KR101102010B1 - Novel Microorganism Jeongeupia naejangsanensis and Cellulase Gene Derived from Thereof - Google Patents

Abstract

The present invention relates to novel microorganisms Jeongeupia naejangsanensis and cellulose genes derived from the microorganisms, and more specifically, to the new microorganisms Jeongeupia naejangsanensis having cellulose resolution, isolated from Korean viscera . It relates to a novel cellulose gene derived from the microorganism.

The novel microorganism Jeongeupia naejangsanensis ) of the new genus and the new species according to the present invention has excellent cellulose degrading activity, and thus, glucose can be efficiently produced from cellulose by using a cellulase derived from Jeongeupia naejangsanensis .

Jeongeuppia Naejangsansis, Jeongeupia naejangsanensis, Cellulase, Cellulose

Description

Novel Microorganism Jeongeupia naejangsanensis and Cellulase Gene Derived from Thereof}

The present invention relates to a novel microorganism, Jeongeupia naejangsanensis and the cellulose gene derived from the microorganism, and more particularly, to a new microorganism, Jeongeupia naejangsanensis , having cellulose resolution, isolated from Korean viscera . It relates to a novel cellulose gene derived from the microorganism.

Among the various enzymes produced by microorganisms, cellulase is one of the enzymes that is expected to increase dramatically in the future. The most important use of this enzyme is to decompose and glycate fiber, which is the most abundant biological resource on the planet, to become food or energy resource, but it is a field that can be put into practical use only after further research. , Industrial applications such as production and waste paper regeneration of high-quality paper, removal of turbid substances such as fruit drinks and beer, and the use of fiber processing which will be mainly mentioned in the present invention.

Recently, the usefulness of cellulase as an enzyme for fiber processing has been increased, and the cellulase is applied to cotton fabrics to improve the luster and feel of cotton fabrics to achieve high quality of cotton fabrics or to remove color by uniformly removing dyes after dyeing cotton fabrics. We use for process. Conventional dye removal process using pumice is not only a large mechanical damage but also requires a lot of labor has been replaced by the enzymatic treatment method using cellulase.

The microorganisms used for cellulase production can be divided into fungi and bacteria. Among the fungi, Trichoderma strains are mainly used. Cellulase, which is superior to bacteria in cellulase productivity, exhibits maximum activity under moderate and acidic conditions. Produce mainly.

Bacteria that produce cellulases are Bacillus sp., Cellulose Pseudomonas (Cellulomonas) genus, Clostridium (Clostridium), An air Winiah (Erwinia) genus Pseudomonas (Pseudomonas), A luminometer Rhodococcus (Ruminococcus) genus Streptomyces ( Streptomyces ) There are various kinds of bacteria belonging to the genus, etc. Cellulase produced according to the bacteria also has a variety of properties that have reaction characteristics such as mesophilic, heat resistance, alkaline, acidic. In order to completely decompose fibrin, there are generally three kinds of enzymes: endoglucanase (endo-β-1,4-glucanase), exoglucanase (exo-β-1,4-glucanase) and glucosidase. It is known that the enzyme (β-glucosidase) should work together, these are collectively known as cellulase-based enzymes.

Tricoderma cellulase currently accounts for a large part of the cellulase market for textile processing, but there are some disadvantages that make it difficult to expand the market. In other words, under acidic conditions in which cellulase derived from Trichoderm spp. Exhibits maximum activity, it is difficult to uniformly discolor the indigo dye, and staining of cotton fabrics occurs by recontamination after decolorization, as well as cellulase products produced using mold. Many kinds of cellulase-based cows together contain side effects such as lowering the strength of cotton fabrics in addition to the effect of discoloration and surface treatment, which is the original purpose of enzyme treatment. Therefore, in recent years, the usefulness of the neutral cellulase derived from bacteria without such side effects has been highlighted, the market is gradually expanding, the price is much higher than the fungal enzyme. Accordingly, there is an urgent need for the development of strains that produce neutral cellulase derived from bacteria.

Therefore, the present inventors have intensively tried to isolate strains of a new genus that produce new cellulase derived from bacteria. As a result, the present inventors have isolated strains excellent in cellulolytic activity from soils of Korean internal organs, and the physiological, biochemical, morphological, As a result of confirming the genetic properties, it was confirmed that the microorganism of the new genus, named as Jeongeupia naejangsanensis , and completed the present invention.

An object of the present invention is to provide a novel microorganism Jeongeupia naejangsanensis having excellent cellulolytic activity.

Another object of the present invention is to provide a cellulose derived from the Jeongeupia naejangsanensis and a gene encoding the cellulose.

Another object of the present invention is to provide a recombinant vector containing the cellulase gene and a recombinant microorganism transformed with the recombinant vector or in which the cellulase gene is inserted on a chromosome.

Another object of the present invention is to cultivate Jeongeupia naejangsanensis or the recombinant microorganism, to produce a cellulase; And it provides a method for producing a cellulase comprising the step of recovering the produced cellulase.

In order to achieve the above object, the present invention provides a novel microorganism Jeongeupia naejangsanensis KCTC 11523BP.

The present invention also provides a cellulase represented by the amino acid sequence of SEQ ID NO: 1 and a cellulase gene characterized in that the cellulase is encoded.

The present invention also provides a recombinant vector containing the cellulase gene and a recombinant microorganism transformed with the recombinant vector or in which the cellulase gene is inserted on a chromosome.

The present invention also comprises the steps of culturing the Jeongeupia naejangsanensis KCTC 11523BP or the recombinant microorganism, to produce a cellulase; And it provides a method for producing a cellulase comprising the step of recovering the produced cellulase.

The novel microorganism Jeongeupia naejangsanensis of the new genus and the new species according to the present invention has excellent cellulolytic activity, and it is determined that glucose can be efficiently produced from cellulose by using cellulase derived from Jeongeupia naejangsanensis .

In one aspect, the present invention relates to a novel microorganism Jeongeupia naejangsanensis KCTC 11523BP.

In the present invention, in the soil sample collected from Korea Naejangsan, microorganisms having cellulose degrading activity is separated, and among the separated microorganisms, BIO-TAS 4-1 strain having excellent ability to form a clear zone is selected, and the form As a result of confirming the physiological, physiological and biochemical properties, and analyzing the genetic physiological properties, it was confirmed that it is a new strain of a new genus and a new species, and BIO-TAS 4-1 ( Jeongeupia naejangsanensis) BIO-TAS 4-1 KCTC 11523BP), which was deposited on July 1, 2009 to the Korea Institute of Bioscience and Biotechnology (KCTC).

The novel microorganisms Jeongeupia naejangsanensis of the present invention is Gram-negative bacillus ( 0.3-0.7 ㅧ 0.7 ~ 2.5㎛), has mobility by a single polar flagella, and the optimum growth temperature is 30 ° C., and optimal growth The pH is 7.0-8.0 and the optimal NaCl growth concentration is 0-0.1% (W / V) NaCl. Aesculin, casein, gelatin, hypozanthine, starch, Tween 20, 40, 60 and 80, L-tyrosine, urea and xanthine did not degrade. Nitrate was reduced to nitrite and did not produce indole and H ₂ S. Glucose was expressed, N-acetyl-glucosamine, andonitol, L-arabitol, caprate, citrate, fructose, gluconate, glucose, D-risose (D -lyxose), malate, mannose, ribose and xylitol were used as carbon and energy sources.

The novel microorganisms Jeongeupia naejangsanensis of the present invention is adipate, aesculin, amigdaline, D-arabinose, L-arabinose, D-arabitol, cellobiose, Dulse Dulcitol, erythritol, D-fucose, galactose, gentibiose, glycerol, glycogen, inositol, inulin, 2-keto-gluconate, 5-keto-gluconate, lactose, maltose, D Mannitol, melezitose, melibiose, α-methyl-D-glucoside, α-methyl-D-mannoside, β-methyl-D-xyloside, phenylacetate, raffinose, rhamnose, salicycin (salicin), sorbitol, sorbose, starch, sucrose, D-tagatose, trehalose, D-turanose, D-xylose and L-xylose It was not available as a carbon source and energy source.

In addition, the novel microorganism of the present invention Jeongeupia naejangsanensis (leucine arylamidase), acid phosphatase and N-acetyl-β-glucosamidase was present, esterase (C4) and Some esterase lipase (C8) was present, but alkaline phosphatase, lipase (C14), valine arylamidase, cystine arylamidase, trypsin, α-chymotrypsin, naphthol-AS-BI-phosphohydrolase , α-galactosidase, β-galactosidase, β-glucuronidase, α-glucosidase, β-glucosidase, α-mannosidase and α-fucosidase are not present Did.

The novel microorganisms Jeongeupia naejangsanensis of the present invention was susceptible to chloramphenicol, gentamicin, kanamycin, neomycin, polymyxin B, streptomycin and tetracycline against antibiotics, ampicillin, carbenicillin, and cesine . It was resistant to palatin, lincomycin, novobiocin, orlenomycin and penicillin G.

The main ubiquinone of the novel microorganism Jeongeupia naejangsanensis of the present invention was Q-8, and the main fatty acid (> 10% total fatty acid) was C _{16: 1} ω7c and / or isoC _15:02 -OH And C _{16: 0} . The G + C content of DNA measured by HPLC was 63.8 mol%.

In another aspect, the present invention relates to a cellulase represented by the amino acid sequence of SEQ ID NO: 1 and a cellulase gene characterized in that the cellulase is encoded.

The cellulase of the present invention may be characterized in that it is derived from Jeongeuppia gut sanessis (KCTC 11523BP), the cellulase gene of the present invention may be characterized by the nucleotide sequence of SEQ ID NO: 2.

The cellulase gene of the present invention is a 1,236 bp long gene encoding 412 amino acids and a signal sequence of 35 aa.

The cellulase of the present invention was 45.27 kDa, the calculated pi was 5.13 and belongs to the glycosyl hydrolase 8 superfamily.

The optimum activity pH of the cellulase of the present invention was 5.0, and at pH 7.0, the activity was about 60% compared to pH 5.0, and the optimum activity was exhibited at 44 ° C. Indicated.

In another aspect, the present invention relates to a recombinant vector containing the cellulase gene and a recombinant microorganism transformed with the recombinant vector or in which the cellulase gene is inserted on a chromosome.

In the present invention, "vector" refers to a DNA preparation containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing DNA in a suitable host. Vectors can be plasmids, phage particles or simply potential genomic inserts. Once transformed into the appropriate host, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself. Since plasmids are the most commonly used form of current vectors, "plasmid" and "vector" are sometimes used interchangeably in the context of the present invention. For the purposes of the present invention, it is preferred to use plasmid vectors. Typical plasmid vectors that can be used for this purpose include (a) a replication initiation point that allows for efficient replication to include hundreds of plasmid vectors per host cell, and (b) host cells transformed with the plasmid vector. It has a structure comprising an antibiotic resistance gene and (c) restriction enzyme cleavage site into which foreign DNA fragments can be inserted. Although no appropriate restriction enzyme cleavage site is present, the use of synthetic oligonucleotide adapters or linkers according to conventional methods facilitates ligation of the vector and foreign DNA.

After ligation, the vector should be transformed into the appropriate host cell. Transformation is described by Sambrook, et. al., easily achieved using the calcium chloride method described in section 1.82 of supra . Alternatively, electroporation (Neumann, et. Al., EMBO J. , 1: 841, 1982) can also be used for transformation of these cells.

Nucleic acids are "operably linked" when placed in a functional relationship with other nucleic acid sequences. This may be genes and regulatory sequence (s) linked in such a way as to enable gene expression when appropriate molecules (eg, transcriptional activating proteins) are bound to regulatory sequence (s). For example, DNA for a pre-sequence or secretory leader is operably linked to DNA for a polypeptide when expressed as a shear protein that participates in the secretion of the polypeptide; A promoter or enhancer is operably linked to a coding sequence when it affects the transcription of the sequence; Or the ribosomal binding site is operably linked to a coding sequence when it affects the transcription of the sequence; Or the ribosomal binding site is operably linked to a coding sequence when positioned to facilitate translation. In general, "operably linked" means that the linked DNA sequence is in contact, and in the case of a secretory leader, is in contact and present within the reading frame. However, enhancers do not need to touch. Linking of these sequences is performed by ligation (linking) at convenient restriction enzyme sites. If such sites do not exist, synthetic oligonucleotide adapters or linkers according to conventional methods are used.

The recombinant microorganism according to the present invention may be prepared by inserting the gene into a chromosome of the microorganism or introducing the recombinant vector into a host microorganism according to a conventional method.

As the method for inserting the gene on the chromosome of the host cell in the present invention can be used a commonly known genetic engineering method, for example retrovirus vector, adenovirus vector, adeno-associated virus vector, herpes simplex virus vector , Poxvirus vectors, lentiviral vectors or non-viral vectors.

In the present invention, the host microorganism is genus Agrobacterium , Aspergillus , Acetobacter , Aminobacter , Agromonas , Acidphilium , Bulleromyces , Bullera , Brevundimonas , Cryptococcus , Chionosphaera , Candida , Cerinosterus , Escherichia , Exisophiala in, Exobasidium in, Fellomyces in, Filobasidium genus, Geotrichum genus, Graphiola genus, Gluconobacter genus, Kockovaella in, Curtzmanomyces in, Lalaria in, Leucospoidium genus, Legionella genus, Psedozyma in, Paracoccus genus, Petromyc genus, Rhodotorula genus, Rhodosporidium genus, Rhizomonas in, Rhodobium in, Rhodoplanes genus Rhodopseudomonas genus Rhodobacter genus Sporobolomyces, A Spridobolus genus Saitoella genus Schizosaccharomyces genus Sphingomonas genus Sporotrichum genus, Sympodiomycopsis in, Sterigmatosporidium in, Tapharina genus Tremella genus, Trichosporon genus, Tilletiaria in, Tilletia genus, Tolyposporium in, Tilletiposis in, Ustilago genus, Udenlomyce in, Xanthophilomyces in, Xanthobacter Genus, Paecilomyces genus, Acremonium genus, Hyhomonus genus, Rhizobium genus, etc. can be exemplified, but is not limited thereto.

In another aspect, the present invention comprises the steps of culturing the Jeongeupia naejangsanensis KCTC 11523BP or the recombinant microorganism, to produce a cellulase; And it relates to a method for producing a cellulase comprising the step of recovering the produced cellulase.

Cultivation of the recombinant strain according to the present invention can be carried out according to well-known methods, conditions such as the culture temperature and time, the pH of the medium can be appropriately adjusted. The recovery of cellulase from the culture medium of the recombinant strain is performed by conventional separation techniques such as salting out, molecular weight cutting, chromatography, affinity chromatography, distillation, electrodialysis, pervaporation, solvent extraction, reaction extraction, and the like. In general, a combination of them can be used to separate materials of high purity.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.

Example 1 Isolation of Cellulose Degrading Microorganisms in Soil

1 g of soil sample taken from Korea Naejangsan was suspended in PBS buffer and diluted appropriately.

The suspension solution prepared above was plated on LB (Luria-Bertani) plate medium containing initial pH 7.0 and 0.2% (W / V Azo-CM cellulose (Megazyme) and incubated at 37 ° C. for 3-5 days. By decomposing -CM cellulose, strains with clear zones were separated into cellulose-degrading microorganisms, among which BIO-TAS 4-1 strains with excellent ability to form clear zones were selected and further experiments were carried out. Was performed.

Example 2: Characterization of BIO-TAS 4-1 Strains

References for fatty acid analysis and phenotypic determination of Andrevitia chitinilytica DSM 18519 from the DSMZ (Deutsche Sammlung von Milroorganismen und Zellkulturen, Braunschweig, Germany) and Silvimonas terrae KCTC 12358 from the Deefgea rivuli DSM 18356 and KCTC (Korean Collection for Type Culture). Used as strain. In order to confirm the morphological, physiological and biochemical properties of the BIO-TAS 4-1 strain isolated in Example 1, it was cultured in TSA (trypticase soy agar; Difco, USA) medium at a temperature of 30 ℃.

Cell morphology was observed under a light microscope (Nikon E600) using a logarithmic growth bacteria. Gram staining was confirmed using the bioMerieux Gram stain kit.

Bacterial growth at various temperature conditions (4, 10, 20, 25, 28, 30, 35, 37, 40, 45, 50 and 55 ° C.) was measured in TSA (trypticase soy agar; Difco, USA) medium The pH range for growth was measured by preparing various pH values (pH4.5-10.5, 0.5 pH intervals) nutrient broth (Difco, USA) with sodium acetate / acetic acid or Na ₂ CO ₃ buffer.

Growth by NaCl concentration was determined using trypticase soy agar (Difco, USA) medium containing NaCl at 0, 0.5, 1.0, 2.0, 3.0, 4.0 and 5.0% W / V concentrations and in anaerobic conditions. Growth was confirmed by culturing in an anaerobic chamber using TSA medium prepared under nitrogen atmosphere and TSA medium containing 0.1% W / V potassium nitrate.

Catalase and oxidase activity and casein, gelatin, hypozanthine, starch, Tween 20, 40, 60 and 80, tyrosine, urea and xanthine were measured by Cowan & Steel (Cowan, ST and Steel, KJ, Manual). for the identification of medical bacteria. , London, Cambridge University Press), aesculin and nitrate were measured by Lanyi's method (Lanyi, B, Methods Microbiol, 19: 1, 1987). .

The susceptibility to antibiotics was determined by placing a disc infused with antibiotics on a TSA plate smeared with test strain. Antibiotic concentrations were polymiyxin B 100U, streptomycin 50μg, penicillin G 20U, chloramphenicol 100μg, ampicillin 10μg, cephalotin 30μg, novamycin 15μg, tetracycline 30μg, kanamycin 30μg, linomycin 15μg 30 μg of neomycin and 100 μg of carbenicillin were used.

The utility of various substrates was determined by testing enzyme activity and other physiological biochemical properties using API 20E, API 20NE, API 50CH and API ZYM systems (BioMerieux). The bacteria were suspended in AUX medium and inoculated into the API 50 CH system.

Biochemical characteristics of the BIO-TAS 4-1 strain measured by the above method are shown in Table 1.

Cells for DNA extraction and isoprenoid quinones analysis of BIO-TAS 4-1 strains were cultured at 30 ° C. in Trypticase soy broth (Difco, USA).

Chromosomal DNA was extracted in the same way as Yoon et al ., Except that RNase T1 was used with RNaseA to minimize RNA contamination (Yoon, JH et al ., Int. J. Syst. Bacteriol ., 46: 502, 1996).

The 16S rRNA gene was amplified by PCR (Yoon, JH et al , Int. J. Syst. Bacteriol ., 48: 187, 1998), and the sequencing and genetic physiological analysis of the amplified 16S rRNA gene was identical to that of Yoon et al. Method (Yoon, JH et al , Int. J. Syst. Evol. Microbiol. , 53: 449, 2003). The total 16S RNA gene sequence of the BIO-TAS 4-1 strain was 1490 nt and showed about 96% homology with the Escherichia coli 16S rRNA gene sequence.

Alignment of the gene sequences was performed using CLISTAL W software (Thompson et al., Nucleic Acids 1994), and further analysis eliminated gaps at the 5 'and 3' ends of the alignment.

Genetic physiological trees were constructed using tree construction algorithms, maximum joining (Saitou, N. and Nei, M, Mol. Biol. Evol ., 4: 406, 1987), maximum-likelihood (Felsenstein, J., J. Mol, Evol ., 17: 368, 1981) and the maximum parsimony (Kluge, A. G and Farris, FS, Syst Zool ., 18, 1, 1969) method for PHYLIP packages (Felsenstein, J., Phylogenetic Inference Package, version). 3.5, Seattle: University of Washington, 1993). The evolutionary distance matrix was calculated using the NAVER-Joining method using the DNADIST program, and analyzed by bootstrap analysis based on 1000 resampling of the Naver Joining dataset, using the SEQBOOT, DNADIST, NEIGHBOR and CONSENSE programs of the PHYLIP package. It was.

Naver crude dining based on algorithms, BIO-TAS 4-1 in genetic physiological tree to form a Neisseriaceae superphosphate Andreprevotia, Silvimonas, Deefgea in the cluster (Fig. 1). The sequence of the 16S rRNA gene of the BIO-TAS 4-1 strain was 94.2%, 93.5% and 93.6% homologous to Andrevotia chitinilytica , Deefgea rivuli and Silvimonas terrae respectively and 92.2% of the other species used for genetic physiology analysis. Less than homology was shown.

Isoprenoid quinones were extracted and analyzed using reversed phase HPLC and YMC ODS-A (250 x 4.6 mm) columns. The most detected isoprenoid quinones in BIO-TAS 4-1 were ubiquinone- 8 (Q-8).

For intracellular fatty acid analysis, BIO-TAS 4-1, Andrevotia chitinilytica DSM 18519, Deefgea rivuli DSM 18356 and Silvimonas terrae KCTC 12358 cells were obtained after incubation at 30 ° C. for 3 days in TSA plates. Fatty acids and fatty acid methylesters were extracted using the MIDI / Hewlett Packard Microbial Identification System (MIDI Inc, Germany) and the analyzed fatty acid profiles are shown in Table 2 (in Table 2, 1 is BIO-TAS 4-1, 2). Ndrevotia chitinilytica DSM 18519, 3 represents Silvimonas terrae KCTC 12358 , 4 represents Deefgea rivuli DSM 18356. All strains deleted less than 0.5% of fatty acids and "-" is undetected.)

The BIO-TAS 4-1 strain contained high levels of unsaturated, chained or hydroxy fatty acids, with the main component (at least 10% of the total fatty acids) being C _{16: 1} ω7c and / or isoC _15:02 -OH and C _{16 : 0} .

The DNA G + C content was found to be 63.8 mol% by hydration of the DNA, and nucleotide analysis by reverse phase HPLC (Tamaoka, J and Komagata, K., FEMS Microbiol Letts ., 25: 125, 1984). .

Genetic physiological analysis based on the 16S rRNA gene sequence, BIO-TAS 4-1 strain belonged to Betaproteobacteria , an independent evolutionary system in the family Neisseriaceae (Fig. 1). Homology of 16S rRNA gene sequence between BIO-TAS 4-1 strain and other genera was relatively low (<94.2%). Many of the isoprenoid quinone types (Q-8) detected in the BIO-TAS 4-1 strain were identical to those of Andrevotia , Deefgea and Silvimonas , which were genetically physiologically related (Yang et al ., Int. J. syst. Evol. Microbiol ., 55: 2329, 2005; Stackebrandt et al., 2007, Weon et al., 2007). When cultured under the same conditions, the fatty acid composition of the BIO-TAS 4-1 strain was distinguished from the strains of other related genera (Table 2). BIO-TAS 4-1 strains showed differences in the composition of Andrevotia and Silvimonas and fatty acids, especially C _{16: 1} ω7c and cyclo-C _{17: 0-} (Table 2), growth in anaerobic conditions, nitrate reduction Differences were also seen in phenotypes, including the hydrolytic capacity of some substrates and the availability of some substrates (Table 1). The BIO-TAS 4-1 strain showed a difference in DNA G + C content from the genus Deefgea (Table 1). Therefore, the BIO-TAS 4-1 strain was considered to be a new genus belonging to Betaproteobacteria based on genetic physiological data, chemical classification and phenotypic characteristics, and was named Jeongeupia naejangsanensis .

Features of the genus Jeongeupia Characteristic Genus Jeongeupia Gram Dyeing voice motility has exist shape Rod-shape Growth environment Anaerobic Catalase positivity Oxidase positivity Main fatty acid C _{16: 1} ω7c and / or isoC _15:02 -OH and C _{16: 0} Lubricating biquinone Ubiquinone-8 (Q-8) Bell Jeongeupia naejangsanensis

Example 3: Jeongeupia naejangsanensis Features of

Jeongeupia naejangsanensis is a Gram-negative bacillus ( 0.3-0.7 ㅧ 0.7-2.5㎛ ), motility by a single polar flagella, and slightly in the form of a round 3.0-5.0 mm diameter in TSA medium when incubated at 30 ° C. for 3 days. It forms irregular, flat, smooth, shiny, grayish yellow colonies. The optimum growth temperature was 30 ° C., grown between 10-50 ° C., and did not grow at 4 ° C. or 55 ° C.

The optimum growth pH was 7.0-8.0, and grown at pH 5.0, but not at pH 4.5. It was grown in 0 ~ 3.0% (W / V) NaCl, and the optimum growth concentration was 0 ~ 0.1% (W / V) NaCl. Anaerobic growth was observed in TSA medium and nitrate added TSA medium. It was catalase- and oxidase-positive and had cellulose degradation.

Aesculin, casein, gelatin, hypozanthine, starch, Tween 20, 40, 60 and 80, L-tyrosine, urea and xanthine did not degrade. Nitrate was reduced to nitrite and did not produce indole and H ₂ S. Glucose was expressed, N-acetyl-glucosamine, andonitol, L-arabitol, caprate, citrate, fructose, gluconate, glucose, D-risose (D -lyxose), malate, mannose, ribose and xylitol were used as carbon and energy sources.

Adipate, aesculin, amigdaline, D-arabinose, L-arabinose, D-arabitol, cellobiose, dulcitol, erythritol, D-fucose, galactose , Gentibiose, glycerol, glycogen, inositol, inulin, 2-keto-gluconate, 5-keto-gluconate, lactose, maltose, D-mannitol, melezitose, melibiose , α-methyl-D-glucoside, α-methyl-D-mannoside, β-methyl-D-xyloside, phenylacetate, raffinose, rhamnose, salicin, sorbitol, sorbose, starch, sucrose Os, D-tagatose, trehalose, D-turanose, D-xylose and L-xylose were not available as carbon and energy sources.

Analysis using the API ZYM system (BioMerieux) revealed leucin arylamidase, acid phosphatase and N-acetyl-β-glucosamidase, esterase (C4) and esterase lipase Slightly present (C8), but alkaline phosphatase, lipase (C14), valine arylamidase, cystine arylamidase, trypsin, α-chymotrypsin, naphthol-AS-BI-phosphohydrolase, α-gal There were no lactosidase, β-galactosidase, β-glucuronidase, α-glucosidase, β-glucosidase, α-mannosidase and α-fucosidase.

It was susceptible to chloramphenicol, gentamicin, kanamycin, neomycin, polymyxin B, streptomycin and tetracycline, and was resistant to ampicillin, carbenicillin, cephaletin, lincomycin, novobiocin, oleomycin and penicillin G. There was this. The main ubiquinone was Q-8 and the main fatty acids (> 10% total fatty acids) were C _{16: 1} ω7c and / or isoC _15:02 -OH and C _{16: 0} . The G + C content of DNA measured by HPLC was 63.8 mol%.

Example 4: Jeongeupia naejangsanensis Cloning of Derived Cellulase Genes

Jeongeupia naejangsanensis has excellent cellulose resolution and was cloned to isolate the cellulase gene present in the strain.

In order to obtain cellulase gene sequencing information of the strain Jeongeupia naejangsanensis , a chromosomal library of this strain using a plasmid was prepared as follows. Chromosomal DNA was isolated and purified from the cells recovered through the culture medium of J. naejangsanensis strain, fragments were processed by restriction enzyme Sau 3AI restriction enzyme, and fragments of constant size (2-3 kb) were purified. The purified DNA was ligated to pHSG298 vector which prevented self-binding by treating CIP after Bam H1 restriction enzyme treatment and transformed the product into E. coli XL1-Blue. The medium for confirming the cellulase activity of the transformed E. coli XL1Blue strain was added to the final concentration of LB_Agar solid medium at 1% CMC (Carboxyl Methyl Cellulose), 0.005% Tryphan Blue, and 15 ㎍ / ml kanamycine as antibiotic. The transformed clones were plated and cultured at 37 ° C., and the clones showing transparent rings were selected.

As a result, a clone showing cellulase activity was obtained (FIG. 2). As a result of DNA sequencing of the clone, the inserted DNA was a 5 Kb clone, and a 1.2 kb gene sequence showing homology with cellulase was obtained. I could confirm it. BLAST analysis of the gene was confirmed to be a novel cellulose belonging to the glycosyl hydrolase 8 superfamily showing a size of approximately 41 kDa (Fig. 3). And using the genomic DNA of J. naejangsanesis strain as a template to design the primers based on the novel cellulase gene, the PCR was confirmed that the PCR product is produced (Fig. 4). This confirmed that the J. naejangsanesis strain has the cellulase .

The primer sequence used is as follows.

EC010 (W / I Signal sequence; Product Size 1,252 bp)

4-2 M siad F (Nd): 5 'AACATATGTTGAGAGGAGCGCATCCGGTGT 3'

(SEQ ID NO: 3)

4-2 M R (Ba): 5 'TTGGATCCTTATGGCTGTTGCCACAACCCC 3'

(SEQ ID NO: 4)

EC010 (W / O Signal sequence; Product Size 1,153 bp)

4-2 M Nosi F (Nd): 5 'AACATATGTACGTCCCTGGCGCGATTACGC 3'

(SEQ ID NO: 5)

4-2 M R (Ba): 5 'TTGGATCCTTATGGCTGTTGCCACAACCCC 3'

(SEQ ID NO: 6)

EC010 (Confirm gene from Genome; Products Size: 800 bp)

4-2 M_I F: 5 'CCGACCCGCAGGACGCAAGC 3' (SEQ ID NO: 7)

4-2 M_I R: 5 'GCCACCAGTTGCCGTCGTGCTC 3' (SEQ ID NO: 8)

In order to express the novel cellulase identified in the above results, the PCR product with the signal sequence and the PCR product with the deleted signal sequence were cloned into the pHCEIIb vector, followed by expression experiments. Cellulase activity was shown, and the amount of expressed protein was confirmed to be large (FIG. 5). In addition, it was confirmed that the expressed cellulase accumulated in the cells rather than secreted into the cells.

Example 5: Purification and Properties of New Cellulase

In order to isolate and purify the novel cellulase identified in Example 4, 1 L culture solution of E. coli transformed with the cellulase gene was obtained only by centrifugation, which was resuspended in 50 mM TRIS buffer (pH 7.5) and then ultrasonically Cells were disrupted using a crusher. The crushed cells were centrifuged at 14,000 rpm to obtain supernatant, which was used as a crude enzyme solution for cellulase separation.

Ammonium sulfate was added to the coenzyme solution prepared by the above method to saturate at a concentration of 30%, and the precipitated protein was removed. The obtained supernatant was immediately equilibrated with 1M ammonium sulfate (50 mM TRIS buffer, pH 7.5). Cellulase was attached by phenyl sepharose HP column, followed by elution through 1-0 M ammonium sulfate liner gradient using 50 mM TRIS buffer (pH 7.5). Only fractions showing cellulase activity were obtained. The cellulase active fraction obtained above was concentrated by ultrafiltration using a YM10 membrane capable of concentrating at least 10 kDa molecular weight. To apply the concentrated sample to the Q-sepharose HP column, salt was removed using a Hi-prep desalting column. Thereafter, the resultant was injected into a Q-sepharose HP column and purified through 0-1M NaCl linner gradient (FIG. 6), and an additional experiment was performed on the A9 fraction showing high purity. The final purified A9 fraction was analyzed by Experion (BIO-RAD, USA) and the purity was 93% and the molecular weight was 40.87kDa. This is the result corresponding to the analysis result using sequence (41.6 kDa) (FIG. 6).

In order to confirm the characteristics of the purified cellulase, the experiment was performed using the Q-Sepharose HP A09 fraction which showed high purity. To determine the optimal activity pH, Na acetate, posphate and TRIS buffers were used to check the pH between 3.0 and 9.0. As a result, the optimum activity was shown at pH 5.0 (FIG. 7), and pH 7.0 showed about 60% activity compared to pH 5.0.

In order to measure the temperature showing the optimum activity, the resolution of CMC for 30 minutes in Na acetate buffer (100 mM) at pH 6.0 was confirmed to show the optimum activity at the temperature of 44 ℃. In addition, it was confirmed that the activity of about 40% even at 60 ℃, the temperature of more than 44 ℃ (Fig. 8).

In order to check pH stability and thermal stability, the separated cellulase was measured at a constant time while standing at a pH of 3.0 to 9.0 and a temperature of room temperature to 56 ° C., respectively. It was confirmed that it has a characteristic that does not have a characteristic, and that the thermal stability at a temperature of more than 40 ℃ rapidly lower (Figs. 9 and 10).

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

1 is Jeongeupia naejangsanensis Genetic physiological position is a phylogenetic tree based on 16S r RNA sequence.

Figure 2 shows the experimental results of the library production process using the genomic DNA of Jeongeupia naejangsanensis and confirmed the cellulose active clone.

Figure 3 shows the nucleotide sequence and amino acid sequence of the novel cellulase of Jeongeupia naejangsanensis .

Figure 4 shows the results confirmed that the cellulase gene is amplified by PCR using the genomc DNA of Jeongeupia naejangsanensis as a template. Here, Con is a control without template DNA added, EC010 is a sample using genomc DNA of Jeongeupia naejangsanensis as a template.

FIG. 5 shows the results of cloning the cellulase gene in the pHCEIIb vector and expressing it in the E. coli BL21 strain. As shown in FIG. 5, the expression level of the protein and the cellulase activity of the clones having the signal sequence and the clones having no. The degree is shown.

Figure 6 shows the results of confirming the purity using the Experion apparatus to confirm the purity of the expressed cellulase during the purification process.

7 is a graph confirming the optimum active pH of purified cellulase.

8 is a graph confirming the optimum activity temperature of purified cellulase.

9 is a graph confirming the pH stability of the purified cellulase.

10 is a graph confirming the thermal stability of the purified cellulase.

<110> Korea Research Institute of Bioscience and Biotechnology <120> Novel Microorganism Jeongeupia naejangsanensis and Cellulase Gene          Derived from Thereof <130> P09-B090 <160> 8 <170> KopatentIn 1.71 <210> 1 <211> 412 <212> PRT <213> Jeongeupia naejangsanensis <400> 1 Val Leu Arg Gly Ala His Pro Val Phe Pro Arg Leu Lys Arg Thr Val   1 5 10 15 Val Leu Leu Leu Ala Ala Gly Gln Leu Gly Leu Tyr Pro Ala Ser Ser              20 25 30 Ala Phe Ala Tyr Val Pro Gly Ala Ile Thr Pro Ala Val Val Asn Gln          35 40 45 Ser Gln Met Leu Asn Gln Val Asp Ala Ala Tyr Ala Ala Trp Lys Thr      50 55 60 Arg Tyr Leu Arg Thr Asp Pro Gln Asp Ala Ser Arg Leu Tyr Val Trp  65 70 75 80 Phe Gly Ser Glu Thr Gly Lys Gln Val Val Ser Glu Gly Gln Gly Phe                  85 90 95 Gly Met Leu Ala Val Ala Gln Met Ala Ala Arg Asp Pro Gln Ala Arg             100 105 110 Ala Thr Phe Asp Ala Leu Phe Arg Tyr Tyr Arg Ala His Pro Thr Leu         115 120 125 Ala Ser Pro Trp Leu Met Ala Trp Ala Gln Ser Leu Ser Asp Asn Arg     130 135 140 Leu Val Asp Thr Asp Gly Gln Asn Ser Ala Thr Asp Gly Asp Leu Asp 145 150 155 160 Ala Ala Tyr Gly Leu Leu Leu Ala Asp Gln Val Trp Gly Ser Thr Gly                 165 170 175 Thr Ile Asn Tyr Arg Asp Glu Ala His Lys Thr Ile Asn Ala Leu Met             180 185 190 Asp Lys Val Val Asn Gln Ser Glu Trp Thr Leu Lys Leu Gly Asp Trp         195 200 205 Val Gly Asp Gly Asp Ala Thr Tyr Gly Lys Gly Leu Arg Gly Ser Asp     210 215 220 Leu Met Phe Asn His Leu Arg Ala Phe His Glu Ala Thr Gly Asp Ala 225 230 235 240 Arg Trp Arg Ala Val Leu Asp Lys Ser Tyr Val Ile Ala Asp Ser Val                 245 250 255 Phe Arg Asn Tyr Gly Pro Asn Thr Gly Leu Leu Pro Asp Phe Ile Val             260 265 270 Lys Gln Gly Thr Asp Phe Arg Pro Ala Pro Ala Gly Phe Leu Glu Gly         275 280 285 Ala Asn Asp Gly Asn Tyr Ser Trp Asn Asn Cys Arg Val Pro Trp Arg     290 295 300 Leu Ser Leu Asp Tyr Leu Leu Asn Gly Asp Thr Arg Ala Leu Pro Leu 305 310 315 320 Leu Gln Ala Leu Asn Arg Trp Val Ser Thr Thr Ala Thr Gly Gly Asp                 325 330 335 Pro Asn Arg Ile Tyr Gly Gly Tyr Thr Leu Asp Gly Gln Ala Leu Asn             340 345 350 Pro Tyr Phe Gln Met Ala Phe Ala Ala Pro Phe Ala Val Ser Ala Thr         355 360 365 Ile Asp Ser Gly Asn Gln Thr Trp Leu Asn Ala Leu Trp Thr Arg Ile     370 375 380 Ala Ala Ala Pro Val Asn Glu Tyr Tyr Ser Asp Ser Ile Arg Leu Leu 385 390 395 400 Ser Met Met Ala Val Ala Gly Leu Trp Gln Gln Pro                 405 410 <210> 2 <211> 1242 <212> DNA <213> Jeongeupia naejangsanensis <400> 2 gtgttgagag gagcgcatcc ggtgtttccc cgtctgaaaa gaaccgtggt tctgttgctg 60 gccgctggcc agcttggttt gtatcccgcc agttctgcct ttgcctacgt ccctggcgcg 120 attacgcccg cagtggtgaa tcagtcccaa atgctgaatc aggtcgacgc cgcctatgcg 180 gcttggaaaa cgcgttatct gcgcaccgac ccgcaggacg caagccggct ttacgtctgg 240 ttcggctccg agaccggcaa gcaggtggtg tcggaaggcc agggcttcgg catgctggcg 300 gtggcgcaga tggcggcgcg tgatccgcag gcccgggcga catttgatgc actgttccgc 360 tactaccgtg cccatccgac gctcgccagc ccgtggctga tggcatgggc gcaatcgctg 420 tcggacaacc ggctggtcga taccgacggc cagaactcgg ccaccgacgg cgatctcgat 480 gctgcctacg gcttgctgct ggccgatcag gtctggggtt cgaccgggac gatcaactac 540 cgcgacgaag cgcacaagac catcaatgcg ctgatggaca aggtggtgaa tcagtccgag 600 tggacgctca agctcggtga ttgggtcggc gatggcgatg cgacctatgg caaggggctg 660 cgcggctcgg acctgatgtt caaccacctg cgcgcgtttc acgaggcgac cggcgacgca 720 cgctggcgcg cggtgctcga caagagctac gtgattgccg attcggtgtt ccgcaactac 780 gggccgaaca ccggtctgct gccggatttc atcgtcaagc agggcaccga tttccggccg 840 gctccggcgg gctttctcga aggtgcgaac gacggcaact acagctggaa caattgccgc 900 gtgccctggc ggctgagtct ggattacctg ctcaatggcg atacccgcgc cttgccgttg 960 ctgcaggcgt tgaatcgctg ggtgagcacg acggcaactg gtggcgatcc gaaccggatt 1020 tacggtggtt atacgctgga cgggcaggcc ttgaacccgt acttccagat ggcgtttgcg 1080 gcaccgtttg ccgtcagcgc caccatcgac agcggcaacc agacctggct gaacgccttg 1140 tggacgcgca tcgcggcggc gccggtcaac gagtattact cggactcgat tcgcctgctg 1200 tcgatgatgg cggtggcggg gttgtggcaa cagccataat aa 1242 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 aacatatgtt gagaggagcg catccggtgt 30 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 ttggatcctt atggctgttg ccacaacccc 30 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 aacatatgta cgtccctggc gcgattacgc 30 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 ttggatcctt atggctgttg ccacaacccc 30 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 ccgacccgca ggacgcaagc 20 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 gccaccagtt gccgtcgtgc tc 22  

Claims (9)

New microorganism Jeongeupia naejangsanensis KCTC 11523BP. Cellulase produced by the strain of claim 1 represented by the amino acid sequence of SEQ ID NO: 1. Cellulase gene, characterized in that for encoding the cellulase of claim 2. The cellulase gene according to claim 3, which is represented by the nucleotide sequence of SEQ ID NO: 2. The method of claim 3, characterized in that derived from Jeongeuppia Naejangsansis (KCTC 11523BP) Cellulase gene. Recombinant vector containing the gene of claim 3. A recombinant microorganism transformed with the recombinant vector of claim 6, or the cellulase gene of claim 3 inserted on a chromosome. Jeongeupia naejangsanensis KCTC 11523BP of claim 1 was prepared using glucose, N-acetyl-glucosamine, andonitol, L-arabitol, caprate, citrate, fructose, Culturing at 10 to 50 ° C. in a medium containing a carbon source selected from the group consisting of gluconate, D-lyxose, maleate, mannose, ribose and xylitol, to produce cellulase; And recovering the produced cellulase. Culturing the recombinant microorganism of claim 7 to produce cellulase; And recovering the produced cellulase.

Images