HRP970586A2 - 1-(3-aminoindazol-5-yl)-3-phenylmethyl-cyclic ureas useful as hiv protease inhibitors - Google Patents

Description

The field of technology

This invention relates in principle to 1-(3-aminoindazol-5-yl)-3-phenylmethyl-cyclic ureas which are useful as HIV protease inhibitors, pharmaceutical mixtures and diagnostic kits (accessories) containing them, as well as methods of applying them for treatment viral infections or for test standards (assays) or reagents.

State of the art

Two separate retroviruses, Human immunodeficiency virus (HIV) type-1 (HIV-1) or type-2 (HIV-2) are etiologically associated with the immunosuppressive disease, acquired immunodeficiency syndrome (AIDS). HIV seropositive people initially do not have any symptoms, but characteristically develop an AIDS-like complex (AIDS related complex - ARC), after which AIDS occurs. Affected individuals show severe immunosuppression that predisposes them to debilitating and ultimately fatal opportunistic infections.

The disease AIDS is the final result of the HIV-1 or HIV-2 virus following its complex life cycle. The life cycle of the virus begins when it binds to the host, a human T-4 lymphocyte immune cell by means of a binding glycoprotein on the surface of the protective envelope of the virus, with a CD4 glycoprotein on the surface of the lymphocyte cell. Once attached, the virus sheds its glycoprotein envelope, penetrates the host cell envelope, and unfolds its RNA. The viral enzyme, reverse transcriptase, controls the process of transcription of RNA into single-stranded DNA. The viral RNA is degraded and another DNA strand is created. Now the double-stranded DNA is incorporated into the genes of human cells, and these genes are used to reproduce the cell.

At this stage, the human cell carries out its reproductive processes using its own RNA polymerase to transcribe the integrated DNA into viral RNA. The viral RNA is translated into a precursor gag-pol fusion polyprotein. Then the HIV protease enzyme cleaves the polyprotein to produce mature viral proteins. Therefore, the HIV protease is responsible for managing a series of cleavage events that lead to the maturation of the viral particle into a virus capable of full infectivity.

The typical response of the human immune system, killing the virus that has attacked it, is difficult, because the virus spends a large part of its life cycle in a latent state inside the immune cell. In addition, viral reverse transcriptase, the enzyme used in the creation of a new viral particle, is not very specific and causes errors in transcription that lead to constantly changing, different glycoproteins on the surface of the virus' protective coat. This lack of specificity reduces the effectiveness of the immune system because antibodies specifically produced against one particular glycoprotein may be useless against another, thus reducing the number of antibodies available to fight the virus. The virus continues to reproduce while the immune response system continues to weaken. Over time, HIV takes over the body's immune system, allowing opportunistic infections to enter, and without antivirals, immunomodulators, or both, death can occur.

There are at least three critical points in the viral life cycle that have been identified as targets of antiviral drug action: (1) initial binding of the virus to the T-4 lymphocyte or macrophage site, (2) transcription of viral RNA into viral DNA (reverse transcriptase, RT), and (3) assembly (formation) of a new viral particle during reproduction (eg HIV aspartic acid protease or HIV protease).

Retrovirus genomes specify a protease that is responsible for the proteolytic processing of one or more polyprotein precursors such as pol and gag gene products. See Wellink, Arch. Virol. 98 l (1988). Retroviral proteases most often process the gag precursor into core proteins and also process the pol precursor into reverse protease and retroviral protease.

Correct processing of precursor polyproteins by retroviral protease is necessary for the formation (assembly) of infectious viruses. In vitro mutagenesis leading to protease-defective viruses has been shown to produce immature core forms that lack infectivity. See Crawford et al., J. Virol. 53 899 (1985); Ketoh et al., Virology 145 280 (1985). Therefore, retroviral protease inhibition represents an attractive target for antiviral therapy. See Mitsuwa, Nature 325 775 (1987).

The ability to inhibit the viral protease provides a procedure to block viral replication and thus a way to treat viral diseases, such as AIDS, which may have fewer side effects, be more effective and less prone to causing drug resistance than existing treatment methods. As a result, there are currently three HIV protease inhibitors on the market, Roche's saquinavir, Abbott's ritonavir and Merck's indinavir, and a number of potential protease inhibitors are in clinical trials, eg Vertex's VX-478, Agouron's nelfinavir, Japan Energy's KNI-272 and Ciba-Geigy's CGP 61755.

As demonstrated by protease inhibitors currently on the market and in clinical trials, a wide variety of compounds have been studied for their potential as HIV protease inhibitors. One core, cyclic urea, has been given a lot of attention. For example, in PCT Application No. WO 94/19329, Lam et al. generically describe cyclic ureas of the formula:

[image]

and procedures for preparing those ureas. easily these compounds fall under what is described by Lam et al., they are not specifically covered in their work.

Despite the current success of protease inhibitors, it has been discovered that HIV patients can become resistant to a single protease inhibitor. Therefore, it is desirable to develop additional protease inhibitors to further fight against HIV infection.

Summary of the invention

Accordingly, one of the objects of the present invention is to provide novel protease inhibitors.

Another object of the present invention is to provide pharmaceutical compositions having a protease inhibitory effect and containing a pharmaceutically acceptable carrier and a therapeutically effective amount of at least one of the compounds of the present invention or a pharmaceutically acceptable salt or prodrug thereof.

Another object of the present invention is to provide a novel method of treating HIV infection comprising administering a therapeutically effective amount of at least one of the compounds of the present invention or a pharmaceutically acceptable salt or prodrug form thereof to a host in need of such treatment.

Another object of the present invention is to provide a novel method of treating HIV infection comprising the administration of a therapeutically effective combination of (a) one of the compounds of the present invention and (b) one or more compounds selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors , to the host in need of such treatment.

Another object of the present invention is to provide a novel method of treating HIV present in a body fluid sample comprising treating the body fluid sample with an effective amount of a compound of the present invention.

Another object of the present invention is to provide a kit or container containing at least one of the compounds of the present invention in an amount effective for use as a standard or reagent in a test or assay to determine the ability of a potential pharmaceutical composition to inhibit HIV protease, HIV growth -a or both.

These, as well as other objects, which will become apparent during the detailed description that follows, have been achieved by the inventors' discovery that the compounds of formulas I and II:

[image]

or their pharmaceutically acceptable salts or prodrug forms effective protease inhibitors.

Detailed description of preferred forms

Therefore, in a first form, this invention provides a new compound of formula I or II:

[image]

or a pharmaceutically acceptable salt or prodrug form thereof.

In a preferred form, the present invention provides a novel compound of formula I.

In another preferred embodiment, the present invention provides a novel compound of formula II.

In another embodiment, the present invention provides a novel pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of a compound of formula I or II or a pharmaceutically acceptable salt or prodrug thereof.

In another preferred form, it is a compound of formula I.

In another preferred form, it is a compound of formula II.

In a third form, the present invention provides a novel method for treating HIV infection comprising administering a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt or prodrug form thereof to a host in need of such treatment.

In another preferred form, it is a compound of formula I. In another preferred form, it is a compound of formula II.

In the fourth form, this invention provides a new method of treating HIV infection, which includes the application, to a host in need of such treatment, of a therapeutically effective amount of the combination:

(a) a compound of formula I or II; and,

(b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors.

In another preferred form, it is a compound of formula I.

In another preferred form, it is a compound of formula II.

In another preferred embodiment, the reverse transcriptase inhibitor is a nucleoside reverse transcriptase inhibitor.

In another more preferred embodiment, the nucleoside reverse transcriptase inhibitor is selected from AZT, 3TC, ddl, ddC and d4T, and the protease inhibitor is selected from saquinavir, ritonavir, indinavir, VX-478, nelfinavir, KNI-272, CGP-61755 and LI-103017.

In an even more preferred embodiment, the nucleoside reverse transcriptase inhibitor is selected from AZT and 3TC, and the protease inhibitor is selected from sequinavir, ritonavir and indinavir.

In a more preferred embodiment, the nucleoside reverse transcriptase inhibitor is AZT. In another, even more preferred form, the protease inhibitor is indinavir.

In a fifth form, the present invention provides a pharmaceutical kit (accessory) useful in the treatment of HIV infection containing a therapeutically effective amount

(a) a compound of formula I or II; and,

(b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors, in one or more sterile containers.

In another preferred form, it is a compound of formula I.

In another preferred form, it is a compound of formula II.

In a sixth embodiment, the present invention provides a novel method of inhibiting HIV present in a body fluid sample comprising treating the body fluid sample with an effective amount of a compound of formula I or II.

In a seventh embodiment, the present invention provides a novel kit or container containing a compound of formula I or II in an amount effective to be used as a standard or reagent in a test or assay to determine the ability of a potential pharmaceutical composition to inhibit HIV protease, HIV growth -a or both.

DEFINITIONS

As used herein, the following terms and expressions have the meanings set forth. It is understood that the compounds of this invention contain an asymmetrically substituted carbon atom and that they can be isolated in optically active or racemic forms. It is well known in this field how to prepare optically active forms, for example by resolution of racemic forms or by synthesis from optically active starting materials (raw materials). All chiral, diastereomeric, racemic forms and all geometrically isomeric forms of the structure are understood unless a specific stereochemical or isomeric form is specifically indicated.

As used herein, "HIV reverse transcriptase inhibitor" refers to both types of inhibitors - nucleoside and non-nucleoside HIV reverse transcriptase (RT) inhibitors. Examples of nucleoside RT inhibitors include, but are not limited to, AZT, ddC, ddl, d4T, and 3TC. Examples of non-nucleoside RT inhibitors include, but are not limited to, viviradine (Pharmacia and Upjohn U90152S), TIBO derivatives, BI-RG-587, nevirapine, L-697, 661, LY 73497, and Ro 18,893 (Roche).

As used herein, "HIV protease inhibitor" refers to compounds that inhibit HIV protease. Examples include, but are not limited to, saguinavir (Roche, Ro31-8959), ritonavir (Abbott, ABT-538), indinavir (Merck, MK-639), VX-478 (Vertex/GIaxo Wellcome), nelfinavir (Agouron, AG-1343), KNI-272 (Japan Energy), CGP-61755 (Ciba-Geigy) and U-10317 (Pharmacia and Upjohn). Additional examples include the cyclic protease inhibitors disclosed in WO 93/07128, WO 94/19329, WO 94/22840 and PCT Application No. US 96/03426.

As used herein, "pharmaceutically acceptable salts" refers to derivatives of the disclosed compounds wherein the parent compound has been modified by making its acid or base salts. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of alkaline residues such as amines; alkaline or organic salts of acidic residues such as carboxylic acids and the like. Pharmaceutically acceptable salts include conventional non-toxic salts or quaternary ammonium salts of the base compound formed, for example, from non-toxic inorganic or organic acids. For example, such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, bromic, sulfuric, sulfamic, phosphoric, nitric and the like; and salts prepared from organic acids such as acetate (acetic), propionic, succinate, glycolic, stearic, lactate (milk), malic, tartar (wine), citrate (lemon), ascorbic, pamoic, maleic, hydroxymaleic, phenylacetate, glutamic, benzoic , salicylic, sulfanyl, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic and the like.

Pharmaceutically acceptable salts of the present invention can be synthesized from the base compound containing a basic or acidic moiety by conventional chemical procedures. In principle, such salts can be prepared by the reaction between the free acidic or alkaline forms of these compounds with a stoichiometric amount of the corresponding alkali or acid in water or some organic solvent, or in their mixture; in principle, anhydrous media such as ether, ethyl acetate, ethanol, isopropanol or acetonitrile are preferred. Lists of suitable salts can be found in Remingtori's Pharmaceutical Sciences, 17th Edition, Mack Publishing, Easton, PA, 1985, p. 1418, the contents of which are incorporated herein by reference.

The term "pharmaceutically acceptable" as used herein refers to those compounds, materials, mixtures, and/or dosage forms which, according to reasonable medical judgment, are suitable for use in contact with the tissues of human beings or animals without being excessively toxic, irritating, or allergic. reactions, or other problems or complications that have been compared with a reasonable benefit-risk ratio.

"Prodrugs" should encompass any covalently bound carrier that releases the active parent drug of formula I or other formulas or compounds of this invention in vivo when such prodrug is administered to a mammalian subject. Prodrugs of the compounds of this invention, for example of formula (I), are prepared by modifying the functional groups present in the compound in such a way that the modifications are cleaved, either by routine procedures or in vivo, to the parent compound. Prodrugs include compounds of the present invention wherein a hydroxy or amino group is attached to any group which, when the prodrug is administered to a mammalian subject, cleaves to produce a free hydroxyl or amino group. Examples of prodrugs include, but are not limited to, acetate, formate or benzoate derivatives of alcohol and amino functional groups in compounds of formula I; phosphate esters, dimethylglycine esters, aminoalkylbenzyl esters, aminoalkyl esters and carboxyalkyl esters of alcohol functional groups in compounds of formula I; and similar. Additional examples include compounds where two hydroxyl groups of formula I are linked to form an epoxide;

-OCH2SCH2O-; -OC(=O)O-; -OCH2O-; -OC(=S)O-; -OC(=O)C(=O)O-; -OC(CH3)2O-;

-OC((CH2)3NH2)(CH3)O-; -OC(OCH3)(CH2CH2CH3)O-; or -OS(=O)O-.

"Stable compound" and "stable compound" should mean a compound that is sufficiently robust to withstand isolation, (isolation) to a useful degree of purity from a reaction mixture, and formulation into an effective therapeutic agent. Only stable compounds are considered in this invention.

"Substituted" should mean that one or more of the hydrogen atoms indicated in the phrase "substituted" have been replaced by one selected from the indicated groups, provided that the normal valency of the indicated atom is not exceeded and that the substitution results in a stable compound. When the substituent is a keto group (eg =O), then two carbons on the atom are replaced.

"Therapeutically effective amount" should mean an amount of a compound of the present invention or an amount of a combination of compounds claimed to be effective in inhibiting HIV infection or treating symptoms of HIV infection in a host. Preferably, the combination of compounds is a synergistic combination. Synergism, as described for example by Chou and Talalay, Adv. Enzyme Regul. 22:27-55 (1984), occurs when the effect (in this case inhibition of HIV replication) of the compounds administered in combination is greater than the sum of the effects of the compounds when administered alone , as individual agents. In principle, the synergistic effect is most clearly seen at suboptimal concentrations of the compounds. The synergism may concern less toxicity, increased antiviral activity, or some other beneficial effect of the combination compared to the individual components.

Other features of the invention will become apparent from the descriptions of exemplary embodiments that follow, which are presented to illustrate the invention and are not intended to limit it in any way.

Examples

Abbreviations used in the Examples are defined as follows: "°C" for degrees Celsius, "d" for doublet, "dd" for doublet or doublets, "eq" for equivalent or equivalents, "g" for gram or grams, "mg" for milligram or milligrams, "ml" for milliliter or milliliters, "H" for hydrogen or hydrogens, "hr" for hour or hours, "m" for multiplet, "M" for mole, "min" for minute or minute, "MHz" for megahertz, "MS" for mass spectroscopy, "nmr" or "NMR" for nuclear magnetic resonance spectroscopy, "t" for triplet, and "TLC" for thin layer chromatography.

Example 1

Preparation of (4R, 5S, 6S, 7R)-hexahydro-1-[5-(3-aminoindazole)methyl]-5,6-dihydroxy-4,7-bis[phenylmethyl]-3-phenylmethyl- 2H-1,3 -diazapin-2-one (I).

[image]

Compound 1 can be prepared by known procedures. For example, the preparation of compound 1 is shown in Scheme 1 of Rossan et al., (Tetr. Lett. 1995, 36(28), 4967, 4968), the contents of which are incorporated herein by reference. An additional procedure for the preparation of compound 1 is shown in Example 6 of U.S. Pat. patent application no. 5,530,124, the contents of which are incorporated herein by reference.

PART A To a suspension of compound 1 (10.0 g; 27.3 mmol) in 1,2-dichloroethane (100 mL) was added methyl triflate (3.4 mL, 30 mmol). After refluxing overnight, the reaction was washed with saturated NaHCO 3 , saturated NaCl, dried (Na 2 SO 4 ) and evaporated to leave 12.5 g of a yellow oil. Column chromatography ("flash" SiO2; 25% EtOAc/hexane) afforded 7.86 g of compound 2 as a light yellow oil which was allowed to crystallize (75% yield). Melting point = 97-100°C. MH+= 381.

[image]

PART B: To a 0°C solution of isourea 2 (4.43 g; 11.7 mmol) and 3-cyano-4-fluorobenzyl bromide (5.00 g; 23.3 mmol) in DMF (50 mL) was added is NaH (60% in mineral oil; 1.40 g; 35.0 mmol). After warming to room temperature and stirring overnight, the reaction was added to 25% Et2O/EtOAc. The organic phase is washed with water (3x), saturated NaCl, dried (Na2SO4) and evaporated to leave a yellow oil. Column chromatography (flash SiO2; 25% EtoAc/Hexane) afforded 5.55 g of (compound) 3 as a colorless oil (92% yield) MH+ = 514.

PART C: (4R,5S,6S,7R)-hexahydro-1-[(3-cyano-4-fluorophenyl)methyl]-5,6-0-isopropylidene-4,7-bis-(4-phenylmethyl)- 3-

phenylmethyl-2H-1,3-diazapin-2-one (4).

[image]

Dissolve isourea 3 (2.78 g, 5.41 mmol) and benzyl bromide (1.93 ml, 16.2 mmol) in acetonitrile (15 ml) and reflux overnight. The reaction is evaporated and subjected to chromatography on a "flash" SiO2 column; 20% EtOAc/hexane) to give 3.02 g (compound 4 as a white foam (95% yield). MH + = 590.

PART D: (4R,5S,6S,7R)-hexahydro-1-[5-(3-aminoindazole)methyl]-5,6-0-isopropylidene-4,7-bis-(4-phenylmethyl)-3- phenylmethyl-2H-1,3-diazapin-2-one (5).

[image]

A solution of nitrile 4 (3.02 g; 5.13 mmol) in n-BuOH (30 mL) and hydrazine hydrate (6 mL) was refluxed overnight. The reaction was added to EtOAc and washed with 10% citric acid (2X), saturated NaHCO 3 , saturated NaCl, dried (NaSO 4 ) and evaporated to leave 3.09 g of (compound) 5 as a white foam (100% yield). MH+ =602.

PART E: (4R,5S,6S,7R)-hexahydro-1-[5-(3-aminoindazole)methyl]-5,6-dihydroxy-4,7-bis-(phenylmethyl)-3-phenylmethyl- 2H- 1,3-diazapin-2-one (I).

A solution of compound 5 (3.09 g; 5.14 mmol) in 3 NHCl (10 mL) and THF (40 mL) was stirred overnight. The reaction was added to EtOAc and washed with saturated NaHCO3, saturated NaCl, dried (NaSO4) and evaporated to leave an orange oil. Column chromatography ("flash" SiO 2 , 7% MeOH/CH 2 Cl 2 and 0.8% NH 4 OH) afforded 2.15 g of a pink glassy solid. Crystallization from 3:1 CH2Cl2/EtO gave 1.7 g of (compound) 1 as light pink crystals which were dried under high vacuum at 85°C overnight. TT = 134 - 139°C.

Example 2

Preparation of (4R,5S,6S,7R)-hexahydro-1-[5-(3-aminoindazole)methyl]-5,6-dihydroxy-4,7-bis[(4-methylphenyl)methyl]-3-

phenylmethyl-2H-1,3-diazapin-2-one (II).

PART A: (2R, 3S, 4S, 5R)-2,5-bis(2,2-dimethylhydrazo)-1,6-bis(4-methylphenyl)-3,4-O-isopropylidenehexanediol (10).

[image]

The starting hydrazone can be prepared by the method of Rossano et al (see Formula 3a on page 4968 Tetr. Lett. 1995, 36(28), 4967-70), the contents of which are incorporated herein by reference.

Sec-butyllithium (95 ml, 123 mmol, 1.3 M in cyclohexane) was added dropwise over 5 minutes to p-xylene (57 ml, 464 mmol) at 15°C. The solution was cooled to -15°C and added dropwise to THF (30 ml). After stirring for 1 hour, hydrazone (10.2 g, 42 mmol) in THF (30 ml) was added dropwise. The reaction mixture is stirred for 20 minutes and heated to 0°C. The solution is carefully quenched with water and extracted with EtOAc. The combined organic layers were extracted with 1N HCl and the combined aqueous fractions were made strongly alkaline with 50% aqueous NaOH. The resulting mixture was extracted with EtOAc, washed with brine and dried (MgSO4). The solvent was removed under reduced pressure to give bis-hydrazine 10 as an oil (19.25 g, 99%): 1H NMR (CDCl3) δ 7.08 (s, 8 H), 4.09 (s, 2 H), 3.02 (t, J = 7.1 Hz, 2H), 2.67 (m, 4H), 2.31 (s, 6H), 2.17 (s, 12H), 1.43 (s, 6H); IR (KBr) at 2980, 2940, 1680, 1510, 1240 cm-1; LRMS (ESI) m/z: 455 (M+H+ , 6%), 228 (M+2H+ , 100%); HRMS calculated for C27H43N4O2 (M+H+) 455.3386; found 455. 3393.

PART B: (2R, 3S, 4S, 5R)-2,5-diamino-1,6-bis(4-methylphenyl)-3,4-O-isopropylidenehexanediol (11).

[image]

Raney nickel (20 g, 50% thick solution) was added to a solution of bis-hydrazine 10 (18.64 g, 41 mmol) in methanol (150 ml). The suspension is filled with hydrogen (250 psi) and heated for 16 hours at 100°C. The suspension is cooled, filtered through celite and the solvent is removed under reduced pressure. Chromatography (silica gel, 10% methanol/CH2Cl2) gave diamine 11 as an oil (12.49 g, 83%): 1H NMR (CDCl3) δ 7.08 (ab, J - 8.1 Hz, Δv = 15.2 Hz, 8 H), 4.01 (s, 2H), 2.94 (m, 2 H), 2.77 (A of ABX, JAB = 13.4 Hz, JAX - 4.6 Hz, 2 H), 2, 51 (B of ABX, JAB = 13.4 Hz, JBX =9.7 Hz, 2H), 2.32 (s, 6 H), 1.45 (s, 6 H), IR (Kbr) v 2980, 2920, 1510 cm-1; LRMS (ESI) m/z: 369 (M+H+ , 16%), 185 (M+2H+ , 100%); HRMS calculated for C23H33N2O2 (M + H+) 369.2542; found 369.2534.

PART C: (4R,5S,6S,7R)-hexahydro-5,6-0-isopropylidene-4,7-bis[(4-methylphenyl)methyl]-2H-1,3-diazapin-2-one. (12).

[image]

To a solution of diamine 11 (12.48 g, 33.9 mmol) in 1,1,2,2-tetrachloroethane (130 ml) was added 1,1-carbonyldiimidazole (5.67 g, 35.0 mmol). After 10 minutes, the solution is added dropwise to 1,1,2,2-tetrachloroethane (600 ml) at reflux for 45 minutes. The solution is cooled, washed with water, brine and dried (MgSO4). The solvent is removed under reduced pressure and the residue is chromatographed (silica gel, 33% ethyl acetate/hexane) and then recrystallized (ethyl acetate/hexane) to give cyclic urea 12 as a white solid (6.18 g, 46%): TT = 228-230°C; 1H NMR (CDCl3) δ 7.12 (br s, 8 H), 4.3 (d, J= 6.2 Hz, 2 H), 4.25 (s, 2 H), 3.50 (m, 2 H), 3.01 (cea. d, J-13.2 Hz, 2 H), 2.78 (t, J = 11.8 Hz, 2 H), 2.33 (s, 6 H), 1.54 (s, 6H); IR (KBr) at 3260, 2930, 1670, 1090 cm-1; LRMS (ESI) m/z: 395 (M+H+, 100%); HRMS calcd for C24H31N2O3 (M + H+) 395.2335; found 395.2333.

PART D: (4R, 5S, 6S, 7R)-hexahydro-5,6-0-isopropylidene-4,7-bis[(4-methylphenyl)methyl]-1-phenylmethyl-2H-1,3-diazapine-2 - he (13).

[image]

To a solution of cyclic urea 12 (3.0 g, 7.6 mmol) and benzyl bromide (1.59 g, 9.3 mmol) in THF (300 ml) at 0°C, potassium t- butoxide (8.4 mL, 8.4 mmol, 1.0 M in THF). The solution is allowed to warm to room temperature and stirred overnight. The reaction mixture was diluted with brine and extracted with EtOAc. The combined organic layers are washed with brine and dried (MgSO4). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 25% ethyl acetate/hexane) to give cyclic urea 13 as a glass (2.57 g, 70%): 1 H NMR (CDCl 3 ) δ 7.28 ( m, 3 H), 7.15 (m, 10 H), 5.12 (d, J - 14.6 Hz, 1 H), 4.88 (d, J = 6.6 Hz, 1 H), 4 .23 (m, 1H), 3.75 (m, 2 H), 3.47 (m, 1H), 3.01 (m, 3 H), 2.86 (d, J = 14, 6 Hz, 1H), 2.66 (m, 1H), 3.01 (m, 3H), 2.86 (d, J-14.6 Hz, 1H), 2.66 (m, 1H), 2, 37 (s, 3H), 2.34 (s, 3H), 1.45 (s, 3H), 1.40 (s, 3H); IR (KBr) at 2930, 1650, 1240, 1090 cm-1; LRMS (ESI) m/z: 485 (M+H+, 100%); HRMS calcd for C31H37N2O3 (M+H+) 485.2804; found 485, 2789.

PART E: (4R, 55, 65, 7R)-hexahydro-1-[(3-cyano-4-fluorophenyl)methyl]-5,6-O-isopropylidene-4,7-bis [(4-methylphenyl)methyl ]- 3-phenylmethyl-2H-1,3-diazapin-2-one (14).

[image]

To a solution of cyclic urea 13 (2.30 g, 4.75 mmol) and cyano-4-fluorobenzyl bromide 3 (1.07 g, 5.0 mmol) in THF (200 ml) at 0°C, potassium -butoxide (4.8 ml, 4.8 mmol, 1.0 M in THF). The solution is warmed to room temperature and stirred overnight. The reaction mixture was diluted with brine and extracted with EtOAc. The combined organic layers are washed with brine and dried (MgSO4). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 25% ethyl acetate/hexane) to give cyclic urea 14 as a glass (2.43 g, 82%): 1H NMR (CDCl3) δ 7.33 (m, 5 H), 7.13 (d, J = 7.7 Hz, 4 H), 6.95 (m, 7 H), 4.89 (d, J = 14.3 Hz, 1 H), 4.46 (d, J = 14.3 Hz, 1H), 3.97 (m, 1H), 3.78 (m, 3H), 3.65 (d, J = 14.3 Hz, 1H) , 3.07 (d, J = 14.3 Hz, 1H), 2.83 (m, 4H), 2.36 (s, 3H), 2.34 (s, 3H), 1.44 (s , 3H), 1.38 (s, 3H); IR (KBr) at 2980, 2930, 2240, 1630, 1230 cm-1; CIMS (NH) m/z: 635 (M+NH, 100%); HRMS calcd for C39H37N2O3 (M+H+) 618.3132; found 618, 3119.

PART F: (4R, 5S, 6S, 7R)-hexahydro-1-[5-(3-aminoindazole)methyl]-5,6-0-isopropylidene-4,7-bis[(4-methylphenyl)methyl] -3- phenylmethyl-2H-1,3-diazapin-2-one. (15).

[image]

To a solution of cyclic urea 14 (2.40 g, 3.89 mmol) in n-butanol (40 ml) was added hydrazine monohydrate (19.8 g, 395 mmol) and the resulting solution was refluxed overnight. The reaction mixture was diluted with water and extracted with EtOAc. The combined organic layers are washed with brine and dried (MgSO4). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 10% methanol/methylene chloride) to give aminoindazole 15 as a white solid. (2.34 g, 95%): mp = 120-124°C; 1H NMR (CDCL3) δ 7.25 (m, 12 H), 6.97 (t, J = 7.7 Hz, 4 H), 4.98 (dd, J = 14.3, 2.0 Hz) , 3.80 (s, 2 H), 3.76 (m, 2 H), 3.27 (d, J = 14.3 Hz, 1H), 3.09 (d, J-14.3 Hz, 1H), 2.86 (m, 4H), 2.35 (s, 6H), 1.32 (s, 6H); IR (KBr) v 3310, 2930, 1630, 1430, 1230, cm-1; CIMS (NH4) m/z: 630 (M+H+, 100%); HRMS calcd for C39H44N5O3 (M+H+) 630, 34444; found 630.3428.

PART G: (4R, 5S, 6S, 7R)-hexahydro-1-[5-(3-aminoindazole)methyl]-5,6-dihydroxy-preparation of 4,7-bis[(4-methylphenyl)methyl]- 3-phenylmethyl-2H-1,3-diazapin-2-one (II).

Cyclic urea 15 (1.90 g, 3.02 mmol) was dissolved in 10% conc. of HCl in methanol (40 ml). After 2 hours, saturated aqueous Na 2 CO 3 was added and the suspension was extracted with EtOAc. The combined organic layers are washed with brine and dried (MgSO4). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 10% methanol/methylene chloride) to give the title compound as a white solid (1.71 g, 96%): TT = 142-146 °C; 1H NMR (CD3OD) δ 7.37 (s, 1H), 7.28 (m, 3H), 7.22 (s, 2H), 7.15 (m, 6H), 6.94 (m , 4 H), 4.77 (d, J = 14.3 Hz, 1H), 4.72 (d, J-14.3 Hz, 1H), 3.59 (m, 2 H), 3.51 (br s, 2 H), 3.11 (d, J = 14.3Hz, 1H), 2.93 (m, 5 H), 2.31 (br s, 6 H); IR (KBr) at 3330, 2920, 1610, 1470, 1230 cm-1; CIMS (NH3) m/z: 590 (M+H+, 100%); HRMS calcd for C36H40N5O3 (M+H+) 590.3131; found 590.3132; Anal. (C36H39N5O3) C, H, N.

Application

The compounds of formulas I and II have an inhibitory effect on HIV protease and are therefore useful as antiviral agents for the treatment of HIV infection and related diseases. The compounds of formula I have an inhibitory effect on HIV protease and are therefore effective as inhibitors of HIV growth. The ability of the compounds of the present invention to inhibit viral growth or infectivity is demonstrated in a standard assay for viral growth and infectivity, for example, using the assay described below.

The compounds of formulas I and II of the present invention are also useful in inhibiting HlV in an ex vivo sample that contains HIV or is expected to be exposed to HIV. Therefore, the compounds of the present invention can be used to inhibit HIV present in a body fluid sample (eg, a serum or seminal fluid sample) that contains or is suspected of containing or will be exposed to HIV.

The compounds provided by this invention are also useful as standard or reference compounds for use in assays or assays to determine the ability of an agent to inhibit viral clone replication and/or HIV protease, for example in a pharmaceutical research program. Therefore, the compounds of this invention can be used as a control or reference compound in such assays and as a quality control standard. The compounds of this invention may be provided in a commercial kit or container, to be used as such a standard or reference compound.

Because the compounds of the present invention exhibit specificity for HIV protease, the compounds of the present invention may also be useful as diagnostic reagents in diagnostic assays for the detection of HIV protease. Therefore, inhibition of protease activity in an assay (such as the assays described herein) by a compound of the present invention would indicate the presence of HIV protease and HIV virus.

As used herein, "μg" means microgram, "mg" means milligram, "g" means gram, "μl" means microliter, "ml" means milliliter, "l" means liter, "nM" means nanomole, "μM" stands for micromole, "mM" stands for millimole, "M" stands for mole and "nm" stands for nanometer. "Sigma" means Sigma-Aldrich Corp. of St. Louis, MO.

HIV RNA Test

DNA plasmids and in vitro RNA transcripts:

Plasmid pDAB 72 containing both the gag and pol sequences of BH10 (bp 113-1816) cloned into PTZ 19 R was prepared according to Erickson-Viitanen et al., AIDS Research and Human Retroviruses 1989, 5, 577. The plasmid was linearized with Bam HI before creation of in vitro RNA transcript using the Riboprobe Gemini system II kit (accessory) (Promega) with T7 RNA polymerase. The synthesized RNA was purified by the action of RNase, free DNAse (Promega), phenol-chloroform extract and ethanol precipitate. RNA transcripts are dissolved in water and stored at -70°C. RNA concentration is determined from A260.

Tests:

Biotinylated "capture" probes were purified by HPLC after synthesis on an Applied Biosystems Synthesizer (Foster City, CA) DNA by adding biotin to the 5' end of the oligonucleotide, using biotin-phosphoramidite reagent Cocuzza, Tet Lett. 1989, 30,6287. Gag biotinylated "capture" test (5-biotin-CTAGCTCCCTGCTTGCCCCATACTA 3') is complementary to nucleotides 889-912 of HXB2, and pol biotinylated "capture" test (5'-biotin-CCCTATCATTTTTGGTTTCCATS1) is complementary to nucleotides 2374-2395 of HXB2. Alkaline phosphatase conjugated nucleotides used as reporter assays were prepared by Sγngene (San Diego, CA). Pol "reporter" probes (51 CTGTCTTACTTTGATAAAACCTC 3') are complementary to nucleotides 2403-2425 of HXB2. Gag "reporter" test (51 CCCAGTATTTGTCTACAGCCTTCT 3') is complementary to nucleotides 950-973 of HXB2. All nucleotide positions belong to the GenBank Genetic Sequence Data Bank accessed through the Genetics Computer Group Sequence Analysis Software Package (Devereau Nucleic Acids Research 1984,12, 387). "Reporter" assay prepared as a 0.5 μM aliquot in 2 x SSC (0.3 M NaCl, 0.03 M sodium citrate), 0.05 M Tris 8.8, 1 mg/ml BSA. Biotinylated "caputere" assays were prepared as 100 μM amounts in water.

Streptavidin-coated plates:

Streptavidin-coated plates were obtained from Du Pont Biotechnology Systems (Boston, MA).

Amounts of cells and viruses:

MT-2 and MT-4 cells were maintained in RPMI 1640 supplemented with 5% fetal calf serum (FCS) for MT-2 cells or 10% FCS for MT-4 cells, 2 mM L-glutamine and 50 μg/ml gentamicin, all from Gibco. HIV-1 RF was propagated in MT-4 cells in the same medium. Virus amounts were prepared about 10 days after acute infection of MT-4 cells and stored as aliquots at -70°C. HIV-1 infectious titers (RF) amounts were 1-3 x 107 PFU (plaque forming units)/ml as measured by plaque assay on MT-2 cells (see below). Each aliquot of viral load used for infection was thawed only once.

To evaluate antiviral efficacy, cells to be infected were exposed to subculture one day prior to infection. On the day of infection, cells were resuspended at 5 x 10 5 cells/ml in RPMI 1640, 5% FCS for primary infections or at 2 x 10 6 /ml in Dulbecco's modified Eagle's medium with 5% FCS for infection in microtiter plates. Virus was added and the culture was allowed to stand for 3 days at 37°C.

HIV RNA test:

Cell lysates or purified RNA in 3 M or 5 M GED were mixed with 5 M GED and captured by assay to a final guanidine isothiocyanate concentration of 3 M and a final biotin oligonucleotide concentration of 30 nM. Hybridization was performed in sealed "U bottom" 96-well tissue culture plates (Nunc or Costar) for 16-20 hours at 37°C. RNA hybridization reactions were diluted three times with deionized water in a final concentration of guanidine isothiocyanate of 1 M, and aliquots (150 μl) were transferred to the wells of streptavidin-coated microtiter plates. Binding of the capture assay and capture assay-RNA hybrid to immobilized streptavidin is allowed to occur for 2 hours at room temperature, after which the plates are washed 6 times with DuPont's ELISA plate wash buffer (phosphate-buffered saline and water (PBS ), 0.05% Tween 20). A second hybridization of the reporter assay for the immobilized complex of the capture assay and hybridized target RNAs is performed in a washed streptavidin-coated well by addition of 120 μl of a hybridization cocktail containing 4 x SSC, 0.66% Triton x 100, 6.66% deionized formamide, 1 mg/ml BSA and 5 nM reporter assay. After hybridization for one hour at 37°C, the plate is washed again 6 times. Immobilized alkaline phosphatase activity is detected by adding 100 μl of 0.2 mM 4-methylumbelliferyl phosphate (MUBP, JBL Scientific) in buffer δ 2.5 M diethanolamine pH 8.9 (JBL Scientific), 10 mM MgCl2, 5 mM zinc acetate dihydrate and 5 mM N-hydroxyethyl-ethylene-diamine-triacetic acid). Plates are incubated at 37°C. Fluorescence is measured at 450 nM using a microplate fluorometer (Dynateck) with excitation at 365 nM.

Testing (evaluation) of the compound placed on the microplate in MT-2 cells infected with HIV-1L

The compounds to be tested (evaluated) are dissolved in DMSO and diluted in the culture medium to twice the concentration of the one to be tested and a maximum DMSO concentration of 2%. Furthermore, threefold serial dilutions of the compound in the culture medium are performed directly in "U bottom" microtiter plates (Nunc). After compound dilution, MT-2 cells (50 μl) are added at a final concentration of 5 x 105 per ml (1 x 105 per well). The cells are incubated for 30 minutes with the compounds at 37°C in a CO2 incubator. To test (estimate) antiviral potency, an appropriate dilution of HIV-1 (RF) virus amount (50 μl) is added to the culture wells containing the cells and dilutions of the test compounds. The final volume in each well is 200 μl. In each plate, eight wells are left uninfected with 50 μl medium added instead of virus, while eight wells are infected in the absence of any antiviral compound. To test the toxicity of the compound, parallel plates were seeded with culture without virus infection.

After 3 days of growing the culture at 37°C in a humidified chamber inside a CO2 incubator, all but 25 μl of medium/well is removed from the HIV-infected plates. Thirty-seven μl of 5 M GED containing biotinylated capture assay was added to the seeded cells and the remaining medium in each well to a final concentration of 3 M GED and 30 nM capture assay.

Hybridization of the capture assay for HIV RNA in cell lysate is performed in the same microplate well used for virus culture by sealing the plate with a plate seal (Costar) and incubating for 16-20 hours in an incubator at 37°C. Distilled water is then added to each well to dilute the hybridization reaction threefold and 150 μl of this diluted mixture is transferred to a streptavidin-coated microtiter plate. HIV RNA is quantified as described above. A standard curve, prepared by adding known amounts of pDAB 72 in vitro RNA transcript to wells containing lysed, uninfected cells, is measured on each microtiter plate to determine the amount of viral RNA produced during infection.

In order to standardize the viral inoculum used to test the compounds for antiviral activity, virus dilutions were chosen that resulted in an IC90 value (compound concentration required to reduce HIV RNA levels by 90%) for dideoxycytidine (ddC) of 0.2 μg/ml. IC90 values of other antiviral compounds, both more and less potent than ddC, were reproducible using several amounts of HIV-1 (RF) when following this procedure. This virus concentration corresponded to ~3 x 10 5 PFU (measured by plaque assay on MT-2 cells) per test well and typically gives about 75% of the maximum viral RNA level achieved with any viral inoculation. For the HIV RNA assay, IC90 values were determined from the percent reduction in net signal (signal from infected cell samples minus signal from uninfected cell samples) in the RNA assay relative to the net signal from infected, untreated cells in the same culture plate (average of eight wells). The valuable performance of individual infection and RNA assay assays was evaluated according to three criteria. Viral infection was required to result in an RNA assay signal equal to or greater than that generated by 2 ng of pDAB 72 in vitro RNA transcript. The IC90 for ddC, determined in each run of the assay, should be between 0.1 and 0.3 μg/ml. Finally, the plateau level of viral RNA achieved by an effective protease inhibitor should be less than 10% of the level achieved in an uninhibited infection. A compound is considered active if its IC90 is found to be less than 1 μM.

For antiviral potency assays, all manipulations in microtitre plates, after the initial addition of 2x concentrated compound solution in one row of wells, are performed using a Perkin Elmer/Cetus ProPette.

Dosage and formulation

Antiviral compounds of the present invention can be used as a method of treating viral infections by any method that brings the active agent(s) into contact with the agent's site of action, eg viral protease, in the body of a mammal. They may be administered in any conventional manner available for use with pharmaceutical preparations, either as an individual therapeutic agent or as a combination of therapeutic agents. They can be administered independently, but it is preferable that they are administered with a pharmaceutical carrier selected based on the chosen route of administration and standard pharmaceutical practice.

Of course, the dose administered will vary depending on known factors, such as the pharmacodynamic characteristics of a particular agent and its method and route of administration; age, health condition and body weight of the patient; nature and extent of symptoms; type of other, parallel treatments; frequency of application of treatment; and the desired effect. A daily dose of the active ingredient can be expected to be about 0.001 to about 1,000 milligrams per kilogram of body weight, with a preferred dose of about 0.1 to about 30 mg/kg.

Dosage forms of mixtures suitable for use contain from about 1 mg to about 100 mg of active ingredient per unit. In these pharmaceutical compositions, the active ingredient will usually be present in an amount of about 0.5-95% by weight relative to the total weight of the mixture. The active ingredient can be administered orally in solid dosage forms or in liquid dosage forms, such as elixirs, syrups and suspensions. It can also be administered parenterally, in the form of sterile liquid doses.

Gelatin capsules contain the active ingredient and breakable carriers, such as lactose, starch, cellulose derivatives, magnesium stearate, stearic acid and the like. Similar diluents can be used to make compressed tablets, 1 tablets and capsules can be manufactured as sustained-release products to ensure continuous release of the drug over a period of time. Compressed tablets can be coated with sugar or film to mask any unpleasant taste and protect the tablet from atmospheric influences, or they can be enteric-coated for selective breakdown in the digestive system. Liquid dosage forms for oral administration may contain color or flavor enhancers to increase patient acceptance.

In principle, water, a suitable oil, a salt-water solution, aqueous dextrose (glucose) and related sugar solutions and glycols such as propylene glycol or polyethylene glycol are suitable carriers for parenteral solutions. It is preferable that solutions for parenteral administration contain a water-soluble salt of the active ingredient, appropriate stabilizing agents and, if necessary, buffer substances. Antioxidants such as sodium bisulfite, sodium sulfite or ascorbic acid, either alone or in combination, are suitable stabilizing agents. Citric acid and its salts and sodium EDTA are also used. In addition, parenteral solutions may contain preservatives, such as benzalkonium chloride, methyl- or propyl-paraben, and chlorobutanol. Suitable pharmaceutical carriers are described in Ramington's Pharmaceutical Sciences, supra, a standard reference text in the art.

Useful pharmaceutical dosage forms for the administration of the compounds of this invention may be illustrated as follows:

Capsules

A large number of unit capsules can be prepared by filling each standard two-part hard gelatin capsule with 100 mg of active ingredient powder, 150 mg of lactose, 50 mg of cellulose and 6 mg of magnesium stearate.

Soft gelatin capsules

A mixture of the active ingredient in a digestible oil such as soybean oil, cottonseed or olive oil can be prepared and injected using a positive displacement pump into gelatin to produce soft gelatin capsules containing 100 mg of the active ingredient. After that, the capsules should be washed and dried.

Pills

A large number of tablets can be prepared by conventional methods so that a unit dose contains 100 mg of active substance, 0.2 mg of colloidal silicon dioxide, 5 milligrams of magnesium stearate, 275 mg of microcrystalline cellulose, 11 mg of starch and 98.8 mg of lactose. Appropriate coatings may be applied to improve taste or delay absorption.

Suspension

The aqueous suspension may be prepared for oral administration so that each 5 ml contains 25 mg of the finally separated active ingredient, 200 mg of sodium carboxymethyl cellulose, 5 mg of sodium benzoate, 1.0 g of sorbitol solution, U.S.P., and 0.025 mg of vanillin.

Injections

Parenteral mixtures suitable for injection can be prepared by mixing 1.5% by weight of the active ingredient in 10% by volume of propylene glycol and water. The solution is sterilized by techniques that are in general use.

Combination of components (a) and (b)

Each component of the therapeutic agent of the present invention may be alone in any dosage form, such as described above, and may also be administered in a variety of ways, as described above. In the description that follows, component (b) is to be understood as representing one or more agents as described above. Therefore, if components (a) and (b) are to be treated together or individually, each agent of component (b) may also be treated together or individually.

Components (a) and (b) of the present invention may be formulated together, in individual dosage units (that is, combined together in a single capsule, tablet, powder, liquid, etc.) as a combination product. When components (a) and (b) are not formulated together in one dosage unit, component (a) may be administered simultaneously with component (b) or in any other order; for example, component (a) of the present invention may be applied first, followed by component (b), or they may be applied in the reverse order. If component (b) contains more than one agent, eg one RT inhibitor and one protease inhibitor, these agents can be administered together or in any other order. When they are not applied simultaneously, it is preferable that the application of components (a) and (b) takes place in an interval that is shorter than one hour.

It is preferable that the route of application of components (a) and (b) be oral. The terms oral agent, oral inhibitor, oral compound, and the like, as used herein, refer to compounds that can be administered orally. it is readily preferred that component (a) and component (b) are both administered by the same route (ie, for example, both orally) or the same dosage form, if desired, they may be administered by different routes (ie, for example, one a component of the combined product may be administered orally, and the other component may be administered intravenously) or in different dosage forms.

As will be apparent to a medical practitioner skilled in the art, the dosages of the combination therapy of this invention may vary depending on various factors such as the pharmacodynamic characteristics of the particular agent and its route and route of administration, the age, health status and body weight of the patient, the nature and extent of symptoms, a variety of other , parallel treatments, frequency of treatment application, and the desired effect, as described above.

Based on this disclosure, appropriate dosing of components (a) and (b) of this invention will be readily apparent to one of ordinary skill in the art. According to the guidelines, a typical daily dose may be about 100 mg to about 1.5 grams of each component. If component (b) is more than one compound, then a typical daily dose may be about 100 milligrams to about 1.5 grams of each agent of component (b).

According to the principle instructions, when the compounds of component (a) and component (b) are administered in combination, the dose amount for each component can be reduced to about 70-80% compared to the usual dose of the component when administered alone as a single agent for the treatment of HIV infections.

The combination products of the present invention may be formulated such that, although the active ingredients are combined in individual dosage units, physical contact between the active ingredients is minimized. In order to minimize contact, for example, when the product is administered orally, one active ingredient can be enteric coated. By enteric coating one of the active ingredients, it is possible not only to minimize the contact between the combined active ingredients, but also, it is possible to control the release of one of these components in the gastrointestinal tract in such a way that one of these components is not released in the stomach, but in the intestines.

Another form of this medicine, which is preferred for oral administration, provides a combination product, where one of the active ingredients is coated with a material for sustained release through the gastrointestinal tract, which also serves to minimize physical contact between the combined active ingredients. Furthermore, the sustained-release component can be additionally enteric-coated in such a way that the release of this component takes place only in the intestines. Another approach would involve formulating a combination product where one component is coated with a sustained and/or enteric release polymer and the other component is also coated with a low viscosity polymer of hydroxypropyl methylcellulose or other suitable materials known in the art to further sequester the active ingredients. components. Coating with a polymer serves to create an additional barrier that prevents interaction with another component. In any formulation in which contact between components (a) and (b) is prevented by coating or some other material, contact between the individual agents of component (b) can also be prevented.

Dosage forms of the combined products of this invention in which one active ingredient is enteric-coated can be in the form of tablets in which the enteric-coated component is mixed with another active ingredient and then compressed into a tablet, or tablets in which the enteric-coated component is compressed in one layer tablets, and the second active ingredient is compressed into a second, additional layer. It is possible, in order to further separate the two layers, in the presence of one or more placebo layers in such a way that the placebo layer is between the layers of active ingredients. In addition, the dosage forms of this invention can be in the form of capsules where one active ingredient is compressed in a tablet or in the form of various microtablets, pellets or granules which are then enterically coated. These enteric-coated microtablets, pellets or granules are then encapsulated or compressed into capsules together with granulations of another active ingredient.

These, as well as other means of minimizing contact between the components of the combination products of this invention, whether administered in a single dosage form or administered in separate forms but simultaneously or concurrently in the same manner, will, in view of this presentation, easily understood by experts in this field.

Pharmaceutical kits (accessories) useful in the treatment of HIV infection, containing a therapeutically effective amount of a pharmaceutical mixture containing a compound from component (a) and one or more compounds from component (b), in one or more sterile containers, are also covered by this invention. Sterilization of the container may be accomplished by conventional sterilization techniques well known to those skilled in the art. Component (a) and component (b) may be in the same sterile container or in separate sterile containers. Sterile material containers can contain separate containers, or one or more multi-part containers, depending on preferences. Component (a) and component (b) may be separated or physically combined in a single dosage form or unit dose, as described above.

Furthermore, such kits (accessories) may include, if desired, one or more of the various components of a conventional pharmaceutical kit, such as, for example, one or more pharmaceutically acceptable carriers, additional containers for mixing the components, etc., as will be readily understood by those skilled in the art. this area. Instructions, whether inserts or labels indicating the quantities of components to be applied, instructions for application and/or instructions for mixing components, may also be included in the kit (accessory).

It will be apparent that numerous modifications and variations of this invention are possible in light of the foregoing. Therefore, it should be understood that with regard to the area of pending patent claims, this invention may be applied differently than specifically described here.

Claims (20)

1. A compound characterized by having the formula I or II: [image] or a pharmaceutically acceptable salt or prodrug form thereof. 2. A compound according to claim 1, characterized in that it is a compound of formula I. 3. A compound according to claim 1, characterized in that it is a compound of formula II. 4. A pharmaceutical mixture characterized in that it contains a pharmaceutically acceptable carrier and a therapeutically effective amount of the compound from claim 1 or its pharmaceutically acceptable salt or prodrug form. 5. The mixture according to claim 4, characterized in that it is a compound of formula I. 6. The mixture according to claim 4, characterized in that it is a compound of formula II. 7. A method of treating HIV infection characterized by the fact that it comprises the application, to a host in need of such treatment, of a therapeutically effective amount of a compound of formula I or II [image] or a pharmaceutically acceptable salt or prodrug form thereof. 8. The method according to claim 7, characterized in that the compound of formula I. 9. The method according to claim 7, characterized in that the compound of formula II. 10. A method of treating HIV infection characterized by the fact that it includes the application, in combination, to a host in need of such treatment, of a therapeutically effective amount (a) compounds of formula I or II. [image] or a pharmaceutically acceptable salt or prodrug form thereof; and (b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors 1 HIV protease inhibitors. 11. The method according to claim 10, characterized in that the compound of formula I. 12. The method according to claim 10, characterized in that the compound of formula II. 13. The method according to claim 10, characterized in that the reverse transcriptase inhibitor is a nucleoside reverse transcriptase inhibitor. 14. The method according to claim 13, characterized in that the nucleoside reverse transcriptase inhibitor is selected from AZT, 3TC, ddl, ddC and d4T, and the protease inhibitor is selected from saguinavir, ritonavir, indinavir, VX-478, nelfinavir, KNI-272, CGP -61755 and U-103017. 15. The method according to claim 14, characterized in that the nucleoside reverse transcriptase inhibitor is selected from AZT and 3TC, and that the protease inhibitor is selected from saguinavir, ritonavir and indinavir. 16. The method according to claim 15, characterized in that the nucleoside reverse transcriptase inhibitor is AZT. 17. The method according to claim 15, characterized in that the protease inhibitor is indinavir. 18. Pharmaceutical kit (accessory) useful in the treatment of HIV infection, indicated by the fact that it contains a therapeutically effective amount of: (a) the compound of claim 1; and (b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors, in one or more sterile containers. 19. Kit (accessory) according to claim 18, characterized in that component (a) is a compound of formula I. 20. Kit (accessory) according to claim 18, characterized in that component (a) is a compound of formula II.