RU2268935C2 - Method for construction of genetically modified microorganism strain - Google Patents

Abstract

FIELD: biotechnology, biochemistry, genetic engineering.

SUBSTANCE: invention proposes a method for construction of genetically modified strains of microorganisms able to destroy steroids. These strains comprise multiple inactivated genes, for example, genes encoding enzymes steroid dehydrogenases implicated in destroying the steroid ring. The gene kstD1 is an example of such genes. Strains comprising the multiple amount of inactivated genes encoding enzymes destroying steroids provides the enhanced effectiveness with respect to accumulation of intermediate steroid compounds. The preferable product of steroid accumulation if 9α-hydroxy-4-androstene-3,17-dione.

EFFECT: improved method for construction of strain.

8 cl, 5 dwg, 7 ex

Description

The present invention relates to a method for producing genetically modified microorganisms having the ability to inhibit the nuclear decay of steroids, to the use of such microorganisms for the accumulation of steroids, and also to the accumulation of such modified microorganisms.

The ability to destroy phytosterols is widespread among nocardioform actinomycetes and requires a set of enzymes that destroy the side chain and structure of the steroid nucleus.

The enzyme 3-ketosteroid Δ ^1- dehydrogenase (KSTD) [4-en-3-oxosteroid: (acceptor) -1-en-oxidoreductase, EC 1.3.99.4] is involved in the breakdown of ring B of the steroid nucleus as a result of the introduction of a double bond in position C1 -C2. More specifically, this enzyme is involved in the conversion of 4-androsten-3,17-dione to 1,4-androstadiene-3,17-dione and 9α-hydroxy-4-androsten-3,17-dione to 9α-hydroxy-1, 4-androstadien-3.17-dione (see Figure 1). This enzyme was identified in several bacteria: Arthrobacter simplex (Penasse and Peyre, 1968 Rhodococcus. Crit. Rev. Biotech. 14: 29-73), Pseudomonas (Levy and Talalay, 1959 J. Biol. Chem. 234: 2009-20013; 1959 J. Biol. Chem. 234: 2014-2021), Nocardia restrictus (Sih and Bennet, 1962 Biochem. Biophys. Acta 56: 587-592), Nocardia corallina (Itagaki et al., 1990 Biochim. Biophys. Acta 1038: 60 -67), Nocardia opaca (Drobnič et al., 1993 Biochim, Biophys. Res. Comm. 190: 509-515), Mycobacterium fortuitum (Wovcha et al., 1979 Biochim. Biophys. Acta 574: 471-479) and Rhodococcus erythropolis IMET7030 (Kaufmann et al., 1992 J. Steroid. Biochem. Molec. Biol. 43: 297-301). KSTD N. opaca has been characterized as a flavoprotein (Lestrovaja et al., 1978 Z. Allg. Microbiol. 18: 189-196). Only genes encoding KSTD in A. simplex, Comamonas testosteroni, and Rhodococcus rhodochrous (Plesiat et al., 1991 J. Bacteriol. 173: 7219-7227; Molnár et al., 1995 Mol. Microbiol. 15: 895-905; Morii et al., 1998 J. Biochem. 124: 1026-1032).

Exceptional inhibition of steroid 1,2-dehydrogenase leads to the accumulation of 9α-hydroxy-4-androsten-3,17-dione, the best starting material for corticoid synthesis (Kieslich K., 1985 J. Basic Microbiol. 25: 461-474). 9α-Hydroxyandrogens are industrially important as antiandrogens, antiestrogens and contraceptives. The 9α-hydroxy group is easily dehydrated to 9 (11) -dehydrosystems and is the initial structure for the formation of 9α-halogen-corticoids.

Rhodococcus species are widely known for their great catabolic potential (Warhurst and Fewson, 1994 Rhodococcus. Crit. Rev. Biotech. 14: 29-73; Bell et al., 1998 J.Appl. Microbiol. 85: 195-210). Some types of Rhodococcus are able to break down natural phytosterols, which are an inexpensive starting material for bioactive steroids (Kieslich K., 1986 Drug Res. 36: 888-892). Strains of Rhodococcus and Mycobacterium, treated with mutagens and / or grown together with enzyme inhibitors, convert sterols to 4-androsten-3,17-dione and 1,4-androstadien-3,17-dione (Martin, 1977 Adv. Appl. Microbiol. 22: 29-58).

с соавт., 1993 Biochem. Biophys. Res. Comm. 190:509-515) (синоним R.erythropolis IMET7030) известна (DDBJ/EMBL/GenBank U59422), о молекулярной характеристике данного гена не сообщалось. Активность KSTD существенна для ядерного распада стероидов, а инактивации гена kstD необходима для накопления промежуточных стероидных соединений. В соответствии с одним аспектом настоящего изобретения создана нуклеотидная последовательность гена kstD R.erythropolis. Белок KSTD1 кодируется нуклеотидами 820-2329 из SEQ ID NO:1.Although kstQ cloning and expression of the inactive KSTD protein of R. erythropolis IMET7030 in Escherichia coli has already been described (Wagner et al., 1992 J. Basic Microbiol. 32: 65-71, 1992 J. Basic Microbiol. 32: 269-277), and the nucleotide N. race sequence (

et al., 1993 Biochem. Biophys. Res. Comm. 190: 509-515) (synonym for R.erythropolis IMET7030) is known (DDBJ / EMBL / GenBank U59422), no molecular characterization of this gene has been reported. KSTD activity is essential for the nuclear decay of steroids, and inactivation of the kstD gene is necessary for the accumulation of intermediate steroid compounds. In accordance with one aspect of the present invention, a nucleotide sequence of the kstD gene of R.erythropolis is provided. The KSTD1 protein is encoded by nucleotides 820-2329 from SEQ ID NO: 1.

Gene inactivation is a powerful tool for analyzing gene function and for introducing metabolic blocks. Gene disruption by a non-replicative vector carrying a selective marker is a commonly used method for gene inactivation. The construction of strains with the desired properties is achieved through the creation of a metabolic pathway, however, it may be necessary to gradually inactivate or replace several genes. This is possible only if there is a suitable method for introducing unmarked gene deletions or gene substitutions, which allows technologically creating endless metabolic variants without the participation of multiple markers. In accordance with a second aspect of the present invention, a stepwise inactivation scheme for genes, preferably dehydrogenase genes involved in steroid degradation, is developed. In particular, the present invention is applicable for the inactivation of genes involved in the accumulation of 9α-hydroxy-4-androsten-3,17-dione, due to the growth of microorganisms on 4-androsten-3,17-dione. Preferably, at least the kstD1 gene is inactivated.

It was unexpectedly found that the destruction of the kstD1 gene encoding 3-ketosteroid Δ ¹ -dehydrogenase in R.erythropolis SQ1 does not lead to inactivation of the nuclear decay of steroids. Residual activity is due to the presence of a second enzyme. It has now been established that in order to obtain a strain with a completely blocked nuclear decay of steroids, more than one gene must be inactivated. Preferably, the second enzyme is a dehydrogenase, more preferably a KSTD isoenzyme. In order to be able to destroy or remove several genes, a site directed mutagenesis method can preferably be used. A method for introducing unlabelled gene deletions is preferred for the stepwise inactivation of KSTD genes. The resulting genetically modified strains should not contain heterologous DNA.

According to a second preferred embodiment of the present invention, at least the kstD2 gene is inactivated. More preferably, both kstD1 and kstD2 genes are inactivated. Another aspect of the present invention is the nucleotide sequence of the kstD2 gene from R.erythropolis. The KSTD2 protein is encoded by nucleotides 1-1678 of SEQ ID NO: 5.

No methods have been reported for introducing unlabelled gene deletions into cells of the genus Rhodococcus. However, gene deletion or gene substitution methods have been described for several other actinomycetes, namely Streptomyces (Hillemann et al., 1991 Nucleic Acid Res. 19: 727-731; Hosted and Baltz, 1997 J. Bacteriol. 179: 180 -186), Corynebacterium (Schäfer et al., 1994 Gene 145: 69-73) and Mycobacterium (Marklund et al., 1995 J. Bacteriol. 177: 6100-6105; Norman et al., 1995 Mol. Microbiol. 16: 755-760; Sander et al., 1995 Mol. Microbioi. 16: 991-1000; Pelicic et al., 1996 Mol. Microbiol. 20: 919-125; Knipfer et al., 1997 Plasmid 37: 129-140). Counter-selective markers can be used to screen for a rare second recombination event leading to a gene deletion or gene replacement. In this regard, both sacB and rpsL have proven to be useful reporter genes (Hosted and Baltz, 1997 J. Bacteriol. 179: 180-186; Schäfer et al., 1994 J. Bacteriol. 172: 1663-1666; Sander et al., 1995 Mol Microbiol. 16: 991-1000; Pelicic et al., 1996 Mol. Microbiol. 20: 919-125; Jäger et al., 1992 J. Bacteriol. 174: 5462-5465), but other suitable markers may also be used. . The use of rspL in Rhodococcus has not been reported, but sacB (coding for Bacillus subtilis levansaccharase) is a strong positive selective marker for this biological genus (Jäger et al. 1995 FEMS Microbiol. Lett. 126: 1-6; Denise-Larose et al., 1998 Appl. Environ. Microbiol. 64: 4363-4367).

Levansaccharase B. subtilis, encoded by the sacB gene, catalyzes the hydrolysis of sugars and the synthesis of levans (high molecular weight fructose polymers). Expression of sacB in the presence of sucrose is lethal to Rhodococcus. The biochemical basis of the toxicity of the levansaccharose action on sucrose is still unknown. Mortality (i.e., the presence or absence of sucrose) due to the sacB gene can therefore be used as a counter-selective marker. Counter-selection in this context means that the expression of this marker is lethal, and not increasing resistance, as, for example, in the case of selective markers (for example, resistant markers).

Counter-selection is needed to select those mutants that undergo a second recombination event, while losing the sacB marker and introducing the desired mutation. The advantage of this system is that only the most suitable mutants will survive during the selection. Compared to a system that uses only one selective marker, counter-selection avoids the time-consuming screening process, as the resistance marker that is needed for a system with one selective marker is lost.

The advantage of an unlabelled mutation is that it allows the reintroduction of mutations into the same strain. Foreign DNA (vector DNA) is removed during the introduction of this mutation. The newly introduced vector DNA intended for introducing the second mutation cannot for this reason integrate into the site of the previous mutation (by homologous recombination between vector DNAs). Integration will undoubtedly happen if vector DNA is still present on this chromosome and gives rise to a large number of false positive integration products. This system allows the use of a separate antibiotic gene to introduce an infinite number of mutations. An unlabelled mutation makes it easy to use it in industry, since the absence of heterologous DNA makes it easy to remove the fermentation broth.

Inactivation of a gene as a result of a deletion of a gene allows the creation of stable, non-reversing mutants. Mostly small genes (<500 bp) are more easily inactivated by gene deletion compared to gene destruction resulting from single recombination integration. Mutagenesis by gene deletion can also be used to inactivate a cluster of several genes from the genome. The method of mutagenesis by gene deletion can also be used to replace a gene (for example, replacing a wild-type gene with a mutant gene).

A preferred strain for mutagenesis of catabolic steroid dehydrogenase genes is Rhodococcus erythropolis. At the same time, in other species, an unmarked deletion of the kstD1 and / or kstD2 gene may occur by genetic conjugation if their molecular organization is the same (or similar) as that of R.erythropolis SQ1. These species preferably belong to the genus Rhodococcus, but closely related species such as Nocardia, Mycobacterium and Arthrobacter can also be used.

Gene inactivation in Rhodococcus is difficult when illogical recombination events occur that lead to random genomic integration of a given mutagenic vector (Desomer et al., 1991 Mol. Microbiol. 5: 2115-2124; Barnes et al., 1997 J. Bacteriol. 179: 614545 -6153), a phenomenon that the inventors encountered when trying to destroy the kstD1 gene in R.erythropolis SQ1. Illogical recombination is also a well-known phenomenon in some slowly growing Mycobacterium species (McFadden, 1996 Mol. Microbiol. 121: 205-211). Conjugative transfer of a plasmid from E. coli S17-1 to Rhodococcus has been shown to minimize random integration (Powell and Archer, 1998 Antinie van Leeuwenhoek 74: 175-188). The possibility of co-conjugative mobilization of plasmids from E. coli strain S17-1 to many different strains of coryneform bacteria and to Rhodococcus fascians DSM20131 (Schäfer et al., 1990 J. Bacteriol. 172: 1663-1666; Jäger et al., 1995 FEMS Microbiol has been proven. Lett. 126: 1-6). In accordance with the present invention, the conjugative transfer of a mutagenic vector carrying the sacB gene as a counter-selective marker is therefore used to introduce unmarked gene deletion into steroid catabolism in R.erythropolis SQ1.

As an additional embodiment of the present invention, the introduction of the second gene inactivation event is performed using the same methods that are discussed in the Examples for the kstD2 gene. For further gene inactivation, the same methods or UV irradiation or chemicals such as nitroguanidine or diepoxyethane can again be used. Methods for introducing gene mutations in this way are well known in the art.

Methods for creating carriers used in the mutagenesis protocol are also well known (Sambrook et al., Molecular Cloning: a Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, latest edition). In addition, techniques for site-directed mutagenesis, ligation of additional sequences, PCR, DNA sequencing and the creation of suitable expression systems are also currently well known in the art. Parts or all of the DNA encoding the desired protein can be created as a result of synthesis using standard solid-phase techniques, mainly to include restriction sites that facilitate ligation.

Modifications and variations of this method for introducing broken gene mutations or unmarked gene deletions, as well as transformation and conjugation, will be understood by those skilled in the art from the previous detailed description of the present invention. It is understood that such modifications and variations are within the scope of this application.

In accordance with another aspect of the present invention, microorganisms having multiple inactivated genes can be used to accumulate steroid intermediates. The accumulated product is predominantly 9α-hydroxy-4-androsten-3,17-dione. This starting material may depend on the presence of enzyme genes that are inactivated. Suitable starting materials are, for example, phytosterols or 4-androsten-3,17-dione. A preferred starting material is 4-androsten-3,17-dione.

The advantage of the presented method is that it is possible to provide highly efficient conversion of the starting steroid to the desired accumulated product. Its yield can exceed 80%, preferably more than 90% and often reaches a value of almost 100%.

Another aspect of the present invention relates to genetically modified microorganisms with many inactivated genes that are involved in steroid degradation. In particular, these genes are dehydrogenases. Preferably, at least the kstD1 or kstD2 gene is inactivated. Inactivation of both kstD1 and kstD2 genes is more preferred. Preferred are microorganisms belonging to the genus Rhodococcus. Most preferred is a strain of Rhodococcus erythropolis RG1-UV29.

Microorganism strains Rhodococcus erythropolis RG1-UV29 and Rhodococcus erythropolis RG1 were deposited with Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ), Mascheroder Weg 1b, D-38124 Braunschweig, 13 were used for DSM15, number 7 and 15 were used. with the Budapest Treaty.

Professionals should understand how to use methods and substances to create microorganisms that lose the ability to destroy the steroid nucleus described in this document and referred to. In a similar manner, many genes encoding several other enzymes that destroy the steroid nucleus can be inactivated.

The following examples are illustrative of the present invention and should in no way be interpreted as limiting the scope of the present invention.

Description of drawings

Figure 1

Schematic representation of the nuclear decay of steroids in R.erythropolis SQ1. The location of the isoenzymes KSTD1 and KSTD2 of the enzyme 3-ketosteroid Δ ^1- dehydrogenase (KSTD) is indicated.

Figure 2

Schematic representation of the mutagenic vector pSDH422 together with the counter-selective sacB marker used to create the strain Rhodococcus erythropolis RG1, with 1062 bp unmarked deletion of the kstD1 gene. ORF2 and ORF3 are the flanking genes of the R.erythropolis SQ1 kstD1 gene.

Figure 3

Schematically presented general molecular organization of the kstD1 gene in the wild-type strain R.erythropolis SQ1 and after inclusion of pSDH422 using a single crossing over, respectively, on the right (strain SDH422-3) and left locus of the target (strain SDH422-4) kstD1. Insert window: Southern analysis using kstD1 as a probe, where wild-type R.erythropolis chromosomal DNA (lane 1) is disengaged by BamHI, strain SDH422-3 (lane 2), SDH422-4 (lane 3) and two separate deletion mutants kstD1 (lanes 4 and 5).

Figure 4

, -Х-).Bioconversion of 4-androsten-3,17-dione to 9α-hydroxy-4-androsten-3,17-dione in a 6-liter culture of Rhodococcus erythropolis SQ1 UV29. 10 g / l AD (-O-) and 20 g / l AD (-Δ-,

, -X-).

Figure 5

Bioconversion of 4-androsten-3,17-dione to 9α-hydroxy-4-androsten-3,17-dione in a 6-liter culture of Rhodococcus erythropolis RG8. 10 g / l AD (-Δ-, -X-).

Examples

Example 1

KstD1 Feature

Degenerate oligonucleotide probe kstD [5 'ttcgg (c / g) gg (c / g) ac (c / g) tc (c / g) gc (c / g) tactc (c / g) gg (c / g) gc (c / g) tc (c / g) atctgg] (SEQ ID NO: 2) was created from the aligned N-terminal parts of the known KSTD protein sequences of A. simplex, C. testosteroni and N. race. After cleavage of the total DNA of R.erythropolis SQ1 with BglII restriction enzyme, the fragment size was determined by sucrose gradient centrifugation. Southern analysis at 68 ° C (washing under stringent conditions with 2 × SSC for 2 × 15 min and 0.1 × SSC for 2 × 10 min) of the obtained fractions gives 6 kb. DNA fragment hybridizing with a labeled dioxygenin kstD oligonucleotide probe. This fragment is ligated to the Rhodococcus-E.coli BglII site of shuttle vector pDA71 (Dabs et al. 1995 Development of improved Rhodococcus plasmid vectors and their use in cloning genes of potential commercial and medical importance, p.129-135. B: Proceedings of the Ninth Symposium on the Actinomycetes, Moscow, Russia) and subcloned into the BamHI digested plasmid pBluescript II KS (Stratagene) (pSDH200).

According to the results of restriction mapping analysis, the inventors concluded that only one EcoRV site is present in the indicated 6 kb. a fragment dividing it into equally sized fragments, approximately 3 kb Southern analysis indicates that the EcoRV fragment of pSDH200 is about 2.9 kb in size. contains sequences homologous to the kstD olinucleotide. Nucleotide sequencing detects an open reading frame of 1.533 N. (kstD1, see SEQ ID NO: 1) encoding KSTD1, as demonstrated by heterologous expression in Escherichia. Further nucleotide sequencing allows you to detect two ORF - 1,533 N. (ORF1) and 627 n. (ORF2) encoding putative proteins of 510 amino acids and 208 amino acids, respectively.

Example 2

Strain with deletion kstD1.

A mutagenic vector was constructed that contains a fragment of the chromosomal DNA of R.erythropolis SQ1 with a deletion of kstD1. 1062 bp The bsmI fragment of pSDH200 encoding most of the interior of KSTD1 is deleted to create the pSDH200) BsmI. In order to create a mutagenic vector of 2724 bp SmaI / EcoRI fragment from pSDH200) BsmI anchoring 468 bp the kstD1 residue and its flanking regions are cloned into the SmaI / EcoRI site pK18mobsacB (pSDH422, see Figure 2). The pSDH422 vector encoding resistance to kanamycin was selected to integrate this mutagenic vector into the chromosome, and the anchor sacB gene from B. subtills, intended for counter-selection, was introduced into E. coli S17-1 and mobilized in R.erythropolis SQ1 by conjugation as follows . Cells of the recipient strain of R.erythropolis SQ1 are distributed on LBP agar with the addition of 30 μg · m ^-1 nalidixic acid and grow them for 5 days. The mutagenic vector pSDH422 was first introduced into E. coli S17-1 by transformation.

Transformants (approximately 1000 per cup) grown overnight in selective medium (25 μg · ml ^-1 kanamycin) are incubated at room temperature for the next 24 hours. Colonies of both strains, Rhodococcus and E. coli, are resuspended in a final volume of 1 5 ml LBP (1% bactopeptone (Difco), 0.5% yeast extract (BBL) and 1% NaCl). Aliquots of 750 μl from each strain are mixed and gently precipitated by centrifugation. The resulting cell pellet was resuspended in 1 ml of LBP, and the cells were distributed on non-selective LBP agar in the form of 250 μl aliquots. After growing overnight at 30 ° C, the resulting co-grown material is resuspended in 2 ml of LBP medium and 100 μl aliquots are dispensed onto LBP agar with kanamycin (200 μg · ml ^-1 ) and nalidixic acid (30 μg · ml) ^-1 ). After 3 days, transconjugates of R.erythropolis SQ1 appear. All obtained Rhodococcus transconjugates resistant to kanamycin (kan ^r ) were sensitive to sucrose (suc ^s ); growth after receiving a replica on LBPS agar (1% bactopeptone, 0.5% yeast extract, 1% NaCl, 10% sucrose) with the addition of 200 μg · ml ^-1 kanamycin did not occur.

Southern analysis (FIG. 3) of wild-type microorganisms (lane 1: single lane approximately 4500 bp) and two transcojugates, SDH422-3 (lane 2: two lanes approximately 2900 and 10100 bp) and SDH422-4 (lane 3: two bands of approximately 4000 and 9000 bp) discovers that both types of strains have one copy of pSDH422 included in the target locus due to a single recombination event. The kstD1 gene deletion obtained in R.erythropolis strain SDH422-3 after night growth under non-selective conditions becomes visible after passaging the cell culture on selective medium, i.e. on LBSP agar.

Deletion of the kstD1 gene is achieved after overnight growth under non-selective conditions and subsequent passaging of the cell culture on a selective medium, i.e. on LBPS agar. Colony PCR using kstD1-primers (forward primer [5 'gcgcatatgcaggactggaccagcgagtgc] (SEQ ID NO: 3); reverse primer [5' gcgggatccgcgttacttcgccatgtcctg] (SEQ ID NO: 4)) for 9 suc ^r / kan ^s -koloniyax gives 6 PCR products with a fragment size of 468 bp including the deleted kstD1 gene. Gene deletion was confirmed by Southern analysis at 60 ° C (washing under stringent conditions with 2 × SSC for 2 × 5 min and 0.1 SSC for 2 × 5 min) using a randomly labeled kstD1 gene as a probe dioxygenin. 4.5 kb The kstD1 wild-type DNA fragment obtained after cleavage of the BamHI chromosomal DNA was reduced to 3.4 kb. in mutants with a gene deletion, indicating a putative deletion of a kstD1 DNA fragment of 1062 bp in size. This resulting strain was named R.erythropolis RG1.

Example 3

Inactivation of steroid Δ ¹ dehydrogenation in UV mutagenesis.

Cells (2 · 10 ⁸ CFU · ml ^-1 ) of late exponential R.erythropolis RG1 grown in 10 mM glucose-mineral medium (K ₂ NRA ₄ 4.65 g · l ^-1 , NaH ₂ PO ₄ · H ₂ O 1, 5 g · l ^-1 , NH ₄ Cl 3 g · l ^-1 , MgSO ₄ · 7H ₂ O g · l ^-1 , Vishniac trace elements, pH 7.2), are subjected to ultrasonic treatment for a short period of time to obtain single cells. Diluted (10 ⁴ ) samples are distributed on glucose-mineral agar medium and irradiated for 15-20 seconds with a UV lamp (Philips TAW 15W) at a distance of 27 cm, which on average leads to 95% cell death. After 4 days of incubation, the colonies are placed on a mineral agar medium containing 4-androsten-3,17-dione (0.5 g · l ^-1 dissolved in DMSO (50 mg · ml ^-1 )). After 3-4 days, growth-defective mutants on the steroid are selected for further characterization. To select strains blocked by Δ ¹ dehydrogenation, the obtained mutant population was screened for mutants with defective growth on 4-androsten-3,17-dione, capable of growing on a mineral agar medium containing 1,4-androstadiene-3,17- dione (0.25 g · l ^-1 ). Based on this, it was concluded that the corresponding gene is inactivated. This gene was called kstD3 (see Figure 1).

Example 4

Microbiological 9α-hydroxylation of 4-androsten-3,17-dione using UV mutants Rhodococcus erythropolis UV-29.

Rhodococcus erythropolis SQ1 UV-29 is a UV mutant that is able to convert 4-androsten-3,17-dione (AD) to 9α-hydroxy-4-androsten-3,17-dione (9αOH-AD) with a concentration of 10 up to 20 g / l.

This conversion is carried out using the following method.

In a 250 ml Erlenmeyer flask containing 75 ml of sterile medium (1.5% yeast extract, 1.5% glucose; pH 7.0), on a rotary shaker (180 rpm) for 24 hours grown at 28 ° С Rhodococcus erythropolis SQ1 UV-29 (preculture). A preculture (1%) is inoculated into a 10-liter fermenter, with 6 liters of sterile culture fluid (1.5% yeast extract, 1.5% glucose, 0.01% antifoam agent propylene glycol; pH 7.5) and incubated at 28 ° C for 16 hours while sparging with sterile air, while the culture is mixed to stimulate deep growth. A suspension of 60 grams of 4-androsten-3,17-dione in 300 ml of polysorbate (0.1%) is then administered. Then continue aerobic incubation with stirring at 28 ° C for 24 hours. The obtained culture samples were extracted with methanol (70%) and filtered through a 0.45 μm blank filter before determining the steroid composition using HPLC. The same operation is carried out in triplo (three times) with a double concentration of AD in an amount of 20 g / l, adding 120 g of AD instead of 60 g.

As shown in figure 4, in 24 hours, 10-20 g / l of 4-androsten-3,17-dione almost completely converted to 9α-hydroxy-4-androsten-3,17-dione (approximately 93% of the total 4- androsten-3.17-dione).

Example 5

Characteristic kstD2.

The R.erythropolis RG1 gene library is introduced via electrical transformation into the competent R.erythropolis RG1-UV29 strain. Colonies are obtained by replicating on a mineral agar medium containing 4-androsten-3,17-dione (0.5 g / l) as the sole source of carbon and energy. The complementation of the phenotype of strain RG1-UV29 is evaluated after three days of incubation at 30 ° C. Colonies growing on a 4-androsten-3,17-dione mineral agar medium were cultured in LBP medium to isolate plasmid DNA, which was subsequently re-introduced into strain RG1-UV29 to control true complementation. Plasmid pKSD101, isolated from a transformant that demonstrates growth restoration on a mineral medium with 4-androsten-3,17-dione, was introduced into E. coli DH5α for subsequent analysis. In pKSD101, an insert of approximately 6.5 kbp is identified. DNA of phototrophic bacteria, and subjected to analytical restriction mapping, subcloning and subsequent complementation experiments. 3.6 kb the EcoRI DNA fragment still retains the ability to recover the phenotype of strain RG1-UV29 and is therefore subcloned into pBluescript (II) KS (pKSD105) for nucleotide sequencing. The analysis of the nucleotide sequence reveals the presence of a large open reading frame (ORF) of 1.698 N., encoding the proposed protein of 565 amino acids with an estimated molecular weight of 60.2 kDa. This ORF was designated kstD2 (SEQ ID NO: 5) (which is identical to the previously described kstD3 — see Example 3). The deduced amino acid sequence kstD2 shows high similarity with the known 3-ketosteroid Δ ¹ -dehydrogenase (KSTD), indicating that kstD2 encodes the second KSTD enzyme in R.erythropolis RG1.

Example 6

KstD2 deletion strains.

Strain RG7 R.erythropolis is a mutant strain derived from the wild-type strain R.Q.ththropolis SQ1 containing a single gene deletion kstD2. Strain RG8 R.erythropolis was created as a result of a sequential deletion in the wild-type strain SQ1 R.erythropolis of two genes encoding the activity of 3-ketosteroid Δ ^1- dehydrogenase, i.e. kstD1 and kstD2. Strain RG8 is obtained by deletion of the kstD2 gene from a genome mutant in the deletion of kstD1 of R.erythropolis strain RG1. The method used for deletion of the kstD2 gene is similar to the method described for deletion of the kstD1 gene in Example 2, except that different mutagenic vectors were used (pKSD201 instead of pSDH422).

Mutagenic vector pKSD201 create as follows. Deletion of the internal 1,093 bp DNA fragment from the kstD2 gene by MluI digestion and subsequent self-ligation of pKSD105 allows the creation of pKSD200. 2.4 kb the EcoRI fragment from pKSD200 containing the mutated kstD2 gene is ligated into EcoRI-treated pK18mobsacB, thereby creating pKSD201. Plasmid pKSD201 is introduced into E. coli S17-1 and mobilized by conjugation to R.erythropolis strain SQ1 (to create strain RG7), or to strain RG1 (to create strain RG8). Transconjugates (suc ^s kan ^r ) obtained as a result of the targeted incorporation of pKSD201 into this genome appear after 3 days of growth at 30 ° C. Deletion of kstD2 is carried out during overnight growth of one selected transconjugate (suc ^s kan ^r ) under non-selective conditions (i.e., on an LBP medium) and subsequent placement on selective LBPS agar medium. Colony PCR was performed on 15 suc ^r / kan ^s colonies using kstD2 primers (forward primer [5 'gcgcatatggctaagaatcaggcaccc] (SEQ ID NO: 6); reverse primer [5' gcgggatccctacttctctctctctctccgtgatg] (SEQ ID NO: 7) PCR product with a 0.6 kb fragment size, including the remainder of the kstD2 gene. In a Southern analysis, using a dig-labeled kstD2 gene as a probe, wild-type chromosomal DNA processed with Asp718 and these 4 mutants obtained confirm kstD2 deletion: 2.4 kb. the wild-type Asp718 DNA fragment is reduced to 1.3 kb. in mutant strains.

Example 7

Microbiological 9α-hydroxylation of 4-androsten-3,17-dione using R.erythropolis strain RG8.

Rhodococcus erythropolis RG8 is a double mutant in the deletion of kstD1 and kstD2, which is able to convert 4-androsten-3,17-dione (AD) to 9α-hydroxy-4-androsten-3,17-dione (9αOH-AD) with a concentration of 10 g / l

This conversion is carried out using the following method:

In a 250 ml Erlenmeyer flask containing 75 ml of sterile medium (1.5% yeast extract, 1.5% glucose; pH 7.0), Rhodococcus erythropolis RG8 (preculture) is grown for 24 hours on a rotary shaker at 28 ° C. ) In a 10 liter fermenter, with 6 liters of sterile culture fluid in it (1.5% yeast extract, 1.5% glucose, 0.01% propylene glycol antifoaming agent; pH 7.5), preculture (1%) is inoculated and incubated at 28 ° C for 16 hours while sparging with sterile air, while the culture is mixed to stimulate deep growth. A suspension of 60 grams of 4-androsten-3,17-dione in 300 ml of polysorbate (0.1%) is then administered. Then continue aerobic incubation with stirring at 28 ° C for 24 hours. Samples are taken during this process. These samples were extracted with methanol (70%) and, before determining the steroid composition, by HPLC, they were filtered through a 0.45 μm blank filter. This process is carried out twice.

As shown in figure 5, in 15 hours 10 g / l of 4-androsten-3,17-dione almost completely converted to 9α-hydroxy-4-androsten-3,17-dione (approximately 92-96% of the total 4- androsten-3.17-dione).

Claims (8)

1. A method of constructing a genetically modified strain of a microorganism that destroys steroids, has lost the ability to destroy the steroid core, comprising inactivating many genes associated with the destruction of the steroid nucleus, in particular a deletion of many genes of steroid dehydrogenase, the first gene deleted by unmarked gene deletion and, in particular, the first the deleted gene is kstD1. 2. The method according to claim 1, characterized in that any subsequent gene is inactivated by UV radiation. 3. The method according to claim 1 or 2, characterized in that any subsequent gene is deleted by unmarked gene deletion. 4. The method according to claim 1, characterized in that the second gene is deleted by means of an unmarked gene deletion. 5. The method according to any one of claims 1 to 4, characterized in that at least both kstD1 and kstD2 are inactivated. 6. The method according to any one of claims 1 to 5, characterized in that the microorganism is Rhodococcus, preferably R.erythropolis. 7. The method according to any one of claims 1 to 6, characterized in that a genetically modified strain of Rhodococcus erythropolis RG1-UV29 (DSM13157) is obtained. 8. The method according to any one of claims 1 to 7, characterized in that the microorganism is used to produce 9α-hydroxy-4-androsten-3,17-dione by growing the specified microorganism in a culture medium containing 4-androsten-3,17- dion.

Images