CN113699138A - Alkaline protease gene, hybrid promoter, recombinant expression vector, recombinant expression engineering bacterium, alkaline protease, method and application - Google Patents

Abstract

The invention discloses an alkaline protease gene, a hybrid promoter, a recombinant expression vector, recombinant expression engineering bacteria, alkaline protease, a method and application thereof, wherein the nucleotide sequence of an alkaline protease gene bcp is shown as SEQ ID NO. 1. The total length of the alkaline protease gene BCP is 1143bp, and the alkaline protease gene BCP is efficiently expressed in a bacillus subtilis expression strain, so that the production cost of the alkaline protease BCP is reduced.

Description

Alkaline protease gene, hybrid promoter, recombinant expression vector, recombinant expression engineering bacterium, alkaline protease, method and application

Technical Field

The invention relates to the field of genetic engineering, in particular to an alkaline protease gene. In addition, the invention also relates to a hybrid promoter, a recombinant expression vector, a recombinant expression engineering bacterium, a preparation method and application thereof.

Background

The protease can decompose protein to form polypeptide and free amino acid, and has wide application prospect in many fields. The protease source is wide, the protease mainly comes from microorganisms in the current industrialized application, and the protease derived from the microorganisms has the characteristics of multiple types, various enzymological characteristics and the like. Proteases derived from microorganisms can be classified into acid proteases, neutral proteases and alkaline proteases according to the pH of action. The three proteases are applied to different industrial fields according to different enzymological properties. The alkaline protease is used as a serine protease, has good activity and stability, can effectively decompose various proteins, and is mainly applied to the fields of food processing, washing, feed and the like at present. Alkaline protease is a commonly used industrial enzyme preparation, and the main alkaline protease products in the market are derived from Bacillus alkalophilus, Bacillus licheniformis and Bacillus subtilis. The production modes of the alkaline protease are mainly divided into two categories of natural bacteria fermentation culture and heterologous high-efficiency expression. The natural bacteria fermentation culture has the advantages of short fermentation period and the disadvantages of low enzyme activity, unstable fermentation process, complex culture medium composition, easy degeneration of strains and the like. Compared with natural bacteria, the heterologous recombinant expression has the advantages of high fermentation enzyme activity, stable and controllable fermentation process and the like, so that the heterologous recombinant expression becomes a mainstream production mode. The alkaline protease heterologous expression hosts currently include Bacillus subtilis, Bacillus amyloliquefaciens and Bacillus licheniformis, of which Bacillus subtilis expression hosts have been the most studied. The bacillus subtilis used as a food-grade expression host has the advantages of simple genetic operation, clear gene background, extracellular secretion of protein and the like.

Disclosure of Invention

The invention provides an alkaline protease gene, a heterozygous promoter, a recombinant expression vector, recombinant expression engineering bacteria, alkaline protease, a method and application, and aims to solve the technical problems of high production cost and low fermentation activity of the alkaline protease from bacillus.

The technical scheme adopted by the invention is as follows:

an alkaline protease gene bcp, the nucleotide sequence of which is shown in SEQ ID NO. 1.

The Bacillus circulans alkaline protease gene bcp was obtained by homologous cloning. Extracting a Bacillus circulans genome sy1 (Bacillus circulans sy1 is obtained by screening bean dregs in the early stage of a laboratory) by referring to a bacterial genome extraction kit, designing a pair of primers according to a genome sequence of a Bacillus circulans strain NCTC2610 (GenBank: UAPZ 01000012.1: 120935-122077), namely the nucleotide sequence of a forward primer is shown as SEQ ID NO:20 (bc1-fw, 5'-TCACGGCCG ATGAAGAAACTGTTGACGAAA-3', underlined is Ec52I cleavage site), and the nucleotide sequence of the reverse primer is shown in SEQ ID NO:21 (bc 1-rev: 5'-ACGTCTAGAGCGTGTTGCCGCTTCTGC-3', XbaI restriction sites underlined). The extracted genome is used as a template, and the alkaline protease gene bcp is obtained by PCR amplification.

The alkaline protease gene BCP is bacillus circulans alkaline protease gene BCP, the total length of the alkaline protease gene BCP is 1143bp, 380 amino acids of the encoding protease BCP are provided, and the nucleotide sequence of the encoding protease BCP is shown as SEQ ID NO. 1.

According to another aspect of the invention, the alkaline protease BCP is provided, and the amino acid sequence of the alkaline protease BCP is shown as SEQ ID NO. 2. By analysis, the alkaline protease BCP encoded by the gene BCP can be divided into three segments, the first 27 amino acids being its signal peptide sequence, amino acids 28 to 111 being its leader peptide, and amino acids 112 to 269 being its mature peptide (please confirm whether modifications are required here).

The NCBI protein comparison analysis shows that the similarity of the alkaline protease BCP and the Bacillus circulans NCTC2610 alkaline protease (protein accession number: No. SPU21234.1) is the highest and is 90 percent; followed by the Bacillus clausii alkaline protease (protein accession No.: WP-094423791) and the Bacillus bartonia alkaline protease (protein accession No.: WP-094190329.1), with similarities of 89.4% and 78.7%, respectively. The three-dimensional structure of the alkaline protease BCP protein is obtained by homologous modeling, and as can be seen from FIG. 1, the BCP catalytic active site consists of a catalytic triad of aspartic acid (D143) at position 143, histidine (H173) at position 173 and serine (S326) at position 326. Two amino acid loops (G) on the surface of proteins²⁰⁹To S²¹⁵，L²³³To S²³⁹) Is responsible for reacting with the substrate. In addition, two Ca are also present in the mature peptide of BCP²⁺The binding sites, one on the surface of the protein and one in the middle of the protein.

According to another aspect of the present invention, there is also provided a hybrid promoter for efficient expression of alkaline protease in Bacillus subtilis, the nucleotide sequence of the hybrid promoter being shown in SEQ ID NO. 11. The construction method of the hybrid promoter comprises the following steps: (1) obtaining alkaline protease gene bcp by PCR amplification, carrying out agarose gel purification, carrying out restriction enzyme digestion by restriction enzymes XbaI and Eco521, purifying the product after enzyme digestion, connecting the product to an expression vector pHY, and finally obtaining the expression vector pHY-bcp by screening and sequencing. (2) And respectively constructing different promoter expression vectors by using the constructed pHY-bcp as a template. The promoters selected included: p_cryIIIA(Bacillus thuringiensis crystallin promoter), P_Bsamy(Bacillus subtilis mesophilic amylase promoter), P_Baamy(Bacillus amyloliquefaciens mesophilic amylase promoter), P_HpaII(Derived from expression vector pMA5q), P_gsib(derived from Bacillus subtilis) P_Bsapr(Bacillus subtilis alkaline protease promoter)，P_Bsnpr(Bacillus subtilis neutral protease promoter) and P_Blapr(the lichen spore alkaline protease promoter) and the nucleotide sequence of the promoter is shown in SEQ ID NO. 3-SEQ ID NO. 10. (3) And transferring all different promoter expression vectors into the bacillus subtilis RIK1285 by adopting an electrical transformation method to obtain a plurality of transformants. (4) And performing enzyme activity screening after culturing a plurality of transformants to determine a single optimal promoter. (5) And (4) constructing a hybrid promoter by using the single optimal promoter as a template, and repeating the steps (3) and (4) to obtain the hybrid promoter. The hybrid promoter is pHYP_{Bsapr-cryIIIA}The enzyme activity of the corresponding recombinant engineering bacteria is 2210U/mL, and the nucleotide sequence of the recombinant engineering bacteria is shown as SEQ ID NO. 11.

According to another aspect of the present invention, there is also provided a recombinant expression vector comprising the above-mentioned alkaline protease gene bcp, the hybrid promoter of claim 3 and a signal peptide, the nucleotide sequence of which is shown in SEQ ID NO. 15. The promoter and the signal peptide are used as core elements for the recombinant expression of the bacillus subtilis and play an important role in the process of the recombinant expression of heterologous proteins. Different enzymes are selective to promoters and signal peptides, so that the protease is heterologously expressed in the bacillus subtilis, and the optimal promoter and signal peptide are obtained by screening. The signal peptide is optimized to further improve the expression level of the alkaline protease BCP in the bacillus subtilis RIK 1285. Selected signal peptides include: SP_Bsamy(Bacillus subtilis medium temperature amylase signal peptide), SP_Bsapr(Bacillus subtilis alkaline protease signal peptide), SP_Bsnpr(Bacillus subtilis neutral protease signal peptide), SP_Bschi(Bacillus subtilis chitinase Signal peptide), SP_DacB(Bacillus subtilis DacB signal peptide), SP_Vpr(Bacillus subtilis Vpr signal peptide), SP_YncM(Bacillus subtilis YncM signal peptide) and SP_Ap(Bacillus subtilis aminopeptidase signal peptide), the nucleotide sequence of which is shown in SEQ ID NO. 12-SEQ ID NO. 19. Respectively transferring different signal peptide expression vectors into bacillus subtilis RIK1285, screening transformants, determining the best signal peptide, and obtaining the SP_Bschi(Bacillus subtilis chitinase signal peptide) the best effect, it is onThe fermentation enzyme activity of the corresponding recombinant engineering bacteria is the highest, the enzyme activity is 2650U/mL after 48 hours of culture, and then the recombinant engineering bacteria are corresponding to the SPBsamy and the SPBsnpr, and the enzyme activities are 2452U/mL and 2345U/mL respectively. The recombinant expression vector is pHYP_{Bsapr-cryIIIA}-SP_Bschi-bcp。

According to another aspect of the invention, a recombinant expression engineering bacterium is also provided, which comprises the recombinant expression vector. In the mode of free plasmid expression, the fermentation enzyme activity of the recombinant engineering bacteria is obviously reduced after multiple passages, so that an optimal recombinant expression vector pHYP needs to be obtained_{Bsapr-cryIIIA}-SP_BschiIntegration of bcp into the B.subtilis RIK1285 genome. After the recombinant expression engineering strain Bs16-5 is cultured in a 7-liter fermentation tank for 48 hours, the fermentation activity reaches the highest value of 51807U/mL; the fermentation enzyme activity after 48 hours of culture in a 50L fermentor was 53708U/mL.

According to another aspect of the present invention, there is also provided a method for preparing the above alkaline protease BCP, comprising the steps of:

providing an alkaline protease gene bcp, an expression vector and an expression strain;

amplifying alkaline protease gene bcp, and connecting an amplification product with an expression vector to obtain a recombinant expression vector;

integrating the recombinant expression vector gene into an expression strain to obtain recombinant expression engineering bacteria;

culturing the recombinant expression engineering bacteria to obtain alkaline protease BCP;

wherein, the nucleotide sequence of the alkaline protease gene bcp is shown as SEQ ID NO:1 is shown.

The preparation method of the alkaline protease BCP firstly obtains the alkaline protease BCP coding gene BCP through homologous cloning, secondly obtains the high-efficiency recombinant bacillus subtilis engineering bacteria Bs16-5 through promoter and signal peptide optimization and integrated expression, and finally realizes the high-efficiency preparation of the alkaline protease BCP through high-density fermentation, thereby laying a foundation for the industrial application of the alkaline protease BCP.

Further, the expression vector comprises a vector pHY, a hybrid promoter and a signal peptide; and/or, the expression strain is bacillus subtilis RIK 1285.

Further, the recombinant expression vector gene is integrated into the site of the mesophilic amylase gene of bacillus subtilis RIK 1285.

Further, in the amplification process of the alkaline protease gene bcp, primers for amplification include a forward primer and a reverse primer, and the nucleotide sequence of the forward primer is shown as SEQ ID NO:20, the nucleotide sequence of the reverse primer is shown as SEQ ID NO: shown at 21.

According to another aspect of the invention, the application of the above alkaline protease BCP in hydrolyzing protein is also provided, wherein the reaction temperature of the alkaline protease BCP is 20-70 ℃; the reaction pH value of the alkaline protease BCP is 7-11.

The invention has the following beneficial effects:

the total length of the alkaline protease gene BCP is 1143bp, and the alkaline protease gene BCP is efficiently expressed in a bacillus subtilis expression strain, so that the production cost of the alkaline protease BCP is reduced.

In addition to the objects, features and advantages described above, other objects, features and advantages of the present invention are also provided. The present invention will be described in further detail below with reference to the accompanying drawings.

Drawings

The accompanying drawings, which are incorporated in and constitute a part of this application, illustrate embodiments of the invention and, together with the description, serve to explain the invention and not to limit the invention. In the drawings:

FIG. 1 is a three-dimensional structural view of the alkaline protease BCP according to a preferred embodiment of the present invention;

FIG. 2 is a schematic diagram of the optimization of the recombinant expression vector according to the preferred embodiment of the present invention;

FIG. 3 is a graph showing the enzyme production of Bacillus subtilis Bs16-5 in a 7-liter fermentor culture in accordance with a preferred embodiment of the present invention;

FIG. 4 is a graph showing the enzyme production of Bacillus subtilis Bs16-5 in a 50-liter fermentor culture in accordance with a preferred embodiment of the present invention;

FIG. 5 is a graph showing reaction temperature characteristics of BCP, an alkaline protease according to a preferred embodiment of the present invention; and

FIG. 6 is a pH profile of BCP, an alkaline protease according to a preferred embodiment of the present invention.

Detailed Description

It should be noted that the embodiments and features of the embodiments in the present application may be combined with each other without conflict. The present invention will be described in detail below with reference to the embodiments with reference to the attached drawings.

FIG. 1 is a three-dimensional structural view of the alkaline protease BCP according to a preferred embodiment of the present invention; FIG. 2 is a schematic diagram of the optimization of the recombinant expression vector according to the preferred embodiment of the present invention; FIG. 3 is a graph showing the enzyme production of Bacillus subtilis Bs16-5 in a 7-liter fermentor culture in accordance with a preferred embodiment of the present invention; FIG. 4 is a graph showing the enzyme production of Bacillus subtilis Bs16-5 in a 50-liter fermentor culture in accordance with a preferred embodiment of the present invention; FIG. 5 is a graph showing reaction temperature characteristics of BCP, an alkaline protease according to a preferred embodiment of the present invention; and FIG. 6 is a pH profile of BCP, an alkaline protease according to a preferred embodiment of the present invention.

Examples

Coli strains Topl0 and Bacillus subtilis RIK1285 were purchased from Takara Shuzo Co.

Bacillus circulans sy1 was obtained from the screening of bean dregs in the early laboratory.

The expression vector pHY was constructed from the preliminary experiments in this subject group and was routinely stored in a freezer at-80 ℃.

High fidelity Q5 enzyme, available from NEB.

Plasmid extraction, gel purification, restriction enzyme, and kit were purchased from Shanghai Biotech.

The culture medium of the escherichia coli and the bacillus subtilis RIK1285 is LB liquid and solid culture medium, and the components of the LB liquid culture medium are as follows: 1% peptone, 0.5% yeast extract, 1% NaCl, ph 7.0; the solid culture medium is prepared by adding 2.5% agar powder to liquid culture medium.

The screening culture medium of the escherichia coli and the bacillus subtilis RIK1285 is a liquid LBK culture medium and a solid LBK culture medium, and is mainly used for screening the escherichia coli recombinant transformant and the bacillus subtilis recombinant transformant. Liquid LBK configuration: adding 30 mu g/mL kanamycin into the sterilized LB liquid culture medium to obtain a liquid LBK culture medium; solid LBK medium: heating and dissolving the sterilized solid LB culture medium, cooling the culture medium to 50 ℃, adding kanamycin according to 30 mu g/mL, and inverting the culture medium to obtain the solid LBK culture medium.

The bacillus subtilis fermentation medium is a maltose culture medium and comprises the following components: 2.5% of yeast extract, 1.5% of peptone, 4% of maltose, 1% of sodium citrate, 0.3% of calcium chloride and 1% of dipotassium phosphate.

The high-density fermentation medium comprises the following components: 7% of maltose, 2.5% of soybean meal, 1.5% of yeast powder, 2% of bran, 1% of dipotassium phosphate, 0.3% of trisodium citrate and 0.3% of calcium chloride.

Example 1

Cloning of alkaline protease gene bcp gene and construction of expression vector

Extracting a Bacillus circulans genome sy1 by referring to a bacterial genome extraction kit, designing a pair of primers according to a genome sequence (GenBank: UAPZ 01000012.1: 120935-122077) of a Bacillus circulans strain NCTC2610, wherein the nucleotide sequence of a forward primer is shown as SEQ ID NO:20 (bc1-fw, 5'-TCACGGCCGATGAAGAAACTGTTGACGAAA-3', underlined is Ec52I cleavage site), and the nucleotide sequence of the reverse primer is shown in SEQ ID NO:21 (bc 1-rev: 5'-ACGTCTAGAGCGTGTTGCCGCTTCTGC-3', underlined XbaI cleavage site) for amplification of the Bacillus circulans alkaline protease gene bcp. The extracted genome is used as a template, and the alkaline protease gene bcp is obtained by PCR amplification.

The amplified alkaline protease gene bcp was purified by agarose gel digestion and digested with restriction enzymes XbaI and Eco521, the digested product was purified, ligated to an expression vector pHY, the ligated product was transformed into E.coli Top10, and the transformed product was spread uniformly on LBK solid medium. The transformant is screened by a bacterial liquid PCR method, which comprises the following steps: (1) the transformant was inoculated in a single colony form into a 2ml sterilized centrifuge tube containing 300. mu.l of LBK liquid medium, and cultured at 37 ℃ and 200rpm for 5 hours; (2) taking the cultured bacterial liquid as a template, carrying out PCR amplification by using primers bc1-fw and bc1-rev, inoculating a transformant with a correct amplification result into an LBK liquid culture medium for culture, and extracting plasmids; (3) through sequencing verification, the expression vector pHY-bcp is finally obtained.

Example 2

Single promoter optimization

And respectively constructing different promoter expression vectors by using the constructed expression vector pHY-bcp as a template. The promoters selected included: p_cryIIIA(Bacillus thuringiensis crystallin promoter), P_Bsamy(Bacillus subtilis mesophilic amylase promoter), P_Baamy(Bacillus amyloliquefaciens mesophilic amylase promoter), P_HpaII(derived from the expression vector pMA5q), P_gsib(derived from Bacillus subtilis) P_Bsapr(Bacillus subtilis alkaline protease promoter), P_Bsnpr(Bacillus subtilis neutral protease promoter) and P_Blapr(lichenified spore alkaline protease promoter), the nucleotide sequence of the promoter is shown in SEQ ID NO. 3-SEQ ID NO.10, all the promoter sequences are synthesized by general biology company, and Eco52I and MluI enzyme cutting sites are added at both ends of the promoter sequence in the gene synthesis process.

As shown in FIG. 2, the specific procedure is as follows (in pHY)_PcryIIIA-bcp for example, other analogous): the expression vector pH was first digested with restriction enzymes Eco52I and MluI, respectively_Y-bcpAnd synthetic promoter P_cryIIIAA plasmid; then, main frame pHY (containing no pHY self-contained promoter P43) and P were recovered by agarose gel aggregation_cryIIIAA promoter, and P_cryIIIAThe promoter is connected to the main frame pHY, and is transferred into escherichia coli Top 10; finally, the pHYP of the expression vector is determined and obtained through colony PCR and sequencing verification_cryIIIA-bcp. Respectively obtaining pHYP by sequential method_cryIIIA-bcp、pHYP_Bsamy-bcp、pHYP_Baamy-bcp、pHYP_HpaII-bcp、pHYP_gsib-bcp、pHYP_Bsapr-bcp、pHYP_Bsnpr-bcp、pHYP_BlaprBcp, 8 expression vectors in total.

8 expression vectors are transferred into bacillus subtilis RIK1285 by adopting an electrical transformation method. The transformation process is as follows: (1) picking a single colony (diameter is 2 mm-3 mm) from a plate cultured for 16 h-20 h at 37 ℃, transferring the single colony into a 50mL EP tube containing 5mL of LB culture medium, and violently shaking at 37 ℃ for overnight; (2) inoculating 1% of the inoculum size in 50ml GM (LB +0.5M sorbitol), measuring OD in a shaking tube, and controlling the inoculum size to ensure that the OD of the culture medium after inoculation is between 0.19 and 0.2, culturing at 37 ℃ and 200rpm until the OD600 is about 0.8 to 1.0 (about 3 to 4 hours); (3) taking all bacteria liquid, carrying out ice-water bath for 10min, then centrifuging at 5000rpm for 8min at 4 ℃ and collecting thalli; (4) washing thallus with 30ml precooled electrotransfer buffer ETM (0.5M sorbitol, 0.5M mannitol, 10% glycerol, and optionally 0.5M trehalose to improve efficiency), centrifuging at 5000rpm for 8min at 4 deg.C to remove supernatant, and rinsing for 3 times; (5) resuspending the washed cells in 500. mu.l ETM, and packaging 100. mu.l each tube; (6) add 1-6. mu.l plasmid into 100. mu.l competent cell, incubate for 5min in ice bath, add into precooled electric rotating cup (1mm), shock once, the setting of electric rotating instrument: 1.5-2.0 kv, 25 muF, 200 omega, 1mm, 1 time of electric shock (duration time is between 4.5ms and 5 ms); (7) after the electric shock, 0.5ml of recovery medium RM (LB +0.5M sorbitol +0.38 mannitol) was added immediately, and after recovery for 3 hours at 37 ℃ and 120rpm, the mixture was plated on an LBK solid plate and cultured overnight at 37 ℃.

And (3) screening transformants by adopting shake flask culture, respectively inoculating bacillus subtilis RIK1285 containing different promoter expression vectors into a 50mL centrifuge tube containing 5mL of bacillus subtilis fermentation medium, culturing at 37 ℃ and 200rpm for 24 hours, and then inoculating the bacillus subtilis RIK into a 500mL shake flask containing 50mL of bacillus subtilis fermentation medium according to the inoculation amount of 5%. The enzyme activity was measured after culturing at 37 ℃ and 200rpm for 48 hours. The enzyme activity determination method is carried out by referring to the national standard GB/T23527-2009 alkaline protease.

The results of the experiments are shown in Table 1, and it can be seen from Table 1 that the promoter P is contained_cryIIIAThe highest enzyme activity of the bacillus subtilis is 1852U/mL, and the second is promoter P_BsaprAnd promoter P_BaamyThe enzyme activity is 1455U/mL and 1415U/mL respectively.

TABLE 1 enzymatic Activity of expression from different promoters

Example 3

Dual promoter optimization

Double promoter optimization was performed based on the results of example 2, using expression vector pHYP, since the promoter PcryIIIA enzyme activity was highest_cryIIIAConstruction of double-promoter expression vector with-bcp as template, and other four promoters P_Bsapr、P_Baamy、P_BsamyAnd P_HpaIIAnd (4) carrying out matching. The construction process of the double-promoter expression vector is as follows (with the double-promoter expression vector pHYP)_{Bsapr-cryIIIA}-bcp as an example): (1) using expression vector pHYP_cryIIIABcp is a template, and PCR amplification is carried out by primers of double-1-fw and double-1-rev, wherein the nucleotide sequence is shown in SEQ ID NO. 22-SEQ ID NO.23, so as to obtain a main frame 1; (2) using expression vector pHYP_Bsapr-bcp as template by primer P_Bsapr-fw and P_BsaprPCR amplification of rev to obtain promoter P_Bsapr(ii) a (3) Promoter P by the seamless cloning method_BsaprFusing with main frame 1 to obtain dual-promoter expression vector pHYP_{Bsapr-cryIIIA}-bcp。

All primer sequences of this part are shown below (5 '-3'):

main frame 1 primer, nucleotide sequence of bis-fw (SEQ ID No. 22): TCGAAACGTAAGATGAAACCT, nucleotide sequence of bis-rev (SEQ ID NO. 23): ACGCGTTCAGACCAGTTTTTAA are provided.

P_BsaprPrimer, P_Bsapr-the nucleotide sequence of fw (SEQ ID NO. 24): AAAAACTGGTCTGAACGCGTTATTTCTTCCTCCCTCTCAAT, P_Bsapr-the nucleotide sequence of rev (SEQ ID No. 25): GGTTTCATCTTACGTTTCGATCTTTACCCTCTCCTTTTAAA are provided.

P_BaamyPrimer, P_Baamy-the nucleotide sequence of fw (SEQ ID NO. 26): AAAAACTGGTCTGAACGCGTGCCCCGCACATACGAAAAGAC, P_Baamy-the nucleotide sequence of rev (SEQ ID No. 27): GGTTTCATCTTACGTTTCGAGTTTCCTCTCCCTCTCATTTT are provided.

P_BsamyPrimer, P_Bsamy-the nucleotide sequence of fw (SEQ ID NO. 28): AAAAACTGGTCTGAACGCGTCCGAGAATGGACACCAAAGA, P_Bsamy-the nucleotide sequence of rev (SEQ ID No. 29): GGTTTCATCTTACGTTTCGATCTTGACACTCCTTATTTGAT are provided.

P_HpaIIPrimer, P_HpaII-the nucleotide sequence of fw (SEQ ID NO. 30): AAAAACTGGTCTGAACGCGTGGGCGCGATTGCTGAATAAAAG, P_HpaII-the nucleotide sequence of rev (SEQ ID No. 31): GGTTTCATCTTACGTTTCGAATGTAAATCGCTCCTTTTTA

Respectively expressing the two promoter expression vectors pHYP_{Bsapr-cryIIIA}-bcp、pHYP_{Baamy-cryIIIA}-bcp、pHYP_{Bsamy-cryIIIA}Bcp and pHYP_{HpaII-cryIIIA}The-bcp was transformed into Bacillus subtilis RIK1285, the transformation process and the selection method of the recombinant transformant were the same as in example 2, and the enzyme activity was measured.

As a result of the experiment, pHYP was found_{Bsapr-cryIIIA}-bcp，pHYP_{Baamy-cryIIIA}-bcp，pHYP_{Bsamy-cryIIIA}Bcp and pHYP_{HpaII-cryIIIA}The enzyme activity of the recombinant engineering bacteria corresponding to the bcp is 2210U/mL, 1985U/mL, 1850U/mL and 2042U/mL respectively.

TABLE 2 enzymatic Activity of expression from different promoters

Example 4

Signal peptide optimization

The signal peptide is selected from the group consisting of: SP_Bsamy(Bacillus subtilis medium temperature amylase signal peptide), SP_Bsapr(Bacillus subtilis alkaline protease signal peptide), SP_Bsnpr(Bacillus subtilis neutral protease signal peptide), SPBschi (Bacillus subtilis chitinase signal peptide), SP_DacB(Bacillus subtilis DacB signal peptide), SP_Vpr(Bacillus subtilis Vpr signal peptide), SP_YncM(Bacillus subtilis YncM signal peptide) and SP_Ap(Bacillus subtilis aminopeptidase signal peptide) and the nucleotide sequence is shown in SEQ ID NO. 12-SEQ ID NO. 19.

Optimized vector pHYP with double promoters_{Bsapr-cryIIIA}Construction of different signal peptide expression vectors using-bcp as template (with expression vector pHYP)_{Bsapr-cryIIIA}-SP_Bschi-bcp as an example): (1) using expression vector pHYP_{Bsapr-cryIIIA}Bcp is a template, and a main frame 2 is obtained by amplification of primers, namely, signal-fw and signal-rev; (2) the primer SP was prepared by PCR_Bschi-fw and SP_BschiRev Synthesis of Signal peptide SP_Bschi(ii) a (3) SP is cloned by seamless cloning_BschiConnecting with main frame 2 to obtain expression vector pHYP_{Bsapr-cryIIIA}-SP_Bschi-bcp。

All primer sequences for this part are shown below:

main frame 2 primer, nucleotide sequence of signal-fw (SEQ ID NO. 32): GCTGAGGAAGCAAATGAAAAAT, nucleotide sequence of believe-rev (SEQ ID NO. 33): CGGCCGCTTTTCATAATACATAA are provided.

SP_BsamyPrimer, SP_Bsamy-the nucleotide sequence of fw (SEQ ID NO. 34): TATTATGAAAAGCGGCCGATGTTTGCAAAACGATTCAAAACCTCTTTACTGCCGTTATTCGCTGGATTTTTAT, SP_Bsamy-the nucleotide sequence of rev (SEQ ID No. 35): TTCATTTGCTTCCTCAGCAGCACTCGCAGCCGCCGGTCCTGCCAGAACCAAATGAAACAGCAATAAAAATCCA are provided.

SP_BsaprPrimer, SP_Bsapr-the nucleotide sequence of fw (SEQ ID NO. 36): TATTATGAAAAGCGGCCGGTGAGAAGCAAAAAATTGTGGATCAGCTTGTTGTTTGCGTTAACGTTA, SP_Bsapr-the nucleotide sequence of rev (SEQ ID No. 37): TTCATTTGCTTCCTCAGCAGCCTGCGCAGACATGTTGCTGAACGCCATCGTAAAGATTAACGTTAA are provided.

SP_BsnprPrimer, SP_Bsnpr-the nucleotide sequence of fw (SEQ ID NO. 38): TATTATGAAAAGCGGCCGGTGGGTTTAGGTAAGAAATTGTCTGTTGCTGTCGCTGCTTCGTTT, SP_Bsnpr-the nucleotide sequence of rev (SEQ ID No. 39): TTCATTTGCTTCCTCAGCAGCCTGAACACCTGGCAGGCTGATTGATAAACTCATAAACGAAGC are provided.

SP_BschiPrimer, SP_Bschi-the nucleotide sequence of fw (SEQ ID No. 40): TATTATGAAAAGCGGCCGATGAAAAAAGTGTTTTCAAACAAAAAGTTTCTCGTTTTTTCTTTCATTTTTGCGA, SP_Bschi-the nucleotide sequence of rev (SEQ ID No. 41): TTCATTTGCTTCCTCAGCGGCTTTTGCACTTTCCCCATTAAAAAAAGACAGACTTAAAATCATCGCAAAAATG are provided.

SP_DacBPrimer, SP_DacB-the nucleotide sequence of fw (SEQ ID No. 42): TATTATGAAAAGCGGCCGATGCGCATTTTCAAAAAAGCAGTATTCGTGATCATGATTTCTTTT，SP_DacB-the nucleotide sequence of rev (SEQ ID No. 43): TTCATTTGCTTCCTCAGCAGCATGTGCTGTATTCACATTTACGGTTGCAATAAGAAAAGAAAT are provided.

SP_VprPrimer, SP_Vpr-the nucleotide sequence of fw (SEQ ID NO. 44): TATTATGAAAAGCGGCCGATGAAAAAGGGGATCATTCGCTTTCTGCTTGTAAGTTTCGTCTTATTTTTT, SP_Vpr-the nucleotide sequence of rev (SEQ ID No. 45): TTCATTTGCTTCCTCAGCAGCCGGAGCTGCCTGAACGCCCGTAATGCCTGTGGATAACGCAAAAAATAAG are provided.

SP_YncMPrimer, SP_YncM-the nucleotide sequence of fw (SEQ ID NO. 46): TATTATGAAAAGCGGCCGATGGCGAAACCACTATCAAAAGGGGGAATTTTGGTGAAAAAAGTATTGATTGCAGGTGCAGTAGGAACAG, SP_YncM-the nucleotide sequence of rev (SEQ ID No. 47): TTCATTTGCTTCCTCAGCAGCGTCTGCCGCGGGTAAACCTGGTATACCTGATGAAAGGGTTCCGAAAAGAACTGCTGTTCCTACTGCA are provided.

SP_ApPrimer, SP_Ap-the nucleotide sequence of fw (SEQ ID NO. 48): TATTATGAAAAGCGGCCGATGAAAAAGCTTTTGACTGTCATGACGATGGCTGTTTTAACTGCCGGCAC, SP_Ap-the nucleotide sequence of rev (SEQ ID No. 49): TTCATTTGCTTCCTCAGCAGCGTGCGCGGCAGGGGTGACACTCTGTGCCGGCAAGAGCAGTGTGCCGGC are provided.

Different signal peptide expression vectors are respectively transferred into bacillus subtilis RIK1285, the conversion process and the screening method of the recombinant transformant are the same as the embodiment 2, and the enzyme activity is measured.

As shown in Table 3, it can be seen from Table 3 that SP_BschiThe (Bacillus subtilis chitinase signal peptide) has the best effect, the corresponding recombinant engineering bacteria have the highest fermentation enzyme activity, the enzyme activity is 2650U/mL after 48 hours of culture, and SP is used for the second time_BsamyAnd SP_BsnprThe enzyme activities of the corresponding recombinant engineering bacteria are 2452U/mL and 2345U/mL respectively.

TABLE 3 enzymatic Activity of different Signal peptide expressions

Example 5

Expression of integrated genes

Expression ofThe vector pHY can be used as a gene integration vector for integration and expression, the 5 'end and the 3' homology arm of the mesophilic amylase of the bacillus subtilis exist on the pHY vector, and in addition, a replicon of the pHY vector is a temperature-sensitive replicon. Will contain pHYP_{Bsapr-cryIIIA}-SP_Bschi-bcp recombinant bacillus subtilis to perform a gene integration experiment, the process of which is approximately as follows: (1) inducing at 45 deg.C to make expression vector pHYP_{Bsapr-cryIIIA}-SP_BschiInactivation of the replicon of bcp, thus promoting the expression vector pHYP_{Bsapr-cryIIIA}-SP_BschiHomologous recombination of bcp and B.subtilis RIK 1285; (2) extracting homologous recombination single colony, inoculating the extracted homologous recombination single colony into a 2ml sterilization centrifugal tube containing 400 mul LB liquid culture medium, culturing for 4 hours at 37 ℃ and 200rpm, and then treating bacterial liquid at 95 ℃ to be used as a PCR amplification template; (3) and taking the heat-treated bacterial liquid as a template, and identifying the nucleotide sequence of the forward primer at the 5 end as shown in SEQ ID NO: 50 (5-fw: 5' -TTCAAAACCTCTTTACTGCCG) and the nucleotide sequence of the reverse primer identified at the 5-terminal is shown in SEQ ID NO: 51 (5-end identification-rev: 5'-GGTCTTTCACATCTTCTGGGC-3'), and the nucleotide sequence of the forward primer identified by the 3-end is shown in SEQ ID NO: 52 (3-terminal identification-fw: 5'-GATGGCTACTCCTCATGTTGC-3') and the nucleotide sequence of the reverse primer identified by the 3-terminal is shown in SEQ ID NO: 53 (primer 3 end identification-rev: 5'-CGCCGTCTCTGGTCCATTATT-3'), 3' end homologous arm amplification is carried out, and the position where the homologous arm single exchange occurs is determined; (3) carrying out nonresistant subculture on the transformants at the position where the homologous arm single exchange occurs, carrying out continuous subculture for 10 times, and carrying out a dot plate experiment, wherein transformants which do not grow on the resistant plate and grow on the nonresistant plate are preliminarily determined as successful gene integration; (4) extracting the genome of the bacillus subtilis with successfully integrated genes, performing PCR amplification by using primer 5 end identification-fw and primer 3 end identification-rev, sequencing the amplified product, and successfully integrating the genes of the bacillus subtilis. Finally, 5 recombinant expression engineering bacteria (respectively named as bacillus subtilis Bs16-1, bacillus subtilis Bs16-2, bacillus subtilis Bs16-3, bacillus subtilis Bs16-4 and bacillus subtilis Bs16-5) with successfully integrated genes are obtained.

The 5 recombinant transformants were cultured and screened by the culture method of example 2, and after 48 hours of culture, the enzyme activities of the 5 recombinant expression engineering bacteria were 2510U/mL, 2515U/mL, 2351U/mL, 2462U/mL and 2615U/mL, respectively. As the Bs16-5 has the highest fermentation enzyme activity, the recombinant expression engineering bacteria Bs16-5 are selected for high-density fermentation culture.

Example 6

High density fermentation

Carrying out high-density fermentation experiments on recombinant expression engineering strains of bacillus subtilis Bs16-5 in 7-liter and 50-liter fermentation tanks, wherein the culture medium for high-density fermentation is as follows: 7% of maltose, 2.5% of soybean meal, 1.5% of yeast powder, 2% of bran, 1% of dipotassium phosphate, 0.3% of trisodium citrate and 0.3% of calcium chloride, wherein the culture temperature is 37 ℃, and the culture pH is 6.0. Taking fermentation liquor at intervals during the culture process for enzyme activity determination.

As shown in FIG. 3, the fermentation enzyme activity of the recombinant expression engineering strain Bacillus subtilis Bs16-5 reaches the highest value of 51807U/mL after culturing for 48 hours in a 7-liter fermentor. As shown in FIG. 4, the maximum level of the fermentative enzyme activity was 53708U/mL after 48 hours of culture in a 50-liter fermentor.

Example 7

Measurement of temperature characteristics

Centrifuging the high-density fermentation liquor to obtain liquid alkaline protease BCP enzyme liquid, wherein the temperature characteristic of the alkaline protease BCP is determined as follows: measuring the enzyme activity of the alkaline protease BCP at different temperatures of 20-70 ℃ under the condition of pH10.0, and calculating the relative enzyme activity at other temperatures by taking the enzyme activity at the highest temperature of the enzyme activity as 100%; and (3) carrying out water bath heat treatment at different temperatures of 50-70 ℃ for 10min, then determining residual enzyme activity, taking the enzyme activity without heat treatment as 100%, and calculating the relative residual enzyme activity at other temperatures.

The experimental result shows that the temperature characteristic of the alkaline protease BCP is shown in figure 5, the relative enzyme activities of the alkaline protease BCP at 20 ℃ and 70 ℃ are respectively 9.7% and 31.6%, the optimal reaction temperature is 60 ℃, the alkaline protease has good stability in terms of thermal stability, the BCP has good stability at different temperatures of 20 ℃ to 50 ℃, after 10min of heat treatment, the residual enzyme activities are both more than 90%, when the temperature is increased to be higher than 50 ℃, the thermal stability of the BCP is sharply reduced, and after 10min of heat treatment at 60 ℃ and 70 ℃, the residual enzyme activities are only 21% and 3%.

Example 8

Determination of pH characteristics

Centrifuging the high-density fermentation liquor to obtain liquid alkaline protease BCP enzyme liquid, wherein the pH characteristic of the alkaline protease BCP is determined as follows: measuring the enzyme activity of alkaline protease BCP at the pH value of 6.0-11.0 at the temperature of 60 ℃, and calculating the relative enzyme activity at other pH values by taking the enzyme activity under the highest enzyme activity pH value as 100%; and (3) under the condition of pH6.0-11.0, storing at room temperature for 5 hours, determining residual enzyme activity, taking the enzyme activity which is not subjected to any treatment as 100%, and calculating the relative residual enzyme activity at other temperatures.

According to the experimental result, the pH characteristic of the alkaline protease BCP is shown in figure 6, the relative enzyme activity of the alkaline protease BCP is more than 70% within the range of pH 7.0-11.0, and the optimal reaction pH is 10.0; in the aspect of pH stability, the residual enzyme activity is more than 80% after the mixture is stored for 5 hours at room temperature under the condition of pH6.0-11.0, and the alkaline protease BCP has good stability in the pH range.

The methods used in the present invention are conventional methods unless otherwise specified, and are carried out as described in molecular cloning, a laboratory Manual (J. SammBruk, D.W. Lassel, Huang Petang, Wang Jia seal, Zhu Hou, et al, 3 rd edition, Beijing: scientific Press, 2002). Meanwhile, the amino acids in the invention are marked by their abbreviations or codes unless otherwise specified (see Table 4 for the names of the amino acids in English and their abbreviations and codes).

TABLE 4 Chinese and English names of amino acids, their abbreviations and codes

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Shaoyang college

<120> alkaline protease gene, hybrid promoter, recombinant expression vector, recombinant expression engineering bacterium, alkaline protease, method and application

<160> 53

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1143

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgaagaaac tgttgacgaa aattgtcgca agcgccgcac tactcctttc tgttgctttt 60

acttcatcga tcgtatcggc tgctgaggaa gcaaatgaaa aatatttaat tggccttaat 120

gagcaggaag ctgtcagtga gtttgtagaa tccatagagg caaatgacga ggtcgccatt 180

ctctctgagg atgagtcagt cgaaattgaa ttgcttcatg agtttgaaac gattcctgtt 240

gtatccgttg agttaagccc agaagatgtg aaagaccttg aaaaagatcc agcgatttct 300

tatactgaag aggatattga agtaacgata atggcgcaat cagtgccatg gggaattagc 360

cgtgtgcaag ccccagctgc ccataaccgt ggattgacag gttctggtga aaaagttgct 420

gtcctcgata caggtatttc cactcatcca gacttaaata ttcgtggtgg cgctagcttt 480

gtaccagggg caccatccac tcaagatggg aatgggcatg gcacgcatgt ggccgggacg 540

attgctgctt taaacaattc gattggcgtt cttggcgtag cgccgagtgc ggaactatac 600

gctgttaatg ttttaggagc cgacgggaga ggtgcaatca gctcgattgc ccatgggttg 660

gaatggacag ggaacaataa catgcacgtt gctaatttaa gtttaggaag cccttcgcca 720

agtgccacac ttgagcaagc tgttaatagc gcgacttcta gaggcgttct tgttgtagcg 780

gcatctggga attcaggtgc aagctcaatc agctatccgg cccgttatgc gaacgcaatg 840

gcagtcggag ctactgacca aaacaacaac cgcgccagct tttcacagta tggcgcaggg 900

cttgacattg tcgcaccagg ggtaggcgtg cagagctcat acccaggttc aacgtatgcc 960

agcttaaacg gtacatcgat ggctactcct catgttgcag gtgtcgcagc ccttgttaaa 1020

cacaagaacc catcttggtc caatacacaa atccgcaacc atctagagaa tacggcaacg 1080

agcttaggaa gcacgaactt gtatgtaagc ggacttgtca aagcagaagc ggcaacacgc 1140

taa 1143

<210> 2

<211> 380

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Lys Lys Leu Leu Thr Lys Ile Val Ala Ser Ala Ala Leu Leu Leu

1 5 10 15

Ser Val Ala Phe Thr Ser Ser Ile Val Ser Ala Ala Glu Glu Ala Asn

20 25 30

Glu Lys Tyr Leu Ile Gly Leu Asn Glu Gln Glu Ala Val Ser Glu Phe

35 40 45

Val Glu Ser Ile Glu Ala Asn Asp Glu Val Ala Ile Leu Ser Glu Asp

50 55 60

Glu Ser Val Glu Ile Glu Leu Leu His Glu Phe Glu Thr Ile Pro Val

65 70 75 80

Val Ser Val Glu Leu Ser Pro Glu Asp Val Lys Asp Leu Glu Lys Asp

85 90 95

Pro Ala Ile Ser Tyr Thr Glu Glu Asp Ile Glu Val Thr Ile Met Ala

100 105 110

Gln Ser Val Pro Trp Gly Ile Ser Arg Val Gln Ala Pro Ala Ala His

115 120 125

Asn Arg Gly Leu Thr Gly Ser Gly Glu Lys Val Ala Val Leu Asp Thr

130 135 140

Gly Ile Ser Thr His Pro Asp Leu Asn Ile Arg Gly Gly Ala Ser Phe

145 150 155 160

Val Pro Gly Ala Pro Ser Thr Gln Asp Gly Asn Gly His Gly Thr His

165 170 175

Val Ala Gly Thr Ile Ala Ala Leu Asn Asn Ser Ile Gly Val Leu Gly

180 185 190

Val Ala Pro Ser Ala Glu Leu Tyr Ala Val Asn Val Leu Gly Ala Asp

195 200 205

Gly Arg Gly Ala Ile Ser Ser Ile Ala His Gly Leu Glu Trp Thr Gly

210 215 220

Asn Asn Asn Met His Val Ala Asn Leu Ser Leu Gly Ser Pro Ser Pro

225 230 235 240

Ser Ala Thr Leu Glu Gln Ala Val Asn Ser Ala Thr Ser Arg Gly Val

245 250 255

Leu Val Val Ala Ala Ser Gly Asn Ser Gly Ala Ser Ser Ile Ser Tyr

260 265 270

Pro Ala Arg Tyr Ala Asn Ala Met Ala Val Gly Ala Thr Asp Gln Asn

275 280 285

Asn Asn Arg Ala Ser Phe Ser Gln Tyr Gly Ala Gly Leu Asp Ile Val

290 295 300

Ala Pro Gly Val Gly Val Gln Ser Ser Tyr Pro Gly Ser Thr Tyr Ala

305 310 315 320

Ser Leu Asn Gly Thr Ser Met Ala Thr Pro His Val Ala Gly Val Ala

325 330 335

Ala Leu Val Lys His Lys Asn Pro Ser Trp Ser Asn Thr Gln Ile Arg

340 345 350

Asn His Leu Glu Asn Thr Ala Thr Ser Leu Gly Ser Thr Asn Leu Tyr

355 360 365

Val Ser Gly Leu Val Lys Ala Glu Ala Ala Thr Arg

370 375 380

<210> 3

<211> 426

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tgtcgacgtg catgcaggcc ggggcatatg ggaaacagcg cggacggagc ggaatttcca 60

atttcatgcc gcagccgcct gcgctgttct catttgcggc ttccttgtag agctcagcat 120

tattgagtgg atgattatat tccttttgat aggtggtatg ttttcgcttg aacttttaaa 180

tacagccatt gaacatacgg ttgatttaat aactgacaaa catcaccctc ttgctaaagc 240

ggccaaggac gctgccgccg gggctgtttg cgtttttacc gtgatttcgt gtatcattgg 300

tttacttatt tttttgccaa agctgtaatg gctgaaaatt cttacattta ttttacattt 360

ttagaaatgg gcgtgaaaaa aagcgcgcga ttatgtaaaa tataaagtga tagcggtacc 420

attata 426

<210> 4

<211> 510

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ccgagaatgg acaccaaaga agaactgcaa aaacgggtga agcagcagcg aatagaatca 60

attgcggtcg cctttgcggt agtggtgctt acgatgtacg acagggggat tccccataca 120

ttcttcgctt ggctgaaaat gattcttctt tttatcgtct gcggcggcgt tctgtttctg 180

cttcggtatg taattgtgaa gctggcttac agaagagcgg taaaagaaga aataaaaaag 240

aaatcatctt gaaaaataga tggtttcttt ttttgtttgg aaagcgaggg aagcgttcac 300

agtttcgggc agcttttttt ataggaacat tgatttgtat tcactctgcc aagttgtttt 360

gatagagtga ttgtgataat ttaaaatgta agcgttaaca aaattctcca gtcttcacat 420

cagtttgaaa ggaggaagcg gaagaatgaa gtaagaggga tttttgactc cgaagtaagt 480

cttcaaaaaa tcaaataagg agtgtcaaga 510

<210> 5

<211> 249

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gccccgcaca tacgaaaaga ctggctgaaa acattgagcc tttgatgact gatgatttgg 60

ctgaagaagt ggatcgattg tttgagaaaa gaagaagacc ataaaaatac cttgtctgtc 120

atcagacagg gtatttttta tgctgtccag actgtccgct gtgtaaaaat aaggaataaa 180

ggggggttgt tattatttta ctgatatgta aaatataatt tgtataagaa aatgagaggg 240

agaggaaac 249

<210> 6

<211> 479

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gggcgcgatt gctgaataaa agatacgaga gacctctctt gtatcttttt tattttgagt 60

ggttttgtcc gttacactag aaaaccgaaa gacaataaaa attttattct tgctgagtct 120

ggctttcggt aagctagaca aaacggacaa aataaaaatt ggcaagggtt taaaggtgga 180

gattttttga gtgatcttct caaaaaatac tacctgtccc ttgctgattt ttaaacgagc 240

acgagagcaa aacccccctt tgctgaggtg gcagagggca ggtttttttg tttctttttt 300

ctcgtaaaaa aaagaaaggt cttaaaggtt ttatggtttt ggtcggcact gccgacagcc 360

tcgcagagca cacactttat gaatataaag tatagtgtgt tatactttac ttggaagtgg 420

ttgccggaaa gagcgaaaat gcctcacatt tgtgccacct aaaaaggagc gatttacat 479

<210> 7

<211> 371

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gatcaagacc gtacatataa gaatgtcgct tctcaaatcc aaggctggcg agaagtcgtt 60

ttgggctatc gagacacgtt tggctggaaa aaacttttcc agatagtgcc ggttgccgga 120

atggtttttg gcgccgctgc caatcgctca acattaaacg acattaccga gacaggcatg 180

atgctgtaca aaaagaggcg cattcttgaa cgactgaaag aaacagaacg agagatggaa 240

tagcagaaag cagacggaca ccgcgatccg cctgcttttt ttagtggaaa catacccaat 300

gtgttttgtt tgtttaaaag aattgtgagc gggaatacaa caaccaacac caattaaagg 360

aggaattcaa a 371

<210> 8

<211> 432

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tatttcttcc tccctctcaa taattttttc attctatccc ttttctgtaa agtttatttt 60

tcagaatact tttatcatca tgctttgaaa aaatatcacg ataatatcca ttgttctcac 120

ggaagcacac gcaggtcatt tgaacgaatt ttttcgacag gaatttgccg ggactcagga 180

gcatttaacc taaaaaagca tgacatttca gcataatgaa catttactca tgtctatttt 240

cgttcttttc tgtatgaaaa tagttatttc gagtctctac ggaaatagcg agagatgata 300

tacctaaata gagataaaat catctcaaaa aaatgggtct actaaaatat tattccatct 360

attacaataa attcacagaa tagtctttta agtaagtcta ctctgaattt ttttaaaagg 420

agagggtaaa ga 432

<210> 9

<211> 520

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gattgcacct ggtgaataag ttcaacagac actcccgcca gcagcacaat ccgcaatata 60

acacccgcca agaacattgt gcgctgccgg tttattttgg gatgatgcac caaaagatat 120

aagcccgcca gaacaacaat tgaccattga atcagcaggg tgctttgtct gcttaatata 180

aaataacgtt cgaaatgcaa tacataatga ctgaataact ccaacacgaa caacaatcct 240

ttacttctta ttaaggcctc attcggttag acagcggact tttcaaaaag tttcaagatg 300

aaacaaaaat atctcatctt ccccttgata tgtaaaaaac ataactcttg aatgaaccac 360

cacatgacac ttgactcatc ttgatattat tcaacaaaaa caaacacagg acaatactat 420

caattttgtc tagttatgtt agtttttgtt gagtattcca gaatgctagt ttaatataac 480

aatataaagt tttcagtatt ttcaaaaagg gggatttatt 520

<210> 10

<211> 406

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

acgcctttca catgagctga tttcatatct tacacccgtt tctgtatgcg atatattgca 60

tattttaata gatgatcgac taggccgcaa cctccttcgg caaaaaatga tctcataaaa 120

taaatgaata gtattttcat aaaatgaatc agacgaagca atctcctgtc attcacggac 180

cccgggacct ctttccctgc caggttgaag cggtctattc atactttcga accgaatatt 240

tttctaaaac agttattaat aaccaataaa tttaaattgg ccgttcaaaa aaatgggtct 300

accatataat tcattttttt tctataataa attaacagaa taattggaat agagtatatt 360

attcttctat ttcaattatt ctgaataaaa cggaggagag tgagta 406

<210> 11

<211> 858

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tatttcttcc tccctctcaa taattttttc attctatccc ttttctgtaa agtttatttt 60

tcagaatact tttatcatca tgctttgaaa aaatatcacg ataatatcca ttgttctcac 120

ggaagcacac gcaggtcatt tgaacgaatt ttttcgacag gaatttgccg ggactcagga 180

gcatttaacc taaaaaagca tgacatttca gcataatgaa catttactca tgtctatttt 240

cgttcttttc tgtatgaaaa tagttatttc gagtctctac ggaaatagcg agagatgata 300

tacctaaata gagataaaat catctcaaaa aaatgggtct actaaaatat tattccatct 360

attacaataa attcacagaa tagtctttta agtaagtcta ctctgaattt ttttaaaagg 420

agagggtaaa gatgtcgacg tgcatgcagg ccggggcata tgggaaacag cgcggacgga 480

gcggaatttc caatttcatg ccgcagccgc ctgcgctgtt ctcatttgcg gcttccttgt 540

agagctcagc attattgagt ggatgattat attccttttg ataggtggta tgttttcgct 600

tgaactttta aatacagcca ttgaacatac ggttgattta ataactgaca aacatcaccc 660

tcttgctaaa gcggccaagg acgctgccgc cggggctgtt tgcgttttta ccgtgatttc 720

gtgtatcatt ggtttactta tttttttgcc aaagctgtaa tggctgaaaa ttcttacatt 780

tattttacat ttttagaaat gggcgtgaaa aaaagcgcgc gattatgtaa aatataaagt 840

gatagcggta ccattata 858

<210> 12

<211> 99

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

atgtttgcaa aacgattcaa aacctcttta ctgccgttat tcgctggatt tttattgctg 60

tttcatttgg ttctggcagg accggcggct gcgagtgct 99

<210> 13

<211> 87

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

atgagaagca aaaaattgtg gatcagcttg ttgtttgcgt taacgttaat ctttacgatg 60

gcgttcagca acatgtctgc gcaggct 87

<210> 14

<211> 81

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

atgggtttag gtaagaaatt gtctgttgct gtcgctgctt cgtttatgag tttatcaatc 60

agcctgccag gtgttcaggc t 81

<210> 15

<211> 99

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

atgaaaaaag tgttttcaaa caaaaagttt ctcgtttttt ctttcatttt tgcgatgatt 60

ttaagtctgt ctttttttaa tggggaaagt gcaaaagcc 99

<210> 16

<211> 81

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

atgcgcattt tcaaaaaagc agtattcgtg atcatgattt cttttcttat tgcaaccgta 60

aatgtgaata cagcacatgc t 81

<210> 17

<211> 93

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

atgaaaaagg ggatcattcg ctttctgctt gtaagtttcg tcttattttt tgcgttatcc 60

acaggcatta cgggcgttca ggcagctccg gct 93

<210> 18

<211> 126

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

atggcgaaac cactatcaaa agggggaatt ttggtgaaaa aagtattgat tgcaggtgca 60

gtaggaacag cagttctttt cggaaccctt tcatcaggta taccaggttt acccgcggca 120

gacgct 126

<210> 19

<211> 93

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

atgaaaaagc ttttgactgt catgacgatg gctgttttaa ctgccggcac actgctcttg 60

ccggcacaga gtgtcacccc tgccgcgcac gct 93

<210> 20

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

tcacggccga tgaagaaact gttgacgaaa 30

<210> 21

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

acgtctagag cgtgttgccg cttctgc 27

<210> 22

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

tcgaaacgta agatgaaacc t 21

<210> 23

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

acgcgttcag accagttttt a 21

<210> 24

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

aaaaactggt ctgaacgcgt tatttcttcc tccctctcaa t 41

<210> 25

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

ggtttcatct tacgtttcga tctttaccct ctccttttaa a 41

<210> 26

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

aaaaactggt ctgaacgcgt gccccgcaca tacgaaaaga c 41

<210> 27

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

ggtttcatct tacgtttcga gtttcctctc cctctcattt t 41

<210> 28

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

aaaaactggt ctgaacgcgt ccgagaatgg acaccaaaga 40

<210> 29

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

ggtttcatct tacgtttcga tcttgacact ccttatttga t 41

<210> 30

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

aaaaactggt ctgaacgcgt gggcgcgatt gctgaataaa ag 42

<210> 31

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

ggtttcatct tacgtttcga atgtaaatcg ctccttttta 40

<210> 32

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

gctgaggaag caaatgaaaa at 22

<210> 33

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

cggccgcttt tcataataca taa 23

<210> 34

<211> 73

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

tattatgaaa agcggccgat gtttgcaaaa cgattcaaaa cctctttact gccgttattc 60

gctggatttt tat 73

<210> 35

<211> 73

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 35

ttcatttgct tcctcagcag cactcgcagc cgccggtcct gccagaacca aatgaaacag 60

caataaaaat cca 73

<210> 36

<211> 66

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 36

tattatgaaa agcggccggt gagaagcaaa aaattgtgga tcagcttgtt gtttgcgtta 60

acgtta 66

<210> 37

<211> 66

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 37

ttcatttgct tcctcagcag cctgcgcaga catgttgctg aacgccatcg taaagattaa 60

cgttaa 66

<210> 38

<211> 63

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 38

tattatgaaa agcggccggt gggtttaggt aagaaattgt ctgttgctgt cgctgcttcg 60

ttt 63

<210> 39

<211> 63

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 39

ttcatttgct tcctcagcag cctgaacacc tggcaggctg attgataaac tcataaacga 60

agc 63

<210> 40

<211> 73

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 40

tattatgaaa agcggccgat gaaaaaagtg ttttcaaaca aaaagtttct cgttttttct 60

ttcatttttg cga 73

<210> 41

<211> 73

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 41

ttcatttgct tcctcagcgg cttttgcact ttccccatta aaaaaagaca gacttaaaat 60

catcgcaaaa atg 73

<210> 42

<211> 63

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 42

tattatgaaa agcggccgat gcgcattttc aaaaaagcag tattcgtgat catgatttct 60

ttt 63

<210> 43

<211> 63

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 43

ttcatttgct tcctcagcag catgtgctgt attcacattt acggttgcaa taagaaaaga 60

aat 63

<210> 44

<211> 69

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 44

tattatgaaa agcggccgat gaaaaagggg atcattcgct ttctgcttgt aagtttcgtc 60

ttatttttt 69

<210> 45

<211> 70

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 45

ttcatttgct tcctcagcag ccggagctgc ctgaacgccc gtaatgcctg tggataacgc 60

aaaaaataag 70

<210> 46

<211> 88

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 46

tattatgaaa agcggccgat ggcgaaacca ctatcaaaag ggggaatttt ggtgaaaaaa 60

gtattgattg caggtgcagt aggaacag 88

<210> 47

<211> 88

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 47

ttcatttgct tcctcagcag cgtctgccgc gggtaaacct ggtatacctg atgaaagggt 60

tccgaaaaga actgctgttc ctactgca 88

<210> 48

<211> 68

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 48

tattatgaaa agcggccgat gaaaaagctt ttgactgtca tgacgatggc tgttttaact 60

gccggcac 68

<210> 49

<211> 69

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 49

ttcatttgct tcctcagcag cgtgcgcggc aggggtgaca ctctgtgccg gcaagagcag 60

tgtgccggc 69

<210> 50

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 50

ttcaaaacct ctttactgcc g 21

<210> 51

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 51

ggtctttcac atcttctggg c 21

<210> 52

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 52

gatggctact cctcatgttg c 21

<210> 53

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 53

cgccgtctct ggtccattat t 21

Claims (10)

1. An alkaline protease gene bcp, characterized in that its nucleotide sequence is shown in SEQ ID NO. 1.

2. An alkaline protease BCP, which is characterized in that the amino acid sequence is shown as SEQ ID NO. 2.

3. A hybrid promoter for efficient expression of alkaline protease in Bacillus subtilis, wherein the nucleotide sequence of the hybrid promoter is as shown in SEQ ID No. 11.

4. A recombinant expression vector comprising the alkaline protease gene bcp of claim 1, the hybrid promoter of claim 3 and a signal peptide, the nucleotide sequence of which is shown in SEQ ID No. 15.

5. A recombinant expression engineered bacterium comprising the recombinant expression vector of claim 4.

6. The method for preparing BCP, an alkaline protease, according to claim 2, comprising the steps of:

providing an alkaline protease gene bcp, an expression vector and an expression strain;

amplifying alkaline protease gene bcp, and connecting an amplification product with an expression vector to obtain a recombinant expression vector;

integrating the recombinant expression vector gene into an expression strain to obtain recombinant expression engineering bacteria;

culturing the recombinant expression engineering bacteria to obtain alkaline protease BCP;

wherein, the nucleotide sequence of the alkaline protease gene bcp is shown as SEQ ID NO. 1.

7. The method for producing BCP, an alkaline protease, according to claim 6,

the expression vector comprises a vector pHY, a hybrid promoter and a signal peptide; and/or

The expression strain is bacillus subtilis RIK 1285.

8. The method for producing BCP, an alkaline protease, according to claim 6,

the recombinant expression vector gene is integrated to the mesophilic amylase gene site of bacillus subtilis RIK 1285.

9. The method for producing BCP, an alkaline protease, according to claim 6,

in the process of amplifying the alkaline protease gene bcp, primers for amplification comprise a forward primer and a reverse primer, wherein the nucleotide sequence of the forward primer is shown as SEQ ID NO. 20, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO. 21.

10. The use of the alkaline protease BCP according to claim 2 for the hydrolysis of proteins,

the reaction temperature of the alkaline protease BCP is 20-70 ℃;

the reaction pH value of the alkaline protease BCP is 7-11.

Images