tests or assays, for example, to measure the ability of a drug to inhibit viral clone replication and / or HIV protease in a pharmaceutical investigation program. . Thus, the compounds of the present invention can be used as control or reference compounds and as quality control standards in such assays. The compounds of the present invention may be provided in commercially available kits or containers for use as such standard or reference compounds.

Since the compounds of the present invention exhibit specificity for HIV proteases, the compounds of the present invention may be useful as diagnostic reagents in diagnostic assays for the detection of HIV proteases. Thus, inhibition of protease activity by a compound of the invention in an assay (eg, in the assays described herein) will be indicative of the presence of HIV proteases and HIV viruses.

As used herein, "μg" is in micrograms, "mg" is in milligrams, "g" is in grams, "μl" is in microliters, "mL" is in milliliters, "L" is in liters, "nM "Silver nanomolar," μM "denotes micromolar," mM "denotes millimolar," M "denotes mole, and" nm "denotes nanometer. "Sigma" refers to Sigma-Aldrich Corp., St. Louis, Missouri.

HIV RNA Analysis

DNA plasmids and in vitro RNA transcripts:

Plasmid pDAB 72 containing both the gag and pol sequences of BH10 (bp 113-1816) cloned into PTZ 19R was prepared according to Erickson-Viitanen et al., AIDS Research and Human Retroviruses 1989, 5, 577. This plasmid was linearized with Bam HI, and then RNA transcripts were generated in vitro using the Riboprobe Gemini system II kit (Promega) with T7 RNA polymerase. The synthesized RNA was purified by treatment with RNase free DNase (promega), extracted with phenol-chloroform and precipitated with ethanol. RNA transcripts were dissolved in water and stored at -70 ° C. The concentration of RNA was measured from A ₂₆₀ .

Probe:

Biotinylated capture probes are described in Cocuzza, Tet. Lett. 1989, 30, 6287] using a biotin-phosphoramidite reagent to synthesize biotin on the 5 'end of the oligonucleotide on an Applied Biosystems (Foster City, CA) DNA synthesizer and then purified by HPLC It was. gag biotinylated capture probe (5′-biotin-CTAGCTCCCTGCTTGCCCATACTA 3 ′) was complementary to nucleotides 889 to 912 of HXB2, and pol biotinylated capture probe (5′-biotin-CCCTATCATTTTTGGTTTCCAT 3 ′) to nucleotides 2374 to HXB2 It was complementary to 2395. Alkaline phosphatase bound oligonucleotides used as reporter probes were prepared by Syngene (Syngene, San Diego, CA). The pol reporter probe (5 ′ CTGTCTTACTTTGATAAAACCTC 3 ′) was complementary to nucleotides 2403 to 2425 of HXB2. The gag reporter probe (5 'CCCAGTATTTGTCTACAGCCTTCT 3') was complementary to nucleotides 950-973 of HXB2. All nucleotide positions were evaluated using the GenBank Genetic Sequence Data Bank as assessed by the Genetics Computer Group Sequence Analysis Software Package (Devereau Nucleic Acids Research 1984, 12, 387). Bank's location. Reporter probes were prepared as 2 × SSC (0.3M NaCl, 0.03M sodium citrate), 0.05M Tris pH 8.8, 0.5 μM stock in 1 mg / mL BSA. Biotinylated capture probes were prepared in 100 μM stock solutions in water.

Streptavidin Coated Plates:

Streptavidin coated plates were obtained from Du Pont Biotechnology Systems (Boston, Massachusetts).

Cell and virus stocks:

MT-2 and MT-4 cells were treated with 5% fetal bovine serum (FCS) for MT-2 cells or 10% FCS for MT-4 cells, 2 mM L-glutamine and 50 μg / mL gentamicin (both Gibco (Gibco) was maintained at RPMI 1640 supplemented. HIV-1 RF was propagated in MT-4 cells in the same medium. Viral stocks were prepared approximately 10 days after acute infection of MT-4 cells and stored at −70 ° C. as aliquots. Infection titers of HIV-1 (RF) stocks ranged from 1 to 3 × 10 ⁷ PFU (plaque forming units) / mL as determined by plaque assay (see below) on MT-2 cells. Each aliquot of the viral stock used for infection was thawed only once.

To assess antiviral effect, cells to be infected were passaged one day before infection. On day 1 of infection, cells were harvested from Dulbecco's modified Eagle's medium (Dulbecco's) containing 5% FCS in RPMI 1640 for bulk infection, 5 x 10 ⁵ cells in 1 mL of 5% FCS or for infection in microtiter plates modified Eagles medium) was resuspended at 2 × 10 ⁶ in 1 mL. Virus was added and continued incubation at 37 ° C. for 3 days.

HIV RNA Analysis:

Cell lysates or purified RNA in 3M or 5M GED were mixed with 5M GED and capture probes to give a final guanidinium isothiocyanate concentration of 3M and a final biotin nucleotide concentration of 30 nM. Hybrids were sealed at 37 ° C. for 16-20 hours in a sealed U-bottom 96 well tissue culture plate (Nunc or Costar). The RNA hybridization reaction was diluted three times with demineralized water to a final guanidinium isothiocyanate concentration of 1M and aliquots (150 μl) were transferred to streptavidin coated microtiter plate wells. After binding the capture probe and capture probe-RNA hybrid to immobilized streptavidin for 2 hours at room temperature, plates were plated using DuPont ELISA plate wash buffer (phosphate buffered saline (PBS), 0.05% Tween 20.). Washed twice. A second hybridization of the reporter probe with the immobilized complex of the capture probe and hybridized target RNA was carried out in 4 × SSC, 0.66% Triton X 100, 6.66% desalted formamide, 1 mg / mL BSA in washed streptavidin coated wells. And 120 μl of hybridization cocktail containing 5 nM reporter probe. After hybridization at 37 ° C. for 1 hour, the plates were washed again six times. Passivated alkaline phosphatase activity was determined by buffer δ (2.5M diethanolamine pH 8.9 (JBL Scientific), 10 mM MgCl ₂ , 5 mM zinc acetate dihydrate and 5 mM N-hydroxyethyl-ethylene-diamine- Detection by adding 100 [mu] l of 0.2 mM 4-methylumbelliferyl phosphate (MUBP, JBL Scientific) in triacetic acid). Plates were incubated at 37 ° C. Fluorescence at 450 nM was measured using a microplate fluorometer (Dynateck) that excited at 365 nM.

Compound Evaluation Based on Microplates in HIV-1 Infected MT-2 Cells:

The compound to be evaluated was dissolved in DMSO and diluted with culture medium to a DMSO concentration of 2% and 2% of the highest concentration to be tested. Directly diluting the compound three times further in culture medium directly in a U-shaped bottom microtiter plate (nonk). After diluting the compound, MT-2 cells (50 μl) were added to a final concentration of 5 × 10 ⁵ / mL (1 × 10 ⁵ / well). Cells were incubated with compounds for 30 minutes at 37 ° C. in a CO ₂ incubator. To assess antiviral capacity, an appropriate dilution (50 μl) of HIV-1 (RF) virus stock was added to the culture wells containing the cell and test compound dilutions. The final volume of each well was 200 μl. Eight wells per plate were left uninfected with 50 μl virus added medium, while eight wells were infected under conditions free of any antiviral compounds. To assess the toxicity of the compounds, comparable plates were incubated without viral infection.

Three days after incubation at 37 ° C. in a humid chamber inside a CO ₂ incubator, all but 25 μl medium / well were removed from HIV infected plates. 37 μl of 5M GED containing biotinylated capture probes were added to the settled cells and residual medium in each well to give 3M GED and 30 nM capture probes. Hybridization of capture probes with HIV RNA in cell lysates was performed in the same microplate wells used for virus culture by sealing the plates with plate sealant (Costa) and incubating in a 37 ° C. incubator for 16-20 hours. Distilled water was then added to each well to dilute the hybridization reaction three times and 150 μl of this diluted mixture was transferred to a streptavidin coated microtiter plate. HIV RNA was quantified as described above. Known pDAB 72 in vitro RNA transcripts were used for each microtiter plate to measure the amount of viral RNA during infection of the standard curve created by adding to wells containing lysed uninfected cells.

To standardize virus inoculum used to evaluate compounds for antiviral activity, virus dilutions were selected and IC for 0.2 μg / mL dideoxycytidine (ddC).₉₀The value (concentration of compound required to reduce HIV RNA levels by 90%) was determined. IC of other antiviral compounds that are less potent and more potent than ddC₉₀Values were reproduced when performing this procedure using several stocks of HIV-1 (RF). The concentration of virus is approximately 3 x 10 per assay well⁵It corresponded to PFU (measured by plaque assay on MT-2 cells) and typically exhibited approximately 75% of the maximum viral RNA levels obtainable in any virus inoculum. For HIV RNA analysis, IC₉₀Values are determined from the reduced percentage of positive signal in RNA analysis for positive signal from untreated cells infected on the same culture plate (average 8 wells) (signal from uninfected cell sample in signal from infected cell sample) can do. The effective performance of individual infection and RNA analysis tests was determined according to three criteria. As a result of viral infection the RNA assay signal needs to be greater than or equal to the signal generated from 2 ng of pDAB 72 in vitro RNA transcript. IC to ddC measured by running each analysis₉₀ Should be 0.1 to 0.3 μg / mL. Finally, the planar level of viral RNA produced by an effective protease inhibitor should be less than 10% of the level obtained with uninhibited infection. IC of compound₉₀When the compound was found to be less than 1 μM, the compound was considered to be active.

For the antiviral capacity test, all work on the microtiter plate was performed using Perkin Elmer / Cetus ProPette, first adding the 2-fold concentrated compound solution to one row of wells. .

Dosage and Formulation

The antiviral compounds of the present invention are administered as a therapeutic agent for viral infections by any means of bringing into contact the active agent with the site of action of the agent in the mammalian body, ie the viral protease. They may be administered by any conventional method useful for using a medicament as an individual therapeutic agent or as a combination of therapeutic agents. They may be administered alone, but are preferably administered with a pharmaceutical carrier selected based on the chosen route of administration and standard pharmaceutical practice.

The dosage administered is of course well known factors such as the pharmacokinetic properties of the particular agent and its mode and route of administration; The age, health and weight of the recipient; The nature and extent of the symptoms; What kind of treatment you are currently receiving; Frequency of treatment; And the desired effect. Daily dosages of the active ingredient can be expected to be from about 0.001 to about 1000 mg, preferably from about 0.1 to about 30 mg / kg per kg of body weight.

Dosage forms of a composition suitable for administration contain from about 1 to about 100 mg of active ingredient per unit. In such pharmaceutical compositions, the active ingredient will usually be present in an amount of about 0.5 to 95 weight percent, based on the total weight of the composition. The active ingredient can be administered orally in solid dosage forms such as capsules, tablets and powders, or in liquid dosage forms such as elixirs, syrups and suspensions. It can also be administered parenterally in sterile liquid dosage forms.

Gelatin capsules contain the active ingredient and powdered carriers such as lactose, starch, cellulose derivatives, magnesium stearate, stearic acid and the like. Similar diluents can be used to make compressed tablets. Both tablets and capsules may be prepared as sustained release preparations to release the drug continuously over a period of time. Compressed tablets may be sugar coated or film coated to hide any unpleasant odors and protect the tablets from the atmosphere, or enteric coated for selective disintegration in the gastrointestinal tract. Liquid dosage forms for oral administration may contain colorants and flavoring agents to increase patient tolerance.

Generally, water, suitable oils, saline, aqueous dextrose (glucose), and related sugar solutions and glycols such as polypropylene glycol or polyethylene glycol are suitable carriers for parenteral solutions. Solution for parenteral administration preferably contains a water-soluble salt of the active ingredient, a suitable stabilizer, and optionally a buffer substance. Antioxidants, such as sodium bisulfite, sodium sulfite or ascorbic acid, alone or in combination, are suitable stabilizers. Citric acid and its salts, and sodium EDTA are also used. Parenteral solutions may also contain preservatives such as benzalkonium chloride, methyl- or propyl-parabens and chlorobutanol. Suitable pharmaceutical carriers are described in the standard reference literature in this field, Remington's Pharmaceutical Sciences, supra .

Useful pharmaceutical dosage forms for the administration of the compounds of the invention can be described as follows:

Capsule

Many unit capsules can be prepared by filling each of the standard two-piece hard gelatin capsules with 100 mg of powdered active ingredient, 150 mg of lactose, 50 mg of cellulose and 6 mg of magnesium stearate.

Soft Gelatin Capsules

Mixtures of the active ingredients in digestible oils such as soybean oil, cottonseed oil or olive oil can be prepared and injected into the gelatin using a positive discharge pump to produce soft gelatin capsules containing 100 mg of the active ingredient. This capsule must then be washed and dried.

refine

Many tablets can be prepared by conventional methods such that the dosage unit is 100 mg of active ingredient, 0.2 mg of colloidal silicon dioxide, 5 mg of magnesium stearate, 275 mg of microcrystalline cellulose, 11 mg of starch and 98.8 mg of lactose. . Appropriate coatings can be added to improve taste or delay absorption.

Suspension

Aqueous suspensions are prepared for oral administration so that 5 mL each contains 25 mg of finely divided active ingredient, 200 mg of carboxymethyl sodium, 200 mg of cellulose, 5 mg of sodium benzoate, 1.0 g of sorbitol solution (USP) and 0.025 mg of vanillin. Can be.

Injection

Parenteral compositions suitable for injection administration can be prepared by stirring 1.5% by weight of active ingredient in propylene glycol and 10% by volume of water. This solution is sterilized by conventional techniques.

Combination of components (a) and (b)

Each therapeutic agent component of the present invention may be independently any dosage form as described above, and may also be administered in a variety of ways as described above. In the following description, component (b) is understood to represent one or more agents as described above. Thus, if components (a) and (b) are treated identically or independently, each agent of component (b) may be treated identically or independently.

The components (a) and (b) of the present invention can be formulated together in a single dosage unit as a combination product (ie, mixed together in one capsule, tablet, powder or liquid, etc.). If components (a) and (b) are not formulated together in a single dosage unit, component (a) may be administered at the same time or in any order as component (b), e.g. Components a) may be administered first followed by a), or they may be administered in the reverse order. If component (b) contains one or more agents, for example one RT inhibitor and one protease inhibitor, these agents may be administered together or in any order. If not administered at the same time, it is preferred to administer components (a) and (b) separately within about 1 hour. It is preferred that the route of administration of components (a) and (b) is oral. As used herein, the term oral medications, oral inhibitors, oral compositions and the like refer to compounds that can be administered orally. It is preferred to administer both component (a) and component (b) in the same route (ie, for example, orally) or in the same dosage form, but in some cases different routes (ie, one component in a combination product, for example). May be administered orally and the other component may be administered intravenously) or in different dosage forms, respectively.

Medical practitioners skilled in the art can determine the combination therapeutic dosage of the present invention as described above, the pharmacokinetic characteristics of the particular agent and its mode and route of administration, the age, health and weight of the recipient, the nature and extent of symptoms, the type of treatment currently being received. It will be appreciated that this may vary depending on various factors such as the frequency of treatment, and the desired effect.

Appropriate dosages of components (a) and (b) of the present invention will be readily determined by one of ordinary skill in the art based on the present disclosure. As a general guideline, typically the daily dosage of each component may be from about 100 mg to about 1.5 g. If component (b) represents one or more compounds, typically the daily dosage of each agent in component (b) may be from about 100 mg to about 1.5 g. As a general guideline, in the case of co-administration of the compounds of component (a) and component (b), in consideration of the synergistic effect of the combination, the dose of each component is administered alone as a single agent for the treatment of HIV infection. It can be reduced to about 70 to 80% of the general dosage of the ingredient.

Combination products of the present invention can be formulated in a manner that minimizes physical contact between the active ingredients even if the active ingredients are combined into a single dosage unit. To minimize contact, one active ingredient may be enteric coated, for example when the product is administered orally. Enteric coating of one of the active ingredients not only minimizes contact between the combined active ingredients, but also allows one of these ingredients in the gastrointestinal tract to be released in the intestine but not in the stomach. Release can be controlled. Another embodiment of the invention where oral administration is preferred provides a combination product in which one of the active ingredients is coated with a sustained release material to affect sustainedly through the gastrointestinal tract, minimizing contact between the combined active ingredients. do. In addition, the sustained release component may be further enteric coated such that release of this component occurs only in the intestine. Another method is to coat the active ingredient with slow release and / or enteric polymers and to further separate the active ingredients and the other ingredients with polymers such as low viscosity hydroxypropyl methylcellulose or other suitable materials known in the art. The formulation is related to the formulation of a combination product. Polymeric coatings serve to form additional barriers to interaction with other components. In each formulation method of preventing contact between components (a) and (b) via a coating or some other material, contact between the individual agents of component (b) can also be prevented.

Dosage forms of a combination product of the present invention which enterically coat one active ingredient may be mixed together with the enteric coated ingredient and the other active ingredient and then compressed into tablets or the enteric coated ingredient is compressed into one tablet layer and the other active ingredient It may be in the form of a tablet in a manner to compress the into another layer. Optionally, one or more placebo layers may be provided such that the placebo layer is between the layers of the active ingredient to further separate the two layers. In addition, the dosage form of the present invention may be in the form of a capsule in which one active ingredient is compressed into tablets or in the form of a plurality of microtablets, particles, granules or non-perils, followed by enteric coating. These enteric coated microtablets, particles, granules or biferyl are encapsulated or compressed into capsules through granulation of other active ingredients.

These and other methods of minimizing contact between the components in the inventive combination product, whether administered in the same time or simultaneously, whether in single or separate forms, will be apparent to those skilled in the art based on the present disclosure.

Pharmaceutical kits useful in the treatment of HIV infection are also within the scope of the present invention, comprising in one or more sterile containers a therapeutically effective amount of a pharmaceutical composition comprising a compound of component (a) and at least one compound of component (b). Sterilization of the vessel can be carried out using conventional sterilization methods well known to those skilled in the art. Component (a) and component (b) may be in the same sterile container or in separate sterile containers. Sterile containers of material may include separate containers or, optionally, containers divided into one or more parts. Component (a) and component (b) may be separated or physically combined into a single dosage form or unit as described above. As will be apparent to those skilled in the art, such kits may further optionally comprise one or more of various conventional pharmaceutical kit components, such as one or more pharmaceutically acceptable carriers, additional vials for mixing the components, and the like. Instructions may also be included in the kit indicating the amount of ingredients to be administered as an insert or label, instructions for administration, and / or instructions for mixing the components.

Clearly, numerous applications and variations of the present invention are possible in light of the above teachings. It is, therefore, to be understood that within the scope of the appended claims, the invention may be practiced otherwise than as specifically described herein.

Claims (24)

Or a pharmaceutically acceptable salt form thereof. <Formula I> Wherein R ¹ is F, R ² is F or H, R ³ is 4-aminophenyl, 3-aminophenyl, 2,3-dihydrobenzofuran-5-yl and 1,3-benzodioxol -5- days from the group. The compound of claim 1, wherein the compound is formula II. <Formula II> The compound of claim 2, wherein the compound is of formula IIa. <Formula IIa> The compound of claim 3, wherein R ³ is 3-aminophenyl. The compound of claim 3, wherein R ³ is 4-aminophenyl. The compound of claim 3, wherein R ³ is 2,3-dihydrobenzofuran-5-yl or 1,3-benzodioxol-5-yl. The compound of claim 2, wherein the compound is of formula IIb, <Formula IIb> 8. A compound according to claim 7, wherein R ³ is 3-aminophenyl. 8. The compound of claim 7, wherein R ³ is 4-aminophenyl. 8. The compound of claim 7, wherein R ³ is 2,3-dihydrobenzofuran-5-yl or 1,3-benzodioxol-5-yl. The compound of claim 2, wherein the compound is of formula IIc. <Formula IIc> The compound of claim 11, wherein R ³ is 3-aminophenyl. The compound of claim 11, wherein R ³ is 4-aminophenyl. 12. The compound of claim 11, wherein R ³ is 2,3-dihydrobenzofuran-5-yl or 1,3-benzodioxol-5-yl. The compound of claim 1, wherein said compound is of formula III. <Formula III> The compound of claim 15, wherein said compound is of formula IIIa. <Formula IIIa> The compound of claim 1, wherein said compound is of formula IV. <Formula IV> 18. The compound of claim 17, wherein said compound is of formula IVa. <Formula IVa> A pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of a compound according to any one of claims 1 to 19. A method of treating HIV infection comprising administering to a host in need thereof a therapeutically effective amount of a compound according to any one of claims 1 to 19 or a pharmaceutically acceptable salt form thereof. (a) a compound according to any one of claims 1 to 19 or a stereoisomeric form, a mixture of stereoisomeric forms, or a pharmaceutically acceptable salt thereof; And (b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors A method of treating HIV infection comprising co-administering a therapeutically effective amount of a to a host in need thereof. The method of claim 21, wherein the reverse transcriptase inhibitor is AZT, ddC, ddI, d4T, 3TC, delavirdine, efavirenz, nevirapine, Ro 18,893, trovirdine , MKC-422, HBY 097, ACT, UC-781, UC-782, RD4-2025 and MEN 10979, wherein the protease inhibitors are saquinavir, ritonavir, indinanav Indinavir, amprenavir, nelfinavir, palinavir, BMS-232623, GS3333, KNI-413, KNI-272, LG-71350, CGP-61755, PD 173606 , PD 177298, PD 178390, PD 178392, U-140690 and ABT-378. 23. The method of claim 22, wherein said reverse transcriptase inhibitor is selected from the group of AZT, efavirenz and 3TC, and said protease inhibitor is selected from the group of saquinavir, ritonavir, elfinavir and indinavir. The method of claim 21, wherein said compound (b) is ritonavir.