MXPA01007047A - Bis-amino acid sulfonamides containing n-terminally a substituted benzyl group as hiv protease inhibitors - Google Patents

Abstract

This invention relates generally to bis-amino acid sulfonamides containing substituted benzyl amines of formula (I) or stereoisomeric forms, stereoisomeric mixtures, or pharmaceutically acceptable salt forms thereof, which are useful as HIV protease inhibitors, pharmaceutical compositions and diagnostic kits comprising the same, methods of using the same for treating viral infection or as assay standards or reagents, and intermediates and processes for making the same.

Description

SULFONAMIDAS BIS AMINO ACIDAS CONTAINING A BENCILO GROUP SUBSTITUTED N-TERMINAL AS PROTEASA INHIBITORS OF HUMAN IMMUNODEFICIENCY VIRUS (HIV) FIELD OF THE INVENTION The present invention relates in general to bis-amino acid sulfonamides containing substituted benzyl amines useful as inhibitors of HIV protease, to pharmaceutical compositions and to diagnostic kits comprising the same, and methods for the use thereof. for the treatment of viral infection or as test standards or reagents.

BACKGROUND OF THE INVENTION Two distinct retroviruses, the human immunodeficiency virus (HIV) type 1 (HIV-1) or type 2 (HIV-2), have been etiologically linked to the immunosuppression disease, the acquired immunodeficiency virus ( AIDS). HIV-positive individuals are initially asymptomatic but typically develop the AIDS-related complex (CRS) followed by AIDS. Affected individuals exhibit severe immunosuppression which predisposes them to debilitation and ultimately fatal opportunistic infections. REF: 130117 The disease of the human immunodeficiency virus type 1 (HIV-1) or type 2 (HIV-2) followed its own life cycle. The virion life cycle begins with the virion joining itself with the human T-4 lymphocyte immune host by binding a glycoprotein on the surface of the protection coat of the virion with the CD4 glycoprotein in the lymphocyte . Once bound, the virion detaches from its glycoprotein coverage, penetrates into the membrane of the host , and discovers its RNA. The virion enzyme, reverse transcriptase, directs the process of RNA transcription into single-stranded DNA. The viral RNA degrades and a second strand of DNA is created. The new double-stranded DNA is integrated into the genes of human s and these genes are used for the reproduction of the virus. At this point, the RNA polymerase transcribes the integrated DNA into viral RNA. The viral RNA is translated into the gag-pol fusion polyprotein precursor. Then, the polyprotein is broken by the HIV protease enzyme to give the mature viral proteins. Then the HIV protease is responsible for the regulation of a cascade of rupture events that result in the maturity of the virus particle in a virus that is capable of total infection. The typical response of the human immune system, of killing the invading virion, is depleted because the virus infects and kills the T s of the immune system. In addition, the viral reverse transcriptase, the enzyme used in the preparation of a new virion particle, is not very specific, and causes the transcription to mistake that result in glycoproteins continuously changed on the surface of the viral protective coat. This lack of specificity decreases the effectiveness of the immune system because antibodies produced specifically against one glycoprotein may be useless against another, thus reducing the number of antibodies available to fight the virus. The virus continues to reproduce while the immune response system continues to weaken. Eventually, HIV dominates widely over the body's immune system, allowing opportunistic infections to be declared and without the administration of antiviral agents, modulators of immunity, or both, resulting in death. There are at least three critical points in the life cycle of the virus that have been identified as possible targets for antiviral drugs: (1) the initial binding of the virion to the T-4 lymphocyte or macrophage site, (2) the transcription of the RNA viral viral DNA (reverse transcriptase, TR), and (3) the processing of the gag-pol protein by the HIV protease. The genomes or retroviruses encode a protease that is responsible for the proteolytic processing of one or more polyprotein precursors such as the pol and gag product genes. See Wellink, Arch. Virol. 98 1 (1998). Retroviral proteases most commonly process the gag precursor in the core proteins, and also process the pol precursor in reverse transcriptase and retroviral protease. The correct processing of the precursor polyproteins by the retroviral protease is necessary for the assembly of the infectious virions. It has been shown that in vitro mutagenesis that produces defective protease virus results in the production of immature central forms lacking infectious capacity. See Cra ford et al., J. Virol. 53 899 (1985); Katoh et al., Virology 145 280 (1985). Therefore, retroviral protease provides an attractive target for antiviral therapy. See Mitsuya, Nature 325 775 (1987). As evidenced by currently commercialized protease inhibitors and in clinical trials, a large variety of compounds have been studied as potential HIV protease inhibitors. One center, hydroxyethylamino-sulfonamides, has received significant attention. For example, PCT Applications WO94 / 05639, O94 / 04492, WO95 / 06030, and 096/28464 generically describe sulfonamides of the formula: and methods for its preparation. Although some of the present compounds seem to fall within the generic descriptions of some of the previous publications, they are not specifically described, suggested or claimed there. Even with the current success of protease inhibitors, it has been found that patients with HIV can become resistant to a simple protease inhibitor. Therefore, it is desirable to develop protease inhibitors to further combat HIV infection.

BRIEF DESCRIPTION OF L? INVENTION Accordingly, an object of the present invention is to provide novel protease inhibitors. Another object of the present invention is to provide a novel method for the treatment of HIV infection which comprises administration to a host in need of such treatment, of an effective amount of at least one of the compounds of the present invention or a pharmaceutically acceptable form of its salts. Another object of the present invention is to provide a novel method for the treatment of HIV infection which comprises administering to a host in need thereof, a therapeutically effective combination of (a) one of the compounds of the present invention and ( b) one or more compounds selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors. Another object of the present invention is to provide pharmaceutical compositions with protease inhibition activity comprising an acceptable pharmaceutical carrier and a therapeutically effective amount of at least one of the compounds of the present invention or one of its pharmaceutically acceptable salt forms. Another object of the present invention is to provide a method for the inhibition of HIV present in a body fluid sample comprising the treatment of the body fluid sample with an effective amount of a compound of the present invention. Another object of the present invention is to provide a kit or container containing at least one of the compounds of the present invention in an amount effective to be used as a standard or reagent in a test or assay to determine the ability of a potential pharmacist to inhibit HIV protease, HIV growth, or both. These and other objects, which will be appreciated during the following detailed description of the invention, have been achieved by the discovery of the inventors that the compounds of the formula (I): wherein R1, R2, and R3 are defined below, their stereoisomeric forms, mixtures of stereoisomeric forms, or pharmaceutically acceptable salts, are effective protease inhibitors.

DETAILED DESCRIPTION OF THE INVENTION [1] Therefore, in a first embodiment, the present invention provides a novel compound of Formula I: or one of its pharmaceutically acceptable salt forms, wherein: R1 is F; R2 is F or H; and R3 is selected from the group: 4-aminophenyl, 3-aminophenyl, 2,3-dihydrobenzofuran-5-yl, and 1,3-benzodioxol-5-yl. [2] In a preferred embodiment, the present invention provides a novel compound of Formula II: II [3] In a more preferred embodiment, the present invention provides a novel compound of the Formula Ha: He has, [4] Still in a more preferred embodiment, the present invention provides a novel compound of Formula Ha, wherein: R 3 is 3-aminophenyl. [5] In another still more preferred embodiment, the present invention provides a novel compound of Formula Ha, wherein: R3 is 4-aminophenyl. [6] In another still more preferred embodiment, the present invention provides a novel compound of Formula Ha, wherein: R is 2,3-dihydrobenzofuran-5-yl or 1,3-benzodioxol-5-yl. [7] In another still more preferred embodiment, the present invention provides a novel compound of the Formula Hb: Hb. [8] In another still more preferred embodiment, the present invention provides a novel compound of the Formula Hb, wherein: R3 is 3-aminophenyl. [9] In another still more preferred embodiment, the present invention provides a novel compound of Formula IIb, wherein: R3 is 4-aminophenyl. [10] In another still more preferred embodiment, the present invention provides a novel compound of the Formula Hb, wherein: R is 2,3-dihydrobenzofuran-5-yl or 1,3-benzodioxol-5-yl, [11] In another even more preferred embodiment, the present invention provides a novel compound of the Formula He: He.

[12] In still another preferred embodiment, the present invention provides a novel compound of Formula He, wherein: R 3 is 3-aminophenyl. [13] In another still more preferred embodiment, the present invention provides a novel compound of the Formula Ie, wherein: R3 is 4-aminophenyl. [14] In another still more preferred embodiment, the present invention provides a novel compound of Formula He, wherein: R is 2,3-dihydrobenzofuran-5-yl or 1,3-benzodioxol-5-yl.

[15] In another yet more preferred embodiment, the present invention provides a novel compound of the Formula III: III.

[16] In another still more preferred embodiment, the present invention provides a novel compound of the Illa Formula: Illa,

[17] In another preferred embodiment, the present invention provides a novel compound of Formula IV: IV.

[18] In another more preferred embodiment, the present invention provides a novel compound of Formula IVa: IVa, In another embodiment, the present invention provides a novel pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of a compound of formula I or a form of its pharmaceutically acceptable salts.

In another embodiment, the present invention provides a novel method for the treatment of HIV infection which comprises administering to a host in need of such treatment, a therapeutically effective amount of a compound of the formula I or a pharmaceutically acceptable salt of the same. In another embodiment, the present invention provides a novel method for the treatment of HIV infection which comprises administering, in combination, to a host in need of such treatment, a therapeutically effective amount of: (a) a compound of the Formula I; and, (b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors. In another preferred embodiment, the reverse transcriptase inhibitor is selected from the group AZT, ddC, ddl, d4T, 3TC, delavirdine, efavirenz, nevirapine, Ro 18,893, trovirdine, MKC-442, HBY 097, ACT, UC-781, UC- 782, RD4-2025, and MEN 10979, and the protease inhibitor is selected from the group of saquinavir, ritonavir, indinavir, amprenavir, nelfinavir, palinavir, BMS-232623, GS3333, KNI-413, KNI-272, LG-71350, CGP-61755, PD 173606, PD 177298, PD 178390, PD 178392, U-140690, and ABT-378.

In an even more preferred embodiment, the reverse transcriptase inhibitor is selected from the group of AZT, efavirenz, and 3TC and the protease inhibitor is selected from the group of saquinavir, ritonavir, nelfanavir, and indinavir. Still in a further preferred embodiment, the reverse transcriptase inhibitor is AZT. In yet another preferred preferred embodiment, the protease inhibitor is ritonavir. In another preferred embodiment, component (b) is a reverse transcriptase inhibitor of HIV and an HIV protease inhibitor. In another preferred embodiment, component (b) are two different inhibitors of HIV reverse transcriptase. In another embodiment, the present invention provides a pharmaceutical composition useful for the treatment of HIV infection, which comprises a therapeutically effective amount of: (a) a compound of the formula I; and, (b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors, in one or more sterile containers. In another embodiment, the present invention provides a novel method of inhibiting HIV present in a body which comprises treating the body fluid sample with an effective amount of a compound of the formula I. In a ninth embodiment, the present invention provides a kit or container comprising a compound of formula I in an amount effective to be used as a standard or reagent in a test or assay for the determination of a potential pharmacist's ability to inhibit protease of HIV, HIV growth, or both.

DEFINITIONS As used herein, the following terms and expressions have the indicated meanings. It will be appreciated that the compounds of the present invention contain asymmetrically substituted carbon atoms, and can be separated into optically active or racemic forms. It is well known in the art how to prepare optically active forms, such as by resolution of racemic forms or by synthesis, from optically active materials. All chiral, diastereomeric racemic forms and all geometric isomeric forms of a structure are intended, unless the specific stereochemistry or isomeric form is specifically indicated.

It is contemplated that the processes of the present invention are practiced on at least one multigram scale, kilogram scale, multikilogram scale, or industrial scale. The multigram scale as used herein is preferably the scale wherein at least one starting material is present in 10 grams or more, more preferably at least 50 grams or more, even more preferably at least 100 grams or more. The multigram scale, as used herein, is intended to mean the scale on which more than one kilogram of at least one starting material is used. The industrial scale as used herein is intended to mean a scale in which it is different from a laboratory scale and which is sufficient to supply sufficient product for clinical tests or for distribution to consumers. The present invention is intended to include isotopes or atoms with occurrence in the present compounds. Isotopes include those atoms that have the same atomic number but different mass numbers. By way of general example and without limitation, the isotopes of hydrogen include tritium and deuterium. Carbon isotopes include C-13 and C14. As used herein, "HIV reverse transcriptase inhibitor" is intended to refer to both nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (TR). Examples of TR nucleoside inhibitors include, but are not limited to, AZT, ddC, ddl, d4T, and 3TC. Examples of non-nucleoside TR inhibitors include, but are not limited to, delavirdine, (Pharmacia and Upjohn, U90152S), efavirenz (DuPont), nevirapine (Boehringer Ingelheim) r Ro 18,893 (Roche), trovirdine (Lilly), MKC-442 (Triangle), HBY 097 (Hoechst), HBY 1293 (Hoechst), ACT (Korean Research Institute), UC-781 (Rega Institute), UC-782 (Rega Institute), RD4-2025 (Tosoh Co. Ltd.) , and MEN 10979 (Menarini Farmaceutici). As used herein, "HIV protease inhibitor" is intended to refer to compounds that inhibit HIV protease. Examples include, but are not limited to, saquinavir (Roche, Ro31-8959), ritonavir (Abott, ABT-538), indinavir (Merck, MK-639), amprenavir (Vertex / Glaxo Wellcome), nelfinavir (Agouron, AG -1343), palinavir (Boehringer Ingelheim), BMS-232623 (Bristol-Myers Squibb), GS3333 (Gilead Sciences), KNI-413 (Japan Energy), KNI-272 (Japan Energy), LG-71350 (LG Chemical), CGP-61755 (Ciba-Geigy), PD 173606 (Parke Davis), PD 177298 (Parke Davis), PD 178390 (Parke Davis), PD 178392 (Parke Davis), tipranavir (Pharmacia and Upjohn, U-140690), DMP- 450 (DuPont) and ABT-378.

As used herein, "pharmaceutically acceptable salts" refers to derivatives of the described compounds wherein the parent compound is modified by making its acid or basic salts. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkaline or organic salts of acidic residues such as carboxylic acids; and similar. The pharmaceutically acceptable salts include the conventional non-toxic salts or the quaternary ammonium salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. For example, such non-toxic conventional salts include those which are derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric, and the like.; and salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroximic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetobenzoic , fumaric, toluenesulfonic, methanesulfonic, ethanesulfonic, isethionic, and the like. The pharmaceutically acceptable salts of the present invention can be synthesized from the parent compound which contains basic or acidic portions by conventional chemical methods. Generally, these salts can be prepared by reaction of the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of two non-aqueous media, generally Preferred, ether, ethyl acetate, ethanol, isopropanol, or acetonitrile. Lists of suitable salts are found in Remington's Pharmaceutical Sciences Remington), 17th. edition, Mack Publishing Company, Easton, PA, 1985, page 1418, the description of which is incorporated herein by reference. The phrase "* pharmaceutically acceptable" is used herein to refer to those compounds, materials, compositions, and / or dosage forms which are suitable for use, within the scope of good medical judgment, in contact with the tissues of humans and animals without excessive toxicity, irritation, allergic response, or other problem or balanced complication with a reasonable benefit / risk ratio. The "Profarmacos" are intended to include any covalently linked carrier which releases the active drug in accordance with the. Formula (I) or other formulas or compounds of the present invention in vivo when said prodrug is administered to a mammalian subject. The prodrugs of a compound of the present invention, for example of the formula (I) are prepared by modifying the functional groups present in the compound in such a way that the modifications dissociate in the routine manipulation or in vivo, in the compound principal. Prodrugs include compounds of the present invention wherein the hydroxy or amino group is attached to any group, when the prodrug is administered to a mammalian subject, it dissociates to form, respectively, a free hydroxyl or free amino. Examples of prodrugs include, but are not limited to, derivatives, acetate, formate and benzoate of alcohol and amine functional groups in the compounds of the present invention, and the like. "Stable compound" and "stable structure" is intended to indicate a compound that is sufficiently robust to survive isolation to a useful degree of purity of a reaction mixture, and the formulation into an effective therapeutic agent. Only stable compounds are contemplated in the present invention. "Substituted" is intended to indicate that one or more hydrogens in the atom indicated in the expression using "substituted" are replaced with a selection of the indicated group (s), provided that the indicated normal valence of the atom does not exceed, and that the substitution results in a stable compound. When a substituent is a keto group (ie, = 0), then 2 hydrogens on the atom are replaced. "Therapeutically effective amount" is intended to include an amount of a compound of the present invention or an amount of the combination of the claimed compounds effective to inhibit HIV infection or treat the symptoms of HIV infection in a host. The combination of compounds is preferably a synergistic combination. Synergy, as described for example by Chou and Talalay, Adv. Enzyme Regul. 22: 27-55 (1984), occurs when the effect (in this case, inhibition of HIV replication) of the compounds when administered in combination is greater than the additive effect of the compounds when administered alone as a single agent . In general, a synergistic effect is demonstrated more clearly at suboptimal concentrations of the compounds. The synergy may be in terms of less toxicity, increased antiviral effect, or other beneficial effect of the combination compared with the individual components. A diastereomer of a compound of Formula I may show superior activity compared to the other.

When required, separation of the racemic material can be obtained by HPLC using a chiral column or by resolution using a resolving agent such as canphonic chloride as in Thomas J. Tucker, et al., J. Med. Chem. 1994, 37, 2437 -2444. A chiral compound of formula I can also be synthesized using a chiral catalyst or a chiral ligand, for example, Mark A. Huffman, et al., J. Org. Chem. 1995, 60, 1590-1594. Other characteristics of the invention can be seen in the course of the following descriptions of example modalities which are given for illustration of the invention and are not intended to limit it.

EXAMPLES The abbreviations used in the Examples are defined as follows: "° C" for degrees Celsius, "d" for double, "dd" for double double, "eq" for equivalent or equivalents, "g" for gram or grams, "mg" for milligram or milligrams, "mL" for milliliter or milliliters, "H" for hydrogen or hydrogens, "hr" for hour or hours, "m" for multiple, "M" for molar, "min" for minute or minutes, "MHz" for megahertz, "MS" for mass spectroscopy, "nmr" or "NMR" for nuclear magnetic resonance spectroscopy, "t" for triple, and "TLC" for thin layer chromatography. Example 1 1A 1G IB To a salt solution of N- [3 (S) - [N, N-bis (phenylmethyl) amino] -2 (R) -hydroxy-4-phenylbutyl] -N-isobutylamino-oxalic acid 1A (127.6 g, 251 mmol) in toluene (1 L), water (500 mL) and CH2C12 (400 mL) was added NaOH (50% aqueous, 44.5 g). After stirring for 10 min, the reaction mixture was extracted with toluene. The combined organic layers were washed with brine, dried (MgSO4) and the solvent was removed under reduced pressure. The residue was taken up in THF (1 L), cooled to 0 ° C, and treated with triethylamine (28.15 g, 278 mmol) and di-tert-butyl dicarbonate (55.23 g, 253 mmol). The solution was warmed to room temperature and stirred overnight. The solvent was removed under reduced pressure and the residue was taken up in EtOAc (1 L), washed with water, 5% citric acid, water, NaHCO 3, brine, and dried (MgSO). The solvent was removed under reduced pressure to give the carbamate IB which was used directly without further purification. CIMS (NH3) m / z: 517 (M + H +, 100%). 1C To a solution of crude IB (possible 251 mmol) in methanol (500 mL) was added palladium hydroxide on carbon (20%, 10 g). The suspension was placed in a parr vessel and charged with hydrogen (55 psi). After stirring overnight the reaction mixture was filtered through Celite and the solvent was removed under reduced pressure. The resulting solid was recrystallized (EtOAc / hexane) to give amine 1C as a white solid (56.6 g, 67% (2 steps)): CIMS (NH3) m / z: 337 (M + H +, 100%).

ID To a solution of N-carbobenzyloxy-L-ter-leucine (47.5 g, 179 mmol) in DMF (250 mL) at 0 ° C was added N-hydroxybenzotriazole (38.6 g, 285 mmol) and EDC (35.7 g, 186 mmol). After stirring 1.5 hours the solution was added to a suspension of 1C (56.6 g, 167 mmol) and 4-methylmorpholine (52.9 g, 521 mmol) in DMF (200 mL). The reaction mixture was allowed to warm to room temperature. After stirring overnight N, N-dimethylethylenediamine (4 mL) was added, the solution was stirred 1.5 hours and the solvent was removed under reduced pressure. The residue was taken up in EtOAc (1 L), washed with water, 5% citric acid, water, saturated NaHCO 3, brine and dried (MgSO 4). The solvent was removed under reduced pressure to give ID (97.5g, 100%) which was used without further purification. CIMS (NH3) m / z: 584 (M + H +, 100%). 1E To a solution of ID (97.5 g, 167 mmol) in methanol (300 mL) was added palladium hydroxide on carbon (20%, 10 g). The suspension was placed in a parr vessel and charged with hydrogen (55 psi). After stirring overnight the reaction mixture was filtered through Celite and the solvent was removed under reduced pressure. The resulting solid was recrystallized (EtOAc / hexane) to give amine 1E as a white solid (72.8 g, 97%): CIMS (NH3) m / z: 450 (M + H +, 100%). 1F To a solution of amine 1E (43.8g, 97.6 mmol) in EtOAc (400 mL) and water (270 mL) were added KHC03 (27.7 g, 276 mmol) and chloroacetyl chloride (12.4 g, 111 mmol). After stirring 3 hours, EtOAc (1 L) was added and the solution was washed with water, 5% citric acid, water, saturated NaHCO 3, brine, and dried (MgSO 4). The solvent was removed under reduced pressure to give 1F as a white solid (51.0 g, 99%): CIMS (NH3) m / z: 526 (M + H +, 100%). 1G To a solution of 1F (33.8 g, 64.2 mmol) in EtOAc (600 mL) was added 4N HCl in dioxane (80 mL, 320 mmol) and the reaction mixture was stirred 6 hours. The solvent was removed under reduced pressure and the resulting solid was triturated with cold ether to give the 1G hydrochloride salt (28.75g, 97%): CIMS (NH3) m / z: 426 (M + H +, 100%). 1H To a solution of the 1G salt (32.0 g, 69.2) in THF (350 mL) and water (450 mL) was added K2C03 (56.7 g, 411 mmol) and 4-nitrobenzenesulfonyl chloride (16.9 g, 76 mmol). After stirring 4 hours, water was added and the suspension was extracted with EtOAc. The combined organic layers were washed with brine, 5% citric acid, water, saturated NaHCO 3, brine, and dried (MgSO). The solvent was removed under reduced pressure and the resulting solid was recrystallized (EtOAc / hexane) to give sulfonamide 1H as a white solid (35.8 g, 85%). CIMS (NH3) m / z: 611 (M + H +, 100%).

II To a solution of 1H chloride (16.0 g, 26.1 mmol) in THF (200 L) was added 3-fluorobenzylamine (20.0 g, 160 mmol) and the reaction mixture was refluxed overnight. The solvent was removed under reduced pressure and the residue was taken up in EtOAc and washed with water, brine, and dried (MgSO). The solvent was removed under reduced pressure and chromatography was performed on the residue (silica gel, 4% methanol / CH2Cl2) to obtain amine II as a white solid (16.3 g, 89%). CIMS (NH3) m / z: 700 (M + H +, 100%). 1 To a solution of II (14.6 g, 20.8 mmol) in methanol (500 mL) was added platinum hydroxide on carbon (20%, 1.5 g) and the reaction mixture was charged with hydrogen. After stirring 3 hours, the mixture was filtered through Celite and the solvent was removed under reduced pressure. To the residue, chromatography (silica gel, 5% methanol / CH2Cl2) was carried out to give the amine as a white solid (13.2 g, 95%). To a solution of the free base (11.68 g, 17.4 mmol) in ether (300 mL) and EtOAc (100 mL) was added IN NHP in ether (37 mL, 37 mmol). The resulting suspension was stirred 15 minutes and filtered to give the bis-hydrochloride 1 salt as a white solid (12.5 g, 96%): CIMS (NH3) m / z: 670 (M + H +, 100%).

Example 2 2A To a solution of the 1H chloride (16.0 g, 26.1 mmol) in THF (200 mL) was added 3,5-difluorobenzylamine (25.0 g, 174 mmol) and the reaction mixture was refluxed overnight. The solvent was removed under reduced pressure and the residue was taken up in EtOAc and washed with water, brine, and dried (MgSO 4). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 4% methanol / CH2C12) to give the amine 2A as a white solid (15.2 g, 81%). CIMS (NH3) m / z: 718 (M + H +, 100%). 2 To a solution of 2A (15.2 g, 21.2 mmol) in methanol (500 mL) was added palladium hydroxide on carbon (20%, 1.5 g) and the reaction mixture was charged with hydrogen. After stirring 4 hours, the mixture was filtered through Celite and the solvent was removed under reduced pressure. Chromatography was performed to the residue (silica gel, 5% methanol / CH2Cl2) to give the amine as a white solid (10.3 g, 71%). To a solution of the free base in ether (300 mL) and EtOAc (100 mL) was added IN NHP in ether (32 mL, 32 mmol). The resulting suspension was stirred 15 minutes and filtered to give the bis-hydrochloride 2 salt as a white solid: CIMS (NH3) m / z: 688 (M + H +, 100%).

Example 3 3A To a solution of 1H chloride (300 mg, 0.49 mmol) in THF (4 mL) was added 2,5-difluorobenzylamine (1.2 g, 8.5 mmol) and the reaction mixture was refluxed 4 hours. The reaction mixture was diluted with EtOAc and washed with water, brine, and dried (MgSO 4). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH2Cl2) to give amine 3A as a white solid (270 mg, 77%). CIMS (NH3) m / z: 718 (M + H +, 100%). 3 To a solution of 3A (260 mg, 0.36 mmol) in methanol (25 mL) was added palladium hydroxide on carbon (20%, 50 mg) and the reaction mixture was charged with hydrogen. After stirring for 1 hour, the mixture was filtered through Celite and the solvent was removed under reduced pressure. Chromatography (silica gel, 5% methanol / CH2C12) was carried out to the residue to obtain the amine as a white solid (226 mg, 91%). To a solution of the free base in ether (30 mL) and EtOAc (10 mL) was added 4N HCl in dioxane (0.2 mL, 0.8 mmol). The resulting suspension was stirred 15 minutes and filtered to obtain the bis-hydrochloride 3 salt as a white solid: CIMS (NH3) m / z: 688 (M + H +, 100%).

Example 4 4A To a solution of the 1H chloride (300 mg, 0.49 mmol) in THF (4 mL) was added 2,6-difluorobenzylamine (1.2 g, 8.5 mmol) and the reaction mixture was refluxed 4 hours. The reaction mixture was diluted with EtOAc and washed with water, brine, and dried (MgSO). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH2Cl2) to give amine 4A as a white solid (306 mg, 87%). CIMS (NH3) m / z: 718 (M + H +, 100%). 4 To a solution of 4A (295 mg, 0.41 mmol) in methanol (25 mL) was added palladium hydroxide on carbon (20%, 50 mg) and the reaction mixture was charged with hydrogen. After stirring for 1 hour, the mixture was filtered through Celite and the solvent was removed under reduced pressure. Chromatography (silica gel, 5% methanol / CH2Cl2) was carried out to the residue to give the amine as a white solid (228 mg, 81%). To a solution of the free base in ether (30 L) and EtOAc (10 mL) was added 4N HCl in dioxane (0.2 mL, 0.8 mmol). The resulting suspension was stirred 15 minutes and filtered to obtain the bis-hydrochloride 4 salt as a white solid: CIMS (NH3) m / z: 688 (M + H +, 100%).

Example 5 5A To a solution of the 1G salt (28.8 g, 62.1 mmol) in THF (300 mL) and water (400 mL) was added K2C03 (51.4 g, 370 mmol) and 3-nitrobenzenesulfonyl chloride (15.14 g, 68.3 mmol) . After stirring 4 hours, water was added and the suspension was extracted with EtOAc. The combined organic layers were washed with brine, 5% citric acid, water, NaHCO 3, brine, and dried (MgSO 4). The solvent was removed under reduced pressure and the resulting solid was triturated with EtOAc and hexane to give sulfonamide 5A as a white solid (32.1 g, 85%). CIMS (NH3) m / z: 611 (M + H +, 100%). 5B To a solution of 5A chloride (16.0 g, 26.1 mmol) in THF (200 mL) was added 3-fluorobenzylamine (17.0 g, 135 mmol) and the reaction mixture was refluxed overnight. The solvent was removed under reduced pressure and the residue was taken up in EtOAc and washed with water, brine, and dried (MgSO 4). The solvent was removed under reduced pressure and chromatography (silica gel, 4% methanol / CH2C12) was carried out to the residue to obtain amine 5B as a white solid (16.0 g, 87%). CIMS (NH3) m / z: 700 (M + H +, 100%).

To a solution of 5B (12.0 g, 17.22 mmol) in methanol (400 L) was added palladium hydroxide. on carbon (20%, 1.25 g) and the reaction mixture was charged with nitrogen. After stirring 3 hours, the mixture was filtered through Celite and the solvent was removed under reduced pressure. Chromatography (silica gel, 5% methanol / CH2C12) was performed to obtain the amine as a white solid (11.2 g, 97%). To a solution of the free base in ether (400 mL) and EtOAc (75 mL) was added INN HCl in ether (36 mL, 36 mmol). The resulting suspension was stirred 15 minutes and filtered to give the bis-hydrochloride salt 5 as a white solid. CIMS (NH3) m / z: 670 (M + H +, 100%).

Example 6 5A 6A To a solution of 5A chloride (16. Og, 26.1 mmol) in THF (200 mL) was added 3,5-difluorobenzylamine (25.0 g, 174 mmol) and the reaction mixture was stirred 2 hours and refluxed overnight . The solvent was removed under reduced pressure and the residue was taken up in EtOAc and washed with water, brine, and dried (MgSO 4). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 3.5% methanol / CH2Cl2) to give the 6A amine as a white solid (15.6 g, 83%). CIMS (NH3) m / z: 718 (M + H +, 100%). 6 To a solution of 6A (14.4 g, 20.0 mmol) in methanol (500 mL) was added platinum hydroxide on carbon (20%, 1.5 g) and the reaction mixture was charged with hydrogen. After stirring 4 hours, the mixture was filtered through Celite and the solvent was removed under reduced pressure. Chromatography was performed (silica gel, 5% methanol / CH2Cl2 to the residue to give the amine as a white solid (12.5 g, 91%). To a solution of the free base (9.57 g, 13.9 mmol) in ether (300 mL) was added IN NHP in ether (31 mL, 31 mmol) The resulting suspension was stirred 20 minutes and filtered to obtain the bis-hydrochloride salt 6 as a white solid (9.9 g, 94%) CIMS (NH3). m / z: 688 (M + H +, 100%).

Example 7 7 To a solution of N- [2R-hydroxy-3- [[(2, 3-dihydro2, 3-dihydrobenzofuran-5-yl) sulfonyl] (2-methylpropyl) amino] -1S- (phenylmethyl) propyl] -2S - [(Chloroacetyl) amino] -3,3-dimethylbutanamide 7A (100 mg, 0.16 mmol) in THF (2 mL) was added 3-fluorobenzylamine (550 mg, 4.4 mmol) and the reaction mixture was refluxed 6 hours. The reaction mixture was diluted with EtOAc and washed with water (4x), brine, and dried (MgSO4). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH2Cl2) to give the amine as a white solid (91 mg, 79%). To a solution of the free base (91 mg, 0.15 mmol) in ether (25 mL) was added 4N HCl in dioxane (0.05 mL, 0.20 mmol). After stirring for 10 minutes the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give the hydrochloride salt 7 as a solid (72 mg, 65%): CIMS (NH3) m / z: 697 ( M + H +, 100%).

Example 8 8 To a solution of 7A (100 mg, 0.16 mmol) in THF (2 mL) was added 3,5-difluorobenzylamine (605 mg, 4.2 mmol) and the reaction mixture was refluxed 6 hours. The reaction mixture was diluted with EtOAc and washed with water (4x), brine, and dried (MgSO4). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH2Cl2) to give the amine as a white solid (83 mg, 70%). To a solution of the free base (83 mg, 0.11 mmol) in ether (25 mL) was added 4N HCl in dioxane (0.05 mL, 0.20 mmol). After stirring for 10 minutes the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give the hydrochloride salt 8 as a white solid (65 mg, 75%): Analysis (C37H49N406S? F2Cl?): Calculated : C, 59.15; H, 6.45; N, 7.47. Found: C, 58.90; H, 6.51; N, 7.21.

Example 9 9 To a solution of 7A (100 mg, 0.16 mmol) in THF (2 mL) was added 2,5-difluorobenzylamine (610 mg, 4.3 mmol) and the reaction mixture was refluxed 6 hours. The reaction mixture was diluted with EtOAc and washed with water (4x), brine, and dried (MgSO4). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH2Cl2) to give the amine as a white solid (110 mg, 93%). To a solution of the free base (110 mg, 0.15 mmol) in ether (25 mL) was added 4N HCl in dioxane (0.05 mL, 0.20 mmol). After stirring for 10 minutes the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give the hydrochloride 9 salt as a white solid (76 mg, 66%): CIMS (NH3) m / z: 715 (M + H +, 100%).

Example 10 To a solution of 7A (100 mg, 0.16 mmol) in THF (2 mL) was added 2,6-difluorobenzylamine (600 mg, 4.2 mmol) and the reaction mixture was refluxed 6 hours. The reaction mixture was diluted with EtOAc and washed with water (4x), brine, and dried (MgSO). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH2Cl2) to give the amine as a white solid (103 mg, 87%). To a solution of the free base (103 mg, 0.14 mmol) in ether (25 mL) was added 4N HCl in dioxane (0.05 mL, 0.20 mmol). After stirring for 10 minutes the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give the hydrochloride salt 10 as a white solid (82 mg, 76%): CIMS (NH3) m / z: 715 (M + H +, 100%).

Example 11 11 To a solution of N- [2R-hydroxy-3- [[(1,3-benzodioxol-5-yl) sulfonyl] (22-methylpropyl) amino] -IS- (phenylmethyl) propyl] -2S- [(chloroacetyl ) amino] -3,3-dimethylbutanamide HA (750 mg, 1.23 mmol) in THF (2 mL) was added 3-fluorobenzylamine (1.1 g, 8.8 mmol) and the reaction mixture was stirred overnight. The reaction mixture was diluted with EtOAc and washed with water (4x), brine, and dried (MgSO). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH2Cl2) to give the amine as a white solid (532 mg, 62%). To a solution of the free base (532 mg, 0.76 mmol) in ether (100 mL) was added 4N HCl in dioxane (0.22 mL, 0.88 mmol). After stirring for 10 minutes the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give the hydrochloride salt 11 as a white solid (417 mg, 75%): CIMS (NH3) m / z: 699 (M + H +, 100%).

Example 12 To a solution of HA (2.0 g, 3.27 mmol) in THF (7 mL) was added 3,5-difluorobenzylamine (2.42 g, 16.9 mmol) and the reaction mixture was refluxed 5 hours. The reaction mixture was diluted with EtOAc and washed with water (4x), brine, and dried (MgSO4). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH2Cl2) to give the amine as a white solid (2.26 mg, 97%). To a solution of the free base (1.8 g, 2.51 mmol) in ether (100 mL) was added 4N HCl in dioxane (0.66 mL, 2.67 mmol). After stirring for 10 minutes the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give the benzylamine salt 12 as a white solid (1.65 g, 87%): CIMS (NH3) m / z: 717 (M + H +, 100%). Analysis (C36H47N407S? F2Cl?): Calculated: C, 57.40; H, 6.17; N, 7.45. Found: C, 57.25; H, 6.25; N, 7.24.

Example 13 13 To a solution of HA (750 mg, 1.23 mmol) in THF (2 mL) was added 2,5-difluorobenzylamine (1.2 g, 8.5 mmol) and the reaction mixture was refluxed for 6 hours. The reaction mixture was diluted with EtOAc and washed with water (4x), brine, and dried (MgSO4). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH2Cl2) to give the amine as a white solid (702 mg, 80%). To a solution of the free base (702 mg, 0.98 mmol) in ether (25 L) was added 4N HCl in dioxane (0.3 mL, 1.2 mmol). After stirring for 10 minutes the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give the hydrochloride 13 salt as a white solid (586 mg, 79%): CIMS (NH3) m / z: 717 (M + H +, 100%).

Example 14 14 To a solution of HA (750 mg, 1.23 mmol) in THF (2 mL) was added 2,6-difluorobenzylamine (1.2 g, 8.3 mmol) and the reaction mixture was refluxed 6 hours. The reaction mixture was diluted with EtOAc and washed with water (4x), brine, and dried (MgSO4). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH2Cl2) to give the amine as a white solid (717 mg, 81%). To a solution of the free base (717 mg, 1.00 mmol) in ether (100 mL) was added 4N HCl in dioxane (0.3 mL, 1.2 mmol). After stirring for 10 minutes the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give the hydrochloride salt 14 as a white solid (663 mg, 88%): CIMS (NH3) m / z: 717 (M + H +, 100%).

Example 15 To a solution of HA (750 mg, 1.23 mmol) in THF (2 mL) was added 3,4-difluorobenzylamine (1.2 g, 8.3 mmol) and the reaction mixture was refluxed 3 hours. The reaction mixture was diluted with EtOAc and washed with water (4x), brine, and dried (MgSO). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH2Cl2) to give the amine as a white solid (760 mg, 86%). To a solution of the free base (760 mg, 1.06 mmol) in ether (100 mL) was added 4N HCl in dioxane (0.3 mL, 1.2 mmol). After stirring for 10 minutes the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give the hydrochloride salt 15 as a white solid (730 mg, 91%): CIMS (NH3) m / z: 717 (M + H +, 100%).

Example 16 To a solution of HA (750 mg, 1.23 mmol) in THF (2 mL) was added 2,4-difluorobenzylamine (1.2 g, 8.3 mmol) and the reaction mixture was refluxed 6 hours. The reaction mixture was diluted with EtOAc and washed with water (4x), brine, and dried (MgSO4). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH2Cl2) to give the amine as a white solid (693 mg, 79%). To a solution of the free base (693 mg, 0.97 mmol) in ether (100 mL) was added 4N HCl in dioxane (0.3 mL, 1.2 mmol). After stirring for 10 minutes the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give the hydrochloride salt 16 as a white solid (638 mg, 91%): CIMS (NH3) m / z: 717 (M + H +, 100%).

Example 17 • HCl 17 To a solution of HA (500 mg, 0.82 mmol) in THF (2 mL) was added 4-fluorobenzylamine (1.0 g, 8.0 mmol) and the reaction mixture was stirred overnight. The reaction mixture was diluted with EtOAc and washed with water (4x), brine, and dried (MgSO). The solvent was removed under reduced pressure and the residue was chromatographed (silica gel, 5% methanol / CH2Cl2) to give the amine as a white solid (470 mg, 82%). To a solution of the free base (400 mg, 0.57 mmol) in ether (30 mL) was added 4N HCl in dioxane (0.18 mL, 0.7 mmol). After stirring for 15 minutes the solvent was removed under reduced pressure and the resulting solid was triturated with ether and filtered to give the hydrochloride salt 17 as a white solid (413 mg, 98%): CIMS (NH3 ') m / z: 699 (M + H +, 100%).

Utility The compounds of the formula I possess inhibitory activity of HIV protease and are therefore useful as antiviral agents for the treatment of HIV infection and associated diseases. The compounds of Formula I possess inhibitory activity of HIV protease and are effective as inhibitors of HIV development. The ability of the compounds of the present invention to inhibit viral development is demonstrated by standard tests of development or viral infection capacity, for example using the assay described below. The compounds of the formula I of the present invention are also useful for the inhibition of HIV in an ex vivo sample that contains HIV or is expected to be exposed to HIV. Thus, the compounds of the present invention can be used to inhibit HIV present in a body fluid sample (eg, serum or semen sample) containing or suspected to contain or be exposed to HIV. The compounds provided by the present invention are also useful as standard or reference compounds for use in tests or assays for the determination of the ability of an agent to inhibit the replication of viral clones and / or HIV protease, for example in a program of pharmaceutical research. Therefore, the compounds of the present invention can be used as control or reference compounds in such assays and as a quality control standard. The compounds of the present invention can be provided in a commercial kit or container for use as such standard or reference compound. Since the compounds of the present invention of the present invention exhibit specificity for HIV protease, the compounds of the present invention may also be useful as diagnostic reagents in diagnostic assays for the detection of HIV protease. Therefore, the inhibition of protease activity in an assay (such as the assays described herein) by a compound of the present invention could be indicative of the presence of HIV protease and HIV virus. As used herein, "μg" denotes migrogram, "mg" denotes milligram, "g" denotes gram "μl" denotes microliters, "mL" denotes milliliter, "L" denotes liter, "nM" denotes nanomolar, "μM" denotes micromolar, "mM" denotes millimolar, "M" denotes molar and "nm" denotes nanometer. "Sigma" refers to the Sigma-Aldrich Corp. of San Luis, MO.

HIV RNA Assay DNA plasmids and RNA transcriptionists in vitro: Plasmid pDAB 72 containing both gag and pol sequences of BH10 (bp 113-1816) cloned in PTZ 19R was prepared according to Erickson-Viitanen et al., AIDS Research and Human Retroviruses (1989), 5, 577. The plasmid was linearized with Bam Hl before in vitro generation of RNA transcribers using the Riboprobe Gemini II system (Promega) with T7 RNA polymerase. The synthesized RNA was purified by treatment-with RNAse-free DNA (Promega), phenol-chloroform extraction, and ethanol precipitation. The RNA transcribers were dissolved in water, and stored at -70 ° C. The concentration of RNA was determined from A260.

Test Compounds: Biotinylated capture test compounds were purified by HPLC after synthesis by the addition of biotin to the 5 'terminus of the oligonucleotide, using the biotin-phosphoramidite reagent from Cocuzza, Tet. Lett. 1989, 30, 6287. The biotinylated capture test compound gag (5-biotin-CTAGCTCCCTGCTTGCCCATACTA 3 ') was complementary to nucleotides 889-912 of HXB2 and the biotinylated capture test compound pol (5'-biotin-CCCTATCATTTTTGGTTTCCAT 3 ') was complementary to nucleotides 2374-2395 of HXB2. The conjugated alkaline phosphatase oligonucleotides used as report test compounds were prepared by Syngene (San Diego, CA.). The pol test report compound (5 'CTGTCTTACTTTGATAAAACCTC 3") was complementary to nucleotides 950-973 of HXB2 All positions of the nucleotides are those of GenBank Genetic Sequence Data Bank (Genbank Gene Sequence Data Bank) with access through Genetic Computer Group Sequence Analysis Software Package (Package of Computer Programs of Sequence Analysis of Computation Group for Genetics) (Devereau Nuclei c Acids Research 1984, 12, 387). The report test compounds were prepared as stores of 0.5 μM in 2 x SSC (0.3 M NaCl, 0.03 M sodium citrate), 0.05 M Tris pH 8.8, 1 mg / mL BSA. The biotinylated capture test compounds were prepared as 100 μM stores in water.

Streptavidin-coated plates: Streptavidin-coated plates were obtained from Du Pont Biotechnology Systems (Boston, MA).

Provisions of Cells and Viruses: MT-2 and MT-4 cells were maintained in RPMI 1640 supplemented with 5% calf fetus serum (FCS) for MT-2 cells or 10% FCS for MT-4 cells, 2 mM of L-glutamine and 50 μg / mL of gentamicin, all from Gibco. HIV-1 RF spread in MT-4 cells in the same medium. Virus stores were prepared approximately 10 days after acute infection of MT-4 cells and stored as aliquots at -70 ° C. Infectious titers of HIV (RF) stores were 1-3 x 107 PFU (platelet formation units) / mL measured by the platelet assay in MT-2 cells (see below). Each aliquot of virus supply used for the infection melted only once. For the evaluation of antiviral efficiency, the cells to be infected were subcultured one day before infection. On the day of infection, the cells were resuspended at 5 x 10 5 cells / mL in RPMI 1640, 5% FCS for mass infections or at 2 x 106 / mL in the modified medium of Dulbecco's Eagles with 5% FCS. for infection in microtiter plates. Virus was added and the culture was continued for 3 days at 37 ° C. ...

HIV RNA assay: Lysates from cells or RNA purified in 3 M or 5 M GED were mixed with 5 M GED and with the capture test compound at a final concentration of 3 M guanidinium isocyanate and a final concentration of oligonucleotide Biotin 30 nM. Hybridization was carried out in a 96-well culture plate of sealed U-bottom tissues (Nunc or Costar) for 16-20 hours at 37 ° C. Hybridization reactions were diluted three times with deionized water to a final concentration of 1 M guanidinium isothiocyanate and aliquots (150 μL) were transferred to streptavidin-coated microtiter plate wells. The binding of the capture test compound and the capture test RNA hybrid with the streptavidin immobilized at room temperature was allowed to proceed for two hours, after which the plates were washed 6 times with buffer solution for washing ELISA plates. DuPont (saline solution buffered with phosphates (PBS), 0.05% Tween 20). A second hybridization of the report test compound to the immobilized complex of the capture test compound and of the target RNA hybridized in the streptavidin-coated culture well washed by the addition of 120 μl of a hybridization cocktail containing 4 X SSC was carried out., Triton X 100 at 0.66%, deionized formamide at 6.66%, 1 mg / mL of BSA and 5 nM of test report compound. After annealing for one hour at 37 ° C, the plate was washed again 6 times. The activity of the immobilized alkaline phosphatase was detected by the addition of 100 μL of 4-methylunbelliferyl phosphate (MUBP, JBL Scientific) 0.2 mM in buffer solution d (2.5 M diethanolamine pH 8.9 (JBL Scientific), 10 mM MgCl2, zinc acetate 5 mM dihydrate and 5 mM N-hydroxyethyl-ethylene diamine triacetic acid). The plates were incubated at 37 ° C. Fluorescence was measured at 450 nM using a microplate fluorometer (Dynateck) with excitation at 365 nM.

Evaluation of the microplate-based compound in MT-2 cells infected with HIV-1 The compounds to be evaluated were dissolved in DMSO and diluted in a culture medium at twice the highest concentration to be tested and at a maximum concentration of DMSO of 2% . Triple serial dilutions of the compound in the culture medium were made directly on microtiter plates with U-bottom (Nunc). After dilution of the compound, MT-2 cells (50 μL) were added to a final concentration of 5 × 10 5 per mL (1 × 10 5 per well). The cells were incubated with the compounds for 30 minutes at 37 ° C in a C02 incubator. For the evaluation of a stock of HIV-1 (RF) virus (50 μL) with an appropriate dilution was added to the culture wells containing cells and dilutions of the test compounds. The final volume in each well was 200 μL. Eight wells per plate were left uninfected with 50 μL of the added medium in place of the virus, while eight wells were infected in the absence of any antiviral compound. For the evaluation of the compound's toxicity, plaques were grown in parallel without virus infection.

After three days of culture at 37 ° C in a humidifying chamber inside a C02 incubator, all except 25 μL of medium / well were removed from the HIV infected plates. 37 μL of 5 M GED containing biotinylated capture test compound was added to the pelleted cells and to the remaining medium in each well at a final concentration of 3 M GED and 30 nM capture test compound. Hybridization of the capture test compound for HIV RNA in the cell lysate was carried out in the same microplate well used for virus culture by sealing the plate with plate sealer (Costar), and incubating for 16-20 hours in an incubator at 37 ° C. Distilled water was then added to each well to dilute the hybridization reaction three times and 150 μL of this diluted mixture was transferred to a microtiter plate coated with streptavidin. HIV RNA was quantified as described above. A standard curve was run, prepared by the addition of known amounts of RNA transcriber pDAB 72 in vi tro to the wells containing uninfected cells used, in each microtiter plate in order to determine the amount of viral RNA made during the infection. In order to standardize the virus inoculum used in the evaluation of compounds for antiviral activity, dilutions of virus were selected which resulted in an IC90 value (concentration of the compound required to reduce the level of HIV RNA by 90% for dideoxycytidine (ddC) of 0.2 μg / mL, the IC90 values of other antiviral compounds, both more and less potent than the ddC, were reproducible using several HIV-1 (RF) stores when this procedure was followed. at approximately 3 x 10 5 PFU (measured by platelet assay in MT-2 cells) per test well and typically produced approximately 75% of the maximum level of viral RNA that is obtained in any virus inoculum. , the IC90 values were determined from the percent reduction of the net signal (signal from the infected cell samples minus the signal from the uninfected cell samples) in the RNA assay in relation to the net signal of untreated infected cells in the same culture plate (average of eight plates). The valid behavior of the individual infection and the RNA assay tests was judged according to three criteria. The virus infection was required to result in an RNA test signal equal to or greater than the signal generated from 2 ng of RNA transcriber pDAB 72 in vitro. The IC90 for ddC, determined in each test run, should be between 0.1 and 0.3 μg / mL. Finally, the level of the viral RNA plateau produced by an effective protease inhibitor should be less than 10% of the level reached in an uninhibited infection. A compound was considered active if its IC90 was found to be less than 1μM. For the antiviral potency tests, all manipulations in the microtiter plates, following the initial addition of the 2X concentrated solution to a single row of wells, were performed using a ProPette Perkin Elmer / Cetus pipette.

Dosage and Formulation The antiviral compounds of the present invention can be administered as a treatment for viral infections by any means that produces contact of the active agent with the site of action of the agent, i.e., the viral protease, in the body of a mammal. They can be administered by any conventional means available for use in conjunction with pharmaceuticals, either as individual therapeutic agents or in a combination of therapeutic agents. They can be administered alone, but are preferably administered with a pharmaceutical carrier selected on the basis of the route chosen for administration and standard pharmaceutical practice.

Of course, the dose administered will depend on known factors, such as the pharmacodynamic characteristics of the particular agent and its mode and route of administration; the age, health and weight of the recipient; the nature and degree of the symptoms; the type of concurrent treatment; the frequency of treatment; and the desired effect. A daily dose of the active ingredient can be expected to be from about 0.001 to about 1000 milligrams per kilogram of body weight, with the preferred dose being about 0.1 to about 30 mg / kg. The dosage forms of the compositions suitable for administration contain about 1 mg about 100 mg of the active ingredient per unit. In these pharmaceutical compositions normally the active ingredient will be present in an amount of about 0.5-95% by weight based on the total weight of the composition. The active ingredient can be administered orally in solid dosage forms, such as capsules, tablets and powders, or in liquid dosage forms, such as elixirs, syrups and suspensions. They can also be administered parenterally, in liquid dosage form. Gelatin capsules contain the active ingredient and powder carriers, such as lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like. Similar diluents can be used to make compressed tablets. Both the tablets and the capsules can be manufactured as sustained release products to provide for the continuous release of the drug over a period of hours. Compressed tablets may be sugar coated or film coated to hide any unpleasant taste and protect the tablet from the atmosphere, or enteric coated for selective disintegration in the gastrointestinal tract. Liquid dosage forms for oral administration may contain colorants and flavors to increase patient acceptance. In general, suitable carriers for parenteral solutions are water, an appropriate oil, saline, aqueous dextrose (glucose), and related sugar solutions and glycols such as propylene glycol or polyethylene glycol. Solutions for parenteral administration preferably contain a water soluble salt of the active ingredient, suitable stabilizing agents, and if necessary, buffering substances. Suitable stabilizing agents are also antioxidant agents such as sodium bisulfite, sodium sulfite, or ascorbic acid, alone or in combination. Citric acid and its salts are also used, and sodium EDTA. In addition, parenteral solutions may contain preservatives, such as benzalkonium chloride, methyl or propyl paraben and chlorobutanol. Suitable pharmaceutical carriers are described in Remington's Pharmaceutical Sciences, supra (Remington Pharmaceutical Sciences, supra), a standard text of reference in this field. The pharmaceutical dosage forms useful for the administration of the compounds of the present invention can be illustrated as follows: Capsules A large number of capsule units can be prepared by filling standard hard gelatin capsules of two pieces each with 100 mg of the active ingredient in powder, 150 mg of lactose, 50 mg of cellulose, and 6 mg of stearic magnesium.

Soft Gelatin Capsules A mixture of the active ingredient can be prepared in a digestible oil such as soybean oil, cottonseed oil or olive oil and injected by means of a positive displacement pump into the gelatin to form the capsules of soft gelatin containing 100 mg of the active agent. The capsules should then be washed and dried.

Tablets A large number of tablets can be prepared by conventional procedures such that the dosage unit is 100 mg of active people, 0.2 mg of colloidal silicon dioxide, 5 milligrams of magnesium stearate, 275 mg of microcrystalline cellulose. , 11 mg of starch and 98.8 mg of lactose. Appropriate coatings may be applied to increase palatability or delay of absorption.

Suspension An aqueous suspension can be prepared for oral administration in such a way that each 5 mL contains 25 mg of the finely divided active ingredient, 200 mg of sodium carboxymethyl cellulose, 5 mg of magnesium benzoate, 1. 0 g of sorbitol solution, U. S. P., and 0.025 mg of vanillin.

Injectable A parenteral composition suitable for administration by injection may be prepared by stirring 1.5% by weight of the active ingredient in 10% by volume of propylene glycol and water. The solution is sterilized by commonly used techniques.

Combination of components (a) and (b) Each therapeutic agent component of the present invention can be independently in any dosage form, such as those described above, and can also be administered in various ways, as described above. In the following description it will be understood that component (b) represents one or more of the previously described agents. Therefore, if components (a) and (b) are to be treated equally or independently, each agent of component (b) can be treated equally or independently. Components (a) and (b) of the present invention can be formulated together, in a single dosage unit (i.e., combined together in a capsule, tablet, powder, or liquid, etc.) as a combined product. When component (a) and (b) are not formulated together in a single dosage unit, component (a) can be administered at the same time as component (b) or in any order; for example (a) of the present invention can be administered first, followed by the administration of component (b), or they can be administered in the reverse order. If component (b) contains more than one agent, for example, a TR inhibitor and a protease inhibitor, these agents can be administered together or in any order. When not administered at the same time, preferably the administration of component (a) and (b) takes place in less than about an hour apart. Preferably, the route of administration of component (a) and (b) is oral. The terms oral agent, oral inhibitor, oral compound, or the like, as used herein, denote compounds that can be administered orally. Although it is preferred that component (a) and component (b) are both administered by the same route (i.e., for example, both orally) or dosage form, if desired, they can each be administered by different routes (ie, for example, one component of the combined product can be administered orally, and another component can be administered intravenously) or dosage forms. As appreciated by a medical practitioner skilled in the art, the dosage of the combination therapy of the invention may vary depending on several factors such as the pharmacodynamic characteristics of the particular agent and its mode and route of administration, the age, health and weight of the agent. recipient, the nature and degree of symptoms, the type of concurrent treatment, the frequency of treatment, and the desired effect, as described above.

The appropriate dosage of components (a) and (b) of the present invention will be readily ascertainable by the practitioner skilled in the art, based on the present disclosure. As a general guide, typically a daily dose can be from about 100 milligrams to about 1.5 grams of each component. If component (b) represents more than one component, then typically the daily dose may be from about 100 milligrams to about 1.5 grams of each agent of component (b). As a general guide, when the compounds of component (a) and component (b) are administered in combination, the amount of the dose of each component can be reduced by about 70-80% relative to the usual dosage of the component when administered alone as a simple agent for the treatment of HIV infection, in view of the synergistic effect of the combination. The combined products of the present invention can be formulated in such a way that, although the active agents are combined in a single dosage unit, the physical contact between the active ingredients is minimized. In order to minimize contact, for example, when the product is administered orally, an active ingredient may be enterically coated. By the enteric coating of one of the active agents, it is possible not only to minimize the contact between the combined active ingredients, but also, it is possible to control the release of one of these components in the gastrointestinal tract in such a way that one of these components does not It is released in the stomach but instead is released into the intestines. Another embodiment of the present invention when oral administration is desired provides a combination product in which one of the active agents is coated with a sustained release material which effect a sustained release through the gastrointestinal tract and also serves to minimize the physical contact between the combined active ingredients. In addition, the sustained release component can be additionally enteric coated such that the release of this component occurs only in the intestine. Still another criterion could involve the formulation of a combined product in which one component is coated with a sustained release and / or enteric polymer, and the other component is also coated with a polymer such as hydroxypropyl methylcellulose of low viscosity grade or other appropriate materials as are known in the art, in order to further separate the components. The polymeric coating serves to form an additional barrier of interaction with the other component. In each formulation where contact between components (a) and (b) is avoided via a coating or some other material, contact can also be avoided between the individual agents of component (b). Dosage forms of the combination products of the present invention wherein an active ingredient is enterically coated may be in the form of tablets such that the enterically coated component and the other active ingredient are combined with each other and subsequently they compress in a tablet or in such a way that the enterically coated component is compressed in one layer of the tablet and the other active ingredient is compressed as an additional layer. Optionally, in order to further separate the two layers, one or more placebo layers may be present in such a way that the placebo layer is between the layers of the active ingredients. In addition, the dosage forms of the present invention can be in the form of capsules in which an active ingredient is compressed into a tablet or in the form of numerous microtablets, particles, granules or non-hazardous, which are coated enterically. These microtablets, particles, granules or non-dangerous ones are subsequently placed in a capsule or tablets in a capsule together with a granulate of the other active ingredient. These, as well as other ways of minimizing contact between the combined product components of the present invention, whether administered in a single dosage form or that are administered in separate forms but at the same time or concurrently in the same manner, may be appreciated by those skilled in the art, based on the present disclosure. Pharmaceutical kits useful for the treatment of HIV infection, comprising a therapeutically effective amount of a pharmaceutical composition comprising a compound of component (a) and one or more compounds of component (b), in one or more sterile containers, they are also within the scope of the present invention. The sterilization of the container can be carried out using conventional sterilization methodologies well known to those skilled in the art. Component (a) and component (b) can be in the same sterile container or in separate sterile containers. Sterile containers of materials may comprise separate containers, or one or more containers of multiple parts, as desired. Component (a) and component (b) may be separated, or physically combined in a single form or dosage unit as described above. Such kits may additionally, if desired, include one or more of several conventional pharmaceutical kit components, such as, for example, one or more pharmaceutically acceptable carriers, additional bottles for the mixing of the components, etc., as those experts will appreciate. in the technique. Can also be included in the kit, instructions, either as inserts or as labels, indicating quantities of components that will be administered, guides for administration, and / or guides for the mixing of the components. Obviously, numerous modifications and variations of the present invention are possible in light of the above teachings. Therefore, it should be understood that within the scope of the appended claims, the invention may be practiced in a manner different from that specifically described herein. It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention.

Claims (24)

1. CLAIMS Having described the invention as above, the content of the following claims is claimed as property: 1. A compound of Formula I: or one of its pharmaceutically acceptable salt forms, characterized in that. R1 is F; R2 is F or H; and R3 is selected from the group: 4-aminophenyl, 3-aminophenyl, 2,3-dihydrobenzofuran-5-yl, and 1,3-benzodioxol-5-yl.
2. 2. A compound according to Claim 1, characterized in that the compound is of Formula II: II
3. 3. A compound in accordance with Claim 2, characterized in that the compound is of Formula Ha: He has,
4. 4. A compound according to claim 3, characterized in that: R3 is 3-aminophenyl.
5. 5. A compound according to claim 3, characterized in that: R is 4-aminophenyl,
6. 6. A compound according to claim 3, characterized in that: R3 is 2,3-dihydrobenzofuran-5-yl or 1,3-benzodioxol-5-yl.
7. 7. A compound of. according to Claim 2, characterized in that the compound is of Formula IIb: Ilb.
8. 8. A compound according to claim 7, characterized in that: R3 is 3-aminophenyl.
9. 9. A compound according to claim 7, characterized in that: R3 is 4-aminophenyl.
10. 10. A compound according to claim 7, characterized in that: R3 is 2,3-dihydrobenzofuran-5-ylo-- o-1,3-benzodioxol-5-yl.
11. 11. A compound according to Claim 2, characterized in that the compound is from Formula He: lie,
12. 12. A compound according to Claim 11, characterized in that: R3 is 3-aminophenyl.
13. 13. A compound according to Claim 11, characterized in that: R3 is 4-aminophenyl.
14. 14. A compound in accordance with Claim 11, characterized in that: R3 is 2,3-dihydrobenzofuran-5-yl or 1,3-benzodioxol-5-yl.
15. 15. A compound according to Claim 1, characterized in that the compound is of Formula III: III.
16. 16. A compound according to Claim 15, characterized in that the compound is of the Formula Illa: Illa.
17. 17. A compound according to Claim 1, characterized in that the compound is of Formula IV: IV.
18. 18. A compound in accordance with Claim 17, characterized in that the compound is of Formula IVa: VAT
19. 19. A pharmaceutical composition characterized in that it comprises: a pharmaceutically acceptable carrier and a therapeutically effective amount of a compound according to one of Claims 1-19.
20. 20. A method for the treatment of HIV infection, characterized in that it comprises: administration to a host in need of such treatment, a therapeutically effective amount of a compound according to one of Claims 1-19, or a pharmaceutically acceptable salt thereof .
21. 21. A method for the treatment of HIV infection characterized in that it comprises administering, in combination, to a host in need of such treatment, a therapeutically effective amount of: (a) a compound in accordance with one of the Claims 1-19 or stereoisomeric forms, mixtures of stereoisomeric forms, or their pharmaceutically acceptable salts; and, (b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors.
22. 22. A method according to claim 21, characterized in that the reverse transcriptase inhibitor is selected from the group AZT, ddC, ddI, d4T, 3TC, delavirdine, efavirenz, nevirapine, Ro 18,893, trovirdine, MKC-442, HBY 097, ACT, UC-781, UC-782, RD4-2025, and MEN 10979, and the protease inhibitor is selected from the group of saquinavir, ritonavir, indinavir, amprenavir, nelfinavir, palinavir, BMS-232623, GS3333, KNI-413, KNI-272, LG-71350, CGP-61755, PD 173606, PD 177298, PD 178390, PD 178392, U-140690, and ABT-378.
23. 23. A method according to Claim 22, characterized in that the reverse transcriptase inhibitor is selected from the group of AZT, efavirenz, and 3TC and the protease inhibitor is selected from the group of saquinavir, ritonavir, nelfanavir, and indinavir.
24. 24. A method according to claim 21, characterized in that the compound (b) is ritonavir. SUBSTITUTED N-TERMINAL AS PROTEASA INHIBITORS OF HUMAN IMMUNODEFICIENCY VIRUS (HIV) SUMMARY OF THE INVENTION In general the present invention relates to bis-a-n-acid sulfonamides containing substituted benzyl amines of the formula (I) or stereoisomeric forms, stereoisomeric mixtures, or their pharmaceutically acceptable salts, which are useful as protease inhibitors. of HIV, pharmaceutical compositions, and diagnostic kits comprising the same, methods for using same for the treatment of viral infection or standards or assay reagents, and intermediates and processes for the preparation thereof.