SK59599A3 - (4r,5s,6s,7r)-hexahydro-1-[5-(3-aminoinazole)methyl]-3-butyl- -5,6-dihydroxy-4,7-bis [phaenylmethyl]-2h-1,3-diazepin-2-one, its preparation and its use as hiv protease inhibitor - Google Patents

Abstract

The present invention relates to compounds of formula (I) or pharmaceutically acceptable salt forms or prodrugs thereof, which are useful as inhibitors of HIV protease, and to pharmaceutical compositions and diagnostic kits comprising the same, and methods of using the same for treating viral infection or as an assay standard or reagent.

Description

Technical field

The present invention relates generally to 1- (3-aminoindazol-5-yl) 3-butyl-cyclic urea which is useful as an HIV protease inhibitor, to pharmaceutical compositions and diagnostic kits containing them, and to methods of using them for the treatment of a viral infection or as a test standard or reagent.

BACKGROUND OF THE INVENTION

Two different retroviruses, human deficiency virus (HIV), type 1 (HIV-1). or HIV-2 (HIV-2-ol) is severely associated with immunosuppressive disease, acquired immune deficiency syndrome (AIDS). HIV seropositive individuals are initially asymptomatic but typically develop AIDS-related complex (ARC), followed by AIDS, affected individuals show a number of immunosuppressions that predispose them to attenuation and ultimately to fatal occasional infections.

AIDS is the ultimate consequence of HIV-1 or HIV-2 viruses that follow their own life cycle. The virion life cycle begins with a virion attack on the host human T-4 lymphocyte immune cell via binding of the glycoprotein to the surface of the virion CD4 glycoprotein protective coating on the lymphocyte cell. Upon attachment, the virion loses its glycoprotein coating, penetrates the host cell membrane and does not envelop its RNA. The virion enzyme, reverse transcriptase, directs the process of transcribing RNA into single-stranded DNA. The viral DNA is cleaved to form a second strand of DNA. It is now double-chain

DNA integrated into human cell genes and these genes are used to reproduce cells.

In this regard, the human cell carries out its reproductive process using its own RNA polymerase to transcribe integrated DNA into viral RNA. The viral RNA is translated into the precursor of the gag-pol fusion polyprotein. Then, the polyprotein is cleaved by the HIV protease enzyme to yield mature viral proteins. The HIV protease is thus responsible for regulating a cascade of cleavage steps that lead to the maturation of the viral particles to a virus capable of complete infectivity.

Too typical for the response of the human immune system, killing invalid virions, is too much of a requirement because a large part of the life cycle is spent in a latent state in the immune cell. Furthermore, the viral reverse transcriptase, the enzyme used, is particularly specific, and causes transcription errors that result in continuously altered glycoproteins. on the surface of the viral protective sheath. This lack of specificity reduces the efficacy of the immune system, since antibodies specifically produced against one glycoprotein may be useless against others, thereby reducing the number of antibodies capable of competing with the virus. The virus continues to reproduce while the immune response system continues to weaken. HIV largely controls the body's immune system, allowing occasional infections to be detected, and death can occur without administration of antiviral agents, immunomodulators, or both.

There are at least three critical points in the viral life cycle that have been identified as possible targets for antiviral drugs: (1) initial attachment of virion to T-4 lymphocyte or macrophage site, (2) transcription of viral RNA to viral DNA (reverse transcriptase, RT) , and (3) complexing of the new viral particle during reproduction (e.g., HIV aspartic protease or HIV protease).

Retrovirus genomes encode a protease that is responsible for the proteolytic processing of one or more polyprotein precursors, such as the pol and gag gene products. See Wellink, Arch. Virol. 98 (1988). Retroviral proteases most commonly process gag precursor into proteins, and also process half precursor into reverse transcriptase and retroviral protease.

Proper processing of polyprotein precursors with a retroviral protease is essential for testing infectious virions. In vitro mutagenesis, which produces a defective protease virus, has been found to result in the production of immature nuclei that lack infectivity. See Crawford et al., J. Virol. 53,899 (1985); Katoh et al., Virolocrv 145 280 (1985). Thus, inhibition of retroviral infection provides attractive

A target for prptiviral therapy is described in U.S. Pat. No. 775 (1987).

The ability to inhibit viral protease provides a method of blocking viral replication and hence the treatment of viral diseases such as AIDS, which may have feverish side effects, greater activity, and less susceptibility to drug resistance, as compared to conventional treatments. As a result, three HIV inhibitors are currently being marketed,

Roche saquinavir, Abbott ritonavir, and Merck indinayir, and a number of potential protease inhibitors such as VX-478 from Vertex, nelfinavir from Agouron, KNI-272 Japan Energy, and CGP 61755 from Ciba are clinically tested. Geigy.

A wide variety of compounds have been studied as potential HIV protease inhibitors, as evidenced by currently marketed protease inhibitors and clinical trials. Significant attention is paid to mononuclear, cyclic urea. For example, in PCT patent applications WO94 / 19329 and WO 93/07128, Lam et al. general cyclic ureas of formula:

and methods for preparing such ureas. Although the present compounds are within the scope of the description of Lama et al., They are not specifically described therein.

Other cyclic ureas are described in Lam et al. Med. Chem. 1996, 39, 3514-3522. Although a series of cyclic ureas are described in this publication, there are no disclosed compounds containing indazolomethyl.

. At the same time, the success of inhibitors of toroVraPX is acephalalase in HIV patients may become resistant to a single protease inhibitor. Therefore, it is appropriate to develop further protease inhibitors to further combat HIV infection.

SUMMARY OF THE INVENTION

One object of the present invention is to provide novel protease inhibitors.

It is a further object of the present invention to provide pharmaceutical compositions having protease inhibitory activity comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of at least one of the compounds of the present invention or a pharmaceutically acceptable salt or prodrug form thereof.

It is a further object of the present invention to provide a novel method of treating HIV infection comprising administering to a host in need of such treatment a therapeutically effective amount of at least one of the compounds of the present invention or a pharmaceutically acceptable salt or prodrug form thereof.

It is another object of the present invention to provide a novel method of treating HIV infection which comprises administering to a host in need thereof a therapeutically effective combination of (a) one of the compounds of the present invention and (b) one or more compounds selected from the group consisting of HIV reverse inhibitors transcriptase and HIV protease inhibitors.

It is a further object of the present invention to provide a method of inhibiting HIV present in a body fluid sample, comprising treating a body fluid sample with an effective amount of a compound of the present invention.

A further object of the present invention provides that the kifc or account extends to at least one of the ripples of the present invention in an amount effective for use as a standard. or a reagent in an assay or assay to determine the ability of a possible pharmaceutical to inhibit HIV protease, HIV growth, or both.

These and other objects, which will be explained in the following detailed description, have been achieved by the inventor's discovery that the compounds of formula I:

or pharmaceutically acceptable salts or prodrug forms thereof, are potent protease inhibitors.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

The present invention therefore provides, in a first embodiment, a novel compound of formula I:

or a pharmaceutically acceptable salt or prodrug form thereof.

In a second embodiment, the present invention provides a novel pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of a pharmaceutically acceptable salt or prodrug form thereof.

In a third embodiment, the present invention provides a novel method of treating HIV infection, comprising administering to a host in need of such treatment a therapeutically effective amount of a compound of Formula I or a pharmaceutically acceptable salt or prodrug form thereof.

In a fourth embodiment, the present invention provides a new method of treating HIV infection, comprising administering, in combination, to a host in need of such treatment a therapeutically effective amount:

(a) a compound of formula I, and (b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors.

In another preferred embodiment, the reverse transcriptase inhibitor is a nucleoside reverse transcriptase inhibitor.

In yet another preferred embodiment, the nucleoside reverse transcriptase inhibitor is selected from AZT, 3TC, dd1, ddC, and d4t, and the protease inhibitor is selected from saquinavir, ritonavir, indinavir, VX-478, nelfinavir, KNI-272, CGP61755 and U-103017.

In a most preferred embodiment, the nucleoside reverse transcriptase inhibitor is selected from AZT and 3TC and the protease inhibitor is selected from saquinavir, ritonavir and indinavir.

In yet another preferred embodiment, the nucleoside reverse transcriptase inhibitor is AZT.

In yet another preferred embodiment, the protease inhibitor is indinavir.

In a fifth treatment, the present invention provides a therapeutic kit suitable for the treatment of HIV infection, comprising a therapeutically effective amount:

(a) a compound of formula I, and (b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors, in one or more sterile containers.

In a sixth embodiment, the present invention provides a novel method of inhibiting HIV present in a body fluid sample, comprising treating a body fluid sample with an effective amount of a compound of formula (I)

In a seventh embodiment, the present invention provides a new kit or container comprising a compound of formula (I) or (II) in an amount effective for use as a standard or reagent in an assay or assay to determine the ability of a potential pharmaceutical to inhibit HIV protease, HIV growth, or both.

definitions

The following terms and expressions as used herein have the meanings indicated. It will be appreciated that the compounds of the present invention contain an asymmetrically substituted carbon atom, and may be isolated in optically active or racemic forms. It is well known in the art how to prepare optically active forms, such as e.g. resolution of racemic forms, or synthesis, from optically active starting materials. All chiral, diastereomeric, racemic forms and all geometric isomeric forms of the structure are possible, unless specific stereochemistry or isomeric form is specifically indicated.

As used herein, an HIV reverse transcriptase inhibitor refers to both nucleoside and non-nucleoside HIV reverse transcriptase (RT) inhibitors. Examples of nucleoside RT inhibitors ^ h ^ asy _and not restricting the ^ ú · .najmichv ^ ZT ^ -jadd.Č, and ddI, d4T, and 3TC. Examples of non-nucleoside RT inhibitors include, but are not limited to, viviradine (Pharmacia und Upjohn U90152S), derivatives of TIBO, BI-RG-587, nevirapine, L-697, 661, LY 73497, and Ro 18,893 (Roche).

As used herein, HIV protease inhibitor refers to compounds that inhibit HIV protease. Examples include, but are not limited to, saquinavir (Roche, RO31-8959), ritonavir (Abbott, ABT-538), indinavir (Merck, MK-639),

VX-478 (Vertex / Glaxo Wellcome); nelfinavir (Agouron, AG1343); KNX-272 (Japan Energy); CGP-61755 (Ciba-Geigy); and U-103017 (Pharmacia und Upjohn). Other examples include the cyclic protease inhibitors disclosed in WO93 / 07128, WO 94/19329, WO 94/22840, and PCT Application No. 5,199,149. US96 / 03,526th

As used herein, the term pharmaceutically acceptable salts refers to derivatives of the disclosed compounds wherein the starting material is modified by conversion to its acidic or basic salts. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and so on. Pharmaceutically acceptable salts include conventional non-toxic salts of quaternary ammonium salts of the starting materials formed, for example, from non-toxic inorganic or organic acids. For example, these conventional non-toxic salts thus derived from inorganic acids such as hydrogen chloride, hydrogen bromide, sulfuric acid, sulfamic acid, phosphoric acid, nitric acid and the like; and salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleinic, phenylacetic, glutamic, benzoic, salicylic, sulfanil, 2-acetoxybenzoic fumaric, toluenesulfonic, methanesulfonic, ethanedisulfonic, oxalic, 2-hydroxyethanesulfonic and the like.

may be synthesized from a starting material that contains a basic or acidic moiety by conventional chemical methods. Generally, these salts may be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of two; generally non-aqueous media such as ether, ethyl acetate, ethanol, isopropanol, or acetonitrile is preferred. A list of suitable salts can be found in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, PA, 1985, p. 1418, the disclosure of which is incorporated herein by reference.

The term pharmaceutically acceptable is used herein to refer to those compounds, materials, compositions and / or dosage forms which, according to medical judgment, are suitable for use in contact with human and animal tissue, without excessive toxicity, irritation, allergic response, or other problems or complications corresponding to a reasonable profit / risk ratio.

A prodrug is intended to include any covalently bonded carriers that release the active parent drug of formula (I) or other formulas or compounds of the present invention in vivo when such prodrug is administered to a mammal. Prodrugs of the compounds of the present invention, for example of formula (I), are prepared by modifying the functional groups present in the compound in such a way that the modified substances are cleaved, either by routine manipulation or in vivo, to the starting material. Prodrugs include compounds of the present invention wherein the hydroxy or amino group is bound to another group such that when the prodrug is administered to a mammal, it cleaves to form the free hydroxyl or amine. Examples of prodrugs include, but are not limited to, acetate, formate, or benzoate derivatives of alcohol and amine functional groups in a compound of Formula (I), phosphate esters, dimethylglycine esters, aminoalkylbenzyl esters, aminoalkyl esters of xeryl-xa-oxy, and ethylbutyl esters. functional groups in the compounds of formula (I); and so on. Other examples include compounds wherein the two hydroxy groups of Formula (I) combine to form an epoxide; -OCH ₂ SCH ₂ O-; -OC (= O) O-; _-CH2 O-; -OC (= S) O-; -OC (= O) C (= O) O 1 -OC (CH ₃ ) ₂ O? -oc ((CH ₂ ) ₃ nh ₂ ) (CH ₃ ) o -; -oc (och ₃ ) (ch ₂ ch ₂ ch ₃ ) o-; or -OS (= O) 0-.

Stable compound and stable structure refer to a compound that is strong enough to survive isolation from the reaction mixture to a suitable degree of purity, and formulation for an effective therapeutic agent. According to the present invention, only stable compounds are contemplated.

Substituted indicates that one or more of the hydrogens on the atom contemplated to be substituted are replaced by a selection from the labeled group (s), provided that the normal valency of the labeled atom is not exceeded, and that the substitution result is a stable compound. When the substituent is a keto group (i.e., = O), two hydrogens on the atom are replaced

By a therapeutically effective amount is meant to include an amount of a compound of the present invention or an amount of a combination of the claimed compounds that is capable of effectively inhibiting HIV infection or treating the symptoms of HIV infection in a host. The combination of compounds is preferably a synergistic combination. Synergy, as described, for example, by Chou and Talalay, Adv. Enzyme Regul. 22: 75-55 (1984), occurs when the effect (in this case inhibition of HIV replication) of the compounds when administered in combination is greater than the additive effect of the compounds when administered alone as individual agents. In general, the synergistic effect is most clearly demonstrated at suboptimal concentrations of the compounds. Synergy may also be at terms of lower effect, or some other advantageous effect of the combination as compared to the individual components.

Other features of the invention will become apparent with reference to the following descriptions of exemplary embodiments that are set forth to illustrate the invention.

DETAILED DESCRIPTION OF THE INVENTION

The abbreviations used in the Examples are defined as follows:

° C for degrees Celsius, d for doublet, dd for doublet of doublets, eq. for equivalent or equivalents, g for gram or grams, mg for milligram or milligrams, ml for milliliter or milliliters, H for hydrogen or hydrogen, h for hour or hours, m for multiplet, M for molarity, min for minute or minutes, MHz for megahertz, HMS for mass spectroscopy, nmr or NMR for nuclear magnetic resonance spectroscopy, t for triplet, and TLC for thin layer chromatography.

Example 1

Preparation of (4S, 5S, 6S, 7R) -Hexahydro-1- [5- (3-amino-indazole) -methyl] -3-butyl-5,6-dihydroxy-4,7-bis [phenylmethyl] -2H-1,3 -diazepin-2-one (I)

CEθΟΤί, DCE reflux

OMe HN ^ N

0-Λ-0 --- Ο ° x °

Compound A can be prepared by known methods. For example, the preparation of compound A is shown in Scheme 1 by Rossan et al (Tetr. Lett. 1995, 36 (28), 4967, 4968), the contents of which are incorporated herein by reference. A further process for preparing Compound A is illustrated in Example 6 of U.S. Patent 5,530,124, the contents of which are incorporated herein by reference.

PART A: To a suspension of compound 1 (10.0 g; 27.3 nunol) in 1,2-dichloroethane (100 mL) was added methyl trifluoromethanesulfonate (3.4 mL, 30 mmol). After refluxing overnight, the reaction mixture was washed with saturated NaHCO 3, saturated. NaCl, dried (Na ₂ SO ₄ ) and evaporated to give 12.5 g of a yellow oil. Column chromatography (SiO ₂ layer, 25% EtOAc / hexane) gave 7.86 g of compound 2 as a pale yellow oil which crystallized on standing (75% yield).

mp = 97-100 ° C. MH ⁺ =

381

OMe

PART B: To a solution of 1 (10.0 g, 36.3 mmol) in anhydrous DMF (30 mL) was added sodium hydride (1.58 g, 65.8 mmol). The reaction mixture was stirred at room temperature for 45 minutes, followed by dropwise addition of a solution of 1-iodobutane (9.68 g, 52.6 mmol) in anhydrous DMF (10 mL). After the addition, stirring was continued at room temperature overnight. The reaction mixture was cooled to 0 ° C and methanol (5 mL) was added to quench excess sodium hydride. The mixture was partitioned between ethyl acetate (200 mL) and water (150 mL). The organic phase was separated and washed with water (4 x 10 0 mL). The residue was purified by flash chromatography (25% EtOAc / hexane) to give n-butylisourea 2. (10.5 g, 92% yield):

HMS (NH ₃ -CI / DDIP) (M + H ⁺ ) 437.2 (100%);

¹ HNMR (300 MHz, CDCl 3, 25 ° C) δ 7.23 (m, 10H), 4.19 (m, 3H), 3.64 (m, 1H), 3.44 (s, 3H), 3 36 (m, 1H), 3.02 (m, 2H), 2.76 (m, 2H), 2.04 (m, 1H), 1.52 (s, 3H), 1.49 (s, 3H), 1.21 (m, 4H), 0.82 (t, J = 7.0 Hz, 3H).

PART C: (4R, 5S, 6S, 7R) -Hexahydro-1 - [(3-cyano-4-fluorophenyl) methyl] -5,6-O-isopropylidene-4,7-bis- (4-phenylmethyl) - 3-Phenylmethyl-2H-1,3-diazepin-2-one (3).

To a solution of 2 (5.0 g, 11.5 mmol) in acetonitrile (40 mL) was added 4-fluoro-3-cyanobenzyl bromide (3.68 g, 17.25 mmol). The reaction mixture was refluxed overnight. After removal of the solvent under reduced pressure overnight, the residue was purified using flash chromatography (35% EtoAc / Hex.) To give cyclic urea 3 as a white solid (4.5 g, 71% yield):

HMS (NH ₃ -CI / DDIP) (M + H ⁺⁾ 556.3 (100%, ^{Χ Η} NMR (300 MHz, _CDCl3, 25 ° C) δ 7.41 (m, 1H), 7.28 ( m, 7H), 7.13 (d, J = 9.2Hz, 2H), 7.05 (t, J = 8.8Hz, 1H), 6.95 (d, J = 9.2Hz, 2H), 4.50 (d, J = 14.0 Hz, 1H), 4.07 (m, 2H), 3.70 (m, 3H), 3.44 (t, J = 7.7 Hz, 1H), 2.90 (m, 4H), 2.12 (m, 1H), 1.50 (s, 6H), 1.26 (m, 4H), 0.83 (t, J = 7.0 Hz, 3H).

PART D: (4R, 5S, 6S, 7R) -Hexahydro-1- [5- (3-aminoindazole) methyl] -3-butyl-5,6-dihydroxy-4,7-bis- (4-phenylmethyl) -2H1,3-diazepine-2-QrLX1

To a solution of 3 (4.5 g, 8.11 mmol) in n-butanol (20 mL) was added hydrazine hydrate (0.82 g, 16.2 mmol). The mixture was refluxed for 6 hours. The solvent and excess hydrazine were removed under reduced pressure. The residue was dissolved in anhydrous methanol (20 mL), followed by the addition of 4 M HCl in dioxane (2 mL). The reaction mixture was stirred at room temperature for about 2 hours. The methanol was removed and the residue was partitioned between ethyl acetate (80 mL) and sodium bicarbonate (sat.) 50 mL. The organic phase was separated, washed with water (2 x 50 mL) and dried over anhydrous sodium sulfate. Purification by flash chromatography afforded (I) (3.0 g, 72% yield) as a white solid: m.p. 129-131 ° C;

HMS (NH ₃ -CI / DDIP) (M + H ⁺ ) 528.3 (100%);

HRMS calcd. for θ ₃₁ Η ₃₇ Ν ₅ Ο ₃ +1 528.2975, found 528.2958;

¹ H NMR (300 MHz, CD ₃ OD, 25 ° C) δ 7.19 (m, 12H), 6.98 (d, J = 1,

Hz, 2H), 4.74 (d, J = 13.9 Hz, 1H), 3.85 (dd, J = 10.25, 4.76 Hz, 1H), 3.65 (m, 1H), 3.56 (m, 2H), 3.15 (m, 2H), 2.96 (m, 3H), 2.07 (m, 2H), 1.37 (m, 2H), 1.22 (m) 2H, 0.84 (t, J = 7);

0. 3H).

usefulness

The compounds of formula I exhibit HIV protease inhibitory activity and are therefore useful as antiviral agents for the treatment of HIV infection and associated diseases. The compounds of formula I exhibit HIV protease inhibitory activity and are effective as inhibitors of HIV growth. The ability of the compounds of the present invention to inhibit virus growth or infectivity is demonstrated by standard virus growth or infectivity assays, for example using the assay described below.

The compounds of formula I of the present invention are also useful for inhibiting HIV in ex vi in a sample containing HIV or suspected to be exposed to HIV. Therefore, the compounds of the present invention can be used to inhibit HIV present in a body fluid sample (e.g., a serum or semen sample) that contains, or is believed to contain, a? = a l ^ bo ^ ola They will build up the influence of HlV; ^ ´ ^^^

The compounds provided by the present invention are also suitable as standard or reference compounds for use in assays or assays to determine the ability of a substance to inhibit replication of viral clones and / or HIV protease, for example, in pharmaceutical research programs. Therefore, the compounds of the present invention can be used in these assays as control or reference compounds and as quality control standards. The compounds of the present invention may be stored in a commercial kit or container for use of such a standard or reference compound.

Where the compounds of the present invention exhibit HIV protease specificity, the compounds of the present invention may also be useful as diagnostic agents in diagnostic assays for detecting HIV protease. Therefore, inhibition of protease activity in an assay (as described herein) by a compound of the present invention may indicate the presence of HIV protease and HIV viruses.

As used herein, 'g indicates microgram, mg indicates milligram, g indicates gram, μΐ indicates microliter, ml indicates milliliter, 1 indicates liter, nM indicates nanomolar, μΜ indicates micromolar, mM indicates millimolar, M indicates molar and nm indicates nanometer . Sigma is a designation for Sigma-Aldrich Corp. of St. Louis, MO.

HIV RNA Assay

DNA plasmids and in vitro RNA transcripts

Plasmid pDAB 72 containing both gag and pol sequences from BH10 (bp 113-1816) cloned on PTZ 19R was prepared according to Erickson-Viitanen et al., AIDS Research and Human Retroviruses 1989, 5, 577. The plasmid was linearized with Bam HI before generation in. in vitro RNA transcripts using the Riboprobe Gemini II ~ kit (Promega). s _; The TL.RNA was purified by treatment with DNAse-free RNAse (Promega), phenol-chloroform extraction, and ethanol precipitation. RNA transcripts were dissolved in water and stored at -70 ° C. RNA concentrations were determined from A ₂₆₀ .

probes

Biotinylated capture probes were purified by HPLC after synthesis on an Applied Biosystems (Foster City, CAa) DNA synthesizer by adding biotin to the 5 'terminal end of the oligonucleotide, using a biotin-phosphoramidite reagent from Cocuzza, Tet. Lett. 1989, 30, 6287. The Gag biotinylated capture probe (5-biotin-CTAGCTCCCTGCTTGCCCATACTA 3 ') was complementary to nucleotides 889-912 from HXB2 and the half biotinylated capture probe (5'-biotin-CCCTATCATTTTTGGTTTCCAT 3' 39) was 39 '. from HXB2. Alkaline phosphatase conjugated oligonucleotides used as reporter probes were prepared in Syngen (San Diego, CA). The Pol reporter probe (5 'CTGTCTTACTTTGATAAAACCTC 3') was com17 plemental to nucleotides 2403-2425 of HXB2). The gag reporter probe (5'- CCCAGTATTTGTCTACAGCCTTCT 3 ') was complementary to nucleotides 950-973 of HXB2. All nucleotide positions are from the GenBank Genetic Sequence Data Bank, as available through the Genetics Computer Group Sequence Analysis Software Package (Devereau Nucleic Acids Research 1984, 12, 387). Reporter probes were prepared as 0.5 μΜ stock solutions in 2 X SSC (0.3 M NaCl, 0.03 M sodium citrate), 0.05 M Tris pH 8.8, 1 mg / ml BSA. Biotinylated capture probes were prepared as 100 μΜ water supplies.

Streptavidin-coated plates

Streptavidin-coated plates were obtained from Du Pont Biotechnology Systems (Boston, MA).

Cellular and viral stocks

MT-2 and MT-4 cells were stored in RPMI 1640 supplemented with 5% fetal calf serum (FCS) for MT-2 cells or 10%

FCS for MT-4 cells, 2 mM L-glutamine and 50 µg / ml gentamycin, all from Gibco. HIV-1 RF was propagated in MT-4 cells in the same medium. Virus stocks were prepared approximately 10 days after acute infection of MT-4 cells and stored as aliquots at -70 ° C. The stocks of HIV-1 (RF) infectious titers were 1-3 x 10 ⁷ PTJ (Coating Units) / ml as measured by the MT-2 cell coating assay (see below). Each portion of the reserve viruses used for infection was allowed to melt only once.

To assess antiviral activity, the cells to be infected were subcultured one day prior to infection. The day after infection, cells were resuspended at 5 x 10 ⁵ cells / ml in RPMI 1640, 5% FCS for large-scale infections, or 2x10 ⁶ / ml in modified Eagle's medium from Dulbecco with 5% FCS for microtiter plate infection. Viruses were added and cultivation continued for 3 days at 37 ° C.

HIV RNA Test

Cell lysates or purified RNA in 3 M or 5 M GED were mixed with 5 M GED and capture probe to a final 3M guanidinium isothiocyanate concentration and a final 30 nM biotin-oligonucleotide concentration. Hybridization was performed in sealed 96-well U-bottom culture plates (Nunc or Costar) for 16-20 hours at 37 ° C. The RNA hybridization reaction mixtures were diluted three times with deionized water to a final guanidinium isothiocyanate concentration of 1 M and aliquots (150 μΐ) were transferred to streptavidin-coated wells of microtiter plates. The capture probe and probe-RNA hybrid binding to immobilized streptavidin was allowed to proceed for 2 hours at room temperature and then the plates were washed 6 times with DuPont ELISA plate wash buffer (phosphate buffered saline _; (pgSl; _, e, 0, 5). 05% -Tween reporter probe activation on immobilized capture probe complex and target RNA hybridization was performed in washed streptavidin-coated wells by the addition of 120 μΐ hybridization cocktail containing 4 X SSC, 0.66% Triton X 100, 6.66% deionized formamide, 1 mg / ml BSA and 5 nM reporter probe After hybridization for one hour at 37 [deg.] C., the plate was washed again 6 times.

4-methylumbelliferyl phosphate (MUBP, JBL Scientific) in δ buffer (2.5 M diethanolamine pH 8.9 (JBL Scientific), 10 mM MgCl ₂ , 5 mM zinc acetate dihydrate and 5 mM N-hydroxyethyl-ethylene-diamine-triacetic acid acid). The plates were incubated at 37 ° C. Fluorescence at 450 nM was measured using a microplate fluorometer (Dynateck) by excitation at 365 nM.

Evaluation of compounds in HIV-1 infected MT-2 cells in microplates

Test compounds were dissolved in DMSO and diluted in culture medium to twice the highest concentration to be tested and a maximum DMSO concentration of 2%. Another series of three-fold dilutions of the compound in culture medium were performed directly in U-bottom microtiter plates (Nunc).

After dilution of the compound, MT-2 cells (50 μ prid) were added to a final concentration of 5 x 10 ⁵ per ml (1 x 10 ⁵ per well). Cells were incubated with compounds for 30 minutes at 37 ° C in a CO ₂ incubator. To determine the antiviral activity, appropriate dilutions of the HIV-1 (RF) virus stock (50 μΐ) were added to the culture flasks containing the cells and the dilutions of the test compounds. The final volume in each well was 200 μΐ. Eight wells per plate were left uninfected with 50 μΐ of medium added instead of viruses, while eight wells were left. _- ip <, ikpyanyqq .. ^. _P-n ^, I ^ thia-P-AA ^> ^ where & ikPJ eK ^ ^ j ^ roläaáaaĽisca compound. Plates without viral infection were cultured in parallel to investigate the toxicity of the compound.

After 3 days of culturing all at 37 ° C in a humidified chamber inside the CO ₂ incubator, 25 μΐ medium / well was taken from HIV infected plates. 37 μΐ of 5 M GED containing the biotinylated capture probe, and the remaining medium were added to the wells to give a final concentration of 3 M GED and 30 nM capture probe. Hybridization of the capture probe to HIV RNA in the cell lysate was performed in the same microplate well as used for virus culture by sealing the plate with plate sealant (Costar) and incubating for 16-20 hours in a 37 ° C incubator. Distilled water was then added to each well three times to dilute the hybridization reaction mixture and 150 µL of this diluted mixture was transferred to a streptavidin-coated microtiter plate. HIV RNA was quantified as described above. Standard curve, prepared by adding known amounts of 72 t pDAB

in an in vitro RNA transcript into wells containing lysed uninfected cells, was run through each microtiter plate to determine the amount of viral RNA produced during infection.

To standardize the viral inoculum used to investigate the compound for antiviral activity, a virus dilution that reached IC ₅₀ (compound concentration required to reduce the Hl V RNA by 90%) for dideoxycytidine (ddC), 0.2 µ9, was selected. ιη1. IC ₅₀ values of other antiviral compounds, more or less stronger than ddC, were reproducible using a series of HIV-1 (RF) stocks, as long as this procedure followed. This virus concentration corresponded to about 3 x 10 ⁵ PTJ (coating forming units, as measured by the MT-2 cell coating assay) per test well and typically produced approximately 75% of the maximum viral RNA level achievable by the viral inoculum. For the HIV RNA assay, IC ₅₀ values were determined from the percentage reduction of the net minus signal from uninfected cell samples) in the RNA assay based on the net (net) signal from infected untreated cells on the same culture plate (eight wells average). The valid development of the individual infection and RNA test assays was judged according to three criteria. The viral infection in the RNA assay was required to have a signal equivalent to or greater than the signal generated by 2 ng of pDAB in vitro RNA transcript. The IC _g Q at ddC, determined in each series of tests, should be between 0.1 and 0.3 μ9 / πι1. Finally, the value of the fifth viral RNA produced by the potent protease inhibitor should be less than 10% of that achieved in the uninhibited infection. A compound is considered active when its IC _{go has been} determined to be less than 1 μΜ.

For anti-viral testing, all microtiter plate manipulations, followed by initial addition of 2X concentrated compound solution to each row of wells, were performed using Perkin Elmer / Cetus Pro Pette.

Dosage and composition

The antiviral compounds of the invention can be administered as a medicament for viral infections by any means that ensures contact of the active agent with the site of action of the agent, or viral protease, in the mammalian body. They may be administered by any of the conventional methods for use in conjunction with pharmaceuticals, either as a single therapeutic agent or in combination of therapeutic agents. They may be administered alone, but preference is given to administration with a pharmaceutical carrier selected on the basis of the chosen route of administration and standard pharmaceutical practice.

The dosage of administration will of course vary depending on many factors, such as the pharmacodynamic characteristics of the particular substance and its type and route of administration; age, health and health. the weight of the symptom and the second treatment; frequency of treatment and desired effect. The daily dose of the active ingredient is acceptable from about 0.001 to about 1000 milligrams per kilogram of body weight, with a preferred dose being about 0.1 to about 30 mg / kg.

Dosage forms of compositions suitable for administration contain from about 1 mg to about 100 mg of active ingredient per unit. In these pharmaceutical compositions, the active ingredient will usually be present in an amount of about 0.5 to 95% by weight. based on the total weight of the composition. The active ingredient may also be administered orally in solid dosage forms such as capsules, tablets and powders, or in liquid dosage forms such as elixirs, syrups and suspensions. It can also be administered parenterally in sterile liquid dosage forms.

Gelatin capsules contain the active ingredient and powdered carriers such as lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like. Similar diluents may be used to prepare compressed tablets. Both tablets and capsules can be manufactured as sustained release products that provide continuous drug release over a period of hours. Compressed tablets may be sugar or film coated to mask any unpleasant taste and protect the tablet from the effects of air or enteric coated for selective disintegration in the gastrointestinal tract. Liquid dosage forms for oral administration may contain coloring and flavoring to enhance patient acceptance.

In general, suitable carriers for parenteral solutions are water, a suitable oil, saline, aqueous dextrose (glucose), and similar sugar solutions and glycols such as propylene glycol or polyethylene glycols. Solutions for parenteral administration preferably contain water-soluble salts of the active ingredient, suitable stabilizing agents and, if necessary, buffering agents. Antioxidants such as sodium bisulfite, sodium - sulfite _-, 5θάηγ ._ ^. ^ Ρ 1β, νΚν Μη ^ ^. Stable or in combination, stabilizers are suitable. Citric acid and its salts and sodium EDTA are also used. Further, parenteral solutions may contain preservatives such as benzalkonium chloride, methyl or propylparaben and chlorobutanol. Suitable pharmaceutical carriers are described in Reaington's Pharmaceutical Sciences, supra, standard reference text in the art.

Suitable pharmaceutical dosage forms for administration of the compounds of this invention may be exemplified as follows:

The capsules

A large number of unit capsules can be prepared by filling standard two-piece hard gelatine capsules, each with 100 mg powdered active ingredient, 150 mg lactose, 50 mg cellulose, and 6 mg magnesium stearate.

Soft gelatin capsules

A mixture of the active ingredient in an edible oil, such as soybean oil, cottonseed oil, or olive oil, can be prepared and injected by means of a positive displacement pump into gelatin to form soft gelatin capsules containing 100 mg of the active ingredient. The capsules are then washed and dried.

tablets

A large number of tablets may be prepared by conventional methods such that the dosage unit is 100 mg of active ingredient, 0.2 mg of colloidal silica, 5 mg of magnesium stearate, 275 mg of microcrystalline cellulose, 11 mg of starch and 98.8 mg of lactose. Appropriate coatings may be applied to improve palatability and gradual absorption.

suspensions

The aqueous suspension may be prepared for oral administration such that every 5 ml contains 25 mg of finely divided active ingredient, 200 mg of sodium carboxymethylcellulose, 5 mg of sodium benzoate, 1.0 g of sorbitol solution, U.S.P., and 0.025 mg of vanillin.

Injectable solutions

A parenteral composition suitable for injection may be prepared by mixing 1.5 wt. of the active substance in 10% by volume. propylene glycol and water. The solution is sterilized by commonly used techniques.

Combination of components (a) and (b)

Each component of the therapeutic agent of the present invention may be independently in any dosage form, such as those described above, and may also be administered by a variety of methods as described above. In the following description, component (b) is to be understood as representing one or more substances as described above. Therefore, when components (a) and (b) are to be treated equally or independently, each substance of component (b) may also be treated equally or independently.

The components (a) and (b) of the present invention may be formulated together, in a single dosage unit (i.e., combined in one capsule, tablet, powder, liquid, etc.) as a combination product. Unless component (a) and (b) are formulated together into a single dosage form, component (a) may be administered at the same time as component (b), or in any order; for example, component (a) of the invention may be administered first, followed by administration of component (b), or may be administered in reverse order. If component (b) contains more than one agent, for example one RT inhibitor and one protease inhibitor, the active agents may be administered together or in any order. If they are administered at the same time, it is preferable to administer components (a) and (b) within less than about one hour of each other. Preferably, the route of administration of components (a) and (b) is oral. The terms oral agent, oral inhibitor, oral compound, or the like, as used herein, refer to compounds that can be administered orally. Although it is preferred that both components (a) and (b) are administered by the same route (i.e., both orally), if desired, they may be administered by different routes (i.e., for example, one component of the combination product may be administered orally, and the second component may be administered intravenously) or in dosage forms.

A medical practitioner, as one of skill in the art, will assume that the dosage for combination therapy of the invention varies depending on various factors such as the pharmacodynamic characteristics of the particular substance and its type and route of administration, the recipient's health and weight, nature and extent of symptoms. the type of other treatment, the frequency of treatment, and the effect desired, as described above.

The actual dosages of components (a) and (b) of the present invention will be readily ascertainable by a medical practitioner skilled in the art based on the present disclosure. As a general guide, a typical daily dosage may be about 100 milligrams to about 1.5 grams of each component. When component (b) refers to more than one compound, a typical daily dosage may be about 100 milligrams to about 1.5 grams of each of the compounds of component (b). As a general guideline, when the compounds of component (a) and component (b) are administered in combination, the dosage amount of each component can be reduced to about 70-80% relative to the usual dosage of the component when administered alone as an individual for the treatment of HIV. infection.

The combination products of the invention may be formulated such that although the active ingredients are combined into a single dosage unit, physical contact between the active ingredients is minimal. In order to minimize contact, for example, when the product is administered orally, one active ingredient should be enteric coated. By enteric coating of one of the active ingredients, it is not only possible to minimize contact between the combined active ingredients, but also to regulate the release of one of these ingredients in the gastrointestinal tract so that one of these ingredients is not released in the stomach but rather released in the intestines.

Another embodiment of the present invention where oral administration is desired provides a combination product wherein one or more active ingredients are coated with a sustained release material that causes sustained release in the gastrointestinal tract and also serves to minimize physical contact between the combined active ingredients. Further, the sustained release component may additionally be enteric coated such that the release of this component occurs only in the intestines. Yet another concept is included in the formulation of a combination product wherein one component is coated with a sustained and / or enteric release polymer and the other component is also coated with a polymer such as low viscosity hydroxypropylmethylcellulose or other suitable materials known in the art to the active ingredients were separated more. The polymer coating serves to form an additional barrier to interaction with another component. In any composition where contact between components (a) and (b) is prevented by a coating or any other material, contact between the individual substances of component (b) may also be avoided.

Dosage forms of the combination products of the present invention wherein one enteric coated active ingredient may be in the form of tablets, such that the enteric coated ingredient and the other active ingredient are mixed together and then compressed into a tablet, or such that the enteric coated ingredient is compressed into one a tablet layer and another active ingredient is compressed into another layer. Alternatively, in order to further separate the two layers, one or more placebo layers may be present so that there is a placebo layer between the active ingredient layers. Further, the dosage forms of the present invention may be in the form of capsules wherein one active ingredient is compressed into a tablet or in the form of a plurality of micro-tablets, particles, granules, which are then enteric coated. These enteric coated microtablets, particles, granules are then introduced into a capsule or compressed into a capsule during granulation of the other active ingredient.

These, as well as other procedures to minimize contact between the components of the combination products of the present invention when administered in unit dosage form or administered in separate forms but at the same time or concurrently in the same manner, are within the skill of the art based on the above description. easily imaginable.

Pharmaceutical kits suitable for treating HIV infection, comprising a therapeutically effective amount of a pharmaceutical composition comprising a compound of component (a) and one or more compounds of component (b), in one or more sterile containers / containers are also within the scope of the present invention. Sterilization of the container may be accomplished by conventional sterilization procedures well known to those skilled in the art. Component (a) and component (b) may be in the same sterile container or in separate sterile containers. Sterile material containers may include separate containers or one or more multi-part containers as required. Component (a) and component (b) may be separated or physically combined into a single dosage form or unit as described above. These kits may further include, as appropriate, one or more different conventional ingredients of pharmaceutical kits, such as one or more pharmaceutically acceptable carriers, additional containers for mixing the ingredients, and the like, as will be apparent to those skilled in the art. Instructions, either as leaflets or stickers, indicating the amount of ingredients to be administered, the directions for administration and / or the instructions for mixing are to be used. _{: part of} QU ^ _v ., kit.

Of course, with respect to the above description, numerous modifications and variations of the present invention are possible. It is therefore to be understood that within the scope of the appended claims, the invention may be practiced otherwise than as specifically set forth herein.

Claims (15)

PATENT CLAIMS A compound of formula I ABOUT N NH ₂ (I) or a pharmaceutically acceptable salt or prodrug form thereof, wherein the prodrug of Formula I is a compound wherein two hydroxy groups combine to form an epoxide; -OCH ₂ SCH ₂ O-; -0C (= 0) 0-; _-CH2 O-; -OC (= S) O-; -OC (= 0) C (= 0) O-; OC _{(CH3) 2} 0; -OC ((CH ₂ ) ₃ NH ₂ ) (CH ₃ ) O-; -OC (OCH ₃ ) (CH ₂ CH ₂ CH ₃ ) 0 -; or -S (= O) O- groups. A compound according to claim 1, wherein the compound is of formula (I). A pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of a compound of claim 1, or a pharmaceutically acceptable salt or prodrug form thereof. The composition of claim 3, wherein the compound is of formula (I). Use of a compound of formula I or a pharmaceutically acceptable salt or prodrug form for the manufacture of a medicament for the treatment of HIV infection, wherein nh ₂ The N (I) prodrug of Formula I is a compound wherein two hydroxy groups combine to form an epoxide; -OCH ₂ SCH ₂ O-; -00 (= 0) 0-; _-CH2 O-; -OC (= S) O-; -OC (= O) C (= O) O-; -OC (CH ₃ ) ₂ O; -OC ((CH ₂ ) ₃ NH ₂ ) (CH ₃ ) 0 -; -OC (OCH ₃ ) (CH ₂ CH ₂ CH ₃ ) O-; or -OS (= O) O- groups. Use according to claim 5, wherein the compound is of formula (I). Use of combination (a) and (b) for the manufacture of a medicament for the treatment of HIV infection, wherein (a) is a compound of formula (I) or a pharmaceutically acceptable salt or prodrug form thereof: wherein the prodrug of Formula I is a compound wherein two hydroxy groups combine to form an epoxide; -OCH ₂ SCH ₂ O-; -00 (= 0) 0-; -CH ₂ O -OC (= S) O-; -OC (= O) C (= O) O-; -OC (CH ₃ ) ₂ O; -OC ((CH ₂ ) ₃ NH ₂ ) (CH ₃ ) O-; -00 (OCH ₃ ) (CH ₂ CH ₂ CH ₃ ) O-; or an -OS (= O) O- group, and (b) is at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors. Use according to claim 7, wherein the compound is of formula (I). The use of claim 7, wherein the reverse transcriptase inhibitor is a nucleoside reverse transcriptase inhibitor. The use of claim 9, wherein the nucleoside reverse transcriptase inhibitor is selected from AZT, 3TC, dd1, ddC, and d4T, and the protease inhibitor is selected from saquinavir, ritonavir, indinavir, VX-478, nelfinavir, KNI-272, CGP-61755 , and U-103017. The use of claim 10, wherein the nucleoside reverse transcriptase inhibitor is selected from AZT and 3TC and the protease inhibitor is selected from saquinavir, ritonavir, and indinavir. The use of claim 11, wherein the nucleoside reverse transcriptase inhibitor is AZT. ♦ The use of claim 11, wherein the protease inhibitor is indinavir. 14. A pharmaceutical kit suitable for the treatment of HIV infection, comprising a therapeutically effective amount of: (a) the compound of claim 1, and (b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and J protease inhibitors of HIV, in one or more sterile containers. Kit according to claim 14, characterized in that component (a) is a compound of formula (I).