LV12374B - (4r,5s,6s,7r)-hexahydro-1-[5-(3-aminoindazole)methyl]-3-butyl-5,6-dihydroxy-4,7-bis[phaenylmethyl]-2h-1,3-diazepin-2-one, its preparation and its use as hiv protease inhibitor - Google Patents

Abstract

The present invention relates to compounds of formula (I) or pharmaceutically acceptable salt forms or prodrugs thereof, which are useful as inhibitors of HIV protease, and to pharmaceutical compositions and diagnostic kits comprising the same, and methods of using the same for treating viral infection or as an assay standard or reagent.

Description

5 LV 12374

(4R,5S,6S.7R)-HEXAHYDRO-! - [5-(3-AMIN01NAZ0LE)METHYL] -3-BUTYL-5,6-DIHYDROXY-4.7-BiS

[PHAENYLMETHYL] -2H-U-DIAZEPIN-2-ONE. ITS PREPARATION AND ITS USE AS HIV PROTEASE INHFBITOR

FIELD OF THE INVENTION 10

This invention relates generally to a 1-(3-aminoindazol-5-yl)-3-butyl-cyclic urea which is useful as inhibitors of HIV protease, pharmaceutical compositions and diagnostic kits comprising the same, and methods of using the same for treating virai infection or as assay standards or reaģents.

BACKGROUND QF THE INVENTION

Two distinct retroviruses, human immunodeficiency virus 15 (HIV) type-l (HIV-1) or type-2 (HIV-2), have been etiologically linked to the immunosuppressive disease, acquired iitununodeficiency syndrome (AIDS) . HIV seropositive individuāls are initially asymptomatic but typically develop AIDS related complex (ARC) followed by AIDS. Affected 20 individuāls exhibit severe immunosuppression which predisposes them to debilitating and ultimately fatal opportunistic infections.

The disease AIDS is the end result of an HIV-1 or HIV-2 virus following its own complex life cycle. The virion life 25 cycle begins with the virion attaching itself to the host human T-4 lymphocyte immune celi through the bonding of a glycoprotein on the surface of the virion's protective coat with the CD4 glycoprotein on the lymphocyte celi. Once attached/ the virion sheds its glycoprotein coat, penetrates 30 into the membrane of the host celi, and uncoats its RNA. The virion enzyme, reverse transcriptase, directs the process of transcribing the RNA into single-stranded DNA. The virai RNA is degraded and a second DNA strand is created. The now double-stranded DNA is integrated into the human celi1 s genes 35 and those genes are used for celi reproduction.

At this point, the human celi carries out its reproductive process by using its own RNA polymerase to -1- transcribe the integrated DNA into virai RNA. The virai RNA is translated into the precursor gag-pol fusion polyprotein. The polyprotein is then cleaved by the HIV protease enzyme to yield the mature virai proteīns. Thus, HIV protease ir. 5 responsible for regulating a cascade of cleavage events that lead to the virus particle's maturing into a virus that is capable of full infectivity.

The typical human immune system response, killing the invading virion, is taxed because a large portion of the 10 virion's life cycle is spent in a latent State within the immune celi. In addition, virai reverse transcriptase, the enzyme used in making a new virion particle, is not very specific, and causes transcription mistakes that result in continually changed glycoproteins on the surface of the virai 15 protective coat. This lack of specificity decreases the immune system's effectiveness because antibodies specifically produced against one glycoprotein may be useless against another, hence reducing the number of antibodies available to fight the virus. The virus continues to reproducē while the 20 immune response system continues to weaken. Eventually, the HIV largely holds free reign over the body's immune system, allowing opportunistic infections to set in and without the administration of antiviral aģents, immunomodulators, or both, death may result. 25 There are at least three critical points in the virus's life cycle which have been identified as possible targets for antiviral drugs: (1) the initial attachment of the virion to the T-4 lymphocyte or macrophage site, (2) the transcription of virai RNA to virai DNA (reverse transcriptase, RT), and 30 (3) the assemblage of the new virus particle during reproduction (e.g., HIV aspartic acid protease or HIV protease).

The genomes of retroviruses encode a protease that is responsible for the proteolytic processing of one or more 35 polyprotein precursors such as the pol and gag gene products. See Wellink, Arch. Virol. Jūi 1 (1988) . Retroviral proteases most commonly process the gag precursor into the core 2 LV 12374 proteīns, and also process the pol precursor into reverse cranscriptase and retroviral protease. 10

The correct Processing of the precursor polyproteins bv the retroviral protease is necessarv for the assemblv of the infectious virions. It has been shown that in vicro mutagenesis that producēs protease-defective virus leads to the production of immature core forms which lack infectivitv. See Crawford et al., J. Virol. 53. 899 (1985); Katoh et al., Virology 145 280 (1985). Therefore, retroviral protease inhibition provides an attractive target for antiviral therapy. See Mitsuya, Nature 325 775 (1987) . 15 20

The abilitv to inhibit a virai protease provides a method for blocking virai replication and therefore a treatment for virai diseases, such as AIDS, that may have fewer side effects, be more efficacious, and be less pror.e to drug resistance when compared to current treatments. As a result, three HIV protease inhibitors, Roche's saguinavir, Abbott's ritonavir, and Merck's indinavir, are currentlv being marketed and a number of poter.tial protease inhibitors are in clinical trials, e.g., Vertex's VX-478, Agouron's nelfinavir, Japan Energy's KNI-272, and Ciba-Geigy's CG? 61755. 25

As evidenced by the protease inhibitors presentlv marketed and in clinical trials, a wide variety of compounds have been studied as potential HIV protease inhibitors. One core, cyclic ureas, has received significant attention. For example, in PCT Application Numbers W094/19329 and W0 93/07128, Lam et ai generically describe cyclic ureas of the formula: 30

3 and methods of preparing these ureas. Though the present compounds fall within Che description of Lam et al, they are r.oc specificallv disclosed therein.

Additional cvclic ureas are aescribed in Lam et al, J. 5 Mad. Chem. 1996, 39, 3514-3525. Though a variety of cvclic ureas are dislosed in this pubiication, no indazolemechyI containing compounds are described.

3A LV 12374

Ever. with the current success of procease inhibitors, it has beer. found that HIV patier.ts can become resistant to a singie protease inhibitor. Thus, it is desirable to develop additional protease inhibitors to further combat KIV infection.

10 SUMMARV OF THE INVENTION

Accordingiy, one object of the present invention is to provide novel protease inhibitors.

It is another object of the present invention to provide pharmaceutical compositions with protease inhibiting activity 15 comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of at least one of the compounds of the present invention or a pharmaceuticallv acceptable salt or prodrug form thereof.

It is ar.other object of the present invention to provide 20 a novel method for treating HIV infection which comprises ādministering to a host in need of such treatment a therapeutically effective amount of at least one of the compounds of the present invention or a pharmaceutically acceptable salt or prodrug form thereof. 25 It is another object of the present invention to provide a novel method for treating HIV infection which comprises administering to a host in need thereof a therapeutically effective combination of (a) one of the compounds of the present invention and (b) one or more compounds selected form 30 the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors.

It is another object of the present invention to provide a method of inhibiting HIV present in a body fluid sample which comprises treating the body fluid sample with an 35 effective amount of a compound of the present invention.

It is another object of the present invention to provide a kit or Container containing at least one of the compounds 4 of the present invention in an amount effective for use as a Standard or reaģent in a tēst or assay for determining the ability of a potential pharmaceutical to inhibit HIV protease, HIV growth, or both. 5 These and other objects, which will become apparent during the following detailed description, have been achieved by the inventors' discovery that compounds of formula I:

10 or pharmaceutically acceptable salts or prodrug forms thereof, are effective protease inhibitors. DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS Thus, in a first embodiment, the present invention 15 provides a novel compound of formula I:

or a pharmaceutically acceptable salt or prodrug form thereof. 20

In a second embodiment, the present invention provides a novel pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of a compound of formula I or a 25 pharmaceutically acceptable salt or prodrug form thereof.

In a third embodiment, the present invention provides a novel method for treating HIV infection which comprises administering to a host in need of such treatment a 5 LV 12374 therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt or prodrug form thereof. 5 In a fourth embodiment, the present invention provides a novel method of treating Hiv infection which comprises administering, in combination, to a host in need thereof a therapeutically effective amount of: (a) a compound of formula 1/ and/ 10 (b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors.

In another preferred embodiment/ the reverse 15 transcriptase inhibitor is a nucleoside reverse transcriptase inhibitor.

In another more preferred embodiment, the nucleoside reverse transcriptase inhibitor is selected from AZT, 3TC, 20 ddl, ddC, and d4T and the protease inhibitor is selected from saquinavir, ritonavir, indinavir, VX-478, nelfinavir, KNI-272, CGP-61755, and U-103017.

In an even more preferred embodiment, the nucleoside 25 reverse transcriptase inhibitor is selected from AZT and 3TC and the protease inhibitor is selected from saquinavir, ritonavir, and indinavir.

In a stili further preferred ebodiment, the nucleoside 30 reverse transcriptase inhibitor is AZT.

In another stili further preferred embodiment, the protease inhibitor is indinavir. 35 In a fifth embodiment, the present invention provides a pharmaceutical kit useful for the treatment of HIV infection, which comprises a therapeutically effective amount of: 6 (a) a compound of formula I; and, (b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors, in one or more sterile containers. 5

In a sixth embodiment, the present invention provides a novel method of inhibiting HIV present in a body fluid sample which comprises treating the body fluid sample with an effective amount of a compound of formula I. 10

In a seventh embodiment, the present invention to provides a novel a kit or Container comprising a compound of formula I or II in an amount effective for use as a Standard or reaģent in a tēst or assay for determining the ability of 15 a potential pharmaceutical to inhibit HIV protease, HIV growth, or both.

DEFIMITIONS

As used herein, the following terms and expressions have 20 the indicated meanings. It will be appreciated that the compounds of the present invention contain an asymmetrically substituted carbon atom, and may be isolated in optically active or racemic forms. It is well known in the art how to prepare optically active forms, such as by resolution of 25 racemic forms or by synthesis, from optically active starting materiāls. Ali chiral, diastereomeric, racemic forms and ali geometric isomeric forms of a structure are intended, unless the specific stereochemistry or isomer form is specifically indicated. 30 As used herein, "HIV reverse transcriptase inhibitor" is intended to refer to both nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT) . Examples of nucleoside RT inhibitors include, but are not limited to, AZT, ddC, ddl, d4T, and 3TC. Examples of non-nucleoside RT 35 inhibitors include, but are no limited to, viviradine (Pharmacia and Upjohn U90152S), TIBO derivatives, BI-RG-587, nevirapine, L-697,661, LY 73497, and Ro 18,893 (Roche). 7 LV 12374

As used herein, "HIV protease inhibitor" is intended to refer to compounds which inhibit HIV protease. Examples include, but are not limited, saquinavir (Roche, Ro31-8959), ritonavir (Abbott, ABT-538), indinavir (Merck, MK-639), VX-5 478 (Vertex/Glaxo Wellcome), nelfinavir (Agouron, AG-1343), KNI-272 (Japan Energy), CGP-61755 (Ciba-Geigy), and U-103017 (Pharmacia and Upjohn). Additional examples include the cyclic protease inhibitors disclosed in WO93/07l28, W0 94/19329, W0 94/22840, and PCT Application Number US96/03426. 10 As used herein, "pharmaceutically acceptable salts” refer to derivatives of the disclosed compounds wherein the parent compound is modified by making acid or base salts thereof. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid 15 salts of basie residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like. The pharmaceutically acceptable salts include the conventional non-toxic salts or the quaternary ammonium salts of the parent compound formed, for example, from non-toxic 20 inorganic or organic acids. For example, such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like; and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, 25 stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, and the like. 30 The pharmaceutically acceptable salts of the present invention can be synthesized from the parent compound which contains a basie or acidic moiety by conventional Chemical methods. Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with a 35 stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonagueous media like ether, ethyl acetate, 8 ethanol, isopropanol, or acetonitrile are preferred. Lists of suitable salts are found in Remington*s Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, PA, 1985, p. 1418, the disclosure of which is hereby incorporated 5 by reference.

The phrase "pharmaceutically acceptable” is employed herein to refer to those compounds, materiāls, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the 10 tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication commensurate with a reasonable benefit/risk ratio. "Prodrugs" are intended to include any covalently bonded 15 carriers which release the active parent drug according to formula I or other formulas or compounds of the present invention in vivo when such prodrug is administered to a mammalian subject. Prodrugs of a compound of the present invention, for example formula (I) , are prepared by modifying 20 functional groups present in the compound in such a way that the modifications are cleaved, either in routine manipulation or in vivo, to the parent compound. Prodrugs include compounds of the present invention wherein the hydroxy or amino group is bonded to any group that, when the prodrug is 25 administered to a mammalian subject, cleaves to form a free hydroxyl or free amino, respectively. Examples of prodrugs include, but are not limited to, acetate, formate, or benzoate derivatives of alcohol and amine functional groups in the compounds of formula I; phosphate esters, 30 dimethylglycine esters, aminoalkylbenzyl esters, aminoalkyl esters and carboxyalkyl esters of alcohol functional groups in the compounds of formula I; and the like. Additional examples include compounds wherein the two hydroxy groups of formula I join to form an epoxide; -OCH2SCH2O-; -0C(=0)0~; 35 -OCH2O-; -OC(—S)0-; -0C(=0)C(=0)0-; -0C(CH3)20-; -OC( (CH2)3NH2) {CH3)0-; -OC <OCH3) (CH2CH2CH3) O-; or-0S(=0)0-. 9 LV 12374 "Stabie compound" and "stabie structure" are meant to indicate a compound that is sufficiently robust to survive isolation to a useful degree of puritv from a reaction nixture, and formulation into an efficacious therapeutic 5 aģent. Oniy stabie compounds are contempleted by the presenc ir.ver.i ion. "Substituted" is intended to indicate that one or more hydrogens on the atom indicated in the expression using "substituted" is replaced with a selection from the indicated 10 group(s), provided that the indicated atom's normai valencv is not exceeaed, and that the substitution results in a stabie compound. When a substituent is keto (i.e., =0) group, then 2 hvdrogens on the atom are replaced. "Therapeutically effective amount" is intended to 15 inciude an amount of a compound of the present invention or an amount of the combination of compounds claimed effective to inhibit HIV infection or treat the svmptoms of HIV infection in a host. The combination of compounds is preferablv a synergistic combination. Synergy, as described 20 for exampie bv Chou and Talalav, Adv. Enzvme Regul. 22:27-55 (1984), occurs when the effect (in this case, inhibition of KIV replication) of the compounds when administered in combination is greater than the additive effect of the compounds when administered alone as a single aģent. In 25 general, a svnergistic effect is most ciearly dēmonstratea at suboņtimal concentrations of the compounds. Synergy can be in terms of lower cytotoxicity, increased antiviral effect, or some other beneficial effect of the combination compared with the individual components. 30 Other features of the invention will become apparent in the course of the following descriptions of exemplary embodiments which are given for illustration of the invention. 35 Examples

Abbreviations used in the Examples are defined as follows: "°C" for degrees Celsius, "d“ for doublet, "dd" for 10 doublet of doublets, "eq" for equivalent or equivalents, "g" for gram or grams, "mg" for milligram or milligrams, "mL" for milliliter or milliliters, "H" for hydrogen or hydrogens, "hr" for hour or hours, "m" for multiplet, "M" for molar, 5 "min" for minūte or minūtes, "MHz" for megahertz, "MS" for mass spectroscopy, "nmr" or "NHR" for nuclear magnetic resonance spectroscopy, "t" for triplet, and "TLC" for thin layer chromatography. 10 EXĀMPLE 1

Praparation of (4R,5S,6S,7R)-Hexahydro-l-[5-(3-aminoindazole)methyl] -3-butyl-5,6-dihydroxy-4,7-bis [phenylmethyl] -2H-1,3-diazapin-2-one (I) . 15

λ

MeOTf, DCE refiux OMe

Compound A can be prepared by known methods. For example, preparation of compound A is shown in Scheme 1 of Rossano et al (Tetr. Lett. 1995, 36(28), 4967, 4968), the 20 contents of which are hereby incorporated by reference. An additional method of preparation of compound A is shown in Example 6 of U.S. Patent No. 5,530,124, the contents of which are hereby incorporated by reference. PART A: To a suspension of compound 1 (10.0 g; 27.3 25 mmol) in 1,2-dichloroethane (100 mL) was added methyltriflate (3.4 mL, 30 mmol). After refluxing overnight, the reaction was washed with sat. NaHC03, sat. NaCl, dried (Na2S04) and evaporated leaving 12.5 g of a yellow oil. Column chromatography (flash S1O2; 25% EtOAc/hexane) gavē 7.86 g of 30 compound 2 as a pale yellow oil which crystallized on standing (75% yield). m.p.= 97-100 °C. MH+ = 381. 11 LV 12374

PART B: To a solution of 1 (10.0 g, 26.3 mmol) in anhydrous DMF (30 ml) was added sodium hydride (1.58 g, 65.8 5 mmol). The reaction mixture was stirred at room temperature for 45 minūtes followed by dropwise addition of a solution of 1-iodobutane (9.68 g, 52.6 mmol) in anhydrous DMF (10 ml). After the addition, the stirring was continued at room temperature overnight. The reaction mixture was cooled to 0 °C 10 and methanol (5 ml) was added to quench excess sodium hydride. The mixture was partitioned between ethyl acetate (200 ml) and water (150 ml). The organic phase was separated and washed with water (4 x 100 ml), brine (100 ml) and dried over sodium sulfate. Flash chromatographic purification (25% 15 EtoAc/Hex.) gavē n-butyl isourea 2 ( 10.5 g, 92%yd): MS{NH3-CI/DDIP) (M+H+) 437.2 (100%) ; ΧΗ NMR(300 MHz, CDC13, 25 °C) δ 7.23 (m, 10H), 4.19 (m, 3H), 3.64 (m, 1H), 3.44 (s, 3H), 3.36 (m, 1H), 3.02 (m, 2H), 2.76 (m, 2H), 2.04 (m, 1H), 1.52 (s, 3H), 1.49 (s, 3H), 1.21 (m, 4H), 0.82 (t, J=7.0 Hz, 3H). 20 PART C: (4R,5S,6S,7R)-Hexahydro-l-[(3-cyano-4-fluorophenyl)methyl]-5,6-0-isopropylidene-4,7-bis-(4-phenylmethyl)-3-phenylmethyl-2H-l,3-diazapin-2-one (3).

12

To a solution of 2 ( 5.0 g, 11.5 mmol) in acetonitrile (40 ml) was added 4-fluoro-3-cyanobenzyl bromide (3.68 g, 17.25 mmol). The reactlon mixture was refluxed overnight. Afcer the solvent was removed under reduced pressure, the 5 residue was purified using flash chromatography ( 35%

EtoAc/Hex.) to give cyclic urea 3 as a white solid (4.5 g, 71% yd) : MS (NF.3-CI/DDIP) (M+H+) 556.3 (100%) ; ^-H NMR (300 MHz, CDCI3, 25 °C) 5 7.41 (m, 1H) , 7.28 (m, 7H) , 7.13 (d, J=S.2Kz, 2H), 7.05 (t, J=8.8 Hz, 1H) , 6.95 (d, J=9.2 Hz, 2H) , 4.50 (d, 10 J=14.0 Hz, 1H), 4.07 <m, 2H), 3.70 (m, 3H), 3.44 (t, J=7.7

Hz, 1H), 2.90 (m, 4H), 2.12 (m, 1H), 1.50 (s, 6H), 1.26 (m, 4H), 0.83 (t, J=7.0 Hz, 3H) . PART D: (4R,5S,6S,7R)-Hexahydro-l-[5-(3-15 aminoindazole)methyl]-3-butyl-5,6-dihydroxy-4, 7- bis[phenylmethyl]-2H-1,3-diazapin-2-one (I)

To a solution of 3 ( 4.5 g, 8.11 mmol) in n-butanol (20 ml) was added hydrazine hydrate ( 0.81 g, 16.2 mmol). The 20 mixture was refluxed for 6 hr. The solvent and excess hydrazine were removed under reduced pressure. The residue was dissolved in anhydrous methanol (20 ml) followed by the addition of 4 M HC1 in dioxane (2ml). The reaction mixture was stirred at room temperature for 2 hr. Methanol was 25 removed and the residue was partitioned betveen ethyl acetate (80 ml) and sodium bicarbonate (sat.) (50 ml). The organic phase was separated, washed with water (2x 50 ml) and dried over sodium sulfate (anhydrous). Flash chromatographic purification gavē I (3.0 g, 72% yd.) as a white solid: MP 30 129-131 °C; MS(NH3-CI/DDIP) (M+H+) 528.3(100%)/ HRMS calcd for C31H37N5O3+I 528.2975, found 528.2958; NMR(300 MHz, CD3OD, 25 °C) 5 7.19 (m, 12H) , 6.98 (d, J=1.5 Hz, 2H) , 4.74 (d, J=13.9 Hz, 1H), 3.85 (dd, J=10.25, 4.76 Hz, 1H), 3.65 (m, 1H), 3.56 (m, 4H), 3.15 (m, 2H), 2.96 (m, 3H), 2.07 (m, 2H), 35 1.37 (m, 2H), 1.22 (m, 2H), 0.84 (t, J=7.0, 3H). 13 LV 12374

Utility

The compounds of formula I possess HIV protease inhibitory activity and are therefore useful as antiviral aģents for the treatment of HIV infection and associated 5 diseases. The compounds of formula I possess HIV protease inhibitory activity and are effective as inhibitors of HIV growth. The ability of the compounds of the present invention to inhibit virai growth or infectivity is demonstrated in Standard assay of virai growth or 10 infectivity, for example, using the assay described below.

The compounds of formula I of the present invention are also useful for the inhibition of HIV in an ex vivo sample containing HIV or expected to be exposed to HIV. Thus, the compounds of the present invention may be used to inhibit HIV 15 present in a body fluid sample (for example, a serum or semen sample) which contains or is suspected to contain or be exposed to HIV.

The compounds provided by this invention are also useful as Standard or reference compounds for use in tests or assays 20 for determining the ability of an aģent to inhibit virai clone replication and/or HIV protease, for example in a pharmaceutical research program. Thus, the compounds of the present invention may be used as a control or reference compound in such assays and as a quality control Standard. 25 The compounds of the present invention may be provided in a commercial kit or Container for use as such Standard or reference compound.

Since the compounds of the present invention exhibit specificity for HIV protease, the compounds of the present 30 invention may also be useful as diagnostic reaģents in diagnostic assays for the detection of HIV protease. Thus, inhibition of the protease activity in an assay (such as the assays described herein) by a compound of the present invention would be indicative of the presence of HIV protease 35 and HIV virus.

As used herein ’^g" denotes microgram, "mg" denotes milligram, "g" denotes gram, "μΐ" denotes microliter, "mL" 14 denotes milliliter, "L" denotes liter, "nM" denotes nanomolar, ΜμΜ" denotes micromolar, "mM" denotes millimolar, "M" denotes molar and "nm" denotes nanometer. "Sigma" stands for the Sigma-Aldrich Corp. of St. Louis, MO. 5 HIV RNA Assav DNA Plasmids and in vitro RNA transcripts:

Plasmid pDAB 72 containing both gag and pol sequences of 10 BH10 (bp 113-1816) cloned into PTZ 19R was prepared according to Erickson-Viitanen et al. AIDS Research and Human Retroviruses 1989, 5, 577. The plasmid was linearized with Bam HI prior to the generation of in vitro RNA transcripts using the Riboprobe Gemini system II kit (Promega) with T7 15 RNA polymerase. Synthesized RNA was purified by treatment with RNase free DNAse (Promega), phenol-chloroform extraction, and ethanol precipitation. RNA transcripts were dissolved in water, and stored at -70°C. The concentration of RNA was determined from the A260· 20

Erofres:

Biotinylated capture probes were purified by HPLC after synthesis on an Applied Biosystems (Foster City, CA) DNA synthesizer by addition of biotin to the 5' termiņai end of '25 the oligonucleotide, using the biotin-phosphoramidite reaģent of Cocuzza, Tet. Lett. 1989, 30, 6287. The gag biotinylated capture probe (5-biotin-CTAGCTCCCTGCTTGCCCATACTA 3') was complementary to nucleotides 889-912 of ΗΧΒ2 and the pol biotinylated capture probe (51-biotin -CCCTATCATTTTTGGTTTCCAT 30 3' ) was complementary to nucleotides 2374-2395 of ΗΧΒ2.

Alkaline phosphatase conjugated oligonucleotides used as reporter probes were prepared by Syngene (San Diego, CA.).

The pol reporter probe (5' CTGTCTTACTTTGATAAAACCTC 3') was complementary to nucleotides 2403-2425 of ΗΧΒ2. The gag 35 reporter probe (5' CCCAGTATTTGTCTACAGCCTTCT 3') was complementary to nucleotides 950-973 of ΗΧΒ2. Ali nucleotide positions are those of the GenBank Genetic Seguence Data Bank 15 LV 12374 as accessed through the Genetics Computer Group Sequence Analysis Software Package (Devereau Nucleic Acids Research 1984, 12, 387). The reporter probes were prepared as 0.5 μΜ scocks in 2 x SSC (0.3 M NaCl, 0.03 M sodium citrate), 0.05 M 5 Tris pH 8.8, 1 mg/mL BSA. The biotinylated capture probes were prepared as 100 μΜ stocks in water.

Streotavidin coated plates:

Streptavidin coated plates were obtained from Du Pont 10 Biotechnology Systems (Boston, MA).

Celis and virus stocks:

MT-2 and MT-4 celis were maintained in RPMI 1640 supplemented with 5% fetal calf serum (FCS) for MT-2 celis or 15 10% FCS for MT-4 celis, 2 mM L-glutamine and 50 μg/mL gentamycin, ali from Gibco. HIV-1 RF was propagated in MT-4 celis in the same medium. Virus stocks were prepared approximately 10 days after acute infection of MT-4 celis and stored as aliquots at -70°C. Infectious titers of HIV-1(RF) 20 stocks were 1-3 x 10^ PFU (plaque forming units)/mL as measured by plaque assay on MT-2 celis (see below). Each aliquot of virus stock used for infection was thawed only once.

For evaluation of antiviral efficacy, celis to be 25 infected were subcultured one day prior to infection. On the day of infection, celis were resuspended at 5 x 10^ cells/mL in RPMI 1640, 5% FCS for bulk infections or at 2 x 10^/mL in Dulbecco1s modified Eagles medium with 5% FCS for infection in microtiter plates. Virus was added and culture continued 30 for 3 days at 37°C. HIV BNA assav:

Celi lysates or purified RNA in 3 M or 5 M GED were mixed with 5 M GED and capture probe to a final guanidinium 35 isothiocyanate concentration of 3 M and a final biotin oligonucleotide concentration of 30 nM. Hybridization was carried out in sealed U bottom 96 well tissue culture plates - 16 - (Nunc or Costar) for 16-20 hours at 37°C. RNA hybridizatior. reacticns were diluted three-fold with deionized water to a final guanidinium isothiocyanate concentration of 1 M and aiiquots (150 μL) were transferred to streptavidin coated microtiter plates wells. Binding of capture probe and capture probe-RNA hybrid to the immobilized streptavidin was allowed to proceed for 2 hours at room temperature, after which the plates were washed 6 times with DuPont ELISA plate wash buffer (phosphate buffered saline(PBS), 0.05% Tween 20.) A second hybridization of reporter probe to the immobilized complex of capture probe and hybridized target RNA was carried out in the washed streptavidin coated well by addition of 120 μι of a hybridization cocktail containing 4 X SSC, 0.66% Triton X 100, 6.66% deionized formamide, 1 mg/mL BSA and 5 nM reporter probe. After hybridization for one hour at 37°C, the plate was again washed 6 times.

Immobilized alkaline phosphatase activity was detected by addition of 100 μΐ^ of 0.2 mM 4-methylumbelliferyl phosphate (MUBP, JBL Scientific) in buffer5(2.5 M diethanolamine pH 8.9 (JBL Scientific), 10 mM MgCl2, 5 mM zinc acetate dihydrate and 5 mM N-hydroxyethyl-ethylene-diamine-triacetic acid}.

The plates were incubated at 37°C. Fluorescence at 450 nM was measured using a microplate fluorometer (Dynateck) exciting at 365 nM.

Microplate based compound evaluation in HIV-1 infected MT-2 celis:

Compounds to be evaluated were dissolved in DMSC and diluted in culture medium to twice the highest concentration to be tested and a maximum DMSO concentration of 2%. Further three-fold serial dilutions of the compound in culture medium were performed directly in U bottom microtiter plates (Nunc). After compound dilution, MT-2 celis (50 μΐΟ were added to a final concentration of 5 x 10^ per mL (1 x 10^ per well). Celis were incubated with compounds for 30 minūtes at 37®C in a C02 incubator. For evaluation of antiviral potency, an appropriate dilution of HIV-l (RF) vīrus stock (50 μΧ) was 17 LV 12374 added to culture wells containing celis and dilutions of the tēst compounds. The final volume in each well was 200 μΐ,. Eight wells per plate were left uninfected with 50 μΐ of medium added in place of virus, while eight wells were 5 infected in the absence of any antiviral compound. For evaluation of compound toxicity, parallel plates were cultured vithout virus infection.

After 3 days of culture at 37°C in a humidified chamber inside a C02 incubator, ali but 25 μΐ, of medium/well was 10 removed from the HIV infected plates. Thirty seven μΤ of 5 M GED containing biotinylated capture probe was added to the settled celis and remaining medium in each well to a final concentration of 3 M GED and 30 nM capture probe. Hybridization of the capture probe to HIV RNA in the celi 15 lysate was carried out in the same microplate well used for virus culture by sealing the plate with a plate sealer (Costar), and incubating for 16-20 hrs in a 37°C incubator. Distilled water was then added to each well to dilute the hybridization reaction three-fold and 150 μΐ, of this diluted 20 mixture was transferred to a streptavidin coated microtiter plate. HIV RNA was quantitated as described above. A Standard curve, prepared by adding known amounts of pDAB 72 in vitro RNA transcript to wells containing lysed uninfected celis, was run on each microtiter plate in order to determine 25 the amount of virai RNA made during the infection.

In order to standardize the virus inoculum used in the evaluation of compounds for antiviral activity, dilutions of virus were selected which resulted in an IC90 value (concentration of compound required to reduce the HIV RNA 30 Ievel by 90%) for dideoxycytidine (ddC) of 0.2 μg/mL. IC90 values of other antiviral compounds, both more and less potent than ddC, were reproducible using several stocks of HIV-1 (RF) when this procedure was followed. This concentration of virus corresponded to -3 χ 105 PFU {measured 35 by plaque assay on MT-2 celis) per assay well and typically produced approximately 75% of the maximum virai RNA Ievel achievable at any virus inoculum. For the HIV RNA assay, - 18 IC90 values were determined from the percent reduction of net signal (signal from infected celi samples minus signal from uninfected celi samples) in the RNA assay relative to the net signal from infected, untreated celis on the same culture 5 plate (average of eight wells). Valid performance of individual infection and RNA assay tests was judged according to three criteria. It was required that the virus infection should result in an RNA assay signal equal to or greater than the signal generated from 2 ng of pDAB 72 in vitro RNA 10 transcript. The IC90 for ddC, determined in each assay run, should be between 0.1 and 0.3 μg/mL. Finally, the plateau Ievel of virai RNA produced by an effective protease inhibitor should be less than 10% of the Ievel achieved in an uninhibited infection. A compound was considered active if 15 its IC90 was found to be less than ΙμΜ.

For antiviral potency tests, ali manipulations in microtiter plates, following the initial addition of 2X concentrated compound solution to a single row of wells, were performed using a Perkin Elmer/Cetus ProPette. 20

Dosaoe and Formulation

The antiviral compounds of this invention can be administered as treatment for virai infections by any means that producēs contact of the active aģent with the aģent*s 25 site of action, i.e., the virai protease, in the body of a mammai. They can be administered by any conventional means available for use in conjunction with pharmaceuticals, either as individual therapeutic aģents or in a combination of therapeutic aģents. They can be administered alone, but 30 preferably are administered with a pharmaceutical carrier selected on the basis of the chosen route of administration and Standard pharmaceutical practice.

The dosage administered will, of course, vary depending upon known factors, such as the pharmacodynamic 35 characteristics of the particular aģent and its mode and route of administration; the age, health and weight of the recipient; the nature and extent of the symptoms; the kind of 19 LV 12374 concurrent treatment; the frequency of treatment; and the effect desired. A daily dosage of active ingredient can be expected to be about 0.001 to about 1000 milligrams per kilogram of body weight, with the preferred dose being about 5 0.1 to about 30 mg/kg.

Dosage forms of compositions suitable for administration contain from about 1 mg to about 100 mg of active ingredient per unit. In these pharmaceutical compositions the active ingredient will ordinarily be present in an amount of about 10 0.5-95% by weight based on the total weight of the composition. The active ingredient can be administered orally in solid dosage forms, such as capsules, tablets and powders, or in liquid dosage forms, such as elixirs, syrups and suspensions. It can also be administered parenterally, 15 in sterile liquid dosage forms.

Gelatin capsules contain the active ingredient and powdered carriers, such as lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like. Similar diluents can be used to make compressed tablets. 20 Both tablets and capsules can be manufactured as sustained release products to provide for continuous release of medication over a period of hours. Compressed tablets can be sugar coated or film coated to mask any unpleasant taste and protect the tablet from the atmosphere, or enteric coated for 25 selective disintegration in the gastrointestinal tract.

Liquid dosage forms for oral administration can contain coloring and flavoring to increase patient acceptance.

In general, water, a suitable oil, saline, aqueous dextrose (glucose), and related sugar Solutions and glycols 30 such as propylene glycol or polyethylene glycols are suitable carriers for parenteral Solutions. Solutions for parenteral administration preferably contain a water soluble salt of the active ingredient, suitable stabilizing aģents, and if necessary, buffer substances. Antioxidizing aģents such as 35 sodium bisulfite, sodium sulfite, or ascorbic acid, either alone or combined, are suitable stabilizing aģents. Also used are citric acid and its salts, and sodium EDTA. In - 20 - addition, parenteral Solutions can contain preservatives, such as benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol. Suitable pharmaceutical carriers are described in Remington 's Pharmaceutical Sciences, supra, a Standard reference text in this field.

Useful pharmaceutical dosage-forms for administration of the compounds of this invention can be illustrated as follows:

Capsules A large number of unit capsules can be prepared by filling Standard two-piece hard gelatin capsules each with 100 mg of powdered active ingredient, 150 mg of lactose, 50 mg of cellulose, and 6 mg magnesium stearic.

Soft Gelatin Capsules A mixture of active ingredient in a digestible oil such as soybean oil, cottonseed oil or olive oil can be prepared and injected by means of a positive displacement pump into gelatin to form soft gelatin capsules containing 100 mg of the active ingredient. The capsules should then be washed and dried.

Tablets A large number of tablets can be prepared by conventional procedures so that the dosage unit is 100 mg of active ingredient, 0.2 mg of colloidal Silicon dioxide, 5 milligrams of magnesium stearate, 275 mg of microcrystalline cellulose, 11 mg of starch and 98.8 mg of lactose.

Appropriate coatings may be applied to increase palatability or delay absorption.

Suspension

An aqueous suspension can be prepared for oral administration so that each 5 ml contain 25 mg of finely divided active ingredient, 200 mg of sodium carboxymethyl - 21 LV 12374 cellulose, 5 mg of sodium benzoate, 1.0 g of sorbitol solution, U.S.P., and 0.025 mg of vanillin.

Tniectable 5 A parenteral composition suitable for administration by injection can be prepared by stirring 1.5% by weight of active ingredient in 10% by volume propylene glycol and water. The solution is sterilized by commonly used techniques. 10

Combination of comoonents (a) and (b)

Each therapeutic aģent component of this invention can independently be in any dosage form, such as those described above, and can also be administered in various ways, as 15 described above. In the following description component (b) is to be understood to represent one or more aģents as described previously. Thus, if components (a) and (b) are to be treated the same or independently, each aģent of component (b) may also be treated the same or independently. 20 Components (a) and (b) of the present invention may be formulated together, in a single dosage unit (that is, combined together in one capsule, tablet, powder, liquid, etc.) as a combination product. When component (a) and (b) are not formulated together in a single dosage unit, '25 component (a) may be administered at the same time as component (b) or in any order; for example component (a) of this invention may be administered first, followed by administration of component (b), or they may be administered in the reverse order. If component (b) contains more that 30 one aģent, e.g., one RT inhibitor and one protease inhibitor, these aģents may be administered together or in any order. When not administered at the same time, preferably the administration of component (a) and (b) occurs less than about one hour apart. Preferably, the route of 35 administration of component (a) and (b) is oral. The terms oral aģent, oral inhibitor, oral compound, or the like, as used herein, denote compounds which may be orally - 22 administered. Although it is preferable that component (aj and component (b) both be administered by the same route (that is, for example, both orally) or dosage form, if desired, they may each be administered by different routes 5 (that is, for example, one component of the combination product may be administered orally, and another component may be administered intravenously) or dosage forms.

As is appreciated by a medical practitioner skilled in the art, the dosage of the combination therapy of the 10 invention may vary depending upon various factors such as the pharmacodynamic characteristics of the particular aģent and its mode and route of administration, the age, health and weight of the recipient, the nature and extent of the symptoms, the kind of concurrent treatment, the frequency of 15 treatment, and the effect desired, as described above.

The proper dosage of components (a) and (b) of the present invention will be readily ascertainable by a medical practitioner skilled in the art, based upon the present disclosure. By way of general guidance, typically a daily 20 dosage may be about 100 milligrams to about 1.5 grams of each component. If component (b) represents more than one compound, then typically a daily dosage may be about 100 milligrams to about 1.5 grams of each aģent of component (b). By way of general guidance, when the compounds of component '25 (a) and component (b) are administered in combination, the dosage amount of each component may be reduced by about 70-80% relative tc the usual dosage of the component when it is administered alone as a single aģent for the treatment of HIV infection. 30 The combination products of this invention may be formulated such that, although the active ingredients are combined in a single dosage unit, the physical contact between the active ingredients is minimized. In order to minimizē contact, for example, where the product is orally 35 administered, one active ingredient may be enteric coated.

By enteric coating one of the active ingredients, it is possible not only to minimizē the contact between the - 23 LV 12374 combined active ingredients, but also, it is possible to control the release of one of these components in the gastrointestinal tract such that one of these components is not released in the stomach but rather is released in the 5 intestines.

Another embodiment of this invention where oral administration is desired provides for a combination product wherein one of the active ingredients is coated with a sustained-release material which effects a sustained-release 10 throughout the gastrointestinal tract and also serves to minimizē physical contact between the combined active ingredients. Furthermore/ the sustained-released component can be additionally enteric coated such that the release of this component occurs only in the intestine. Stili another 15 approach would involve the formulation of a combination product in which the one component is coated with a sustained and/or enteric release polymer, and the other component is also coated with a polymer such as a low viscosity grade of hydroxypropyl methylcellulose or other appropriate materiāls 20 as known in the art, in order to further separate the active components. The polymer coating serves to form an additional barrier to interaction with the other component. In each formulation wherein contact is prevented between components (a) and (b) via a coating or some other material, contact may ' 25 also be prevented between the individual aģents of component (b) .

Dosage forms of the combination products of the present invention wherein one active ingredient is enteric coated can be in the form of tablets such that the enteric coated 30 component and the other active ingredient are blended together and then compressed into a tablet or such that the enteric coated component is compressed into one tablet layer and the other active ingredient is compressed into an additional layer. Optionally, in order to further separate 35 the two layers, one or more placebo layers may be present such that the placebo layer is between the layers of active ingredients. In addition, dosage forms of the present - 24 invention can be in the form of capsules wherein one active ingredient is compressed into a tablet or in the form of a plurality of microtablets, pārticies, granules or non-perils, which are then enteric coated. These enteric coated 5 microtablets, pārticies, granules or non-perils are then placed into a capsule or compressed into a capsule alcng with a granulation of the other active ingredient.

These as well as other ways of minimizing contact between the components of combination products of the present 10 invention, whether administered in a single dosage form or administered in separate forms but at the same time or concurrently by the same manner, will be readily apparent to those skilled in the art, based on the present disclosure.

Pharmaceutical kits useful for the treatment of HīV 15 infection, which comprise a therapeutically effective amount of a pharmaceutical composition comprising a compound of component (a) and one or more compounds of component (b), in one or more sterile containers, are also within the ambit of the present invention. Sterilization of the Container may be 20 carried out using conventional sterilization methodology weil known to those skilled in the art. Component (a) and component (b) may be in the same sterile Container or in separate sterile containers. The sterile containers of materiāls may comprise separate containers, or one or more '25 multi-part containers, as desired. Component (a) and component (b), may be separate, or physically combined into a single dosage form or unit as described above. Such kits may further include, if desired, one or more of various conventional pharmaceutical kit components, such as for 30 example, one or more pharmaceutically acceptable carriers, additional vials for mixing the components, etc., as will be readily apparent to those skilled in the art. Instructions, either as inserts or as labels, indicating quantities of the components to be administered, guidelines for administration, 35 and/or guidelines for mixing the components, may also be included in the kit. - 25 LV 12374

Obviously, numerous modifications and variations of the present invention are possible in light of the above teachings. It is therefore to be understood that within the scope of the appended claims, the invention may be practiced 5 otherwise than as specifically described herein. - 26 LV 12374 WE CLAIM; A compound of formula I:

or a pharmaceuticallv acceptable salt or prodrug form thereof, wherein a prodrug of formula I is a compound wherein the two hyaroxy groups join to form an epoxide, -OCH2SCK2O-, -0C(=0)0-, -OCK2O-, -0C(=S)0-, -0C(=0)C(=0)0-, -OC(CK3)20-, -OC((CK2)3NK2) (CH3)0-, -OC(OCH3) (CH2CH2CH3 ) 0-, or -0S(=0)0-group. 2. A compound according to Claim 1, wherein the compound is of formula I. 3 . A pharmaceutical composition comprising a pharmaceuticallv acceptable carrier and a therapeutically effective amount of a compound of Claim 1 or a pharmaceuticaliv acceptable salt or prodrug form thereof. 4. A composition according to Claim 3, wherein the compound is of formula I. 5. Use of a compound of formula I or a pharmaceuticallv acceptable salt or prodrug form thereof for the manufacture of a medicament for treating HIV infection: - 27

wherein a orodrug of formula I is a coirround wherei^

- - - —u ,vO hydroxy groups join to form an epoxide, -OCK2SCH2G-, -0C(=0)0-, -OCH2O-, -0C(=S)0-, -0C(=0)C(=0)0-, -0C(CH3) 20-, -OC((CH2)3NK2)(CH3)0-, -OC(OCH3)(CH2CK2CK3)0-, or -OS(=0)0-group. 6. A use according to Claim 5, wherein the compound is of formula I. 7. Use of a combinatior, of (a) and (b) for the manufacture of a medicament for treating HIV infection, wherein: (a) is a compound of formula I or a pharmaceucicallv accepcable salt or prodrug form thereof:

wherein a prodrug of formula I is a compound wherein the two hydroxy groups join to form an epoxide, -OCH2SCH20-, -0C(=0)0-, -OCH2O-, -0C(=S)0-, -0C{=0)C(=0)0-, -0C(CH3);0-, -OC { (CH2 ) 3NH2) (CH3 ) 0-, -0C (0CK3 ) (CH2CH2CK3 ) O-, or -OS (=0)0-group, and (b) is at ieast one compound selecced from the group consisting of ΚΓ7 reverse transcriptase inhibitors and HIV protease inhibitors. 8. A use according to Claim 7, wherein the compound is of formula I. 28 -29- LV 12374 9. A use according to Claim 7, wnerein the reverse anscripcass mnibitor is a nucleoside reverse transcriocase inhibitor. 10. A use according to Claiiti 9, wherein the nucleoside reverse transcriptase inhibitor is selected from AZT, 3TC, ddl, ddC, and d4T and the protease inhibitor is selected from sacrumavir, ritonavir, indinavir, VX-478, nelfinavir, KNI-272, CGP-61755, and U-103017. 10 15 11· A use according to Claim 10, wherein the nucleoside reverse transcriptase inhibitor is selected from AZT and 3TC and the protease inhibitor is selected from sacuinavir, ritonavir, ānd indinavir. 12· A. use according to Claim 11, wherein the nucleoside reverse transcrĪDtase inhibitor is AZT. 13. A use according to Claim 11, wherein the protease 20 inhibitor is indinavir. 14. a pharmaceutical kit useful for the treatment of KIV infection, vhich comprises a therapeutically effective amount of: 25 (a) a compound of Claim 1; and, (b) at ieast one compound selected from the group consisting of HZV reverse transcriptase inhibitors and HIV protease inhibitors, in one or more sterile containers. 30 15. A kit according to Claim 14, wherein component (a) is a compound cf formula I. 29

Claims (15)

A compound of the formula I o Characterized in that the precursor of formula I is a compound in which two oxygroups are bonded to form an epoxy, -OCH2SCH20-, -00 (= O) 0-, -0CH2O, -0C (= S) 0-, -00 (= O) 0 (= O) 0-, -OC (CH3) 20-, -OC ((CH2) 3NH2) (CH3) 0-, - 0C (OCH3) (CH2CH2CH3) 0- or -O (= O) 0-. 2. A compound according to claim 1, wherein the compound corresponds to formula I. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of a compound of claim 1 or a pharmaceutically acceptable salt or prodrug thereof. 4. A composition according to claim 3, wherein the compound corresponds to formula I. A compound of formula I or a pharmaceutically acceptable salt or prodrug thereof, characterized in that the precursor of formula I is a compound in which two oxygroups are bonded to form an epoxide, -OCH2SCH20-, -OC (= O) -O-, -OCH20-, -0C (= S) 0-, -C (= O) C (= O) 0-, -C (CH3) 20-, -C ((CH2) 3NH2) (CH3) 0-, -0C (0CH3) (CH2CH2CH3) 0- or -S (= O) 0-, for use in the manufacture of a medicament for the treatment of HIV (human immunodeficiency virus) infection. Use according to claim 5, wherein the compound corresponds to formula I. Use of combination (a) and (b) for the manufacture of a medicament for treating HIV infection, characterized in that (a) is a compound of formula I or a pharmaceutically acceptable salt or prodrug form of this compound, characterized in that the precursor of formula I is a compound in which two oxygroups are bonded to form an epoxide, -OCH2SCH2O-, -OC (= O) 0-, -OCH2O-, -0C (= S) 0-, -OC (= O) C (= O) 0-, -OC (CH3) 20-, -C ((CH2) 3NH2) (CH3) 0-, -OC (OCH3) (CH2CH2CH3 ) 0- or -OS (= O) 0-, and (b) at least one compound selected from the group consisting of HIV reverse transcriptase (revertase) inhibitors and HIV protease inhibitors. Use according to claim 7, wherein the compound corresponds to formula I. 9. The method of claim 7, wherein the reverse transcriptase inhibitor is a nucleoside reverse transcriptase inhibitor. LV 12374 10. The method of claim 9, wherein the nucleoside reverse transcriptase inhibitor is selected from A2T, 3TC, ddl, ddC and d4T and the protease inhibitor is selected from saquinavir, ritonavir, indinavTra, VX-478,. nelfinavir, KNI-272, CGP-61755 and U-103017. Use according to claim 10, wherein the nucleoside reverse transcriptase inhibitor is selected from AZT and 3TC and the protease inhibitor is selected from saquinavir, ritonavir and indinavir. 12. The method of claim 11, wherein the nucleoside reverse transcriptase inhibitor is AZT. 13. The method of claim 11, wherein the protease inhibitor is indinavir. A pharmaceutical kit for treating HIV infection comprising (a) a compound of claim 1; and (b) a therapeutically effective amount of at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors in one or more sterile vials. 15. The kit of claim 14, wherein component (a) is a compound of formula I.