CZ20012435A3 - Sulfonamides of bis-amino acids containing N-terminus substituted benzyl group and being useable as inhibitors of HIV proteases - Google Patents

Abstract

This invention relates generally to bis-amino acid sulfonamides containing substituted benzyl amines of formula (I) or stereoisomeric forms, stereoisomeric mixtures, or pharmaceutically acceptable salt forms thereof, which are useful as HIV protease inhibitors, pharmaceutical compositions and diagnostic kits comprising the same, methods of using the same for treating viral infection or as assay standards or reagents, and intermediates and processes for making the same.

Description

Bis-amino acid sulfonamides containing an N-terminally substituted benzyl group useful as HIV protease inhibitors

Technical field

The present invention generally relates to bis-amino acid sulfonamides containing substituted benzylamines useful as HIV protease inhibitors, pharmaceutical compositions and diagnostic kits containing said compounds, and the use of said compounds for the treatment of viral infection or as standards in assays or as reagents.

BACKGROUND OF THE INVENTION

Two different retroviruses, human immunodeficiency virus (HIV) type 1 (HIV-1) or type 2 (HIV-2), are etiologically associated with immunosuppressive disease, acquired immune deficiency syndrome (AIDS). HIV seropositive individuals are initially symptom free, but typically develop AIDS-related complex (symptoms), followed by AIDS. Affected persons develop severe immunosuppression, which makes them susceptible to debilitating and eventually fatal opportunistic infections.

AIDS is the end result of HIV-1 and HIV-2 following their own complex life cycles. The virion life cycle begins by binding the virion itself to the host immune cells, human T4 lymphocytes, by binding the glycoprotein on the surface of the virion protective envelope with the CD4 glycoprotein to the lymphocyte. Once bound, the virion discards its glycoprotein envelope, penetrates the host cell membrane and unpacks its RNA. The virion enzyme, reverse transcriptase, controls the process of transcribing RNA to single-stranded

• · · ·

DNA. The viral RNA is degraded and a second strand of DNA is formed. This now double-stranded DNA is integrated into human cell genes and these genes are used to reproduce the virus.

From this point on, RNA polymerase transcribes the integrated DNA to viral RNA. Viral RNA is translated into the precursor of the gag-pol fusion polyprotein. The polyprotein is then enzymatically cleaved by HIV proteases to produce mature viral proteins. Thus, HIV protease is responsible for regulating the cascade of cleavage, which results in the viral particles maturing to a virus that is fully infectious.

The typical response of the human immune system, killing a damaging virion, is not "free" because the virus infects and kills T cells of the immune system. In addition, the viral reverse transcriptase, the enzyme used to form new virion particles, is not very specific and causes transcriptional errors that result in constant changes in glycoproteins on the surface of the viral protective coat. This lack of specificity reduces the efficacy of the immune system, since antibodies specifically produced against one glycoprotein may be unusable against another, reducing the amount of antibodies suitable to fight the virus. The virus continues to reproduce while the immune system's reaction weakens. Finally, HIV largely takes over the body's immune system, allowing opportunistic infections to occur, and death can occur without administration of antiviral agents, immunomodulators, or both.

There are at least three critical sections in the life-cycle of the virus that have been identified as possible targets for antiviral drugs: 1) initial virion binding to site on T-4 lymphocytes or macrophage, 2) viral RNA transcription to viral DNA (reverse transcriptase, RT) and 3 ) processing of the gag-pol protein with an HIV protease.

Retrovirus genomes encode a protease that is responsible for the proteolytic processing of one or more polyprotein precursors, such as products of the pol and gag genes. (See Wellink, Arch. Virol., 98, 1, 1988). Retroviral proteases most often process the gag precursor into core proteins, and also process the pol precursor into reverse transcriptase and retroviral protease.

Proper processing of precursor polyproteins with a retroviral protease is essential for the assembly of infectious virions. In vitro mutagenesis has been shown to produce viruses with defective proteases leading to the production of immature core forms lacking infectivity. (See Crawford et al., J. Virol., 53, 899 (1985), Katoh et al., Virology, 145,

280, 1985). Therefore, retroviral protease inhibition provides an attractive target for antiviral therapy. (See Mitsuya, Nature, 325, 775, 1987).

As shown by protease inhibitors currently available on the market and in clinical trials, many compounds have been studied as potential inhibitors

HIV protease.

One group, the hydroxyethylaminosulfonamides, received significant attention. For example, PCT applications WO94 / 05639, WO94 / 04492,

WO95 / 06030 and WO96 / 28464 generically describe sulfonamides of the formula:

and methods for their preparation. Although some of the present compounds appear to fall within the generic description of any of the above publications, they are not specifically described, suggested or claimed therein.

······································································· ··· «·· ·· ···

Even with the simultaneous success of protease inhibitors, it has been found that HIV patients may become resistant to one protease inhibitor. Thus, it is desirable to develop additional protease inhibitors to further combat HIV infection.

SUMMARY OF THE INVENTION

Accordingly, it is an object of the present invention to provide novel protease inhibitors.

It is a further object of the present invention to provide a new treatment for HIV infection which comprises administering to a recipient in need thereof a therapeutically effective amount of at least one of the compounds of the present invention or a pharmaceutically acceptable salt thereof.

It is a further object of the present invention to provide a new treatment for HIV infection which comprises administering a therapeutically effective combination of a) one of the compounds of the present invention and

b) one or more compounds selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors to a recipient in need thereof.

It is a further object of the present invention to provide pharmaceutical compositions having protease inhibiting activity comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of at least one of the compounds of the present invention or a pharmaceutically acceptable salt thereof.

It is another object of the present invention to provide a method of inhibiting HIV present in a body fluid sample, the method comprising treating a body fluid sample with an effective amount of a compound of the present invention.

It is a further object of the present invention to provide a kit or container containing at least one of the compounds of the present invention in an amount effective for use as a standard or reagent in an assay or assay for detection.

the potency of a potential drug to inhibit HIV protease, HIV growth, or both.

These and other objects, which will become apparent in the following detailed description, have been achieved by the discovery of the inventor that compounds of formula I:

wherein R ¹ , R ² and R ³ are as defined below, their stereoisomeric forms, mixtures of stereoisomeric forms, or pharmaceutically acceptable salts thereof are potent protease inhibitors.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS [1] Thus, in a first embodiment, the present invention provides a novel compound of formula I:

or a pharmaceutically acceptable salt thereof, wherein: R ¹ is F.

R ² is F or H, and,

R ³ is selected from:

4-aminophenyl,

3-aminophenyl, 2,3-dihydrobenzofuran-5-yl and 1,3-benzodioxol-5-yl.

[2] In a preferred embodiment, the present compound of formula II:

the invention provides a new one

[3] In a more preferred embodiment, the present invention provides a novel compound of formula IIa:

[4] In an even more preferred embodiment, the present invention provides a novel compound of formula IIa, wherein:

R ³ is a 3-aminophenyl group.

[5] In another even more preferred embodiment, the present invention provides a novel compound of formula IIa, wherein:

R ³ is a 4-aminophenyl group.

[6] In another even more preferred embodiment, the present invention provides a novel compound of formula IIa, wherein:

R ³ is 2,3-dihydrobenzofuran-5-yl or 1,3-benzodioxol-5-yl.

[7] In another more preferred embodiment, the present invention provides a novel compound of formula IIb:

[8]

lib.

In another even more preferred embodiment, the present invention provides a novel compound of formula IIb, wherein: R ³ is a 3-aminophenyl group.

[9] In another even more preferred embodiment, the present invention provides a novel compound of formula IIb, wherein:

R ³ is a 4-aminophenyl group.

[10] In another even more preferred embodiment, the present invention provides a novel compound of formula IIb, wherein:

R ³ is a 2,3-dihydrobenzofuran-5-yl group

1,3-benzodioxol-5-yl.

invention invention or [11] In another more preferred embodiment, the present invention provides a novel compound of formula IIc:

invention

face.

In another even more preferred embodiment, the present invention provides a novel compound of formula IIc, wherein:

R ³ is a 3-aminophenyl group.

Invention In another even more preferred embodiment, the present invention provides a novel compound of formula IIc, wherein:

R ³ is a 4-aminophenyl group.

[14] In another even more preferred embodiment, the present provides a novel compound of formula IIc, wherein:

R ³ is a 2,3-dihydrobenzofuran-5-yl group

1,3-benzodioxol-5-yl.

In another preferred embodiment, the present invention or the invention provides a novel compound of formula III:

[16] In another more preferred embodiment, the present invention provides a novel compound of formula IIIa:

invention

lila.

In another preferred embodiment, the present invention provides a novel compound of formula IV:

• ·

In another more preferred embodiment, the present invention provides a novel compound of formula IVa:

IVa.

In another embodiment, the present invention provides a new pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of a compound of Formula I or a pharmaceutically acceptable salt thereof.

In another embodiment, the present invention provides a new treatment for HIV infection which comprises administering to a recipient in need thereof a therapeutically effective amount of a compound of Formula I or a pharmaceutically acceptable salt thereof.

In another embodiment, the present invention provides a novel treatment for HIV infection comprising administering a combination of a therapeutically effective amount:

(a) compounds of formula I, and

b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors to a recipient in need thereof.

In another preferred embodiment, the reverse transcriptase inhibitor is selected from the group consisting of AZT, ddC, dd1, d4T, 3TC, delavirdine, efavirenz, nevirapine, Ro18,893, trovirdine, MKC-442, HBY 097, ACT, UC-781, UC-782 , RD4-2025 and MEN 10979, and the protease inhibitor is selected from the group consisting of saquinavir, ritonavir, indinavir, amprenavir, nelfinavir, palinavir, BMS-232623, GS3333, KNI-413, KNI-272, LG-71350, CGP- 61755, PD 173606, PD 177298, PD 178390, PD 178392, U-140690, and ABT378.

In an even more preferred embodiment, the reverse transcriptase inhibitor is selected from the group consisting of AZT, efavirenz and 3TC, and the protease inhibitor is selected from the group consisting of saquinavir, ritonavir, nelfinavir, and indinavir.

In yet another preferred embodiment, the reverse transcriptase inhibitor is AZT.

In yet another preferred embodiment, the protease inhibitor is ritonavir.

In another preferred embodiment, component b) is an HIV reverse transcriptase inhibitor and an HIV protease inhibitor.

In another preferred embodiment, component b) is two different HIV reverse transcriptase inhibitors.

In another embodiment, the present invention provides a pharmaceutical composition useful for treating HIV infection, comprising a therapeutically effective amount of:

(a) compounds of formula I, and

b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors, in one or more sterile containers.

In another embodiment, the present invention provides a novel method of inhibiting HIV present in a body fluid sample, the method comprising treating a body fluid sample with a therapeutically effective amount of a compound of Formula I.

In a ninth embodiment, the present invention provides a new kit or container comprising a compound of Formula I in an amount effective for use as a standard or reagent in an assay or assay to determine the efficacy of a potential drug to inhibit HIV proteases, HIV growth, or both.

of the text have meanings,

· • • · · · · · ·

Definition

The terms and expressions used herein are as follows. It is necessary to present carbon atoms and racemic form.

of the invention may be active

For example, it is appreciated in the art, asymmetrically, that compounds containing and isolated optically well known as prepared optically by resolution of racemic or substituted active or forms from optically active starting materials. The invention encompasses the chiral diastereomeric racemic forms and, unless all the geometric isomeric forms of a given structure are synthesized, specific stereochemical or isomeric forms are reported that the methods presented on a scale of many grams, in industrial form, a plurality of forms are present.

of the invention will be at least many

It is assumed to operate in practice approximately a kilogram scale. Scale many grams, preferably a scale where at least 10 grams or

100 grams or herein, kilograms or as used herein, one starting material is grams or more, more preferably at least more, even more preferably at least more. A scale of many kilograms, as a measure, is used where more than one kilogram of at least one of the starting materials is used. Industrial scale, as used herein, means a scale that differs from a laboratory scale and is adequate to supply a product sufficient for either clinical trials or distribution to consumers.

it is intended that the present invention encompasses all atoms occurring in the present compounds, but is not limited to isotopes of hydrogen, including deuterium. Carbon isotopes include C-13 and C-14.

The term "HIV reverse transcriptase inhibitor" as used herein is intended to refer to nucleoside and non-nucleoside HIV reverse transcriptase (RT) inhibitors. Examples of nucleoside RT inhibitors include, but are not limited to

It is isotopes

General tritium and

AZT, ddC, dd1, d4T, and 3TC. Examples of non-nucleoside RT inhibitors include, but are not limited to, delavirdine (Pharmacia and Upjohn, U90152S), efavirenz (DuPont), nevirapine (Boehringer Ingelheim), Ro 18,893 (Roche), trovirdine (Lilly), MKC-442 (Triangle), HBY 097 (Hoechst); HBY 1293 (Hoechst); ACT (Korean Research Institute); UC-781 (Rega Institute); UC-782 (Rega Institute); RD4-2025 (Tosoh Co. Ltd.) and MEN 10979 (Menarini Pharmaceuticals) .

The term "HIV protease inhibitor" as used herein is intended to refer to compounds that inhibit HIV protease. Examples include, but are not limited to, saquinavir (Roche, Ro31-8959), ritonavir (Abbott, ABT-538), indinavir (Gauge, MK-639), amprenavir (Vertex / Glaxo Wellcome), nelfinavir (Agouron, AG-1343), palinavir ( Boehringer Ingelheim), BMS-232623 (Bristol-Myers Squibb), GSI3333 (Gilead Sciences), KNI-413 (Japan Energy), KNI-272 (Japan Energy), LG-71350 (LG Chemical), CGP-61755 (Ciba- Geigy), PD 173606 (Parke Davis), PD 177298 (Parke Davis), PD 178390 (Parke Davis), PD 178392 (Parke Davis), tipranavir (Pharmacia and Upjohn, U-140690), DMP-450 (DuPont), and ABT -378.

The term "pharmaceutically acceptable salts" as used herein is intended to include derivatives of the disclosed compounds wherein the parent compound is modified by forming its acid or base salt. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines, alkali or organic salts of acid residues such as carboxylic acids, and the like. Pharmaceutically acceptable salts include conventional nontoxic salts or quaternary ammonium salts of basic compounds formed e.g. non-toxic inorganic or organic acids. Such conventional non-toxic salts include, for example, those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic,

0 0 ·· • 000 00 00 · 0 0000 0 0 00

0 000 0 0 0 · 0 0 0 0 0 0 0 0 0 00 00 000 00 · 0 · phosphoric, nitric, etc. and salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, apple, tartar, lemon, ascorbic, pamoic, maleic, hydroxymalein, phenylacetic, glutamic, benzoic, salicylic, sulfanil, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethanedisulfonic, oxal, isethionic and the like.

The pharmaceutically acceptable salts of the present invention can be synthesized from basic compounds containing basic or acidic groups by conventional chemical methods. Generally, such salts can be prepared by reacting the free acid or base form of these compounds with a stoichiometric amount of the appropriate base or acid in water or an organic solvent, or a mixture thereof, generally non-aqueous media such as ether, ethyl acetate, ethanol, isopropanol or acetonitrile are preferred. (A list of suitable salts can be found in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, PA, 1418, 1985, the disclosure of which is incorporated by reference).

The term "pharmaceutically acceptable" as used herein refers to those compounds, substances, preparations and / or dosage forms which, according to sound medical judgment, are suitable for use in contact with human and animal tissues without undue toxicity, irritation, irritation, allergic reaction or other problem or complication corresponding to a rational benefit / risk ratio.

It is intended that the term "prodrug" includes any covalently bound carrier that releases the active parent drug of Formula I or other formulas or compounds of the present invention when the prodrug is administered to a mammal.

Prodrugs of the compounds of the present invention, for example of Formula I, are prepared by modifying the functional groups present in the compound such that the modifications are cleaved, 99

9 9 · 99 99

9,999 9,99999

9 9 9 9 99 either by routine manipulation or in vivo to give the parent compound. Prodrugs include compounds of the present invention wherein the hydroxy or amino group is attached to any group which, when administered to a mammal, cleaves to form a free hydroxyl or free amino group, respectively. Examples of prodrugs include, but are not limited to, acetate, formate and benzoate derivatives of alcohol and amine functional groups in the compounds of the present invention, and the like.

The terms "stable compound" and "stable structure" refer to compounds that are strong enough to withstand isolation from the reaction mixture to a useful degree of purity and formulation for an effective therapeutic preparation. The present invention contemplates only stable compounds.

The term "substituted" indicates that one or more of the hydrogens on the atom designated "substituted" is replaced by a group selected from said groups, provided that said normal valence of the atom is not exceeded, and that the substitution results in a stable compound. When the substituent is a keto group (ie = 0), then 2 hydrogens on the atom are replaced.

The term "therapeutically effective amount" refers to an amount of a compound of the present invention or an amount of a combination of compounds which is said to be effective in inhibiting HIV infection or treating the symptoms of HIV infection in a recipient. The combination of compounds is preferably a synergistic combination. Synergy (as described, for example, by Chou and Talalay, Adv. Enzyme Regul., 22: 27-55, 1984) occurs when the effect (in this case, inhibition of HIV replication) of the compounds administered in combination is greater than the additive effect of the compounds administered alone. preparations. In general, the synergistic effect is most clearly demonstrated when administering suboptimal concentrations of the compounds. Synergy may result in lower cytotoxicity, increased antiviral activity, or some other beneficial effects of the combination compared to the individual components.

One diastereomer of a compound of formula I may exhibit greater activity compared to another. If desired, separation of the racemic substance by HPLC using a chiral column or resolution can be achieved. using a distinguishing agent such as carafonyl chloride (Thomas J. Tucker, et al., J. Med. Chem., 37, 2437-2444, 1994). The chiral compound of formula I can also be synthesized directly using a chiral catalyst or chiral ligands (Mark A. Huffman, et al., J. Org. Chem., 60, 1590-1594, 1995).

Other features of the invention will become apparent during the following descriptions of exemplary embodiments that are provided to illustrate the invention and are not intended to limit it.

DETAILED DESCRIPTION OF THE INVENTION

The abbreviations used in the examples are defined as follows: "° C for degrees Celsius," d for doublet, "dd for doublet of doublets," equiv for equivalent or equivalents, "g for gram or grams," mg for milligram or milligrams, "ml for milliliter or milliliters, "H for hydrogen or hydrogen," h for hour or hour, "m for multiplet," M for molar, "min for minute or minutes," MHz for Megahertz, "MS for mass spectroscopy," nmr or " NMR for nuclear magnetic resonance spectroscopy, t for triplet and TLC for thin layer chromatography.

Example 1

in V · * · t · Φ · Φ · ΦΦ

4 · φ · · ΦΦΦ · · · · · ·

1ΒΒ solution of 127.6 g (251 mmol) of Ν- [3 (S) - [Ν, Ν-bis (phenylmethyl) amino] -2 (R) -hydroxy-4-phenylbutyl] -N-isobutylamine salt and oxalic acid VΑ in 1 L toluene, 500 mL water and 400 mL CH 2 Cl 2 was added 44.5 g NaOH (50% aqueous). After stirring for 10 minutes, the reaction mixture was extracted with toluene. The combined organic layers were washed with brine, dried (MgSO ₄ ), and the solvent was removed under reduced pressure. The residue was taken up in 1 L of THF, cooled to 0 ° C and treated with 28.15 g (278 mmol) of triethylamine and 55.23 g (253 mmol) of di-tert-butyl dicarbonate. The solution was warmed to room temperature and stirred overnight. The solvent was removed under reduced pressure and the residue was taken up in 1 L EtOAc, washed with water, 5% citric acid, water, saturated NaHCO ₃ , brine and dried (MgSO ₄ ). The solvent was removed under reduced pressure to give carbamate 1B, which was used directly without further purification. CIMS (NH ₃ ) m / z: 517 (M + H ⁺ , 100%).

• ·

1C To a solution of crude 1B (251 mmol possible) in 500 mL of methanol was added 10 g of palladium hydroxide on carbon (20%). The suspension was placed in a Parr bottle into which it was soaked

559 psi hydrogen. After shaking overnight, the reaction mixture was filtered through Celite and the solvent was removed under reduced pressure. The resulting solid was recrystallized (EtOAc / hexane) to give 56.6 g (67%) of amine 1C as a white solid (2 steps): CIMS (NH ₃ ) m / z: 337 (M + H ⁺ , 100%) .

ID To a solution of 47.5 g (179 mmol) of N-carbobenzyloxy-L-tert-leucine in 250 mL of DMF at 0 ° C was added 38.6 g (285 mmol) of N-hydroxybenzotriazole and 35.7 g (186 mmol) EDC. After stirring for 1.5 hours, the solution was added to 56.6 g (167 mmol) of suspension 1C and 52.9 g (521 mmol) of 4-methylmorpholine in 200 mL of DMF. The reaction mixture was warmed to room temperature. After stirring overnight, 4 mL of Ν, Ν-dimethylethylenediamine was added, the solution was stirred for 1.5 hours, and the solvent was removed under reduced pressure. The residue was taken up in 1 L EtOAc, washed with water, 5% citric acid, water, saturated NaHCO 3, brine, and dried (MgSO ₄ ). The solvent was removed under reduced pressure to give 97.5 g (100%) of ID, which was used directly without further purification. CIMS (NH ₃ ) m / z: 584 (M + H < + & gt ^; , 100%).

KΕ To a solution of 97.5 g (167 mmol) of ID in 300 ml of methanol was added 10 g of palladium hydroxide on carbon (20%). The suspension was placed in a Parr vessel into which 55 psi of hydrogen was charged. After shaking overnight, the reaction mixture was filtered through Celite and the solvent was removed under reduced pressure. The resulting solid was recrystallized (EtOAc / hexane) to give 72.8 g (97%) of amine 1E as a white solid: CIMS (NH ₃ ) m / z: 450 (M + H ⁺ , 100%).

1F To a solution of 43.8 g (97.6 mmol) of amine 1E in 400 mL of EtOAc and 270 mL of water was added 27.7 g (27.6 mmol) of KHCO3 and 12.4 g (111 mmol) of chloroacetyl chloride. After stirring for 3 hours, 1 L of EtOAc was added and the solution was washed with water, 5% citric acid, water, saturated NaHCO ₃ , brine, and dried (MgSO ₄ ). The solvent was removed under reduced pressure to give 51.0 g (99%) of 1F as a white solid. CIMS (NH ₃ ) m / z: 526 (M + H < + & gt ^; , 100%).

1G To a solution of 33.8 g (64.2 mmol) of 1F in 600 mL of EtOAc was added 80 mL (320 mmol) of 4N HCl in dioxane and the reaction mixture was stirred for 6 hours. The solvent was removed under reduced pressure and the resulting solid was triturated with cold ether to give 28.75 g (97%) of 1G: CIMS (NH ₃ ) hydrochloride m / z: 426 (M + H ⁺ , 100%).

1H To a solution of 32.0 g (69.2 mmol) of 1G salt in 350 mL of THF and 450 mL of water was added 56.7 g (411 mmol) of K 2 CO 3 and 16.9 g (76.0 mmol)

4-nitrobenzenesulfonyl chloride. After stirring for 4 hours, water was added and the suspension was extracted with EtOAc. The combined organic layers were washed with brine, 5% citric acid, water, saturated NaHCO ₃ , brine and dried (MgSO ₄ ). The solvent was removed under reduced pressure and the resulting solid was recrystallized (EtOAc / hexane) to give 35.8 g (85%) of sulfonamide 1H as a white solid. CIMS (NH ₃ ) m / z: 611 (M + H < + & gt ^; , 100%).

II To a solution of 1H (16.0 g, 26.1 mmol) in THF (200 mL) was added 3-fluorobenzylamine (20.0 g, 160 mmol) and the reaction mixture was refluxed overnight. The solvent was removed under reduced pressure and the residue was taken up in EtOAc and washed with water, brine and dried (MgSO ₄ ). The solvent was removed under reduced pressure and the residue was subjected to a residue.

chromatography (silica, 4% MeOH / _CH2 C12) to give 16.3 g (89%) of the amine II as a white solid. CIMS (NH ₃ ) m / z: 700 (M + H +, 100%).

To a solution of 14.6 g (20.8 mmol) of II in 500 mL of methanol was added 1.5 g of palladium hydroxide on carbon (20%) and the reaction mixture was impregnated with hydrogen. After stirring for 3 hours, the mixture was filtered through Celite and the solvent was removed under reduced pressure. The residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give 13.2 g (95%) of the amine as a white solid. To a solution of 11.68 g (17.4 mmol) of the free base in 300 mL of ether and 100 mL of EtOAc was added 37 mL (37 mmol) of 1N HCl in ether. The resulting suspension was stirred

15 minutes and it was filtered by origin 12, 5 g (96%) bis- hydrochloride 1 as white solid Substances: CIMS (NH ₃₎ m / z: 670 (M + H ⁺ , 100%). Example 2

2A

2A To a solution of 1H (16.0 g, 26.1 mmol) in THF (200 mL) was added 3,5-difluorobenzylamine (25.0 g, 174 mmol) and the reaction mixture was refluxed overnight. The solvent was removed under reduced pressure and the residue was taken up in EtOAc and washed with water, brine and dried (MgSO 4). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 4% methanol / CH ₂ Cl ₂ ) to give 15.2 g (81%) of amine 2A as a white solid. CIMS (NH 3) m / z: 718 (M + H ⁺ , 100%).

To a solution of 15.2 g (21.2 mmol) of 2A in 500 mL of methanol was added 1.5 g of palladium hydroxide on carbon (20%) and the reaction mixture was impregnated with hydrogen. After stirring for 4 hours, the mixture was filtered through Celite and the solvent was removed under reduced pressure. The residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂₎ to give 10.3 g (71%) of the amine as a white solid. To a solution of the free base in 300 mL of ether and 100 mL of EtOAc was added 32 mL (32 mmol) of 1N HCl in ether. The resulting suspension was stirred for 15 minutes and was filtered to give bis-hydrochloride 2 as a white solid: CIMS (NH 3) m / z: 688 (M + H ⁺ , 100%).

Example 3

3A To a solution of 1H (300 mg, 0.49 mmol) in THF (4 mL) was added 2,5-difluorobenzylamine (1.2 g, 8.5 mmol) and the reaction mixture was refluxed for 4 hours. The reaction mixture was diluted with EtOAc and was washed with water, brine and dried (MgSO ₄ ). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give 270 mg (77%) of amine 3A as a white solid. CIMS _(NH3) m / z: 718 (M + H ^+, 100/0)

To a solution of 260 mg (0.36 mmol) of 3A in 25 mL of methanol was added 50 mg of palladium hydroxide on carbon (20%) and the reaction mixture was impregnated with hydrogen. After stirring for 1 hour, the mixture was filtered through Celite and the solvent was removed under reduced pressure. The residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give 226 mg (91%) of the amine as a white solid. To a solution of the free base in 30 mL of ether and 10 mL of EtOAc was added 0.2 mL (0.8 mmol) of 4N HCl in dioxane. The resulting suspension was stirred for 15 minutes and was filtered under vacuum.

formation of bis-hydrochloride 3 as a white solid: CIMS (NH ₃ ) m / z: 688 (M + H ⁺ , 100%).

Example 4

4A To a solution of 1H (300 mg, 0.49 mmol) in THF (4 mL) was added 2,6-difluorobenzylamine (1.2 g, 8.5 mmol) and the reaction mixture was refluxed for 4 hours. The reaction mixture was diluted with EtOAc and washed with water, brine and dried (MgSO 4). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel,

5% methanol / CH ₂ Cl ₂ ) gave 306 mg (87%) of amine 4A as a white solid. CIMS (NH ₃ ) m / z: 718 (M + H ⁺ , 100%).

To a solution of 295 mg (0.41 mmol) of 4A in 25 mL of methanol was added 50 mg of palladium hydroxide on carbon (20%) and the reaction mixture was impregnated with hydrogen. After stirring for 1 hour, the mixture was filtered through Celite and the solvent was removed under reduced pressure. The residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give 228 mg (81%) of the amine as a white solid. To a solution of the free base in 30 ml of ether and

mL of EtOAc was added 0.2 mL (0.8 mmol) of 4N HCl in dioxane. The resulting suspension was stirred for 15 minutes and was filtered to give bis-hydrochloride 4 as a white solid: CIMS (NH ₃ ) m / z: 688 (M + H ⁺ , 100%).

Example 5

5A To a solution of 28.8 g (62.1 mmol) of the IG salt in 300 mL of THF and 400 mL of water was added 51.4 g (370 mmol) of K2CO3 and 15.14 g (68.3 mmol).

3-nitrobenzenesulfonyl chloride. After stirring for 4 hours, water was added and the suspension was extracted with EtOAc. The combined organic layers were washed with brine, 5% citric acid, water, saturated NaHCO 3, brine and dried (MgSO 4. The solvent was removed under reduced pressure and the resulting solid was triturated with EtOAc and hexane to give 32.1 g (85%) sulfonamide. 5A as white solids.

CIMS (NH ₃ ) m / z: 611 (M + H < + & gt ^; , 100%).

5B To a solution of chloride 5A (16.0 g, 26.1 mmol) in THF (200 mL) was added 3-fluorobenzylamine (17.0 g, 135 mmol) and the reaction mixture was refluxed overnight. The solvent was removed under reduced pressure and the residue was taken up in EtOAc and washed with water, brine and dried (MgSO ₄ ). The solvent was removed under reduced pressure and the residue was subjected to chromatography (silica gel, 4% MeOH / CH ₂ C1 ₂₎ to afford 16.0 g (87%) of the amine 5B as a white solid. CIMS (NH ₃ ) m / z: 700 (M + H ⁺ , 100%).

To a solution of 12.0 g (17.22 mmol) of 5B in 400 mL of methanol was added 1.25 g of palladium hydroxide on carbon (20%) and the reaction mixture was impregnated with hydrogen. After stirring for 3 hours, the mixture was filtered through Celite and the solvent was removed under reduced pressure. The residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give 11.2 g (97%) of the amine as a white solid. To a solution of the free base in 400 mL of ether and 75 mL of EtOAc was added 36 mL (36 mmol) of 1N HCl in ether. The resulting suspension was stirred for 15 minutes and was filtered to give bis-hydrochloride 5 as a white solid. CIMS (NH ₃ ) m / z: 670 (M + H ⁺ , 100%).

Example 6

6A

6A To a solution of 16.0 g (26.1 mmol) of chloride 5A in 200 mL of THF was added 25.0 g (174 mmol) of 3,5-difluorobenzylamine, and the reaction mixture was stirred for 2 hours and refluxed overnight. The solvent was removed under reduced pressure and the residue was taken up in EtOAc and washed with water, brine and dried (MgSO ₄ ). The solvent was removed under reduced pressure and the residue was subjected to chromatography (silica gel,

3.5% methanol / CH ₂ Cl ₂ ) to give 15.6 g (83%) of amine 6A as a white solid. CIMS (NH 3) m / z: 718 (M + H ⁺ , 100%).

To a solution of 14.4 g (20.0 mmol) of 6A in 500 mL of methanol was added 1.5 g of palladium hydroxide on carbon (20%) and the reaction mixture was impregnated with hydrogen. After stirring for 4 hours, the mixture was filtered through Celite and the solvent was removed under reduced pressure. The residue was subjected to chromatography (silica gel, 5% methanol / ClUCls) to give 12.5 g (91%) of the amine as a white solid. To a solution of 9.57 g (13.9 mmol) of the free base in 300 mL of ether was added 31 mL (31 mmol) of 1 N HCl in ether. The resulting suspension was stirred for 20 minutes and was filtered to give 9.9 g (94%) of bis-hydrochloride 6 as a white solid. CIMS (NH 3) m / z: 688 (M + H ⁺ , 100%).

Example 7

To a solution of 100 mg (0.16 mmol) of N- [2R-hydroxy-3 - [[(2,3-dihydro-2,3-dihydrobenzofuran-5-yl) sulfonyl] (2-methylpropyl) amino] -1S- (phenylmethyl) propyl] -2S - [(chloroacetyl) amino] -

To -3,3-dimethylbutanamide 7A in 2 mL THF was added 550 mg (4.4 mmol) of 3-fluorobenzylamine and the reaction mixture was refluxed for 6 hours. The reaction mixture was diluted with EtOAc and washed with water (4x), brine and dried (MgSO ₄ ). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give 91 mg (79%) of the amine as a white solid. To a solution of 91 mg (0.13 mmol) of the free base in 25 mL of ether was added 0.05 mL (0.20 mmol) of 4N HCl in dioxane. After stirring for 10 minutes, the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give 72 mg (65%) of hydrochloride 7 as a white solid.

CIMS (NH ₃ ) m / z: 697 (M + H ⁺ , 100%).

Example 8

To a solution of 7 mg (100 mg, 0.16 mmol) in THF (2 mL) was added 3,5-difluorobenzylamine (605 mg, 4.2 mmol) and the reaction mixture was refluxed for 6 hours. The reaction mixture was diluted with EtOAc and washed with water (4x), brine and dried (MgSO 4. The solvent was removed under reduced pressure and the residue was chromatographed (silica gel,

5% methanol / CH ₂ Cl ₂ ) gave 83 mg (70%) of the amine as a white solid. To a solution of 83 mg (0.11 mmol) of the free base in 25 mL of ether was added 0.05 mL (0.20 mmol) of 4N HCl in dioxane. After stirring for 10 minutes, the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give 65 mg (75%) of hydrochloride 8 as a white solid. Tínal. (C 37 H ₄₉ N ₄ O ₆ SiF ₂ Cl 1): Calculated: C, 59.15, H, 6.45, N, 7.47. Found: C, 58.90, H, 6.51, N, 7.21.

Example 9

7A

To a solution of 7 mg of 100 mg (0.16 mmol) in THF (2 mL) was added 2,5-difluorobenzylamine (610 mg, 4.3 mmol) and the reaction mixture was refluxed for 6 hours. The reaction mixture was diluted with EtOAc and washed with water (4x), brine and dried (MgSO 4. The solvent was removed under reduced pressure and the residue was chromatographed (silica gel,

5% methanol / CH ₂ Cl ₂ ) to give 110 mg (93%) of the amine as a white solid. To a solution of 110 mg (0.15 mmol) of the free base in 25 mL of ether was added 0.05 mL (0.20 mmol) of 4N HCl in dioxane. After stirring for 10 minutes, the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give 76 mg (66%) of hydrochloride 9 as a white solid. CIMS (NH ₃ ) m / z: 715 (M + H ⁺ , 100%).

Example 10

To a solution of 7 mg of 100 mg (0.16 mmol) in THF (2 mL) was added 2,6-difluorobenzylamine (600 mg, 4.2 mmol) and the reaction mixture was refluxed for 6 hours. The reaction mixture was diluted with EtOAc and was washed with water (4x), brine and dried (MgSO 4). The solvent was removed under reduced pressure and the residue was subjected to chromatography (silica gel,

5% methanol / CH ₂ Cl ₂ ) to give 103 mg (87%) of the amine as a white solid. To a solution of 103 mg (0.14 mmol) of the free base in 25 mL of ether was added 0.05 mL (0.20 mmol) of 4N HCl in dioxane. After stirring for 10 minutes, the solvent was removed under reduced pressure and the resulting solid was triturated

With ether and filtered to give 82 mg (76%) of hydrochloride 10 as a white solid. CIMS (NH 3) m / z: 715 (M + H ⁺ , 100%).

Example 11

To a solution of 750 mg (1.23 mmol) of N- [2R-hydroxy-3 - [[(1,3-

-benzodioxol-5-yl) sulfonyl] (2-methylpropyl) amino] -1S- (phenylmethyl) propyl] -2S - [(chloroacetyl) amino] -3,3-dimethylbutanamide 11A in 2 mL THF was added 1.1 g (8.8 mmol) of 3-fluorobenzylamine and the reaction mixture was stirred overnight. The reaction mixture was diluted with EtOAc and was washed with water (4x), brine and dried (MgSO 4). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give 532 mg (62%) of the amine as a white solid. To a solution in 100 mL of ether was added

532 mg (0.76 mmol) of the free base

0.22 mL (0.88 mmol) of 4N HCl in dioxane.

After stirring for minutes, the solvent was removed under reduced pressure. The resulting solid was triturated with ether and filtered to give 417 hydrochloride 11 as a white solid (M + H ⁺ , 100%).

mg (75%) of the substance. CIMS (NH ₃ ) m / z: 699

Example 12

To a solution of 11 g (2.0 g, 3.27 mmol) in THF (7 mL) was added

2.42 g (16.9 mmol) of 3,5-difluorobenzylamine and the reaction mixture was refluxed for 5 hours. The reaction mixture was diluted with EtOAc and washed with water (4x), brine and dried (MgSO 4. The solvent was removed under reduced pressure and the residue was chromatographed (silica gel,

5% methanol / CH ₂ Cl ₂ ) gave 2.26 g (97%) of the amine as a white solid. To a solution of 1.8 g (2.51 mmol) of the free base in 100 mL of ether was added 0.66 mL (2.67 mmol) of 4N HCl in dioxane. After stirring for 10 minutes, the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give 1.65 g (87%) of benzylamine 12 as a white solid. CIMS (NH ₃ ) m / z: 717 (M + H ⁺ , 100%). Anal. (C ₃₆ H ₄₇ N ₄ O ₇ SiF ₂ Cl 1): Calculated: C, 57.40, H, 6.17, N, 7.45. Found: C, 57.25, H, 6.25, N, 7.24.

Example 13

11A

To a solution of 750 mg (1.23 mmol)

11A in 2 mL THF was added

1.2 g (8.5 mmol) of 2,5-difluorobenzylamine and the reaction mixture was refluxed for 6 hours. The reaction mixture was •

diluted with EtOAc and washed with water (4x), brine and dried (MgSO ₄ ). The solvent was removed under reduced pressure and the residue was subjected to chromatography (silica gel,

5% methanol / CH ₂ Cl ₂ ) to give 702 mg (80%) of the amine as a white solid. To a solution of 702 mg (0.98 mmol) of the free base in 100 mL of ether and 25 mL of EtOAc was added 0.3 mL (1.2 mmol) of 4N HCl in dioxane. After stirring for 10 minutes, the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give 586 mg (79%) of hydrochloride 13 as a white solid.

CIMS (NH ₃ ) m / z: 717 (M + H ⁺ , 100%).

Example 14

11A

To a solution of 750 mg (1.23 mmol)

1LA in 2 mL THF was added

1.2 g (8.3 mmol) of 2,6-difluorobenzylamine and the reaction mixture was refluxed for 6 hours. The reaction mixture was diluted with EtOAc and was washed with water (4x), brine and dried (MgSO ₄ ). The solvent was removed under reduced pressure and the residue was subjected to chromatography (silica gel,

5% methanol / CH ₂ Cl ₂ ) gave 717 mg (81%) of the amine as a white solid. To a solution of 717 mg (1.00 mmol) of the free base in 100 mL of ether was added 0.3 mL (1.2 mmol) of 4N HCl in dioxane. After stirring for 10 minutes, the solvent was removed in vacuo

The reduced pressure and the resulting solid was triturated with ether and filtered to give 663 mg (88%) of hydrochloride 14 as a white solid. CIMS (NH ₃ ) m / z: 717 (M + H ⁺ , 100%).

Example 15

11A

and

THF was added to the reaction

To a solution of 11 mg of 750 mg (1.23 mmol) in 3,4-difluorobenzylamine (1.2 g, 8.3 mmol) was refluxed for 3 hours, diluted

The reaction brine mixture was mixture and dried (MgSO ₄ ).

residue

5% methanol / CH 2 Cl 2)

EtOAc and was washed with water (4x),

The solvent was removed after chromatography (silica gel,

760 mg (86%) of the amine as a white (1.06 mmol) of the free base in 100 mL of reduced pressure was subjected to a solid. To a solution of 760 mg of ether was added 0.3 mL (1.2 mmol) of 4N HCl in dioxane. After stirring to form a substance. The CIMS for 10 minutes was solid

730 mg (91%) of (NH ₃₎ m / z: 717 (M + H is filtered,

Example 16

11A jako

THF was added and the reaction white solid

To a solution of 750 mg (1.23 mmol) of 11A in aq

1.2 g (8.3 mmol) of 2,4-difluorobenzylamine i was refluxed for 6 hours, diluted with EtOAc and washed with water (4x),

The reaction brine mixture was dried and dried (MgSO 4). The solvent was removed under reduced pressure and the solvent was removed under reduced pressure.

the residue was subjected to chromatography (silica gel

5% methanol / CH ₂ Cl ₂ ) gave 693 mg (79%) of the amine as a white solid. To a solution of 693 mg (0.97 mmol) of the free base in 100 mL of ether was added 0.3 mL (1.2 mmol) of 4N HCl in dioxane. After stirring for 10 minutes, the resulting solid was filtered to give 638 mg (88%) of hydrochloride 16 as a white solid. CIMS (NH ₃ ) m / z: 717 (M + H ⁺ , 100%).

Example 17

F17

To a solution of 11A (500 mg, 0.82 mmol) in THF (2 mL) was added 4-fluorobenzylamine (1.0 g, 8.0 mmol) and the reaction was stirred overnight. The reaction mixture was diluted with EtOAc and washed with water (4x), brine and dried (MgSO 4. The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH ₂ Cl ₂ ) to give 470 mg (82%). To a solution of 400 mg (0.57 mmol) of the free base in 30 mL of ether was added 0.18 mL (0.7 mmol) of 4N HCl in dioxane After stirring for 15 minutes, the resulting solid was filtered to give 413 mg (98%) of hydrochloride 17 as a white solid CIMS (NH ₃ ) m / z: 699 (M + H ⁺ , 100%).

Use

The compounds of formula I exhibit HIV protease inhibitory activity and are therefore useful as antiviral agents for the treatment of HIV infection and associated diseases. The compounds of formula I exhibit HIV protease inhibitory activity and are effective as inhibitors of HIV growth. The effect of the compounds of the invention to inhibit viral growth or infectivity is demonstrated in a standard viral growth or viral infectivity assay, for example using the assay described below.

The compounds of formula I of the present invention are also useful for ex vivo inhibition of HIV in a sample containing HIV or expected to be exposed to HIV.

The compounds provided by this invention are also useful as standard or reference compounds for use in assays or assays to determine the efficacy of a preparation to inhibit viral clone and / or HIV protease replication, for example, in a pharmaceutical research program.

Thus, the compounds of the present invention can be used as controls or reference compounds in these assays and as a quality control standard. The compounds of the present invention may be provided in a commercial kit or container for use as this standard or reference compound.

Since the compounds of the present invention are specific for HIV protease, the compounds of the present invention may also be useful as diagnostic reagents in diagnostic assays detecting HIV protease. Thus, inhibition of protease activity in this assay (e.g., in the assays described herein) by a compound of the present invention is indicative of the presence of HIV protease and HIV.

As used herein, "pg denotes microgram," mg denotes milligram, "g denotes gram," μΐ denotes microliter, "ml denotes milliliter," I denotes liter, "nM denotes nanomolar," pM denotes micromolar, "mM denotes millimolar, "M denotes molar and" nm denotes • ·

J nanometer. “Sigma means Sigma-Aldrich Corp., St.

St. Louis, MO.

HIV RNA Test

DNA plasmids and in vitro RNA transcripts:

Plasmid pDAB 72 containing both the gag and pol sequences of BH10 (bp 113-1816) cloned into PTZ 19R was prepared by Erickson-Viitanen et al. (AIDS Research and Human Retroviruses, 5, 577, 1989). The plasmid was linearized with BamHI before generating in vitro RNA transcripts using the Riboprobe Gemini System II kit (Promega) with T7 RNA polymerase. Synthesized RNA was purified by RNase-free DNase treatment (Promega), phenol-chloroform extraction and ethanol precipitation. RNA transcripts were dissolved in water and stored at -70 ° C. RNA concentration was determined by measuring A ₂₆ q.

Probes

Biotinylated via HPLC Applied Biosystems end group phosphoramidite capture probes were purified after synthesis on a DNA synthesizer from Foster City, CA by adding biotin to the 5 'oligonucleotide reagent of the probe author using biotinCocuzza (Tet * Lett.,

30, 6287 (1989). The biotinylated (5-biotin-CTAGCTCCCTGCTTGCCCATACTA to nucleotides 889 to 912 of HXB2 for was the gag complementary probe and the biotinylated probe for (5'-biotin-CCCTATCATTTTTGGTTTCCAT 3 ') was to nucleotides 2374 to 2395 of HX2.

capture of half complementary Oligonucleotides as reporter probes Diego, CA). Reporter 3 ') was complementary to the alkaline phosphatase conjugate used by Syngene (San probe pol (5' CTGTCTTACTTTGATAAAACCTC) to nucleotides 2403 to 2425 of HXB2.

• ·

The gag reporter probe (5 'CCCAGTATTTGTCTACAGCCTTCT 3') was complementary to nucleotides 950-973 of HXB2. All nucleotide positions listed are based on the GenBank Genetic Sequence Data Bank when accessed from the Genetics Computer Group Sequence Analysis Software Package (Devereau, Nucleic Acids Research, 12, 387, 1984). Reporter probes were prepared as 0.5 μΜ stock solutions in 2 x SSC (0.3M NaCl, 0.03M sodium citrate), 0.05M Tris pH 8.8, 1 mg / ml BSA. Biotinylated capture probes were prepared as ΙΟΟμΜ stock solutions in water.

Streptavidin coated plates

Streptavidin-coated plates were obtained from DuPont Biotechnology Systems (Boston, MA).

Stock solutions of cells and viruses

MT-2 and MT-4 cells were grown in RPMI 1640 medium supplemented with 5% fetal calf serum (FCS) for MT-2 cells or 10% FCS for MT-4 cells, 2mM L-glutamine and 50 µg / ml gentamycin, all from Gibco. HIV-1 RF was propagated in MT-4 cells in the same medium. Virus stocks were prepared approximately 10 days after acute infection of MT-4 cells and stored in aliquots at -70 ° C. Infectious titers of HIV-1 (RF) stock solutions were 1 to 3 x 10 ⁷ PFU (plaque forming units) / ml as measured by the plaque formation assay on MT-2 cells (see below). Each aliquot of the viral stock used for infection was thawed only once.

In evaluating antiviral activity, the cells to be infected were cultured one day prior to infection. On the day of infection, cells were resuspended at 5 x 10 ⁵ cells / ml in RPMI 1640, 5% FCS for large volume infections or at 2 x 10 ⁶ / ml in Eagle's modified medium. ·· · φ · ··· · · · · ··

Dulbecca with 5% FCS for microtitre plate infection.

Virus was added and cultivation continued for 3 days at 37 ° C.

HIV RNA Test

Cell lysates or purified RNA in 3M or 5M GED were mixed with 5M GED and capture probe to a final 3M guanidinium isothiocyanate concentration and a final 30 nM biotinylated oligonucleotide concentration. Hybridization was performed in sealed 96-well U-bottom tissue culture plates (Nunc or Costar) for 16-20 hours at 37 ° C. RNA hybridization reaction mixtures were diluted three times with deionized water to a final 1 M concentration of guanidinium isothiocyanate, and aliquots (150 μΐ) were transferred to wells of microtiter plates coated with streptavidin. The capture probe-hybrid capture probe-RNA was bound to immobilized streptavidin for 2 hours at room temperature, and then the plates were washed 6 times with DuPont ELISA plate wash buffer (phosphate buffered saline (PBS), 0.05% Tween 20). . A second hybridization of the reporter probe to the immobilized capture probe complex and hybridized target RNA was performed in washed wells coated with streptavidin by adding 120 μ 120 hybridization mixture containing 4 X SSC, 0.66% Triton X 100, 6.66% deionized formamide, 1 mg / ml BSA and a 5 nM reporter probe. After hybridization for one hour at 37 ° C, the plate was washed again 6 times. Immobilized alkaline phosphatase activity was detected by the addition of 100 μΐ 0.2 mM

4-methylumbeliferyl phosphate (MUBP, JBL Scientific) in δ buffer (2.5M diethanolamine, pH 8.9, JBL Scientific, 10mM MgCl ₂ , 5mM zinc acetate dihydrate

5mM acid

N-hydroxyethylethylenediaminetriacetic acid).

Plates were incubated at 37 ° C.

Fluorescence ve

450 nM was measured using a plate fluorescence measuring instrument (Dynatech) with excitation at 365 nm.

Evaluation of compounds based on HIV-1 infected MT-2 cells on microtiter plates

Test compounds were dissolved in DMSO and diluted in tissue medium to twice the highest concentration tested and a maximum DMSO concentration of 2%. A further three-fold serial dilution of the compound in tissue medium was performed directly on U-bottom microtiter plates (Nunc). After compound dilution, MT-2 cells (50 μΐ) were added to a final concentration of 5 x 10 ⁵ / ml (1 x 10 ⁵ per well). Cells were incubated with compounds for 30 minutes at 37 ° C in a CO ₂ incubator. To evaluate antiviral activity, an appropriate dilution of the HIV-1 (RF) stock solution (50 μ () was added to the culture wells containing cells and diluted test compound. The final volume of each well was 200 μΐ. Eight wells on the plate were not infected with virus, 50 μΐ medium was added instead of virus, while eight wells were infected with virus in the absence of any antiviral compound. Plates without virus infection were grown in parallel to evaluate compound toxicity.

After growing for 3 days at 37 ° C in a humidified chamber in a CO ₂ incubator, only 25 μΐ of medium was left in the wells of the infected plates and the remainder was discarded. 37 μΐ of 5M GED containing a biotinylated capture probe to a final concentration of 3M GED and 30 nM capture probe was added to each well and the rest of the medium. Hybridization of the capture probe to HIV RNA in the cell lysate was performed in the same well of a microtiter plate that was used for virus culture by sealing the plate with plate adhesive film (Costar) and incubating for 16-20 hours in an incubator at 37 ° C. Distilled water was then added to each well for 4-fold dilutions of the hybridization reaction and 150 µL of this diluted mixture was transferred to a microtiter plate coated with streptavidin. HIV RNA was quantified as described above. A standard curve prepared by adding a known amount of pDAB 72 in vitro RNA transcript to wells containing lysed uninfected cells was evaluated on each microtiter plate to determine the amount of viral RNA produced during infection.

To standardize the virus inoculum used to evaluate the antiviral activity of the compounds, virus dilutions that resulted in an IC 90 (compound concentration necessary to reduce HIV RNA by 90%) for dideoxycytidine (ddC) at 0.2 µg / ml were selected. IC ₅₀ values of other antiviral compounds, both weaker and stronger than ddC, were reproducible using several HIV-1 (RF) stock solutions to monitor this process. This virus concentration corresponded to ~ 3 x 10 ⁵ PFU (as measured by plaque formation assay on MT-2 cells) per well of assay and typically constituted approximately 75% of the maximum viral RNA level achievable with each virus inoculum. For the HIV RNA assay, IC ₅₀ values were determined from the percentage reduction of the pure signal (signal from infected cell samples minus the signal from uninfected cell samples) in the RNA assay relative to the pure signal from infected untreated cells on the same culture plate (eight-well average). The valid performance of individual infection and RNA assays was assessed by three measures. It was necessary for the virus infection to give a signal in the RNA assay equal to or greater than the signal generated by using 2 ng of pDAB 72 in vitro RNA transcript. The IC ₅₀ value for ddC, as determined in each test series, should be between 0.1 and 0.3 pg / ml. Finally, the plateau level of viral RNA produced by a potent protease inhibitor should be less than 10% of the level achieved with uninhibited infection. A compound was considered active if its IC ₉ o was found to be less than ΙμΜ.

In the antiviral activity assays, all manipulations on microtiter plates, following the initial addition of 2 x concentrated compound solution to one row of wells, were performed using a Perkin Elmer / Cetus ProPette instrument.

Dosage and formulation

The antiviral compounds of the invention can be administered in the treatment of viral infections by any means that ensures contact of the active agent with the site of action of the agent, i.e. with a viral protease, in the mammal. They may be administered by any conventional means suitable for the administration of drugs, either as separate therapeutic agents or in combination therapies. They may be administered alone, but are preferably administered with a pharmaceutical carrier selected according to the chosen route of administration and standard pharmaceutical practice.

However, the dosage administered will vary according to known factors, such as the pharmacodynamic properties of the particular formulation and its mode and route of administration, the age, health and weight of the recipient, the nature and extent of the symptoms, the type of concomitant treatment, the frequency of treatment and the effect desired. The daily dose of active ingredient is expected to be about 0.001 to about 1000 mg / kg body weight, with a preferred dose being about 0.1 to 30 mg / kg.

Dosage forms of compositions suitable for administration contain from about 1 mg to about 100 mg of active ingredient per unit. In these pharmaceutical preparations, the active ingredient is usually present in an amount of about 0.5 to 95% by weight based on the total weight of the preparation. The active ingredient may be administered orally in solid dosage form, such as capsules, tablets and powders, or in liquid dosage form, such as elixirs, syrups and suspensions. It can also be administered parenterally in sterile liquid dosage forms.

Gelatin capsules contain the active ingredient and powdered carriers such as lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like. Both tablets and capsules can be manufactured as sustained release products to ensure continuous release of the drug over several hours . Compressed tablets may be coated with a carbohydrate or film to mask unpleasant taste and protect the tablet from atmospheric influences, or may be coated with an enteric coating for selective release in the gastrointestinal tract. Liquid dosage forms for oral administration may contain coloring and flavoring to improve patient uptake.

Generally, for parenteral solutions, suitable carriers are water, suitable oil solutions, saline, aqueous dextrose (glucose) and related carbohydrate solutions and glycols such as propylene glycol or polyethylene glycols. Solutions for parenteral administration preferably contain a water-soluble salt of the active ingredient, suitable stabilizers and, if necessary, buffers. Antioxidants such as sodium bisulfite, sodium sulfite, or ascorbic acid, either alone or in combination, are suitable stabilizers. Citric acid and its salts, and sodium EDTA are also used. In addition, parenteral solutions may contain preservatives such as benzalkonium chloride, methyl or propylparaben, and chlorobutanol. Suitable pharmaceutical carriers are described in Remington's Pharmaceutical Sciences, supra, which is a standard reference text in this field.

Useful pharmaceutical dosage forms for administration of the compounds of this invention may be illustrated as follows:

Capsules

A variety of unit capsules can be prepared by filling standard hard gelatine capsules in two pieces, each filled with 100 mg powdered active ingredient, 150 mg lactose, 50 mg cellulose and 6 mg magnesium stearate.

Soft gelatin capsules

A mixture of the active ingredient in a digestible oil such as soybean oil, cottonseed oil or olive oil can be prepared and injected into gelatin through a positive displacement pump to form soft gelatin capsules containing 100 mg of the active ingredient. The capsules can then be washed and dried.

Tablets

The whole range of tablets may be prepared by conventional methods such that the dosage unit is 100 mg of active ingredient, 0.2 mg of colloidal silica, 5 mg of magnesium stearate, 275 mg of microcrystalline cellulose, 11 mg of starch and 98.8 mg of lactose. Suitable packaging may be used to increase palatability or delay absorption.

Suspension

The aqueous suspension may be prepared for oral administration such that each 5 ml contains 25 mg of finely divided active ingredient, 200 mg of sodium carboxymethylcellulose, 5 mg of sodium benzoate, 1.0 g of sorbitol solution, U.S.P., and 0.025 mg of vanillin.

Solutions for injections

A parenteral formulation suitable for injection may be prepared by mixing 1.5% (w / w) of the active ingredient in 10% (v / v) propylene glycol and water. The solution is sterilized by commonly used techniques.

Combination of components a) and b)

Each component of the therapeutic composition of the invention may be separately in any dosage form, such as those described above, and may also be administered in a variety of ways as described above. In the following description, it is understood that component (b) is one or more of the formulations as described above. Thus, if components (a) and (b) are to be treated identically or independently, each formulation of component (b) may also be treated identically or independently.

Components a) and b) of the present invention may be formulated together in a single dosage unit (ie combined together in a single capsule, tablet, powder or liquid, etc.) as a combination product. When components a) and b) are not formulated together in a single dosage unit, component a) may be administered at the same time as component b), or in any order, for example component a) of the invention may be administered first followed by administration of component b) , or may be administered in reverse order. When component b) comprises more than one agent, eg, one RT inhibitor and one protease inhibitor, these agents may be administered together or in any order. When not co-administered, it is preferred that components a) and b) are administered for less than about one hour in a row. Preferably, the route of administration of components a) and b) is oral. The terms oral preparation, oral inhibitor, oral compound or the like, as used herein, refer to compounds that can be administered orally. Although it is preferred that both components (a) and component (b) are administered in the same manner (e.g., both orally) or in the same dosage form, if desired, each component may be administered in different ways (e.g., one). the combination product component may be administered orally and the second component may be administered intravenously) or a different dosage form.

As the skilled practitioner will appreciate, the dose of the combination therapy of the invention may vary depending upon various factors, such as the pharmacodynamic properties of the particular formulation and its mode and route of administration, age, health and weight of the recipient, nature and extent of symptoms, , frequency of treatment and desired effect as described above.

The proper dosage of components a) and b) of the present invention is readily ascertainable by the skilled practitioner based on the present disclosure. As an example of the general guidance, a typical daily dose may be about 100 mg to about 1.5 g of each component. If component b) represents more than one compound, then a typical daily dose may be about 100 mg to about 1.5 g of each agent of component b). As an example of the general guidance, when the compounds of component a) and component b) are administered in combination, the amount of dose of each component may be reduced by about 70% to 80% relative to the usual dose of component when administered alone as a single agent for HIV infection , in view of the synergistic effect of the combination.

The combination products of the invention may be formulated such that although the active ingredients are combined into a single dosage unit, physical contact between the active ingredients is minimized. To minimize contact, for example, when the product is administered orally, one active ingredient may be coated with an enteric coating. By the enteric coating of one of the active ingredients, it is not only possible to minimize contact between the combined active ingredients, but also to control the release of one of these ingredients in the gastrointestinal tract so that one of the ingredients is not released in the stomach. Another embodiment of the invention, when oral administration is desired, provides a combination product, is coated with a sustained release material in the gastrointestinal tract, and serves as a component also provided in combination with the prolonged coated intestine. Yet the product is in prolonged and the other component wherein one effective release, which to minimize the physical active ingredients. In addition, contact between the release component may additionally be enteric-coated, that release of this component occurs only in the formulation of a single release combination with one release and / or component coated with an enteric polymer, also coated with a polymer such as low viscosity hydroxypropylmethylcellulose or suitable substances as known in the art to further separate the components. The polymer sheath serves to form another for interaction with the second component. In any formulation where effective barriers are prevented from contacting the components of (a) the packaging or any other agent, contact between the individual agents of component (b) may be avoided.

The dosage forms of the combination products of the invention wherein one active ingredient is to be in the form of tablets, for example, such that component a b) can also be prevented by the present enteric coating.

with the enteric coating and the other active ingredient are mixed together and then compressed into tablets or so that the enteric coating component is compressed into one layer of the tablet and the other active ingredient is compressed into another layer. Optionally, in order to further separate the two layers, one or more placebo layers may be present such that the placebo layer is between the active ingredient layers. In addition, the dosage forms of the present invention may be in the form of capsules wherein one active ingredient is compressed into a tablet or in the form of a plurality of microtablets, particles, granules or beads (non-pareilles), which are then enteric coated. The enteric coated microtablets, particles, granules or beads are then placed in a capsule or compressed into a capsule together with a granulate of the other active ingredient.

These as well as other methods of minimizing contact between the components of the combination products of the present invention, whether administered in a single dosage form or administered in separate forms but simultaneously or concurrently in the same manner, will be readily apparent to those skilled in the art.

Pharmaceutical kits useful for treating HIV infection comprising a therapeutically effective amount of a pharmaceutical composition comprising a compound of component a) and one or more compounds of component b) in one or more sterile containers are also within the scope of the present invention. Sterilization of the container can be performed using conventional sterilization methods well known to those skilled in the art. Component a) and component b) may be in the same sterile container or in separate sterile containers. Sterile material containers may contain separate containers or one or more multi-part containers as desired. Component a) and component b) may be separated or physically combined into a single dosage form or unit as described above. These kits may further comprise, if desired, one or more different conventional components of the pharmaceutical kit, such as one or more pharmaceutically acceptable carriers, additional vials for mixing the ingredients and the like, as will be readily apparent to those skilled in the art. Instructions may also be included in the kit, either as attachments or as labels, indicating the amount of ingredients administered, instructions for administration, and / or instructions for mixing the ingredients.

Of course, numerous modifications and variations of the present invention are possible in light of the above teachings. Accordingly, it is to be understood that within the scope of the appended claims, the invention may be practiced otherwise than as specifically described herein.

Claims (24)

PATENT CLAIMS 1,3-benzodioxol-5-yl. 1,3-benzodioxol-5-yl. group or 1,3-benzodioxol-5-yl. or 1. A compound of formula I: A compound according to claim 1 3-aminophenyl, 2,3-dihydrobenzofuran-5-yl and 1,3-benzodioxol-5-yl. The compound of claim 3, wherein: R ³ is a 3-aminophenyl group. A 4-aminophenyl group, or a pharmaceutically acceptable group thereof R ¹ is F, R ² is F or H, and, R ³ is selected from: The compound of claim 3, wherein: R ³ is a 4-aminophenyl group. The compound of claim 3, wherein: R ³ is a 2,3-dihydrobenzofuran-5-yl group The compound of claim 2, wherein the compound is of formula IIb The compound of claim 7, wherein R ³ is a 3-aminophenyl group. The compound of claim 7, wherein: R ³ is a 4-aminophenyl group. The compound of claim 7, wherein: R ³ is 2,3-dihydrobenzofuran-5-yl The compound of claim 2, wherein the compound is of formula IIc: face. The compound of claim 11, wherein R ³ is a 3-aminophenyl group. The compound of claim 11, wherein: R ³ is a 4-aminophenyl group. The compound of claim 11, wherein: R ³ is 2,3-dihydrobenzofuran-5-yl or The compound of claim 1, wherein the compound is of formula III: The compound of claim 15, wherein the compound is of formula IIIa: lila. The compound of claim 1, wherein the compound is of formula IV: The compound of claim 17, wherein the compound is of formula IVa: JO 1 V ³ OH IVa. 19 Dec A pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of a compound according to any one of claims 1 to 15 20. A method of treating HIV infection comprising administering to a recipient in need thereof a therapeutically effective amount of a compound according to any one of claims 1 to 19 or a pharmaceutically acceptable salt thereof. 21. A method of treating an HIV infection comprising administering in combination a therapeutically effective amount of: a) a compound according to any one of claims 1 to 19 or stereoisomeric forms thereof, a mixture of stereoisomeric forms, or a pharmaceutically acceptable salt thereof, and b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors to a recipient in need thereof. The method of claim 21, wherein the reverse transcriptase inhibitor is selected from the group consisting of AZT, ddC, dd1, d4T, 3TC, delavirdine, efavirenz, nevirapine, Ro 18 893, trovirdine, MKC-442, HBY 097, ACT, UC-781, UC-782, RD4-2025 and MEN 10979 and the protease inhibitor is selected from the group consisting of saquinavir, ritonavir, indinavir, amprenavir, nelfinavir, palinavir, BMS-232623, GS3333, KNI-413, KNI-272, LG- 71350, CGP-61755, PD 173606, PD 177298, PD 178390, PD 178392, U-140690, and ABT-378. 23. The method of claim 22 wherein the reverse transcriptase inhibitor is selected from the group consisting of AZT, efavirenz and 3TC, and the protease inhibitor is selected from the group consisting of saquinavir, ritonavir, nelfinavir, and indinavir. 24. The method of claim 21 wherein compound (b) is ritonavir.